ES2374054B1 - NEW SERINA PROTEASA INHIBITOR AND ITS USE. - Google Patents

Abstract

New serine protease inhibitor and its use. The invention relates to a new protein, identified by scanning an Anisakis simplex cDNA library, as well as its coding sequence and its expression vectors. Said protein, a member of the serpine family, is capable of dose-dependent inhibition of human thrombin, without affecting coagulation factor Xa, and without heparin altering its inhibitory activity. Thus, the invention also relates to the use of this protein for the preparation of a medicament, especially if it is an anticoagulant. Its administration would have special interest in cases of hypercoagulopathies associated with the administration of heparin. It also represents an alternative to coumarin-derived anticoagulants, which could be substituted in any of the situations in which they are administered.

Description

New serine protease inhibitor and its use.

Technical field

The invention falls within the field of Biotechnology and in the application of biological molecules in the clinical field. More specifically, the invention relates to a new serine protease inhibitor isolated from the Anisakis simplex nematode and its use as an anticoagulant.

Background of the invention

The blood coagulation cascade is a complex process that is triggered in response to a lesion in a blood vessel and that comprises a complex sequence of chain reactions, in which several cell types and soluble blood proteins participate, and culminating with the formation of a clot that prevents blood loss through the initial injury. A clot is called a network of insoluble proteins composed of fibrin, in which other proteins, water, salts, platelets and other blood cells are trapped, which prevents blood from flowing out until the injured tissue is repaired.

The process of preventing blood loss begins with the constriction of the blood vessel, to decrease blood flow to the area of the lesion. Then, when the platelets come into contact with the exposed collagen fibers due to the rupture of the epithelial lining of the vessels, their aggregation occurs, joining the collagen to form a platelet plug, as well as its activation, which results in different factors are released such as thromboxane A2, inducer of platelet aggregation, as well as phospholipids, lipoproteins and other important proteins of the coagulation cascade.

The coagulation cascade itself, which leads to the formation of the fi ber mesh that covers the plug, is a sequence of proteolytic reactions that are initiated by activating substances secreted by the vessel, by platelets and by blood proteins adhered to the wall of the glass. As outlined in Fig. 1, the coagulation cascade is formed by two pathways, whose designation refers to the place where the coagulation cascade begins in each of them: the extrinsic pathway (which starts outside the vessel blood, when active factor VII (VIIa) binds to tissue factor (TF) or thromboplastin of the membranes of cells that are outside the vessels and originate the VIIa / TF complex) and the intrinsic pathway (which is activated in the inside the blood vessel, by the contact of the wall of the same with the particles of lipoproteins and chylomicrons). Both pathways influence the formation of active factor X (Xa), which leads to the conversion of prothrombin to thrombin, an enzyme responsible for the transformation of the phytogen into the fi fi ber that finally generates the clot.

Therefore, thrombin is often considered the key coagulation enzyme, as it is the protease that gives rise to fibrin formation when acting on the phytogen. It is a serine protease, that is, a hydrolase that degrades peptide bonds and that has in its active center a serine residue essential for enzymatic catalysis. It is generated by the action of factor Xa on prothrombin, a glycoprotein that is synthesized in the liver and that requires vitamin K as a cofactor for its synthesis.

Other coagulation factors also need vitamin K for their synthesis in the liver, so the deficit in this vitamin can seriously affect blood clotting, leading to bleeding.

In addition to the coagulation factors, there are other very important proteins for the control of the process: those of the anticoagulant system, which prevents the formation of thrombi or emboli and occlusion of the undamaged areas, con fi ning the formation of the clot to the injured area. Protein C, protein S, thrombomodulin (TM) and antithrombin (AT) are important elements of this system.

Antithrombin III in particular is considered the main physiological inhibitor of coagulation. It is a glycoprotein that is synthesized in the liver without relying on vitamin K and acts irreversibly inhibiting several active procoagulant factors, including thrombin, but also factor Xa, calicrein and factors XIa and XIIa. The activity of antithrombin III is one of the main physiological mechanisms for controlling the amount of thrombin, although other inhibitors, such as cofactor II of human heparin (HCII), are also relevant in that regard. The action of antithrombin, which is produced by the formation of complexes with the coagulation factors that it inhibits, is markedly increased in the presence of heparin, a heteropolysaccharide present in the endothelium of blood vessels and in granules of primed cells , which facilitates the binding of antithrombin III with the corresponding active procoagulant factors.

There are several clinical situations in which it is convenient to delay or prevent blood clotting. To this end, different anticoagulant drugs have been used traditionally, which are compounds that make it difficult

or prevent platelet aggregation or some other passage of the coagulation cascade. Among them, heparin itself stands out, a physiological compound present in large quantities in mammals, which lengthens the clotting time, and whose administration is usually used when rapid and short-term anticoagulant action is required, such as in the prevention of venous thrombosis surgery, where it is used at low doses.

The administration of heparin, however, is not always recommended, as it may lead to hypercoagulable states. Thus, for example, among patients who are administered heparin in the preoperative period, such as those who will undergo cardiopulmonary bypass, it has been observed that a percentage of them have a significant deficit of antithrombin III and they need replacement before performing the intervention, either in the form of fresh frozen plasma, or as an antithrombin III concentrate: the previous administration of heparin, to enhance the anticoagulant action of antithrombin III, causes the consumption of antithrombin and a progressive decrease of it. Reduction of antithrombin III is also observed in patients suffering from liver disease, in consumption coagulopathies with DIC (disseminated intravascular coagulation) and in case of massive hemorrhages, leading to an increased risk of perioperative thrombotic events. Therefore, in these cases, the antithrombin III is replaced, using fresh frozen plasma or antithrombin concentrates. Although, in general, it is considered that the previous treatment to which the antithrombin III concentrates available in Europe and the United States are subjected makes the risk of transmission of infectious agents practically null, there is always a residual risk and they are also extremely expensive products , so they lead to a significant increase in treatment costs.

Another state of hypercoagulability, much feared in critically ill patients, is thrombosis related to thrombopenia associated with heparin. Heparin causes a mild degree of thrombocytopenia, a disorder that has been shown to be mediated by an antibody that stimulates platelet aggregation and activation in the presence of heparin. Patients suffering from this disorder usually suffer venous episodes, as well as serious thrombotic arterial accidents. If the syndrome is not immediately identified, it can lead to loss of limbs, visceral and cardiac infarctions and even high-grade mortality. Its treatment includes the immediate cessation of the administration of heparin, replacing it sometimes with low molecular weight heparin (which predominantly has an anti-factor Xa activity, although it is also dependent on antithrombin III) or combining it with hirudin to decrease the administered dose; The antiaggregant treatment with acetylsalicylic acid can also be used as an alternative.

All these problems have led to the search for alternatives to replace heparin.

Other commonly used anticoagulants are dicumarinic anticoagulants, which are inhibitors of vitamin K, which results in inactive forms of factors in whose synthesis the vitamin is involved in the blood. Thus, the action of these anticoagulants, as with heparin, is not limited to a specific passage of the coagulation cascade, but affects several points of the same, making it difficult to control and increasing the risk of bleeding. . In addition, continued treatment with anti-marine medications, as occurs, for example, in patients with cardiac valves or mechanical or joint prostheses, as well as in those with atrial fibrillation or pulmonary embolism, increases the risk of calcification of the arteries and valves. cardiac

The importance of coagulation control in different clinical situations has led to the search for other new anticoagulants, having preference for those that act exclusively at a specific step in the coagulation cascade. Thus, a series of synthetic compounds that specifically inhibit thrombin (dabigatran) and factor Xa (rivaroxaban) have been described recently, the use of which is approved for the prevention of venous thromboembolism after total knee and hip prostheses (Ufer, 2010) . In addition, dabigatran is being evaluated in phase III clinical trials as an oral anticoagulant for different pathologies such as acute coronary syndrome, chronic patients, and conditions related to cardiac surgeries (Ahrens et al., 2010).

On the other hand, they have also tried to characterize molecules of living beings with anticoagulant properties. Some of the proteins with anticoagulant activity belong to the group of serpins. This is called a protein superfamily, to which the antithrombin and antitrypsin belong, which share a similar structure, and which owe their name to the fact that most of them inhibit serine proteases, although serpins that inhibit caspases have also been identified and cistern proteases similar to papain, which are called cross-class serpins (Sakata et al., 2004; Law et al., 2006). They form a diverse group, to which several human proteins belong, as well as plant molecules, bacteria, multicellular parasites such as nematode helminths, and certain viruses. Serpins have evolved to modulate the hydrolysis of peptide bonds through an irreversible inhibition mechanism similar to that of suicidal substrates (Silverman & Lomas, 2004), compounds that bind to the active center of an enzyme and chemically transform into a reactive species which irreversibly modifies the amino acid of the active site. Serpins, on the other hand, undergo important changes in their structure in the process of enzymatic inhibition.

The serpins in which anticoagulant activity has been identified have been isolated from various organisms. Thus, for example, the PTI protein of human origin described by Coughlin et al. (Coughlin et al., 1993), which is supposedly an intracellular molecule that lacks a signal peptide, but that has the ability to inhibit thrombin independently of the presence of heparin, and that also inhibits both trypsin and coagulation factor Xa (Morgenstern et al., 1994). Myxoma virus serpine has also been isolated (Nash et al., 1998) which, in addition to inhibiting thrombin and cathepsin G, also inhibits factor Xa. Another serpine capable of inhibiting thrombin has been detected in the Tachipleus tridentatus crab (Miura et al., 1994).

Many other serpins do not show anticoagulant activity. Thus, in organisms evolutionarily quite distant from any of the aforementioned, such as nematodes, serpins that act on coagulation serine proteases have not been described, not even in parasitic nematodes, although recently published that, in general, serine protease inhibitors of parasites of the serpine family are among the best examples of genes that interact with the physiological processes of the host (Zang & Maizels, 2001). It is known that parasite protease inhibitors not only interact with endogenous proteases of the same parasite, regulating their own activity as proteases, but are supposed to play other important roles in the defense against digestion by host proteases, in the inhibition of host proteases involved in the immune response, or even acting as immunomodulators. Thus, in the nematodes, some hypothetical roles have been assigned to the serpins, for example, the protection of the hostile proteolytic environment. But only in the case of the Brugia malayi SPN-2 serpine are there experimental evidences that support that the serpins have in the parasitic nematodes a function of evasion of the host immune response, since the SPN-2 serpine is able to inhibit two serine Neutrophil-derived proteases (Zang et al., 1999), elastase and cathepsin G, although it has not been described that said serpine is capable of acting on coagulation serine proteases.

In non-parasitic, free-living nematodes, as in the case of Caenorhabditis elegans, up to nine serpins have been described (Pak et al., 2004), for none of which has been mentioned to have antithrombin activity. In addition, at the time of their isolation, their characteristics were considered sufficiently distinctive from other groups of serpins to create for them a new clade, different from those established until then. Even requiring a specific classification for them, Pak et al. (2004) comment that the Caenorhabditis elegans serpins fundamentally resemble the clade B of serpins, which are intracellular proteins. One of these nine serpins, SRP-2, is considered by the authors of the article a classic cross-class inhibitory serpine; This is because it mainly inhibits granzyme B (serine protease) and, to a lesser extent, cathepsin V (cistern protease). In addition to not being suggested in the article, it is unlikely that SRP-2 has antithrombin activity, because the amino acids present in its active center, P1-P1 ', are the Glu-Met couple, while thrombin is a specific Arg enzyme, although Not all of its inhibitors have said amino acid at its reactive site, with HCII being one of those exceptions.

In parasitic nematodes, protease inhibitors that inhibit coagulation have been described, but belong to other serine protease inhibitor families, such as that of esmapins. This is the case, for example, of serine protease inhibitors characterized by Ancylostoma caninum and Ancylostoma ceylanicum, intestinal nematodes that cause severe anemias. None of the inhibitors identified from these nematodes directly inhibit thrombin, but act on other coagulation serine proteases: NAP5, on factors Xa and Xia; NAP6, on factor Xa; AceAP1 on factor Xa; and NAP2, on the factor VIIa / TF complex (Capello et al., 1995; Stassens et al., 1996).

Another of the parasitic nematodes in which some protein with anticoagulant capacity has been identi fi ed is Anisakis simplex. Anisakis simplex is a parasitic nematode that infects aquatic mammals, producing gastric ulcers, with worms attached to the gastric mucosa or free in the stomach, as well as hemorrhagic exudates and perforation of the abdominal cavity (Geraci & St. Aubin, 1987). The human being is an accidental host that acquires the infection by ingesting larvae of Anisakis simplex present in raw or undercooked seafood. Anisakis simplex infection of humans is a well-known cause of gastrointestinal disease, with moderate to severe clinical symptoms such as nausea, vomiting, diarrhea, abdominal and epigastric pain (Ishikura et al., 1993), often finding hidden blood in gastric juice or feces (Bier, 1988). In many cases gastrointestinal symptoms are associated with immunological disorders, usually allergic reactions (Audicana & Kennedy, 2008). However, despite the many studies that are being carried out on this parasite, due to the high degree of infection that is being detected in humans, there is an empty space in the knowledge of genes that interact with the physiological processes of the host. In Anisakis simplex, only serine protease inhibitors belonging to the Kunitz family and the smapine family have been described (Morris & Sakanary, 1994; Nguyem et al., 1999; Kobayashi et al., 2007; Kobayashi et al., 2008) . The smapines described in Anisakis simplex (ASPI-1 and ASPI-2) inhibit elastase and in the case of ASPI-3, its target is unknown. Although esmapins characterized in other nematodes, such as Ancylostoma caninum and Ancylostoma ceylanicum have anticoagulant activity, their point of intervention in the coagulation cascade is the inhibition of factors Xa and VIIa. So far, in the Anisakis simplex nematode, anticoagulants of the serpina family have not been identified.

As can be seen, anticoagulant factors capable of directly interacting with commercially available thrombin do not abound. In addition, in many cases, its activity depends or is enhanced by the presence of heparin. Given the importance that prevention of blood clotting has in many clinical situations, it is important to have alternative anticoagulants to those currently existing. Such anticoagulants should preferably act on thrombin so that, if there is any deficiency or alteration in both the extrinsic and intrinsic coagulation pathways, the activity of the anticoagulant would not be affected, because it would act specifically on the key and final molecule of the coagulation cascade: on the enzyme that reacts with the phytogen and converts it into a fibrin that forms the clot. More preferably, the anticoagulant should be selective, with direct action on the thrombin without needing heparin, so its use would avoid the harmful effects derived from the indiscriminate use of the latter compound and, in addition, would be of potential utility in those situations in which Heparins cannot be used, as well as in immunocompromised patients or undergoing continuous treatments with fresh plasma or antithrombin III concentrates, thereby reducing the risk of acquiring some infectious disease of parenteral transmission and its high economic cost.

The present invention provides a solution to those problems.

Compendium of the invention

The invention is based on the biochemical and bioinformatic characterization of a recombinant serpin of Anisakis simplex, to which hereafter referred to in the present application as AniSerp. In particular, the invention is based on the discovery that said serpine is capable of inhibiting human thrombin, in a dose-dependent manner, without affecting coagulation factor Xa and without heparin having any effect on this inhibitory activity. In addition, AniSerp is also able to inhibit, although with less activity and reversibly, cathepsins G and L.

The ability of this new serpin to inhibit thrombin and not coagulation factor Xa (the other serine protease that is inhibited by antithrombin III) makes it suitable for use as an anticoagulant in patients in whom it is suspected that there may be de fi science or alteration both in the extrinsic pathway and in the intrinsic coagulation pathway, since the use of this new serpine would not interfere, since it acts specifically on the key and final molecule of the coagulation cascade. This makes the use of AniSerp as an anticoagulant present the advantage, compared to the use of other anticoagulants, that it can be administered to immunocompromised patients, or subjected to continuous treatments with fresh plasma or antithrombin III concentrates, which in addition to being expensive, puts at risk of acquiring some infectious disease of parenteral transmission, risk that is eliminated with the use of an isolated or synthetic protein. Thus, the expression of AniSerp in expression systems through hosts transformed with recombinant vectors that contain an AniSerp coding sequence under the control of appropriate regulatory sequences, which allow its expression in said host, would facilitate the production and isolation of the recombinant protein , which would be useful for the preparation of safer medical administration forms, reducing the risk of transmission of infectious diseases parenterally, in addition to lowering the costs of alternative treatments.

On the other hand, the fact that the anticoagulant activity of AniSerp is not enhanced by heparin allows the therapeutic application of AniSerp in situations where there is a risk of developing hypercoagulable states that are associated with heparin, such as acquired deficit of antithrombin, which occurs many times in the context of heparin therapy, or even for the treatment of such hypercoagulable states. One of the situations in which its administration could be adequate would be the preoperative periods prior to certain surgical interventions, such as those of cardiopulmonary bypass, which would allow to reduce the amounts of heparin used, avoiding the massive consumption of antithrombin produced by heparin and the hypercoagulability generated as a result of the decrease in said protein. It could also be administered after surgery, instead of extremely expensive antithrombin III concentrates, which are often used to replenish antithrombin III when a deficit occurs. It would also be indicated in other clinical situations in which antithrombin III is reduced, such as liver disease, in coagulopathies of consumption with DIC (disseminated intravascular coagulation) and massive hemorrhages, as well as in thrombosis related to heparin-associated thrombopenia. .

AniSerp, in addition, is an alternative as an anticoagulant to coumarin derivatives, with respect to which it has the advantages of acting on thrombin without interfering with factor Xa, allowing a more precise control of the doses according to the requirements of the patient and their specific conditions, thereby reducing the risk of bleeding. In addition, the fact that AniSerp does not interact with vitamin K also reduces the risk of arterial and valve calcification associated with the continued consumption of coumarin-derived anticoagulants. In this way, AniSerp represents a suitable alternative to be supplied as an anticoagulant, for example, to patients with heart valves or mechanical or joint prostheses, as well as those suffering from atrial fibrillation, acute coronary syndrome, pulmonary embolism or chronic heart disease.

Its safety as an anticoagulant is further reinforced by the fact that AniSerp is not recognized by IgE antibodies of patients suffering from anisakidosis, which indicates that this new serpine does not have allergenic / immunogenic properties, a very important characteristic for any compound that It is desired to use as anticoagulant.

It is also worth noting that the AniSerp protein sequence has a relatively low degree of identity (less than 40%) with other serpins, understanding as such the degree of invariability between amino acid sequences. Thus, for example, in terms of serpins mentioned in the present application, the percentages of identity obtained with the protein sequences accessible through the European Bioinformatic Institute (UniProt databases, aaGeneSeq, Euro Patents, Japan Patents, US Patents and Korea Patents), using the FASTA algorithm and the fasta 3 program, are: 33.1% with the Tachipleus tridentatus serpina (GenBank D14483); 37.4% with the human PTI protein (SPB6_HUMAN, access no .: P35237 in UniProtKB); 35.1% with the serpentine SRP-2 of Caenorhabditis elegans (GenBank AY525079); 30.3% with Brugia malayi serpina (GenBank U04206).

Therefore, the invention refers, in a first aspect, to the polypeptide of the invention, that is, a polypeptide comprising the amino acid sequence of AniSerp (either in its mature form (SEQ ID NO: 3) without signal peptide ,

or in the immature form (SEQ ID NO: 2) with signal peptide, or a polypeptide that exhibits its same activity and that has a high percentage of identity (higher than other serpins with known anticoagulant activity) with AniSerp. Thus, the invention refers to a polypeptide whose amino acid sequence comprises:

a) the sequence represented by SEQ ID NO: 3, or

b) a sequence at least 40% identical to SEQ ID NO: 3 that has serpine structure and the ability to inhibit human thrombin.

It is preferred that the amino acid sequence comprises the sequence represented by SEQ ID NO: 3. Possible embodiments of the invention are also those in which the polypeptide comprises an amino acid sequence having a serpine structure capable of inhibiting human thrombin, in which said sequence is identical to SEQ ID NO: 3 in a percentage that is selected from the group of 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%, and 99.9%.

As mentioned, not only the mature form, lacking the signal peptide, but the immature form of AniSerp, which comprises the mature form and the signal peptide, is also within the scope of the invention. Therefore, possible embodiments of the polypeptide of the invention are those in which its sequence comprises:

a) the sequence represented by SEQ ID NO: 2, or

b) a sequence at least 40% identical to SEQ ID NO: 2 that has a serpine structure capable of inhibiting human thrombin.

It is preferred that the amino acid sequence comprises the sequence represented by SEQ ID NO: 2. Possible embodiments of the invention are also those in which the polypeptide comprises an amino acid sequence having a serpine structure capable of inhibiting human thrombin, wherein said sequence is identical to SEQ ID NO: 2 in a percentage that is selected from the group of 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%, and 99.9%.

In another possible embodiment of this aspect of the invention, the polypeptide is a fusion protein that additionally comprises the sequence of AniSerp or a serpine capable of inhibiting human thrombin with a high degree of identity with it, the sequence of a second protein, so that the polypeptide is a fusion protein. This second protein can be, for example, glutathione-S-transferase, as in the Examples of the present application, or any other protein of interest.

AniSerp, as mentioned, has the peculiarity that its ability to inhibit thrombin activity is not altered by the presence of heparin. Therefore, it is an embodiment compatible with any of the foregoing, in which the polypeptide of the invention has an ability to inhibit thrombin that is not affected by the presence of heparin.

Likewise, it is an embodiment compatible with any of the foregoing, in which the polypeptide also has the capacity to inhibit cathepsins G and L, as described for AniSerp in the Examples presented later in the present application.

In a second aspect, the invention relates to a DNA molecule comprising a sequence encoding the polypeptide of the invention, that is, to an isolated nucleic acid molecule comprising a sequence encoding a serpine capable of inhibiting thrombin. human, selected from the group consisting of:

a) a nucleic acid sequence encoding a polypeptide sequence at least 40% identical to the sequence represented by SEQ ID NO: 3

b) a nucleic acid sequence encoding a polypeptide sequence at least 40% identical to the sequence represented by SEQ ID NO: 2;

c) a nucleic acid molecule complementary to one of the above.

Preferred embodiments of said aspect of the invention are those in which the sequence comprised in the nucleic acid molecule encodes a polypeptide sequence identical to that represented by SEQ ID NO: 3 or to that represented by SEQ ID NO: 2. In the latter case, the nucleic acid molecule may have the sequence of the isolated molecule described in the Examples of the present application, that is, the sequence represented by SEQ ID NO: 1. Also possible are embodiments of this aspect of the invention in which the nucleic acid molecule comprises a sequence fragment encoding a polypeptide sequence that is identical to that represented by SEQ ID NO: 2 at least in a percentage selected from the group of 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.5%, 99.9%, particularly preferring that changes in amino acids are conservative changes.

As used in the present application, changes (conservative substitutions) of amino acids are understood as changes in a specific position of the polypeptide sequence that preserve the physicochemical properties of the original residue. There are several algorithms to assess this issue but the most general and strict way of considering that a change is conservative is to consider that it occurs when amino acids are exchanged with side chains of similar sizes and similar charge or polarity in physiological conditions. Thus, the changes between: would be conservative changes:

-

glutamic acid (Glu) and aspartic acid (Asp) (acidic amino acids, negatively charged at physiological pH);

-

glutamine (Gln) and asparagine (Asn) (basic amino acids, positively charged at physiological pH);

-

valine (Val), leucine (Leu) and isoleucine (Ile): short chain hydrophobic amino acids; Depending on its specific structural function in the folding of the protein and the maintenance of its structure, it can also be included in this cistern group (Cys) (if its change does not lead, for example, to the loss of a disulfide bridge), glycine (Gly) (if its small size is not essential to allow a sharp change in the progression of the secondary structure, for example, but its polarity is more important)

or methionine (Met).

-

serine (Ser) and threonine (Thr), polar amino acids at physiological pH that have a -OH group in their side chain.

Another object of the invention is an expression vector comprising a DNA sequence of the invention, operatively linked to an expression control sequence. The expression vector may be, for example, a plasmid, as in Example 2 of the present application, or a more complex system, such as, for example, a recombinant virus.

A further object of the invention is a host cell transformed with an expression vector of the invention. The host cell can be, among others, a bacterium, a yeast, or a cell derived from a higher eukaryotic organism, such as a human cell or derived from human cells. In each case, logically, the expression vector with which the host cell has been transformed will comprise as an expression control sequence operatively linked to the sequence encoding the identical or similar serpin of the immature or mature form of AniSerp (SEQ ID NO: 2 or SEQ ID NO: 3), a control sequence that can give rise to encoded protein in said host cell. Thus, for example, if expression in a bacterium is desired, the coding sequence of the serpine will be operatively linked to a promoter that allows expression in that bacterium; if expression in a eukaryotic cell is desired, the coding sequence of the serpin will be operatively linked to at least one promoter that allows expression in that cell. As used in the present application, "transformation" means any process in which an exogenous nucleic acid is introduced into a cell.

A further object is a method of producing a protein that comprises the steps of:

a) culturing the transformed host cell with an expression vector of the invention under conditions that allow expression of the polypeptide with serpine activity capable of inhibiting human thrombin encoded in said expression vector;

b) purify the polypeptide synthesized in step a) of the cell or cell medium.

A further aspect of the invention relates to an antibody that specifically binds to a polypeptide comprising the sequence of SEQ ID NO: 2 or the sequence of a serpine capable of inhibiting human thrombin whose amino acid sequence differs from the sequence of SEQ ID NO: 2 only for conservative amino acid substitutions. Conservative substitutions should be understood as changes in a specific position of an amino acid that preserve the physical-chemical properties of the original residue. Typical conservative substitutions are the substitution of one acidic residue for another (changes between glutamic and aspartic acids), changes of one basic residue for another (changes between glutamine and asparagine), changes of one apolar residue for another (alanine, valine, leucine , isoleucine ...).

In a further aspect, the invention relates to the use of the polypeptide of the invention as an anticoagulant agent. Thus, another aspect of the invention is the use of the polypeptide of the invention (a polypeptide comprising the sequence of a serpine capable of inhibiting human thrombin with at least 40% identity with SEQ ID NO: 2 and / or SEQ ID : 3) for the preparation of a medicine. Preferably, the medicament will be intended to be used as an anticoagulant. It is especially preferred that the medicament is intended for patients in whom it is suspected that there may be some alteration in coagulation cascade proteins other than thrombin, to immunosuppressed patients, to patients with hepatic disorders, to patients with coagulation consumption coagulopathies. disseminated intravascular, to patients with hypercoagulable states associated with the use of heparin or to patients with a deficit of antithrombin III. Particular preference is also given for the administration of the drug as an anticoagulant during perioperatotial periods in general such as cardiopulmonary surgery (with or without the simultaneous administration of heparin), trauma surgery especially in treatments of complete hip and knee replacement. In another possible embodiment of the use of the invention, the polypeptide of the invention can be used as an alternative to conventional anticoagulants such as coumarin anticoagulants, being intended for patients with pathologies such as acute coronary syndrome, atrial fibrillation, pulmonary embolism, chronic coronary disease, or to patients with heart or vascular valves or with mechanical or joint prostheses.

Brief description of the fi gures

Fig. 1: Coagulation cascade. The scheme shows the sequence of reactions between coagulation factors that make up the extrinsic (left part) and intrinsic (right part) coagulation pathways and that influence the generation of factor Xa and subsequent common stages (protein names in bold ). Complementary factors are indicated next to the reactions (Ca2 +: calcium, PL: phospholipids ...). Also indicated are the action points of proteins involved in the anticoagulant system (dashed dashed lines, ending in ellipses), as well as thrombin boosted reactions (broken lines ending in a arrow).

Fig. 2: Activity as an AniSerp inhibitor: The graph shows the effect of the AniSerp recombinant inhibitor (AniSerp-GST: AniSerp fusion protein with glutathione-S-transferase) on the proteolytic activity of the enzymes indicated under bar pairs (protease endogenous Anisakis simplex; human plasmin; human thrombin; cathepsin B; Factor Xa; trypsin; cathepsin G), represented as% of residual activity calculated with respect to the activity detected in the presence of the GST protein alone.

Fig. 3: Effect of the recombinant inhibitor AniSerp-GST on the proteolytic activity of human thrombin. The graph shows the percentage of residual fluorescence due to AMC released from the Boc-Val-Pro-Arg-AMC substrate by thrombin, as a function of the concentration of the AniSerp-GST fusion protein present. The data shown are the mean ± standard deviation (S.D.) of three independent experiments carried out in triplicate. The bars indicate the S.D.

Fig. 4: Structural models based on the homology of latent (panel B) and active (panel C) forms of AniSerp (not thrombin-bound). Panel A shows the alignment of multiple sequences between AniSerp (sequence headed by the word "serpin") and templates 1DVN_A (latent form of human plasminogen activator inhibitor 1) and 2DUT_D (native conformation of the MENT protein: Myeloid and Erythroid Nuclear Termination stagespeci fi c: specific erythroid and myeloid nuclear termination protein). Panels B and C show the structural models of the latent (panel B) and active (panel C) forms of AniSerp deduced from the 1DVN_A and 2DUT_D molds respectively, 3D models in which the center loop position is indicated reagent (RCL).

Fig. 5: Model of the interaction between Anisakis simplex (AniSerp) serpine and human thrombin:

-

Panel A shows a three-dimensional model in which human thrombin (upper part of the drawing) appears attached to the Anisakis simplex serpina (lower part of the panel drawing); the location of the RCL (catalytic loop residues) of the Anisakis simplex serpine in the structural groove of the thrombin is indicated. Darker colored areas on the surface of the thrombin indicate areas of positive or negative theoretical electrostatic charge.

-

Panel B: Representation, as a model of balls and rods, of the residues of the heavy chain of human thrombin (bold legends) that come into contact with the amino acids Pro365 to Ile372 of AniSerp.

-

Panel C: Detail of the interaction between AniSerp and His43 (H43), Asp99 (D99) and Ser205 (S205) residues of the catalytic triad of human thrombin.

Fig. 6: Sequence alignments of the Anisakis simplex Serpina (sequence headed with the legend "serpin"), human Antithrombin-III (sequence headed with the legend "1ATH_A") and cofactor II of the human heparin (sequence headed with the legend "1JMO"). The dark spheres represented under the sequence 1JMO indicate the key residues involved in heparin binding described for cofactor II of heparin.

Description of the invention

As mentioned above, the invention relates to a new Anisakis simplex nematode protein, which has anticoagulant activity. Specifically, its activity is based on its ability to inhibit human thrombin, in a dose-dependent manner, and independent of the presence of heparin. In addition, the new protein also has the ability to inhibit, although to a lesser extent, the activity of another serine protease, cathepsin G, as well as that of a protease cistern, cathepsin L. This protein is referred to in the present application with the short for AniSerp.

AniSerp is the result of an antibody scan of an Anisakis simplex nematode cDNA library and of the cloning of a new serine protease inhibitor from all ESTs (Expressed sequence tags). Said cDNA allows obtaining a protein of 397 amino acids (SEQ ID NO: 2), of which the first 25 constitute a signal peptide that seems to confer an secretory nature to AniSerp, unlike what happens with other serpins, such as PTI or the serpins identified in Caenoharbditis elegans, which appear to be intracellular.

AniSerp is structurally a serpine, as it presents the classic three-dimensional assembly of this family of inhibitors, which is necessary to exert its mechanism of action. AniSerp has a conformation composed of nine α-helices and three β-sheets, with a hypothetical reactive center (RCL: reactive center loop) of 27 amino acid residues (347-GSEAAAATGLFMVFRSSRPMPVTPPIR-373), which is exposed in its active form. This makes it the first serine inhibitor of parasitic nematodes that has anticoagulant capacity, so it was not obvious to expect a nematode, Anisakis simplex, to produce a protein with anticoagulant activity that had a serine protease inhibitor activity and that belonged to the family of the serpinas. As previously mentioned, they had previously been characterized in other serine protease inhibitor nematodes belonging to other families, such as esmapins, which exhibit anticoagulant activity. Thus, for example, the NAP5, NAP6 and NAP2 esmapins of Ancylostoma ceylanicum, which are responsible for the anticoagulant properties of this hematophagous intestinal parasite, which causes severe anemias. Each of these esmapins affects a different type of serine protease from blood clotting, but none directly inhibits thrombin (Capello et al., 1995, Stassens et al., 1996), as does AniSerp. In addition, both the amino acid sequence and the structure of these inhibitors is different from that of AniSerp.

As regards the serpins identified in free-living nematodes such as Caenorhabditis elegans, they show quite a few differences with AniSerp. On the one hand, as mentioned, it seems to be intracellular proteins, which lack signal peptide, while the mature form of AniSerp seems to be extracellular. In addition, the Caenorhabditis elegans serpins constitute by themselves a specific clade within the family, the clade L, although they fundamentally resemble clade B of intracellular serpins, while AniSerp presents greater similarity with the clap C1 serpins, where it is found classi fi ed human antithrombin III. Although one of the Caenorhabditis elegans serpins, SRP-2, also appears to be a cross-class serpine, it inhibits proteins of a different nature from those affected by AniSerp: granzyme B as a serine protease and, to a lesser extent, the Cathepsin V as a protease cistern. In addition, considering the structure of its catalytic site, it is unlikely that SRP-2 has antithrombin activity, one of the main characteristics of AniSerp.

As for other serpins that were already known to have anticoagulant activity and that, specifically, are capable of inhibiting thrombin, they have been identified from evolutionarily quite distant organisms from nematodes, such as humans themselves, the Tachipleus tridentatus crab or myxoma virus. The sequence identity of any of these serpins with AniSerp does not reach, in any case, 40%. In addition, its properties are, in general, different from those of AniSerp, either by inhibiting thrombin, for example, at the same time as some other coagulation factor (Xa in the case of PTI serpins or myxoma virus) or for inhibiting other serine proteases such as plasmin and trypsin (case of Tachipleus tridentatus serpine). All this is an indication that it was not obvious to think that there could be a serpine capable of inhibiting thrombin independently of the presence of heparin, which could be identified in Anisakis simplex, since neither its structure nor its properties seemed to be expected from the previous knowledge

The ability to inhibit human thrombin by AniSerp, as mentioned, is dose dependent. According to the tests described below in the Examples of the present application, it has an inhibitory concentration 50 (IC50) of 36.68 μg / ml, and an inhibition mechanism that is maintained for at least 24 hours. The evidence suggests that inhibition is irreversible. In addition, this activity could probably partly explain the in vitro anticoagulant action on human plasma that has been described for the crude extracts and excretory secretors of Anisakis simplex (Perteguer et al., 1996).

On the other hand, the molecular dynamics studies described hereinafter showed that AniSerp appears to inhibit thrombin by a mechanism similar to that of the suicidal substrate, similar to the mechanism shown by coagulation inhibitors in mammals such as antithrombin III (AT) (the natural thrombin inhibitor) and cofactor II of heparin (HCII). Thus, AniSerp has a tertiary structure similar to that exhibited by these human serine protease inhibitors, which can be considered the main regulators of blood coagulation.

The specificity of both coagulation control factors, however, is not the same: human AT binds to both factor Xa and thrombin and is able to inhibit both, while HCII selectively inhibits thrombin, not affecting the activity of factor Xa. It has been described that the different specificities of AT, which is capable of inhibiting thrombin and Xa, compared to HCII, which only inhibits thrombin, appear to be due to changes in amino acids in P1 and immediately adjacent residues located within the RCL recognition sequence of the enzyme. AT with an Arg in P1 is an inhibitor of the specific proteases of Arg, thrombin and Xa, while HCII provides a specific thrombin inhibitor despite having an unfavorable P1, with Leu. (Gettins & Olson, 2009).

AniSerp, for its part, selectively inhibits thrombin, without affecting the activity of factor Xa, as is the case with HCII. These characteristics could be explained by the fact that although AniSerp has an Arg (R) in position P1, as does the AT, it also shows more than ten changes in adjacent RCL residues. In addition, 8 of these different residues between AT and AniSerp are maintained with respect to HCII, which, like AniSerp, selectively inhibits thrombin but not factor Xa.

Also, one of the interesting features of AniSerp is that the activity of the molecule is not affected by the presence of heparin. In this, it differs from both AT and HCII, in which heparin acts by enhancing the anticoagulant property of both inhibitors. This quality is explained by the absence of positively charged residues at potential heparin binding sites in AniSerp. The fact of having an anticoagulant molecule whose action is not enhanced by heparin allows the therapeutic application of AniSerp in processes such as hypercoagulable states associated with the use of heparin, as in the acquired AT deficit, which occurs many times in the context of heparin therapy. Thus, in patients who are administered heparin in the preoperative period (for example in cardiopulmonary bypass interventions), it is observed that a percentage of them have a significant deficit of AT and need replacement of the product prior to performing the intervention, either in the form of fresh frozen plasma, or as an AT concentrate. Therefore, AniSerp could be applied, in general, to cases in which the AT is reduced, both in the aforementioned preoperative ones, as in liver disease, in coagulopathies of consumption with disseminated intravascular coagulation and massive hemorrhages. The use of AniSerp would not produce consumption and then de fi cit AT as heparin produces. It could also be used in cases of thrombosis related to heparin-associated thrombopenia, when a new treatment with anticoagulants is required. And in general, AniSerp could be applied in any case where anticoagulation is needed, avoiding the side effects that lead to the administration of heparin or those associated with the inhibition of vitamin K and / or the depletion of coagulation factors dependent on it. .

It should be noted that AniSerp is also capable of inhibiting, although with less activity and reversibly, cathepsins G and L. This function requires higher doses of AniSerp than is used to achieve anticoagulant activity. Cathepsin L is a protease cistern while cathepsin G is a serine protease. The fact that AniSerp is able to inhibit both serine and cistern protease makes it what is called cross-class serpins. Examples of these would be antigen 1 of squamous cell carcinoma.

Finally, it should be noted that the recognition of IgE antibodies of patients affected by anisakidosis against AniSerp has been verified, noting that there were no specific IgE against AniSerp in any of them. These results, performed on individuals likely to have developed these antibodies, because they are theoretically exposed to the protein, seem to indicate that the administration of AniSerp would not lead to adverse allergenic / immunogenic reactions. Preliminary studies conducted by immunizing rabbits with very potent adjuvants give rise to low antibody titers, which further supports AniSerp's poor immunogenic potential and its safety in its possible administration to humans.

Thus, AniSerp is the first serine protease inhibitor belonging to the family of serpins described for the Anisakis simplex nematode. In addition, it is the first report of a nematode serpin that specifically inhibits thrombin, whose activity is not modified by heparin. The fact that AniSerp inhibits thrombin independently of heparin makes it very useful as an anticoagulant. Also, its selectivity for thrombin makes it a member of the new class of antithrombotic agents in which there is great interest, selective inhibitors of specific coagulation factors. Compared to conventional drugs, they have the potential to be more effective, safe and easy to use (Bauer, 2008). The usefulness of AniSerp is supported by the good results obtained when evaluating the anticoagulant properties of another recombinant anticoagulant protein other than nematodes, NAPc2, which have been evaluated for the prevention of postoperative venous thromboembolism in patients undergoing selective knee arthroplasty (Lee et al., 2001). Moreover, clinical studies with therapeutic dose intervals, following repeated subcutaneous administrations, also show a low immune response to NAPc2, infrequent and not robust, which forces them to continue with these studies (Vlasuk et al., 2003). The fact that AniSerp seems not to be recognized either by the sera of patients suffering from anisakidosis is also a point of interest, as it is another proof of the safety that its use would offer. Thus, it seems that AniSerp could be a new alternative anticoagulant drug, with properties that make it interesting to use in specific applications, particularly, as mentioned, in cases where it has been produced or wants to avoid the occurrence of an acquired deficit. of antithrombin III.

The invention will now be explained in more detail by means of the Examples and Figures that appear below.

Examples

-

Example 1

Cloning of AniSerp

The AniSerp gene was cloned in two stages, i) In an initial stage the incomplete gene was obtained and, subsequently, ii) the entire gene was isolated.

i) The incomplete gene was obtained by screening an expression library of the Anisakis simplex nematode with monoclonal antibodies, in which AniSerp was an irrelevant (non-reactive) clone for the purposes of the immunograph performed.

Briefly:

-

From larvae 3 (L3) of the Anisakis simplex nematode manually extracted from bacaladillas (Micromesistius poutassou), messenger RNAs (mRNA) were synthesized using the commercial kit "Fast Track mRNA isolation kit" (Invitrogen).

-

Using as a template 5 μg of messenger RNAs, a collection of complementary DNA (cDNA) was synthesized using the commercial kit “ZAP-cDNA synthesis kit” (Stratagene), which were subsequently ligated into the λ-ZAP expression vector using the kit commercial for the construction of cDNA libraries in phage λ cleavable “Uni-ZAP XR library kit”, following the instructions of the Stratagene commercial house. The final titer of the expression library, once amplified, was 1.3 x 1010 pfu / ml (plaque forming units) with 1% non-recombinant phage.

-

Screening with antibodies from the expression library was performed. The phages were adsorbed onto nitrocellulose (Schleicher & Schuell) filters impregnated with 10 mM isopropyl thio-β-D-galactoside (IPTG). After performing a blocking phase with TBS (Tris buffer pH 7.4 with 3% bovine serum albumin (BSA)) one hour at 37 ° C, the membranes were incubated with the monoclonal antibodies at the appropriate dilution in the TBS buffer, throughout the night at 4 ° C. After the addition of the corresponding secondary antibodies, the immunocomplexes were visualized using as a substrate NBT (nitro-blue tetrazolium salt: nitro blue salt of tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl phosphate salt of p-toluidine) (Sigma ). From the λ-ZAP clones, phagemids were obtained by "in vivo" cleavage, using a "helper" rescue phage (Short et al., 1988).

-

The DNA sequence of one of the clones (irrelevant clone for the purposes of the immunograph performed, which expressed a recombinant protein not recognized by the monoclonal that was used in its isolation) showed similarity

(2. 2e-36) in the GenBank (http://www.ncbi.nlm.nih.gov/genbank/) with serpins (NA: Q608754 Serine Protease Inhibitor 3), although the gene was incomplete (clone 3A22 ). The gene fragment consisted of 1005 nucleotides with a deduced sequence of 334 amino acids (aa), missing the 5 ’end of the molecule.

ii) Obtaining the complete gene

The incomplete gene sequence information allowed the synthesis of primers to isolate the entire gene from a cDNA collection with adapters of known sequence at its 5 ’and 3’ ends.

Briefly

-

From the mRNA obtained from L3 of Anisakis simplex, a collection of cDNA was synthesized to whose ends a known sequence adapter (AP1) was ligated. The commercial kit “Marathon cDNA ampli fi cation” (Clontech), which includes the AP1 adapter, was used for the reaction.

-

Obtaining the complete gene, from the collection of previously synthesized cDNAs:

Rapid amplification of the 5 ’end of clone 3A22 (RACE-PCR): The following primers were used:

Direct primer AP1 (5 ’CTAATACGACTCACTATAGGGC 3’: SEQ ID NO: 4), primer corresponding to the AP1 adapter created at the 5 ′ end of synthesized cDNAs.

SR1 reverse primer (5 'ACCCGCAGTAGTTTTATCCATTTGTTCG 3': SEQ ID NO: 5), designed from the sequence obtained from clone 3A22 that only encompassed the 3 'end of the gene (nucleotides from position 160 to 186 in the nucleotide sequence of the gene complete, as checked later).

PCR ampli fi cation of the complete coding sequence: Two primers were designed for cloning the complete gene, a direct SER5 'primer (5' ATGATGACAGCATTACCGTTTTTAAC 3 ': SEQ ID NO: 6), with the ATG start codon and part of the new 5 'gene sequence and a SER3' reverse primer (5 'TCAGTGGAAACGACCAATAAACAGAATGCG 3': SEQ ID NO: 7) with the TGA termination codon and part of the 3 'sequence. As a result, a complete cDNA of 1194 nucleotides (397 aa) was obtained, represented by the sequence of SEQ ID NO: 1, corresponding to the Anisakis simplex serpine.

-

Example 2

Subcloning, expression and purification of AniSerp

Once the gene was cloned, the first stage to initiate the characterization of AniSerp was the subcloning of the cDNA into an expression vector and then inducing its expression, followed by the puri fi cation of the recombinant protein. Sequence analysis with the SignalP 3.0 Server program (Bendtsen et al., 2004) showed that the molecule contained a possible signal peptide (Metl-Gly25).

i) Subcloning

Two primers with the SmaI and NotI restriction sites were designed to facilitate subsequent subcloning of the AniSerp cDNA into the expression vector pGEX-4T2 (Amersham). In addition to making its expression possible, the sequence corresponding to the signal peptide was cleaved, using the direct primer 5’-SER-SPS (5 ’CCCGGGATG CAGCAGACAATCGATGAT 3’) (SEQ ID NO: 8). As a reverse primer, 3’-SER-SPS (5 ’GCGGCCGCT CAGTGGAAACGACCAATAA 3’) (SEQ ID NO: 9) was used, which included the TGA termination codon. Thus, a cDNA of 1119 nucleotides (372 aa plus stop codon), corresponding to the Anisakis simplex serpin (AniSerp), is obtained.

As a template for PCR, a 1/100 dilution of the complete Anisakis simplex serpine gene previously cloned was used.

After purifying the AniSerp amplification products, these and the commercial vector pGEX-4T2 (Amersham Biosciences) were digested with the restriction enzymes SmaI and NotI. The AniSerp gene (without the signal peptide) was linked to the previously dephosphorylated pGEX-4T2 vector with the enzyme T4 ligase (Promega) overnight at 16 ° C. With the recombinant plasmid produced, competent cells XLIBlue [recA1 endA1 gyrA96 thi1 hsdR17 supE44 relA1 lac (F 'proAB lacIqZΔM15 Tn10 (Tetr))] (Stratagene) of Escherichia coli were transformed following the protocol recommended by the commercial house. A selection of the positive recombinants was made by PCR using primers 5’-SER-SPS and 3’-SER-SPS and as a template the DNA of the grown colonies. From cultures, in LBampicillin, of the positive recombinants the plasmid DNA was extracted with the commercial kit QIAGEN. After confirming the correct subcloning by sequencing, with the recombinant plasmid produced, competent BL21 cells [F-, ompT, hsdS (rb-, mb-), gal] (Esmersichia coli Amersham Biosciences) were transformed by thermal shock following the protocol recommended by The commercial house.

ii) Expression of recombinant protein

The expression of the recombinant protein was induced according to different protocols in order to obtain soluble fusion proteins and with folding similar to the native one, so that enzymatic tests could be carried out with the purified expression product. Several expression protocols were tested, in which different incubation temperatures were combined with different concentrations of inducer, ITPG (Isopropyl β-D-1-thiogalactopyranoside, from SIGMA) and various incubation times. The protocols tested were the following.

◦

Ta incubation = 37 ° C, ITPG = 1 mM, Time = 4 hours.

◦

Ta incubation = 37 ° C, ITPG = 0.5 mM, Time = 4 hours.

◦

Ta incubation = 37 ° C, ITPG = 0.1 mM, Time = 4 hours.

◦

Ta incubation = 37 ° C, ITPG = 0.01 mM, Time = 4 hours.

◦

Ta incubation = 16 ° C, ITPG = 1 mM, Time = 24 hours.

◦

Ta incubation = 16 ° C, ITPG = 0.5 mM, Time = 24 hours.

◦

Ta incubation = 16 ° C, ITPG = 0.1 mM, Time = 24 hours.

◦

Ta incubation = 16 ° C, ITPG = 0.01 mM, Time = 24 hours.

The protocol with Ta incubation = 16 ° C, ITPG = 0.01 mM, Time = 24 hours, provided the AniSerp fusion protein as a soluble product. The recombinant AniSerp protein, without the signal peptide, had an open reading frame of 1119 nucleotides, which encoded 372 amino acid residues, to which the amino acids of the GST molecule (glutathione-S-transferase) must be added.

iii) Puri fi cation of the recombinant protein (AniSerp)

Once the AniSerp fusion protein was obtained in its soluble form, it was purified by glutathione affinity chromatography using glutathione-Sepharose beads (Amersham Biosciences), followed by elution using an elution buffer with 10 mM glutathione (Amersham Biosciences). This chromatography is based on the fact that GST fusion proteins facilitate the puri fi cation of recombinants thanks to the high affinity of GST by the glutathione molecule. Through this process it was possible to purify the recombinant protein in a state similar to the native molecule. Then, the purified recombinant AniSerp was dialyzed and subsequently the protein concentration was determined by the BCA protein assay kit (Pierce, Smith et al., 1985), using bovine serum albumin as the standard.

-

Example 3

Inhibitory assays

Once the recombinant protein was purified in its supposed active form, sequence analysis was carried out using BLAST (Basic Local Alignment Search Tool) in order to select the possible targets to study. Comparisons with the database showed similarities with different serine protease inhibitors described in other organisms. The highest similarity values were found with the serine protease inhibitor, similar to that of clade B, from Bos taurus (XP001254097, value E <6.10-60), mouse serpin 3b (Mus musculus, AAR89288, value E <4.10-59) and protein 1 related to squamous cell carcinoma antigen 2, also mouse (Mus musculus, AAN62872, E value <1.10-58), with a 37.2% identity with the first and 36.7% with the last two, respectively, when the comparison is made with the signal peptide, the identity being even lower (36.1% with any of the three proteins mentioned) when the comparison is made without the peptide signal. As you can see, both in the case of the mature protein and in the case of the immature form, there is no sequence with an identity with AniSerp that reaches 40%). The value E, which measures the ability of the percentage of similarity found, being more reliable the lower the value of E, is in all cases quite low.

Due to this variability, it was decided to carry out the inhibition activity tests of the following serine proteases: trypsin, plasmin, and thrombin. Since coincidences were found with a significant similarity with squamous cell carcinoma antigen 2 and related proteins, and these serpins are cross-class serpins capable of inhibiting both cistern proteases and serine proteases (Sakata et al., 2004), also Inhibition of the activity of the cathepsin cysteine proteases ByLydela serine protease cathepsin G, whose inhibition of activity has been described for cross-class serpine 3b, was tested. Finally, the inhibitory activity was also verified using a substrate that is specifically hydrolyzed by an Anisakis simplex serine protease described by Morris & Sakanary (1994) (SIGMA Aldrich).

Thus, the inhibitory activity of AniSerp was established on eight proteases (plasmin, factor Xa, thrombin, trypsin, cathepsin B, cathepsin L, cathepsin G and the serine protease activity of Anisakis simplex) by measuring the residual proteolytic activity after the incubation of each one of these enzymes with purified recombinant AniSerp (recombinant Anisakis simplex serpine plus GST). The substrates used for the enzymatic tests of trypsin, plasmin, thrombin, factor Xa and cathepsin B, L, and cathepsin G were Boc-Gln-Ala-Arg-AMC in 50 mM Tris-HCl pH 8, 0.15 M NaCl, 1 mM CaCl2; Boc-Val-Leu-Lys-AMC in 50 mM Tris-HCl pH 8, 50 mM NaCl; Boc-Val-Pro-Arg-AMC in 50 mM Tris-HCl pH 8, 100 mM NaCl; Boc-Ile-Glu-Gly-Arg-AMC in 50 mM Tris-HCl pH 8.3, 5 mM CaCl2, 0.2 mM NaCl and Z-Arg-Arg-AMC, Z-Phe-Arg-AMC in Sodium Citrate 50 mM pH 5.5, 5 mM EDTA, 20 mM DTT, 0.005% BSA and N-Succinyl-Ala-Ala-Pro-Phe-pNA in 50 mM Tris-HCl pH 7.5 respectively. Tests were also performed with the NCBZ-Gly-Pro-Arg-AMC substrate in 50 mM Tris-HCl pH 7.5 with 20 mM NaCl which is specifically hydrolyzed by the Anisakis simplex protease serine described by Morris & Sakanary (1994), using a crude extract of the nematode as a source of the enzyme. All substrates were purchased from SIGMA Aldrich. The tests were carried out with the previous incubation of AniSerp with each enzyme for 10 min at 37 ° C, in its previously indicated reaction buffer. The optimum concentration of each enzyme used was previously determined by studying enzymatic kinetics by selecting that concentration that showed a linear relationship with the reaction time (30 min). After the addition of 100 μM substrate to the reaction mixture, the residual activity of the enzyme was measured by continuous monitoring using, for fluorescent substrates (with AMC), excitation and emission wavelengths of 380 and 460 nm respectively, in a Victor 3, 1420 microplate fluorescence reader from Perkin Elmer and for the chromogenic substrate (pNA) a wavelength of 405 nm in a Bioteck ELX 800TM microplate absorbance reader. As a control, glutathione transferase protein (GST) was used. The assays were performed in triplicate and under conditions in which the incubation time and enzyme concentration were linearly related to the activity.

The results obtained are shown in Fig. 2. Said Fig. 2 shows that AniSerp was able to inhibit only thrombin and cathepsin and a concentration of 500 μg / ml; The other proteases were not inhibited by AniSerp. It should be noted that, while thrombin was completely inhibited at this concentration, the percentage of cathepsin inhibition was significantly lower, 36% for cathepsin L and 58% for cathepsin G. These latter results are consistent with the hypothetical nature of AniSerp cross class serpina.

In addition, it should be noted that only the inhibition of human thrombin was maintained over time and was dose dependent, showing an IC50 of 36.68 μg / ml, and an inhibition of more than 90% was observed with 200 μg / ml (Fig . 3).

-

Example 4

Structural modeling and interaction with thrombin

Once the antithrombin activity was demonstrated, it was decided to carry out an “in silico” analysis of the AniSerp molecule in order to define its possible structural model and its interaction with human thrombin, since, in general, serpins are a protein superfamily characterized by folding into a conserved structure and by employing a unique inhibitory mechanism similar to that of suicidal substrates. In order to obtain a reliable representation of the alleged interactions between AniSerp and human thrombin, three different 3D models based on homology were generated, corresponding to the three different stages of the serpin: inactive or latent, active

or native, and attached to thrombin. The three-dimensional structural models of AniSerp were assembled using homology modeling procedures based on Protein Data Bank structures, selected based on superior sequence similarity, coverage and sequence compatibility with respect to the structure.

To generate the first two models (inactive or latent and active or native), a mixed strategy was applied based on mold search by sequence and sequence versus structure, using the BLAST algorithm (Altschul et al., 1997) and the server Crimp (folding recognition) Phyre (Bennett-Lovsey et al., 2008) (http://blast.ncbi.nlm.nih.gov; http://www.sbg.bio.ic.ac.uk/phyre /).

The molds selected were two different serpins, one in the latent state and the other in the native state, both with a high degree of similarity (value E <10−38) with respect to the original search (AniSerp sequence). The selected templates were specifically: 1DVN (latent form of the human plasminogen activator inhibitor I; Stout et al., 2000) and 2DUT (native MENT conformation: Myeloid and Erythroid Nuclear Termination stage-speci fi c protein, McGowan et al., 2006 ).

Once the molds were selected, standard modeling procedures were used to generate the final 3D models. These models were built using the SWISS-MODEL server tools (Guex et al., 1999; Peitsch, 1996; Schwede et al., 2003) at http://swissmodel.expasy.org//SWISS-MODEL.html, and its structural quality was checked using the analysis programs provided by the same server (Anolea / Gromos / Verify3D). To optimize the geometries, the minimization of energy in the models was sought using the force field of GROMOS 43B1 implemented in DeepView (Guex & Peitsch, 1997), using 500 steps of downward minimization with greater slope, followed by 500 steps of gradient-conjugate minimization.

The final 3D models are shown in Fig. 4. The latent AniSerp model showed all the described characteristics of the classic mammalian serpins, with the presence of a six-strand antiparallel β sheet, in which the central strand contains several residues of the reactive central loop (RCL). This observation is in line with the fact described by Zang & Maizels (2001), who reported that, although nematode serpins have a low similarity in the overall primary sequence with respect to mammalian species serpins, they are capable of acquiring a Commonly ordered tertiary structure consisting of nine α helices and three β sheets, which allow the inhibitor to interact specifically with the enzyme. The comparison of the models of the latent and active form and, particularly, of the position of the loop of the reactive center (RCL) in each of them, shows the great structural reorganization, associated with the conformational change of the protein, which occurs at move from one form to another.

To achieve a model of the proposed complex of AniSerp and human thrombin, a strategy similar to the previous one was applied, based on search of molds by sequence and by sequence versus structure, using the Blast algorithm and the crimping server (folding recognition) Phyre Thus, the thrombin mold 1JMO (Baglin et al., 2002), obtained from the crystalline structure of the thrombin-co factor II complex of human heparin, which includes an inactive form of human thrombin and cofactor II was selected of human heparin (HCII), a protein with a high degree of sequence similarity (value E <10−33) with AniSerp. In addition, prior to molecular dynamics and, in order to obtain a more realistic model, the structure of the human thrombin included in the PDB 1JMO file was also remodeled, placing a serine residue (Ser205) in the active center, in the catalytic position, instead of the mutated alanine (Ala205) that appears in the inactive crystallized form of human thrombin. The initial overall interaction model obtained is shown in Fig. 5A, in which it can be seen how the exposed RCL of AniSerp interacts with human thrombin.

Finally, to obtain a high quality model for the proposed contact between human thrombin and Ani-Serp, the structure resulting from the homology modeling procedures was subjected to a short, 2 nanosecond stage of standardized molecular dynamics simulation using the PMEMD module of the AM-BER9 package (Case et al., 2005) and the parameter set parm99 of this distribution. The objective of this stage is to help the amino acids of the side chains, as well as the RCL skeleton, find a stable low energy conformation. The minimized structure was useful to analyze the nature of the specific contacts between both proteins. Fig. 5B shows the groove of the thrombin substrate (which involves the amino acids of AniSerp Met358 to Phe374). Fig. 5C includes contacts with the active center, which involve the catalytic triad of thrombin His43, Asp99 and Ser205, and the AniSerp residues Arg361 (P1) and Ser362 (P1 ’).

Since human antithrombin (AT) inhibits the coagulatory activity of serine proteases thrombin and factor Xa, the effect of AniSerp on factor Xa activity was also tested and no effect was found (Fig. 2-Factor Xa).

-

Example 5

Test of the effect of heparin

It is well documented that the activity of inhibitors such as AT and HCII is greatly enhanced by heparin, so it was decided to test the effect of heparin on the activity of AniSerp.

The assay was carried out in 200 μl of 0.15 mM NaCl, 0.02 mM HEPES, 1 mg / ml of polyethylene glycol (Mr = 8,000), and 1 mg / ml of bovine serum albumin (BSA), pH 7 ,4. The inhibition reaction mixtures contained 0.1 μg / ml-100 μg / ml of heparin and 30 μg / ml of serpine. The reaction was started by adding 5 nM thrombin. After 5 minutes of incubation, 50 μl of a solution containing 100 μM Boc-Val-Pro-Arg-AMC and 1.5 mg / ml of Polybrene were added. The residual thrombin activity was determined by measuring the hydrolysis of the fluorescent substrate in a microplate fluorescence reader (Victor 3, 1420 of Perkin Elmer).

Heparin (0.1 to 100 μg / ml) had no effect on the activity of AniSerp although it increased the inhibitory activity of control TA.

In order to study the different behavior of AniSerp, AniSerp residues that could be hypothetical heparin binding sites were investigated by aligning the sequence with residues of the AT and HCII binding sites, with heparin that have been previously described (Baglin et al., 2002). Additionally, to compare the 3D position of the heparin binding sites, structural alignment was carried out between the AniSerp model obtained after the molecular dynamics procedures and the structures of the 1JMO Protein Data Bank (human HCII; Baglin et al., 2002) and 1ATH (human antithrombin-III; Schreuder et al., 1994) using the Dali program (Holm et al., 2008). Structure traces were generated using PyMOL (DeLano Scienti fi c, San Carlos, CA).

Fig. 6 shows the sequence and structural alignment of the three proteins. None of the six critical residues (marked as spheres in Fig. 6) and involved in the binding of heparin to HCII (Lysl73, Argl84, Lysl85, Argl89, Argl92, and Argl93) are present in the AniSerp sequence, and only a conservative substitution is recognized at position 192 (Arg / Lys). This lack of conservation of critical residues can explain the results obtained when the inhibition activity of AniSerp was tested in the presence of heparin.

Bibliographic References

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402.

Ahrens I, Lip GY, Peter K (2010) New oral anticoagulant drugs in cardiovascular disease. Thromb Haemost.

104.1: 1-12.

Audicana MT, Kennedy MW (2008) Anisakis simplex: from obscure infectious worm to inducer of immune hypersensitivity. Clin Microbiol Rev 21: 360-379.

Baglin TP, Carrell RW, Church FC, Esmon CT, Huntington JA (2002) Crystal structures of native and thrombincomplexed heparin cofactor II reveal a multistep allosteric mechanism. Proc Natl Acad Sci USA 99: 11079-11084.

Bauer KA. New anticoagulants (2008) Curr Opin Hematol 15: 509-515.

Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340: 783-795.

Bennett-Lovsey RM, Herbert AD, Sternberg MJ, Kelley LA (2008) Exploring the extremes of sequence / structure space with ensemble fold recognition in the program Phyre. Proteins 70: 611-625.

Bier JW (1988) Anisakiasis. Laboratory Diagnosis of Infectious Diseases. Vol I. Bacterial, Mycotic and Parasitic Diseases. (Edited by Balows A., Hausler, W. J. Jr, Ohashi M., Turano A.), pp. 768-774. Springer, New York.

Cappello M, Vlasuk GP, Bergum PW, Huang S, Hotez PJ. (1995) Ancylostoma caninum anticoagulant peptide: a hookworm-derived inhibitor of human coagulation factor Xa. Proc Natl Acad Sci USA 92: 6152-6156.

Case DA, Cheatham TE 3rd, Darden T, Gohlke H, Luo R, Merz KM Jr, Onufriev A, Simmerling C, Wang B, Woods RJ (2005) The Amber biomolecular simulation programs. J Comput Chem 26: 1668-1.

Coughlin P, Sun J, Cerruti L, Salem HH, Bird P (1993) Cloning and molecular characterization of a human intracellular serine proteinase inhibitor. Proc Natl Acad SciUSA 90: 9417-9421.

Geraci JR, St Aubin DJ (1987) Effects of parasites on marine mammals. Int J Parasitol 17: 407-414.

Gettins PG, Olson ST (2009) Exosite determinants of serpin speci fi city. J Biol Chem 284: 20441-20445.

Guex N, Diemand A, Peitsch MC (1999) Protein modeling for all. Trends Biochem Sci 24: 364-367.

Guex N, Peitsch MC (1997) SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18: 2714-2723.

Holm L, Kaariainen S, Rosenstrom P, Schenkel A. (2008) Searching protein structure databases with DaliLite

v.3. Bioinformatics 24: 2780-2781.

Ishikura H, Kikuchi K, Nagasawa K, Ooiwa T, Takamiya H, Sato N, Sugane K (1993) Anisakidae and anisakidosis. Prog Clin Parasitol 3: 43-102.

Kobayashi Y, Ishizaki S, Nagashima Y, Shiomi K (2008) Ani s 1, the major allergen of Anisakis simplex: puri fi cation by affinity chromatography and functional expression in Escherichia coli. Parasitol Int 57: 314-319.

Kobayashi Y, Ishizaki S, Shimakura K, Nagashima Y, Shiomi K (2007) Molecular cloning and expression of two new allergens from Anisakis simplex. Parasitol Res 100: 1233-1241.

Law RH, Zhang Q, McGowan S, Buckle AM, Silverman GA, Wong W, Pink CJ, Langendorf CG, Pike RN, Bird PI, Whisstock JC. (2006) An overview of the serpin superfamily Genome Biol 7: 216.

Lee A, Agnelli G, Büller H, Ginsberg J, Heit J, Rote W, Vlasuk G, Costantini L, Julian J, Comp P, van Der Meer J, Piovella F, Raskob G, Gent M. (2001) Dose-response study of recombinant factor VIIa / tissue inhibitor factor recombinant nematode anticoagulant protein c2 in prevention of postoperative venous thromboembolism in patients undergoing total knee replacement. Circulation 104: 74-78.

McGowan S, Buckle AM, Irving JA, Ong PC, Bashtannyk-Puhalovich TA, Kan WT, Henderson KN, Bulynko YA, Popova EY, Smith AI, Bottomley SP, Rossjohn J, Grigoryev SA, Pike RN, Whisstock JC (2006) X -ray crystal structure of MENT: evidence for functional loop-sheet polymers in chromatin condensation. EMBO J 25: 3144-3155.

Miura Y, Kawabata S, Iwanaga S (1994) A Limulus intracellular coagulation inhibitor with characteristics of the serpin superfamily. Puri fi cation, characterization, and cDNA cloning. J Biol Chem 269: 542-547.

Morgenstern KA, Sprecher C, Holth L, Foster D, Grant FJ, Ching A, Kisiel W (1994) Complementary DNA cloning and kinetic characterization of a novel intracellular serine proteinase inhibitor: mechanism of action with trypsin and factor Xa as model proteinases. Biochemistry 33: 3432-3441.

Morris SR, Sakanari JA (1994) Characterization of the serine protease and serine protease inhibitor from the tissue-penetrating nematode Anisakis simplex. J Biol Chem 269: 27650-27656.

Nash P, Whitty A, Handwerker J, Macen J, McFadden G (1998) Inhibitory speci fi city of the anti-inflammatory myxoma virus serpin, SERP-1. J Biol Chem 273: 20982-20991.

Nguyen TT, Qasim MA, Morris S, Lu CC, Hill D, Laskowski MJr, Sakanari JA (1999) Expression and characterization of elastase inhibitors from the ascarid nematodes Anisakis simplex and Ascaris suum. Mol Biochem Parasitol

102: 79-89

Pak SC, Kumar V, Tsu C, Luke CJ, Askew YS, Askew DJ, Mills DR, Brömme D, Silverman GA (2004) SRP2 is a cross-class inhibitor that participates in postembryonic development of the nematode Caenorhabditis elegans: initial characterization of the clade L serpins. J Biol Chem 279: 15448-15459.

Peitsch MC (1996) ProMod and Swiss-Model: Internet-based tools for automated comparative protein modeling. Biochem Soc Trans 24: 274-279.

Perteguer MJ, Raposo R, Cuéllar C (1996) In vitro study on the effect of larval excretory / secretory producís and crude extraets from Anisakis simplex on blood coagulation. Int J Parasitol 26: 105-108.

Sakata Y, Arima K, Takai T, Sakurai W, Masumoto K, Yuyama N, Suminami Y, Kishi F, Yamashita T, Kato T, Ogawa H, Fujimoto K, Matsuo Y, Sugita Y, Izuhara Kt (2004) The squamous cell Carcinoma antigen 2 inhibits the cysteine proteinase activity of a major mite allergen, Der p 1. J Biol Chem 279: 5081-5087.

Short JM, Fernández JM, Sorge JA, Huse WD (1988) λ-ZAP: a bacteriophage expression vector with in-vivo excision properties. Nucleic Acid Res 16: 7583-7600.

Schreuder HA, by Boer B, Dijkema R, Mulders J, Theunissen HJ, Grootenhuis PD, Hol WG (1994) The intact and cleaved human antithrombin III complex as a model for serpin-proteinase interactions. Nat Struct Biol 1: 48-54.

Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res 31: 3381-3385.

Silverman GA, Lomas DA (2004) Serpin identification, production, and characterization. Methods 32: 71-72.

Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, Fujimoto EK, Goeke NM, Olson BJ, Klenk DC (1985) Measurement of protein using bicinchoninic acid. Anal Biochem 150: 76-85.

Stassens P, Bergum PW, Gansemans Y, Jespers L, Laroche Y, Huang S, Maki S, Messens J, Lauwereys M, Cappello M, Hotez PJ, Lasters I, Vlasuk GP (1996) Anticoagulant repertoire of the hookworm Ancylostoma caninum. Proc Natl Acad Sci USA 93: 2149-2154.

Stout TJ, Graham H, Buckley DI, Matthews DJ (2000) Structures of active and latent PAI-1: a possible stabilizing role for chloride ions. Biochemistry 39: 8460-8469.

Ufer M. (2010) Comparative ef fi cacy and safety of the novel oral anticoagulants dabigatran, rivaroxaban and apixaban in preclinical and clinical development. Thromb Haemost 103: 572-585.

Vlasuk GP, Bradbury A, López-Kinninger L, Colón S, Bergum PW, Maki S, Rote WE (2003) Pharmacokinetics and anticoagulant properties of the factor VIIa-tissue recombinant inhibitor factor Nematode Anticoagulant Protein c2 following subcutaneous administration in man. Dependence on the stoichiometric binding to circulating factor X. Thromb Haemost 90: 803-812.

Zang X, Maizels RM (2001) Serine proteinase inhibitors from nematodes and the arms race between host and pathogen. Trends Biochem Sci 26: 191-197.

Zang X, Yazdanbakhsh M, Jiang H, Kanost MR, Maizels RM (1999) A novel serpin expressed by blood-borne micro fi lariae of the parasitic nematode Brugia malayi inhibits human neutrophil serine proteinases Blood 94: 14181428.

Claims (27)

1. A polypeptide whose amino acid sequence comprises: a) the sequence represented by SEQ ID NO: 3, or b) a sequence that is at least 40% identical to SEQ ID NO: 3 that has a serpin structure with a layer The ability to inhibit human thrombin, or c) the amino acid sequence represented by SEQ ID NO: 2, or d) a sequence at least 40% identical to SEQ ID NO: 2, which has a serpine structure with ability to inhibit human thrombin.

2.

Polypeptide according to claim 1, comprising the amino acid sequence represented by SEQ ID NO: 3.

3.

Polypeptide according to claim 1, comprising an amino acid sequence having a serpine structure capable of inhibiting human thrombin, wherein said sequence is identical to SEQ ID NO: 3 in a percentage selected from the 50% group , 60%, 70%, 80%, 90%, 95%, 99%, 99.5% and 99.9%.

Four.

Polypeptide according to claim 1, comprising the amino acid sequence represented by SEQ ID NO: 2.

5.

Polypeptide according to claim 1, comprising an amino acid sequence having a serpine structure capable of inhibiting human thrombin, wherein said sequence is identical to SEQ ID NO: 2 in a percentage selected from the 50% group , 60%, 70%, 80%, 90%, 95%, 99%, 99.5% and 99.9%.

6.

Polypeptide according to any one of the preceding claims, which is a fusion protein comprising the sequence of a second protein.

7. Polypeptide according to claim 6, wherein the second protein is glutathione-S-transferase.

8.

Polypeptide according to any one of the preceding claims, whose ability to inhibit human thrombin is not affected by the presence of heparin.

9.

Polypeptide according to any one of the preceding claims, which also has the ability to inhibit Cathepsins GyL.

10.

An isolated nucleic acid molecule comprising a sequence that encodes a serpine capable of inhibiting human thrombin selected from the group consisting of:

a) a nucleic acid sequence encoding a polypeptide sequence at least 40% identical to the sequence represented by SEQ ID NO: 3 b) a nucleic acid sequence encoding a polypeptide sequence at least 40% identical to the sequence represented by SEQ ID NO: 2; c) a nucleic acid molecule complementary to one of the above.

eleven.

Nucleic acid molecule according to claim 10, comprising a sequence encoding a polypeptide sequence identical to that represented by SEQ ID NO: 3.

12.

Nucleic acid molecule according to claim 10, comprising a sequence encoding a polypeptide sequence identical to that represented by SEQ ID NO: 2.

13.

Nucleic acid molecule according to claim 12, comprising the sequence represented by SEQ ID NO: 1.

14.

Nucleic acid molecule according to claim 10, comprising a sequence fragment encoding a polypeptide sequence that is identical to that represented by SEQ ID NO: 2 at least in a percentage that is selected from the group of 50%, 60%, 70 %, 80%, 90%, 95%, 99%, 99.5% and 99.9%.

fifteen.

An expression vector comprising the DNA sequence corresponding to the nucleic acid molecule of any one of claims 10 to 14 operatively linked to an expression control sequence.

16.

A host cell transformed with an expression vector of claim 15.

17.

Host cell according to claim 16, which is a bacterium, a yeast, or a eukaryotic cell.

18.

A method of producing a protein comprising the steps of:

a) culturing the transformed host cell with an expression vector of claim 15 that allows expression of the polypeptide capable of inhibiting human thrombin encoded in said expression vector; b) purify the polypeptide synthesized in step a) of the cell or cell medium.

19.

Use of a polypeptide of any one of claims 1-9 for the preparation of a medicament.

twenty.

Use according to claim 19, wherein the medicament is intended to be used as an anticoagulant.

twenty-one.

Use according to claim 20, wherein the medicament is intended for patients in whom it is suspected that there may be some alteration in coagulation cascade proteins other than thrombin, to immunocompromised patients, to patients with liver disorders, to patients with consumption coagulopathies with disseminated intravascular coagulation, to patients with hypercoagulable states associated with the use of heparin or to patients with antithrombin III deficiency.

22

Use according to claim 20, wherein the medicament is intended to be administered as an anticoagulant during perioperative periods.

2. 3.

Use according to claim 22, wherein the medicament is intended to be administered during the perioperative period of cardiopulmonary surgery, and trauma surgery.

24.

Use according to claim 23, wherein the medicament is intended to be administered during the perioperative period of traumatic surgery in full hip and knee replacement treatments.

25.

Use according to claim 19, wherein the medicament is intended for patients with acute coronary syndrome, atrial fibrillation, chronic coronary disease, mechanical or joint prostheses and cardiac or vascular valves.

26.

Use according to any one of claims 20 to 25, wherein the medicament is intended to be administered without the simultaneous administration of heparin.

SEQUENCE LIST <110> CARLOS III HEALTH INSTITUTE; CENTRAL UNIVERSITY OF VENEZUELA CARACAS <120> NEW SERINA PROTEASA INHIBITOR AND ITS USE <130> P-100994 <160> 9 <170> PatentIn version 3.3 <210> 1 <211> 1194 <212> DNA <213> Anisakis simplex <220> <221> CDS <222> (1) .. (1191) <223> AniSerp coding sequence, serine protease inhibitor <220> <221> sig peptide <222> (1) .. (25) <223> Signal Peptide <400> 1 <210> 2 <211> 397 <212> PRT <213> Anisakis simplex <400> 2 <210> 3 <211> 372 <212> PRT <213> Anisakis simplex <220> <221> mat_peptide <222> (1) .. (372) <223> Mature form of AniSerp <400> 3 <210> 4 <211> 22 <212> DNA <213> Artificial sequence <220> <223> AP1 PCR direct primer, for amplification of the 5 ′ end of Anisakis simplex clone 3A22 <400> 4 <210> 5 <211> 28 <212> DNA <213> Artificial sequence <220> <223> SR1 PCR reverse primer, for amplification of the 3 ′ end of Anisakis simplex clone 3A22 <400> 5 <210> 6 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Direct PCR primer: SER5 ’, for amplification of the entire AniSerp gene <400> 6 <210> 7 <211> 30 <212> DNA <213> Artificial sequence <220> <223> SER3 ’PCR Reverse Primer, for amplification of the entire AniSerp gene <400> 7 <210> 8 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 5′-SER-SPS PCR director primer <400> 8 <210> 9 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Inverse PCR primer 3’-SER-SPS <400> 9 SPANISH OFFICE OF THE PATENTS AND BRAND Application no .: 201031031 SPAIN Date of submission of the application: 03.07.2010 Priority Date: REPORT ON THE STATE OF THE TECHNIQUE RELEVANT DOCUMENTS

 Category

 @ Documents cited  Claims Affected

A A A A A  WO 9610638 A1 (PPL THERAPAUTICS (SCOTLAND) LTD.) 11.04.1996, the whole document. WO 9100291 A1 (AZKO N.V.) 10.01.1991, the whole document. US 5427937 A (MICHAEL CAPPELLO et al.) 27.06.1995, the whole document. US 5420252 A (HIROYURI KATO et al.) 30.05.1995, the whole document. EP 0238473 A2 (MONSANTO COMPANY) 23.09.1987, the whole document.  1-26 1-26 1-26 1-26 1-26

  Category of the documents cited X: of particular relevance Y: of particular relevance combined with other / s of the same category A: reflects the state of the art O: refers to unwritten disclosure P: published between the priority date and the date of priority submission of the application E: previous document, but published after the date of submission of the application

  This report has been produced � for all claims � for claims no:

Date of realization of the report 12.01.2012  Examiner M. M. García Coca  Page 1/4

REPORT OF THE STATE OF THE TECHNIQUE Application number: 201031031 CLASSIFICATION OBJECT OF THE APPLICATION C12N15 / 15 (2006.01) C07K14 / 81 (2006.01) A61K38 / 57 (2006.01) A61P7 / 02 (2006.01) Minimum documentation sought (classification system followed by classification symbols) C12N, A61P Electronic databases consulted during the search (name of the database and, if possible, search terms used) INVENTIONS, EPODOC State of the Art Report Page 2/4  WRITTEN OPINION Application number: 201031031 Date of Written Opinion: 12.01.2012 Statement

Novelty (Art. 1 LP 11/198)

Claims Claims 1-26 IF NOT

Inventive activity (Art. 8.1 LP11 / 198)

Claims Claims 1-26 IF NOT

The application is considered to comply with the industrial application requirement. This requirement was evaluated during the formal and technical examination phase of the application (Article 31.2 Law 11/1986).  Basis of Opinion.- This opinion has been made on the basis of the patent application as published. State of the Art Report Page 3/4  WRITTEN OPINION Application number: 201031031 1. Documents considered.- The documents belonging to the state of the art taken into consideration for the realization of this opinion are listed below.

Document

Publication or Identification Number Publication Date

D01

WO 9610638 A1 (PPL THERAPAUTICS (SCOTLAND) LTD.) 11.04.1996

D02

WO 9100291 A1 (AZKO N.V.) 10.01.1991

D03

US 5427937 A (MICHAEL CAPPELLO et al.) 27.06.1995

D04

US 5420252 A (HIROYURI KATO et al.) 05.30.1995

D05

EP 0238473 A2 (MONSANTO COMPANY) 23.09.1987

2. Statement motivated according to articles 29. and 29.7 of the Regulations for the execution of Law 11/198, of March 20, on Patents on novelty and inventive activity; quotes and explanations in support of this statement The object of the invention, as set forth in claims 1-26, is a serpine structure polypeptide (SEQ ID NO: 2 and 3) capable of inhibiting human thrombin independently of heparin, wherein said Polypeptide can bind to a second protein, giving a fusion protein where the second protein is glutathione-Stransferase. Said polypeptide also has the ability to inhibit cathepsins G and L (reiv. 1-9). The subject of the invention is also the nucleic acid encoding said polypeptide (reiv. 10-14), an expression vector comprising the nucleic acid (reiv. 15), a host cell transformed with the expression vector (reiv. 16 and 17), a method for producing the protein (reiv. 18) and the use of the polypeptide of the invention for the preparation of an anticoagulant medicament (reiv. 19-26).  Novelty and Inventive Activity (Art. 1 and 8.1 of Law 11/198 on Patents). Document D01 discloses a serine protease inhibitor that does not require activation by heparin and which comprises a sequence that interacts with the catalytic site of thrombin by inhibiting its proteolytic activity. This enzyme can be administered independently of heparin. Document D02 discloses variants of human antithrombin III, which have substitutions in the region comprised of amino acid 384 to 396. Substitutions in this region specifically allow modulating the heparin dependence of said protein, so that the effect is altered Heparin-dependent inhibitor of inhibiting factors IIa (thrombin) and Xa. One of the substitutions means that in the presence of heparin, the protein retains its ability to inhibit thrombin, but loses the ability to inhibit factor Xa. Document D03 discloses an anticoagulant protein obtained from the Ancylostoma nematode, which has sequence homology with the Kunitz family of serpins. This protein prolongs the lifetime of prothrombin and thromboplastin, but also inhibits factors VIIa and Xa within the coagulation cascade. Document D04 discloses a mutated human antithrombin III by recombinant DNA methods. This protein has modified the heparin binding site, so that said protein is active in the absence of heparin, and is effective as an anticoagulant. Document D05 discloses peptides capable of inhibiting serine proteases. These peptides have a region with a serpine structure of which some of them have the capacity to inhibit both thrombin and cathepsin G. This document also discloses a method for the synthesis of said peptides, and their use as inhibitors of serine proteases None of the documents cited (D01-D05), taken alone or in combination, reveal the invention defined in claims 1-26. In addition, there are no suggestions in the cited documents that direct the person skilled in the art towards the invention defined by said claims. Therefore, the object of the invention as set forth in claims 126, meets the requirement of novelty and implies inventive activity within the meaning of articles 6.1 and 8.1 of Patent Law 11/1986. State of the Art Report Page 4/4