ES2365749T3 - SPECIFIC UNION MOLECULES OF GUEST CELL CAPABLE OF NEUTRALIZING VIRUSES AND USES OF THE SAME. - Google Patents

Abstract

Monoclonal antibody capable of binding to a host cell protein and having flavivirus neutralizing activity, said antibody comprising a heavy and a light chain, wherein said heavy chain comprises a CDR1 region according to SEQ ID NO: 7, a CDR2 region according to SEQ ID NO: 8 and a CDR3 region according to SEQ ID NO: 5; and wherein said light chain comprises a CDR1 region according to SEQ ID NO: 9, a CDR2 region according to SEQ ID NO: 10 and a CDR3 region according to SEQ ID NO: 11, and wherein said host cell protein is a factor 1 associated with Fas.

Description

FIELD OF THE INVENTION

The invention relates to medicine. In particular, the invention relates to the diagnosis, prophylaxis and / or treatment of viral infections.

BACKGROUND OF THE INVENTION

Several viruses assemble their core proteins and genomic material into the cytoplasm of a host cell and leave the cell by plasma membrane budding. Studies of these viruses, for example HIV-1 virus, have shown that in addition to proteins encoded by the virus, host cell proteins can be found in the viruses. Although some of these proteins can be taken in viruses simply because of their proximity to viral assembly and budding sites, it is likely that other host cell proteins are included in viruses as a result of their interaction with viral proteins during assembly and the Liberation. Additionally, some host cell proteins can be incorporated to provide a function for the virus during the infection process. Host cell proteins have been found on the surface or inside of viruses. Despite their detection on or in viruses, the role and function of host cell proteins in the viral assembly process is poorly understood and they are still highly speculative.

A variety of agents are currently used to fight viral infection. These agents include antiviral compounds, compounds suitable for active immunization such as vaccines and compounds suitable for passive immunization such as neutralizing immunoglobulins. This last group focuses on neutralizing immunoglobulins that act through specific binding to viral proteins or cell surface receptors involved in viral entry. Thus, the binding of neutralizing immunoglobulins to the protein (E) of the West Nile virus viral envelope (WNV) (Engle and Diamond, 2003; Oliphant et al., 2005; and WO02 / 072036) has been described. These immunoglobulins can specifically neutralize WNV. However, due to their specificity of binding, such immunoglobulins are only suitable in the prophylaxis and / or treatment of specific viral diseases and cannot be widely applied in the treatment of viral diseases.

Virus neutralization for immunoglobulins directed against proteins derived from the host cell incorporated into the virus has been described. For example, HIV-1 has been shown to incorporate the protein 1 intercellular adhesion molecule (ICAM-1) derived from the host cell and it has been shown that an antibody against ICAM-1 neutralizes HIV-1 virions expressing ICAM- 1 (see Rizzuto and Sodroski, 1997). Unfavorably, ICAM-1 is also located on the surface of uninfected host cells, so that the protection and / or treatment of a viral infection with immunoglobulin against ICAM-1, due to the interaction of immunoglobulin with cells Uninfected host, can result in serious and unwanted side effects. An additional disadvantage of the anti-ICAM-1 immunoglobulin is that its neutralizing activity is similar to cell surface receptor specific and viral protein specific immunoglobulins (virus-specific) (HIV-1). Therefore, there is an urgent need for immunoglobulins that do not have the disadvantages described above.

The present invention provides such immunoglobulins. The immunoglobulins found can bind to an intracellular host cell protein that is incorporated into viruses or expressed on the cell surface. Due to the intracellular location of the protein in uninfected host cells, no unwanted side effects occur during the administration of immunoglobulins. An additional advantage of immunoglobulins is that they do not depend on specific viral identification and that they interact with a host cell protein that is commonly involved in the process of viral budding and assembly and consequently can neutralize several different viruses.

DESCRIPTION OF THE FIGURES

Figure 1 shows the titration of the anti-WNV monoclonal antibody CR4354L4328 in a murine model of WNV exposure. From top to bottom, titration of the anti-WNV monoclonal antibody CR4354L4328 using doses of 0.03, 0.01, 0.003, and 0.001 mg / kg and titration with a control antibody at a concentration of 10 mg are shown / kg Days are shown on the X axis and the probability of survival (%) is represented on the Y axis.

Figure 2 shows the titration of the CR4348 anti-WN monoclonal antibody in a murine model of WNV exposure. From top to bottom, titration of the anti-WNV monoclonal antibody CR4348 using doses of 0.1, 0.03, 0.01, 0.003 and 0.001 mg / kg and titration with a control antibody at a concentration are shown 10 mg / kg Days are shown on the X axis and the survival probability (%) is represented on the Y axis.

Figure 3 shows the ELISA binding of dilutions of the optimized antibodies CR4354L4261, CR4354L4267, CR4354L4328, CR4354L4335, CR4354L4383 and the original antibody CR4354 to WNV. The absorbance (OD) at 492 nm is shown on the Y axis and the amount of antibody in g / ml is shown on the X axis.

Figure 4 shows neutralization data of CR4348 (black circles) and CR4354L4328 (white circles) of the yellow fever virus flavivirus, Japanese encephalitis virus, St. Louis encephalitis virus and Dengue 2 virus in a trial of plate reduction

Figure 5 shows an immunoblot with, from left to right, mycNDUFV-1 cell lysate and immunoprecipitated lysate with CR4348, CR4361, CR4374 or CR4354L4328.

DESCRIPTION OF THE INVENTION

Definitions of terms as used in the invention follow below.

DEFINITIONS

Amino acid sequence

The term "amino acid sequence" as used herein refers to synthetic or naturally occurring molecules and a peptide, oligopeptide, polypeptide or protein sequence.

Binding molecule

As used herein, the term "binding molecule" refers to an intact immunoglobulin including monoclonal antibodies, such chimeric, humanized or human monoclonal antibodies, or to an antigen-binding domain and / or variable comprising a fragment. of an immunoglobulin that competes with the intact immunoglobulin for specific binding to the immunoglobulin binding partner, for example a host cell protein. Regardless of the structure, the antigen-binding fragment binds with the same antigen that recognizes the intact immunoglobulin. An antigen binding fragment may comprise a peptide or polypeptide comprising an amino acid sequence of at least 2 contiguous amino acid residues, at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues , at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 amino acid residues acid contiguous or at least 250 contiguous amino acid residues of the amino acid sequence of the binding molecule.

The term "binding molecule", as used herein, includes all classes and subclasses of immunoglobulins known in the art. Depending on the amino acid sequence of the constant domain of their heavy chains, the binding molecules can be divided into five main classes of intact antibodies: IgA, IgD, IgE, IgG and IgM, and several of these can be subdivided into subclasses (isotypes), for example, IgA1, IgA2, IgG1, IgG2, IgG3 and IgG4.

Antigen-binding fragments include, among others, Fab, F (ab '), F (ab') 2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single chain antibodies (scFv), bivalent single chain antibodies, single chain phage antibodies, diabodies, triabodies, tetrabodies, (poly) peptides containing at least one fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the (poly) peptide, etc. The above fragments can be produced synthetically and by enzymatic or chemical cleavage of intact immunoglobulins or can be engineered by recombinant DNA techniques. Production methods are well known in the art and are described, for example, in Antibodies: A Laboratory Manual, edited by: E. Harlow and D, Lane (1988), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. A binding molecule or antigen binding fragment thereof can have one or more binding sites. If there is more than one binding site, the binding sites may be identical to each other or they may be different.

The binding molecule can be a naked or unconjugated binding molecule that can also be part of an immunoconjugate. A naked or unconjugated binding molecule is intended to refer to a binding molecule that is not conjugated, operably linked or physically or functionally associated with an effector tag or moiety, such as among others a toxic substance, a radioactive substance, a Liposome, an enzyme. It will be understood that naked or unconjugated binding molecules do not exclude binding molecules that have been stabilized, multimerized, humanized or manipulated in any other way, other than by binding an effector tag or moiety. Accordingly, all posttranslationally modified naked or unconjugated binding molecules are included herein, including when modifications are made in the environment of the cell that produces the natural binding molecule, by a cell that produces the binding molecule. recombinant, and are introduced by the hand of man after the preparation of the initial binding molecule. Of course, the expression "naked or unconjugated binding molecule" does not exclude the ability of the binding molecule to form functional associations with molecules and / or effector cells after administration to the organism, since some such interactions are necessary in order to exert a biological effect. The lack of label or associated effector group is therefore applied in the definition to the naked or unconjugated binding molecule in vitro, not in vivo.

Biological sample

As used herein, the term "biological sample" encompasses a variety of types of samples, including blood and other liquid samples of biological origin, solid tissue samples such as a biopsy sample or tissue cultures, or derived cells. of them and the progeny of them. The expression also includes samples that have been manipulated in any way after being obtained, such as by treatment with reagents, solubilization or enrichment of certain components, such as proteins or polynucleotides. The expression encompasses various types of clinical samples obtained from any species, and also includes cells in culture, cell supernatants and cell lysates.

Complementary determining regions (CDR)

The term "complementarity determining regions" as used herein means sequences within the variable regions of binding molecules, such as immunoglobulins, that usually contribute greatly to the antigen binding site that is complementary in form. and load distribution to the epitope recognized in the antigen. The CDR regions may be specific for linear epitopes, discontinuous epitopes or conformational epitopes of proteins or protein fragments, either as presented in the protein in its native conformation or, in some cases, as presented in the proteins as denatured. , for example, by solubilization in SDS. Epitopes may also consist of post-translational protein modifications.

Deletion

The term "deletion," as used herein, indicates a change in the sequence of either amino acids or nucleotides in which one or more amino acid or nucleotide residues, respectively, are absent compared to the molecule. original, often the one that occurs naturally.

Nucleic acid sequence that regulates expression

The term "nucleic acid sequence that regulates expression" as used herein refers to polynucleotide sequences necessary for and / or affecting the expression of an operably linked coding sequence in a particular host organism. Nucleic acid sequences that regulate expression, such as among other appropriate enhancer, promoter, initiation and termination sequences of transcription; repressor or activator sequences; effective RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (eg, ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion, can be any nucleic acid sequence that shows activity in the host organism of choice and can be derived from genes encoding proteins, which are either homologous or heterologous to the organism Guest. The identification and use of sequences that regulate expression are routine for those skilled in the art.

Functional variant

The term "functional variant," as used herein, refers to a binding molecule that comprises a nucleotide and / or amino acid sequence that is altered in one or more nucleotides and / or amino acids compared to the sequences. of nucleotides and / or amino acids of the original binding molecule and which can still compete for binding to the binding partner, for example, an intracellular protein of the host cell, with the original binding molecule. In other words, modifications in the amino acid and / or nucleotide sequence of the original binding molecule do not significantly affect or alter the binding characteristics of the binding molecule encoded by the nucleotide sequence or which contains the amino acid sequence, is That is, the binding molecule can still recognize and bind to its target. The functional variant may have conservative sequence modifications including substitutions, additions and deletions of nucleotides and amino acids. These modifications may be introduced by conventional techniques known in the art, such as site-directed mutagenesis and randomized PCR-mediated mutagenesis, and may comprise natural as well as unnatural nucleotides and amino acids.

Conservative amino acid substitutions include those in which the amino acid residue is replaced by an amino acid residue having similar chemical or structural properties. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (for example, lysine, arginine, histidine), acidic side chains (for example, aspartic acid, glutamic acid), uncharged polar side chains (for example, glycine, asparagine, glutamine, serine, threonine, tyrosine, cystine, tryptophan), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), branched beta side chains (e.g. threonine, valine, isoleucine) and side chains aromatic (for example, tyrosine, phenylalanine, tryptophan, histidine). It will be clear to one skilled in the art that other classifications of amino acid residue families other than the one used above may also be used. In addition, a variant may have non-conservative amino acid substitutions, for example, the substitution of an amino acid for an amino acid residue having different chemical or structural properties. Similar minor variations may also include deletions or insertions of amino acids, or both. Guidelines for determining which amino acid residues can be substituted, inserted or deleted without suppressing immunological activity can be found using computer programs well known in the art.

A mutation in a nucleotide sequence can be a single alteration performed in a locus (a point mutation), such as transition or transverse mutations, or alternatively multiple nucleotides can be inserted, deleted or changed in a single locus. In addition, one or more alterations can be made to any number of loci within a nucleotide sequence. Mutations can be made by any method known in the art.

Guest

The term "host", as used herein, is intended to refer to an organism or a cell in which a vector such as a cloning vector or an expression vector has been introduced. The organism or cell can be prokaryotic or eukaryotic. It should be understood that this term is intended to refer not only to the particular object organism or cell, but also to the progeny of such an organism or cell as well. Because certain modifications may occur in later generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the original organism or cell, but is still included within the scope of the term "host" as It is used in this document.

Human

The term "human", when applied to binding molecules as defined herein, refers to molecules that are either derived directly from a human being or based on a human sequence. When a binding molecule is derived from or based on a human sequence and subsequently modified, it is still considered human as used throughout the entire specification. In other words, the term human, when applied to binding molecules, is intended to include binding molecules that have variable and constant regions derived from human germline immunoglobulin sequences or based on variable or constant regions that occur in a human being or human lymphocyte and modified in some way. Thus, human binding molecules may include amino acid residues not encoded by human germline immunoglobulin sequences, comprise substitutions and / or deletions (eg, mutations introduced by for example random or site-specific mutations in vitro or well somatic mutation in vivo). "Based on" as used herein refers to the situation that a nucleic acid sequence can be copied exactly from a template, or with minor mutations, such as by error-prone PCR methods, or prepared in a manner synthetic coinciding with the mold exactly or with minor modifications. Semisynthetic molecules based on human sequences are also considered to be human as used herein.

Insertion

The term "insertion," also known as the term "addition," indicates a change in an amino acid or nucleotide sequence that results in the addition of one or more amino acid or nucleotide residues, respectively, compared to the original sequence.

Isolated

The term "isolated," when applied to binding molecules as defined herein, refers to binding molecules that are substantially free of other proteins or polypeptides, particularly free of other binding molecules that have specificities. different antigens, and are also substantially free of other cellular material and / or chemicals. For example, when the binding molecules are produced recombinantly, they are preferably substantially free of culture medium, and when the binding molecules are produced by chemical synthesis, they are preferably substantially free of chemical precursors or other chemicals, that is, They are separated from chemical precursors or other chemicals that are involved in protein synthesis. The term "isolated" when applied to nucleic acid molecules encoding binding molecules as defined herein, is intended to refer to nucleic acid molecules in which the nucleotide sequences encoding the binding molecules are free from other nucleotide sequences, particularly nucleotide sequences encoding binding molecules that bind to different binding partners of host cell proteins. In addition, the term "isolated" refers to nucleic acid molecules that are substantially separated from other cellular components that naturally accompany the native nucleic acid molecule in its natural host, for example, ribosomes, polymerases or genomic sequences with which is associated naturally. In addition, "isolated" nucleic acid molecules, such as cDNA molecules, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. .

Monoclonal antibody

The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of individual molecular composition. A monoclonal antibody has a unique binding specificity and affinity for a particular epitope. Accordingly, the term "human monoclonal antibody" refers to an antibody that has a unique binding specificity that has variable and constant regions derived from or based on human germline immunoglobulin sequences or derived from completely synthetic sequences. The method of preparation of the monoclonal antibody is not relevant.

That occurs naturally

The expression "which occurs naturally" as used herein as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism that can be isolated from a source in nature and that has not been intentionally modified by man in the laboratory occurs naturally.

Nucleic acid molecule

The term "nucleic acid molecule" as used in the present invention refers to a polymeric form of nucleotides and includes both sense and antisense strands of RNA, cDNA, genomic DNA and synthetic forms of mixed polymers of the foregoing. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of any type of nucleotide. The expression also includes single and double stranded forms of DNA. In addition, a polynucleotide can include any or both modified and naturally occurring nucleotides linked to each other by naturally occurring and / or non-naturally occurring nucleotide bonds. Nucleic acid molecules may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, markers, methylation, substitution of one or more of the naturally occurring nucleotides by an analog, internucleotide modifications such as non-charged bonds (eg, methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds (for example, phosphorothioates, phosphorodithioates, etc.), hanging moieties (for example, polypeptides), intercalating agents (for example, acridine, psoralen, etc.), chelants, alkylating agents and modified bonds (for example, alpha-anomeric nucleic acids, etc.). The previous expression also aims to include any topological conformation, including single-chain, double-stranded, partially double, triple, fork, circular and padlock conformations. Synthetic molecules that mimic polynucleotides in their ability to bind a designated sequence through hydrogen bonds and other chemical interactions are also included. Such molecules are known in the art and include, for example, those in which phosphate bonds replace peptide bonds in the main structure of the molecule. A reference to a nucleic acid sequence encompasses its complement unless otherwise specified. Therefore, it should be understood that a reference to a nucleic acid molecule having a particular sequence encompasses its complementary strand, with its complementary sequence. The complementary strand is also useful, for example, for antisense therapy, hybridization probes and PCR primers.

Operationally linked

The term "operably linked" refers to two or more nucleic acid sequence elements that are usually physically linked and are in a functional relationship with each other. For example, a promoter is operably linked to a coding sequence, if the promoter can initiate or regulate the transcription or expression of a coding sequence, in which case it should be understood that the coding sequence is "under the control of the" promoter.

Pharmaceutically acceptable excipient

By "pharmaceutically acceptable excipient" is meant any inert substance that is combined with an active molecule such as a drug, agent or binding molecule to prepare a convenient pharmaceutical form.

or nice. The "pharmaceutically acceptable excipient" is an excipient that is not toxic to the receptors at the dosages and concentrations employed, and is compatible with other components of the formulation comprising the drug, binding agent or molecule.

Union specifically

The term "specifically binding", as used herein, in reference to the interaction of a binding molecule, for example an antibody, and its binding partner, for example an antigen, means that the interaction depends of the presence of a particular structure, for example an antigenic determinant or epitope, in the binding partner. In other words, the antibody binds or preferentially recognizes the binding partner even when the binding partner is present in a mixture of other molecules or organisms. Binding can be mediated by covalent or non-covalent interactions or a combination of both. In other words, the term "specifically binding" means binding immunospecifically to an antigen or a fragment thereof and not binding immunospecifically to other antigens. A binding molecule that immunospecifically binds to an antigen can bind to other peptides or polypeptides with lower affinity as determined, for example, by radioimmunoassay (RIA), enzyme-linked immunosorbent assays (ELISA), BIACORE or other assays. known in the art. Binding molecules or fragments thereof that bind immunospecifically to an antigen can cross-react with related antigens. Preferably, the binding molecules or fragments thereof that immunospecifically bind to an antigen do not cross-react with other antigens.

Substitutions

A "substitution," as used herein, indicates the substitution of one or more amino acids or nucleotides with different amino acids or nucleotides, respectively.

Therapeutically effective amount

The term "therapeutically effective amount" refers to an amount of the binding molecule as defined herein that is effective in preventing, improving and / or treating a condition that results from a viral infection.

Treatment

The term "treatment" refers to therapeutic treatment as well as prophylactic or preventive measures to cure or stop or at least delay the evolution of the disease. Those who need treatment include those who are already suffering from a condition that results from a viral infection as well as those in which a viral infection is to be prevented. Subjects partially or fully recovered from a viral infection may also need treatment. Prevention includes inhibiting or reducing the spread of a virus or inhibiting or reducing the occurrence, development or evolution of one or more of the symptoms associated with a viral infection.

Vector

The term "vector" indicates a nucleic acid molecule in which a second nucleic acid molecule can be inserted for introduction into a host where it will be replicated, and in some cases expressed. In other words, a vector can transport a nucleic acid molecule to which it has been linked. The term "vector" contemplates cloning vectors as well as expression vectors, as used herein. Vectors include, but are not limited to, plasmids, cosmids, artificial bacterial chromosomes (BAC) and artificial yeast chromosomes (YAS) and vectors derived from bacteriophages or plant or animal viruses (including humans). The vectors comprise an origin of replication recognized by the proposed host and in the case of expression vectors, promoter sequences and other regulatory regions recognized by the host. A vector containing a second nucleic acid molecule is introduced into a cell by transformation, transfection or using viral entry mechanisms. Certain vectors can replicate autonomously in a host into which they are introduced (for example, vectors that have an origin of bacterial replication can replicate in bacteria). Other vectors can be integrated into the genome of a host after introduction into the host, and thereby replicate along with the host genome.

SUMMARY OF THE INVENTION

The invention provides binding molecules capable of specifically binding to a host cell protein and can neutralize viruses. The invention also relates to nucleic acid molecules that encode at least the binding region of the binding molecules. The invention further provides the use of the binding molecules of the invention in the prophylaxis and / or treatment of a subject who has, or is at risk of developing, a viral infection. In addition to that, the invention relates to the use of the binding molecules of the invention in the diagnosis / detection of a viral infection.

DETAILED DESCRIPTION OF THE INVENTION

In a first aspect, the present invention encompasses binding molecules capable of specifically binding to a host cell protein. Preferably, the host cell protein is an intracellular host cell protein, which means that the host cell protein is not normally exposed (for example in an uninfected host cell) outside the host cell such as by example a cell surface receptor. In one aspect, the host cell protein is a mammalian host cell protein, preferably human. In normal host cells (for example not infected), host cells the intracellular protein of the host cell may have a cytoplasmic location (it is a cytoplasmic protein). Alternatively, it may be located on or within the organelles of the host cell including, but not limited to, the mitochondria, the Golgi apparatus, the nucleus, vacuoles, vesicles and / or the endoplasmic reticulum. After infection of the host cell with a virus, the intracellular protein of the host cell can move to the cell membrane and can be located / incorporated into or on the cell surface of the host cell. In other words, after infection of the host cell with a virus, the intracellular protein of the host cell can be presented on the surface of the host cell. The location of the host cell protein in normal cells (for example, not infected) compared to infected cells may therefore differ. The binding molecules of the invention can specifically bind to a host cell, once the intracellular protein of the host cell is exposed on or on the surface of the cell. Preferably, the binding molecules of the invention can also be linked to a fragment of a host cell protein, said fragment comprising at least one antigenic determinant recognized by the binding molecules of the invention. An "antigenic determinant" as used herein is a moiety, such as a (poly) peptide, a protein, a glycoprotein, an analogue or fragment thereof that can bind to a binding molecule of the invention with affinity. high enough to form a detectable binding antigen-molecule complex.

According to the invention, the intracellular protein of the host cell recognized by the binding molecules of the invention is Fas-associated factor 1 (FAF-1; for the nucleotide sequence see SEQ ID NO: 1 (nucleotides 278-2230 encode protein) and for the amino acid sequence see SEQ ID NO: 2; see also Genbank No. BC067100) or NADH-dehydrogenase (ubiquinone) flavoprotein-1 (NDUFV-1; for the nucleotide sequence see SEQ ID NO: 3 (nucleotides 34-1428 encode the protein) and for the amino acid sequence see SEQ ID NO: 4; see also Genbank No. BC015645.2). In one embodiment of the invention, truncated or secreted forms that occur naturally, naturally occurring variant forms (eg, alternately spliced and spliced forms) and naturally occurring allelic variants of FAF- 1 or NDUFV-1, particularly FAF-1 or NDUFV-1 comprising an amino acid sequence as shown in SEQ ID NO: 2 and SEQ ID NO: 4, respectively, are also a part of the present invention. A variant form of NDUFV-1 is shown in Genbank No. BC008146.1. This variant form has an amino acid sequence that is identical to SEQ ID NO: 4, with the proviso that it lacks amino acids 16-24 of SEQ ID NO: 4. Other variant forms of NDUFV-1 can be found in Genbank Nos. S67973.1, CR605492.1 and BC007619.1. A variant form of FAF-1 is shown in Genbank No. NM131917. This variant form has an amino acid sequence that is identical to SEQ ID NO: 2, with the proviso that as a result of the lack of an internal coding sequence, it lacks amino acids 189-344 (but has the same N and C ends -terminales compared to the full length form of FAF-1). Amino acids 189-344 have been replaced by FSSR amino acids in this variant form. Preferably, the binding molecules of the invention can specifically bind to the variants and alternative forms of FAF-1 or NDUFV-1, provided that modifications in the variants and alternative forms do not suppress the binding of the binding molecules thereto. Variants of FAF-1 or NDUFV-1 may comprise an amino acid sequence having a homology of at least 95%, preferably at least 97%, more preferably at least 98% and even more preferably at least 99% with the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, respectively. Molecular biology techniques for preparing variants and forms of FAF-1 or NDUFV-1 recombinantly and / or purifying them from a (natural) source are within the skill of the person skilled in the art and are also contemplated herein. .

The present invention also encompasses binding molecules capable of specifically binding to a fragment of FAF-1 or NDUFV-1 or any of the variants or forms described above. The fragment must comprise at least the FAF-1 or NDUFV-1 antigenic determinant recognized by the respective binding molecules.

In one aspect of the invention, the intracellular protein of the host cell can be incorporated into a viral membrane. The incorporation can take place inside the host cell, for example in the cytoplasm, but it can also take place inside or on the surface of one of the organelles of the host cells. Alternatively, incorporation can also take place near, on or on the surface of the host cell, for example when, after infection of the host cell with a virus, the intracellular protein of the host cell is presented on the surface of the host cell. In other words, the host cell protein can be incorporated into the viral membrane of newly formed viruses after infection of a host cell with a virus. Thus, the intracellular protein of the host cell can also be present in or on viruses, virus-like particles (VLP) or other material comprising at least one viral membrane or parts thereof comprising the host cell protein. Accordingly, the binding molecules of the invention can specifically bind to viruses, virus-like particles or other material comprising at least one viral membrane or parts thereof comprising the host cell protein. Viruses comprising the host cell protein may be in activated or inactivated / attenuated form. Methods for inactivating / attenuating viruses are well known in the art and include, but are not limited to, heat inactivation, UV irradiation inactivation and gamma irradiation inactivation. As used herein, "virus-like particle" refers to a viral particle that is assembled to give intact enveloped viral structures. However, a virus-like particle does not contain enough genetic information to replicate. Virus-like particles essentially have a physical appearance similar to the wild-type virus, that is, they are essentially morphologically and antigenically similar to authentic virions. Virus-like particles as used herein may comprise, close to the host cell intracellular protein, wild-type viral amino acid sequences. Virus-like particles can also include functional copies of certain genes. In addition, virus-like particles can also include foreign nucleic acid. Virus-like particles can be viral particles that occur naturally or that do not occur naturally. They may lack functional copies of certain wild-type virus genes, and this may result in the virus-like particle not being able to perform any function that is characteristic of the wild-type virus, such as cell-cell replication and / or movement. . Missing functional copies of the genes can be provided by the genome of a host cell or a plasmid present in the host cell, thereby restoring the function of the wild-type virus in the virus-like particle when it is in the host cell . Preferably, the virus-like particles have the same cellular tropism as the wild-type virus. The virus-like particle may be non-infectious, but is preferably infectious. The term "infectious" as used herein means the ability of the virus-like particle to complete the initial stages of the viral cycle that lead to entry into the cell. In one embodiment of the invention, the virus-like particle is self-assembled. In another embodiment, the virus-like particles are pseudoviruses. The person skilled in the art knows well the pseudoviruses and their production. Preferably, the pseudoviruses as used herein comprise the intracellular protein of the host cell on its surface, for example, incorporated into its viral membrane. Virus-like particles can be produced in suitable host cells such as, among others, mammalian cells. They can be produced intracellularly and / or extracellularly and can be collected, isolated and / or purified as intact virus-like particles by means known to the skilled person such as among other affinity chromatography, gel filtration chromatography, ion exchange chromatography and / or sedimentation in density gradient. A virus-like particle as described herein, particularly one comprising an intracellular host cell protein, for example FAF-1 and / or NDUFV-1, incorporated into its viral membrane, is also part of the present. invention.

In one embodiment the virus-like particle is derived from a enveloped virus, preferably a member of the flavivirus genus such as WNV. In one embodiment, the virus-like particle derived from WNV also comprises WNV protein E. In another embodiment, this virus-like particle further comprises WNV M protein. By a "W and E protein of WNV" is meant a shell and membrane protein, respectively, of any strain of WNV. Preferably, the WN E and M proteins are derived from the same WNV strain.

In a further aspect, the binding molecules of the invention have virus neutralizing activity. Preferably, the binding molecules of the invention have virus neutralizing activity against viruses of more than one genus. Preferably, they neutralize viruses of at least two different genera, more preferably at least three different genera, even more preferably at least four different genera and in particular at least five or more different genera. The viruses may be non-enveloped viruses, but preferably they are enveloped viruses including, but not limited to, Herpesviridae (eg, herpes simplex virus type 1, 2, 6, 7, 8, cytomegalovirus, varicella zoster virus, Epstein-Barr), Poxviridae (for example smallpox virus), Retroviridae (for example HIV1, HIV2, HTLV1, HTLV2), Paramyxoviridae (for example mumps virus, measles virus, respiratory syncytial virus, parainfluenza virus), HepaDNAviridae (for example hepatitis B virus), Orthomyxoviridae (for example influenza A or B virus), Togaviridae (for example rubella), Flaviviridae (for example yellow fever virus, Dengue virus, West Nile virus, hepatitis C, Japanese encephalitis virus, Venezuela encephalitis virus), Rhabodiviridae (for example rabies virus), Arenaviridae (for example Lassa virus, lymphocytic choriomeningitis virus) and Coronaviridae (for example SARS virus, vi rus of the metaneumonia). In addition, they can also neutralize viruses not mentioned above, including, but not limited to, Sindbis virus, poliovirus, human papillomavirus, adeno-associated virus, coxsackie virus, enterovirus, hepatitis A virus, tick-borne encephalitis virus, astrovirus, Ebola virus, Marburg virus, La Crosse virus, California encephalitis virus, Hantaan virus, Crimea-Congo virus, Rift valley fever, Argentine hemorrhagic fever virus, Bolivian hemorrhagic fever virus , Colorado tick fever, JC virus, BK virus, human adenovirus and human parvovirus. Preferably, the binding molecules of the invention have a broad neutralizing activity of the virus and can neutralize different, preferably all, viruses within a genus. Preferably, they neutralize different, preferably all, strains of a given virus.

In a specific aspect the binding molecules of the invention have neutralizing activity of flavivirus, preferably neutralizing activity of West Nile virus. The genus flavivirus is a member of the Flaviviridae family. Flaviviruses are small spherical wrapped positive strand RNA viruses. The flavivirus genus includes more than 80 virus highly related including several human pathogens such as among others the virus, yellow fever virus, Japanese encephalitis virus, St. Louis encephalitis, encephalitis virus, Murray Valley, Tick-borne encephalitis virus and Dengue virus. Other viruses belonging to the genus flavivirus can be found among others in Kuno et al. (1998). Preferably, the binding molecules of the invention can neutralize both variants of the WNV lineage I such as among others strain 385-99 and variants of WND lineage II such as among others strain H-442. In the most preferred embodiment, the binding molecules of the invention can essentially neutralize all currently known variants and strains of WNV. In one embodiment, the binding molecules of the invention also neutralize at least one other flavivirus including, but not limited to, virus, yellow fever virus, Japanese encephalitis virus, St. Louis encephalitis virus, Valley encephalitis Murray, virus tick-borne encephalitis and dengue virus, for example Dengue 1, 2, 3, 4. virus addition to members of the flavivirus genus, can neutralize viral members pestivirus hepaciviruses such as hepatitis C Like flavivirus, the assembly and germination of the hepatitis C virus takes place in the ER.

In a further aspect, the binding molecules of the invention also have rabies virus neutralizing activity. In one aspect of the invention, they can also specifically bind to rabies virus. Rabies virus is a member of the genus Lyssavirus. In total, the genus Lyssavirus includes eleven genotypes: rabies virus (genotype 1), Lagos bat virus (genotype 2), Mokola virus (genotype 3), Duvenhage virus (genotype 4), European bat lyssavirus 1 (genotype 5), European bat lyssavirus 2 (genotype 6), Australian bat lyssavirus (genotype 7), Aravan virus (genotype 8), Khujand virus (genotype 9), Irkut virus (genotype 10) and West Caucasus virus ( genotype 11). In addition to the rabies virus, the binding molecules of the invention can also bind to other genotypes of the genus Lyssavirus. Preferably, the binding molecules can also neutralize other genotypes of the genus Lyssavirus. In addition, the binding molecules of the invention can bind to and / or neutralize viruses, other than Lyssavirus, of the rhabdovirus family. This family includes, but is not limited to, the genera ephemerovirus, lyssavirus, rhabdovirus and vesiculovirus.

In one embodiment, the binding molecules of the invention are human binding molecules. The binding molecules of the invention can be intact immunoglobulin molecules such as polyclonal or monoclonal antibodies or the binding molecules can be antigen binding fragments including, but not limited to, Fab, F (ab '), F (ab' ) 2, Fv, dAb, Fd, complementarity determining region (CDR) fragments, single chain antibodies (scFv), bivalent single chain antibodies, single chain phage antibodies, diabodies, triabodies, tetrabodies and (poly) peptides containing at least one fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the intracellular protein of the host cell or fragment thereof. In a preferred embodiment, human binding molecules that have virus neutralizing activity are administered in the format of IgG1, IgA or IgM.

The binding molecules of the invention can be used in isolated or non-isolated form. In addition, the binding molecules of the invention can be used alone or in a mixture comprising at least one binding molecule (or variant or fragment thereof) of the invention. In other words, the binding molecules can be used in combination, for example, as a pharmaceutical composition comprising at least two or more binding molecules of the invention, variants or fragments thereof. For example, binding molecules that have different but complementary activities in a single therapy can be combined to achieve a desired prophylactic, therapeutic or diagnostic effect, although alternatively, binding molecules that have identical activities in a single therapy can also be combined to achieve an effect. prophylactic, therapeutic or diagnostic desired. The mixture may further comprise at least one other therapeutic agent. Preferably, the therapeutic agent is useful in the prophylaxis and / or treatment of a viral infection (for example WNV infection).

Normally, the binding molecules according to the invention can bind to their binding partners, that is, the intracellular proteins of the host cell or fragments thereof, with an affinity constant (Kd value) that is less than 0.2 * 10-4 M, 1.0 * 10-5 M, 1.0 * 10-6 M, 1.0 * 10-7 M, preferably less than 1.0 * 10-8 M, more preferably less than 1 , 0 * 10-9 M, more preferably less than 1.0 * 10-10 M, even more preferably less than 1.0 * 10-11 M and in particular less than 1.0 * 10-12 M. The constants Affinity may vary for antibody isotypes. For example, affinity binding for an IgM isotype refers to a binding affinity of at least about 1.0 * 10-7 M. Affinity constants can be measured for example using surface plasmon resonance, that is, an optical phenomenon. which allows the analysis of biospecific interactions in real time by detecting alterations in protein concentrations within a biosensor matrix, for example using the BIACORE system (Pharmacia Biosensor AB, Uppsala, Sweden).

The binding molecules according to the invention can bind to the intracellular protein of the host cell or fragment thereof in soluble form such as for example in a sample or can bind to the intracellular protein of the host cell or a fragment thereof bound or coupled to a carrier or substrate, for example, microtiter plates, membranes and beads, etc. The carriers or substrates can be made of glass, plastic (for example, polystyrene), polysaccharides, nylon, nitrocellulose or Teflon, etc. The surface of such supports can be solid or porous and in any convenient way. In addition, the binding molecules can bind to the intracellular protein of the host cell in purified / isolated or non-purified / non-isolated form. Accordingly, the binding molecules can bind to the intracellular protein of the host cell when incorporated into the host cell and / or viral membrane, such as in an infected host cell, a virus or a virus-like particle.

The binding molecules of the invention can neutralize the infectivity of viruses. This can be achieved by targeting specific viral events in which the intracellular proteins of the host cell are involved including, but not limited to, virus binding to cell membranes and cell penetration, loss of the virus envelope, nucleic acid synthesis. of the virus, synthesis of viral proteins and maturation, assembly and release of infectious particles, selection as a target of the infected cell membrane resulting in a signal that leads to non-replication or a lower replication rate of the virus. Neutralization assays for different viruses are known in the art. For example, the neutralizing activity of WNV, yellow fever virus, Japanese encephalitis virus, St. Louis encephalitis virus, Dengue virus and rabies virus can be measured as described herein. Alternative WNV neutralization assays are described in for example Gollins and Porterfield (1986).

In a preferred embodiment, the binding molecules according to the invention comprise at least one CDR3 region, preferably a heavy chain CDR3 region, comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6 . In one embodiment, the binding molecules of the invention may comprise two, three, four, five or even the six CDR regions of the binding molecules of the invention. The heavy chain CDR1 region, the heavy chain CDR2 region, the light chain CDR1 region, the light chain CDR2 region and the light chain CDR3 region of the binding molecules of the invention are shown in Table 9. CDR regions are according to Kabat et al. (1991) as described in Sequences of Proteins of Immunological Interest.

In yet another embodiment, the binding molecules according to the invention comprise a heavy chain comprising the variable heavy chain of the amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20. In a further embodiment, the binding molecules according to the invention comprise a light chain comprising the variable light chain of the amino acid sequence selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 24. Table 8 specifies, next to the heavy chain CDR3 region, the nucleotide and amino acid sequence of the heavy and light chains (their variable regions) of the single chain antibodies.

Even in a further embodiment, the binding molecules of the invention comprise a heavy chain comprising the amino acid sequence selected from the group consisting of SEQ ID NOs 30 and 32, and / or comprise a light chain comprising the selected amino acid sequence of the group consisting of SEQ ID Nos 34 and 36.

In another embodiment, the binding molecules of the invention comprise a heavy chain CDR1 region, heavy chain CDR2 region, heavy chain CDR3 region, light chain CDR1 region, light chain CDR2 region and light chain CDR3 region such as It is shown in SEQ ID Nos 12, 13, 6, 143, 144 and 145, respectively. In yet another embodiment, the binding molecules of the invention comprise a heavy chain comprising the variable heavy chain of the amino acid sequence of SEQ ID NO: 20 and / or comprise a light chain comprising the variable light chain of the sequence of amino acids of SEQ ID NO: 74, ie amino acids 1-113 of SEQ ID NO: 74. Even in a further embodiment, the binding molecules of the invention comprise a heavy chain comprising the amino acid sequence of SEQ ID NO 32, and / or comprise a light chain comprising the amino acid sequence of SEQ ID NO: 74.

Another aspect of the invention includes functional variants of the binding molecules as defined herein. Molecules are considered to be functional variants of a binding molecule according to the invention if the variants can compete for specific binding to the intracellular proteins of the host cell.

or fragment thereof with the original binding molecules. The host cell protein may be incorporated into the viral membrane. In other words, when functional variants can still bind to the intracellular proteins of the host cell or fragment thereof. Furthermore, molecules are considered to be functional variants of a binding molecule according to the invention if they have virus neutralizing activity (for example VNO neutralizing activity). Functional variants include, but are not limited to, derivatives that are substantially similar in primary structural sequence, but which contain, for example, in vitro modifications.

or in vivo, chemical and / or biochemical, which are not found in the original binding molecule. Such modifications include among others acetylation, acylation, covalent binding of a nucleotide or nucleotide derivative, covalent binding of a lipid or lipid derivative, crosslinking, disulfide bond formation, glycosylation, hydroxylation, methylation, oxidation, pegylation, proteolytic processing, phosphorylation .

Alternatively, the functional variants may be binding molecules as defined in the present invention that comprise an amino acid sequence containing substitutions, insertions, deletions or combinations thereof of one or more amino acids compared to the amino acid sequences of the original binding molecules. In addition, functional variants may comprise truncation of the amino acid sequence at any or both the amino terminal and carboxyl terminal. The functional variants according to the invention may have the same or different binding affinities, either higher or lower, compared to the original binding molecule but can still bind to the intracellular proteins of the host cell or fragment thereof. For example, the functional variants according to the invention may have increased or decreased binding affinities for the intracellular proteins of the host cell or fragment thereof compared to the original binding molecules. Preferably, the amino acid sequences of the variable regions are modified, including, but not limited to, framework regions, hypervariable regions, in particular the CDR3 regions. Generally, the light chain and the heavy chain variable regions comprise three hypervariable regions, comprising three CDRs, and more conserved regions, the so-called framework regions (FR). Hypervariable regions comprise amino acid residues of CDR and amino acid residues of hypervariable loops. Functional variants that are intended to be within the scope of the present invention have at least about 50% to about 99%, preferably at least about 60% to about 99%, more preferably at least about 70% to about 99%, even more preferably at least about 80% to about 99%, most preferably at least about 90% to about 99%, in particular at least about 95% at about 99% and in particular at least about 97% to about 99% amino acid sequence homology with the original human binding molecules as defined herein. Computer algorithms such as among other Gap or Bestfit known to one skilled in the art can be used to optimally align amino acid sequences to be compared and to define similar or identical amino acid residues. Functional variants can be obtained by altering the original binding molecules or portions thereof by general molecular biology methods known in the art including, but not limited to, error-prone PCR, oligonucleotide-directed mutagenesis, site-directed mutagenesis and chain exchange. heavy or light Preferably, the functional variants of the invention have virus neutralizing activity. This neutralizing activity can be either identical, or be higher or lower compared to the original binding molecules. In addition, preferably the functional variants have neutralizing activity against more than one genus, preferably against viruses of at least two, three, four, five, six, etc., different genera. Hereinafter, when the expression "binding molecule" (human) is used, it also encompasses functional variants of the binding molecule (human).

Still in a further aspect, the invention includes immunoconjugates, that is to say molecules comprising at least one binding molecule as defined herein and further comprising at least one tag, such as among others a detectable moiety / agent. Also contemplated in the present invention are mixtures of immunoconjugates according to the invention or mixtures of at least one immunoconjugate according to the invention and another molecule, such as a therapeutic agent or another binding or immunoconjugate molecule. In a further embodiment, the immunoconjugates of the invention may comprise more than one label. These labels may be the same or different from each other and may bind / conjugate in a non-covalent manner to the binding molecules. The tag (s) can also be directly bound / conjugated to human binding molecules through covalent bonds. Alternatively, the label (s) can be bound / conjugated to the binding molecules by means of one or more linker compounds. The person skilled in the art is well aware of techniques for conjugating labels to binding molecules.

The immunoconjugate labels of the present invention may be therapeutic agents, but preferably they are detectable moieties / agents. The labels may also be toxins, such as botulinum toxin or functional parts thereof. Immunoconjugates comprising a diagnostic detectable agent can be used to, for example, assess whether a subject has been infected with a virus or monitor the development or evolution of a virus infection as part of a clinical testing procedure to, for example, determine the effectiveness of a given treatment regimen. However, they can also be used for other detection and / or analytical and / or diagnostic purposes such as detection of viruses or virus-like particles comprising the intracellular protein of the host cell or host cells that have been infected and as a consequence of The same is true of the intracellular protein of the host cell on its surface. Detectable moieties / agents include, but are not limited to, enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals and non-radioactive paramagnetic metal ions. The labels used to label the binding molecules for detection and / or analytical and / or diagnostic purposes depend on the specific techniques and / or detection / analysis / diagnostic methods used such as among other immunohistochemical staining of (tissue) samples. , flow cytometry detection, scanning laser cytometry detection, fluorescent immunoassays, enzyme-linked immunosorbent assays (ELISA), radioimmunoassay (RIA), bioassays (e.g. neutralization assays), Western blot applications, etc. Markers suitable for the techniques and / or methods of detection / analysis / diagnosis known in the art are within the skill of the person skilled in the art.

In addition, the human or immunoconjugate binding molecules of the invention can also bind to solid supports, which are particularly useful for in vitro immunoassays or purification of the intracellular protein from the host cell or fragment thereof, host cells presenting the protein. intracellular of the host cell on its surface, or virus or virus-like particles that have the intracellular protein of the host cell incorporated into the viral membrane. Such solid supports can be porous or non-porous, flat or non-flat. The binding molecules of the present invention can be fused to marker sequences, such as a peptide to facilitate purification. Examples include, but are not limited to, the hexa-histidine tag, the hemagglutinin (HA) tag, the myc tag, or the flag tag. Alternatively, an antibody can be conjugated with a second antibody to form a heteroconjugated antibody. In another aspect, the binding molecules of the invention can be conjugated / bound to one or more antigens. Preferably, these antigens are antigens that are recognized by the immune system of a subject to which the antigen binding molecule conjugate is administered. The antigens may be identical, but they may also differ from each other. Conjugation methods for binding antigens and binding molecules are well known in the art and include, but are not limited to, the use of crosslinking agents. The binding molecules of the invention will bind to the intracellular protein of the host cell and the antigens bound to the binding molecules will initiate a potent attack of T cells on the conjugate, which will eventually lead to the destruction of the structure to which the intracellular protein of the host cell or in which it is incorporated is bound.

In addition to being chemically immunoconjugated by conjugation, directly or indirectly, by means of, for example, a linker, immunoconjugates may be produced as fusion proteins comprising the binding molecules of the invention and a suitable label. Fusion proteins can be produced by methods known in the art such as, for example, recombinantly by constructing nucleic acid molecules that comprise nucleotide sequences encoding the binding molecules in frame with nucleotide sequences encoding the tag (s) ( s) suitable and then expressing the nucleic acid molecules.

Another aspect of the present invention is to provide a nucleic acid molecule that encodes at least one binding or immunoconjugate molecule according to the invention. Such nucleic acid molecules can be used as intermediates for cloning purposes, for example in the affinity maturation process as described above. In a preferred embodiment, the nucleic acid molecules are isolated or purified.

The expert will appreciate that functional variants of these nucleic acid molecules are also intended to be a part of the present invention. Functional variants are nucleic acid sequences that can be translated directly, using the conventional genetic code, to provide an identical amino acid sequence to that translated from the original nucleic acid molecules.

Preferably, the nucleic acid molecules encode binding molecules comprising a CDR3 region, preferably a heavy chain CDR3 region, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 5 and SEQ ID NO: 6. In a further embodiment, the nucleic acid molecules encode binding molecules comprising two, three, four, five or even the six CDR regions of the binding molecules of the invention.

In another embodiment, the nucleic acid molecules encode binding molecules that comprise a heavy chain comprising the variable heavy chain of the amino acid sequence selected from the group consisting of SEQ ID NO: 18 and SEQ ID NO: 20. In another embodiment, the nucleic acid molecules encode binding molecules that comprise a light chain comprising the variable light chain of the amino acid sequence selected from the group consisting of SEQ ID NO: 22 and SEQ ID NO: 24.

Even in a further embodiment, the nucleic acid molecules encode binding molecules that comprise a heavy chain that comprises the amino acid sequence selected from the group consisting of SEQ ID Nos. 30 and 32, and / or that comprise a light chain that comprises the amino acid sequence selected from the group consisting of SEQ ID Nos. 34 and 36.

In another embodiment the nucleic acid molecules encode binding molecules that comprise a heavy chain CDR1 region, heavy chain CDR2 region, heavy chain CDR3 region, light chain CDR1 region, light chain CDR2 region and light chain CDR3 region as shown in SEQ ID Nos. 12, 13, 6, 143, 144 and 145, respectively. In yet another embodiment, the nucleic acid molecules encode binding molecules that comprise a heavy chain that comprises the variable heavy chain of the amino acid sequence of SEQ ID NO: 20 and / or that comprise a light chain that comprises the variable light chain of the amino acid sequence of SEQ ID NO: 74, ie amino acids 1-113 of SEQ ID NO: 74. Even in a further embodiment the nucleic acid molecules encode binding molecules that comprise a heavy chain that comprises the amino acid sequence of SEQ ID NO 32, and / or that comprise a light chain that comprises the amino acid sequence of SEQ ID NO: 74.

Another aspect of the invention is to provide vectors, that is, nucleic acid constructs, which comprise a

or more nucleic acid molecules according to the present invention. Vectors can be derived from plasmids such as, among others, F, R1, RP1, Col, pBR322, TOL, Ti, etc .; cosmids; phages such as lambda, lambdoid, M13, Mu, P1, P22, Q, T-even, T-odd, T2, T4, T7, etc .; plant viruses The vectors can be used for cloning and / or for the expression of the binding molecules of the invention and could even be used for gene therapy purposes. Vectors comprising one or more nucleic acid molecules according to the invention operatively linked to one or more nucleic acid molecules that regulate expression are also covered by the present invention. The choice of the vector depends on the recombinant procedures followed and the host used. The introduction of vectors into host cells can be effected by, among other things, calcium phosphate transfection, viral infection, DEAE-dextran-mediated transfection, lipofectamine transfection or electroporation. The vectors can be autonomous replication or they can be replicated together with the chromosome in which they have been integrated. Preferably, the vectors contain one or more selection markers. The choice of markers may depend on the host cells of choice, although this is not critical to the invention since they are well known to those skilled in the art. They include, but are not limited to, kanamycin, neomycin, puromycin, hygromycin, zeocin, thymidine kinase gene from herpes simplex virus (HSV-TK), mouse dihydrofolate reductase (dhfr) gene. Vectors comprising one or more nucleic acid molecules encoding human binding molecules as described above operatively linked to one more nucleic acid molecules encoding proteins or peptides that can be used to isolate human binding molecules are also covered. for the invention These proteins or peptides include, but are not limited to, glutathione-S-transferase, maltose binding protein, metal binding polyhistidine, green fluorescent protein, luciferase and beta-galactosidase.

Guests containing one or more copies of the aforementioned vectors are an additional subject of the present invention. Preferably, the hosts are host cells. Host cells include, but are not limited to, cells of mammalian, plant, insect, fungal or bacterial origin. Bacterial cells include, but are not limited to, Gram-positive bacteria cells such as several species of the Bacillus, Streptomyces and Staphylococcus genera or Gram-negative bacteria cells such as several Escherichia genera, such as E. coli, and Pseudomonas. In the group of fungal cells, yeast cells are preferably used. Expression in yeasts can be achieved using yeast strains such as among others Pichia pastoris, Saccharomyces cerevisiae and Hansenula polimorpha. In addition, insect cells such as Drosophila and Sf9 cells can be used as host cells. In addition to that, the host cells may be plant cells such as among other cells of cultivated plants such as forest plants, or plant cells that provide food and raw materials such as cereal plants, or medicinal plants, or ornamental plant cells, or flower bulb culture cells. Transformed (transgenic) plant cells or plants are produced by known methods, for example, Agrobacterium-mediated gene transfer, leaf disc transformation, protoplast transformation by polyethylene glycol-induced DNA transfer, electroporation, sonication, microinjection or ballistic gene transfer. Additionally, a suitable expression system may be a baculovirus system. Expression systems using mammalian cells such as Chinese hamster ovary (CHO) cells, COS cells, BHK cells or Bowes melanoma cells in the present invention are preferred. Mammalian cells provide proteins expressed with post-translational modifications that are most similar to natural molecules of mammalian origin. Since the present invention is concerned with molecules that are to be administered to humans, a completely human expression system would be particularly preferred. Therefore, even more preferably, the host cells are human cells. Examples of human cells are among others HeLa, 911, AT1080, A549, 293 and HEK293T cells. In preferred embodiments, the human producing cells comprise at least a functional part of a nucleic acid sequence encoding an E1 region of adenovirus in format that can be expressed. Even in more preferred embodiments, said host cells are derived from a human retina and are immortalized with nucleic acids comprising adenoviral E1 sequences, such as 911 cells or the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury , Wiltshire SP4 OJG, Great Britain on February 29, 1996 under the number 96022940 and marketed under the trademark PER.C6® (PER.C6 is a registered trademark of Crucell Holland BV). For the purposes of this application, "PER.C6" refers to cells deposited with the number 96022940 or ancestors, passes forward or backward as well as descendants of ancestors of deposited cells, yes as derived from any of the above. The production of recombinant proteins in host cells can be carried out according to methods well known in the art. The use of cells marketed under the trademark PER.C6® as a production platform for proteins of interest has been described in WO 00/63403.

A method of producing a binding molecule or an immunoconjugate according to the invention is an additional part of the invention. The method comprises the steps of a) culturing a host according to the invention under conditions that lead to the expression of the binding or immunoconjugate molecule, and b) optionally recovering the expressed binding or immunoconjugate molecule. The expressed binding or immunoconjugate molecules can be recovered from the free cell extract, but preferably they are recovered from the culture medium. The above method of production can also be used to prepare functional variants of the binding and immunoconjugate molecules of the present invention. The person skilled in the art knows well methods to recover proteins, such as binding molecules, from free cell extracts or culture medium. Binding or immunoconjugate molecules as can be obtained by the method described above are also a part of the present invention.

Alternatively, in addition to host expression, such as host cells, the binding and immunoconjugate molecules of the invention can be synthetically produced by conventional peptide synthesizers or in cell-free translation systems using RNA nucleic acid derived from DNA molecules. according to the invention. Binding and immunoconjugate molecules as can be obtained by synthetic production methods or cell-free translation systems described above are also a part of the present invention.

In yet another embodiment, binding molecules of the present invention can also be produced in transgenic, non-human mammals such as among other rabbits, goats or cows, and are secreted, for example, in their milk.

In yet another alternative embodiment, binding molecules according to the present invention can be generated, preferably human binding molecules that specifically bind to the intracellular protein of the host cell or fragment thereof, by transgenic non-human mammals, such as for example mice. or transgenic rabbits, which express human immunoglobulin genes. Preferably, transgenic non-human mammals have a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or a part of the human binding molecules as described above. Transgenic non-human mammals can be immunized with a purified or enriched preparation of the intracellular protein of the host cell or fragment thereof. The protocols for immunizing non-human mammals are well established in the art. See Using Antibodies: A Laboratory Manual, edited by: E. Harlow, D. Lane (1998), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York and Current Protocols in Immunology, edited by: J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W. Strober (2001), John Wiley & Sons Inc., New York. Immunization protocols often include multiple immunizations, either with or without adjuvants such as Freund's complete adjuvant and incomplete Freund's adjuvant, but may also include immunizations with naked DNA. In another embodiment, human binding molecules are produced by B cells or plasma cells derived from transgenic animals. In yet another embodiment, human binding molecules are produced by hybridomas, which are prepared by fusion of B cells obtained from the transgenic non-human mammals described above with immortalized cells. B cells, plasma cells and hybridomas as can be obtained from the transgenic non-human mammals described above and human binding molecules as can be obtained from the transgenic non-human mammals described above, B cells, plasma cells and hybridomas are also a part of the present invention.

The intracellular proteins of the FAF-1 and / or NDUFV-1 host cell can also be produced and purified according to the methods and with the vectors and host cells as described above. Alternatively, they can also be produced and / or purified from a "native" host cell, for example a host cell that normally expresses the intracellular protein of the host cell. Expression in a "native" host cell can be increased by substituting the natural protein promoter and / or by adding, substituting and / or mutating elements of protein expression enhancement. The person skilled in the art knows the elements and methods to increase the expression.

In a further aspect, the invention provides a method of identifying binding molecules according to the invention such as human binding molecules, for example monoclonal antibodies or fragments thereof, that specifically bind to a host cell protein or molecules of nucleic acid encoding such binding molecules and comprises the steps of a) contacting a collection of binding molecules on the surface of replicable genetic packages with a virus, virus-like particle or fragment thereof under conditions that lead to binding , b) select at least once to detect a replicable genetic package that binds to the virus, virus-like particle or fragment thereof, and c) separate and recover the replicable genetic package that binds to the virus, virus-like particle or fragment thereof from replicable genetic packages that do not bind. The host cell protein can be an intracellular host cell protein.

A replicable genetic package as used herein may be prokaryotic or eukaryotic and includes cells, spores, yeasts, bacteria, viruses, (bacterium) phages, ribosomes and polysomes. A preferred replicable genetic package is a phage. Binding molecules, such as single chain Fv, are presented in the replicable genetic package, that is, bound to a group or molecule located on an outer surface of the replicable genetic package. The replicable genetic package is a unit that can be examined that comprises a binding molecule to be examined attached to a nucleic acid molecule encoding the binding molecule. The nucleic acid molecule must be replicable either in vivo (for example, as a vector) or in vitro (for example, by PCR, transcription and translation). In vivo replication can be autonomous (as for a cell), with the help of host factors (such as for a virus) or with the help of both the host and an auxiliary virus (as for a phagemid). Replicable genetic packages are formed that present a collection of binding molecules by introducing nucleic acid molecules that encode exogenous binding molecules that are to be presented in the genomes of the replicable genetic packages to form fusion proteins with endogenous proteins that are normally expressed from of the external surface of the replicable genetic packages. The expression of fusion proteins, transport to the external surface and assembly result in exogenous binding molecules from the external surface of replicable genetic packages.

In one embodiment, the selection step in the method according to the present invention is performed in the presence of virus that is inactivated. Virus inactivation can be performed by viral inactivation methods well known to those skilled in the art. The person skilled in the art knows well methods to test whether a virus is still infective or is partially or completely inactivated. Viruses used in the above method may not be isolated, for example, present in the serum and / or blood of an infected individual. The virus used can also be isolated either before or after inactivation. Purification can be carried out by means of well-known purification methods suitable for viruses such as, for example, centrifugation through a glycerol mattress. The virus contains the (intracellular) protein of the host cell incorporated into its viral membrane.

Alternatively, the selection step can be performed in the presence of a virus fragment such as a fragment comprising the viral membrane or virus-like particles that have the (intracellular) protein of the host cell incorporated into their membranes. The inactivated virus, virus-like particle or fragment thereof can be immobilized in a suitable material before use. In a specific embodiment, the selection can be made in different materials comprising the (intracellular) proteins of the host cell. For example, the first round of selection can be performed on virus (inactivated), while the second round can be performed on particles similar to WNV. Alternatively, the first round of selection can be performed on host cells that present the (intracellular) protein of the host cell on its surface, while the second round of selection can be performed on virus (inactivated). Of course, other combinations are also suitable. For example, the first and second round of selection can be made on identical material such as VNO-like particles. Different materials comprising the (intracellular) protein of the host cell can also be used during a screening / screening step.

Still in a further aspect, the invention provides a method of obtaining a binding molecule that specifically binds to a host cell protein or a nucleic acid molecule that encodes such a binding molecule that specifically binds to a host cell protein, the method comprising the steps of a) performing the above-described method of identification of binding molecules, and b) isolating the binding molecule and / or the nucleic acid molecule encoding the molecule from the replicable genetic package recovered of Union. The collection of surface binding molecules of replicable genetic packages can be a collection of scFv or Fab. Once a new scFv or Fab has been established or identified with the above-mentioned method of identifying binding molecules or nucleic acid molecules that encode binding molecules, the DNA encoding scFv or Fab can be isolated from bacteria or phages and combined with conventional molecular biology techniques to prepare constructs encoding bivalent scFv or complete human immunoglobulins of a desired specificity (eg IgG, IgA or IgM). These constructs can be transfected into suitable cell lines and whole human monoclonal antibodies can be produced (see Huls et al., 1999; Boel et al., 2000).

As mentioned earlier, the preferred replicable genetic package is a phage. Phage display methods for identifying and obtaining (human) binding molecules, for example monoclonal antibodies, are now well established methods known to those skilled in the art. They are described for example in US Patent 5,696,108; Burton and Barbas, 1994; de Kruif et al., 1995b; and Phage Display: A Laboratory Manual. Edited by: CF Barbas, DR Burton, JK Scott and GJ Silverman (2001), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. For the construction of phage display libraries, gene collections of heavy and light chain variable regions of human monoclonal antibodies are expressed on the surface of bacteriophages, preferably filamentous bacteriophages, particles, for example single chain Fv (scFv) or in Fab format (see de Kruif et al., 1995b). Large phage libraries that express antibody fragments normally contain more than 1.0 * 109 antibody specificities and can be assembled from the V regions of immunoglobulin expressed in B lymphocytes of immunized individuals

or not immunized. In a specific embodiment of the invention, the phage library of binding molecules, preferably the scFv phage library, is prepared from RNA isolated from cells obtained from a subject who has been vaccinated or exposed to a virus. RNA can be isolated from among other bone marrow or peripheral blood, preferably peripheral blood lymphocytes. The subject may be an animal vaccinated or exposed to a virus, but is preferably a human subject who has been vaccinated or has been exposed to a virus. Preferably, the human subject has recovered from the viral infection. In one embodiment of the invention, the virus is a flavivirus such as WNV.

Alternatively, phage display libraries can be constructed from variable regions of immunoglobulin that have been partially assembled in vitro to introduce additional antibody diversity into the library (semi-synthetic libraries). For example, variable regions assembled in vitro contain stretches of randomized or partially randomized DNA, synthetically produced in those regions of the molecules that are important for antibody specificity, for example, the CDR regions. Antibodies in specific phage of the host cell protein can be selected from the library for example by immobilizing target antigens such as viruses, virus-like particles, host cells or host cell proteins, for example, intracellular host cell proteins , in a solid phase and subsequently exposing the target antigens to a phage library to allow phage binding to express specific antibody fragments for the antigen (s) bound to the solid phase. Unbound phages are removed by washing and bound phages are eluted from the solid phase for infection of E. coli bacteria and subsequent spread. Usually multiple rounds of selection and propagation are required to sufficiently enrich the phages that specifically bind to the target antigen (s). If desired, before exposing the phage library to target antigens, the phage library can first be removed by exposing the phage library to non-target antigens bound to a solid phase. Phages can also be selected to determine their binding to complex antigens such as complex mixtures of proteins or (poly) peptides of the host cell, host (expression) cells expressing one or more proteins or (poly) peptides of the host cell, virus-like particles comprising host cell proteins, or complete inactivated viruses. Antibodies in antigen specific phages can be selected from the library by incubating a solid phase with virus-like particles bound thereon with the phage antibody library to allow for example that the scFv or Fab part of the virus binds to the virus-like particle. Of course, in an alternative embodiment, selections and subtractions in solution can also be made. After incubation and several washes to remove unbound and weakly bound phages, phages that have joined their scFv or Fab part to the virus-like particle are eluted and used to infect E. coli to allow amplification of the new specificity Generally, one or more selection rounds are required to separate the phages of interest from the large excess of phages that do not bind. Alternatively, host cell proteins can be expressed in expression host cells, for example PER.C6® cells, and these cells can be used for the selection of antibodies in specific phage for proteins or (poly) peptides. A phage display method using host (expression) cells can be extended and improved by subtracting non-relevant junctions during the examination by adding an excess of host cells comprising non-target molecules or non-target molecules that are similar, but not identical, to the target, and thus greatly enhances the possibility of finding relevant binding molecules. Of course, the subtraction can also be performed before or after the examination with material comprising the host cell protein or fragment thereof. In one embodiment, the selection can take place in host cells that have been infected with a virus or a virus-like particle. These cells present the host cell protein normally located intracellularly after infection on its surface. Subtraction can be performed before, during or after selection and can be performed with host cells that have not been infected and therefore comprise the intracellular protein of the host cell at its original cellular location, that is, within the host cell. The subtraction process is called the Mabstract® process (Mabstract® is a registered trademark of Crucell Holland B.V., see also US Patent No. 6,265,150).

In yet another aspect, the invention provides a method of obtaining a binding molecule that has potentially neutralizing activity against a virus and that can specifically bind to a host cell protein, the method comprising the steps of a) performing the method of obtaining a binding molecule that specifically binds to the host cell protein or a nucleic acid molecule that encodes such a binding molecule that specifically binds to the host cell protein as described above, and b ) Check if the isolated binding molecule has neutralizing activity against a virus. Preferably, the host cell protein is an intracellular host cell protein. In one embodiment, the methods described above are performed with a flavivirus such as WNV. In a preferred embodiment of the method, it is verified whether the isolated binding molecule has neutralizing activity against viruses of at least two different genera. More preferably, it is verified whether the binding molecules are widely neutralizing binding molecules and can neutralize many different genera. Assays to verify whether a binding molecule has neutralizing activity for a specific virus are well known in the art.

In a further aspect the invention relates to a specific binding molecule of a host cell protein that can be obtained by the methods described above. Preferably, the binding molecule has neutralizing activity against at least one virus.

Still in a further aspect, the invention provides compositions comprising at least one binding molecule, at least one functional variant thereof, at least one immunoconjugate according to the invention or a combination thereof. The invention also relates to compositions comprising at least two binding molecules, preferably human binding molecules, at least one of which may be a binding molecule of the invention. Preferably, both binding molecules have virus neutralizing activity. The activity can be against the same virus but also against different viruses. In one embodiment, the compositions comprising two or more binding molecules that have virus neutralizing activity exhibit synergistic virus neutralizing activity. In one embodiment, the binding molecules that act synergistically in neutralizing a virus can also neutralize other viruses synergistically. As used herein, the term "synergistic" means that the combined effect of binding molecules when used in combination is greater than their additive effects when used individually. One way to calculate synergy is through the combination index. The concept of combination index (IC) has been described by Chou and Talalay, 1984. In an alternative embodiment, the compositions comprise two or more binding molecules having different modes of action. In one embodiment, the binding molecules of the invention have flavivirus neutralizing activity, for example WNV. In addition to that, the compositions may comprise among other stabilization molecules, such as albumin or polyethylene glycol, or salts. Preferably, the salts used are salts that retain the desired biological activity of the binding molecules and do not confer any unwanted toxicological effect. If necessary, the human binding molecules of the invention can be coated in or on a material to protect them from the action of acids or other natural or unnatural conditions that can inactivate the binding molecules.

Still in a further aspect, the invention provides compositions comprising at least one nucleic acid molecule as defined in the present invention. The compositions may comprise aqueous solutions such as aqueous solutions containing salts (for example, NaCl or salts as described above), detergents (for example, SDS) and / or other suitable components.

Further, the present invention relates to pharmaceutical compositions comprising at least one binding molecule (or functional fragment or variant thereof), at least one immunoconjugate according to the invention, at least one composition according to the invention, or combinations thereof. . The pharmaceutical composition of the invention further comprises at least one pharmaceutically acceptable excipient. A pharmaceutical composition according to the invention may further comprise another therapeutic, prophylactic and / or diagnostic agent. Preferably, the pharmaceutical composition comprises at least one other prophylactic and / or therapeutic agent. Preferably, said additional therapeutic and / or prophylactic agents are agents capable of preventing and / or treating an infection and / or a condition resulting from a virus, for example a flavivirus such as WNV. Therapeutic and / or prophylactic agents include, but are not limited to, antiviral agents. Such agents may be binding molecules, small molecules, organic or inorganic compounds, enzymes, polynucleotide sequences, etc. Agents capable of preventing and / or treating a viral infection and / or a condition resulting from a virus that are in the experimental phase could also be used as other therapeutic and / or prophylactic agents useful in the present invention.

The binding molecules or pharmaceutical compositions of the invention can be tested in suitable animal model systems before use in humans. Such animal model systems include, but are not limited to, a murine model, a hamster model and a geese model system.

Normally, pharmaceutical compositions should be sterile and stable under the conditions of manufacture and storage. The binding molecules, immunoconjugates, nucleic acid molecules or compositions of the present invention may be in powder form for reconstitution in the pharmaceutically appropriate excipient before or at the time of administration. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze drying (lyophilization) which produce a powder of the active ingredient plus any additional desired component from a solution previously sterilized by filtration thereof.

Alternatively, the binding molecules, immunoconjugates, nucleic acid molecules or compositions of the present invention may be in solution and the appropriate pharmaceutically acceptable excipient may be added and / or mixed before or at the time of administration to provide an injectable dosage form. unitary. Preferably, the pharmaceutically acceptable excipient used in the present invention is suitable for a high concentration of drug, can maintain proper fluidity and, if necessary, can delay absorption.

The choice of the optimal route of administration of the pharmaceutical compositions will be influenced by several factors including the physicochemical properties of the active molecules within the compositions, the urgency of the clinical situation and the relationship of the plasma concentrations of the active molecules with the desired therapeutic effect. For example, if necessary, the binding molecules of the invention can be prepared with carriers that will protect them from rapid release, such as a controlled release formulation, including implants, transdermal patches and microencapsulated delivery systems. They can be used among other biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, poly (glycolic acid), collagen, polyorthoesters and poly (lactic acid). In addition, it may be necessary to coat the binding molecules with, or jointly administering the binding molecules with, a material or compound that prevents inactivation of human binding molecules. For example, binding molecules can be administered to a subject in an appropriate carrier, for example, liposomes or a diluent.

The routes of administration can be divided into two main categories, oral and parenteral administration. The preferred route of administration is intravenous.

Oral pharmaceutical forms, among others, may be formulated as tablets, troches, lozenges, aqueous or oily suspensions, granules or dispersible powders, emulsions, hard capsules, soft gelatin capsules, syrups or elixirs, pills, sugar-coated tablets, liquids, gels or suspensions. These formulations may contain pharmaceutically excipients including, but not limited to, inert diluents, granulating and disintegrating agents, binding agents, lubricating agents, preservatives, colorants, flavoring or sweetening agents, vegetable or mineral oils, wetting agents and thickening agents.

The pharmaceutical compositions of the present invention can also be formulated for parenteral administration. Formulations for parenteral administration may be among others in the form of sterile non-aqueous isotonic non-toxic solutions or suspensions for injection or infusion. The solutions or suspensions may comprise agents that are not toxic to the receptors at the dosages and concentrations employed such as 1,3-butanediol, Ringer's solution, Hank's solution, isotonic sodium chloride solution, oils, fatty acids, anesthetic agents local, preservatives, buffers, viscosity or solubility increasing agents, water soluble antioxidants, oil soluble antioxidants and metal chelating agents.

In a further aspect, the binding molecules (functional fragments and variants thereof), immunoconjugates, compositions, or pharmaceutical compositions of the invention can be used as a medicament. Thus, a method of treatment and / or prevention of a viral infection using the binding molecules, immunoconjugates, compositions, or pharmaceutical compositions of the invention is another part of the present invention. The molecules mentioned above can be used among others in the diagnosis, prophylaxis, treatment or combination thereof, of one or more conditions resulting from a virus or viral infection. Preferably, they can be widely applied to prevent, detect and / or treat various viral infections caused by viruses of different genera and / or strains, including, but not limited to, Herpesviridae (for example herpes simplex virus type 1, 2, 6, 7 , 8, cytomegalovirus, varicella zoster virus, Epstein-Barr virus), Poxviridae (for example smallpox virus), Retroviridae (for example HIV1, HIV2, HTLV1, HTLV2), Paramyxoviridae (for example mumps virus, measles virus, respiratory syncytial virus, parainfluenza virus), HepaDNAviridae (for example hepatitis B virus), Orthomyxoviridae (for example influenza A or B virus), Togaviridae (for example rubella), Flaviviridae (for example yellow fever virus , Dengue virus, West Nile virus, hepatitis C virus, Japanese encephalitis virus, Venezuela encephalitis virus), Rhabodiviridae (for example rabies virus), Arenaviridae (for example Lassa virus, virus of lymphocytic choriomeningitis) and Coronaviridae (for example SARS virus, metaneumonia virus). In addition, they can also be applied to prevent, detect and / or treat various viral infections caused by viruses not mentioned above, including, but not limited to, Sindbis virus, poliovirus, human papillomavirus, adeno-associated virus, coxsackie virus, enterovirus, virus of hepatitis A, tick-borne encephalitis virus, astrovirus, Ebola virus, Marburg virus, La Crosse virus, California encephalitis virus, Hantaan virus, Crimea-Congo virus, Rift valley fever, Argentine hemorrhagic fever virus, Bolivian hemorrhagic fever virus, Colorado tick fever, JC virus, BK virus, human adenovirus and human parvovirus. In other words, the binding molecules of the invention are broad spectrum antiviral binding molecules. They are suitable for the treatment of untreated patients who suffer from a condition that results from a virus and patients who have been treated or are dealing with a condition that results from a virus or a viral infection. They protect against further infection by a virus for approximately 1 month and / or will delay the onset or evolution of symptoms associated with a virus. They can also be used in post-exposure prophylaxis, when there is a possibility of infection but symptoms are absent. They can also be used as prophylaxis in the transplantation of infected organs or in other populations of patients at high risk of exposure and evolution to the disease due, among others, to age or immune status. In a specific embodiment, the compounds and compositions are used to treat and / or prevent a flavivirus infection, for example WNV and / or a rabies virus infection.

The molecules or compositions mentioned above may be used in conjunction with other molecules useful in diagnosis, prophylaxis and / or treatment. They can be used in vitro, ex vivo or in vivo. For example, the binding molecules, immunoconjugates or pharmaceutical compositions of the invention can be co-administered with a vaccine against the intracellular proteins of the host cell. Alternatively, the vaccine can also be administered before or after administration of the molecules of the invention. Instead of a vaccine, other antiviral agents may also be employed in conjunction with the binding molecules of the present invention. In one aspect, the invention also relates to the use of an intracellular protein from the host cell, preferably FAF-1 and / or NDUFV-1, as a vaccine suitable for preventing and / or treating a viral infection, for example an infection by flavivirus such as WNV infection.

The molecules are normally formulated in the pharmaceutical compositions and compositions of the invention in a therapeutic or diagnostic effective amount. Alternatively, they can be formulated and administered separately. For example, the other molecules such as antiviral compounds can be applied systemically, while the binding molecules of the invention can be applied intrathecally, intraventricularly or intradermally.

Dosage regimens can be adjusted to provide the optimal desired response (eg, a therapeutic response). A suitable dosage range may be for example 0.1-100 mg / kg body weight, preferably 0.5-15 mg / kg body weight. In addition, for example, a single bolus may be administered, several divided doses may be administered over time or the dose may be reduced or increased proportionally as indicated by the requirements of the therapeutic situation. The molecules and compositions according to the present invention are preferably sterile. Methods for making these molecules and compositions sterile are well known in the art. The other molecules useful in diagnosis, prophylaxis and / or treatment can be administered in a similar dosage regimen as proposed for the binding molecules of the invention. If the other molecules are administered separately, they can be administered to a patient before (for example, 2 minutes, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 7 days, 2 weeks, 4 weeks or 6 weeks before ), concomitantly with, or subsequently to (for example, 2 minutes, 5 minutes, 10 minutes, 15 minutes, 30 minutes, 45 minutes, 60 minutes, 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 7 days, 2 weeks, 4 weeks or 6 weeks after) the administration of one or more of the human binding molecules or pharmaceutical compositions of the invention. The exact dosage regimen is set during clinical trials in human patients.

Human binding molecules and pharmaceutical compositions comprising human binding molecules are particularly useful, and are often preferred, when they are to be administered to humans as therapeutic agents in vivo, since the immune response of the receptor against the administered antibody will often be substantially lower than that caused by the administration of a humanized, chimeric or murine monoclonal binding molecule.

In another aspect, the invention relates to the use of (human) binding molecules (functional fragments and variants thereof), immunoconjugates, nucleic acid molecules, pharmaceutical compositions or compositions according to the invention in the preparation of a medicament for the diagnosis, prophylaxis, treatment or a combination thereof, of a viral infection and / or a condition resulting therefrom.

In addition to that, kits comprising at least one binding molecule (functional fragments and variants thereof), at least one immunoconjugate, at least one nucleic acid molecule, at least one composition, at least one pharmaceutical composition, at least one vector, at least one host according to the invention or a combination thereof are also a part of the present invention. Optionally, the components described above of the kits of the invention are packaged in suitable containers and labeled for diagnosis, prophylaxis and / or treatment of the indicated conditions. The aforementioned components may be stored in unit or multi-dose containers as an aqueous solution, preferably sterile or as a lyophilized formulation, preferably sterile for reconstitution. The containers may be formed of a variety of materials such as glass or plastic and may have a sterile access hole (for example, the container may be an intravenous dissolution bag or a vial having a plug pierceable by a hypodermic injection needle ). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer. It may also include other desirable materials from a commercial and user point of view, including other buffers, diluents, filters, needles, syringes, culture medium for one

or more of suitable hosts and possibly even at least one other therapeutic, prophylactic or diagnostic agent. Associated with the kits may include instructions usually included in commercial packages of therapeutic, prophylactic or diagnostic products, which contain information on, for example, indications, use, dosage, manufacture, administration, contraindications and / or related warnings. to the use of such therapeutic, prophylactic or diagnostic products.

The invention further relates to a method of detecting an intracellular protein of the host cell such as FAF-1 and / or NDUFV-1 in a sample, the method comprising the steps of a) contacting a sample with a diagnostic amount effective of a binding molecule (functional fragments and variants thereof) or an immunoconjugate according to the invention, and b) determining whether the binding or immunoconjugate molecule specifically binds to a sample molecule. The sample may be a biological sample including, but not limited to blood, serum, urine, tissue or other biological material of (possibly) infected subjects, or a non-biological sample such as water, beverages, etc. The (possibly) infected subjects may be human subjects, but also animals that are suspected of carrying a virus could be tested for the presence of viruses using the human or immunoconjugate binding molecules of the invention. By detecting the intracellular proteins of the host cell, a viral infection (infected host cell and / or virus particle) can be detected. First, the sample can be manipulated to make it more suitable for the detection method. Manipulation means among others treating the sample that is suspected to contain and / or that contains a virus in such a way that the virus is broken down into antigenic components such as proteins, (poly) peptides or other antigenic fragments. Preferably, the human or immunoconjugate binding molecules of the invention are contacted with the sample under conditions that allow the formation of an immune complex between human binding molecules and the intracellular protein of the host cell or antigenic components thereof. They may be present in the sample. The formation of an immune complex, if any, indicating the presence of a virus in the sample, is then detected and measured by appropriate means. Such methods include, among others, homogeneous and heterogeneous binding immunoassays, such as radioimmunoassay (RIA), ELISA, immunofluorescence, immunohistochemistry, FACS, BIACORE, and Western blot analysis.

Preferred assay techniques, especially for large-scale clinical examination of serum and blood of patients and blood products are ELISA and Western blotting techniques. ELISA tests are particularly preferred. For use as reagents in these assays, the binding or immunoconjugate molecules of the invention conveniently bind to the inner surface of microtiter wells. The binding or immunoconjugate molecules of the invention can be attached directly to the plate well. However, maximum binding of the binding or immunoconjugate molecules of the invention to the wells could be achieved by treating the wells with polylysine before the addition of the binding or immunoconjugate molecules of the invention. In addition, the binding or immunoconjugate molecules of the invention can be covalently linked by known means to the wells. Generally, binding or immunoconjugate molecules are used between 0.01 and 100 µg / ml for coating, although higher as well as lower amounts can also be used. The samples are then added to the wells coated with the binding or immunoconjugate molecules of the invention.

In addition, the binding molecules of the invention can be used to identify epitopes of the intracellular proteins of the host cell such as FAF-1 and / or NDUFV-1. The epitopes can be linear, but also structural and / or conformational. In one embodiment, the binding of binding molecules of the invention to a series of overlapping peptides, such as 15-mer peptides, of the host cell protein can be analyzed by means of PEPSCAN analysis (see among others WO 84 / 03564, WO 93/09872, Slootstra et al., 1996). The binding of the molecules to each peptide can be tested in an enzyme-linked immunoassay based on PEPSCAN (ELISA). In another embodiment, a random peptide library comprising peptides from host cell proteins can be examined to detect peptides capable of binding to the binding molecules of the invention. In the previous tests, the use of neutralizing binding molecules can identify one or more neutralizing epitopes. The peptides / epitopes found can be used as vaccines and for the diagnosis of a viral infection.

In a further aspect, the invention provides a method of examining a binding molecule (or a functional fragment or variant thereof) to detect specific binding to the same epitope of the intracellular protein of the host cell, such as FAF-1 and / or NDUFV-1, such as the epitope to which a binding molecule of the invention binds, the method comprising the steps of a) contacting a binding molecule to be examined, a binding molecule of the invention and material comprising the intracellular protein of the host cell or antigen fragment thereof, b) measuring whether the binding molecule to be examined can compete for specific binding to the intracellular protein of the host cell comprising antigenic material or fragment of the same with the binding molecule of the invention. The material comprising the intracellular protein of the host cell or antigen fragment thereof can be a host cell that has the protein on its surface, a virus that has the protein incorporated into its viral membrane, a virus-like particle that has the protein incorporated into the viral membrane or the protein itself in purified or unpurified form. In a further step it can be determined whether the binding molecules examined are capable of competing for specific binding to the intracellular protein of the host cell or antigen fragment thereof have neutralizing activity. A binding molecule that can compete for specific binding to the intracellular protein of the host cell or an antigen fragment thereof with the binding molecule of the invention is another part of the present invention. In the test method described above, "specific binding to the same epitope" also contemplates specific binding to substantially or essentially the same epitope as the epitope to which a binding molecule of the invention binds. The ability to block, or compete with, the binding of the binding molecules of the invention to the intracellular protein of the host cell normally indicates that a binding molecule to be examined binds to an epitope or binding site in the protein. The intracellular host cell that structurally overlaps with the intracellular protein binding site of the host cell that immunospecifically recognize the binding molecules of the invention. Alternatively, this may indicate that a binding molecule to be examined binds to an epitope or binding site that is sufficiently close to the binding site recognized immunospecifically by the binding molecules of the invention to sterically or sterically inhibit otherwise, the binding of the binding molecules of the invention to the intracellular protein of the host cell.

In general, competitive binding is measured by means of an assay, in which an antigen composition, that is, a composition comprising the intracellular protein of the host cell or antigenic fragments thereof, is mixed with binding molecules of reference, ie the binding molecules of the invention, and binding molecules to be examined. Usually, the binding molecules to be examined are presented in excess. ELISA-based protocols and Western blots are suitable for use in such simple competition studies. In certain embodiments, the reference binding molecules can be pre-mixed with varying amounts of the binding molecules to be examined (e.g., 1:10, 1:20, 1:30, 1:40, 1:50, 1 : 60, 1:70, 1:80, 1:90 or 1: 100) for a period of time before its application to the antigen composition. In other embodiments, the reference binding molecules and varying amounts of binding molecules to be examined can simply be mixed during exposure to the antigen composition. In yet another embodiment, the reference binding molecules or binding molecules to be examined are contacted before the binding molecules to be examined or the reference binding molecules, respectively, are contacted with the intracellular protein of the host cell or antigen fragment thereof. In any case, using secondary isotype or species antibodies, only bound reference binding molecules can be detected, whose binding will be reduced by the presence of a binding molecule to be examined that substantially recognizes the same epitope. When conducting a competition study of binding molecules between a reference binding molecule and any binding molecule to be examined (regardless of species and isotype), the reference binding molecule can be labeled first with a marker detectable, such as, for example, biotin, an enzymatic marker, a radioactive marker or other marker to allow subsequent identification. In these cases, the labeled reference binding molecules would be previously mixed or incubated with the binding molecules to be examined for various reasons (e.g., 1:10, 1:20, 1:30, 1:40, 1 : 50, 1:60, 1:70, 1:80, 1:90 or 1: 100) and (optionally after a suitable period of time) the reactivity of the labeled reference binding molecules is then tested and compare this to a control value in which no potentially competing binding molecule was included in the incubation. Again, the assay can be any one of a range of immunological assays based on antibody hybridization, and reference binding molecules would be detected by detecting their own label, for example, using streptavidin in the case of biotinylated reference binding molecules or using a chromogenic substrate in conjunction with an enzyme marker (3,3,5,5'-tetramethylbenzidine (TMB) substrate with peroxidase enzyme) or simply by detecting a radioactive marker. A binding molecule to be examined that binds to the same epitope that the reference binding molecule can effectively compete for binding and therefore significantly reduce the binding of the reference binding molecule, as verified by a reduction in the marker attached. The reactivity of the reference binding molecule (labeled) in the absence of a completely irrelevant binding molecule would be the high control value. The low control value would be obtained by incubating the labeled reference binding molecule with unlabeled reference binding molecules of exactly the same type, when competition would occur and the binding of the labeled reference binding molecule would be reduced. In a test trial, a significant reduction in the reactivity of the labeled reference binding molecule in the presence of a binding molecule to be examined is indicative of a binding molecule that recognizes the same epitope, that is, one that " cross-react ”with the labeled reference binding molecule.

Binding molecules identified by these competition assays ("competitive binding molecules" or "cross-reacting binding molecules") include, but are not limited to, antibodies, antibody fragments and other binding agents that bind. to an epitope or binding site to which the reference binding molecule binds, that is, a binding molecule of the invention, as well as antibodies, antibody fragments and other binding agents that bind to an epitope or site of binding. binding in a manner sufficiently proximal to an epitope to which the reference binding molecule binds so that competitive binding occurs between the binding molecules to be examined and the reference binding molecule. Preferably, the competitive binding molecules of the invention, when present in excess, will inhibit the specific binding of a reference binding molecule to a selected target species by at least 10%, preferably at least 25%, more preferably at least 50% and most preferably at least 75% -90% or even more. The identification of one or more competitive binding molecules that bind to approximately, substantially, essentially or the same epitope as the binding molecules of the invention is a simple technical matter. Since the identification of competitive binding molecules is determined in comparison to a reference binding molecule, that is, a binding molecule of the invention, it will be understood that it is not really required in any way to determine the epitope at which the molecule Reference binding and the competitive binding molecule are joined in order to identify a competitive binding molecule that binds to the same or substantially the same epitope as the reference binding molecule.

In a further aspect, the invention relates to new leader peptide sequences (also called signal sequences or pre-sequences) and nucleotide sequences encoding the leader peptides. The leader peptides are useful in methods for producing recombinant proteins, for example immunoglobulin molecules, from a host cell. The entry of almost all polypeptides secreted into the secretory pathway, both in prokaryotes and eukaryotes, is directed by specific leader peptides at the N-terminal end of the polypeptide chain. The leader peptides direct the nascent polypeptides to the cell machinery that exports polypeptides from the cell to the surrounding environment or, in some cases, to the periplasmic space. The mechanisms by which the leader peptides direct nascent polypeptide chains to the secretion pathway and direct precise and effective proteolytic cleavage to release mature proteins are not fully understood. Usually, although not necessarily, the leader peptide is located at the N-terminal end of the primary translation product and generally, but not necessarily, is removed by cleavage of the desired polypeptide during the secretion process, to produce the "mature" polypeptide. Polypeptide secretion is a dynamic and multi-stage process that involves several elements of the cellular secretory apparatus and specific sequence elements in the signal peptide. It also implies translation, translocation and post-translational processing, and one or more of these stages may not necessarily be completed before another has either been initiated or completed. Signal sequences are indispensable for phage antibody production, in which antibody fragments such as scFv or Fab are fused with phage coat proteins such as pIII or pVIII.

The signal sequences are predominantly hydrophobic in nature, a characteristic that may be important in the direction of the nascent peptide to the membrane and the transfer of secretory proteins through the inner membrane of prokaryotes or the membranes of the endoplasmic reticulum of eukaryotes. In mammalian cells, the leader peptides are recognized by the 54K protein of the signal recognition particle (SRP), which is believed to hold the nascent chain in a conformation competent for translocation until it comes into contact with the membrane of the endoplasmic reticulum. SRP consists of a 7S RNA and six different polypeptides. The 7S RNA and the 54K leader peptide binding protein (SRP54) of mammalian SRP have a strong sequence similarity with the 4.5S RNA and the P48 protein (Ffh) of Escherichia coli, which forms the recognition particle of the Signal in bacteria. It is likely that the various sequences found in different signal peptides interact in unique ways with the secretion apparatus. No eukaryotic signal sequence is available that results in correct protein processing and high protein expression in bacteria or vice versa.

Phage format with antibodies or scFv fragment format is often not considered an appropriate format in tests of functionalities other than binding, for example assays to test neutralizing activity when bivalent binding is required or when functional Fc regions are required. . For example, in assays that test neutralizing activity, data obtained with phage antibodies or scFv fragments derived from phage antibodies are not representative of the neutralizing activity of whole immunoglobulin molecules. Therefore, complete immunoglobulin molecules, for example IgG1, are needed to test particular specificities to determine functional activity. To increase the efficiency by which scFv molecules can be reformed to give IgG1, a new vector system was designed that makes use of new leader peptides. The new vectors and leader peptides were designed to allow direct transport of immunoglobulin heavy chain regions (VH region) and immunoglobulin light chain regions (VL region) from bacterial expression vectors, such as phage display vectors , for example PDV, pHEN and vectors derived therefrom, to a eukaryotic expression system. This approach has a significant time and cost advantage over conventional systems in which each VH and VL region have to be amplified by PCR, cloned and checked to detect frequent mutations that occur through the amplification process before being transported to eukaryotic expression vectors. In short, the procedure is as follows. Repertoires of VH and VK fragments are cloned into prokaryotic expression vectors such as pHEN1 and PDV-C06 using specific restriction enzymes. These sites are chosen to be outside the sequences encoding the V region because there is too much sequence diversity within the V regions to achieve effective PCR amplification and cloning of V gene repertoires. Normally, the recognition site of the enzyme at the 5 'end of the VH antibody fragments is located in the coding region of the prokaryotic leader sequence such as the SfiI site in the PelB leader sequence of pHEN1 or PDV-C06. Therefore, SfiI is one of the sites available for cloning at the 5 'end that is present in all scFv clones derived from phage display. When this site is used for cloning, the sequence encoded by the SfiI site and the sequence in the 3 ’sense are transferred to the eukaryotic vector; This means that the C-terminal part of the prokaryotic leader is transferred to the eukaryotic vector. In the present invention, a eukaryotic leader was designed that is functional when the region encoding the C-terminal part of the prokaryotic leader sequence (eg PelB) is transferred to the eukaryotic vector. Repertoires of VL antibody fragments are cloned using a SalI site that is located within the scFv linker sequence. When this site is used for cloning, the sequence encoded by the SalI site is transferred to the eukaryotic vector and will be part of the eukaryotic leader sequence. Thus, leaders were designed that contained a sequence in the 5 'direction of the SalI restriction site that together with the sequence encoded by the SalI restriction site and the sequence in the 3' sense of the restriction site after transcription and Translation form a functional leader in eukaryotic cells. The VH region is cut from a phage display vector with restriction enzymes and cloned in frame between a "truncated" eukaryotic leader peptide and the constant and hinge domains of an immunoglobulin heavy chain present in the expression vector. Similarly, the VL region is cloned in frame with a "truncated" eukaryotic leader peptide and the constant domain of the light chain (either lambda or kappa) of immunoglobulin. The newly designed leader peptides have a sequence that is recognized by the cellular secretory apparatus and is proteolytically cleaved during secretion of immunoglobulin chains from host cells, for example eukaryotic host cells, resulting in Ig heavy and light chain proteins. mature properly processed. The invention also provides an expression vector (pIGCHG1) for the production of a full-length IgG1 heavy chain immunoglobulin molecule and two vectors encoding a full light chain fragment. A vector (pIG-Ckappa) produces the light chain subtype. kappa and the other (pIG-Clambda) the lambda light chain variant. It is essential to determine in advance to which subtype the VL region belongs, so that the correct constant light chain domain can be fused with it. Of course, the constant IgG1 domain in the vector can be replaced by an IgG2, IgG3 or IgG4 domain to produce heavy chains of the IgG2, IgG3 or IgG4 format. Other proteins that need a leader sequence in both prokaryotes and eukaryotes can also be prepared through the new leaders. To achieve convenient and efficient cloning, pIG vectors were extended with large filler fragments so that double cut vectors are easily separated from linear single cut vectors.

In one aspect, the invention relates to a eukaryotic leader peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 150, SEQ ID NO: 152 and SEQ ID NO: 154. In a further aspect, the invention provides a recombinant polypeptide (eg recombinant protein) comprising a eukaryotic leader peptide of the invention and a polypeptide of interest. The polypeptide of interest may be any recombinant protein, but preferably it is a eukaryotic protein such as a mammalian protein, or more preferably a human protein. In one embodiment, the polypeptide of interest is selected from the group consisting of an immunoglobulin heavy chain, an immunoglobulin light chain, an immunoglobulin heavy chain fragment and an immunoglobulin light chain fragment. Preferred fragments are variable regions of immunoglobulin (VH or VL regions). Preferably, the immunoglobulin fragments and chains are human. In one aspect of the invention, the leader peptide is used to direct or even enhance the secretion of the recombinant polypeptide produced in a recombinant (ie transformed) host organism, for example a host cell. In one embodiment, the carboxyl terminal end of the eukaryotic leader peptide binds / fuses to the amino terminal end of the polypeptide of interest. Preferably, the leader peptide comprising SEQ ID NO: 150 is fused to an immunoglobulin heavy chain or fragment thereof. This leader peptide is the result of the binding of a "truncated" eukaryotic leader peptide encoded by the nucleotide sequence of SEQ ID NO: 155 to a nucleotide sequence encoding an immunoglobulin heavy chain

or fragment thereof, for example a heavy chain variable region of plasmid pHEN1 or PDV-C06. The leader peptides comprising SEQ ID NO: 152 and SEQ ID NO: 154 bind to a light chain kappa and lambda

or fragment thereof, respectively. These leader peptides are the result of the binding of a "truncated" eukaryotic leader peptide encoded by the nucleotide sequence of SEQ ID NO: 156 or SEQ ID NO: 157 to a nucleotide sequence encoding a kappa or lambda immunoglobulin light chain or fragment thereof, for example a kappa or lambda light chain variable region of plasmid pHEN1 or PDV-C06. Thus, the invention provides a fusion polypeptide comprising a leader peptide sequence of the invention and a recombinant protein sequence. The fusion polypeptide can be designed so that additional amino acids are present between the leader peptide and the recombinant protein. In these cases, cleavage of the leader peptide of the fusion polypeptide can produce a modified recombinant protein that has additional amino acids at the N-terminal end. Alternatively, the fusion polypeptide can be designed so that the site for cleavage of the leader peptide is a few amino acids in the sequence of the recombinant protein. In these cases, a modified recombinant protein can be produced that has an altered N-terminal end.

In another aspect, the invention provides a nucleic acid sequence encoding a eukaryotic leader peptide of the invention. The eukaryotic leader peptides according to the invention comprise the GGCCCAGCCGGCC nucleotides (SEQ ID NO: 158), ie an SfiI site, or the TCGAC nucleotides (SEQ ID NO: 159), that is, an XhoI / SalI site, within the sequence of nucleic acid encoding the leader peptides. The combined XhoI / SalI site is prepared by linking the XhoI site is a prokaryotic leader in a eukaryotic vector that has been digested with the restriction enzyme SalI. Preferably, the sites are located within the carboxyl terminal portion of the sequences encoding the leader peptide. In a preferred embodiment, the nucleic acid sequence encoding the new leader peptides according to the invention comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 149, SEQ ID NO: 151 and SEQ ID NO: 153. The nucleic acid sequence may further comprise a nucleic acid sequence encoding a polypeptide of interest. Suitable polypeptides of interest were mentioned above. The nucleic acid sequence encoding the leader peptides and the nucleic acid sequence encoding the polypeptides of interest can form a so-called fusion construct. By "fusion construct" is meant a nucleic acid comprising the coding sequence for a leader peptide and the coding sequence, with or without introns, for a recombinant protein, in which the coding sequences are adjacent in the same reading frame of so that when the fusion construct is transcribed and translated into a host cell, a protein is produced in which the C-terminal end of the leader peptide is attached to the N-terminal end of the recombinant protein. The protein product of the fusion construct may be referred to herein as "fusion polypeptide." The nucleic acid encoding the leader peptide may be operatively linked / linked to the nucleic acid containing the recombinant protein coding region such that the coding region of the leader peptide is in the 5 'sense of (i.e., 5' with respect to) and in the same reading frame with the coding region of the recombinant protein to provide a fusion construct. Typically, the 3 ′ end of the nucleic acid encoding the leader peptide is attached to the 5 ′ end of the nucleic acid encoding the recombinant protein. The two coding regions are linked so that they are in the same reading frame. Thus, the fusion construct will code for a single protein, which has the leader peptide at the N-terminal end followed by the recombinant protein at the C-terminal end. The leader peptide and the recombinant protein can be directly linked or there may be one or more amino acids that connect them. It is well known that certain amino acids interfere with cleavage by signal peptidases and these residues are avoided in the design of the cleavage site for the fusion polypeptide. The fusion construct can be expressed in a host cell to provide a fusion polypeptide comprising the leader peptide attached, at its carboxyl terminus, to the recombinant protein at its amino terminus. The fusion polypeptide can be secreted from the host cell. Normally, the leader peptide is cleaved from the fusion polypeptide during the secretion process, resulting in the accumulation of secreted recombinant protein in the external cellular environment.

In a further aspect, the invention provides an expression vector comprising a nucleic acid sequence according to the invention. Preferably, the nucleic acid sequence of the invention comprises a nucleic acid sequence encoding a leader peptide according to the invention. It may further comprise a nucleic acid sequence encoding the polypeptide of interest. Expression vectors containing the nucleic acids encoding the leader peptide or the fusion construct can be prepared by methods that are well known in the art. In general, the expression vectors will contain nucleic acid encoding the leader peptide, or the fusion construct, under the control of a promoter. In some embodiments, more than one leader peptide or fusion construct can be placed under the control of a single promoter. In such embodiments, the additional fusion construct (s) will be placed in the 3 'direction of the first fusion construct and separated (s) from the fusion construction in the 5' direction by nucleotides The promoter is chosen so that it is capable of directing transcription in a host of interest. Promoters capable of directing transcription in various host cells are well known. In one embodiment, the promoter is the long CMV promoter, but any other suitable promoter can also be chosen. In general, a "promoter" will include all nucleotide sequences within the 5 ’sense of translational initiation necessary for transcription of the coding region of the leader peptide and / or fusion polypeptide. The promoter may include or overlap with the sequence of the ribosome binding site. Promoter selection will often influence the selection of the ribosome binding site as well. The expression vector may also contain other nucleic acid sequences that regulate expression including selectable marker genes, origins of replication, polyadenylation signal sequences, etc. Other nucleic acid sequences that regulate expression and additional sequences, for example polypeptide sequences useful for isolation, which may be included in the vectors, were mentioned above. Expression vectors may contain one or more selectable marker genes, including ampicillin and / or neomycin, for selection in the host of interest and / or one or more origins of replication, including an ori pUc and / or an SV40 ori or an ori f1, to provide autonomous replication of the vector in the host. Additionally, they may contain a

or more polyadenylation signal sequences including an SV40-polyA signal and / or a BGH-polyA signal. Alternatively, or in addition, the expression vector may contain nucleotide sequences to aid in the integration of the vector into the host chromosome. An expression vector according to the invention may further comprise an XhoI site or a NotI site. An immunoglobulin heavy and / or light chain variable region can be located for example between an Sfi site and an XhoI site (for example in an expression vector for the production of heavy chain immunoglobulin (IgG1) chains), and be located between an XhoI site and a NotI site (for example in an expression vector for the production of light chain immunoglobulin chains (kappa and lambda)). Restriction sites may be located in the 3 ′ sense of a nucleic acid sequence encoding the promoter, for example the long CMV promoter, and in the 3 ′ sense of the eukaryotic leader peptide of the invention. The sites may be located within the 5 ’sense of a nucleic acid sequence that encodes a constant immunoglobulin domain.

In a further embodiment, the invention provides an expression vector of a nucleic acid sequence selected from the group consisting of SEQ ID NO: 155, SEQ ID NO: 156 and SEQ ID NO: 157, that is, a eukaryotic leader peptide " truncated". The expression vector comprising the nucleic acid sequence of SEQ ID NO: 155 comprises an SfiI site at its carboxyl terminus. Expression vectors comprising the nucleic acid sequence of SEQ ID NO: 156 or SEQ ID NO: 157 comprise an XhoI site at its carboxyl terminal ends. The vectors may further comprise within the 3 'sense of the nucleic acid sequence selected from the group consisting of SEQ ID NO: 155, SEQ ID NO: 156 and SEQ ID NO: 157 an XhoI site (for SEQ ID NO: 155 ) or a NotI site (for SEQ ID NO: 156 and SEQ ID NO: 157). They may further comprise a filler sequence between the nucleic acid sequence selected from the group consisting of SEQ ID NO: 155, SEQ ID NO: 156 and SEQ ID NO: 157 and the XhoI site or the NotI site. The nucleic acid sequence selected from the group consisting of SEQ ID NO: 155, SEQ ID NO: 156 and SEQ ID NO: 157, the fill sequence and the XhoI site and the NotI site may be located in the 3 'direction of a promoter sequence such as a long CMV promoter sequence. They can be located in the 5 ’direction of a constant region of heavy or light immunoglobulin chain. The expression vector may further comprise other nucleic acid sequences that regulate the expression or other sequences. Examples of nucleic acid sequences that regulate expression or other suitable sequences were mentioned above. In one embodiment, the expression vector according to the invention comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 53, SEQ ID NO: 54 and SEQ ID NO: 58. These vectors comprise a fill sequence.

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

A host cell comprising at least one expression vector according to the invention is another aspect of the invention. Preferably, the host cell is a human host cell. Other suitable host cells were mentioned above. Furthermore, the invention relates to the use of an expression vector according to the invention and / or a host cell according to the invention for the production of an immunoglobulin chain and / or molecule.

Even in a further aspect the invention provides a method for producing expression vectors. In one embodiment, the expression vector produced is suitable for producing an immunoglobulin heavy chain. The method comprises the steps of: digesting / cutting an expression vector comprising the nucleic acid sequence of SEQ ID NO: 155 and in the 3 'sense thereof an XhoI site and an immunoglobulin heavy chain constant region with the restriction enzymes SfiI and XhoI, digest / cut a phage display vector comprising an immunoglobulin heavy chain variable region with the SfiI and XhoI restriction enzymes, insert the immunoglobulin heavy chain variable region into the expression vector and isolate the expression vector. In a specific embodiment, the expression vector comprising the nucleic acid sequence of SEQ ID NO: 155 and in the 3 'sense thereof an XhoI site and an immunoglobulin heavy chain constant region comprises the nucleic acid sequence of SEQ ID NO: 53. In another embodiment, the expression vector produced is suitable for producing an immunoglobulin light chain. The method comprises the steps of digesting / cutting an expression vector comprising the nucleic acid sequence of SEQ ID NO: 156 or SEQ ID NO: 157 and in the 3 'sense thereof a NotI site and a constant region of immunoglobulin light chain with restriction enzymes XhoI and NotI, digest / cut a phage display vector comprising a variable region of immunoglobulin light chain with restriction enzymes SalI and NotI, insert the variable region of immunoglobulin light chain in the expression vector and isolate the expression vector. In a specific embodiment, the expression vector comprising the nucleic acid sequence of SEQ ID NO: 156 or SEQ ID NO: 157 and in the 3 'sense thereof a NotI site and a constant immunoglobulin light chain region it comprises the nucleic acid sequence of SEQ ID NO: 54 or SEQ ID NO: 58, respectively. The phage display vector can be a phagemid but also any other suitable vehicle. It is clear that the digestion / cutting stages can be performed in any order and even simultaneously. It should also be understood that the variable light chain and variable heavy chain regions in the phage display vector, such as pHEN1 or PDV, are located between the SfiI and XhoI and SalI and NotI sites, respectively. By digesting the presentation vectors with the respective restriction enzymes, the regions are obtained and can be used for insertion into eukaryotic expression vectors.

In a further aspect, the invention relates to a method for producing a heavy or light chain of immunoglobulin, the method comprising the steps of transforming at least one host cell with an expression vector as produced above, culturing the host cell in conditions that lead to the expression of an immunoglobulin chain and, optionally, purify the immunoglobulin chain from the medium or cell extract. In one embodiment, the host cell can be transformed with a suitable expression vector to produce a heavy chain and a suitable expression vector to produce a light chain and a complete immunoglobulin can be produced. Many commercially significant proteins are produced by recombinant gene expression in appropriate prokaryotic or eukaryotic host cells. It is often desirable to isolate the expressed protein product after secretion into the culture medium. Secreted proteins are normally soluble and can easily be separated from host contaminating proteins and other cellular components. Methods for separation and / or purification are well known in the art.

EXAMPLES

To illustrate the invention, the following examples are provided.

Example 1

Construction of a scFv phage display library using RNA extracted from peripheral blood of convalescent WNV donors.

Blood samples were taken from three patients with convalescent WNV 1, 2 and 3 months after infection. Leukocytes were isolated from peripheral blood by centrifugation and the blood serum was stored and frozen at -80 ° C. All donors at all time points had high titers of neutralizing antibodies against WNV as determined using a virus neutralization assay. Total RNA was prepared from the cells using organic phase separation and subsequent ethanol precipitation. The RNA obtained was dissolved in RNase-free water and the concentration was determined by OD measurement at 260 nm. After that, the RNA was diluted to a concentration of 100 ng / .l. Next, 1 µg of RNA was converted into cDNA as follows: To 10 µl of total RNA, 13 µl of ultrapure water treated with DEPC and 1 µl of random hexamers (500 ng / µl) were added ) and the mixture obtained was heated at 65 ° C for 5 minutes and rapidly cooled on wet ice. Then, 8 µl of 5X First-Strand buffer, 2 µl of dNTP (10 mM each), 2 µl of DTT (0.1 M), 2 µl of RNase inhibitor (40) were added to the mixture U / l) and 2 l of VLMM Superscript ™ III reverse transcriptase (200 U / l), incubated at room temperature for 5 minutes and incubated for 1 hour at 50 ° C. The reaction was terminated by heat inactivation, that is, by incubating the mixture for 15 minutes at 75 ° C.

The cDNA products obtained were diluted to a final volume of 200 µl with ultrapure water treated with DEPC. The OD at 260 nm of a solution diluted 50 times (in 10 mM Tris buffer) of the dilution of the cDNA products obtained gave a value of 0.1.

For each donor, 5 to 10 µl of the diluted cDNA products were used as a template for PCR amplification of the kappa or lambda light chain sequences and the immunoglobulin gamma heavy chain family using specific oligonucleotide primers (see Tables 1-6). The PCR reaction mixtures contained, in addition to the diluted cDNA products, 25 pmoles of sense primer and 25 pmoles of antisense primer in a final volume of 50 µl of 20 mM Tris-HCl (pH 8.4), KCl 50 mM, 2.5 mM MgCl2, 250 µM dNTP and 1.25 units of Taq polymerase. In a heated capped thermal cycler having a temperature of 96 ° C, the mixtures obtained were rapidly melted for 2 minutes, followed by 30 cycles of: 30 seconds at 96 ° C, 30 seconds at 60 ° C and 60 seconds at 72 ° C.

In a first round of amplification, each of seventeen sense light region variable region primers (eleven for the lambda light chain (see table 1) and six for the kappa light chain (see table 3) were combined with a primer antisense that recognized the constant region of C-kappa called HuCk 5'ACACTCTCCCCTGTTGAAGCT CTT-3 '(see SEQ ID NO: 37) or C-lambda HuC2 5'TGAACATTCTGTAGGGGCCACTG-3' (see SEQ ID NO: 38) and HuC7 5'-AGAGCATTCTGCAGGGGCCACTG-3 '(see SEQ ID NO: 39) (HuC2 and HuC7 antisense primers were mixed until equimolarity before use), providing 4 times 17 products of approximately 600 pairs of bases These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel extraction columns 1/10 of each of the isolated products was used in a PCR reaction identical to that described above using the same seventeen primers felt whereby each lambda light chain sense primer was combined with one of three J-lambda region specific antisense primers and each kappa light chain sense primer was combined with one of the five J-kappa region specific antisense primers . The primers used in the second amplification were extended with restriction sites (see table 3) to allow direct cloning into the phage display vector PDV-C06 (see SEQ ID NO: 40). This resulted in 4 multiplied by 63 products of approximately 350 base pairs that were combined to give a total of 10 fractions. This number of fractions was chosen to maintain the natural distribution of the different families of light chains within the library and not to represent in excess or defect certain families. The number of alleles within a family was used to determine the percentage of representation within a library (see table 4). In the next step, 2.5 µg of combined fraction and 100 µg of PDV-C06 vector were digested with SalI and NotI and purified from gel. Subsequently, ligation was performed overnight at 16 ° C as follows. To 500 ng of PDV-C06 vector, 70 ng of combined fraction was added in a total volume of 50 µl of ligation mixture containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl 2, 10 mM DTT, 1 mM ATP, 25 µg / ml BSA and 2.5 µL T4 DNA ligase (400 U / µl). This procedure was followed for each combined fraction. Ligation mixtures were purified by phenol / chloroform, followed by extraction in chloroform and ethanol precipitation, methods well known to those skilled in the art. The DNA obtained was dissolved in 50 µl of ultrapure water and two 2.5 µl aliquots were electroporated by ligation mixture in 40 µl of E. coli bacteria competent for TG1 according to the manufacturer's protocol (Stratagene) . The transformants were grown overnight at 37 ° C in a total of 30 plates (three plates per combined fraction; plate size: 240 mm x 240 mm) containing 2TY agar supplemented with 50 µg / ml ampicillin and a 4, 5% glucose A (sub) library of variable light chain regions was obtained by scraping the transformants from the agar plates. This (sub) library was used directly for the preparation of plasmid DNA using a QIAFilter MAXI preparation kit from Qiagen ™.

For each donor, the heavy chain immunoglobulin sequences were amplified from the same cDNA preparations in a two-round PCR procedure and reaction parameters identical to those described above for light chain regions with the condition that used the primers represented in tables 5 and 6. The first amplification was performed using a set of nine sense-directed primers (see table 5; covering all families of heavy chain variable regions) each combined with an antisense primer of specific IgG constant region called HuCIgG 5'-GTC CAC CTT GGT GTT GCT GGG CTT-3 '(SEQ ID NO: 41) providing four times nine products of approximately 650 base pairs. These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel extraction columns. 1/10 of each of the isolated products was used in a PCR reaction identical to that described above using the same nine sense primers, whereby each heavy chain sense primer was combined with one of the four region specific antisense primers. JH The primers used in the second round were extended with restriction sites (see table 6) to allow targeted cloning in the (sub) light chain library vector. This resulted in donor 36 products of approximately 350 base pairs. These products were combined for each donor per sense primer (VH) used in nine fractions. The products obtained were purified using Qiagen PCR purification columns. Next, the fractions were digested with SfiI and XhoI and ligated into the light chain (sub) library vector, which was cut with the same restriction enzymes, using the same ligation and volume procedure as described above for (sub) light chain library. Alternatively, the fractions were digested with NcoI and XhoI and ligated into the light chain vector, which was cut with the same restriction enzymes, using the same ligation procedure and volumes as described above for the (sub) chain library light The ligation, purification and subsequent transformation of the resulting definitive library were also performed as described above for the (sub) light chain library and at this point the ligation mixtures of each donor were combined by VH combination. The transformants were grown on 27 plates (three plates per combined fraction; plate size: 240 mm x 240 mm) containing 2TY agar supplemented with 50 µg / ml ampicillin and 4.5% glucose. All bacteria were collected in 2TY culture medium containing 50 µg / ml ampicillin and 4.5% glucose, mixed with glycerol up to 15% (v / v) and frozen in 1.5 ml aliquots at -80 ° C. The rescue and selection of each library were performed as described below.

Example 2

Selection of phages carrying single stranded Fv fragments that specifically recognize the protein (E) of the WNV envelope

Antibody fragments were selected using antibody phage display libraries, general phage display technology and MAbstract® technology, essentially as described in US Patent No. 6,265,150 and WO98 / 15833. The antibody phage libraries used were two different semisynthetic scFv phage libraries (JK1994 and WT2000) and the immune library prepared as described in example 1. The first semisynthetic scFv phage library (JK1994) has been described in de Kruif et al., 1995b, the second (WT2000) was constructed essentially as described in de Kruif et al., 1995b. In summary, the library has a semi-synthetic format whereby variation was incorporated into the light and heavy chain V genes using degenerate oligonucleotides that incorporate variation within the CDR regions. Only VH3 heavy chain genes were used, in combination with kappa and lambda light chain genes. CDR1 and CDR3 of the heavy chain and CDR3 of the light chain were synthetically recreated in a PCR-based approach similar to that described in de Kruif et al., 1995b. The V region genes created in a scFv format were sequentially cloned into a phagemid vector and amplified to generate a phage library as described above. In addition, the cooperating methods and phages described in WO 02/103012 were used in the present invention. To identify antibodies in phages that recognized WN protein E, phage selection experiments were performed using complete WNV (called strain USA99b or strain 385-99) inactivated by gamma irradiation (50 Gy for 1 hour), expressed WN protein E recombinantly (strain 382-99) and / or WNV-like particles that express WNV protein E (strain 382-99) on its surface.

The recombinantly expressed protein E was produced as follows. The nucleotide sequence encoding the M / preM protein and the full length E protein of the WNV strain 382-99 was synthesized (see SEQ ID NO: 42 for the amino acid sequence of a fusion protein comprising both polypeptides of WINE). Amino acids 1-93 of SEQ ID NO: 42 constitute the preM protein of WNV, amino acids 94-168 of SEQ ID NO: 42 constitute the M protein of WNV, amino acids 169-669 of SEQ ID NO: 42 constitute the protein WNV E (soluble WNV protein E (ectodomain) constitutes amino acids 169-574 of SEQ ID NO: 42, while the stem and transmembrane region of WN protein E constitutes amino acids 575669 of SEQ ID NO: 42 ). The nucleotide sequence synthesized in plasmid pAdapt was cloned and the plasmid named pAdapt.WNV.prM-E (FL) was obtained.

To produce a soluble secreted form of protein E, a construct was prepared that lacked the regions encompassing the transmembrane present in the final 95 amino acids at the carboxyl terminus of the full-length protein E (truncated form). To that end, the full-length construction pAdapt.WNV.prM-E (FL) was amplified by PCR with primers CMV-Spe (SEQ ID NO: 43) and WNV-E-95 REV (SEQ ID NO: 44) and the fragment obtained in plasmid pAdapt.myc.his was cloned to create the plasmid called pAdapt.VNO -95. Next, the region encoding the preM protein, the truncated E protein, the Myc tag and the His tag were amplified by PCR with the clefsmaquwnv primers (SEQ ID NO: 45) and reverse WNVmychis (SEQ ID NO: 46) and they cloned into the pSyn-C03 vector containing the HAVT20 leader peptide using the EcoRI and SpeI restriction sites. The expression construct obtained, pSyn-C03-WNV-E -95, was transfected into 90% confluent HEK293T cells using lipofectamine according to the manufacturer's instructions. The cells were cultured for 5 days in ultra-serum-free CHO medium, then, the medium was collected and purified by passing on HisTrap chelation columns (Amersham Bioscience) preloaded with nickel ions. Truncated protein E was eluted with 5 ml of 250 mM imidazole and further purified by passing on a G-75 gel filtration column equilibrated with phosphate buffered saline (PBS). The fractions obtained were analyzed by SDS-PAGE analysis and Western blot using the murine antibody 7H2 specific for WNV protein E (Biorelience, see Beasley and Barrett 2002). Aliquots of three 5 ml fractions containing a single 45 kDa band that were immunoreactive with the 7H2 antibody were taken and stored at -20 ° C until later use. Protein concentration was determined by OD at 280 nm.

VNO-like particles were produced as follows. The pSyn-C03-WNV-E -95 construct described above and pDNAc3.1 (Invitrogen) were digested with the restriction endonucleases MunI and XbaI and the pAdapt.WNV.prM-E (FL) construct described above was digested with the endonucleases ClaI and XbaI restriction. The resulting fragments were combined in a three-point ligation to produce the pSyn-H-preM / E FL construct. This construct contained the full-length E protein and expressed the two VNO structural proteins, the M and E protein, required for the assembly of a wrapped virion. The construction was transfected into 70% confluent HEK293T cells using lipofectamine according to the manufacturer's instructions. The cells were cultured for 3 days in serum-free CHO medium, then the medium was collected, layered on a 30% glycerol solution at a 2: 1 ratio and sedimented by centrifugation for 2 hours at 120,000 * at 4 ° C. WNV-like particles were resuspended in PBS, divided into aliquots and stored at -80 ° C. The aliquots were analyzed by SDS-PAGE analysis and Western blot using the 7H2 murine antibody specific for WNV protein E (Biorelience).

Prior to inactivation, complete WNV was purified by sedimentation through a 30% glycerol solution as described above for WNV-like particles. The purified WNV was resuspended in 10 mM Tris / HCl pH 7.4 containing 10 mM EDTA and 200 mM NaCl, the preparation obtained on dry ice was maintained during inactivation, tested for infectivity and stored at - 80ºC in small aliquots. The aliquots were analyzed by SDS-PAGE analysis and Western blot using the 7H2 murine antibody specific for WNV protein E (Biorelience).

Complete inactivated WNV, WNV-like particles or soluble E protein recombinantly expressed in PBS were diluted. 2-3 ml of the preparation was added to MaxiSorp ™ Nunc-Immuno (Nunc) tubes and incubated overnight at 4 ° C on a rotating wheel. An aliquot of a phage library (500 µL, approximately 1013 cfu, amplified using the CT helper phage (see WO 02/103012)) was blocked in blocking buffer (2% Protifar in PBS) for 1-2 hours at room temperature. The blocked phage library was added to the immunotubes, incubated for 2 hours at room temperature and washed with wash buffer (0.1% Tween-20 v / v in PBS) to remove unbound phages. The bound phage of the antigen was eluted by incubation with 1 ml of 50 mM glycine-HCl pH 2.2 for 10 minutes at room temperature. Subsequently, the eluted phages were mixed with 0.5 ml of 1M Tris-HCl pH 7.5 to neutralize the pH. This mixture was used to infect 5 ml of a culture of E. coli XL1-Blue that had been grown at 37 ° C to an OD at 600 nm of approximately 0.3. The phages were allowed to infect the XL1-Blue bacteria for 30 minutes at 37 ° C. Then, the mixture was centrifuged for 10 minutes at 3200 * g at room temperature and the bacterial pellet was resuspended in 0.5 ml of 2-tryptone (2TY) yeast extract medium. The bacterial suspension obtained was divided on two 2TY agar plates supplemented with tetracycline, ampicillin and glucose. After overnight incubation of the plates at 37 ° C, the colonies of the plates were scraped and used to prepare an enriched phage library, essentially as described by De Kruif et al. (1995a) and WO 02/103012. In summary, scraped bacteria were used to inoculate 2TY medium containing ampicillin, tetracycline and glucose and grown at a temperature of 37 ° C to an OD at 600 nm of 0.3. CT-cooperating phages were added and the bacteria were allowed to infect after which the medium was changed to 2TY containing ampicillin, tetracycline and kanamycin. Incubation was continued overnight at 30 ° C. The next day, the bacteria were removed from the 2TY medium by centrifugation after which the phages were precipitated in the medium using polyethylene glycol (PEG) 6000 / NaCl. Finally, phages were dissolved in 2 ml of PBS with 1% bovine serum albumin (BSA), sterilized by filtration and used for the next round of selection.

Normally, two rounds of selections were made before the isolation of antibodies in individual phages. After the second round of selection, individual E. coli colonies were used to prepare antibodies in monoclonal phages. Essentially, individual colonies were grown to the logarithmic phase in a 96-well plate format and infected with CT helper phages, after which the production of phage antibodies was allowed to continue overnight. The phage antibodies produced were precipitated with PEG / NaCl and sterilized by filtration and tested in ELISA to determine the binding to purified VNO-like particles as described above.

Example 3

Validation of antibodies in WNV specific single chain phages

Selected single chain phage antibodies that were obtained in the tests described above in ELISA were validated to determine their specificity, that is, their binding to WN protein E, completely inactivated WNV and WNV-like particles, all purified as described above. For this purpose, complete inactivated WNV, WNV protein E, or WNV-like particles were coated on Maxisorp ™ ELISA plates. In addition, complete inactivated rabies virus was coated on the plates as a control. After coating, the plates were blocked in PBS containing 1% Protifar for 1 hour at room temperature. The antibodies selected in single stranded phages were incubated for 15 minutes in an equal volume of PBS containing 1% Protifar to obtain antibodies in blocked phages. Plates were emptied and antibodies in single stranded phage were added to the wells. The incubation was allowed to continue for one hour, the plates were washed in PBS containing 0.1% Tween-20 v / v and antibodies were detected in bound phages (using OD measurement at 492 nm) using an anti antibody -M13 conjugated with peroxidase. As a control, the procedure was performed simultaneously without single-stranded phage antibody, with a negative single-stranded phage antibody directed against rabies virus glycoprotein (antibody named SC02-447), with an antibody in single chain phage of negative control directed against SARS-CoV (antibody called SC03-014) and a single chain phage antibody of positive control directed against rabies virus. As shown in Table 7, the antibodies in selected phages called SC04-348 and SC04-354 had a significant binding to immobilized VNO and complete inactivated VNO-like particles. Both antibodies were selected in single chain phages when VNO-like particles were used in the first and second round of selection. When the ELISA was performed with purified recombinantly expressed WNV protein E prepared as described above or rabies virus, the single chain phage antibodies SC04-348 and SC04-354 did not bind, suggesting that either they bind to a region not present in the truncated soluble protein E, they bind to an unrelated protein on the virion surface, they do not bind to the monomeric form of protein E or they do not bind due to antibody format in phage.

Example 4

Characterization of WNV specific scFv

From the selected specific single chain phage antibody clones (scFv) plasmid DNA was obtained and nucleotide sequences were determined according to conventional techniques. The nucleotide sequences of the scFv (including restriction sites for cloning) designated SC04-348 and SC04-354 are shown in SEQ ID NO: 25 and SEQ ID NO: 27, respectively. The amino acid sequences of scFv called SC04-348 and SC04-354 are shown in SEQ ID NO: 26 and SEQ ID NO: 28, respectively.

VH and VL gene identity (see Tomlinson IM, Williams SC, Ignatovitch O, Corbett SJ, Winter G. V-BASE Sequence Directory. Cambridge United Kingdom: MRC Center for Protein Engineering (1997)) and chain CDR3 sequences Weighing of scFvs that specifically bind to VNOs are depicted in Table 8. Table 9 shows the other CDR regions of VNO-specific scFvs.

Example 5

Construction of fully human immunoglobulin molecules (human monoclonal anti-WNV antibodies) from selected anti-WNV single chain Fv

Heavy and light chain variable regions of the scFv called SC04-354 were amplified using PCR to oligonucleotides to attach restriction sites and / or sequences for expression in the IgG expression vectors pSyn-C18-HC1 (see SEQ ID No : 47) and pSyn-C04-C (see SEQ ID No: 48). The heavy chain variable region of the scFv named SC04-354 was cloned into the vector pSyn-C18-HC1; the light chain variable region of the scFv named SC04-354 was cloned into the vector pSyn-C04-C. The lambda gene of VL was first amplified using the following set of oligonucleotides: SC04-354, 5LC (SEQ ID NO: 49) and sy3L-Cmod (SEQ ID NO: 50) and the PCR product was cloned into the vector pSyn-C04-C. The nucleotide sequence for construction was verified according to conventional techniques known to those skilled in the art. The VH gene was first amplified using the following set of oligonucleotides: SC04-354, 5H-A (SEQ ID NO: 51) and sy3H-A (SEQ ID NO: 52). After that, the PCR product was cloned into the pSyn-C18-HC1 vector and the nucleotide sequence was verified according to conventional techniques known to those skilled in the art.

The light and heavy chain variable region of the scFv named SC04-348 was directly cloned by restriction digestion for expression in the IgG expression vectors pIg-C911-HCgamma1 (see SEQ ID NO: 53) and pIg-C909-Ckappa (see SEQ ID NO: 54). The heavy chain variable regions of the scFv called SC04-348 in the vector pIg-C911-HCgamma1 were cloned by restriction digestion using the SfiI and XhoI enzymes and the light chain variable region of the scFv named SC04-348 was cloned in the vector pIgC909-Ckappa by restriction digestion using the enzymes SalI and NotI. After that, the nucleotide sequence was verified according to conventional techniques known to those skilled in the art.

The resulting expression constructs pgG104-348C911 and pgG104-354C18 encoding the heavy chains of human IgG1 and pgG104-348C909 and pgG104-354C04 encoding the light chains of human IgG1 were expressed transiently in combination in 293T cells and supernatants were obtained containing antibodies to human IgG1. The nucleotide sequences of the heavy chains of antibodies designated CR4348 and CR4354 are shown in SEQ ID Nos. 29 and 31, respectively. The amino acid sequences of the heavy chains of the antibodies designated CR4348 and CR4354 are shown in SEQ ID NOs 30 and 32, respectively. The nucleotide sequences of the light chain of antibodies CR4348 and CR4354 are shown in SEQ ID NOs 33 and 35, respectively. The amino acid sequences of the light chain of antibodies CR4348 and CR4354 are shown in SEQ ID NOs 34 and 36, respectively. One skilled in the art can determine the variable regions of the heavy and light chains of the above antibodies according to Kabat et al. (1991) as described in Sequences of Proteins of Immunological Interest. Alternatively, batches of more than 1 mg of each antibody were produced and purified using conventional procedures. The antibodies were then titrated at a fixed concentration of irradiated West Nile virus and tested in ELISA as described above. The results are shown in Table 10. As a negative control, an anti-rabies virus antibody was used. Both antibodies showed binding to the virus in a dose-dependent manner. The antibodies could also bind to particles similar to WNV (data not shown).

Additionally, the binding of CR4348 and CR4354L4328 (an optimized variant of the CR4354 antibody; see example 8 for the selection of this variant) to viral material in a capture ELISA was tested. To this end, CR4348, CR4283 (a monoclonal anti-WNV antibody; positive control for inactivated WNV and particle similar to WNV and negative control for rabies virus), CR4354L4328 and CR4104 (a monoclonal anti-virus virus were coated. rabies; positive control for rabies virus and negative control for inactivated WNV and VNO-like particle) at a concentration of 5 mg / ml on Maxisorp ™ ELISA plates. After coating, the plates were blocked in PBS containing 1% Protifar for 1 hour at room temperature. Next, a serial dilution of complete inactivated WNV, WNV-like particles, or rabies virus (inactivated with GLP) in PBS / protifar in a volume of 100 ml was performed until a dilution of 1/2048 was reached. The viral material was allowed to incubate for 1 hour at room temperature. Plates were emptied and washed 3 times with 100 µl of PBS containing 0.1% v / v Tween-20. Next, the 7H2 mouse monoclonal antibody (Bioreliance) was added at a concentration of 1 mg / ml (diluted in PBS / protifar) for the detection of inactivated WNV and WNV-like particles. In addition, the mouse monoclonal antibody 1112 directed against the rabies virus was added in a 1: 1000 dilution (diluted in PBS / protifar) for the detection of rabies virus. Bound monoclonal antibodies were detected by OD measurement at 492 nm with a peroxidase-conjugated anti-mouse antibody (Jackson) in a 1: 2000 dilution in PBS / protifar. CR4348, CR4283 and CR4354L4328 showed a very high binding to WNV-like particles joining CR4348 with double efficacy compared to CR4354L4328 (data not shown). In addition, CR4348, CR4283 and CR4354L432B also joined VNO (data not shown). When the rabies virus capture ELISA was performed, binding was observed with the positive control CR4104 and the antibody CR4348. No binding of the CR4354L4328 antibody was observed (data not shown).

Example 6

In vitro neutralization of WNV using scFv and specific WNV IgG (virus neutralization assay)

In order to determine if the scFv selected could block WNV infection, in vitro neutralization assays (VNA) were performed. VNAs were performed in Vero cells (ATCC CCL 81). The strain of WNO 38599 that is used in the assay is diluted to a titer of 4x103 TCID50 / ml (50% tissue culture infective dose per ml), the titer being calculated according to the method of Spearman and Kaerber. Serial 2-fold dilutions of scFv preparations are made in PBS starting from 1: 2 (1: 2 -1: 1024). 25 µl of the respective scFv dilution is mixed with 25 µl of virus suspension (100 TCID50 / 25 µl) and incubated for one hour at 37 ° C. The suspension is then pipetted twice in triplicate into 96-well plates. Next, 50 µl of a freshly trypsinized and homogeneous Vero cell suspension (1: 3 division of the confluent monolayer of a T75 flask) resuspended in DMEM with 10% v / v fetal calf serum and antibiotics are added. The inoculated cells are cultured for 3-4 days at 37 ° C and observed daily to detect the development of cytopathic effect (CPE). The CPE is compared with the positive control (cells inoculated with WNV) and negative controls (cells simulated inoculated or cells incubated with scFv only). The complete absence of CPE in an individual cell culture is defined as protection (= 100% reduction in titre). The dilution of the serum that provides protection in 50% of the wells (i.e. three of six wells) is defined as the 50% neutralizing antibody titer. The murine neutralizing antibody 7H2 (Biorelience) is used as a positive control in the assay. A 50% neutralization titer of  1: 4 (meaning that the antibody is diluted 4 times or more) is considered as a specific test of scFv neutralizing activity against WNV.

Alternatively, in vitro neutralization assays (VNA) were performed in order to determine whether anti-WNV IgGs could block WNV infection. VNAs were performed essentially as described for scFv, with the proviso that the dilution of serum providing protection in 66% of the wells (i.e. two of three wells) was defined as the neutralizing antibody titer of 66 % and a neutralization titer of 66% of  1: 2 was considered as a specific test of the neutralizing activity of IgG against WNV.

Supernatants containing the anti-WNV antibodies designated CR4348 and CR354 were expressed as described in Example 5 and were subjected to the VNAs described above. All antibodies had a neutralizing titer  1: 2. The potency of the antibodies (in g / ml) is given in Table 11.

Example 7

In vivo protection by monoclonal antibodies against fatal WNV infection in a murine exposure model

A murine exposure model was adapted from the literature (see Ben-Nathan et al. 2003; Beasley et al. 2002; Wang et al. 2001). In Ben-Nathan et al. (2003) 4-week-old BALB / c mice were used and the animals were inoculated intraperitoneally (ip) 20 times the viral dose that resulted in a 50% survival (LD50) of the WNO strain ISR52 ( the LD50 was equivalent to 5 pfu). With this dosage, the mice succumbed to the infection 6-7 days after inoculation and reached 100% mortality after 11 days. In another study, the US99 strain of WNV (used in the experiments described herein) was shown to have a LD50 of 0.5 pfu. This is 10 times lower than the LD50 of ISR52, which may indicate a higher degree of neuroinvasivity for this viral strain or differences associated with the mouse strain used (see Beasley et al. 2002).

To determine the LD50 i.p. of USA99 in 4-week-old BALB / c mice, animals (5 per group) were injected USA99 to TCID50 (infectious dose in tissue culture) of 100, 30, 10, 3, 1, 0.3, 0 , 1, 0.03 50% in two separate experiments. The LD50 calculated from this first experiment was 5.75 TCID50 and from the second experiment 13.25 TCID50. For the calculation of the viral dose in additional experiments, the average of the two experiments, ie 9.5 TCID50, was calculated by Probit regression analysis.

The protective ability of the in vitro neutralizing antibodies CR4348 and CR4354 in the in vivo model was tested. Purified antibodies were injected via i.p. in 4-week-old BALB / c mice (5 animals per group) at a concentration of 15 mg / kg. After 24 hours, the US99 strain of WNV was injected via i.p. at a dose of 20 times the calculated LD50. Animals were observed to detect signs of disease over 21 days and were sacrificed when symptoms of encephalitis were evident. In the model, unprotected animals generally succumbed to infection between day 8 and day 10.

Table 12 shows that the two antibodies, CR4348 and CR4354, are 100% protective in vivo at the dose of 15 mg / kg. The 7H2 positive control antibody (a murine anti-WNV monoclonal antibody) was fully protective and the negative control antibody (which binds to an irrelevant antigen) showed no protection in the experiment.

To establish a dose-protection relationship, the protective antibody CR4348 in the mouse model was titrated using doses of 10, 3, 1, 0.3, 0.1, 0.03, 0.01, 0.003 and 0.001 mg / kg Using the same doses, an optimized variant of the CR4354 antibody, ie CR4354L4328, was titrated in the mouse model (see example 8 for the selection of this variant). A negative control antibody that binds to an irrelevant antigen was included as a control at a dose of 10 mg / kg.

Figure 1 shows that the CR4354L4328 antibody is 100% protective at a dose of 0.03 mg / kg. The doses of 10, 3, 1, 0.3 and 0.1 mg / kg were also 100% protective (data not shown). Figure 1 also shows that there is a direct correlation between dose and protective capacity. The 50% protective dose calculated by Probit regression analysis is 0.003 mg / kg.

Figure 2 shows that the CR4348 antibody is 100% protective at a dose of 0.1 mg / kg. The doses of 10, 3, 1 and 0.3 mg / kg were also 100% protective (data not shown). Figure 2 also shows that there is a direct correlation between dose and protective capacity. The 50% protective dose calculated by Probit regression analysis is 0.006 mg / kg.

Antibody titration data were compared by Probit regression analysis. The values for the Pearson goodness of fit test (Chi square = 10.38, DF = 30, p = 1.00) showed that the model was valid and the results of the parallelism test (Chi square = 3.47 , DF = 3, p = 0.324) meant that the curves could be compared reliably. The values for the 50% protective dose and the 95% protective dose are summarized in Table 13.

Example 8

Selection of optimized variants of the CR4354 neutralizing monoclonal antibody

The monoclonal antibody CR4354 was selected which was shown to have WNV neutralizing activity in vitro and was 100% protective in vivo to improve its potency and affinity. This was done based on the following hypothesis. The specificity of CR4354 (as determined by the CDR3 region in the heavy chain variable chain) is one that selects as a potent VNO neutralizing epitope, but the light chain that is randomly paired with the heavy chain (through the heavy chain). phage display process) does not optimally recreate the original antigen binding site. Mating with a more optimally mutated light chain could improve the "fit" of the antibody binding pocket for the related antigen. Therefore, light chain replacement could be a way to improve the potency and affinity of the antibody.

Heavy and light chain analysis of the CR4354 antibody showed that they belong to the VH1 1-46 (DP-7) and Vlambda1 (1c-V1-16) gene family, respectively. Additional analyzes of WNV specific scFv selected from the WNV immune library as described in Example 1 revealed 5 scFv, ie SC04-261, SC04-267, SC04-328, SC04-335 and SC04-383 ( these scFv were not included in table 8), which had light chains that had the same gene family as the CR4354 light chain. None of the scFv or their respective IgG showed WNV neutralizing activity. Each of these light chains contained mutations in the CDR and framework regions away from the germ line indicating that they had been modified as part of the natural affinity maturation process.

In summary, the construction of the antibodies was as follows. CR4354 was prepared as described in Example 5. The heavy chain variable regions of scFvs named SC04-261, SC04-267, SC04-328 and SC04-335 were amplified by PCR using oligonucleotides to attach restriction sites and / or sequences for expression in the IgG expression vector pSyn-C18-HC1 and were cloned into this vector. Amplification was performed using the following oligonucleotide sets: SC04-261, 5HA (SEQ ID NO: 51) and sy3H-A (SEQ ID NO: 52); SC04-267, 5H-A (SEQ ID NO: 51) and sy3H-C (SEQ ID NO: 55); SC04-328, 5H-A (SEQ ID NO: 51) and sy3HA (SEQ ID NO: 52); and SC04-335, 5H-C (SEQ ID NO: 56) and sy3H-A (SEQ ID NO: 52).

The heavy chain variable region of the scFv called SC04-383 was cloned by restriction digestion using the SfiI and XhoI enzymes in the IgG expression vector pIg-C911-HCgamma1.

The light chain variable region of the scFv named SC04-267 was first amplified using oligonucleotides SC04-267, 5L-C (SEQ ID NO: 49) and sy3L-Amod (SEQ ID NO: 57) and the product was cloned PCR in the vector pSyn-C04-Clambda.

The light chain variable regions of scFvs named SC04-261, SC04-328, SC04-335 and SC04-383 were cloned directly by restriction digestion using the SalI and NotI enzymes for expression in the IgG expression vector pIg- C910-Clambda (SEQ ID NO: 58).

Nucleotide sequences were verified for all constructs according to conventional techniques known to those skilled in the art.

The resulting expression constructs pgG104-261C18, pgG104-267C18, pgG104-328C18, pgG104-335C18 and pgG104-383C911 encoding the heavy chains of anti-WNV human IgG1 and pgG104-261C910, pgG104267104104109104109104109104109 pgG104-383C910 encoding the anti-WNV human IgG1 light chains were expressed transiently in combination in 293T cells and supernatants containing human IgG1 antibodies were obtained.

The nucleotide sequences of the heavy chains of the antibodies designated CR4261, CR4267, CR4328, CR4335, CR4354 and CR4383 are shown in SEQ ID NOs: 59, 61, 63, 65, 31 and 67, respectively (the variable regions are from nucleotides 1-348; 1-381; 1-348; 1-351; 1-363; and 1-372, respectively). The amino acid sequences of the heavy chains of the antibodies designated CR4261, CR4267, CR4328, CR4335, CR4354 and CR4383 are shown in SEQ ID Nos: 60, 62, 64, 66, 32 and 68, respectively (the variable regions are from amino acids 1-116; 1-127; 1-116; 1-117; 1-121; and 1-124, respectively). The light chain nucleotide sequences of the antibodies CR4261, CR4267, CR4328, CR4335, CR4354 and CR438 are shown in SEQ ID NOs: 69, 71, 73, 75, 35 and 77, respectively (the variable regions are from the nucleotides 1-342; 1-330; 1-339; 1-339; 1-330; and 1-339, respectively). The light chain amino acid sequences of the antibodies CR4261, CR4267, CR4328, CR4335, CR4354 and CR4383 are shown in SEQ ID NOs: 70, 72, 74, 76, 36 and 78, respectively (the variable regions are from amino acids 1-114; 1-110; 1113; 1-113; 1-110; and 1-113, respectively).

The expression construct encoding the heavy chain of CR4354 was combined with the constructs expressing the light chains of the respective antibodies for transfection of HEK293T cells essentially as described in Example 5. The antibodies obtained were designated CR4354L4261, CR4354L4267, CR4354L4328, CR4354L4335 and CR4354L4383. Supernatants were tested to detect binding by staining with ELISA as described in example 5 and to determine the potency in the in vitro neutralization assay as described in example 6.

Binding data showed that all the exchanged variants had specificity for the preselected antigen (see Figure 3).

Regarding functional activity, it was concluded that two variants with interchanged chain CR4354L4328 and CR4354L4335 had a higher affinity for WNV compared to CR4354. CR4354L4261 bound the virus with a similar affinity compared to CR4354, while both CR4354L4383 and CR4354L4267 bound with a lower affinity to the virus compared to CR4354 (see Figure 3).

In addition, the CR4354L4383 and CR4354L4267 antibodies showed no neutralizing activity of WNV, which matched their lower binding affinity. CR4354L4261 had a neutralization endpoint concentration similar to the original CR4534 antibody, which again matched the binding data. CR4354L4335 which bound VNO with a higher affinity compared to CR4354 had a lower neutralizing activity compared to the original CR4534 antibody. In contrast, the CR4354L4328 antibody variant that had a higher affinity for WNV compared to CR4354 also had a higher neutralizing activity compared to the original CR4534 antibody (see Table 14). In 4 of 5 cases, there was a direct correlation between binding affinity and neutralization power of the variants. It was shown that the substitution of similar light chains can improve a functionality of interest of an antibody, for example affinity or neutralizing activity.

In addition, CR4354 was converted to a fully human IgM format by removing the Fc gamma region of the pgG104-354C18 construct by restriction digestion with the NheI and XbaI endonucleases. The pCR-IgM vector (SEQ ID NO: 146) containing a Fc mu region with the same restriction enzymes was digested and the Fc mu region obtained in the pgG104-354C18 vector was ligated and fused in frame with the chain gene variable weight derived from SC04-354 to prepare the vector pgM104-354C899. This construct was expressed transiently in combination with the light chain construct pgG104-354C04 (see above) in 293T cells and supernatants containing human IgM antibodies were obtained. The nucleotide sequence of the vector pgM104-354CB99 is shown in SEQ ID NO: 147. The amino acid sequence of the heavy chain of the antibody called CRM4354 is shown in SEQ ID NO: 148. The IgM antibody was purified from the supernatant by adding ammonium sulfate to a final concentration of 2.4 M and incubating the mixture overnight on ice, with stirring. The precipitated IgM was recovered by centrifugation at 10,395xg for 30 minutes. The pellet was resuspended in PBS and further purified by gel filtration. A column of quality of preparation HiLoad 26/60 Superdex 200 (GE healthcare) equilibrated with PBS with the resuspended IgM was loaded and fractions were collected from the column, while washing under a constant flow rate with PBS. The first major elution peak, which contained the purified IgM, was collected. Antibody binding activity was confirmed by titration in particles similar to West Nile virus (VLP) (data not shown).

Example 9

In vitro neutralization power determined by plaque reduction neutralization test (PRNT)

To further investigate the neutralizing activity of the antibodies of the invention, a PRNT was developed. In summary, they were trypsinized and a Vero-E6 cell count was performed. 2.5x105 cells were added to each well of a 12-well plate and incubated overnight at 37 ° C in a humidified CO2 incubator. Serial dilutions were made (10 times) of a stock solution titled of West Nile virus USA99b in complete medium. Mixtures of equal volume (250 µl) of virus (100 pfu) and serial dilutions of purified IgG1 antibodies were incubated in duplicate at 37 ° C for 1 hour. Dilutions of both virus and antibodies were made in DMEM medium. The mixture (400 µl) was then added to the 12-well plates containing Vero cell monolayers after careful aspiration of the medium overnight. After incubating the plates at 37 ° C for 1 hour, a 1.5 ml coating of CMC carboxymethylcellulose medium with 10% FBS (v / v) (CMC medium: complete) was added per well and the plates were placed in an incubator of humidified CO2 for 3 days at 37 ° C. One day before staining, the CMC: complete medium was removed from the wells and replaced with a mixture of CMC: PBS (1: 1; v / v) containing neutral red 8.25 mg / ml (2 ml of red neutral at 3.3 g / l in 80 ml of CMC: PBS). The plates were incubated 1 more day at 37 ° C in a humidified CO2 incubator, after which the number of visible plates was quantified.

To analyze the potency data of the antibodies from the PRNT, a binary regression model known as Probit analysis was used. The Probit analysis is valid, if it can be assumed that the probability of neutralizing WNV in vitro follows a normal distribution with respect to the amount of antibodies used. The assumption of normality most likely follows a logarithmic scale, since virus neutralization was modeled as a function of the logarithm of the amount of antibodies administered. Antibodies were compared directly in the regression model, with an alpha significance level set at 0.05. Antibody concentrations that produced 50% and 90% neutralization were estimated from the model, along with 95% confidence intervals. Table 15 provides a summary of the final analysis of the antibodies. When converting CR4354 to IgM format (CRM4354) the power was increased dramatically in vitro (see table 15).

Using the assay described above, the antibodies were tested to determine their neutralization potential against other flaviviruses including yellow fever virus, Japanese encephalitis virus, St. Louis encephalitis virus and Dengue virus 2. Figure 4 shows that CR4348 had a significant neutralizing activity against St. Louis encephalitis virus and Dengue 2 virus.

Example 10

Identification of CR4348 and CR4354L4328 target antigens

To identify the target antigens of the CR4348 and CR4354L4328 antibodies, a human fetal brain protein expression library was examined with the antibodies. The cDNA library was constructed in the bacterial expression vector pQE-30 (Qiagen) for IPTG-inducible expression of (His) 6 tail fusion proteins. The library consisted of 38,016 clones with an average insert of 1500 bp and were printed in duplicate on the membranes. To identify the target antigens, the CR4348, CR4354L4328 and a negative control antibody (CR4374) (RZPD (Heidelberg, Germany)) were subjected to protein microarray analysis. Two independent experiments with the antibodies were performed. Protein matrices were incubated with the primary antibody and binding was detected with a secondary anti-human conjugate antibody. Clones were considered positive if duplicate spots appeared that were not present with the secondary antibody alone. The negative control showed no reactivity, while 5 different clones reacted with CR4348 and 4 different clones with CR4354L4328. The reactive clones were sequenced and used for database search in the NCBI database using the BLAST nucleotide to nucleotide program. The identity of the clones is represented in table 16.

To confirm the data of the protein matrix obtained with CR4348 and CR4354L4328, the different cDNA clones were expressed. The 9 different clones and a bacterial clone expressing WNV protein E were streaked on an agar plate and grown overnight at 37 ° C. Next, 10 ml volumes of LB were inoculated with the nine different clones and the VNO protein E control clone. Bacteria were grown overnight at 37 ° C. The next day the cultures were diluted 1:50 and grown until an OD was reached at 600 nm of 0.6, subsequently the expression of the protein was induced by adding IPTG and the cells were collected after 4 hours of induction in three 1 ml portions. Each portion was then subjected to a different extraction procedure that allowed the extraction of soluble and non-soluble proteins. The VNO protein E clone was included as a positive control in the test, since this protein is expressed as a soluble protein and is therefore present in all three extraction procedures. All methods began with a three freeze-thaw cycle of sediment. In the first method, the sediment was extracted in one volume twice the volume of the cell pellet in a soft extraction buffer (50 mM Na2HPO4, 300 mM NaCl, 0.05% Tween-20 buffer with 1 mg / ml lysozyme) by incubating the cell pellet for 30 minutes on ice, the cells were then sedimented and the supernatant was stored for analysis (fraction 1). Subsequently, the sediment was extracted with a more rigorous buffer (0.2% DOC -Titon X-100 at 1%) and twice the volume of the cell sediment was resuspended. After an incubation period of 30 minutes on ice, the cells were pelleted and the supernatant was stored for analysis (fraction 2). In the second method (an adaptation of the colony immunoblot procedure), the sediment was lysed by the addition of 10% SDS (double the volume of the cell pellet). After 10 minutes of incubation at room temperature, the suspension was denatured with an equal volume of 5 M NaOH containing 1.5 M NaCl for 5 minutes at room temperature. By adding an equal volume of 1.5 M NaCl, 0.5 M Tris pH 7.4 the suspension was neutralized. Next, the cell debris was sedimented and the supernatant was stored for analysis (fraction 3). In the third method, inclusion bodies were solubilized and the sediment was extracted by the addition of 8 M urea in 100 mM Tris / HCl 100 mM Na2HPO4 in a volume twice the volume of the cell pellet. After 30 minutes of incubation at room temperature, cell debris was sedimented and the supernatant was stored for analysis (fraction 4). The proteins extracted with each procedure were placed on a nitrocellulose filter. In addition, controls were placed, ie purified WNV protein E (negative control) and human IgG (positive control). The membranes were blocked overnight with 4% 4% milk powder in TBST at 4 ° C. Subsequently, the immunoblotting was incubated with 5 µg / ml of CR4348, CR4354L4328 or the murine VNO anti-protein E monoclonal antibody 7H2. The antibody used for the detection of WNV protein E recognizes a linear epitope and still reacts with the recombinant protein after treatment with denaturing reagents such as 8 M urea (method 3). After an incubation period of 1 hour at room temperature in a rotating incubator, the membranes were washed three times for five minutes with TBST. Antibody binding was detected with goat anti-mouse (DAKO) or goat anti-human antibodies conjugated with HRP (Pharmingen). Finally, the membranes were thoroughly washed in TBST followed by a PBS wash step. The reactive proteins were revealed by the ECL chemofluorescent detection system (Amersham).

CR4348 reacted with fractions 1, 2 and 3 of the FAF-1 expression clone (data not shown). CR4354L4328 reacted only with fraction 3 of the NADH expression clone flavoprotein 1 dehydrogenase (NDUFV1) (data not shown). This indicates that both antibodies react with a single expression clone. It was also concluded that both antibodies recognize a conformational epitope, since they did not react with the extracted protein using 8 M urea, while anti-WNV antibodies that recognize a linear epitope did react with the extracted protein using this procedure (data not shown) . In conclusion, CR4348 recognizes an epitope present in the FAF-1 protein, while CR4354L4328 recognizes an epitope present in the NDUFV-1 protein.

To confirm the identification of NDUFV-1 as the target antigen recognized by CR4354L4328, mRNA from 2 * 107 293T cells was extracted using the NucleoTrap mRNA mini-purification kit (Beckton Dickinson) according to protocols provided by the manufacturer. RT-PCR was performed on the isolated mRNA. For the PCR procedure, the following primers were designed: direct primer 5’-ATGAAGGTGACAGCGTGAGGTGAC-3 ’(SEQ ID NO: 160) and reverse primer 5’-ACATGGATAGACGCAGGACAGCAG-3’ (SEQ ID NO: 161). PCR was performed with Pfu (Promega) in the presence of 5% DMSO and resulted in a 1500 bp product. The resulting fragment was cloned into the pCR4TOPO vector (Invitrogen) and transformed into DH5 cells. The resulting clone, TOPONDUFV1, was verified by sequence analysis and aligned with the sequence present in the database. To simplify the detection of the protein in subsequent transfection experiments, the protein was fused with a myc marker at the 5 'end of the primer by means of PCR (using the construct as a template). For the 5’myc construction, the following primers were designed: direct primer 5’AAGCTTAGCATGGAACAAAAACTTATTTCTGAAGAAGATCTGCTGGCAACACG GCGGCTGCTCGGCTG-3 ’(SEQ ID NO: 162) and reverse primer 5’-GATATCCTTTATTGTCCAG 163 IDAG 163 Q IDAC 163 163 G IDAC’ 163 PCR was performed using Pfu polymerase and the resulting 5'myc marker fragment was cloned into PCRblunt4-TOPO, and subsequently digested with HindIII-EcoRV. The resulting fragment was cloned into the corresponding sites of pDNA3,1 / zeo (Invitrogen) resulting in the mycNDUFV-1 construct. Construction was verified by sequencing. All cloning procedures were performed according to conventional molecular techniques. 3 * 105 293T cells were seeded in T175 flasks and subjected to a transfection procedure after 72 hours. The mycNDUFV-1 expression construct and an ATAD3Amyc positive control construct were transfected with lipofectamine (Gibco) according to the manufacturers instructions. 72 hours after transfection, the cells were lysed in DOC buffer (1% Triton X-100 and 0.5% w / v deoxycholate in 0.2 M phosphate buffer containing 0.12 M NaCl, pH 7.4 and protease inhibitors (Sigma). Insoluble material was removed by centrifugation for 30 minutes at 4 ° C at 20,000 * g. Next, the lysates of the transfected cells were analyzed to determine the amount of myc-labeled protein expressed. Then, the lysate was previously cleared with protein A (Amersham) beads for 2 hours at 4 ° C. Meanwhile, 4 deg of CR4354L4328, control antibody CR4374 (negative control, antibody directed against WN protein E) and control antibody CR2361 IgG1 (positive control; antibody directed against ATAD3A) were coupled to protein A beads at room temperature. Next, previously cleared samples were incubated with the IgGs coupled to the beads for 2 hours at 4 ° C. Protein A beads were washed three times for 5 minutes with 1 ml of DOC lysis buffer and the bound complexes were eluted by the addition of sample loading buffer. The samples were subjected to SDS-PAGE under non-reducing conditions. After immunoblotting on PVDF membranes, myc-labeled proteins were detected with the 9E10 anti-myc monoclonal antibody conjugated with HRP (Amersham). Immunoblotting developed with the anti-myc antibody showed that mycNDUFV-1 only immunoprecipitated by CR4354L4328 and not by any of the other antibodies (see Figure 5). In addition, the ATAD3Amyc protein was only immunoprecipitated by CR2361 (data not shown).

Example 11

Distribution of the antigen recognized by CR4348 and CR4354L4328 in 293T cells and HEK293T cells transfected with VLP as shown by FACS

The distribution of the target antigens recognized by the CR4348 and CR4354L4328 antibodies was analyzed by flow cytometry in three different ways: a) using HEK293T cells in permeabilized format, b) using HEK293T cells in non-permeabilized format, and c) using HEK293T cells transfected with VLP of VNO not permeabilized. 293T cells were obtained from ATCC CRL-11268 and collected with trypsin / EDTA. One part of the cells was fixed and permeabilized for intracellular staining with the IntraStain dye from DakoCytomation (K2311) according to the manufacturer's instructions, the other part of the cells were stained extracellularly and incubated directly with the antibodies after collection. For each sample, 100,000 cells were incubated with 2.5 µg / ml of CR4354L4328, CR4348 or control antibodies CR2300, CR4374 and CR4104 diluted in PBS containing 1% BSA. CR2300 is a positive control antibody (which recognizes CD46 that is present in nucleated cells); CR4374 recognizes WNV protein E and is the positive control antibody for 293T cells transfected with VLP and the negative antibody for 293T cells not transfected; and CR4104 recognizes rabies virus glycoprotein and is included as a negative control for all stains. The antibodies were incubated with the cells for 1 hour on ice and the cells were collected three times with PBS / BSA. The binding of the antibodies to the cells after incubation for 1 hour on ice with human goat anti-phycoerythrin antibody (Pharmingen) was visualized. The cells were washed twice in PBS / BSA before analysis. In the extracellular staining experiment, dead or permeable cells were excluded from the analysis by staining with 7-AAD, a dye that stains the nuclear DNA. 293T cells transfected with VLP were collected 24 hours after transfection and stained according to the method described above for extracellular staining. The cells were analyzed in a FACScalibur (BD) device using the CellQuest software. For the final analysis of extracellularly stained cells, the cells were activated based on frontal dispersion against a low 7-AAD signal. A sample was considered positive if the average fluorescence intensity was more than twice the signal obtained with the negative control antibody. As shown in Table 17, CR4348 and CR4354L4328 both recognize an intracellular target antigen that is not expressed on the cell surface under normal culture conditions. However, after transfection with the DNA construct for the production of VNO-VLP, the target antigens of CR4348 and CR4354L4328 were detected on the cell surface. The antibodies reacted specifically with antigens expressed after transfection with VNO-VLP, since they did not bind to the cell surface of simulated transfected cells (data not shown). When the antibodies were applied in a serial dilution, they were bound to the target antigens in a dose-dependent manner (data not shown).

From these combined expression data it was concluded that the antigens recognized by CR4348 and CR4354L4328 are located intracellularly in healthy, normal cells. However, after simulating a WNV infection by introducing a VNO-VLP construct into the cells, the antigens came to express themselves on the cell surface.

Example 12

Intracellular location of CR4354L4328 and CR4348 target antigens demonstrated by immunofluorescence

The intracellular location of the CR4354L4328 and CR4348 target antigens was analyzed by immunofluorescent staining of the cells. VERO cells and 293T cells were seeded at a confluence of 20% in 4-well LAB-TEK chambers (Nuno). 24 hours after planting the cells, a part of the VERO cells was infected with 8.1E-3 TCID50 / cell of the 385-99 strain of WNV. A part of the 293T cells was transfected with the VNO-VLP construct. VERO and 293T cells that were not used for infection or transfection were grown for an additional 24 hours. 24 hours after infection or transfection, all VERO and 293T cells were fixed with 2% formaldehyde in PBS for 15 minutes at room temperature. They were then kept in PBS until the staining procedure. To allow the antibodies to react with the intracellular antigens in the cell, the cells were permeabilized with 0.2% Triton X-100 in PBS for 5 minutes at room temperature and rinsed for 15 minutes. The cells were then blocked with 2% BSA in PBS for 1 hour at room temperature. Subsequently, different stains were performed. Double stains: the

5

10

fifteen

twenty

25

30

35

40

Four. Five

CR4354L4328, CR4348, C4104 and CR4283 antibodies at a concentration of 5 µg / ml in 2% BSA for 1 hour at room temperature. After 3 5-minute washes in PBS, the antibodies were visualized by the addition of goat anti-human antibody stained with Alexa fluor 488 at a concentration of 5 µg / ml in 2% BSA containing 5 units of Bodipy phalloidin (Molecular probes) to stain the structure of the cytoskeleton. The cells were incubated for 1 hour at room temperature in the dark. Next, 3 5-minute washes were performed with PBS and anti-bleaching agent (Vectashield) was added to prevent discoloration of the fluorescent signal. Then a glass coverslip was attached on top with opaque nail lacquer (Miss Helen, HEMA). Triple stains were performed to analyze the joint location of CR4348 and CR4354L4328 with their FAF-1 and NDUFV1 target antigens. The slides were visualized under a Leica TCS-NT confocal laser scanning microscope. Staining of VERO cells not infected with CR4348 demonstrated a network-like pattern consisting of tiny vesicles. After infection with WNV, larger vesicles appeared that dispersed throughout the cytoplasm. Staining of non-infected VERO cells with CR4354L4328 demonstrated a bright nuclear staining. After infection of VERO cells with WNV, densely packed vesicles appeared throughout the cytoplasm and nucleus staining disappeared. In 293T cells, the target for CR4348 was located in vesicle-like structures near the cell membrane. After transfection with the VLP construct, a brighter staining pattern appeared and vesicles were also located throughout the cytoplasm. In 293T cells, CR4354L4328 stains small vesicles that were located throughout the cytoplasm in densely packed structures. After the transfection of the VLP construct, the appearance of the vesicles in densely packed structures disappeared and the vesicles dispersed throughout the cell and showed a bright staining pattern.

Example 12

Rabies virus neutralization with CR4354L4328

To investigate the neutralizing activity of CR4354L4328 on other viral species, the antibody was tested in an RFITT experiment for neutralization of rabies virus. RFFIT was carried out by mixing serial dilutions five times of CR4354L4328, CR4374 (negative control; VNO anti-protein E antibody) and CR57 (positive control; rabies anti-virus antibody) with a constant amount of rabies virus (50 FFD50 / 0.1 ml) on a multi-chamber slide. A unit of the virus is determined as the dilution at which 50% of the microscopic fields observed contain one or more foci of infected cells, the focus formation dose, FFD50. After allowing the mixture to react in a CO2 incubator at 37 ° C for 90 minutes, mouse neuroblastoma cells (MNA) were added in Eagle's minimum essential medium with 10% fetal bovine serum (MEM-10) to each antibody mixture monoclonal-virus resulting in a final concentration of 1 * 105 cells / ml. Cell cultures-virus-monoclonal antibody were incubated for 20 hours in a CO2 incubator at 37 ° C. The cultures were removed from the incubator, washed, fixed and then stained with a rabies anti-rabies virus antibody conjugate and observed under a fluorescence microscope to determine the presence of fluorescent cells; 20 microscopic fields (160X -200X) were read for each dilution of monoclonal antibody and compared with the virus control (50 FFD50 / 0.1 ml), which should contain 18 to 20 fields with fluorescent cells. The 50% neutralization endpoint of a particular antibody is defined as the dilution at which 50% or more of the microscopic fields observed contain one or more infected cells and was calculated using the Reed-Muench method. Virus neutralizing antibody titers were normalized to international units (U.I.) using the reference R3 batch of NIH US standard human rabies virus immunoglobulin (SRIG). The 50% neutralization point of CR57 was obtained at a concentration of 7.3 ng / ml. The 50% neutralization point of CR4354 was obtained at a concentration of 9.2 µg / ml. The CR4374 control antibody could not neutralize the rabies virus at any concentration tested. The results clearly show that CR4354L4328 has rabies virus neutralizing activity.

Table 1: Primers of the variable region of the human lambda chain (sense).

Primer Name

Primer Nucleotide Sequence SEQ ID NO

HuV1A

SEQ ID NO: 79

HuV1B

SEQ ID NO: 80

HuV1C

SEQ ID NO: 81

HuV2

SEQ ID NO: 82

HuV3A

image 1 SEQ ID NO: 83

HuV3

SEQ ID NO: 84

HuV4

SEQ ID NO: 85

HuV5

SEQ ID NO: 86

HuV6

SEQ ID NO: 87

HuV7 / 8

SEQ ID NO: 88

HuV9

SEQ ID NO: 89

Table 2: Variable region primers of human kappa chain (sense).

Primer Name

Primer Nucleotide Sequence SEQ ID NO

HuV1B

SEQ ID NO: 90

HuV2

SEQ ID NO: 91

HuV3

SEQ ID NO: 92

HuV4

SEQ ID NO: 93

HuV5

SEQ ID NO: 94

HuV6

SEQ ID NO: 95

Table 3: Extended human kappa chain variable region primers with SalI restriction sites (sense), extended human kappa chain J region primers with NotI restriction sites (antisense), extended human lambda chain variable region primers with sites of restriction SalI (sense) and primers of region J of human lambda chain extended with restriction sites NotI (antisense).

Primer Name

Primer Nucleotide Sequence SEQ ID NO

HuVB-SalI

SEQ ID NO: 96

HuV2-SalI

SEQ ID NO: 97

HuV3B-SalI

SEQ ID NO: 98

HuV4B-SalI

SEQ ID NO: 99

HuV5-SalI

SEQ ID NO: 100

HuV6-SalI

SEQ ID NO: 101

HuV1-NotI

SEQ ID NO: 102

HuJ2-NotI

SEQ ID NO: 103

HuJ3-NotI

image 1 SEQ ID NO: 104

HuV4-NotI

SEQ ID NO: 105

HuV5-NotI

SEQ ID NO: 106

HuV1A-SalI

SEQ ID NO: 107

HuV1B-SalI

image 1 SEQ ID NO: 108

HuV1C-SalI

SEQ ID NO: 109

HuV2-SalI

SEQ ID NO: 110

HuV3A-SalI

SEQ ID NO: 111

HuV3B-SalI

image 1 SEQ ID NO: 112

HuV4-SalI

SEQ ID NO: 113

HuV5-SalI

SEQ ID NO: 114

HuV6-SalI

SEQ ID NO: 115

HuV7 / 8-SalI

SEQ ID NO: 116

HuV9-SalI

SEQ ID NO: 117

HuJ-NotI

SEQ ID NO: 118

HuV2 / 3-NotI

SEQ ID NO: 119

HuJ4 / 5-NotI

SEQ ID NO: 120

Table 4: Distribution of the different light chain products throughout the 10 fractions.

Light chain products

Number of alleles Number of fractions Alleles / fraction

Vk1B / Jk1-5

19 1 and 2 9.5

Vk2 / Jk1-5

9 3 9

Vk3B / Jk1-5

7 4 7

Vk4B / Jk1-5

one 5 5

Vk5 / Jk1-5

one

Vk6 / Jk1-5

3

V1A / Jl1-3

5 6 5

V1B / Jl1-3

V1C / Jl1-3

V2 / Jl1-3

5 7 5

V3A / Jl1-3

9 8 9

V3B / Jl1-3

V4 / Jl1-3

3 9 5

V5 / Jl1-3

one

V6 / Jl1-3

one

V7 / 8 / Jl1-3

3 10 6

V9 / Jl1-3

3

Table 5: Heavy chain variable region primers of human IgG (sense).

Primer Name

Primer Nucleotide Sequence SEQ ID NO

HuVH1B / 7A

SEQ ID NO: 121

HuVH1C

SEQ ID NO: 122

HuVH2B

SEQ ID NO: 123

HuVH3B

SEQ ID NO: 124

HuVH3C

image 1 SEQ ID NO: 125

HuVH4B

SEQ ID NO: 126

HuVH4C

SEQ ID NO: 127

HuVH5B

SEQ ID NO: 128

HuVH6A

SEQ ID NO: 129

Table 6: Heavy IgG heavy chain variable region primers extended with SfiI / NcoI (sense) restriction sites and extended human IgG heavy chain J region primers with XhoI / BstEII (antisense) restriction sites.

Primer Name

Primer Nucleotide Sequence SEQ ID NO

HuVH1B / 7A-SfiI

SEQ ID NO: 130

HuVHIC-SfiI

SEQ ID NO: 131

HuVH2B-SfiI

SEQ ID NO: 132

HuVH3B-SfiI

SEQ ID NO: 133

HuVH3C-SfiI

SEQ ID NO: 134

HuVH4B-SfiI

image 1 SEQ ID NO: 135

HuVH4C-SfiI

SEQ ID NO: 136

HuVH5B-SfiI

image 1 SEQ ID NO: 137

HuVH6A.SfiI

SEQ ID NO: 138

HuJH1 / 2-XhoI

SEQ ID NO: 139

HuJH3-XhoI

SEQ ID NO: 140

HuJH4 / 5-XhoI

SEQ ID NO: 141

HuJH6-XhoI

SEQ ID NO: 142

Table 7: Binding of antibodies in single stranded phages (scFv) to West Nile virus (WNV), recombinant WNV protein E, FBS and rabies virus as measured by ELISA at 492 nm).

Phage Antibody Name

NO virus WNV protein E VNO-like particle FBS (5%) Rabies virus

SC04-348

1,026 0.093 0.771 ND 0.063

SC04-354

1,041 0.069 0.811 ND 0.063

SC02-447

0.094 0.057 ND 0.041 ND

SC03-014

0.061 0.060 ND ND 0.062

Pos. Control

0.067 0.056 0.062 ND 0.991

ND means not determined Table 8: Specific single chain PV data for WNV.

ScFv name

SEQ ID NO of nucl sequence. SEQ ID NO of amino acid sequence * HCDR3 (SEQ ID NO :) VH locus VL locus

SC04-348

25 26 (Vh 1-124; Vl 143-250) DKSYYYGSGTSGGWF DP (SEQ ID NO: 5) 3-09 (DP-31) Vk I (O12 / O2-DPK9)

SC04-354

27 28 (Vh 1-121; Vl 140-250) DWGSNYVWGSYPKY (SEQ ID NO: 6) 1-46 (DP-7) Vl 1 (1c -V1-16)

* in parentheses the amino acids that constitute the heavy chain variable region (VH) and the light chain variable region (VL) are shown

Table 9: Data of the CDR regions of the single-chain VNOs specific for WNV.

ScFv name

HCDR1 (SEQID NO :) HCDR2 (SEQID NO :) LCDR1 (SEQ ID NO :) LCDR2 (SEQ ID NO :) LCDR3 (SEQ ID NO :)

SC04-348

7 8 9 10 eleven

SC04-354

12 13 14 fifteen 16

Table 10: Binding of IgG1 antibodies to WNV as measured by ELISA (OD at 492 nm).

Ac

Antibody concentration (g / ml)

20,000

10,000 5,000 2,500 1,250 0.630 0.310 0.160 0.078 0.039 0.000

CR4348

ND 0.370 0,343 0,300 0.251 0.192 0.143 0.122 0.104 0.085 0.003

CR4354

0.291 0.262 0.217 0.167 0.151 0.106 0.067 0.034 0.014 0.010 0.003

Neg control

0.051 ND ND ND ND ND ND ND ND ND ND

10 ND means not determined Table 11: Potency of anti-WNV antibodies in the 66% neutralizing antibody titer assay.

Antibody name

g / ml

CR4348

1.97

CR4354

0.48

Table 12: Protection from fatal exposure to WNV in mice by monoclonal antibodies.

image2

CR4354

5/5

7H2

5/5

IgG1 negative control

0/5

Table 13: Probit analysis of the protective activity of human IgG1 in a murine model of fatal exposure to WNV

Antibody

50% protection 95% protection

(g / kg)

(g / kg)

CR4354L4328

2.74 57.4

CR4348

6.26 131

Table 14: Difference in percentage in the neutralization concentration of 66% of IgG1 variants of CR4354 versus WNV as measured by VNA.

Antibody

Power (%)*

CR4354

100

CR4354L4261

106

CR4354L4267

Below detection

CR4354L4328

286

CR4354L4335

60

CR4354L4383

Below detection

* The potency is represented in comparison to the original CR4354 antibody (whose neutralization concentration of 66% was set at 100%) and was calculated by dividing the neutralization concentration of 66% (in /g / ml) of CR4354 by the concentration 66% neutralization (in g / ml) of chain variants

10 exchanged and multiplying the resulting number by 100%.

Table 15: Neutralization potency against the West Nile virus USA99b strain as measured by PRNT.

Antibody

PRNT50 (95% CI) PRNT90 (95% CI)

(g / ml)

(g / ml)

CR4348

3.72 (3.21 -4.27) 65.2 (52.3 -84.1)

CR4354L4328

21.2 (10.1 -53.4) 1602 (397-20000)

CRM4354

0.17 (0.11 -0.25) 4.3 (2.85 -7.29)

Table 16. Clones reactive with CR4348 and CR4354L4328 as recognized by microarray analysis of 15 proteins.

Antibody

Reactive clone Blast Diana (Homo sapiens)

CR4348

MPMGp800B14568 gi | 19528653 | ref | NM0 07051.2 | Fas Associated Factor 1 (TNFRSF6) (FAF1)

CR4348

MPMGp800G07549Q170 gi | 27924136 | gb | BC044 933.1 | IMAGE clone: 4540326, mRNA, partial CDS

CR4348

MPMGp800005569Q170 gi | 54607125 | ref | NM0 13364.2 | paraneoplastic antigen MA3 (PNMA3), mRNA

CR4348

MPMGp800E02577Q gi | 34364672 | emb | BX64 0642.1 MRNA; DKFZp686K01114 cDNA

CR4348

MPMGp800M04560Q183 gi | 39761682 | gb | AY405 708.1 | CYLN2 gene, VIRTUAL TRANSCRIPT

CR4354L4328

MPMGp800J14549Q gi | 14198175 | gb | BC008 146.1 | NADH dehydrogenase (ubiquinone) flavoprotein 1

CR4354L4328

MPMGp800K13552Q gi | 62087473 | dbj | AB20 8947.1 | MRNA for chordin isoform, a variant protein

CR4354L4328

MPMGp800A02549Q gi | 17149812 | ref | NM 0 57161.2 | Kelch domain containing 3 (KLHDC3)

CR4354L4328

MPMGp800I05513Q gi | 4753262 | gb | AC0063 60.2 PAC clone RP51140N14 of 14q24.3

Table 17. Average fluorescence measured after incubation with 2.5 µg / ml antibody.

Antibody

293T extracellular Intracellular 293T 293T-VLP extracellular

CR4348

16 225 fifteen

CR4354L4328

16 840 eleven

CR4104

fifteen 55 4

CR4374

fifteen 57 19

CR2300

484 236 10

5

10

fifteen

twenty

25

30

35

40

BIBLIOGRAPHY

Beasley DW and Barrett AD (2002), Identification of neutralizing epitopes within structural domain III of the West Nile virus envelope protein. J. Virol. 76: 13097-13100.

Beasley DW, Li L, Suderman MT and Barrett AD (2002), Mouse neuroinvasive phenotype of West Nile virus strains varies depending upon virus genotype. Virology 296: 17-23.

Ben-Nathan D, Lustig S, Tam G, Robinzon S, Segal S and Rager-Zisman B (2003), Prophylactic and therapeutic efficacy of human intravenous immunoglobulin in treating WNV infection in mice. J. Infect. Dis. 188: 5-12.

Boel E, Verlaan S, Poppelier MJ, Westerdaal NA, Van Strijp JA and Logtenberg T (2000), Functional human monoclonal antibodies of all isotypes constructed from phage display library-derived single-chain Fv antibody fragments. J. Immunol. Methods 239: 153-166.

Burton DR and Barbas CF (1994), Human antibodies from combinatorial libraries. Adv. Immunol 57: 191-280.

Chou, TC and P Talalay (1984), Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22: 27-55.

From Kruif J, Terstappen L, Boel E and Logtenberg T (1995a), Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library. Proc. Natl Acad. Sci. USA 92: 3938.

From Kruif J, Boel E and Logtenberg T (1995b), Selection and application of human single-chain Fv antibody fragments from a semi-synthetic phage antibody display library with designed CDR3 regions. J. Mol. Biol. 248: 97-105.

Gollins SW and Porterfield JS (1986), A new mechanism for the neutralization of enveloped viruses by antiviral antibody. Nature 321: 244-246.

Huls G, Heijnen IJ, Cuomo E, van der Linden J, Boel E, van de Winkel J and Logtenberg T (1999), Antitumor immune effector mechanisms recruited by phage display-derived fully human IgGl and IgAl monoclonal antibodies. Cancer Res. 59: 5778-5784.

Kuno G, Chang GJ, Tsuchiya KR, Karabatsos N and Cropp CB (1998), Phylogeny of the genus Flavivirus. J. Virol. 72: 73-83.

Rizzuto CD and Sodroski JG (1997), Contribution of virion ICAM-1 to human immunodeficiency virus infectivity and sensitivity to neutralization. J. Virol. 71: 4847-4851.

Slootstra JW, Puijk WC, Ligtvoet GJ, Langeveld JP, Meloen RH (1996), Structural aspects of antibody-antigen interaction revealed through small random peptide libraries. Mol. Divers 1: 87-96.

Wang T, Anderson JF, Magnarelli LA, Wong SJ, Koski RA and Fikrig E (2001), Immunization of mice against West Nile virus with recombinant envelope protein. J. Immunol. 167: 5273-5277.

<Engle MJ and Diamond MS (2003), Antibody Prophylaxis and Therapy against West Nile Virus Infection in Wild-Type and Immunodeficient Mice. J. Virol. 77: 12941-12949.

Oliphant T, Engle M, Nybakken GE, Doane C, Johnson S, Hunag L, Gorlatov S, Mehlhop E, Marri A, Chung KM, Ebel GD, Kramer LD, Fremont DH, Diamond MS (2005), Development of a humanized monoclonal antibody with therapeutic potential against West Nile virus. Nature Medicine 11: 522-530.>

SEQUENCE LIST

<110> Crucell Holland B.V. Throsby, Mark De Kruif, John

<120> Host cell specific binding molecules capable of neutralizing viruses and their uses

<130> 0142 WO 00 ORD

<150> PCT / EP2005 / 052160

<151> 12-05-2005

<150> PCT / EP2005 / 054002

5 <151> 08-15-2005

<150> PCT / EP2005 / 052946

<151> 06-23-2005

<150> PCT / EP2005 / 052648

<151> 06-08-2005

10 <160> 163

<170> Patentln version 3.1

<210> 1

<211> 2424

<212>

 DNA 15 <213> Homo sapiens

<220>

<221> CDS

<222> (278) .. (2230)

<223>

<210> 2

<211> 650

<212> PRT

<213> Homo sapiens

<400> 2

<210> 3

<211> 1529

<212>

 DNA 5 <213> Homo sapiens

20 <400> 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

<220>

<221> CDS

<222> (39) .. (1428)

<223>

10 <400> 3

image 1

image 1

image 1

image 1

<210> 4

<211> 464

<212> PRT

<213> Homo sapiens

<400> 4

image 1

image 1

image 1

<210> 5

<211> 17

<212> PRT

<213> Artificial sequence

<220>

<223> HCDR3

<400> 5

image 1

10 <210> 6

<211> 14

<212> PRT

<213> Artificial sequence

<220>

15 <223> HCDR3

<400> 6

image 1

<210> 7 <211> 5

<212> PRT

<213> Artificial sequence

<220>

<223> HCDR1

<400> 7

image 1

<210> 8

<211> 17

<212> PRT

<213> Artificial sequence

<220>

<223> HCDR2

<400> 8

image 1

<210> 9

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR1

<400> 9

image 1

<210> 10

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR2

<400> 10

image 1

<210> 11

<211> 9

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR3

<400> 11

image 1

<210> 12

<211> 5

<212> PRT

<213> Artificial sequence

<220>

<223> HCDR1

<400> 12

image 1

<210> 13

<211> 17

<212> PRT

<213> Artificial sequence

<220>

<223> HCDR2

<400> 13

image 1

<210> 14

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR1

<400> 14

image 1

<210> 15

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR2

<400> 15

image 1

<210> 16

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR3

<400> 16

image 1

<210> 17

<211> 372

<212> DNA

<213> Artificial sequence

<220>

<223> Heavy chain variable region 348

<220>

<221> CDS

<222> (1) .. (372)

<223>

<400> 17

image 1

<210> 18

<211> 124

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain variable region 348

<400> 18

image 1

<210> 19

<211> 363

<212> DNA 5 <213> Artificial sequence

<220>

<223> Heavy chain variable region 354

<220>

<221> CDS

10 <222> (1) .. (363)

<223>

<400> 19

image 1

<210> 20

<211> 121

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain variable region 354

<400> 20

image 1

<210> 21

<211> 330

<212> DNA 5 <213> Artificial sequence

<220>

<223> Light chain variable region 348

<220>

<221> CDS

10 <222> (1) .. (330)

<223>

<400> 21

image 1

<210> 22

<211> 110

<212> PRT

<213> Artificial sequence

<220>

<223> Light chain variable region 348

<400> 22

image 1

image 1

<210> 23

<211> 333

<212> DNA 5 <213> Artificial sequence

<220>

<223> Light chain variable region 354

<220>

<221> CDS

10 <222> (1) .. (333)

<223>

<400> 23

image 1

image 1

<210> 24

<211> 111

<212> PRT

<213> Artificial sequence

<220>

<223> Light chain variable region 354

<400> 24

image 1

10 <210> 25

<211> 750

<212> DNA

<213> Artificial sequence

<220>

<223> SC04-348

<220>

<221> CDS

<222> (1) .. (750)

<223>

<400> 25

image 1

image 1

<210> 26

<211> 250

<212> PRT

<213> Artificial sequence

<220>

<223> SC04-348

<400> 26

image 1

image 1

<210> 27

<211> 750

<212> DNA

<213> Artificial sequence

5 <220>

<223> SC04-354

<220>

<221> CDS

<222> (1) .. (750)

10 <223>

<400> 27

image 1

image 1

<210> 28

<211> 250

<212> PRT

<213> Artificial sequence

<220>

<223> SC04-354

<400> 28

image 1

image 1

<210> 29

<211> 1368

<212> DNA

<213> Artificial sequence

5 <220>

<223> CR4348 heavy chain

<220>

<221> CDS

<222> (1) .. (1368)

10 <223>

<400> 29

image 1

image 1

image 1

<210> 30

<211> 456

<212> PRT

<213> Artificial sequence

<220>

<223> CR4348 heavy chain

<400> 30

image 1

image 1

image 1

<210> 31

<211> 1359

<212> DNA

<213> Artificial sequence

<220>

<223> Heavy chain CR4354

<220>

<221> CDS

<222> (1) .. (1359)

<223>

<400> 31

image 1

image 1

image 1

<210> 32

<211> 453

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4354

<400> 32

image 1

image 1

image 1

<210> 33

<211> 645

<212> DNA 5 <213> Artificial sequence

<220>

<223> CR4348 light chain

<220>

<221> CDS

10 <222> (1) .. (645)

<223>

<400> 33 <210> 34

image 1

<211> 215

<212> PRT

<213> Artificial sequence

<220>

<223> CR4348 light chain

<400> 34

image 1

image 1

<210> 35

<211> 648

<212> DNA 5 <213> Artificial sequence

<220>

<223> Light chain CR4354

<220>

<221> CDS

10 <222> (1) .. (648)

<223>

<400> 35

image 1

image 1

<210> 36

<211> 216

<212> PRT

<213> Artificial sequence

<220>

<223> Light chain CR4354

<400> 36

image 1

<210>

37

<210>

 48

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> HuCkappa antisense primer

<400> 37

acactctccc ctgttgaagc tctt

24

<210> 38

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuClambda2 antisense primer

<400> 38

tgaacattct gtaggggcca ctg

2. 3

<210> 39

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuClambda7 antisense primer

<400> 39

agagcattct gcaggggcca ctg

2. 3

<210> 40

<211> 4941

<212> DNA

<213> Artificial sequence

<220>

<223> Vector PDV-C06

<400> 40

image 1

image 1

image 1

image 1

<210> 41

<211> 24

<212> DNA

5

<213> Artificial sequence

<220>

<223> HuCIgG antisense primer

<400> 41

gtccaccttg gtgttgctgg gctt

24

10

<210> 42

<211> 669

<212> PRT

<213> West Nile virus

<400> 42

image3

image 1

image 1

image 1

<210> 43

<211> 23

<212> DNA

5

<213> Artificial sequence

<220>

<223> CMV-Spe primer

<400> 43

ccatgttgac attgattatt gac

2. 3

10

<210> 44

<211> 26

<212> DNA

<213> Artificial sequence

<220>

fifteen

<223> Primer WNV-E-95 REV

<400> 44

gctctagact tgccgatgct gctgcc

26

<210> 45

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> clefsmaquwnv primer

<400> 45

ggaattcagc atggcccagg tgaccctgag caacttccag

40

<210> 46

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> WNVmychis reverse primer

<400> 46

gactagtcaa ctcaatggtg atggtg

26

<210> 47

<211> 6760

<212> DNA

<213> Artificial sequence

<220>

<223> Vector pSyn-C18-HCgammal

<400> 47

image 1

image 1

image 1

image 1

image 1

<211> 6283

<212> DNA

<213> Artificial sequence

<220>

<223> Vector pSyn-C04-Clambda

<400> 48

image 1

image 1

image 1

image 1

image 1

<210> 49

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<223> 5L-C oligonucleotide

<400> 49

acctgtctcg agttttccat ggctcagtcc gtgctgaccc agcctccctc ag

52

<210> 50

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3L-Cmod

<400> 50

ccagcacggt aagcttggtg cctccgcc

28

<210> 51

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-A oligonucleotide

<400> 51

acctgtcttg aattctccat ggcccaggtg cagctggtgc agtctgg

47

<210> 52

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-A

<400> 52

gcccttggtg ctagcgctgg agacggtcac cagggtgccc tggcccc

47

<210> 53

<211> 10515

5

<212> DNA

<213> Artificial sequence

<220>

<223> Vector pIg-C911-HCgammal

<220>

10

<221> misc_feature

<222> (1326) .. (5076)

<223> Stuffing

<400> 53

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

<210> 54

<211> 8777

<212> DNA 5 <213> Artificial sequence

<220>

<223> Vector pIg-C909-Ckappa

<220>

<221> misc_feature

10 <222> (1328) .. (3860)

<223> Stuffing

<400> 54

image 1

image 1

image 1

image 1

image 1

image 1

<210> 55

<211> 47

<212> DNA

5

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-C

<400> 55

gcccttggtg ctagcgctgg agacggtcac ggtggtgccc tggcccc

47

10

<210> 56

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-C oligonucleotide

<400> 56 acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgg 47

<210> 57

5 <211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3L-Amod

10 <400> 57

ccagcacggt aagcttcagc acggtcacct tggtgccagt tcc 43

<210> 58

<211> 8792

<212> DNA 15 <213> Artificial sequence

<220>

<223> Vector pIg-C910-Clambda

<220>

<221> misc_feature

20 <222> (1330) .. (3869)

<223> Stuffing

<400> 58

image 1

image 1

image 1

image 1

image 1

image 1

<210> 59

<211> 1344

<212> DNA 5 <213> Artificial sequence

<220>

<223> Heavy chain CR4261

<220>

<221> CDS

10 <222> (1) .. (1344)

<223>

<400> 59

image 1

image 1

image 1

<210> 60

<211> 448

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4261

<400> 60

image 1

image 1

<210> 61

<211> 1377

<212> DNA

<213> Artificial sequence

5 <220>

<223> Heavy chain CR4267

<220>

<221> CDS

<222> (1) .. (1377)

10 <223>

<400> 61

image 1

image 1

image 1

<210> 62

<211> 459

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4267

<400> 62

image 1

image 1

image 1

<210> 63

<211> 1344

<212> DNA 5 <213> Artificial sequence

<220>

<223> Heavy chain CR4328

<220>

<221> CDS

10 <222> (1) .. (1399)

<223>

<400> 63

image 1

image 1

image 1

<210> 64

<211> 448

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4328

<400> 64

image 1

image 1

image 1

<210> 65

<211> 1347

<212> DNA 5 <213> Artificial sequence

<220>

<223> Heavy chain CR4335

<220>

<221> CDS

10 <222> (1) .. (1397)

<223>

<400> 65

image 1

image 1

image 1

<210> 66

<211> 449

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4335

<400> 66

image 1

image 1

image 1

<210> 67

<211> 1368

<212> DNA 5 <213> Artificial sequence

<220>

<223> Heavy chain CR4383

<220>

<221> CDS

10 <222> (1) .. (1368)

<223>

<400> 67

image 1

image 1

image 1

<210> 68

<211> 456

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CR4383

<400> 68

image 1

image 1

<210> 69

<211> 669

<212> DNA

<213> Artificial sequence

5 <220>

<223> CR4261 light chain

<220>

<221> CDS

<222> (1) .. (669)

10 <223>

<400> 69

image 1

image 1

<210> 70

<211> 223

<212> PRT

<213> Artificial sequence

<220>

<223> CR4261 light chain

<400> 70

image 1

image 1

<210> 71

<211> 648

<212> DNA 5 <213> Artificial sequence

<220>

<223> Light chain CR4267

<220>

<221> CDS

10 <222> (1) .. (648)

<223>

<400> 71

image 1

<210> 72 <211> 216

<212> PRT

<213> Artificial sequence

<220>

<223> Light chain CR4267

<400> 72

image 1

image 1

<210> 73

<211> 666

<212> DNA 5 <213> Artificial sequence

<220>

<223> CR4328 light chain

<220>

<221> CDS

10 <222> (1) .. (666)

<223>

<400> 73

image 1

image 1

<210> 74

<211> 222

<212> PRT

<213> Artificial sequence

<220>

<223> CR4328 light chain

<400> 74

image 1

<210> 75

<211> 666

<212> DNA

<213> Artificial sequence

<220> 5 <223> Light chain CR4335

<220>

<221> CDS

<222> (1) .. (666)

<223>

10 <400> 75

image 1

image 1

<210> 76

<211> 222

<212> PRT

<213> Artificial sequence

<220>

<223> CR4335 light chain

<400> 76

image 1

image 1

<210> 77

<211> 666

<212> DNA

<213> Artificial sequence

<220>

<223> Light chain CR4383

<220>

<221> CDS

<222> (1) .. (666)

<223>

<400> 77

image 1

image 1

<210> 78

<211> 222

<212> PRT

<213> Artificial sequence

<220>

<223> Light chain CR4383

<400> 78

image 1

image 1

<210> 79

<211> 23

<212> DNA

5

<213> Artificial sequence

<220>

<223> HuVlambda1A

<400> 79

cagtctgtgc tgactcagcc acc

2. 3

10

<210> 80

<211> 23

<212> DNA

<213> Artificial sequence

<220>

fifteen

<223> HuVlambdalB

<400> 80

cagtctgtgy tgacgcagcc gcc

2. 3

<210> 81

<211> 23 <400> 85 <213> Artificial sequence <210> 95

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda1C

<400> 81

cagtctgtcg tgacgcagcc gcc

2. 3

<210> 82

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda2

<400> 82

cartctgccc tgactcagcc t

twenty-one

<210> 83

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda3A

<400> 83

tcctatgwgc tgactcagcc acc

2. 3

<210> 84

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda3B

<400> 84

tcttctgagc tgactcagga ccc

2. 3

<210> 85

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda4

cacgttatac tgactcaacc gcc

2. 3

<210> 86

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda5

<400> 86

caggctgtgc tgactcagcc gtc

2. 3

<210> 87

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Huvlambda6

<400> 87

aattttatgc tgactcagcc cca

2. 3

<210> 88

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda7 / 8

<400> 88

cagrctgtgg tgacycagga gcc

2. 3

<210> 89

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Huvlambda9

<400> 89

cwgcctgtgc tgactcagcc mcc

2. 3

<210> 90

<211> 23

<212> DNA

<220>

<223> HuVkappa1B

<400> 90

gacatccagw tgacccagtc tcc

2. 3

<210> 91

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa2

<400> 91

gatgttgtga tgactcagtc tcc

2. 3

<210> 92

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa3

<400> 92

gaaattgtgw tgacrcagtc tcc

2. 3

<210> 93

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa4

<400> 93

gatattgtga tgacccacac tcc

2. 3

<210> 94

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa5

<400> 94

gaaacgacac tcacgcagtc tcc

2. 3

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa6

<400> 95

gaaattgtgc tgactcagtc tcc

2. 3

<210> 96

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa1B-SalI

<400> 96

tgagcacaca ggtcgacgga catccagwtg acccagtctc c

41

<210> 97

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa2-SalI

<400> 97

tgagcacaca ggtcgacgga tgttgtgatg actcagtctc c

41

<210> 98

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa3B-SalI

<400> 98

tgagcacaca ggtcgacgga aattgtgwtg acrcagtctc c

41

<210> 99

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa4B-SalI

<400> 99

tgagcacaca ggtcgacgga tattgtgatg acccacactc c

41

<210> 100

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa5-SalI

<400> 100

tgagcacaca ggtcgacgga aacgacactc acgcagtctc c

41

<210> 101

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa6-SalI

<400> 101

tgagcacaca ggtcgacgga aattgtgctg actcagtctc c

41

<210> 102

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJkappa1-NotI

<400> 102

gagtcattct cgacttgcgg ccgcacgttt gatttccacc ttggtccc

48

<210> 103

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJkappa2-NotI

<400> 103

gagtcattct cgacttgcgg ccgcacgttt gatctccagc ttggtccc

48

<210> 104

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJkappa3-NotI

<400> 104

gagtcattct cgacttgcgg ccgcacgttt gatatccact ttggtccc

48

<210> 105

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJkappa4-NotI

<400> 105

gagtcattct cgacttgcgg ccgcacgttt gatctccacc ttggtccc

48

<210> 106

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJkappa5-NotI

<400> 106

gagtcattct cgacttgcgg ccgcacgttt aatctccagt cgtgtccc

48

<210> 107

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda1A-SalI

<400> 107

tgagcacaca ggtcgacgca gtctgtgctg actcagccac c

41

<210> 108

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda1B-SalI

<400> 108

tgagcacaca ggtcgacgca gtctgtgytg acgcagccgc c

41

<210> 109

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambdalC-SalI

<400> 109

tgagcacaca ggtcgacgca gtctgtcgtg acgcagccgc c

41

<210> 110

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda2-SalI

<400> 110

tgagcacaca ggtcgacgca rtctgccctg actcagcct

39

<210> 111

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda3A-SalI

<400> 111

tgagcacaca ggtcgacgtc ctatgwgctg actcagccac c

41

<210> 112

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda3B-SalI

<400> 112

tgagcacaca ggtcgacgtc ttctgagctg actcaggacc c

41

<210> 113

<211> 41

<212> DNA

<213> Artificial sequence

<220> <211> 48 <400> 122 <213> Artificial sequence <210> 132 <223> HuVH4C-SfiI <212> DNA

<223> HuVlambda4-SalI

<400> 113

tgagcacaca ggtcgacgca cgttatactg actcaaccgc c

41

<210> 114

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda5-SalI

<400> 114

tgagcacaca ggtcgacgca ggctgtgctg actcagccgt c

41

<210> 115

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda6-SalI

<400> 115

tgagcacaca ggtcgacgaa ttttatgctg actcagcccc a

41

<210> 116

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Huvlambda7 / 8-SalI

<400> 116

tgagcacaca ggtcgacgca grctgtggtg acycaggagc c

41

<210> 117

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda9-SalI

<400> 117

tgagcacaca ggtcgacgcw gcctgtgctg actcagccmc c

41

<210> 118

<212> DNA

<213> Artificial sequence

<220>

<223> HuJlambdal-NotI

<400> 118

gagtcattct cgacttgcgg ccgcacctag gacggtgacc ttggtccc

48

<210> 119

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJlambda2 / 3-NotI

<400> 119

gagtcattct cgacttgcgg ccgcacctag gacggtcagc ttggtccc

48

<210> 120

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> HuJlambda4 / 5-NotI

<400> 120

gagtcattct cgacttgcgg ccgcacytaa aacggtgagc tgggtccc

48

<210> 121

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH1B / 7A

<400> 121

cagrtgcagc tggtgcartc tgg

2. 3

<210> 122

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH1C

saggtccagc tggtrcagtc tgg

2. 3

<210> 123

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH2B

<400> 123

saggtgcagc tggtggagtc tgg

2. 3

<210> 124

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3B

<400> 124

saggtgcagc tggtggagtc tgg

2. 3

<210> 125

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3C

<400> 125

gaggtgcagc tggtggagwc ygg

2. 3

<210> 126

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH4B

<400> 126

caggtgcagc tacagcagtg ggg

2. 3

<210> 127

<211> 23

<212> DNA

<220>

<223> HuVH4C

<400> 127

cagstgcagc tgcaggagtc sgg

2. 3

<210> 128

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH5B

<400> 128

gargtgcagc tggtgcagtc tgg

2. 3

<210> 129

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH6A

<400> 129

caggtacagc tgcagcagtc agg

2. 3

<210> 130

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH1B / 7A-SfiI

<400> 130

gtcctcgcaa ctgcggccca gccggccatg gcccagrtgc agctggtgca rtctgg

56

<210> 131

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH1C-SfiI

<400> 131

gtcctcgcaa ctgcggccca gccggccatg gccsaggtcc agctggtrca gtctgg

56

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH2B-SfiI

<400> 132

gtcctcgcaa ctgcggccca gccggccatg gcccagrtca ccttgaagga gtctgg

56

<210> 133

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3B-SfiI

<400> 133

gtcctcgcaa ctgcggccca gccggccatg gccsaggtgc agctggtgga gtctgg

56

<210> 134

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3C-SfiI

<400> 134

gtcctcgcaa ctgcggccca gccggccatg gccgaggtgc agctggtgga gwcygg

56

<210> 135

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH4B-SfiI

<400> 135

gtcctcgcaa ctgcggccca gccggccatg gcccaggtgc agctacagca gtgggg

56

<210> 136

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<400> 136

gtcctcgcaa ctgcggccca gccggccatg gcccagstgc agctgcagga gtcsgg

56

<210> 137

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH5B-SfiI

<400> 137

gtcctcgcaa ctgcggccca gccggccatg gccgargtgc agctggtgca gtctgg

56

<210> 138

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH6A-SfiI

<400> 138

gtcctcgcaa ctgcggccca gccggccatg gcccaggtac agctgcagca gtcagg

56

<210> 139

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> HuJH1 / 2-XhoI

<400> 139

gagtcattct cgactcgaga cggtgaccag ggtgcc

36

<210> 140

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> HuJH3-XhoI

<400> 140

gagtcattct cgactcgaga cggtgaccat tgtccc

36

<210> 141

<211> 36

<213> Artificial sequence

<220>

<223> HuJH4 / 5-XhoI

<400> 141

gagtcattct cgactcgaga cggtgaccag ggttcc

36

<210> 142

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> HuJH6-xhoI

<400> 142

gagtcattct cgactcgaga cggtgaccgt ggtccc

36

<210> 143

<211> 13

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR1

<400> 143

image 1

<210> 144

<211> 7

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR2

<400> 144

image 1

<210> 145

<211> 11

<212> PRT

<213> Artificial sequence

<220>

<223> LCDR3

<400> 145

image 1

5 <210> 146

<211> 5855

<212> DNA

<213> Artificial sequence

<220> 10 <223> Vector pCR-IgM

<400> 146

image 1

image 1

image 1

image 1

<210> 147

<211> 2235

<212> DNA 5 <213> Artificial sequence

<220>

<223> pgM104-354C899

<220>

<221> Intron

10 <222> (681) .. (764)

<223>

<220>

<221> Intron

<222> (1667) .. (1845)

<223>

<220>

<221> Intron

<222> (1101) .. (1345)

<223>

<400> 147

image4

image 1

<210> 148

<211> 576

<212> PRT

<213> Artificial sequence

<220>

<223> Heavy chain CRM4354

<400> 148

image 1

image 1

image 1

<210> 149

<211> 60

<212> DNA

<213> Artificial sequence

<220>

<223> Leader peptide, heavy chain

<220>

<221> CDS

<222> (1) .. (60)

<223>

<400> 149

image 1

5 <210> 150

<211> 20

<212> PRT

<213> Artificial sequence

<220> 10 <223> Leader peptide, heavy chain

<400> 150

image 1

<210> 151

<211> 57

15 <212> DNA

<213> Artificial sequence

<220>

<223> Leader peptide, kappa light chain

<220>

20 <221> CDS

<222> (1) .. (57)

<223>

<400> 151

image 1

25 <210> 152

<211> 19

<212> PRT

<213> Artificial sequence

<220>

<223> Leader peptide, kappa light chain

<400> 152

image 1

<210> 153

<211> 60

<212> DNA 10 <213> Artificial sequence

<220>

<223> Leading peptide, lambda light chain

<220>

<221> CDS

15 <222> (1) .. (60)

<223>

<400> 153

image 1

<210> 154

20 <211> 20

<212> PRT

<213> Artificial sequence

<220>

<223> Leading peptide, lambda light chain

25 <400> 154

image 1

<210>

 155

<210>

 163

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Leader peptide, heavy chain

<400> 155

atgggatgga gctgtatcat cctcttcttg gtactgctgc tggcccagcc ggcc

54

<210> 156

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Leader peptide, kappa light chain

<400> 156

atgcggctgc ccgcccagct gctgggcctt ctcatgctgt gggtgcccgc ctcgag

56

<210> 157

<211> 59

<212> DNA

<213> Artificial sequence

<220>

<223> Leading peptide, lambda light chain

<400> 157

atgcggttct ccgctcagct gctgggcctt ctggtgctgt ggattcccgg cgtctcgag

59

<210> 158

<211> 13

<212> DNA

<213> Artificial sequence

<220>

<223> SfiI Site

<400> 158

ggcccagccg gcc

13

<210> 159

<211> 5

<212> DNA

<213> Artificial sequence

<220>

<223> XhoI / SalI site combined

<400> 159

Tcgac

5

<210> 160

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Direct primer

<400> 160

atgaaggtga cagcgtgagg tgac

24

<210> 161

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer

<400> 161

acatggatag acgcaggaca gcag

24

<210> 162

<211> 68

<212> DNA

<213> Artificial sequence

<220>

<223> Direct primer

<400> 162

image 1

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Reverse primer

<400> 163 gatatccttt attgtccagc attccac 27

Claims (9)

one.

Monoclonal antibody capable of binding to a host cell protein and having flavivirus neutralizing activity, said antibody comprising a heavy and a light chain, wherein said heavy chain comprises a CDR1 region according to SEQ ID NO: 7, a CDR2 region according to SEQ ID NO: 8 and a CDR3 region according to SEQ ID NO: 5; and wherein said light chain comprises a CDR1 region according to SEQ ID NO: 9, a CDR2 region according to SEQ ID NO: 10 and a CDR3 region according to SEQ ID NO: 11, and wherein said host cell protein is a factor 1 associated with Fas.

2.

Monoclonal antibody capable of binding to a host cell protein and having flavivirus neutralizing activity, said antibody comprising a heavy and a light chain, wherein said heavy chain comprises a CDR1 region according to SEQ ID NO: 12, a CDR2 region according to SEQ ID NO: 13 and a CDR3 region according to SEQ ID NO: 6; and wherein said light chain comprises a CDR1 region according to SEQ ID NO: 14, a CDR2 region according to SEQ ID NO: 15 and a CDR3 region according to SEQ ID NO: 16, or a sequence according to SEQ ID NO: 74, and in which said host cell protein is NADH dehydrogenase flavoprotein-1.

3.

Immunoconjugate comprising a monoclonal antibody according to claim 1 or 2, the immunoconjugate further comprising at least one label.

Four.

Nucleic acid molecule encoding a monoclonal antibody according to claim 1 or 2.

5.

Pharmaceutical composition comprising a monoclonal antibody according to claim 1 or 2 and at least one pharmaceutically acceptable excipient.

6.

Monoclonal antibody according to claim 1 or 2 for use as a medicament.

7.

Use of a monoclonal antibody according to claim 1 or 2 in the preparation of a medicament for prophylaxis and / or the treatment of a flavivirus infection.

8.

Use according to claim 7, wherein said flavivirus is a West Nile virus.

9.

Use of a monoclonal antibody according to claim 1 or 2 for in vitro diagnosis.