ES2362669T3 - UNION MOLECULES THAT CAN NEUTRALIZE RABIA VIRUSES AND USES OF THE SAME. - Google Patents

Abstract

Binding molecule that has neutralizing activity against rabies virus, characterized in that the binding molecule comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 39 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 63, or a heavy and light chain variable region that has at least 80% sequence homology thereto and in which one or more amino acids are altered compared to SEQ ID NO : 39 and SEQ ID NO: 63 and which can compete to specifically bind rabies virus or a fragment thereof with the binding molecule comprising SEQ ID NO: 39 and SEQ ID NO: 63, and still It has neutralizing activity against rabies virus.

Description

FIELD OF THE INVENTION

The invention relates to medicine. In particular, the invention relates to binding molecules that neutralize the rabies virus. Binding molecules are useful in prophylaxis after rabies exposure.

BACKGROUND OF THE INVENTION

Rabies is a viral infection with almost worldwide distribution that mainly affects wild and domestic animals but also involves humans, resulting in a devastating, lethal encephalitis almost invariably. Annually, more than 70,000 human fatalities are estimated, and millions of other people require treatment after exposure.

Rabies virus is a single-stranded RNA virus with a bullet-shaped envelope, classified in the Rhabdovirus family and the genus Lyssavirus. The rabies virus genome codes for five viral proteins: RNA-dependent RNA polymerase (L); a nucleoprotein (N); a phosphorylated protein (P); a matrix protein (M) located on the inner side of the viral protein envelope; and an external surface glycoprotein (G).

Protein G (62-67 KDa) is a type I glycoprotein composed of 505 amino acids that has two to four possible N-glycosylation sites, of which only one or two are glycosylated depending on the virus strains. Protein G forms the protrusions that cover the outer surface of the virion envelope and are known to induce antibodies that neutralize the virus.

Rabies can be treated or prevented by both passive and active immunizations. Prophylaxis after exposure to rabies includes the immediate care of the local wound and the administration of both passive (anti-rabies immunoglobulins) and active immunizations (vaccines).

Currently, anti-rabies immunoglobulins (RIG) are prepared from serum samples from either humans immunized against rabies virus (HRIG) or horses immunized against rabies virus (ERIG). A disadvantage of ERIG as well as HRIG is that they are not available in sufficient quantities and, in the case of HRIG, it is too expensive. In addition, the use of ERIG can lead to adverse reactions such as anaphylactic shock. The possibility of contamination by known or unknown pathogens is an additional problem associated with HRIG. To overcome these disadvantages, it has been suggested to use monoclonal antibodies that can neutralize rabies virus in prophylaxis after exposure. Murine monoclonal antibodies that neutralize the rabies virus are known in the art (see Schumacher et al., 1989). However, the use of murine antibodies in vivo is limited due to problems associated with the administration of murine antibodies to humans, such as short serum half-life, an inability to elicit certain human effector functions and production of a drastic immune response. desired against the murine antibody in a human being (the reaction of "human anti-mouse antibody" (HAMA)).

Recently, human monoclonal antibodies that neutralize the rabies virus have been described (see Dietzschold et al., 1990, Champion et al., 2000, and Hanlon et al., 2001). In order for human anti-rabies monoclonal antibodies to be as effective as HRIG in prophylaxis after exposure, a mixture of monoclonal antibodies should be used. In such a mixture, each antibody must bind to a different epitope or site in the virus to prevent the escape of resistant variants of the virus.

Currently, there is still a significant need for new human monoclonal antibodies that neutralize the rabies virus that have prophylactic potential after enhanced exposure, particularly antibodies that have different epitope recognition specificities. The present invention provides such human monoclonal antibodies that offer the possibility of being used in mixtures useful in prophylaxis after exposure of a wide variety of rabies viruses and variants resistant to neutralization thereof.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the comparison of the amino acid sequences of the CVS-11 strain of rabies virus and E57 escape viruses. Virus-infected cells were collected 2 days after infection and total RNA was isolated. CDNA was generated and used for DNA sequencing. Regions containing mutations are shown and mutations are indicated in bold. Figure 1A shows the comparison of nucleotide sequences. The numbers above the amino acids indicate the amino acid numbers of the rabies virus glycoprotein including the signal peptide. Figure 1B shows the comparison of amino acid sequences. The schematic representation of the rabies virus glycoprotein is shown at the top. The black box indicates the signal peptide, while the gray box indicates the transmembrane domain. The sequences in Figure 1 are also represented by SEQ ID No: 130-141.

Figure 2 shows the comparison of the amino acid sequences of the CVS-11 strain of rabies virus and EJB escape viruses. Virus-infected cells were collected 2 days after infection and total RNA was isolated. CDNA was generated and used for DNA sequencing. Regions containing mutations are shown and mutations are indicated in bold. Figure 2A shows the comparison of nucleotide sequences. The numbers above the amino acids indicate the amino acid numbers of the rabies virus glycoprotein including the signal peptide. Figure 2B shows the comparison of amino acid sequences. The schematic representation of the rabies virus glycoprotein is shown at the top. The black box indicates the signal peptide, while the gray box indicates the transmembrane domain. The sequences in Figure 2 are also represented by SEQ ID No: 142-151.

Figure 3 shows the vector PDV-C06.

Figure 4 shows a competition ELISA of scbv anti-rabies virus and biotilinated anti-rabies virus antibody called CR-57. ELISA plates coated with purified G protein from rabies virus were incubated with respective scFv before the addition of CR-57bio (0.5 µg / ml). Subsequently, CR-57bio binding was monitored in the absence and presence of scFv.

Figure 5 shows a competition ELISA of anti-rabies virus scFv and anti-rabies virus antibody called CR-57. ELISA plates coated with purified G protein from rabies virus were incubated with CR-57 (1 µg / ml) before the addition of scFv in excess. Subsequently, svFv binding was monitored in the absence and presence of CR-57.

Figure 6 shows a competition ELISA assay of anti-rabies G protein IgG and the anti-rabies virus antibody called CR-57. Protein G (ERA strain) was incubated with unlabeled IgG (shown on the X axis). Biotinylated CR57 (CR57bio) was added and allowed to bind to G protein before visualization by streptavidin-HRP. ELISA signals are shown as percentage of CR57bio binding alone.

Figure 7 shows a competition FACS assay of rabies anti-protein G IgG and rabies anti-rabies antibody called CR-57. PER.C6 cells expressing G protein (ERA strain) were incubated with unlabeled IgG (shown on the X axis). Biotinylated CR57 (CR57bio) was added and allowed to bind to cells expressing G protein before visualization by streptavidin-PE. FACS signals are shown as percentage of CR57bio binding alone.

Figure 8 shows the comparison of the E98 and CVS-11 escape virus amino acid sequences. Virus-infected cells were collected 2 days after infection and total RNA was isolated. CDNA was generated and used for DNA sequencing. The region containing a point mutation is shown and the mutation is indicated in bold. Figure 8A shows the comparison of nucleotide sequences. The number above the nucleotide indicates the mutated nucleotide (indicated in bold) of the open reading frame of the rabies virus glycoprotein without signal peptide sequence. Figure 8B shows the comparison of amino acid sequences. The number above the amino acid indicates the mutated amino acid (indicated in bold) of the rabies virus glycoprotein without signal peptide sequence.

Figure 9 shows a phylogenetic tree of 123 natural rabies viruses (123 rabies virus G glycoprotein sequences, Kimura's method with 2 neighbor binding parameters, 500 primers). Bold indicates the viruses that host the N> D mutation as seen in the E98 escape virus.

Figure 10 shows neutralizing epitopes on rabies glycoprotein. A schematic representation of the rabies virus glycoprotein depicting antigen sites including the novel CR57 epitope is shown. The signal peptide (19 amino acids) and the transmembrane domain are indicated by black boxes. Disulfide bridges are indicated. The amino acid numbering is from the mature protein minus the signal peptide sequence.

DESCRIPTION OF THE INVENTION

Definitions of terms as used in the invention follow hereinafter.

DEFINITIONS

Binding molecule

As used herein, the term "binding molecule" refers to an intact immunoglobulin including monoclonal antibodies, such as chimeric, humanized or human monoclonal antibodies, or to an antigen-binding domain and / or variable comprising a fragment. of an immunoglobulin that competes with the intact immunoglobulin for specific binding to the immunoglobulin binding partner, for example rabies virus or a fragment thereof such as for example protein G. Regardless of the structure the binding fragment The antigen binds with the same antigen that recognizes the intact immunoglobulin. An antigen-binding fragment may comprise a peptide or polypeptide comprising an amino acid sequence of at least 2 contiguous amino acid residues, at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues , at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 35 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at at least 60 contiguous amino acid residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least 100 contiguous amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, or at least 250 contiguous amino acid residues of the amino acid sequence of the binding molecule.

The term "binding molecule", as used herein, includes all classes and subclasses of immunoglobulins known in the art. Depending on the amino acid sequence of the constant domain of their heavy chains, the binding molecules can be divided into five main classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes ), for example, IgA1, IgA2, IgG1, IgG2, IgG3 and IgG4.

Antigen-binding fragments include, among others, Fab, F (ab '), F (ab') 2, Fv, dAb, Fd, fragments the complementarity determining region (CDR), single chain antibodies (scFv), antibodies bivalent single stranded, single stranded phage antibodies, diabodies, triabodies, tetrabodies, (poly) peptides containing at least one fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the (poly) peptide, etc. The above fragments can be produced synthetically or by enzymatic or chemical cleavage of intact immunoglobulins or can be obtained genetically by recombinant DNA techniques. Production methods are well known in the art and are described, for example, in Antibodies: A Laboratory Manual, edited by: E. Harlow and D, Lane (1988), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. A binding molecule or antigen binding fragment thereof can have one or more binding sites. If there is more than one binding site, the binding sites may be identical to each other or they may be different.

The binding molecule can be a naked or unconjugated binding molecule, but it can also be part of an immunoconjugate. A naked or unconjugated binding molecule is intended to refer to a binding molecule that is not conjugated, operably linked or physically or functionally associated with an effector label or moiety, such as, among others, a toxic substance, a radioactive substance , a liposome, an enzyme. It will be understood that naked or unconjugated binding molecules do not exclude binding molecules that have been stabilized, multimerized, humanized or manipulated in any other way, other than by binding an effector marker or moiety. Accordingly, all nude and unconjugated binding molecules modified after translation are included herein, including when modifications are made in the environment of the cell that produces the natural binding molecule, by a cell that produces the molecule of recombinant binding and are introduced manually after preparation of the initial binding molecule. Naturally, the expression "naked or unconjugated binding molecule" does not exclude the ability of the binding molecule to form functional associations with molecules and / or effector cells after administration to the organism, since some such interactions are necessary in order to exert a biological effect Therefore, the lack of label or associated effector group is applied in the definition to the naked or unconjugated binding molecule in vitro, not in vivo.

Regions determining complementarity (CDR)

The term "complementarity determining regions" as used herein means sequences within the variable regions of the binding molecules, such as immunoglobulins, which usually contribute greatly to the antigen binding site that is complementary. in form and distribution of charge to the epitope recognized in the antigen. CDR regions may be specific for linear epitopes, discontinuous epitopes or protein conformation epitopes or protein fragments, either as they occur in the protein in its native conformation, or in some cases, as they occur in proteins when they are denatured, for example, by solubilization in SDS. Epitopes may also consist of post-translational modifications of proteins.

Functional variant

The term "functional variant," as used herein, refers to a binding molecule comprising a nucleotide and / or amino acid sequence that is altered by one or more nucleotides and / or amino acids compared to the sequences. of nucleotides and / or amino acids of the original binding molecule and which can still compete for binding to the binding partner, for example rabies virus or a fragment thereof, with the original binding molecule. In other words, modifications in the amino acid and / or nucleotide sequence of the original binding molecule do not significantly affect or alter the binding characteristics of the binding molecule encoded by the nucleotide sequence or which contains the amino acid sequence, is That is, the binding molecule can still recognize and bind to its target. The functional variant may have conservative sequence modifications including substitutions, additions and deletions of nucleotides and amino acids. These modifications may be introduced by conventional techniques known in the art, such as site-directed mutagenesis and random PCR-mediated mutagenesis, and may comprise natural as well as unnatural nucleotides and amino acids.

Conservative amino acid substitutions include those in which the amino acid residue is substituted with an amino acid residue having similar chemical or structural properties. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (for example, lysine, arginine, histidine), acid side chains (for example, aspartic acid, glutamic acid), uncharged polar side chains (for example, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), non-polar side chains (e.g., glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), branched beta side chains (e.g. threonine, valine, isoleucine) and side chains aromatic (for example, tyrosine, phenylalanine, tryptophan). It will be clear to the expert that other classifications of amino acid residue families apart from that previously used can also be used. In addition, a variant may have non-conservative amino acid substitutions, for example, the substitution of an amino acid with an amino acid residue having different chemical or structural properties. Similar minor variations may also include deletions or insertions of amino acids, or both. Guidance can be found in determining which amino acid residues can be substituted, inserted or deleted without suppressing immunological activity using computer programs well known in the art.

A mutation in a nucleotide sequence can be a single alteration performed in a locus (a point mutation), such as transition or transverse mutations, or alternatively, multiple nucleotides can be inserted, deleted or changed in a single locus. In addition, one or more alterations can be made to any number of loci within a nucleotide sequence. Mutations can be made by any method known in the art.

Guest

The term "host", as used herein, is intended to refer to a microorganism or a cell in which a vector such as a cloning vector or an expression vector has been introduced. The microorganism or cell can be prokaryotic or eukaryotic. It should be understood that this term is intended to refer not only to the particular object microorganism or cell, but also to the progeny of such a microorganism or cell. Since certain modifications may occur in successive generations due to either mutation or environmental influences, such progeny may not in fact be identical to the original microorganism or cell, but is still included within the scope of the term "host" as It is used in this document.

Human

The term "human", when applied to binding molecules as defined herein, refers to molecules that are either derived directly from a human being or based on a human sequence. When a binding molecule is derived from or based on a human sequence and subsequently modified, it should still be considered human as used throughout the entire specification. In other words, the term human, when applied to binding molecules, is intended to include binding molecules that have variable and constant regions derived from human germline immunoglobulin sequences based on variable or constant regions whether or not they occur in a human being. or human lymphocyte or in modified form. Thus, human binding molecules may include amino acid residues not encoded by human germline immunoglobulin sequences, comprise substitutions and / or deletions (for example, mutations introduced by for example random or site-specific mutagenesis in vitro or by mutation somatic in vivo). "Based on" as used herein refers to the situation in which exactly one nucleic acid sequence can be copied from a template, or with minor mutations, such as by error-prone PCR methods, or Obtained synthetically by pairing the mold exactly or with minor modifications. Semisynthetic molecules based on human sequences are also considered human as used herein.

Monoclonal antibody

The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of unique molecular composition, ie primary structure, that is to say it has a unique amino acid sequence. A monoclonal antibody has a unique binding specificity and affinity for a particular epitope. Accordingly, the term "human monoclonal antibody" refers to an antibody that has a unique binding specificity that has variable and constant regions derived from or based on human germline immunoglobulin sequences or derived from completely synthetic sequences. The method of preparation of the monoclonal antibody is not relevant.

Nucleic acid molecule

The term "nucleic acid molecule" as used in the present invention refers to a polymeric form of nucleotides and includes both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the foregoing. A nucleotide refers to a ribonucleotide, deoxynucleotide.

or a modified form of any type of nucleotide. The expression also includes single and double stranded forms of DNA. In addition, a polynucleotide can include any or both naturally occurring or modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide bonds. Nucleic acid molecules may be modified chemically or biochemically or they may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Such modifications include, for example, markers, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, modifications between nucleotides such as uncharged bonds (eg, methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc. .), charged bonds (for example, phosphorothioates, phosphorodithioates, etc.), pendant moieties (for example, polypeptides), intercalation molecules (for example, acridine, psoralen, etc.), chelants, alkylating agents, and modified bonds (for example, anomeric alpha nucleic acids, etc.). The previous expression also intends to include any topological conformation, including single-stranded, double-stranded, partial duplex, triple, fork, circular and padlock conformations. Synthetic molecules that mimic polynucleotides in their ability to bind a designated sequence through hydrogen bonds and other chemical interactions are also included. Such molecules are known in the art and include, for example, those in which phosphate bonds are replaced by peptide bonds in the main structure of the molecule. A reference to a nucleic acid sequence encompasses its complement unless otherwise specified. Therefore, it should be understood that a reference to a nucleic acid molecule having a particular sequence encompasses its complementary chain, with its complementary sequence. The complementary chain is also useful, for example, for antisense therapy, hybridization probes and PCR primers.

Pharmaceutically acceptable excipient

By "pharmaceutically acceptable excipient" is meant any inert substance that is combined with an active molecule such as a drug, agent, or binding molecule to prepare a suitable pharmaceutical form.

or convenient. The "pharmaceutically acceptable excipient" is an excipient that is not toxic, or at least whose toxicity is acceptable for its intended use, for the receptors at the dosages and concentrations employed and that is compatible with other components of the formulation comprising the drug, binding agent or molecule.

Prophylaxis after exposure

"Prophylaxis after exposure" (PEP) is indicated for people possibly exposed to an animal with rabies. Possible exposures include exposure to a bite (i.e., any penetration of the skin through the teeth) including animal bites, and exposure without a bite. Non-bite exposures include exposure to large amounts of rabies virus sprayed in laboratories or caves and surgical recipients of transplanted corneas from patients who died from rabies. Contamination of open wounds, abrasions, mucous membranes, or theoretically, scratches, with saliva or other potentially infectious material (such as nerve tissue) of an animal with rabies also constitutes an exposure without bite. Another contact by itself, such as petting an animal with rabies and contact with blood, urine or feces of an animal with rabies, does not constitute an exposure and is not an indication for prophylaxis. PEP should start as soon as possible after an exposure. If no exposure has occurred, prophylaxis after exposure is not necessary. In all prophylaxis regimens after exposure, except for previously immunized persons, active and passive immunizations should be used simultaneously.

Specific union

The term "specific binding", as used herein, in reference to the interaction of a binding molecule, for example an antibody, and its binding partner, for example an antigen, means that the interaction depends on the presence of a particular structure, for example an antigenic determinant or epitope, in the binding partner. In other words, the antibody preferably binds or recognizes the binding partner even when the binding partner is present in a mixture of other molecules or microorganisms. Binding can be mediated by covalent or non-covalent interactions or by a combination of both. In other words, the term "specific binding" means immunospecific binding to an antigen or a fragment thereof and non-immunospecific binding to other antigens. A binding molecule that immunospecifically binds to an antigen can bind to other peptides or polypeptides with lower affinity as determined by, for example, radioimmunoassays (RIA), enzyme-linked immunosorbent assays (ELISA), BIACORE, or other assays. known in the art. Binding molecules or fragments thereof that immunospecifically bind to an antigen can cross-react with related antigens. Preferably, the binding molecules or fragments thereof that immunospecifically bind to an antigen do not cross-react with other antigens.

Therapeutically effective amount

The term "therapeutically effective amount" refers to an amount of the binding molecule as defined herein that is effective for prophylaxis after exposure to rabies.

Vector

The term "vector" indicates a nucleic acid molecule in which a second nucleic acid molecule can be inserted for introduction into a host where it will be replicated, and in some cases expressed. In other words, a vector can transport a nucleic acid molecule to which it has been linked. The term "vector", as used herein, contemplates cloning and expression vectors. Vectors include, but are not limited to, plasmids, cosmids, artificial bacterial chromosomes (BAC) and artificial yeast chromosomes (YAC) and vectors derived from bacteriophages or virus from plants or animals (including humans). The vectors comprise an origin of replication recognized by the proposed host and in the case of expression vectors, a promoter and other regulatory regions recognized by the host. A vector containing a second nucleic acid molecule is introduced into a cell for example by transformation, transfection, or using bacterial or viral entry mechanisms. Other ways of introducing nucleic acid into cells, such as electroporation or bombardment with particles often used with plant cells, and the like are known. The method of introducing nucleic acid into cells depends among other things on the type of cells, etc. This is not critical to the invention. Certain vectors can perform autonomous replication in a host into which they are introduced (for example, vectors that have an origin of bacterial replication can replicate in bacteria). Other vectors can be integrated into the genome of a host when introduced into the host, and thereby replicate together with the host genome.

SUMMARY OF THE INVENTION

The invention provides binding molecules that can specifically bind to and neutralize rabies virus. In addition, the invention relates to nucleic acid molecules that code for at least the binding region of those binding molecules. The invention further provides the use of the binding molecules of the invention in prophylaxis upon exposure of a subject at risk of developing a condition resulting from the rabies virus.

DETAILED DESCRIPTION OF THE INVENTION

In a first aspect, the present invention encompasses binding molecules that have neutralizing activity against rabies virus, the binding molecule comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 39 and a variable region light chain comprising the amino acid sequence of SEQ ID NO: 63, or a heavy and light chain variable region having at least 80% sequence homology thereto and in which one or more amino acids are altered in compared to SEQ ID NO: 39 and SEQ ID NO: 63 and which can compete to specifically bind rabies virus or a fragment thereof with the binding molecule comprising SEQ ID NO: 39 and SEQ ID NO : 63, and it still has neutralizing activity against rabies virus. Preferably, the binding molecules of the invention also have neutralizing activity against the rabies virus. Preferably, the binding molecules of the invention are human binding molecules. Alternatively, they can also be binding molecules of other animals. The rabies virus belongs to the genus Lyssavirus. In total, the genus Lyssavirus includes eleven genotypes: rabies virus (genotype 1), Lagos bat virus (genotype 2), Mokola virus (genotype 3), Duvenhage virus (genotype 4), European bat lyssavirus 1 (genotype 5), European Bat Lyssavirus 2 (Genotype 6), Australian Bat Lyssavirus (Genotype 7), Aravan Virus (Genotype 8), Khujand Virus (Genotype 9), Irkut Virus (Genotype 10) and Western Caucasian Virus (Genotype 11 ). In addition to binding to the rabies virus, the binding molecules of the invention may also be able to bind to other genotypes of the genus Lyssavirus. Preferably, the binding molecules may also be able to neutralize other genotypes of the genus Lyssavirus. In addition, the binding molecules of the invention may even be capable of binding to and / or neutralizing viruses, other than Lyssavirus, of the Rhabdovirus family. This family includes the genera cytorhabdovirus, ephemerovirus, lyssavirus, nucleorhabdovirus, rhabdovirus and vesiculovirus.

The binding molecules may be able to specifically bind to the rabies virus in its natural form or in its inactivated / attenuated form. Rabies virus inactivation can be performed by treatment with, among others, beta-propiolactone (BPL) (White and Chappel, 1982), heating at 56 ° C for more than 30 minutes, gamma irradiation, treatment with acetylethylenimine or ethylenimine or treatment with ascorbic acid and copper sulfate for 72 hours (Madhusudana et al., 2004). General viral inactivation methods known to those skilled in the art may also be used such as, among others, pasteurization (wet heating), dry heat treatment, steam heat treatment, low pH treatment, organic solvent / detergent treatment, nanofiltration; irradiation with UV light. Preferably, the inactivation is performed by treatment with betapropiolactone (BPL). The person skilled in the art is well aware of methods to test whether rabies virus is still infective or partially or completely inactivated and can be found, among others, in Laboratory techniques in rabies, edited by: F.-X Meslin, M.M. Kaplan and H. Koprowski (1996), 4th edition, Chapter 36, World Health Organization, Geneva.

Binding molecules may also be able to specifically bind to one or more rabies virus fragments such as, among others, a preparation of one or more proteins and / or (poly) peptides derived from rabies virus or a cell. transfected with a protein and / or (poly) rabies virus peptide. For treatment and / or prevention methods such as methods for prophylaxis after exposure of the rabies virus, the binding molecules can preferably specifically bind to accessible surface proteins of the rabies virus such as the M protein (see Ameyama et al. 2003) or G. For diagnostic purposes, human binding molecules may also be able to specifically bind proteins not present on the surface of the rabies virus. The amino acid sequence of accessible and internal surface proteins of various known strains of rabies virus can be found in the EMBL database and / or in other databases.

Preferably, the fragment comprises at least one antigenic determinant recognized by the human binding molecules of the invention. An "antigenic determinant" as used herein is a moiety such as a (poly) peptide, (glyco) protein, or analogue or fragment thereof of rabies virus, which can bind to a binding molecule of the invention with affinity high enough to form a detectable antigen-binding molecule complex.

The binding molecules according to the invention can be intact immunoglobulin molecules such as monoclonal or polyclonal antibodies, in particular human monoclonal antibodies, or the binding molecules can be antigen binding fragments including, but not limited to, Fab, F (ab '), F (ab') 2, Fv, dAb, Fd, fragments of the complementarity determining region (CDR), single-chain antibodies (scFv), bivalent single-chain antibodies, phage single-chain antibodies, diabodies, triabodies, tetrabodies, and (poly) peptides containing at least one fragment of an immunoglobulin that is sufficient to confer specific antigen binding to the rabies virus or fragment thereof. The binding molecules of the invention can be used in an isolated or non-isolated manner. In addition, the binding molecules of the invention can be used alone or in a mixture comprising at least one human binding molecule (or variant or fragment thereof). In other words, the binding molecules can be used in combination, for example, as a pharmaceutical composition comprising two or more binding molecules, variants or fragments thereof. For example, binding molecules that have neutralizing activity against rabies virus can be combined in a single therapy to achieve a desired prophylactic, therapeutic or diagnostic effect.

RNA viruses such as rabies virus make use of their own RNA polymerase during virus replication. These RNA polymerases tend to be prone to mistakes. This leads to the formation of so-called quaspecies during a viral infection. Each quasi-species has a unique RNA genome, which could result in differences in the amino acid composition of viral proteins. If such mutations occur in structural viral proteins, the virus could potentially escape from the host's immune system due to a change in the epitopes of T or B cells. The possibility of this occurring is greater when individuals are treated with a mixture of two binding molecules, such as human monoclonal antibodies, that when treated with a mixture of polyclonal antibodies (HRIG). Therefore, a prerequisite for a mixture of two human monoclonal antibodies for the treatment of rabies is that the two antibodies recognize non-overlapping, non-competitive epitopes in their target antigen, that is, rabies virus glycoprotein. This minimizes the possibility of rabies escape virus. As a consequence, the binding molecules of the invention may preferably react with different non-overlapping, non-competitive rabies epitopes, such as epitopes on the G rabies protein G. The mixture of binding molecules may further comprise at least one other therapeutic agent such as a drug suitable for prophylaxis after exposure to rabies.

Normally, the binding molecules according to the invention can bind to their binding partners, that is to the rabies virus or fragments thereof such as rabies virus proteins, with an affinity constant (Kd value) which is lower at 0.2 * 10-4M, 1.0 * 10-5M, 1.0 * 10-6M, 1.0 * 10-7M, preferably less than 1.0 * 10-8M, more preferably less than 1.0 * 10-9 M, more preferably less than 1.0 * 10-10 M, even more preferably less than 1.0 * 10-11 M, and in particular less than 1.0 * 10 * -12 M. Affinity constants may vary for antibody isotypes. For example, affinity binding of an IgM isotype refers to a binding affinity of at least about 1.0 * 10-7 M. Affinity constants can be measured for example using surface plasmon resonance, that is, a optical phenomenon that allows the analysis of biospecific interactions in real time by detecting alterations in protein concentrations within a biosensor matrix, for example using the BIACORE system (Pharmacia Biosensor AB, Uppsala, Sweden).

The binding molecules according to the invention can bind to the rabies virus in purified / isolated or non-purified / non-isolated form. The binding molecules can bind to the rabies virus in soluble form such as in a sample or they can bind to the rabies virus bound or associated to a carrier or substrate, for example, microtiter plates, membranes and beads, etc. . The carriers or substrates can be composed of glass, plastic (for example, polystyrene), polysaccharides, nylon, nitrocellulose, or Teflon, etc. The surface of such supports can be solid or porous and in any convenient way. Alternatively, the binding molecules can also bind to rabies virus fragments such as proteins or (poly) rabies virus peptides. In one embodiment, the binding molecules can specifically bind to the rabies virus G protein or a fragment thereof. The rabies virus (poly) peptides or proteins may either be in soluble form or they may bind to the rabies virus bound or associated with a carrier or substrate as described above. In another embodiment, cells transfected with the G protein can be used as a binding partner for the binding molecules.

According to the invention, the binding molecules of the invention neutralize the infectivity of the rabies virus. This can be achieved by preventing the binding of the rabies virus to its receptors in host cells, such as, among others, the murine p75 neurotrophin receptor, the neuronal cell adhesion molecule (CD56) and the acetylcholine receptor,

or inhibition of the release of RNA in the cytoplasm of the cell or preventing transcription or translation of the RNA. In a specific embodiment, the binding molecules of the invention prevent the rabies virus from infecting the host cells in at least 99%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 45%, at least 40%, at least 45%, at least 35 %, at least 30%, at least 25%, at least 20%, or at least 10% with respect to infection of the host cells by the rabies virus in the absence of said binding molecules. Neutralization can be measured, for example, as described in Laboratory techniques in rabies, edited by: F.-X Meslin, M.M. Kaplan and H. Koprowski (1996), 4th edition, Chapters 15-17, World Health Organization, Geneva. In addition, the human binding molecules of the invention can complement binding binding molecules that can assist in lysis of the rabies virus with envelope. The human binding molecules of the invention could also act as opsonins and increase phagocytosis of the rabies virus either by enhancing its uptake through Fc or C3b receptors or by agglutinating the rabies virus to make it more easily phagocytosed. .

Binding molecules comprising at least one CDR3 region comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, are disclosed SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24. In one embodiment the CDR3 region is a heavy chain CDR3 region.

Binding molecules comprising a variable heavy chain comprising essentially an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 are also disclosed. , SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO : 46, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49. In a preferred embodiment, the binding molecules according to the invention comprise a variable heavy chain essentially comprising an amino acid sequence comprising amino acids 1 -119 of SEQ ID NO: 335.

Binding molecules comprising a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 26 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 50, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 27 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 51, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 28 and a variable light chain that comprises the amino acid sequence of SEQ ID NO: 52, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 53, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 30 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 54, a variable heavy chain comprising the sequence of amino acids of SEQ ID NO: 31 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 55, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 32 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 56, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 33 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 57, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 34 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 58, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35 and a variable light chain that comprises the amino acid sequence of SEQ ID NO: 59, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 36 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 60, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 37 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 61, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 38 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 62, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 63, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 64, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 41 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 65, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 42 and a light chain variable comprising the amino acid sequence of SEQ ID NO: 66, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 67, a chain variable weight comprising the amino acid sequence of SEQ ID NO: 44 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 68, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 45 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 69, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 46 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 70, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 47 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 71, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 48 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 72, a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 49 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 73. In a preferred embodiment, the human binding molecules according to the invention comprise a variable heavy chain comprising the amino acid sequence comprising amino acids 1-119 of SEQ ID NO: 335 and a variable light chain comprising the amino acid sequence comprising amino acids 1-107 of SEQ ID NO: 337.

In a preferred embodiment, the binding molecules that have neutralizing activity against the rabies virus of the invention are administered in IgG format, preferably in IgG1 format.

Another aspect of the invention includes functional variants of binding molecules as defined herein. The molecules are considered functional variants of a binding molecule according to the invention, if the variants can compete for specific binding to the rabies virus or a fragment thereof with the original binding molecules. In other words, when functional variants can still bind to rabies virus or a fragment thereof. Functional variants must also still have neutralizing activity against rabies virus. Functional variants include, but are not limited to, derivatives that are substantially similar in the primary structural sequence, but which contain, for example, in vitro or in vivo modifications, chemical and / or biochemical, which are not found in the original binding molecule. . Such modifications include among others, acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavin, covalent binding of a heme moiety, covalent binding of a nucleotide or nucleotide derivative, covalent binding of a lipid or lipid derivative, covalent binding phosphotidylinositol, crosslinking, cyclisation, disulfide bridge formation, demethylation, covalent crosslinking formation, cystine formation, pyroglutamate formation, formylation, gammacarboxylation, glycosylation, GPI formation, hydroxylation, iodination, mutilation, myristoylation, oxidation, pegylation, processing proteolytic, phosphorylation, prepylation, racemization, selenoylation, sulphation, transfer of amino acids mediated by transfer RNA to proteins such as arginylation, ubiquitination, and the like.

Alternatively, the functional variants may be binding molecules as defined in the present invention comprising an amino acid sequence containing substitutions, insertions, deletions or combinations thereof of one or more amino acids compared to the amino acid sequences of the original binding molecules. In addition, the functional variants may comprise truncation of the amino acid sequence at either or both amino or carboxyl terminal ends. The functional variants according to the invention may have the same or different binding affinities, either higher or lower, compared to the original binding molecule but which can still bind to rabies virus or a fragment thereof and which can still neutralize The rabies virus. For example, functional variants according to the invention may have increased or decreased binding affinities for the rabies virus or for a fragment thereof compared to the original binding molecules or may have a higher or lower neutralizing activity against the virus. anger. Preferably, the amino acid sequences of the variable regions, including, but not limited to, framework regions, hypervariable regions, in particular the CDR3 regions, are modified. In general, the light chain and heavy chain variable regions comprise three hypervariable regions, comprising three CDRs, and more conserved regions, the so-called framework regions (FR). Hypervariable regions comprise amino acid residues of CDR and amino acid residues of hypervariable loops. The functional variants that are intended to be within the scope of the present invention have at least about 50% to about 99%, preferably at least about 60% to about 99%, more preferably at least about 70% to about 99%, even more preferably at least about 80% to about 99%, most preferably at least about 90% to about 99%, in particular at least about 95% at about 99%, and in particular at least about 97% to about 99% amino acid sequence homology with the original binding molecules as defined herein. Computer algorithms such as, among others, Gap or Bestfit known to one skilled in the art can be used to optimally align the amino acid sequences to be compared and define similar or identical amino acid residues.

In another embodiment, functional variants can be produced when the original binding molecule comprises a glycosylation site in itself sequence that results in glycosylation of the binding molecule with expression in eukaryotic cells and therefore could stop binding to the antigen. The produced functional variant no longer contains the glycosylation site, but it can bind to the rabies virus and still has neutralizing activity.

Functional variants can be obtained by altering the original binding molecules or portions thereof by general molecular biology methods known in the art including, but not limited to, error-prone PCR, oligonucleotide-directed mutagenesis and site-directed mutagenesis. In addition, functional variants may have complement binding activity, be able to assist in the lysis of rabies virus with envelope and / or act as opsonins and increase phagocytosis of rabies virus or by enhancing its uptake through receptors of Fc or C3b or by agglutinating the rabies virus to make it easier to phagocyte.

Still in a further aspect, the invention includes immunoconjugates, that is to say molecules comprising at least one binding molecule or functional variant thereof as defined herein and further comprising at least one label, such as, among others. , a detectable moiety / agent. Also contemplated in the present invention are mixtures of immunoconjugates according to the invention or mixtures of at least one immunoconjugate according to the invention and another molecule, such as a therapeutic agent or another binding or immunoconjugate molecule. In a further embodiment, the immunoconjugates of the invention may comprise one or more markers. These markers may be the same or different from each other and may bind / conjugate in a non-covalent manner to the binding molecules. The marker (s) can also be directly bound / conjugated to the binding molecules by covalent bonding, including, but not limited to, disulfide bridges, hydrogen bonds, electrostatic bonding, recombinant fusion and conformational bonding. Alternatively, the marker (s) can be bound / conjugated to the binding molecules by means of one or more binding compounds. The expert knows well the techniques to conjugate markers to binding molecules.

The markers of the immunoconjugates of the present invention may be therapeutic agents, but preferably they are detectable moieties / agents. Immunoconjugates comprising a detectable agent can be used in diagnosis to, for example, assess whether a subject has been infected with the rabies virus or to monitor the development or evolution of a rabies virus infection as part of a Clinical testing procedure to, for example, determine the effectiveness of a given treatment regimen. However, they can also be used for other detection and / or analytical and / or diagnostic purposes. Detectable moieties / agents include, but are not limited to, enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emission metals and non-radioactive paramagnetic metal ions.

The markers used to label the binding molecules for detection and / or analytical and / or diagnostic purposes depend on the specific detection / analysis / diagnostic techniques and / or the methods used such as, among others, immunohistochemical staining of samples ( holders), flow cytometry detection, scanning laser cytometric detection, fluorescent immunoassays, enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), bioassays (e.g. neutralization assays), Western blot applications , etc. For immunohistochemical staining of titular samples, preferred markers are enzymes that catalyze the production and local deposition of a detectable product. Enzymes normally conjugated to binding molecules are well known to allow immunohistochemical visualization and include, but are not limited to, acetylcholinesterase, alkaline phosphatase, beta-galactosidase, glucose oxidase, horseradish peroxidase, and urease. The person skilled in the art also knows well the typical substrates for the production and deposition of visually detectable products. In addition to that, the immunoconjugates of the invention may be labeled using colloidal gold or may be labeled with radioisotopes, such as 33P, 32P, 35S, 3H, and 125I. The binding molecules of the invention can be linked to radionuclides directly or indirectly through a chelating agent by methods well known in the art.

When the binding molecules of the present invention are used for flow cytometric detections, scanning laser cytometric detections, or fluorescent immunoassays, they can be usefully labeled with fluorophores. The skilled person knows a wide variety of fluorophores useful for fluorescently labeling the binding molecules of the present invention. When the binding molecules of the present invention are used for secondary detection using labeled avidin, streptavidin, captavidin or neutravidin, the binding molecules can be labeled with biotin to form suitable prosthetic group complexes.

When the immunoconjugates of the invention are used for in vivo diagnostic use, the binding molecules can also be made detectable by conjugation with for example contrast agents for magnetic resonance imaging (MRI), such as gadolinium-diethylenetriaminepentaacetic acid, with agents of contrast for ultrasound or with contrast agents for X-rays, or for radioisotopic labeling.

In addition, the binding molecules, functional variants thereof or immunoconjugates of the invention can also bind to solid supports, which are particularly useful for in vitro immunoassays or for purification of the rabies virus or a fragment thereof. Such solid supports could be porous or non-porous, flat and non-flat and include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene supports. Human binding molecules can also be conjugated, for example, in a useful manner with filtration media, such as NHS activated Sepharose or CNB activated Sepharose for immunoaffinity chromatography purposes. They can also be usefully bound to paramagnetic microspheres, usually through the biotin-streptavidin interaction. The microspheres can be used for the isolation of the rabies virus or a fragment thereof from a sample containing the rabies virus or a fragment thereof. As another example, the human binding molecules of the present invention can be usefully attached to the surface of a microtiter plate for ELISA.

The binding molecules of the present invention or functional variants thereof can be fused to marker sequences, such as a peptide to facilitate purification. Examples include, but are not limited to, the hexa-histidine marker, the hemagglutinin (HA) marker, the myc marker or the flag marker.

Alternatively, an antibody can be conjugated with a second antibody to form an antibody heteroconjugate. In another aspect, the human binding molecules of the invention can be conjugated / bound to one or more antigens. Preferably, these antigens are antigens that are recognized by the immune system of a subject to which the antigen-binding molecule conjugate is administered. The antigens may be identical but may also differ from each other. Conjugation methods for binding antigens and binding molecules are well known in the art and include, but are not limited to, the use of crosslinking agents. Human binding molecules will bind to the rabies virus and antigens bound to human binding molecules will initiate a potent T-cell attack on the conjugate that will eventually lead to the destruction of the rabies virus.

In addition to the production of immunoconjugates in a chemical manner by conjugation, directly or directly through, for example, a linker, immunoconjugates can be produced as fusion proteins comprising the human binding molecules of the invention and a suitable label. Fusion proteins can be produced by methods known in the art such as, for example, recombinantly by constructing nucleic acid molecules comprising nucleotide sequences encoding human binding molecules in frame with nucleotide sequences encoding the / the appropriate marker (s) and then expressing the nucleic acid molecules.

Another aspect of the present invention is to provide a nucleic acid molecule that encodes at least one binding molecule or functional variant thereof according to the invention. Such nucleic acid molecules can be used as intermediates for cloning purposes, for example in the affinity maturation process described above. In a preferred embodiment, the nucleic acid molecules are isolated or purified.

The expert will appreciate that the functional variants of these nucleic acid molecules are also intended to be a part of the present invention. Functional variants are nucleic acid sequences that can be translated directly, using the conventional genetic code, to provide an identical amino acid sequence to that translated from the original nucleic acid molecules.

Nucleic acid molecules encoding binding molecules comprising a CDR3 region, preferably a heavy chain CDR3 region, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: are disclosed: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 and SEQ ID NO: 24.

Nucleic acid molecules encoding human binding molecules comprising a variable heavy chain comprising essentially an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO are also disclosed. : 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36 , SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49. In a particularly preferred embodiment, the nucleic acid molecules encode for binding molecules comprising a heavy chain variable comprising essentially an amino acid sequence comprising amino acids 1-119 of SEQ ID NO: 335.

Nucleic acid molecules encoding binding molecules comprising a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 26 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 50 are also disclosed. , or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 27 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 51, or encode for a variable heavy chain comprising the sequence of amino acids of SEQ ID NO: 28 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 52, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 29 and a variable light chain that comprises the amino acid sequence of SEQ ID NO: 53, or encodes for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 30 and a variable light chain which comprises the amino acid sequence of SEQ ID NO: 54, or encodes for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 31 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 55 , or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 32 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 56, or encode for a variable heavy chain comprising the sequence of amino acids of SEQ ID NO: 33 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 57, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 34 and a variable light chain that comprises the amino acid sequence of SEQ ID NO: 58, or encodes for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 35 and a variable light chain comprising the sequence of amino acids of SEQ ID NO: 59, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 36 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 60, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 37 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 61, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO : 38 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 62, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 39 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 63, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 64, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 41 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 65, or encode for a variable heavy chain comprising the sequence of amino acids of SEQ ID NO: 42 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 66, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 43 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 67, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 44 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 68, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 45 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 69, or encode for a chain a variable weighing comprising the amino acid sequence of SEQ ID NO: 46 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 70, or encoding a variable heavy chain comprising the amino acid sequence of SEQ ID NO : 47 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 71, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 48 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 72, or encode for a variable heavy chain comprising the amino acid sequence of SEQ ID NO: 49 and a variable light chain comprising the amino acid sequence of SEQ ID NO: 73. In a preferred embodiment, the Nucleic acid molecules encode for human binding molecules that comprise a variable heavy chain comprising the amino acid sequence comprising amino acids 1-119 of SEQ ID NO: 335 and a variable light chain comprising the amino acid sequence comprising amino acids 1-107 of SEQ ID NO: 337.

Nucleic acid molecules encoding the variable heavy chain of the binding molecules of the invention comprising essentially a nucleotide sequence selected from the group consisting of SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID are disclosed. NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96 and SEQ ID NO: 97. Preferably, the nucleic acid molecules encoding the variable heavy chain of the binding molecules of The invention essentially comprises a nucleotide sequence comprising nucleotides 1-357 of SEQ ID NO: 334.

Nucleic acid molecules encoding the variable light chain of the binding molecules of the invention that essentially comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 98, SEQ ID NO: 99, SEQ are also disclosed. ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO : 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116 , SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120 and SEQ ID NO: 121. Preferably, the nucleic acid molecules encoding the variable light chain of the binding molecules The human invention of the invention essentially comprises a nucleotide sequence comprising nucleotides 1-321 of SEQ ID NO: 336.

Another aspect of the invention is to provide vectors, that is, nucleic acid constructs, which comprise a

or more nucleic acid molecules according to the present invention. Vectors can be derived from plasmids such as, among others, F, R1, RP1, Col, pBR322, TOL, Ti, etc .; cosmids; phages such as lambda, lambdoide, M13, Mu, P1, P22, Qβ, T-even, T-odd, T2, T4, T7, etc; plant viruses such as, among others, alfalfa mosaic virus, bromovirus, capillovirus, carlavirus, carmovirus, caulivirus, clostervirus, comovirus, cryptovirus, cucumovirus, dianthovirus, fabavirus, fijivirus, furovirus, geminivirus, hordeivirus, ilarvirus, luteirus , machlovirus, marafivirus, necrovirus, nepovirus, phytoreovirus, plant rhabdovirus, potexvirus, potyvirus, sobemovirus, tenuivirus, tobamovirus, tobravirus, tomato tan virus, tombusvirus, tymovirus, etc; or virus from animals such as, among others, adenovirus, arenaviridae, baculoviridae, birnaviridae, bunyaviridae, calciviridae, cardiovirus, coronaviridae, corticoviridae, cystoviridae, Epstein-Barr virus, enterovirus, filoviridae, flaviviridae, glosopeda virus, hevirus hepatitis, herpesviridae, immunodeficiency virus, influenza virus, inoviridae, iridoviridae, orthomyxoviridae, papovavirus, paramyxoviridae, parvoviridae, picornaviridae, poliovirus, polydnaviridae, poxviridae, reoviridae, retrovirus, rvirdoeviridae, rvirdoeviridae, rvirdoeviridae, rvirdoviridae, rvirdoviridae, rvirdoviridae, rvirdoviridae, rvirdoviridae, rvirdoviridae, rvirdoeviridae, rvirdoeviridae, rvirdoeviridae, rvirdoviridae, rvirdoviridae virus , vaccinia virus, vesicular stomatitis virus, etc. The vectors can be used for cloning and / or for the expression of the human binding molecules of the invention and can even be used for gene therapy purposes. The present invention also covers vectors comprising one or more nucleic acid molecules according to the invention operatively linked to one or more nucleic acid molecules that regulate expression. The choice of the vector depends on the recombinant procedures followed and the host used. The introduction of vectors into host cells can be performed, among others, by transfection with calcium phosphate, virus infection, transfection mediated by DEAE-dextran, transfection with lipofectamine or electroporation. The vectors can replicate autonomously or they can replicate together with the chromosome in which they have been integrated. Preferably, the vectors contain one or more selection markers. The choice of markers may depend on the host cells of choice, although this is not critical to the invention as is well known to those skilled in the art. They include, but are not limited to, kanamycin, neomycin, puromycin, hygromycin, zeocin, thymidine kinase gene from herpes simplex virus (HSV-TK), the mouse dihydrofolate reductase (dhfr) gene. The invention also covers vectors comprising one or more nucleic acid molecules that code for human binding molecules as described above operably linked to one or more nucleic acid molecules that code for proteins or peptides that can be used to isolate the molecules. of Union. These proteins or peptides include, but are not limited to, glutathione-Stransferase, maltose-binding protein, metal-binding polyhistidine, green fluorescent protein, luciferase and beta-galactosidase.

A further object of the present invention are hosts that contain one or more copies of the aforementioned vectors. Preferably, the hosts are host cells. Host cells include, but are not limited to, cells of mammalian, plant, insect, fungal or bacterial origin. Bacterial cells include, but are not limited to, Gram positive bacteria cells such as several species of the Bacillus, Streptomyces and Staphylococcus genera or Gram negative bacteria cells such as several species of the Escherichia genera, such as E. coli, and Pseudomonas In the group of fungal cells, yeast cells are preferably used. Expression in yeasts can be achieved using yeast strains such as among others Pichia pastoris, Saccharomyces cerevisiae and Hansenula polymorpha. In addition, insect cells such as Drosophila and Sf9 cells can be used as host cells. In addition to this, the host cells can be plant cells. Transformed (transgenic) plants or plant cells are produced by known methods, for example, Agrobacterium-mediated gene transfer, leaf disc transformation, protoplast transformation by polyethylene glycol-induced DNA transfer, electroporation, sonication, microinjection or gene transfer ballistics. Additionally, a suitable expression system may be a baculovirus system. In the present invention expression systems using mammalian cells such as Chinese hamster ovary (CHO) cells, COS cells, BHK cells or Bowes melanoma cells are preferred. . Mammalian cells provide proteins expressed with modifications after translation that are very similar to natural molecules of mammalian origin. Since the present invention is about molecules that may have to be administered to humans, a completely human expression system would be particularly preferred. Therefore, even more preferably, the host cells are human cells. Examples of human cells are, among others, HeLa, 911, AT1080, A549, 293 and HEK293T cells. Preferred mammalian cells are human retinal cells such as 911 cells or the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 with the number 96022940 and marketed under the PER.C6® brand (PER.C6 is a registered trademark of Crucell Holland BV). For the purposes of this application, "PER.C6" refers to cells deposited with the number 96022940 or ancestors, forward or backward steps as well as descendants of ancestors of deposited cells, but as derivatives of any of the foregoing.

In preferred embodiments, the human producing cells comprise at least a functional part of a nucleic acid sequence encoding an E1 region of adenovirus in format that can be expressed. In even more preferred embodiments, said host cells are derived from a human retina and are immortalized with nucleic acids comprising adenoviral E1 sequences, such as the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 under the number 96022940 and marketed under the trademark PER.C6® (PER.C6 is a registered trademark of Crucell Holland BV). The production of recombinant proteins in host cells can be carried out according to methods well known in the art. The use of cells marketed under the PER.C6® brand as a production platform for proteins of interest has been described in WO 00/63403.

A method of producing a binding molecule or a functional variant according to the invention is an additional part of the invention. The method comprises the steps of a) cultivating a host according to the invention under conditions that lead to the expression of the binding molecule or functional variant thereof, and b) optionally recovering the binding molecule or functional variant thereof expressed. Binding molecules

or functional variants thereof expressed can be recovered from the cell-free extract, but preferably they are recovered from the culture medium. The person skilled in the art is well aware of methods to recover proteins, such as binding molecules, from cell-free extracts or culture medium. The binding molecules or functional variants thereof as can be obtained by the method described above are also a part of the present invention.

Alternatively, in addition to host expression, such as host cells, binding molecules or functional variants thereof of the invention can be synthetically produced by conventional peptide synthesizers or in cell-free translation systems using RNA-derived nucleic acid. of DNA molecules according to the invention. The binding molecule or functional variants thereof as can be obtained by synthetic production methods or cell-free translation systems described above are also a part of the present invention.

In another embodiment, the binding molecules or functional variants thereof according to the present invention can be generated by transgenic non-human mammals, such as for example transgenic mice or rabbits, which express human immunoglobulin genes. Preferably, transgenic non-human mammals have a genome comprising a human heavy chain transgene and a human light chain transgene that encode all or a portion of the human binding molecules as described above. Transgenic non-human mammals can be immunized with a purified or enriched preparation of the rabies virus or a fragment thereof. The protocols for immunizing non-human mammals are well established in the art. See Using Antibodies: A Laboratory Manual, edited by: E. Harlow, D. Lane (1998), Cold Spring Harbor Laboratory, Cold Spring Harbor, New York and Current Protocols in Immunology, edited by: J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, W. Strober (2001), John Wiley & Sons Inc., New York.

In a further aspect, the invention provides compositions comprising at least one binding molecule, at least one functional variant or a fragment thereof, at least one immunoconjugate according to the invention or a combination thereof. The compositions may further comprise, among others, stabilization molecules, such as albumin or polyethylene glycol, or salts. Preferably, the salts used are salts that retain the desired biological activity of human binding molecules and do not confer any unwanted toxicological effect. If necessary, the human binding molecules of the invention can be coated with a material to protect them from the action of acids or other natural or unnatural conditions that can inactivate the binding molecules.

Still in a further aspect, the invention provides compositions comprising at least one nucleic acid molecule as defined in the present invention. The compositions may comprise aqueous solutions such as aqueous solutions containing salts (for example, NaCl or salts as described above), detergents (for example, SDS) and / or other suitable components.

In addition, the present invention relates to pharmaceutical compositions comprising at least one binding molecule according to the invention, at least one functional variant or fragment thereof, at least one immunoconjugate according to the invention, at least one composition according to the invention, or combinations thereof. The pharmaceutical composition of the invention further comprises at least one pharmaceutically acceptable excipient.

In a preferred embodiment, the pharmaceutical composition according to the invention comprises at least one additional binding molecule, that is, the pharmaceutical composition may be a cocktail / mixture of binding molecules. The pharmaceutical composition may comprise at least two binding molecules according to the invention or at least one binding molecule according to the invention and at least one additional anti-rabies virus binding molecule. Said additional binding molecule preferably comprises a CDR3 region comprising the amino acid sequence of SEQ ID NO: 25. The binding molecule comprising the CDR3 region comprising the amino acid sequence of SEQ ID NO: 25 may be a chimeric monoclonal antibody. or humanized or a functional fragment thereof, but preferably it is a human monoclonal antibody or functional fragment thereof. In one embodiment, the binding molecule comprises a heavy chain variable region comprising the amino acid sequence SEQ ID NO: 273. In another embodiment, the binding molecule comprises a light chain variable region comprising the amino acid sequence SEQ ID. NO: 275. In yet another embodiment, the binding molecule comprises a heavy and light chain comprising the amino acid sequences of SEQ ID NO: 123 and SEQ ID NO: 125, respectively. The binding molecules in the pharmaceutical composition must be able to react with different non-competitive epitopes of the rabies virus. Epitopes may be present in rabies virus G protein and may be different non-overlapping epitopes. The binding molecules must be of high affinity and must have a wide specificity. Preferably, they neutralize as many fixed and natural strains of the rabies virus as possible. Even more preferably, they also show neutralizing activity towards other genotypes of the genus Lyssavirus or even with other viruses of the rhabdovirus family, while not showing cross-reactivity with other viruses or with normal cellular proteins. Preferably, the binding molecule can neutralize escape variants of the other binding molecule in the cocktail.

Another aspect of the present invention relates to a pharmaceutical composition comprising at least two binding molecules that neutralize the rabies virus, preferably (human) binding molecules according to the invention, characterized in that the binding molecules can react with non-epitopes. Different competitive rabies virus. In one embodiment, the pharmaceutical composition comprises a first binding molecule that neutralizes the rabies virus that can react with an epitope located at the antigenic site I of the G protein of the rabies virus and a second binding molecule that neutralizes the virus of rabies that can react with an epitope located at the antigenic site III of the G protein of rabies virus. The antigenic structure of rabies glycoprotein was initially defined by Lafon et al. (1983). Antigenic sites were identified using a mouse Acm panel and their respective variants of the Acm resistant virus. Since then, antigenic sites have been mapped by identifying amino acid mutations in the glycoprotein of Acm resistant variants (see Seif et al., 1985; Prehaud et al., 1988; and Benmansour et al., 1991). Most of the Acm that neutralize rabies are directed against antigenic site II (see Benmansour et al., 1991), which is a discontinuous conformational epitope comprising amino acids 34-42 and amino acids 198-200 (see Prehaud et al ., 1988). The antigenic site III is a continuous conformational epitope at amino acids 330-338 and houses two charged residues, K330 and R333, that affect viral pathogenicity (see Seif et al., 1985; Coulon et al., 1998; and Dietzschold et al., 1983). The conformational antigenic site I was defined by only one Acm, 509-6, and was located at amino acid 231 (see Benmansour et al., 1991; and Lafon et al., 1983). It is known that the antigenic site IV harbors overlapping linear epitopes (see Tordo, 1996; Bunschoten et al., 1989; Luo et al., 1997; and Ni et al.,

nineteen ninety five). Benmansour et al. (1991) also described the presence of a minor site located at position 342343, which is different from antigenic site III despite its close proximity. Alignment of the CR-57 epitope with the conformational and linear neutralizing epitopes currently known in the rabies glycoprotein (Figure 10) revealed that the CR-57 epitope is located in the same region as the conformational antigenic site I, defined by the Acm 509-6 unique. Based on the nucleotide and amino acid sequences of the CR04-098 escape virus glycoprotein, the epitope recognized by this antibody appears to be located in the same region as the continuous conformational antigenic site III.

Pharmaceutical compositions comprising a first binding molecule that neutralizes the rabies virus comprising at least one CDR3 region, preferably the heavy chain CDR3 region, comprising the amino acid sequence of SEQ ID NO: 25 and a second binding molecule that neutralizes the rabies virus comprising at least one CDR3 region, preferably the heavy chain CDR3 region, comprising the amino acid sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 10 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 22. Preferably, the second binding molecule that neutralizes the rabies virus comprises at least one CDR3 region, preferably the CDR3 region heavy chain, comprising the amino acid sequence of SEQ ID NO: 14. Preferably, the first binding molecule that neutralizes the rabies virus comprises a heavy and light chain comprising the sequences of a Minoacids of SEQ ID NO: 123 and SEQ ID NO: 125, respectively, and the second binding molecule that neutralizes the rabies virus comprises a heavy and light chain comprising the amino acid sequences of SEQ ID NO: 335 and SEQ ID NO: 337, respectively. Preferably, the heavy and light chain of the first binding molecule that neutralizes the rabies virus are encoded by SEQ ID NO: 122 and SEQ ID NO: 124, respectively, and the heavy and light chain of the second binding molecule that Rabies virus neutralizes are encoded by SEQ ID NO: 334 and SEQ ID NO: 336, respectively.

A pharmaceutical composition comprising two binding molecules, in which the pI of the binding molecules is divergent can be a problem when a suitable buffer is chosen that optimally stabilizes both binding molecules. When the pH of the composition buffer is adjusted so that the stability of one binding molecule increases, this could decrease the stability of the other binding molecule. The decrease in the stability or even the instability of a binding molecule can lead to its precipitation or aggregation or its spontaneous degradation resulting in the loss of the functionality of the binding molecule. Therefore, in another aspect, the invention provides a pharmaceutical composition comprising at least two binding molecules, preferably human binding molecules, characterized in that the binding molecules have isoelectric points (pI) that differ by less than about 1.5, 1.4, 1.3, 1.2, 1.1, 1.0, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, preferably in less than (and including) 0.25 pI units with each other. The pI can be measured experimentally, for example by means of isoelectric focusing, or it can be calculated based on the amino acid sequence of the binding molecules. In one embodiment, the binding molecules are binding molecules according to the present invention and the pharmaceutical composition is a pharmaceutical composition according to the invention. Preferably, the binding molecules are monoclonal antibodies, for example human monoclonal antibodies such as IgG1 antibodies. Preferably, the binding molecules can bind to and / or neutralize an infectious agent, for example a virus, a bacterium, a yeast, a fungus or a parasite. In one embodiment, the binding molecules can bind to and / or neutralize a lyssavirus, for example rabies virus. In a specific embodiment both binding molecules have a calculated pI that is in the range of 8.0-9.5, preferably 8.1-9.2, more preferably 8.2-8.5. Preferably, the binding molecules have the heavy chain CDR3 region of SEQ ID NO: 14 and SEQ ID NO: 25, respectively.

In another embodiment, the invention provides a cocktail of two or more human or other animal binding molecules, including, but not limited to, antibodies, in which at least one binding molecule is derived from a phage antibody or other technique. of presentation in replicable packages and at least one binding molecule can be obtained by a hybridoma technique. When divergent techniques are used, the selection of binding molecules that have a compatible pI is also very useful for obtaining a composition in which each binding molecule is sufficiently stable for storage, handling and subsequent use.

In another embodiment, the binding molecules present in the pharmaceutical composition of the invention increase the neutralizing activity of one another, that is, they act synergistically when combined. In other words, the pharmaceutical compositions may show synergistic neutralizing activity against rabies virus, and even against lyssavirus. As used herein, the term "synergistic" means that the combined effect of binding molecules when used in combination is greater than their additive effects when used individually. The ranges and ratios of the components of the pharmaceutical compositions of the invention should be determined based on their individual potencies and should be tested in in vitro neutralization tests or in animal models such as hamsters.

In addition, the pharmaceutical composition according to the invention may comprise at least one other therapeutic, prophylactic and / or diagnostic agent. Such additional therapeutic and / or prophylactic agents may be antiviral agents such as ribavirin or interferon-alpha.

The binding molecules or pharmaceutical compositions of the invention can be tested in suitable animal model systems before use in humans. Such animal model systems include, but are not limited to, mice, rats, hamsters, monkeys, etc.

Normally, pharmaceutical compositions should be sterile and stable under the conditions of manufacture and storage. Human binding molecules, variants or fragments thereof, immunoconjugates, nucleic acid molecules or compositions of the present invention may be in powder form for reconstitution in the appropriate pharmaceutically acceptable excipient before or at the time of administration. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation methods are vacuum drying and freeze drying (lyophilization) that produce a powder of the active ingredient plus any additional desired component from a solution that has been previously subjected to sterilization by filtration thereof.

Alternatively, the binding molecules, variants or fragments thereof, immunoconjugates, nucleic acid molecules or compositions of the present invention may be in solution and the appropriate pharmaceutically acceptable excipient may be added and / or mixed before or at the time of administration. to provide a unit injectable dosage form. Preferably, the pharmaceutically acceptable excipient used in the present invention is suitable for a high concentration of drug, can maintain proper fluidity and, if necessary, can delay absorption.

The choice of the optimal route of administration of the pharmaceutical compositions will be influenced by several factors including the physicochemical properties of the active molecules within the compositions, the urgency of the clinical situation and the relationship of the plasma concentrations of the active molecules with regarding the desired therapeutic effect. For example, if necessary, the human binding molecules of the invention can be prepared with vehicles that will protect them from rapid release, such as a controlled release formulation, including implants, transdermal patches and microencapsulated delivery systems. Among others, biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, poly (glycolic acid), collagen, polyorthoesters, and poly (lactic acid) can be used. In addition, it may be necessary to coat the human binding molecules with, or co-administer the binding molecules with, a material or compound that prevents inactivation of the human binding molecules. For example, human binding molecules can be administered to a subject in an appropriate vehicle, for example, liposomes, or a diluent.

The routes of administration can be generally divided into two main categories, oral and parenteral administration. The preferred administration of human binding molecules and pharmaceutical compositions of the invention is in and around the wound and intramuscularly in the gluteal region. The formulations of human binding molecules and pharmaceutical compositions depend on the routes of administration.

In a further aspect, the binding molecules, functional variants, immunoconjugates, compositions, or pharmaceutical compositions of the invention can be used as a medicament. Therefore, a method of treatment and / or prevention of a lyssavirus infection using human binding molecules, functional variants, immunoconjugates, compositions, or pharmaceutical compositions of the invention is another part of the present invention. The lyssavirus can be a virus of any of the known genotypes, but preferably it is the rabies virus. The molecules or compositions mentioned above can be used in prophylaxis such as rabies exposure.

The molecules or compositions mentioned above may be used together with other molecules useful in the diagnosis, prophylaxis and / or treatment of rabies virus. They can be used in vitro, ex vivo or in vivo. For example, human binding molecules, functional variants, immunoconjugates or pharmaceutical compositions of the invention can be co-administered with a rabies vaccine. Alternatively, the vaccine can also be administered before or after administration of the molecules or compositions of the invention. Administration of the molecules or compositions of the invention with a vaccine is suitable for prophylaxis after exposure. Rabies vaccines include, but are not limited to, purified chicken embryonic cell vaccine (PCEC) (RabAvert), human diploid cell vaccine (HDCV; Imovax vaccine) or adsorbed rabies vaccine (RVA).

The molecules are normally formulated in the compositions and pharmaceutical compositions of the invention in a therapeutically effective or diagnostic effective amount. Dosage regimens can be adjusted to provide the desired optimal response (eg, a therapeutic response). A suitable dosage range may be for example 0.1-100 IU / kg body weight, preferably 1.0-50 IU / kg body weight and more preferably 10-30 IU / kg body weight, such as 20 IU / kg body weight.

Preferably, a single bolus of the binding molecules or pharmaceutical compositions of the invention is administered. The pharmaceutical molecules and compositions according to the present invention are preferably sterile. Methods for making these molecules and compositions sterile are well known in the art. The dosage regimen for prophylaxis after exposure is the administration of five doses of rabies vaccine intramuscularly in the deltoid muscle on days 0, 3, 7, 14 and 28 after exposure in individuals not previously immunized against the virus. of rage Human binding molecules or pharmaceutical compositions according to the invention should be administered in and around the wounds on day 0 or otherwise as soon as possible after exposure, the rest of the volume being administered intramuscularly at a distant site of the vaccine. Unvaccinated individuals are advised to administer human anti-rabies virus binding molecules, but it is clear that human anti-rabies virus binding molecules can also be administered to the person skilled in the art who vaccinated the individuals who needed such treatment.

In another aspect, the invention relates to the use of binding molecules or functional variants thereof, immunoconjugates according to the invention, nucleic acid molecules according to the invention, pharmaceutical compositions or compositions according to the invention in the preparation of a medicament for diagnosis. , prophylaxis, treatment, or combination thereof, of a state resulting from an infection by a lyssavirus. The lyssavirus can be a virus of any of the known genotypes but is preferably rabies virus. Preferably the molecules mentioned above are used in the preparation of a prophylaxis medicament after exposure of rabies.

Next, kits comprising at least one binding molecule according to the invention, at least one functional variant thereof according to the invention, at least one immunoconjugate according to the invention, at least one nucleic acid molecule according to the invention, at least one Composition according to the invention, at least one pharmaceutical composition according to the invention, at least one vector according to the invention, at least one host according to the invention or a combination thereof are also part of the present invention. Optionally, the components described above of the kits of the invention are packaged in suitable containers and labeled for diagnosis, prophylaxis and / or treatment of the indicated conditions. The aforementioned components may be stored in unit or multi-dose containers, for example, sealed ampoules, vials, bottles, syringes and test tubes, as an aqueous solution, preferably sterile, or as a lyophilized formulation, preferably sterile, for reconstitution. The containers may be formed from a variety of materials such as glass or plastic and may have a sterile access hole (for example, the container may be an intravenous dissolution bag or a vial having a plug pierceable by a hypodermic injection needle ). The kit may further comprise more containers comprising a pharmaceutically acceptable buffer, such as phosphate buffered saline, Ringer's solution and dextrose solution. It may also include other desirable materials from a commercial and user point of view, including other buffers, diluents, filters, needles, syringes, culture medium for one or more of the suitable hosts. Associated with the kits, there may be instructions usually included in commercial packages of therapeutic, prophylactic and diagnostic products, containing information on, for example, indications, use, dosage, manufacture, administration, contraindications and / or warnings concerning the use of such therapeutic, prophylactic or diagnostic products.

Currently, HRIG products are used for prophylaxis after rabies exposure. An adult dose of HRIG of 1500 IU (75 kg individual, 20 IU / kg) is only available in a volume of 10 ml. More concentrated HRIG products are not possible since the 10 ml dose that can be obtained currently contains 11.5 grams of total IgG. In view of the same, current HRIG products have two drawbacks. First, it is often not anatomically feasible to administer the recommended full dose in and around bite wounds, and secondly, the administration of the current volume dose of HRIG is associated with significant pain. The present invention provides a solution to these drawbacks as it provides a pharmaceutical composition comprising a full adult dose in a volume of about 2 ml or less, if desirable. Such a pharmaceutical composition may comprise, for example, two binding molecules that can neutralize the rabies virus, preferably CR57 and CR04-098. The pharmaceutical composition further comprises a pharmaceutically acceptable excipient and has a volume of about 2 ml. More is also possible, but it is less desirable in view of the pain associated with the injection of larger volumes. It is also possible less than 2 ml. The pharmaceutical composition comprises the full adult dose (in IU) necessary for prophylaxis after satisfactory exposure. In one embodiment, the pharmaceutical composition is stored in a 10 ml vial such as, for example, a 10 ml ready-to-use vial (type I glass) with a stopper. By providing a 10 ml vial, the option of diluting the pharmaceutical composition to a higher volume is provided in case an individual has a large wound surface area. The invention also provides a kit comprising at least one container (such as a vial) comprising the pharmaceutical composition. The kit may further comprise a second container containing a diluent suitable for diluting the pharmaceutical composition to a higher volume. Suitable diluents include, but are not limited to, the pharmaceutically acceptable excipient of the pharmaceutical composition and a saline solution. In addition, the kit may comprise instructions for diluting the pharmaceutical composition and / or instructions for administering the pharmaceutical composition, diluted or not.

The binding molecules of the invention can be used to identify epitopes of rabies virus proteins such as the G protein. The epitopes can be linear, but also structural and / or conformational. In one embodiment, the binding of binding molecules of the invention to a series of overlapping peptides, such as 15-mer peptides, of a rabies virus protein such as rabies virus G protein can be analyzed by means of PEPSCAN analysis (see among others WO 84/03564, WO 93/09872, Slootstra et al. 1996). The binding of human binding molecules to each peptide can be tested in an enzyme-linked immunoassay (ELISA) based on PEPSCAN. In another embodiment, a random peptide library comprising rabies virus protein peptides can be examined to select peptides that can bind to the human binding molecules of the invention. In previous trials, the use of human rabies virus neutralizing binding molecules can identify one or more neutralizing epitopes.

The peptides / epitopes found can be used as vaccines and for the diagnosis of rabies.

In addition, a binding molecule is disclosed as defined herein that has a neutralizing activity against rabies virus, characterized in that the human binding molecule comprises at least one heavy chain CDR3 region comprising the amino acid sequence. comprising SEQ ID NO: 25 and further characterized in that the human binding molecule has a neutralizing activity against rabies virus of at least 2500 IU / mg protein. More preferably, said human binding molecule has a neutralizing activity against rabies virus of at least 2800 IU / mg protein, at least 3000 IU / mg protein, at least 3200 IU / mg protein, at least 3400 IU / mg of protein, at least 3600 IU / mg of protein, at least 3800 IU / mg of protein, at least 4000 IU / mg of protein, at least 4200 IU / mg of protein, at least 4400 IU / mg of protein, at least 4600 IU / mg of protein, at least 4800 IU / mg of protein, at least 5000 IU / mg of protein, at least 5200 IU / mg of protein, at least 5400 IU / mg of protein. The neutralizing activity of the binding molecule was measured by an in vitro neutralization assay (RFFIT (modified fast fluorescent focus inhibition test)). The essay is described in detail in the examples section below.

In one embodiment the binding molecule comprises a variable heavy chain comprising the amino acid sequence comprising SEQ ID NO: 273. In another embodiment the binding molecule comprises a heavy chain comprising the amino acid sequence comprising SEQ ID NO: 123 The variable light chain of the binding molecule may comprise the amino acid sequence comprising SEQ ID NO: 275. The light chain of the binding molecule may comprise the amino acid sequence comprising SEQ ID NO: 125.

A nucleic acid molecule that codes for the binding molecules as described above is also disclosed. Preferably, the nucleic acid molecule comprises the nucleotide sequence comprising SEQ ID NO: 122. In addition, the nucleic acid molecule may also comprise the nucleotide sequence comprising SEQ ID NO: 124. A vector is also provided herein. which comprises nucleic acid molecules and a host cell comprising such a vector. Preferably, the host cell is a mammalian cell such as a human cell. Examples of suitable cells for the production of human binding molecules are, among others, HeLa, 911, AT1080, A549, 293 and HEK293T cells. Preferred mammalian cells are human retinal cells such as 911 cells or the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 with the number 96022940 and marketed under the PER.C6® brand (PER.C6 is a registered trademark of Crucell Holland BV). For the purposes of this application, "PER.C6" refers to cells deposited with the number 96022940 or ancestors, steps forward or backward as well as descendants of ancestors of deposited cells, as well as derivatives of any of the foregoing.

EXAMPLES

To illustrate the invention, the following examples are provided. The examples are not intended to limit the scope of the invention in any way.

Example 1

Human antibody epitope recognition CR-57 and CR-JB anti-rabies

To treat whether human monoclonal antibodies named CR-57 and CR-JB recognize non-overlapping, non-competitive epitopes, escape viruses were generated from human monoclonal antibodies named CR-57 and CR-JB. CR-57 and CR-JB were generated essentially as described (see Jones et al., 2003), by introduction of the variable light and heavy chain coding regions of the corresponding antibody genes into a single IgG1 expression vector human called pcDNA3002 (Neo). The resulting vectors pgSO57C11 and pgSOJBC1 were used for transient expression in cells from the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 with the No. 96022940 and marketed under the PER.C6® brand. The amino acid and nucleotide sequences of the light and heavy chains of these antibodies are shown in SEQ ID NO: 122

- 129, respectively. Serial dilutions (0.5 ml) of the rabies virus strain CVS-11 (dilutions ranging from 10-1 -10-8) were incubated with a constant amount (~ 4 IU / ml) of CR- antibody 57 or CR-JB (0.5 ml) for 1 hour at 37 ° C / 5% CO2 before addition to wells containing mouse neuroblastoma cells (MNA cells) or BSR cells (kidney kidney-like cell line hamster). After 3 days of selection in the presence of human monoclonal antibody either CR-57 or CR-JB, medium (1 ml) containing possible escape viruses was collected and stored at 4 ° C until further use. Subsequently, the cells were fixed in acetone for 20 minutes at 4 ° C, and stained overnight at 37 ° C / 5% CO2 with anti-rabies antibody conjugate with N-FITC (Centocor). The number of foci per well was scored by immunofluorescence and the medium from wells containing one to six foci was chosen for virus amplification. All E57 escape viruses were generated from 1 single focus with the exception of E57B1 (3 foci). EJB escape viruses were isolated from 1 bulb (EJB3F), 3 bulbs (EJB2B), 4 bulbs (EJB2C), 5 bulbs (EJB2E, 2F), or 6 bulbs (EJB2D), respectively. Each escape virus was amplified in a small-scale primer in BSR or MNA cells depending on their growth characteristics. Then these small batches of virus were used to further amplify the virus on a large scale in MNA or BSR cells. The virus amplified in MNA cells was then titrated to determine the title of each batch of escape virus as well as the optimal dilution of the escape virus (which provides 80-100% infection after 24 hours) for use in a test of virus neutralization

Modified RFFIT assays (rapid fluorescent focus inhibition test) were performed to examine the cross protection of E57 (CR-57 escape viruses) and EJB (CR-JB escape viruses) with CR-JB and CR57 respectively. Therefore, CR-57 or CR-JB was diluted by triple serial dilutions starting with a 1: 5 dilution. Rabies virus (strain CVS-11) was added to each dilution at a concentration that provides 80100% infection. A virus / IgG mixture was incubated for 1 hour at 37 ° C / 5% CO2 before addition to MNA cells. 24 hours after infection (at 34 ° C / 5% CO2) the cells were fixed in acetone for 20 minutes at 4 ° C, and stained for a minimum of 3 hours with a rabies anti-rabies virus antibody conjugate with N-FITC (Centocor). The wells were then analyzed for rabies virus infection with a fluorescence microscope to determine the dilution of the 50% titration criteria. This is the dilution at which virus infection is blocked by 50% in this assay. To calculate potency, an international standard (rabies immunoglobulin batch R3, reference material from the standards laboratory and DMPQ / CBER / FDA assays) was included in each modified RFFIT. The dilution of the evaluation criteria of 50% of this standard corresponds to a power of 2 IU / ml. The neutralizing potency of the individual human monoclonal antibodies CR57 and CR-JB was tested as well as the combination of these antibodies.

EJB viruses were no longer neutralized by CR-JB or CR-57 (see table 1), suggesting that both antibodies bind to and induce amino acid changes in similar regions of rabies virus glycoprotein. E57 viruses were no longer neutralized by CR-57, while 4 out of 6 E57 viruses were still neutralized by CRJB, although with a lower potency (see Table 1). A mixture of the CR-57 and CR-JB antibodies (in a ratio of 1: 1 IU / mg) gave similar results to those observed with the individual antibodies (data not shown).

To identify possible mutations in the rabies virus glycoprotein, the nucleotide sequence of the open reading frame (ORF) of the glycoprotein of each of the EJB and E57 escape viruses was determined. Viral RNA from each of the escape viruses and CVS-11 was isolated from virus-infected MNA cells and converted to cDNA by conventional RT-PCR. Subsequently, cDNA was used for ORF nucleotide sequencing of the rabies virus glycoprotein in order to identify mutations.

Both E57 and EJB escape viruses showed mutations in the same region of the glycoprotein (see Figures 1 and 2, respectively; see for all sequences described in Figures 1 and 2 SEQ ID NO: 130 151). This indicates that both antibodies recognize overlapping epitopes. From the above, it can be concluded that the combination of CR-57 and CRJB in a cocktail does not prevent the escape of neutralization resistant variants and is therefore not an ideal immunoglobulin preparation for prophylaxis after exposure to rabies.

Example 2

Construction of a scFv phage display library using peripheral blood lymphocytes from donors vaccinated against rabies.

From four human subjects vaccinated against rabies, 50 ml of blood was drawn from a vein one week after the last reinforcement. Peripheral blood lymphocytes (PBL) were isolated from these blood samples using cell density fractionation in Ficoll. The blood serum was stored and frozen at -20 ° C. A positive test result was obtained to determine the presence of anti-rabies antibodies in the sera using FACS staining with 293T cells transfected with rabies virus glycoprotein. Total RNA was prepared from the PBLs using organic phase separation (TRIZOL ™) and subsequent ethanol precipitation. The RNA obtained was dissolved in ultrapure water treated with DEPC and the concentration was determined by OD measurement at 260 nm. Subsequently, the RNA was diluted to a concentration of 100 ng / l. Next, 1 µg of RNA was converted into cDNA in the following manner: to 10 µl of total RNA, 13 µl of ultrapure water treated with DEPC and 1 µl of random hexamers (500 ng / le) were added l) and the mixture obtained was heated at 65 ° C for 5 minutes and rapidly cooled in wet ice. Then, 8 µl of 5X First-Strand buffer, 2 µl of dNTP (10 mM each), 2 µl of DTT (0.1 M), 2 µl of RNase inhibitor (40) were added to the mixture U / ml) and 2 µl of MMLV Superscript ™ III reverse transcriptase (200 U / ml), was incubated at room temperature for 5 minutes and incubated for 1 hour at 50 ° C. The reaction was terminated by heat inactivation, that is, by incubating the mixture for 15 minutes at 75 ° C.

The cDNA products obtained were diluted to a final volume of 200 µl with ultrapure water treated with DEPC. The OD at 260 nm of a solution diluted 50 times (in 10 mM Tris buffer) of the dilution of the cDNA products obtained gave a value of 0.1.

For each donor, 5 to 10 µl of the diluted cDNA products were used as a template for PCR amplification of the lambda or kappa light chain sequences and the gamma immunoglobulin heavy chain family using specific oligonucleotide primers (see tables 2-7). The PCR reaction mixtures contained, in addition to the diluted cDNA products, 25 pmol of sense primer and 25 pmol of antisense primer in a final volume of 50 µl of 20 mM Tris-HCl (pH 8.4), KCl 50 mM, 2.5 mM MgCl2, 250 mM dNTP and 1.25 units of Taq polymerase. In a heated lid cycler having a temperature of 96 ° C, the mixtures obtained were rapidly melted for 2 minutes, followed by 30 cycles of: 30 seconds at 96 ° C, 30 seconds at 60 ° C and 60 seconds at 72 ° C.

In a first round of amplification, each of seventeen sense light region variable region primers (eleven for the lambda light chain (see table 2) and six for the kappa light chain (see table 3) were combined with a primer antisense that recognized the constant region of C-kappa called HuCk 5'ACACTCTCCCCTGTTGAAGCTCTT-3 '(see SEQ ID NO: 152) or C-lambda HuC2 5'TGAACATTCTGTAGGGGCCACTG-3' (see SEQ ID NO: 153) and HuC 57 5'-AGAGCATTCTGCAGGGGCCACTG- 3 '(see SEQ ID NO: 154) (antisense primers HuC2 and HuC7 were mixed until equimolarity before use), providing 4 times 17 products of approximately 600 base pairs These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel extraction columns 1/10 of each of the isolated products was used in a PCR reaction identical to that described above using the same seventeen primers sense, whereby each lambda light chain sense primer was combined with one of three J-lambda region specific antisense primers and each kappa light chain sense primer was combined with one of five J-kappa region specific antisense primers . The primers used in the second amplification were extended with restriction sites (see table 4) to allow direct cloning into the phage display vector PDV-C06 (see Figure 3 and SEQ ID NO: 155). This resulted in 4 multiplied by 63 products of approximately 350 base pairs that were combined to give a total of 10 fractions. This number of fractions was chosen to maintain the natural distribution of the different families of light chains within the library and not to represent in excess or defect certain families. The number of alleles within a family was used to determine the percentage of representation within a library (see table 5). In the next step, 2.5 µg of combined fraction and 100 µg of PDV-C06 vector were digested with SalI and NotI and purified from gel. Subsequently, ligation was performed overnight at 16 ° C as follows. To 500 ng of PDV-C06 vector, 70 ng of combined fraction was added in a total volume of 50 µl of ligation mixture containing 50 mM Tris-HCl (pH 7.5), 10 mM MgCl 2, 10 mM DTT, 1 mM ATP, 25 µg / ml BSA and 2.5 µL T4 DNA ligase (400 U / µl). This procedure was followed for each combined fraction. Ligation mixtures were purified by phenol / chloroform, followed by extraction in chloroform and ethanol precipitation, methods well known to those skilled in the art. The DNA obtained was dissolved in 50 µl of ultrapure water and two 2.5 µl aliquots were electroporated per ligation mixture in 40 µl of E. coli bacteria competent for TG1 according to the manufacturer's protocol (Stratagene). The transformants were grown overnight at 37 ° C in a total of 30 plates (three plates per combined fraction; plate size: 240 mm x 240 mm) containing 2TY agar supplemented with 50 µg / ml ampicillin and a 4, 5% glucose A (sub) library of variable light chain regions was obtained by scraping the transformants from the agar plates. This (sub) library was used directly for the preparation of plasmid DNA using a QIAFilter MAXI preparation kit from Qiagen ™.

For each donor, the heavy chain immunoglobulin sequences were amplified from the same cDNA preparations in a two-round PCR procedure and reaction parameters identical to those described above for light chain regions with the condition that used the primers represented in tables 6 and 7. The first amplification was performed using a set of nine sense-directed primers (see table 6; covering all families of heavy chain variable regions) each combined with an antisense primer of specific IgG constant region called HuCIgG 5'-GTC CAC CTT GGT GTT GCT GGG CTT-3 '(SEQ ID NO: 156) providing four times nine products of approximately 650 base pairs. These products were purified on a 2% agarose gel and isolated from the gel using Qiagen gel extraction columns. 1/10 of each of the isolated products were used in a PCR reaction identical to that described above using the same nine sense primers, whereby each heavy chain sense primer was combined with one of the four region specific antisense primers. JH The primers used in the second round were extended with restriction sites (see table 7) to allow targeted cloning in the (sub) light chain library vector. This resulted in donor 36 products of approximately 350 base pairs. These products were combined for each donor per sense primer (VH) used in nine fractions. The products obtained were purified using Qiagen PCR purification columns. Next, the fractions were digested with SfiI and XhoI and ligated into the light chain (sub) library vector, which was cut with the same restriction enzymes, using the same ligation procedure and volumes to those described above for (sub) light chain library. Alternatively, the fractions were digested with NcoI and XhoI and ligated into the light chain vector, which was cut with the same restriction enzymes, using the same ligation procedure and volumes to those described above for the (sub) chain library light The ligation, purification and subsequent transformation of the resulting definitive library were also performed as described above for the (sub) light chain library and at this point the ligation mixtures of each donor were combined by VH combination. The transformants were grown on 27 plates (three plates per combined fraction; plate size: 240 mm x 240 mm) containing 2TY agar supplemented with 50 µg / ml ampicillin and 4.5% glucose. All bacteria were collected in 2TY culture medium containing 50 µg / ml ampicillin and 4.5% glucose, mixed with glycerol up to 15% (v / v) and frozen in 1.5 ml aliquots at -80 ° C. The rescue and selection of each library were performed as described below.

Example 3

Selection of phages carrying single stranded Fv fragments that specifically recognize rabies virus glycoprotein

Antibody fragments were selected using antibody phage display libraries, general phage display technology and MAbstract® technology, essentially as described in US Patent No. 6,265,150 and WO98 / 15833. The antibody phage libraries used were two different semi-synthetic scFv phage libraries (JK1994 and WT2000) and the immune scFv phage libraries (RAB-03-G01 and RAB-04-G01) prepared as described in example 2 above. . The first semisynthetic scFv phage library (JK1994) has been described in de Kruif et al. (1995b), the second (WT2000) was constructed essentially as described in de Kruif et al. (1995b). In summary, the library has a semi-synthetic format whereby variation was incorporated into the light and heavy chain V genes using degenerate oligonucleotides that incorporate variation within the CDR regions. Only VH3 heavy chain genes were used, in combination with kappa and lambda light chain genes. CDR1 and CDR3 of the heavy chain and CDR3 of the light chain were synthetically recreated in a PCR-based approach similar to that described in de Kruif et al. (1995b). The V region genes created in a scFv format were sequentially cloned into a phagemid vector and amplified to generate a phage library as described above. In addition, res cooperating methods and phages described in WO02 / 103012 (incorporated by reference herein) were used in the present invention. To identify phage antibodies that recognized rabies virus glycoprotein, phage selection experiments were performed using complete rabies virus (Pitman-Moore strain of rabies virus) inactivated by treatment with beta-propiolactone, virus glycoprotein of purified rabies (ERA strain of rabies virus), and / or transfected cells expressing G protein of rabies virus (ERA strain of rabies virus).

Protein G was purified from the ERA strain of rabies virus as follows. To a virus solution, 1/10 by volume of 10% octyl-beta-glucopyranoside was added and mixed gently. After a 30 minute incubation at 4 ° C, the virus sample (36,000 rpm, 4 ° C) was centrifuged in a SW51 rotor. The supernatant was collected and dialyzed overnight at 4 ° C against 0.1 M Tris / EDTA. Subsequently, the glycoprotein was collected from the dialysis chamber, divided into aliquots, and stored at -80 ° C until further use. The protein concentration was determined by OD at 280 nm and the integrity of the G protein was analyzed by SDS-PAGE.

Complete inactivated rabies virus or rabies virus G protein was diluted in phosphate buffered saline (PBS), 2-3 ml was added to MaxiSorp Nunc-Immuno tubes (Nunc) and incubated overnight at 4 ° C in a rotary stirrer An aliquot of a phage library (500 µL, approximately 1013 cfu, amplified using CT helper phage (see WO 02/103012)) was blocked in blocking buffer (2% Protifar in PBS) for 1-2 hours at room temperature. The blocked phage library was added to the immunotube (pre-incubated with or without CRF 57 scFv to block the epitope recognized by CR-57), incubated for 2 hours at room temperature, and washed with wash buffer ( 0.1% Tween-20 (Serva) in PBS) to eliminate unbound phages. The bound phage of the antigen was then eluted by incubation for 10 minutes at room temperature with 1 ml of 50 mM glycine-HCl, pH 2.2. Subsequently, the eluted phages were mixed with 0.5 ml of 1M Tris-HCl, pH 7.5 to neutralize the pH. This mixture was used to infect 5 ml of E. coli XL1-Blue culture that had been grown at 37 ° C to an OD at 600 nm of approximately 0.3. The phages were allowed to infect the XL1-Blue bacteria for 30 minutes at 37 ° C. The mixture was then centrifuged for 10 minutes, at 3200 * g at room temperature and the bacterial pellet was resuspended in 0.5 ml of yeast extract medium and 2-tryptone (2TY). The bacterial suspension obtained was divided into two 2TY agar plates supplemented with tetracycline, ampicillin and glucose. After overnight incubation of the plates at 37 ° C, the colonies of the plates were scraped off and used to prepare an enriched phage library, essentially such

as described by De Kruif et al. (1995a) and WO 02/103012. In summary, scraped bacteria were used to inoculate 2TY medium containing ampicillin, tetracycline and glucose and grown at

CT cooperating phages were added and 0.3 was allowed.
׽ temperature of 37 ° C to an OD at 600 nm of

they infected the bacteria after which the medium was changed to 2TY containing ampicillin, tetracycline and kanamycin. Incubation was continued overnight at 30 ° C. The next day, the bacteria were removed from the 2TY medium by centrifugation after which the phages were precipitated in the medium using polyethylene glycol (PEG) 6000 / NaCl. Finally, phages were dissolved in 2 ml of PBS with 1% bovine serum albumin (BSA), sterilized by filtration and used for the next round of selection.

Phage selections were also made with cells transfected with rabies virus glycoprotein. The cells used were cells of the cell line deposited in the European Cell Culture Collection (ECACC), CAMR, Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 under the number 96022940 and marketed under the brand PER.C6® . Hereinafter referred to as PER.C6® cells. In this case, the blocked phage library (2 ml) was first added to 1 * 107 subtractor cells (in DMEM / 10% FBS) and incubated for 1 hour at 4 ° C on a rotary shaker. The subtractor cells were PER.C6® cells expressing the ectodomain of the vesicular stomatitis virus (VSV) glycoprotein on its surface fused with the cytoplasmic and transmembrane domain of the rabies virus. With this subtraction stage, phages that recognized either the VSV glycoprotein or specific antigens for PER.C6® cells were removed from the phage library. The phage / cell mixture (5 minutes at 4 ° C at 500xg) was centrifuged to remove phage bound to cells, and the supernatant was added to a new tube containing 3 ml of 1 * 107 subtractor cells. The subtraction step was repeated twice with the respective supernatant. Subsequently, the subtracted phages were incubated for 1.5 hours at 4 ° C on a rotary shaker with the transfected cells expressing rabies virus glycoprotein (PER.C6® cells (3 * 106 cells)). Prior to that, the transfected cells were pre-incubated with either or without scFv of CR-57 to block the epitope recognized by CR-57. After incubation the cells were washed five times with 1 ml of DMEM / 10% FBS (for each wash, the cells were resuspended and transferred to a new tube), the phages were eluted and processed as described above.

Normally, two rounds of selections were made before isolation of antibodies from individual phages. After the second round of selection, individual E. coli colonies were used to prepare monoclonal phage antibodies. Essentially, individual colonies were grown to the logarithmic phase in a 96-well format and were infected with VCSM13 cooperating phages after which the production of phage antibodies was allowed to proceed overnight. The phage antibodies produced were precipitated by PBG / NaCl and sterilized by filtration and tested in ELISA to detect binding to both complete inactivated rabies virus and G protein of purified rabies virus. From the selection, a large phage antibody panel was obtained that demonstrates the binding to both complete inactivated rabies virus and rabies virus G protein (see example below). Two selection strategies were followed with the immune libraries described above. In the first strategy, 736 phage antibodies were selected after two rounds of selection using inactivated virus or purified G protein in the first and second round of selection. In the second strategy, 736 phage antibodies were selected after two rounds of selection using in the first round of selection recombinant G protein expressed on the cell surface and in the second round of selection inactivated virus or purified G protein. The number of single phage antibodies obtained by the first strategy was 97, while the second strategy provided 70 unique. The 97 unique phage antibodies found by the first strategy resulted in 18 neutralizing antibodies and the 70 unique clones identified by the second strategy provided 33 neutralizing antibodies. This clearly demonstrates that the selections that included cells transfected with rabies virus glycoprotein, i.e. recombinant G protein expressed on the cell surface, as an antigen appeared to provide more neutralizing antibodies compared to selections using only purified G protein and / or inactivated virus .

Example 4

Validation of the single-chain phage antibodies specific for rabies virus glycoprotein.

Selected single stranded phage antibodies that were obtained from the selections described above, were validated in ELISA to determine the specificity, that is, the G protein binding of purified rabies virus as described above. Additionally, single-stranded phage antibodies were also tested for 5% FBS binding. For this, the preparation of rabies virus G protein or 5% FBS was coated on Maxisorp ™ ELISA plates. After coating, the plates were blocked in PBS / 1% Protifar for 1 hour at room temperature. Selected single-stranded phage antibodies were incubated for 15 minutes in an equal volume of PBS / 1% Protifar to obtain blocked phage antibodies. Plates were emptied, and blocked phage antibodies were added to the wells. Incubation was allowed to proceed for one hour, the plates were washed in PBS containing 0.1% Tween-20 and bound phage antibodies were detected (using OD measurement at 492 nm) using an anti-M antibody 13 conjugated with peroxidase. As a control, the procedure was performed simultaneously without using any single-stranded phage antibody, a negative control single-stranded phage antibody directed against CD8 (SC02-007) or a single-control positive phage phage antibody directed against rabies virus glycoprotein (scFv SO57). As shown in Table 8, the selected phage antibodies named SC04-001, SC04-004, SC04-008, SC04-010, SC04-018, SC04-021, SC04-026, SC04-031, SC04-038 , SC04-040, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04 -144, SC04-146 and SC04-164 showed significant binding to the immobilized purified rabies virus G protein, while no FBS binding was observed. Identical results were obtained in ELISA using the complete inactivated rabies virus as described above (data not shown).

Example 5

Characterization of scFv specific for rabies virus

From the selected single-stranded phage antibody clones (scFv) plasmid DNA was obtained and nucleotide sequences were determined according to conventional techniques. The nucleotide sequences of scFv (including restriction sites for cloning) called SC04-001, SC04-004, SC04008, SC04-010, SC04-018, SC04-021, SC04-026, SC04-031, SC04-038, SC04-040, SC04-060, SC04-073, SC04097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04-144, SC04146 and SC04-164 are shown in SEQ ID NO: 157, SEQ ID NO: 159, SEQ ID NO: 161, SEQ ID NO: 163, SEQ ID NO: 165, SEQ ID NO: 167, SEQ ID NO: 169, SEQ ID NO: 171, SEQ ID NO: 173, SEQ ID NO: 175, SEQ ID NO: 177, SEQ ID NO: 179, SEQ ID NO: 181, SEQ ID NO: 183, SEQ ID NO: 185, SEQ ID NO: 187, SEQ ID NO: 189, SEQ ID NO: 191, SEQ ID NO: 193, SEQ ID NO: 195, SEQ ID NO: 197, SEQ ID NO: 199, SEQ ID NO: 201 and SEQ ID NO: 203, respectively. The amino acid sequences of scFv called SC04-001, SC04-004, SC04-008, SC04-010, SC04-018, SC04-021, SC04-026, SC04-031, SC04-038, SC04-040, SC04- 060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04-120, SC04-125, SC04-126, SC04-140, SC04-144, SC04-146 and SC04-164 are shown in SEQ ID NO: 158, SEQ ID NO: 160, SEQ ID NO: 162, SEQ ID NO: 164, SEQ ID NO: 166, SEQ ID NO: 168, SEQ ID NO: 170, SEQ ID NO: 172, SEQ ID NO: 174, SEQ ID NO: 176, SEQ ID NO: 178, SEQ ID NO: 180, SEQ ID NO: 182, SEQ ID NO: 184, SEQ ID NO: 186, SEQ ID NO: 188, SEQ ID NO: 190, SEQ ID NO: 192, SEQ ID NO: 194, SEQ ID NO: 196, SEQ ID NO: 198, SEQ ID NO: 200, SEQ ID NO: 202 and SEQ ID NO: 204, respectively.

VH and VL gene identity (see Tomlinson IM, Williams SC, Ignatovitch O, Corbett SJ, Winter G. V-BASE Sequence Directory. Cambridge United Kingdom: MRC Center for Protein Engineering (1997)) and CDR3 chain compositions Weighing scFvs that specifically bind to the G protein of rabies virus are shown in Table 9.

Example 6

In vitro neutralization of rabies virus by specific rabies virus scFv (modified RFFIT)

In order to determine if the scFv selected could block rabies virus infection, in vitro neutralization assays (modified RFFIT) were performed. The scFv preparations were diluted by triple serial dilutions starting with a 1: 5 dilution. Rabies virus (strain CVS-11) was added to each dilution at a concentration that provides 80-100% infection. A virus / scFv mixture was incubated for 1 hour at 37 ° C / 5% CO2 before addition to MNA cells. 24 hours after infection (at 34 ° C / 5% CO2) the cells were fixed in acetone for 20 minutes at 4 ° C, and stained for a minimum of 3 hours with an anti-rabies antibody conjugate with N-FITC (Centocor) . The cells were then analyzed for rabies virus infection with a fluorescence microscope to determine the dilution of 50% titration criteria. This is the dilution at which virus infection is blocked by 50% in this assay (see example 1). Several scFv were identified that showed neutralizing activity against rabies virus (see table 10).

Additionally, it was investigated by means of the in vitro neutralization test (modified RFFIT) as described above, if the scFv selected could neutralize the E57 escape virus as prepared in example 1 (E57A2, E57A3, E57B1, E57B2, E57B3 and E57C3). Several scFvs that showed neutralizing activity against E57 escape viruses were identified (see Tables 11A and 11B).

Example 7

Rabies virus G protein competition ELISA with scFv

To identify antibodies that bound non-overlapping, non-competitive epitopes, a competition ELISA with rabies glycoprotein was performed. Maxisorp F96 Nunc-Inmuno ™ (Nunc) plates were coated overnight at 4 ° C with a 1: 1000 dilution of purified rabies virus glycoprotein (1 mg / ml; ERA strain of rabies virus) in PBS (50 )L). Uncoated protein was washed off before blocking the wells with 100 µl of PBS / 1% Protifar for 1 hour at room temperature. Subsequently, the blocking solution was discarded and 50 µl of the non-purified rabies anti-rabies scFv in PBS / 1% Protifar (diluted twice) were added. The wells were washed five times with 100 µl of PBS / 0.05% Tween-20. Then, 50 µl of biotinylated rabies anti-rabies virus IgG, CR-57bio, was added to each well, incubated for 5 minutes at room temperature, and the wells were washed five times with 100 µl of PBS / 0 , 05% of Tween-20. To detect CR-57bio binding, 50 µl of a 1: 2000 dilution of streptavidin-antibody with HRP (Becton Dickinson) was added to the wells and incubated for 1 hour at room temperature. The wells were washed again as before and the ELISA was further developed by adding 100 µl of OPD reagents (Sigma). The reaction was stopped by adding 50 µl of 1 M H2SO4 before measuring the OD at 492 nm.

The signal obtained with CR-57bio could only be reduced to basal levels when co-screened with scFv SO57, ie the scFv form of CR-57 (for nucleotide and amino acid sequences of SO57 see SEQ ID NO: 205 and 206, respectively) or scFv SOJB, ie the scFv form of CR-JB (for nucleotide and amino acid sequences of SOJB see SEQ ID NO: 312 and 313, respectively). This indicates that the scFv SO57 and SOJB compete with the interaction of CR-57bio with the rabies virus glycoprotein by binding to the same epitope or an overlapping epitope to that of CR-57bio, respectively. In contrast, an irrelevant scFv called SC02-007, that is, an scFv that binds to CD8, did not compete for binding. The anti-rabies scFv called SC04-004, SC04-010, SC04-024, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-120, SC04 -125, SC04-127, SC04-140, SC04-144 and SC04-146 also did not compete with CR-57bio, indicating that these scFv bind to an epitope other than the epitope recognized by CR-57 (see Figure 4) .

Similar results were obtained with the following experiment. First, the CR-57 antibody against rabies virus was added to wells coated with rabies virus G protein. Next, the competition scFvs were added. In this configuration the rabies anti-rabies scFv were detected with HRP-conjugated anti-VSV antibody by virtue of the presence of a VSV tag in the scFv amino acid sequences (see Figure 5).

Example 8

Construction of fully human immunoglobulin molecules (rabies anti-virus human monoclonal antibodies) from single-chain Fv selected anti-rabies virus

Variable regions of light and heavy chain scFvs called SC04-001, SC04-008, SC04-018, SC04040 and SC04-126 were amplified by PCR using oligonucleotides to add restriction sites and / or sequences for expression in the vectors of IgG expression pSyn-C03-HC1 (see SEQ ID NO: 277) and pSynC04-C (see SEQ ID NO: 278), respectively. The VH and VL genes were amplified using the oligonucleotides shown in Tables 12 and 13, respectively, and the PCR products were cloned into vectors pSyn-C03-HC1 and pSyn-C04-C, respectively.

The light and heavy chain variable regions of scFvs called SC04-004, SC04-010, SC04-021, SC04026, SC04-031, SC04-038, SC04-060, SC04-073, SC04-097, SC04-098, SC04-103, SC04-104, SC04-108, SC04120, SC04-125, SC04-140, SC04-144, SC04-146 and SC04-164 were also amplified by PCR using oligonucleotides to add restriction sites and / or sequences for expression in the IgG expression vectors pSyn-C03-HC1 and pSyn-C05-C (see SEQ ID NO: 279), respectively. The VH and VL genes were amplified using the oligonucleotides provided in tables 12 and 13, respectively, and the PCR products were cloned into the vectors pSyn-C03-HC1 and pSyn-C05-C, respectively. The oligonucleotides are designed in such a way that they correct any deviation from the germline sequence that was introduced during the construction of the library, due to the limited set of oligonucleotides that have been used to amplify the large repertoire of antibody genes. Nucleotide sequences for all constructs were verified according to conventional techniques known to those skilled in the art.

The resulting expression constructs pgG104-001C03, pgG104-008C03, pgG104-018C03, pgG104-040C03 and pgG104-126C03 encoding the heavy chains of human IgG1 anti-rabies virus in combination with the pSyn-C04-V0-V0-V0-construct relevant coding for the corresponding light chain, were expressed transiently in 293T cells and supernatants containing IgG1 antibodies were obtained. The expression constructs pgG104-004C03, pgG104-010C03, pgG104-021C03, pgG104-026C03, pgG104-031C03, pgG104038C03, pgG104-060C03, pgG104-073C03, pgG04, p4G3-03, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4103, p4-103 pgG104-108C03, pgG104-120C03, pgG104-125C03, pgG104-140C03, pgG104-144C03, pgG104-146C03 and pgG104-164C03 coding for the heavy chains of human IgG1 rabies combination with rab virus p5 -V relevant coding for the corresponding light chain, were expressed transiently in 293T cells and supernatants containing IgG1 antibodies were obtained.

The nucleotide and amino acid sequences of the light and heavy chains of antibodies called CR04-001, CR04-004, CR04-008, CR04-010, CR04-018, CR04-021, CR04-026, CR04-031, CR04 -038, CR04-040, CR04-060, CR04-073, CR04-097, CR04-098, CR04-103, CR04-104, CR04-108, CR04-120, CR04-125, CR04-126, CR04-140 , CR04-144, CR04-146 and CR04-164 were determined according to conventional techniques. Subsequently, recombinant human monoclonal antibodies were purified on a protein A column followed by a buffer exchange on a desalination column using conventional purification methods generally used for immunoglobulins (see for example WO 00/63403).

Additionally, for CR04-098, a single human IgG1 expression vector called pgG104098C10 was generated as described above for the pgSO57C11 and pgSOJBC11 vectors encoding CR-57 and CR-JB, respectively (see example 1). The nucleotide and amino acid sequences of the light and heavy chains of antibody CR04-098 encoded by the vector pgG104-098C10 are shown in SEQ ID NO: 334 337, respectively. Vectors pgSO57C11 (see example 1) and pgG104-098C10 were used for stable expression of CR-57 and CR04-098, respectively, in cells from the cell line deposited in the European cell culture collection (ECACC), CAMR , Salisbury, Wiltshire SP4 OJG, Great Britain on February 29, 1996 under the number 96022940 and marketed under the brand PER.C6®. The CR-57 and CR04-098 produced stably have a calculated isoelectric point of 8.22 and 8.46, respectively. The isoelectric points observed experimentally are between 8.1-8.3 for CR-57 and 9.0-9.2 for CR04-098. Recombinant human monoclonal antibodies were purified as described above. Unless otherwise indicated, for CR04-001, CR04-004, CR04-008, CR04-010, CR04-018, CR04-021, CR04-026, CR04-031, CR04038, CR04-040, CR04-060 , CR04-073, CR04-097, CR04-098, CR04-103, CR04-104, CR04-108, CR04-120, CR04125, CR04-126, CR04-140, CR04-144, CR04-146 and CR04-164 recombinant human monoclonal antibodies expressed transiently by the two vector system were used as described above and for CR57 recombinant human monoclonal antibody expressed transiently by the vector system was used as described in example 1.

Example 9

Rabies virus G protein competition ELISA with IgG

To treat whether human anti-protein G monoclonal IgG of rabies virus bind to non-overlapping, non-competitive epitopes, competition experiments were performed. Wells are incubated with rabies virus protein G coated with increasing concentrations (0-50 µg / ml) of unlabeled rabies virus anti-protein G IgG for 1 hour at room temperature. Then, 50 µl of a different biotinylated IgG anti rabies virus (1 µg / ml) is added to each well, incubated for 5 minutes at room temperature, and immediately washed five times with 100 µl of PBS / 0.05% Tween-20. Subsequently, the wells are incubated for 1 hour at room temperature with 50 µl of a 1: 2000 dilution of streptavidin-HRP (Becton Dickinson), washed and developed as described above. A decrease in the signal with the increase in unlabeled IgG concentration indicates that the two antibodies are competing with each other and recognize the same epitope or overlapping epitopes.

Alternatively, wells coated with rabies virus G protein (ERA strain) were incubated with 50 µg / ml unlabeled rabies virus anti-protein G IgG for 1 hour at room temperature. Then, 50 µl of biotinylated CR57 (0.5-5 µg / ml; at subsaturated levels) was added to each well. Additional steps were performed as before. The signals obtained were compared with the signal obtained only with biotinylated CR57 (see Figure 6; no competitor). From Figure 6 it can be deduced that the signal could not be reduced with the antibody called CR02-428 that served as a negative control. In contrast, competition with unmarked CR57 (positive control) or CR-JB reduced the signal to baseline levels. From Figure 6 it can be further deduced that none of the rabies virus anti-protein G IgG competed significantly with CR-57, which is consistent with scFv competition data as described in example 7.

In addition, competition experiments were performed with PER.C6 cells transfected with rabies virus G protein (ERA strain) by means of flow cytometry. Cells transfected with 20 µl of unlabeled rabies virus anti-protein G IgG (50 µg / ml) were incubated for 20 minutes at 4 ° C. After washing the cells with PBS containing 1% BSA, 20 µl of biotinylated CR57 (0.5-5 µg / ml; at substrate level) was added to each well, incubated for 5 minutes at 4 ° C, and immediately washed twice with 100 µl of PBS containing 1% BSA. Subsequently, the wells were incubated for 15 minutes at 4 ° C with 20 µl of a 1: 200 dilution of streptavidin-PE (Caltag), washed and developed as described above. The signal obtained with biotinylated CR57 could not be significantly reduced with the negative control antibody CR02-428 (see Figure 7). In contrast, competition with unmarked CR57 (positive control) or CR-JB reduced the signal to baseline levels. None of the rabies virus anti-protein G IgG competed significantly with CR-57, with the exception of CR04-126 which reduced the signal to approximately 30% (see Figure 7). The latter did not compete in ELISA (see Figure 6). This may be caused by the difference in the way glycoprotein is presented to the antibody in FACS experiments compared to ELISA experiments. The binding of CR04-126 could depend more on the conformation of the glycoprotein, resulting in the competitive effect observed with CR04-126 in the competition test based on FACS and not in the competition test based on ELISA. Additionally, CR04-008 and CR04-010 reduced the signal to approximately 50% (see Figure 7) in the FACS-based competition test which indicates that they could compete with CR57. However, this was not confirmed for CR04-010 by scFv competition data or the ELISA based competition test. For the other IgG, the FACS data corresponded with the respective ELISA data of both scFv and IgG.

Example 10

Additive synergistic effects of anti-rabies IgG on in vitro neutralization of rabies virus (modified RFFIT)

In order to determine whether rabies virus anti-protein G IgGs had additive or synergistic effects on rabies virus neutralization, different combinations of IgGs were tested. First, the potency (in IU / mg) of each individual antibody is determined in a modified RFFIT (see example 1). Then, antibody combinations are prepared based on equal amounts of IU / mg and tested on the modified RFFIT. The potencies of each antibody combination can be determined and compared with the expected potencies. If the potency of the antibody combination is equal to the sum of the potencies of each individual antibody present in the combination, the antibodies have an additive effect. If the potency of the antibody combination is superior, the antibodies have a synergistic effect on the neutralization of rabies virus.

Alternatively, additive or synergistic effects can be determined by the following experiment. First, the potency of the antibodies to be tested, for example CR-57 and CR04-098, is determined in a conventional RFFIT (see Laboratory techniques in rabies, edited by: FX Meslin, MM Kaplan and H. Koprowski (1996), 4th edition, chapter 15, World Health Organization, Geneva). Then, the antibodies are mixed in a 1: 1 ratio based on IU / ml. This mixture of antibodies, together with the individual antibodies at the same concentration, is tested in six independent RFFIT experiments to determine the 50% neutralization titration criteria. Subsequently, the combination index (CI) for the antibody mixture is determined using the formula CI = (C1 / Cx1) + (C2 / Cx2) + (C1C2 / Cx1Cx2) as described by Chou et al. (1984). C1 and C2 are the amount (in g) of monoclonal antibody 1 and monoclonal antibody 2 that leads to 50% neutralization when used in combination and Cx1 and Cx2 are the amounts (in g) of monoclonal antibody 1 and antibody monoclonal 2 that lead to 50% neutralization when used alone. CI = 1, indicates an additive effect, CI <1 indicates a synergistic effect and CI> 1 indicates an antagonistic effect of monoclonal antibodies.

Virus

Potencia Potencia Virus Potencia Potencia

CR-57 (UI/mg)

CR-JB (UI/mg) CR-57 (UI/mg) CR-JB (UI/mg)

CVS-11

3797 605 CVS-11 3797 605

E57A2

0 <0,2 EJB2B 0,004 0,6

E57A3

0 419 EJB2C <0,004 2

E57B1

0 93 EJB2D <0,004 3

E57B2

0 <0,3 EJB2E <0,2 <0,3

E57B3

0 419 EJB2F <0,06 3

E57C3

0 31 EJB3F <0,04 0,06

Tabla 2: Cebadores de región variable de cadena lambda humana (sentido). Tabla 3: Cebadores de región variable de cadena kappa humana (sentido).

Nombre del cebador

Secuencia de nucleótidos del cebador SEQ ID NO

HuV1A

SEQ ID NO: 208

HuV1B

SEQ ID NO: 209

HuV1C

SEQ ID NO: 210

HuV2

SEQ ID NO: 211

HuV3A

SEQ ID NO: 212

HuV3

SEQ ID NO: 213

HuV4

SEQ ID NO: 214

HuV5

SEQ ID NO: 215

HuV6

imagen1 SEQ ID NO: 216

HuV7/8

SEQ ID NO: 217

HuV9

SEQ ID NO: 218

Nombre del cebador

Secuencia de nucleótidos del cebador SEQ ID NO

HuV1B

SEQ ID NO: 219

HuV2

SEQ ID NO: 220

HuV3

SEQ ID NO: 221

HuV4

SEQ ID NO: 222

HuV5

SEQ ID NO: 223

HuV6

SEQ ID NO: 224

Tabla 4: Cebadores de región variable de cadena kappa humana extendidos con sitios de restricción SalI (sentido), cebadores de región J de cadena kappa humana extendidos con sitios de restricción NotI (antisentido), cebadores de región variable de cadena lambda humana extendidos con sitios de restricción SalI (sentido) y cebadores de región J de cadena lambda humana extendidos con sitios de restricción NotI (antisentido).

Nombre del cebador

Secuencia de nucleótidos del cebador SEQ ID NO

HuVB-SalI

SEQ ID NO: 225

HuV2-SalI

SEQ ID NO: 226

HuV3B-SalI

SEQ ID NO: 227

HuV4B-SalI

SEQ ID NO: 228

HuV5-SalI

SEQ ID NO: 229

HuV6-SalI

SEQ ID NO: 230

HuV1-NotI

imagen1 SEQ ID NO: 231

HuJ2-NotI

SEQ ID NO: 232

HuJ3-NotI

imagen1 SEQ ID NO: 233

HuV4-NotI

imagen1 SEQ ID NO: 234

HuV5-NotI

SEQ ID NO: 235

HuV1A-SalI

SEQ ID NO: 236

HuV1B-SalI

SEQ ID NO: 237

HuV1C-SalI

SEQ ID NO: 238

HuV2-SalI

SEQ ID NO: 239

HuV3A-SalI

SEQ ID NO: 240

HuV3B-SalI

SEQ ID NO: 241

HuV4-SalI

SEQ ID NO: 242

HuV5-SalI

SEQ ID NO: 243

HuV6-SalI

imagen1 SEQ ID NO: 244

HuV7/8-SalI

SEQ ID NO: 245

HuV9-SalI

SEQ ID NO: 246

HuJ-NotI

imagen1 SEQ ID NO: 247

HuV2/3-NotI

SEQ ID NO: 248

HuJ4/5-NotI

imagen1 SEQ ID NO: 249

Tabla 5: Distribución de los diferentes productos de cadena ligera a lo largo de las 10 fracciones. imagen1
Tabla 6: Cebadores de región variable de cadena pesada de IgG humana (sentido).

Nombre del cebador

Secuencia de nucleótidos del cebador SEQ ID NO

HuVH1B/7A

SEQ ID NO: 250

HuVH1C

SEQ ID NO: 251

HuVH2B

SEQ ID NO: 252

HuVH3B

SEQ ID NO: 253

HuVH3C

SEQ ID NO: 254

HuVH4B

imagen1 SEQ ID NO: 255

HuVH4C

SEQ ID NO: 256

HuVH5B

SEQ ID NO: 257

HuVH6A

SEQ ID NO: 258

Tabla 7: Cebadores de región variable de cadena pesada de IgG humana extendidos con sitios de restricción SfiI/NcoI (sentido) y cebadores de región J de cadena pesada de IgG humana extendidos con sitios de restricción XhoI/BstEII (antisentido). imagen2

HuVH1B/7A-SfiI

SEQ ID NO: 259

HuVHIC-SfiI

imagen1 SEQ ID NO: 260

HuVH2B-SfiI

SEQ ID NO: 261

HuVH3B-SfiI

SEQ ID NO: 262

HuVH3C-SfiI

SEQ ID NO: 263

HuVH4B-SfiI

SEQ ID NO: 264

HuVH4C-SfiI

SEQ ID NO: 265

HuVH5B-SfiI

imagen1 SEQ ID NO: 266

HuVH6A.SfiI

imagen1 SEQ ID NO: 267

HuJH1/2-XhoI

SEQ ID NO: 268

HuJH3-XhoI

SEQ ID NO: 269

HuJH4/5-XhoI

imagen1 SEQ ID NO: 270

HuJH6-XhoI

imagen1 SEQ ID NO: 271

Tabla 8: Unión de anticuerpos de fagos monocatenarios (scFv) a proteína G de virus de la rabia (cepa ERA) y a FBS según se mide mediante ELISA.

Nombre de anticuerpo de fagos

Proteína G de virus de la rabia (DO a 492 nm) FBS (DO a 492 nm)

SC04-001

0,828 0,053

SC04-004

0,550 0,054

SC04-008

0,582 0,058

SC04-010

0,915 0,043

SC04-018

0,247 0,052

SC04-021

0,278 0,052

SC04-026

0,212 0,054

SC04-031

0,721 0,065

SC04-038

0,653 0,061

SC04-040

0,740 0,053

SC04-060

0,923 0,056

SC04-073

0,657 0,054

SC04-097

0,835 0,056

SC04-098

0,798 0,060

SC04-103

0,606 0,059

SC04-104

0,566 0,063

SC04-108

0,363 0,052

SC04-120

0,571 0,052

SC04-125

0,735 0,049

SC04-126

0,232 0,051

SC04-140

0,865 0,057

SC04-144

0,775 0,054

SC04-146

0,484 0,057

SC04-164

0,547 0,057

Control (SO57)

0,650 0,055

Control (02-007)

0,063 0,052

Tabla 9: Datos de los Fv monocatenarios que pueden unirse a proteína G de virus de la rabia.

Nombre de scFv (bib.)

SEQ ID NO de secuencia de nucl. SEQ ID NO de secuencia de aminoácidos HCDR3 (SEQ ID NO:) Locus de VH Locus de VL

sc04-001 (JK1994)

157 158 GLYGELFDY (SEQ ID NO: 1) 3-20 (DP32) V13 (31 -V213)

sc04-004 (WT2000)

159 160 DYLYPTTDFDY (SEQ ID NO: 2) 3-23 (DP47) VkI (012/02DPK9)

sc04-008 (RAB03- G01)

161 162 MGFTGTYFDY (SEQ ID NO: 3) 2-70 (DP28) V13 (3h -V214)

sc04-010 (RAB03- G01)

163 164 3-30 (DP49) VkI (L11 DPK3)

sc04-018 (RAB03- G01)

165 166 VSVTTGAFNI (SEQ ID NO: 5) 4-04 (DP70) V11 (1c -V116)

sc04-021 (RAB03- G01)

167 168 GSVLGDAFDI (SEQ ID NO: 6) 3-30 (DP49) VkI (L8)

sc04-026 (RAB03- G01)

169 170 TSNWNYLDRFDP (SEQ ID NO: 7) 5-51 (DP73) VkII (A 19/03 -DPK15)

sc04-031 (RAB03- G01)

171 172 GSVLGDAFDI (SEQ ID NO: 8) 3-30 (DP49) VkI (L5 -DPK5)

sc04-038 (RAB03- G01)

173 174 GSVLGDAFDI (SEQ ID NO: 9) 3-30 (DP49) VkI (L5 -DPK5)

sc04-040 (RAB03- G01)

175 176 GSKVGDFDY (SEQ ID NO: 10) 3-30 (DP49) V13 (3h -V214)

sc04-060 (RAB04- G01)

177 178 4-59 (DP71) VkI (O12/02 DPK9)

sc04-073 (RAB04- G01)

179 180 imagen1 3-30 (DP49) VkI (L12)

sc04-097 (RAB04- G01)

181 182 TASNLGRGGMDV (SEQ ID NO: 13) 3-23 (DP47) VkI (L8)

sc04-098 (RAB04- G01)

183 184 VAVAGTHFDY (SEQ ID NO: 14) 3-30 (DP49) VkI (A30)

sc04-103 (RAB04- G01)

185 186 VAVAGESFDS (SEQ ID NO: 15) 3-30 (DP49) VkI (L5 -DPK5)

sc04-104 (RAB04- G01)

187 188 IVVVTALDAFDI (SEQ ID NO: 16) 3-30 (DP49) VkI (L12)

sc04-108 (RAB

189 190 FMIVADDAFDI 3-30 (DP49) VkI (L1)

04- G01)

(SEQ ID NO: 17)

sc04-120 04- G01)

(RAB 191 192 GGKTGEFDY (SEQ ID NO: 18) 3-30 (DP49) VkI (L8)

sc04-125 04- G01)

(RAB 193 194 IATAGTGFDY (SEQ ID NO: 19) 3-30 (DP49) VkI (L8)

sc04-126 04- G01)

(RAB 195 196 MGFTGTYTDY (SEQ ID NO: 20) 2-70 (DP28) V13 (3h -V214)

sc04-140 04- G01)

(RAB 197 198 VTNPGDAFDI (SEQ ID NO: 21) 3-30 (DP49) VkI (L4/18a)

sc04-144 04- G01)

(RAB 199 200 GGKTGEFDY (SEQ ID NO: 22) 3-30 (DP49) VkI (L8)

sc04-146 04- G01)

(RAB 201 202 GGKTGEFDY (SEQ ID NO: 23) 3-30 (DP49) VkIII (L2 -DPK21)

sc04-164 04- G01)

(RAB 203 204 GSVLGDAFDI (SEQ ID NO: 24) 3-30 (DP49) VkI (L19 DPK6)

SO57

205 206 1-69 (DP10) V12 (2e -VI3)

SOJB

312 313 RQHISSFPWFDS (SEQ ID NO: 276) 2-05 V13 (3h -V214)

Tabla 10: Datos de ensayo para determinar la actividad neutralizante contra el virus de la rabia de scFv.

Nombre de scFv

Dilución de criterio de valoración del 50% Norma de la OMS de dilución de criterio de valoración del 50% (2 UI/ml) Potencia (UI/ml)

SC04-001

270 405 1,3

SC04-004

3645 405 18

SC04-008

>10935 405 >54

SC04-010

810 405 4

SC04-018

15 405 0,1

SC04-021

270 405 1,3

SC04-026

45 270 0,3

SC04-031

90 270 0,7

SC04-038

270 270 2

SC04-040

45 270 0,3

SC04-060

30 270 0,2

SC04-073

405 270 3

SC04-097

30 270 0,2

SC04-098

1215 270 9

SC04-103

45 270 0,3

SC04-104

135 270 1

SC04-108

135 270 1

SC04-120

810 270 6

SC04-125

405 270 3

SC04-126

10 270 0,1

SC04-140

135 270 1

SC04-144

810 270 6

SC04-146

405 270 3

SC04-164

45 270 0,3

Tabla 11A: Datos de ensayo para medir la actividad neutralizante de scFv para virus de escape E57 E57A2, E57A3 y E57B1.

Nombre de scFv

E57A2 E57A3 E57B1

1*

2* 3* 1* 2* 3* 1* 2* 3*

SC04-001

10 90 0,2 10 90 0,2 30 45 1,3

SC04-004

810 90 18,0 1215 90 27,0 810 45 36,0

SC04-008

10 90 0,2 15 90 0,3 270 45 12,0

SC04-010

270 90 6,0 270 90 6,0 270 45 12,0

SC04-018

5 90 0,1 15 90 0,3 15 45 0,7

SC04-021

10 90 0,2 30 90 0,7 10 90 0,2

SC04-026

<5 90 0,0 <5 45 0,0 <5 90 0,0

SC04-031

10 90 0,2 30 90 0,7 10 90 0,2

SC04-038

90 90 2,0 90 90 2,0 45 90 1,0

SC04-040

15 90 0,3 5 90 0,1 5 90 0,1

SC04-060

5 90 0,1 5 90 0,1 <5 90 0,0.

SC04-073

135 90 3,0 90 30 6,0 30 30 2,0

SC04-097

<5 90 0,0 <5 90 0,0 <5 90 0,0

SC04-098

810 90 18,0 270 30 18,0 270 30 18,0

SC04-103

<5 90 0,0 10 90 0,2 5 90 0,1

SC04-104

90 90 2,0 30 30 2,0 30 30 2,0

SC04-108

15 90 0,3 <5 90 0,0 <5 90 0,0

SC04-120

45 90 1,0 30 30 2,0 10 30 0,7

SC04-125

135 90 3,0 135 30 9,0 90 30 6,0

SC04-126

<5 90 0,0 <5 45 0,0 <5 90 0,0

SC04-140

30 45 1,3 90 30 6,0 45 90 1,0

SC04-144

270 45 12,0 270 30 18,0 135 90 3,0

SC04-146

90 45 4,0 90 30 6,0 90 90 2,0

SC04-164

15 45 0,7 30 30 2,0 15 90 0,3

1* es la dilución de criterio de valoración del 50% 2* es la norma de la OMS de dilución de criterio de valoración del 50% (2 UI/ml) 3* es la potencia (UI/ml)
Tabla 11 B: Data de ensayo para medir la actividad neutralizante de scFv para virus de escape E57 E57B2, E57B3 y E57C3.

Nombre de scFv

E57B2 E57B3 E57C3

1*

2* 3* 1* 2* 3* 1* 2* 3*

SC04-001

30 45 1,3 90 270 0,7 5 90 0,1

SC04-004

5 45 0,2 2430 270 18,0 270 90 6,0

SC04-008

5 45 0,2 45 270 0,3 10 90 0,2

SC04-010

45 45 2,0 405 270 3,0 270 90 6,0

SC04-018

15 45 0,7 15 270 0,1 30 90 0,7

SC04-021

10 90 0,2 30 270 0,2 10 90 0,2

SC04-026

<5 45 0,0 <5 45 0,0 <5 30 0,0

SC04-031

10 90 0,2 30 270 0,2 30 90 0,7

SC04-038

30 90 0,7 90 270 0,7 90 90 2,0

SC04-040

5 90 0,1 15 135 0,2 10 90 0,2

SC04-060

<5 90 0,0 10 135 0,1 5 90 0,1

SC04-073

30 90 0,7 90 270 0,7 90 90 2,0

SC04-097

<5 90 0,0 <5 135 0,0 <5 90 0,0

SC04-098

90 90 2,0 810 270 6,0 270 90 6,0

SC04-103

<5 90 0,0 10 135 0,1 10 90 0,2

SC04-104

45 90 1,0 45 270 0,3 90 90 2,0

SC04-108

10 90 0,2 <5 135 0,0 15 90 0,3

SC04-120

15 90 0,3 45 270 0,3 30 90 0,7

SC04-125

90 90 2,0 270 270 2,0 270 90 6,0

SC04-126

<5 45 0,0 <5 45 0,0 <5 30 0,0

SC04-140

30 90 0,7 90 90 2,0 270 90 6,0

SC04-144

90 90 2,0 270 90 6,0 405 90 9,0

SC04-146

30 90 0,7 90 90 2,0 90 90 2,0

SC04-164

15 90 0,3 15 90 0,3 30 90 0,7

1* es la dilución de criterio de valoración del 50% 2* es la norma de la OMS de dilución de criterio de valoración del 50% (2 UI/ml) 3* es la potencia (UI/ml)
Tabla 12: Oligonucleótidos usados para la amplificación mediante PCR de genes de VH.

Nombre y secuencia de nucleótidos

Gen de VH SEQ ID NO:

5H-B:

SC04-001 280

acctgtcttgaattctccatggccgaggtgcagctggtggagtctg

5H-C: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgg

SC04-021 SC04-031 SC04-125 SC04-164 281

5H-C-largo: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgggg

SC04-010 SC04-038 SC04-040 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-120 SC04-140 SC04-144 SC04-146 282

5H-F: acctgtcttgaattctccatggcccaggtgcagctgcaggagtccggccc

SC04-018 SC04-060 283

5H-H: acctgtcttgaattctccatggccgaggtgcagctggtgcagtctgg

SC04-026 284

5H-I: acctgtcttgaattctccatggccgaggtgcagctgctggagtctgg

SC04-004 SC04-097 285

5H-M: acctgtcttgaattctccatggcccaggtgaccttgaaggagtctgg

SC04-008 SC04-126 286

sy3H-A: gcccttggtgctagcgctggagacggtcaccagggtgccctggcccc

SC04-001 SC04-004 SC04-008 SC04-010 SC04-026 SC04-040 SC04-073 SC04-098 SC04-120 SC04-125 SC04-126 SC04-144 SC04-146 287

sy3H-C: gcccttggtgctagcgctggagacggtcacggtggtgccctggcccc

SC04-097 288

sy3H-C-largo:

SC04-060 289

sy3H-D: gcccttggtgctagcgctggacacggtcaccatggtgccctggcccc

SC04-018 SC04-021 SC04-031 SC04-038 SC04-104 SC04-108 SC04-140 SC04-164 290

sy3H-E: gcccttggtgctagcgctggacacggtcaccagggtgccccggcccc

SC04-103 291

Tabla 13: Oligonucleótidos usados para la amplificación mediante PCR de genes de VL.

Nombre y secuencia de nucleótidos

Gen de VL SEQ ID NO:

3L-B:

SC04-001 292

ttttccttagcggccgcgactcacctaggacggtcagcttggtc

5K-B: acctgtctcgagttttccatggctgacatccagatgacccagtc

SC04-031 SC04-060 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-164 293

5K-C: acctgtctcgagttttccatggctgacatccagatgacccagtctccatcct ccc

SC04-004 294

5K-G: acctgtctcgagttttccatggctgacatcgtgatgacccagtctcc

SC04-026 295

5K-K: acctgtctcgagttttccatggctgccatccagatgacccagtctcc

SC04-010 296

5K-M: acctgtctcgagttttccatggctgacatccagctgacccagtc

SC04-021 SC04-097 SC04-120 SC04-125 SC04-144 297

5K-N: acctgtctcgagttttccatggctgacatccagatgactcagtc

SC04-038 298

5K-O: acctgtctcgagttttccatggctgccatccagctgacccagtc

SC04-140 299

5K-Q: acctgtctcgagttttccatggctgagatcgtgatgactcagtc

SC04-146 300

5L-E: acctgtctcgagttttccatggcttcctacgtgctgactcagccg

SC04-008 301

5L-F: acctgtctcgagttttccatggctcagtccgtgctgactcagcc

SC04-018 302

5L-G: acctgtctcgagttttccatggcttcctacgtgctgactcagcc

SC04-040 303

SC04-126

sy3K-F: gctgggggcggccacggtccgcttgatctccaccttggtccc

SC04-004 SC04-010 SC04-021 SC04-031 SC04-098 SC04-104 SC04-125 SC04-140 SC04-144 SC04-164 304

sy3K-I: gctgggggcggccacggtccgcttgatctccagccgtgtccc

SC04-038 SC04-097 SC04-103 SC04-108 SC04-146 305

sy3K-J: gctgggggcggccacggtccgcttgatctccagcttggtccc

SC04-026 SC04-060 SC04-073 306

sy3K-K: gctgggggcggccacggtccgcttgatgtccaccttggtccc

SC04-120 307

sy3L-A: ccagcacggtaagcttcagcacggtcaccttggtgccagttcc

SC04-018 SC04-126 308

sy3L-C: ccagcacggtaagcttcagcacggtcagcttggtgcctccgcc

SC04-040 309

sy3L-D: ccagcacggtaagcttcaacacggtcagctgggtccc

SC04-008 310

sy5L-A:

SC04-001 311

Tabla 14: Unión de los anticuerpos monoclonales humanos CR57, CRJB y CR04-010 (10 g/ml) a péptidos lineales del dominio extracelular de glicoproteína G de la cepa ERA del virus de la rabia.

Secuencia de aminoácidos de péptido lineal

CR57 CRJB CR04-010

KFPIYTILDKLGPWS

71 97 1

FPIYTILDKLGPWSP

42 105 39

PIYTILDKLGPWSPI

36 89 87

IYTILDKLGPWSPID

44 97 104

YTILDKLGPWSPIDI

48 114 91

TILDKLGPWSPIDIH

76 96 88

ILDKLGPWSPIDIHH

54 104 69

LDKLGPWSPIDIHHL

55 99 107

DKLGPWSPIDIHHLS

62 103 93

KLGPWSPIDIHHLSC

72 105 45

LGPWSPIDIHHLSCP

69 112 19

GPWSPIDIHHLSCPN

68 114 33

PWSPIDIHHLSCPNN

62 104 47

WSPIDIHHLSCPNNL

80 106 11

SPIDIHHLSCPNNLV

74 85 1

PIDIHHLSCPNNLVV

46 93 90

IDIHHLSCPNNLVVE

69 102 55

DIHHLSCPNNLVVED

38 96 78

IHHLSCPNNLVVEDE

37 85 113

HHLSCPNNLWEDEG

56 76 117

HLSCPNNLVVEDEGC

65 119 111

LSCPNNLVVEDEGCT

69 117 127

SCPNNLVVEDEGCTN

83 114 91

CPNNLVVEDEGCTNL

77 97 49

PNNLVVEDEGCTNLS

78 107 97

NNLVVEDEGCTNLSG

72 99 97

NLVVEDEGCTNLSGF

75 119 55

LVVEDEGCTNLSGFS

76 103 52

VVEDEGCTNLSGFSY

73 107 91

VEDEGCTNLSGFSYM

74 103 31

EDEGCTNLSGFSYME

54 90 7

DEGCTNLSGFSYMEL

1 23 1

EGCTNLSGFSYMELK

51 114 129

GCTNLSGFSYMELKV

55 114 118

CTNLSGFSYMELKVG

47 110 137

TNLSGFSYMELKVGY

43 106 161

NLSGFSYMELKVGYI

61 115 170

LSGFSYMELKVGYIL

71 132 169

SGFSYMELKVGYILA

79 132 161

GFSYMELKVGYILAI

65 111 141

FSYMELKVGYILAIK

89 112 192

SYMELKVGYILAIKM

65 123 152

YMELKVGYILAIKMN

78 114 150

MELKVGYILAIKMNG

76 141 107

ELKVGYILAIKMNGF

87 132 76

LKVGYILAIKMNGFT

78 112 118

KVGYILAIKMNGFTC

78 118 68

VGYILAIKMNGFTCT

77 93 1

GYILAIKMNGFTCTG

75 90 1

YILAIKMNGFTCTGV

47 107 107

ILAIKMNGFTCTGVV

79 103 104

LAIKMNGFTCTGVVT

68 130 159

AIKMNGFTCTGVVTE

47 103 152

IKMNGFTCTGVVTEA

68 108 138

KMNGFTCTGVVTEAE

76 104 133

MNGFTCTGVVTEAEN

69 99 148

NGFTCTGVVTEAENY

69 101 138

GFTCTGVVTEAENYT

71 86 129

FTCTGVVTEAENYTN

83 125 154

TCTGVVTEAENYTNF

92 112 129

CTGVVTEAENYTNFV

76 123 150

TGVVTEAENYTNFVG

85 110 154

GVVTEAENYTNFVGY

86 111 110

VVTEAENYTNFVGYV

87 106 114

VTEAENYTNFVGYVT

79 90 73

TEAENYTNFVGYVTT

68 84 8

EAENYTNFVGYVTTT

69 117 142

AENYTNFVGYVTTTF

66 106 110

ENYTNFVGYVTTTFK

44 112 183

NYTNFVGYVTTTFKR

49 114 174

YTNFVGYVTTTFKRK

51 104 138

TNFVGYVTTTFKRKH

71 125 165

NFVGYVTTTFKRKHF

65 107 154

FVGYVTTTFKRKHFR

70 111 152

VGYVTTTFKRKHFRP

75 113 155

GYVTTTFKRKHFRPT

70 123 160

YVTTTFKRKHFRPTP

85 106 160

VTTTFKRKHFRPTPD

79 105 119

TTTFKRKHFRPTPDA

80 108 137

TTFKRKHFRPTPDAC

74 99 110

TFKRKHFRPTPDACR

96 111 108

FKRKHFRPTPDACRA

64 92 62

KRKHFRPTPDACRAA

65 93 1

RKHFRPTPDACRAAY

64 107 99

KHFRPTPDACRAAYN

73 112 124

HFRPTPDACRAAYNW

46 113 118

FRPTPDACRAAYNWK

43 112 148

RPTPDACRAAYNWKM

77 101 129

PTPDACRAAYNWKMA

99 125 143

TPDACRAAYNWKMAG

92 132 160

PDACRAAYNWKMAGD

61 124 147

DACRAAYNWKMAGDP

84 113 136

ACRAAYNWKMAGDPR

82 116 138

CRAAYNWKMAGDPRY

87 118 137

RAAYNWKMAGDPRYE

90 130 120

AAYNWKMAGDPRYEE

68 106 120

AYNWKMAGDPRYEES

96 94 77

YNWKMAGDPRYEESL

83 118 116

NWKMAGDPRYEESLH

58 101 69

WKMAGDPRYEESLHN

69 101 1

KMAGDPRYEESLHNP

62 102 84

MAGDPRYEESLHNPY

64 116 112

AGDPRYEESLHNPYP

40 101 125

GDPRYEESLHNPYPD

36 98 123

DPRYEESLHNPYPDY

57 110 118

PRYEESLHNPYPDYR

73 115 129

RYEESLHNPYPDYRW

69 112 125

YEESLHNPYPDYRWL

58 106 120

EESLHNPYPDYRWLR

76 123 141

ESLHNPYPDYRWLRT

92 132 125

SLHNPYPDYRWLRTV

78 111 137

LHNPYPDYRWLRTVK

79 106 142

HNPYPDYRWLRTVKT

86 108 146

NPYPDYRWLRTVKTT

85 102 151

PYPDYRWLRTVKTTK

65 93 103

YPDYRWLRTVKTTKE

72 97 97

PDYRWLRTVKTTKES

76 85 27

DYRWLRTVKTTKESL

54 111 105

YRWLRTVKTTKESLV

46 117 125

RWLRTVKTTKESLVI

40 110 120

WLRTVKTTKESLVII

41 104 125

LRTVKTTKESLVIIS

65 104 161

RTVKTTKESLVIISP

82 120 150

TVKTTKESLVIISPS

76 116 150

VKTTKESLVIISPSV

71 120 154

KTTKESLVIISPSVA

101 112 147

TTKESLVIISPSVAD

78 121 141

TKESLVIISPSVADL

86 112 132

KESLVIISPSVADLD

86 117 111

ESLVIISPSVADLDP

88 125 143

SLVIISPSVADLDPY

68 105 125

LVIISPSVADLDPYD

85 107 93

VIISPSVADLDPYDR

59 98 50

IISPSVADLDPYDRS

83 125 14

ISPSVADLDPYDRSL

50 119 91

SPSVADLDPYDRSLH

59 114 118

PSVADLDPYDRSLHS

44 114 118

SVADLDPYDRSLHSR

49 106 129

VADLDPYDRSLHSRV

71 113 141

ADLDPYDRSLHSRVF

70 121 141

DLDPYDRSLHSRVFP

111 152 127

LDPYDRSLHSRVFPS

99 142 106

DPYDRSLHSRVFPSG

90 120 134

PYDRSLHSRVFPSGK

86 120 130

YDRSLHSRVFPSGKC

364 818 127

DRSLHSRVFPSGKCS

98 142 141

RSLHSRVFPSGKCSG

87 141 156

SLHSRVFPSGKCSGV

69 111 141

LHSRVFPSGKCSGVA

78 114 129

HSRVFPSGKCSGVAV

97 118 111

SRVFPSGKCSGVAVS

100 125 24

RVFPSGKCSGVAVSS

69 110 106

VFPSGKCSGVAVSST

74 114 142

FPSGKCSGVAVSSTY

64 134 146

PSGKCSGVAVSSTYC

56 112 132

SGKCSGVAVSSTYCS

64 121 120

GKCSGVAVSSTYCST

92 143 145

KCSGVAVSSTYCSTN

88 130 130

CSGVAVSSTYCSTNH

110 165 143

SGVAVSSTYCSTNHD

79 110 115

GVAVSSTYCSTNHDY

79 114 108

VAVSSTYCSTNHDYT

85 114 118

AVSSTYCSTNHDYTI

71 105 102

VSSTYCSTNHDYTIW

78 107 121

SSTYCSTNHDYTIWM

76 107 121

STYCSTNHDYTIWMP

86 99 119

TYCSTNHDYTIWMPE

96 107 74

YCSTNHDYTIWMPEN

47 92 29

CSTNHDYTIWMPENP

52 106 86

STNHDYTIWMPENPR

60 112 107

TNHDYTIWMPENPRL

69 129 119

NHDYTIWMPENPRLG

71 119 130

HDYTIWMPENPRLGM

82 125 123

DYTIWMPENPRLGMS

93 127 123

YTIWMPENPRLGMSC

97 132 143

TIWMPENPRLGMSCD

69 106 134

IWMPENPRLGMSCDI

98 110 101

WMPENPRLGMSCDIF

88 113 120

MPENPRLGMSCDIFT

105 121 143

PENPRLGMSCDIFTN

83 111 104

ENPRLGMSCDIFTNS

71 118 111

NPRLGMSCDIFTNSR

90 113 138

PRLGMSCDIFTNSRG

72 112 105

RLGMSCDIFTNSRGK

88 106 113

LGMSCDIFTNSRGKR

76 110 114

GMSCDIFTNSRGKRA

54 120 101

MSCDIFTNSRGKRAS

46 110 106

SCDIFTNSRGKRASK

44 111 98

CDIFTNSRGKRASKG

42 104 117

DIFTNSRGKRASKGS

70 107 111

IFTNSRGKRASKGSE

77 125 87

FTNSRGKRASKGSET

83 111 119

TNSRGKRASKGSETC

68 108 110

NSRGKRASKGSETCG

92 100 119

SRGKRASKGSETCGF

64 93 90

RGKRASKGSETCGFV

75 104 115

GKRASKGSETCGFVD

92 124 118

KRASKGSETCGFVDE

92 106 129

RASKGSETCGFVDER

86 110 134

ASKGSETCGFVDERG

97 108 103

SKGSETCGFVDERGL

92 102 76

KGSETCGFVDERGLY

90 97 44

GSETCGFVDERGLYK

57 115 92

SETCGFVDERGLYKS

33 116 86

ETCGFVDERGLYKSL

64 120 138

TCGFVDERGLYKSLK

47 120 125

CGFVDERGLYKSLKG

72 115 120

GFVDERGLYKSLKGA

84 120 129

FVDERGLYKSLKGAC

86 121 124

VDERGLYKSLKGACK

50 108 110

DERGLYKSLKGACKL

90 119 54

ERGLYKSLKGACKLK

90 118 106

RGLYKSLKGACKLKL

90 121 121

GLYKSLKGACKLKLC

94 129 92

LYKSLKGACKLKLCG

93 136 141

YKSLKGACKLKLCGV

80 112 110

KSLKGACKLKLCGVL

129 113 110

SLKGACKLKLCGVLG

200 111 124

LKGACKLKLCGVLGL

340 90 23

KGACKLKLCGVLGLR

181 111 100

GACKLKLCGVLGLRL

123 134 129

ACKLKLCGVLGLRLM

148 117 142

CKLKLCGVLGLRLMD

410 111 147

KLKLCGVLGLRLMDG

273 120 114

LKLCGVLGLRLMDGT

918 145 148

KLCGVLGLRLMDGTW

3152 132 86

LCGVLGLRLMDGTWV

83 138 129

CGVLGLRLMDGTWVA

99 117 104

GVLGLRLMDGTWVAM

89 148 117

VLGLRLMDGTWVAMQ

90 141 127

LGLRLMDGTWVAMQT

102 115 97

GLRLMDGTWVAMQTS

104 138 120

LRLMDGTWVAMQTSN

103 114 118

RLMDGTWVAMQTSNE

100 113 130

LMDGTWVAMQTSNET

96 106 106

MDGTWVAMQTSNETK

97 97 110

DGTWVAMQTSNETKW

69 114 92

GTWVAMQTSNETKWC

58 113 82

TWVAMQTSNETKWCP

78 118 107

WVAMQTSNETKWCPP

50 114 116

VAMQTSNETKWCPPD

86 104 151

AMQTSNETKWCPPDQ

104 114 128

MQTSNETKWCPPDQL

104 132 125

QTSNETKWCPPDQLV

92 120 155

TSNETKWCPPDQLVN

97 111 90

SNETKWCPPDQLVNL

99 129 110

NETKWCPPDQLVNLH

90 128 107

ETKWCPPDQLVNLHD

105 120 118

TKWCPPDQLVNLHDF

85 125 125

KWCPPDQLVNLHDFR

89 113 121

WCPPDQLVNLHDFRS

101 119 99

CPPDQLVNLHDFRSD

93 137 127

PPDQLVNLHDFRSDE

107 120 56

PDQLVNLHDFRSDEI

35 106 63

DQLVNLHDFRSDEIE

54 117 97

QLVNLHDFRSDEIEH

60 113 106

LVNLHDFRSDEIEHL

47 104 100

VNLHDFRSDEIEHLV

83 129 98

NLHDFRSDEIEHLVV

83 113 110

LHDFRSDEIEHLVVE

93 115 121

HDFRSDEIEHLVVEE

69 107 150

DFRSDEIEHLVVEEL

99 103 110

FRSDEIEHLVVEELV

86 114 116

RSDEIEHLVVEELVR

100 138 104

SDEIEHLVVEELVRK

101 117 118

DEIEHLVVEELVRKR

94 123 143

EIEHLWEELVRKRE

82 113 121

IEHLVVEELVRKREE

90 129 118

EHLVVEELVRKREEC

82 114 106

HLVVEELVRKREECL

82 123 46

LVVEELVRKREECLD

64 100 79

VVEELVRKREECLDA

62 108 97

VEELVRKREECLDAL

58 111 101

EELVRKREECLDALE

69 112 123

ELVRKREECLDALES

82 113 117

LVRKREECLDALESI

86 130 124

VRKREECLDALESIM

58 181 151

RKREECLDALESIMT

73 110 137

KREECLDALESIMTT

102 113 97

REECLDALESIMTTK

94 110 106

EECLDALESIMTTKS

82 120 133

ECLDALESIMTTKSV

91 112 125

CLDALESIMTTKSVS

101 146 155

LDALESIMTTKSVSF

97 116 152

DALESIMTTKSVSFR

104 120 188

ALESIMTTKSVSFRR

97 132 137

LESIMTTKSVSFRRL

48 114 130

ESIMTTKSVSFRRLS

62 111 114

SIMTTKSVSFRRLSH

54 130 97

IMTTKSVSFRRLSHL

43 101 111

MTTKSVSFRRLSHLR

59 116 125

TTKSVSFRRLSHLRK

66 118 111

TKSVSFRRLSHLRKL

83 125 123

KSVSFRRLSHLRKLV

108 124 129

SVSFRRLSHLRKLVP

64 123 117

VSFRRLSHLRKLVPG

90 111 105

SFRRLSHLRKLVPGF

92 110 96

FRRLSHLRKLVPGFG

90 108 111

RRLSHLRKLVPGFGK

92 143 118

RLSHLRKLVPGFGKA

93 123 148

LSHLRKLVPGFGKAY

96 139 150

SHLRKLVPGFGKAYT

113 132 132

HLRKLVPGFGKAYTI

99 111 102

LRKLVPGFGKAYTIF

83 118 82

RKLVPGFGKAYTIFN

47 115 86

KLVPGFGKAYTIFNK

47 114 123

LVPGFGKAYTIFNKT

54 112 139

VPGFGKAYTIFNKTL

58 114 138

PGFGKAYTIFNKTLM

78 113 157

GFGKAYTIFNKTLME

78 123 320

FGKAYTIFNKTLMEA

90 151 356

GKAYTIFNKTLMEAD

76 127 418

KAYT1FNKTLMEADA

101 123 554

AYTIFNKTLMEADAH

86 121 197

YTIFNKTLMEADAHY

104 147 161

TIFNKTLMEADAHYK

107 123 1405

IFNKTLMEADAHYKS

100 118 1828

FNKTLMEADAHYKSV

111 141 2736

NKTLMEADAHYKSVR

104 116 141

KTLMEADAHYKSVRT

91 98 123

TLMEADAHYKSVRTW

100 114 90

LMEADAHYKSVRTWN

73 107 97

MEADAHYKSVRTWNE

62 129 83

EADAHYKSVRTWNEI

58 97 106

ADAHYKSVRTWNEIL

56 100 100

DAHYKSVRTWNEILP

59 121 112

AHYKSVRTWNEILPS

112 160 125

HYKSVRTWNEILPSK

80 130 123

YKSVRTWNEILPSKG

66 137 116

KSVRTWNEILPSKGC

115 125 114

SVRTWNEILPSKGCL

106 138 118

VRTWNEILPSKGCLR

90 124 133

RTWNEILPSKGCLRV

120 127 120

TWNEILPSKGCLRVG

97 146 127

WNEILPSKGCLRVGG

102 136 117

NEILPSKGCLRVGGR

104 130 163

EILPSKGCLRVGGRC

104 112 128

ILPSKGCLRVGGRCH

79 113 107

LPSKGCLRVGGRCHP

77 119 100

PSKGCLRVGGRCHPH

69 138 91

SKGCLRVGGRCHPHV

72 121 103

KGCLRVGGRCHPHVN

68 130 115

GCLRVGGRCHPHVNG

85 125 123

CLRVGGRCHPHVNGV

102 132 134

LRVGGRCHPHVNGVF

104 143 133

RVGGRCHPHVNGVFF

86 143 99

VGGRCHPHVNGVFFN

120 136 120

GGRCHPHVNGVFFNG

86 119 119

GRCHPHVNGVFFNGI

117 113 117

RCHPHVNGVFFNGII

98 141 143

CHPHVNGVFFNGIIL

97 150 151

HPHVNGVFFNGIILG

104 138 164

PHVNGVFFNGIILGP

93 173 146

HVNGVFFNGIILGPD

97 123 114

VNGVFFNGIILGPDG

68 116 85

NGVFFNGIILGPDGN

66 117 97

GVFFNGIILGPDGNV

58 116 100

VFFNGIILGPDGNVL

55 132 108

FFNGIILGPDGNVLI

92 143 105

FNGIILGPDGNVLIP

61 139 130

NGIILGPDGNVLIPE

102 146 141

GIILGPDGNVLIPEM

107 132 123

IILGPDGNVLIPEMQ

85 118 93

ILGPDGNVLIPEMQS

125 134 119

LGPDGNVLIPEMQSS

100 134 150

GPDGNVLIPEMQSSL

86 154 157

PDGNVLIPEMQSSLL

87 129 139

DGNVLIPEMQSSLLQ

123 134 169

GNVLIPEMQSSLLQQ

96 120 168

NVLIPEMQSSLLQQH

72 120 150

VLIPEMQSSLLQQHM

92 104 142

LIPEMQSSLLQQHME

89 111 85

IPEMQSSLLQQHMEL

89 128 129

PEMQSSLLQQHMELL

62 133 93

EMQSSLLQQHMELLE

58 129 142

MQSSLLQQHMELLES

65 113 117

QSSLLQQHMELLESS

82 114 132

SSLLQQHMELLESSV

90 128 132

SLLQQHMELLESSVI

124 163 133

LLQQHMELLESSVIP

78 111 121

LQQHMELLESSVIPL

106 134 128

QQHMELLESSVIPLV

103 134 133

QHMELLESSVIPLVH

98 146 139

HMELLESSVIPLVHP

110 129 134

MELLESSVIPLVHPL

90 125 152

ELLESSVIPLVHPLA

90 133 155

LLESSVIPLVHPLAD

72 117 118

LESSVIPLVHPLADP

90 128 128

ESSVIPLVHPLADPS

104 138 143

SSVIPLVHPLADPST

73 104 93

SVIPLVHPLADPSTV

72 137 107

VIPLVHPLADPSTVF

69 141 123

IPLVHPLADPSTVFK

96 156 188

PLVHPLADPSTVFKD

93 112 138

LVHPLADPSTVFKDG

164 174 188

VHPLADPSTVFKDGD

98 138 125

HPLADPSTVFKDGDE

74 141 117

PLADPSTVFKDGDEA

99 125 90

LADPSTVFKDGDEAE

68 116 113

ADPSTVFKDGDEAED

147 152 110

DPSTVFKDGDEAEDF

98 147 137

PSTVFKDGDEAEDFV

104 143 141

STVFKDGDEAEDFVE

104 120 125

TVFKDGDEAEDFVEV

107 124 96

VFKDGDEAEDFVEVH

100 106 93

FKDGDEAEDFVEVHL

65 76 119

KDGDEAEDFVEVHLP

72 93 76

DGDEAEDFVEVHLPD

85 123 91

GDEAEDFVEVHLPDV

46 124 113

DEAEDFVEVHLPDVH

68 136 123

EAEDFVEVHLPDVHN

76 117 114

AEDFVEVHLPDVHNQ

123 138 123

EDFVEVHLPDVHNQV

90 141 123

DFVEVHLPDVHNQVS

96 141 118

FVEVHLPDVHNQVSG

92 143 102

VEVHLPDVHNQVSGV

106 141 123

EVHLPDVHNQVSGVD

91 150 139

VHLPDVHNQVSGVDL

110 114 137

HLPDVHNQVSGVDLG

104 150 129

LPDVHNQVSGVDLGL

104 154 154

PDVHNQVSGVDLGLP

106 129 115

DVHNQVSGVDLGLPN

117 133 113

VHNQVSGVDLGLPNW

100 119 38

HNQVSGVDLGLPNWG

76 106 38

NQVSGVDLGLPNWGK

78 138 98

Promedio

91,9 119,5 130,9

D.E.

157,9 37,6 169,8

Tabla 15: Potencias neutralizantes de IgG anti-proteína G de virus de la rabia.

Nombre de IgG

UI/mg

CR04-001

89

CR04-004

5

CR04-008

1176

CR04-010

3000

CR04-018

1604

CR04-021

1500

CR04-026

<2

CR04-031

272

CR04-038

2330

CR04-040

3041

CR04-060

89

CR04-073

6116

CR04-097

<1

CR04-098

7317

CR04-103

3303

CR04-104

4871

CR04-108

4871

CR04-120

4938

CR04-125

4718

CR04-126

2655

CR04-140

478

CR04-144

6250

CR04-146

ND

CR04-164

4724

CR57

3800

CRJB

605

ND = no determinado
Tabla 16: Potencias neutralizantes de IgG anti-proteína G de virus de la rabia frente a virus de escape E57.

Nombre

E57A2 E57A3 E57B1 E57B2 E57B3 E57C3

de IgG

(UI/mg) (UI/mg) (UI/mg) (UI/mg) (UI/mg) (UI/mg)

CR04-008

0* 0 0 0 0 0

CR04-010

8127 1355 5418 1355 2709 4064

CR04-018

1604 0 1604 0 59 535

CR04-021

450 2 150 8 50 50

CR04-038

9437 1573 9437 1049 6291 1573

CR04-040

8209 2736 24628 1368 5473 912

CR04-073

8256 1835 11008 1835 3669 1835

CR04-098

9878 3293 9878 3293 3293 3293

CR04-103

8917 2972 17835 2972 5945 2972

CR04-104

3288 2192 6576 2192 4384 1096

CR04-108

3288 731 4384 731 2192 731

CR04-120

1111 14 741 82 247 41

CR04-125

708 39 236 79 157 79

CR04-126

88 0 18 0 18 0

CR04-144

5625 2813 11250 2813 5625 1875

CR04-164

4252 472 4252 472 945 709

* 0 indica ausencia de criterio de valoración del 50% a una dilución de 1:100 del anticuerpo
Tabla 17. Potencia neutralizante de CR-57 frente a virus de escape E98.

E98-2 (UI/mg)

E98-4 (UI/mg) E98-5 (UI/mg) E98-6 (UI/mg) E98-7 (UI/mg)

CR-57

2813 8438 4219 2813 8438

CR04-098

0* 0 0 0 0

* Cero indica ausencia de criterio de valoración del 50% a una dilución de 1:1000 del anticuerpo.
Tabla 18: Aparición de residuos de aminoácido en la región de unión mínima de CR57 dentro de virus de la rabia de 10 genotipo 1.

Tipo natural

K L C G V L

K (99,6%)*

L (100%) C (100%) G (98,7%) V (99,6%) L (70,7%)

R (0,4%)

E (0,9%) I (0,4%) P (26,7%)

R (0,4%)

S (2,6%)

* Se muestra el porcentaje de aparición de cada aminoácido se muestra dentro de 229 aislados de virus de la rabia.
BIBLIOGRAFÍA
Ameyama S, Toriumi H, Takahashi T, Shimura Y, Nakahara T, Honda Y, Mifune K, Uchiyama T and Kawai A (2003), Monoclonal antibody #3-9-16 recognizes one of the two isoforms of rabies virus matrix protein that exposes its Nterminus on the virion surface. Microbiol. Immunol. 47:639-651.
Badrane H and Tordo N (2001), Host switching in Lyssavirus history from the Chiroptera to the Carnivora orders. J. Virol. 75:8096-8104.
Benmansour A, Leblois H, Coulon P, Tuffereau C, Gaudin Y, Flamand A, and Lafay F (1991), Antigenicity of rabies virus glycoprotein. J. Virol. 65:4198-4203.
Bunschoten H, Gore M, Claassen IJ, Uytdehaag FG, Dietzschold B, Wunner WH, and Osterhaus AD (1989), Characterization of anewvirus-neutralizing epitope that denotes a sequential determinant on the rabies virus glycoprotein. J. Gen. Virol. 70 (Pt 2):291-8.
Champion JM, Kean RB, Rupprecht CE, Notkins AL, Koprowski H, Dietzschold B, and Hooper DC (2000), The development of monoclonal human rabies virus-neutralizing antibodies as a substitute for pooled human immune globulin in the prophylactic treatment of rabies virus exposure. J. Immunol. Methods 235:81-90.
Chou TC and Talalay P (1984), Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22:27-55.
Coulon P, Ternaux JP, Flamand A, and Tuffereau C (1998), An avirulent mutant of rabies virus is unable to infect motoneurons in vivo and in vitro. J. Virol. 72:273-278.
De Kruif J, Terstappen L, Boel E and Logtenberg T (1995a), Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library. Proc. Natl. Acad. Sci. USA 92:3938.
De Kruif J, Boel E and Logtenberg T (1995b), Selection and application of human single-chain Fv antibody fragments from a semi-synthetic phage antibody display library with designed CDR3 regions. J. Mol. Biol. 248:97-105.
Dietzschold B, Wunner WH, Wiktor TJ, Lopes AD, Lafon M, Smith CL, and Koprowski H (1983), Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl. Acad. Sci. USA 80:70-74. Dietzschold B, Gore M, Casali P, Ueki Y, Rupprecht CE, Notkins AL, and Koprowski H (1990), Biological characterization of human monoclonal antibodies to rabies virus. J. Virol. 64:3087-3090.
Hanlon CA, DeMattos CA, DeMattos CC, Niezgoda M, Hooper DC, Koprowski H, Notkins A, and Rupprecht CE (2001), Experimental utility of rabies virus neutralizing human monoclonal antibodies in post-exposure prophylaxis. Vaccine 19:3834-3842.
Jones D, Kroos N, Anema R, van Montfort B, Vooys A, van der Kraats S, van der Helm E, Smits S, Schouten J, Brouwer K, Lagerwerf F, van Berkel P, Opstelten DJ, Logtenberg T and Bout A (2003), High-level expression of recombinant IgG in the human cell line PER.C6. Biotechnol. Prog. 19:163-168.
Lafon M, Wiktor TJ, and Macfarlan RI (1983), Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J. Gen. Virol. 64 (Pt 4):843-851.
Luo TR, Minamoto N, Ito H, Goto H, Hiraga S, Ito N, Sugiyama M, and Kinjo T (1997), A virus-neutralizing epitope on the glycoprotein of rabies virus that contains Trp251 is a linear epitope. Virus Res. 51:35-41.
Madhusudana SN, Shamsundar R and Seetharaman S (2004), In vitro inactivation of the rabies virus by ascorbic acid. Int. J. Infect. Dis. 8:21-25.
Ni Y, Tominaga Y, Honda Y, Morimoto K, Sakamoto S, and Kawai A (1995), Mapping and characterization of a sequential epitope on the rabies virus glycoprotein which is recognized by a neutralizing monoclonal antibody, RG719. Microbiol. Immunol. 39:693-702.
Prehaud C, Coulon P, LaFay F, Thiers C, and Flamand A (1988), Antigenic site II of the rabies virus glycoprotein: structure and role in viral virulence. J. Virol. 62:1-7.
Schumacher CL, Dietzschold B, Ertl HC, Niu HS, Rupprecht CE, and Koprowski H (1989), Use of mouse anti-rabies monoclonal antibodies in postexposure treatment of rabies. J. Clin. Invest. 84:971-975.
Seif I, Coulon P, Rollin E, and Flamand A (1985) Rabies virulence: effect on pathogenicicty and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J. Virol. 53:926-934.
Slootstra JW, Puijk WC, Ligtvoet GJ, Langeveld JP, Meloen RH 1996. Structural aspects of antibody-antigen interaction revealed through small random peptide libraries. Mol. Divers. 1:87-96.
Tordo N (1996), Characteristics and molecular biology of rabies virus. In Meslin F-X, Kaplan MM, Koprowski H, editors. Laboratory Techniques in rabies, 4th edition Geneva, Switzerland: World Health Organization.
White LA and Chappell WA (1982), Inactivation of rabies virus in reagents used for the fluorescent rabies antibody test. J. Clin. Microbiol. 16:253-256.
LISTA DE SECUENCIAS
<110> Crucell Holland B.V. Bakker, Alexander B.H. Marissen, Willem E. Kramer, Robert A. De Kruif, Cornelis A.
<120> Moléculas de unión humanas que pueden neutralizar el virus de la rabia y usos de las mismas
<130> 0110 WO 00 ORD
<160> 337
<170> Patent In versión 3.1
<210> 1
<211> 9
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-001
<400> 1 imagen1
<210> 2
<211> 11
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-004
<400> 2 imagen1
<210> 3
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-008
<400> 3 <210> 4 imagen1
<211> 14
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-010
<400> 4 imagen1
<210> 5
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-018
<400> 5 imagen1
<210> 6
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-021
<400> 6 imagen1
<210> 7
<211> 12
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-026
<400> 7 imagen1
<210> 8
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-031
<400> 8 imagen1
<210> 9
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-038
<400> 9 imagen1
<210> 10
<211> 9
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-040
<400> 10 imagen1
<210> 11
<211> 20
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-060
<400> 11 imagen1
<210> 12
<211> 14
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-073
<400> 12 imagen1
<210> 13
<211> 12
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-097
<400> 13 imagen1
<210> 14
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-098
<400> 14 imagen1
<210> 15
<211> 10
<212> PRT <213> Secuencia artificial
<220>
<223> CDR3 de SC04-103
<400> 15 imagen1
<210> 16
<211> 12
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-104
<400> 16 imagen1
<210> 17
<211> 11
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-108
<400> 17 imagen1
<210> 18
<211> 9
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-120
<400> 18 imagen1
<210> 19
<211> 10
<212> PRT <213> Secuencia artificial
<220>
<223> CDR3 de SC04-125
<400> 19 imagen1
<210> 20
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-126
<400> 20 imagen1
<210> 21
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-140
<400> 21 imagen1
<210> 22
<211> 9
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-144
<400> 22 imagen1
<210> 23
<211> 9
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-146
<400> 23 imagen1
<210> 24
<211> 10
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SC04-164
<400> 24 imagen1
<210> 25
<211> 18
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de SO57
<400> 25 imagen1
<210> 26
<211> 117
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-001
<400> 26 <210> 27 imagen1
<211> 118
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-004
<400> 27 <210> 28 imagen1 imagen1
<211> 120
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-008
<400> 28 imagen1
<210> 29
<211> 123
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-010
<400> 29 <210> 30 imagen1
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-018
<400> 30 <210> 31 imagen1
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-021
<400> 31 <210> 32 imagen1 imagen1
<211> 121
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-026
<400> 32 imagen1
<210> 33
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-031
<400> 33 imagen1
<210> 34
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-038
<400> 34 <210> 35 imagen1
<211> 118
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-040
<400> 35 <210> 36 imagen1 imagen1
<211> 128
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-060
<400> 36 imagen1
<210> 37 <211> 123
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-073
<400> 37 imagen1
<210> 38
<211> 121
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-097
<400> 38 <210> 39 imagen1
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-098
<400> 39 <210> 40 imagen1 imagen1
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-103
<400> 40 imagen1
<210> 41 <211> 121
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-104
<400> 41 imagen1
<210> 42
<211> 120
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-108
<400> 42 <210> 43 imagen1
<211> 118
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-120
<400> 43 imagen1
<210> 44 <211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-125
<400> 44 imagen1
<210> 45
<211> 120
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-126
<400> 45 <210> 46 imagen1
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-140
<400> 46 <210> 47 imagen1
<211> 118
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-144
<400> 47 imagen1
<210> 48
<211> 118
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-146
<400> 48 imagen1
<210> 49
<211> 119
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-164
<400> 49 <210> 50 imagen1
<211> 108
<212> PRT
<213> Secuencia artificial
<223> Región variable de cadena ligera de SC04-001
<400> 50 <210> 51 imagen1
<211> 103
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-004
<400> 51 imagen1
<210> 52
<211> 109
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-008
<400> 52 <210> 53 imagen1
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-010
<400> 53 <210> 54 imagen1
<211> 110
<212> PRT
<213> Secuencia artificial
<220>
<223>Región variable de cadena ligera de SC04-018 <400>54 imagen1
<210> 55
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-021
<400> 55 <210> 56 imagen1 imagen1
<211> 112
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-026
<400> 56 imagen1
<210> 57
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-031
<400> 57 <210> 58 imagen1
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-038
<400> 58 <210> 59 imagen1 imagen1
<211> 108
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-040
<400> 59 imagen1
<210> 60
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-060
<400> 60 imagen1
<210> 61
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-073
<400> 61 <210> 62 imagen1 imagen1
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-097
<400> 62 imagen1
<210> 63
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-098
<400> 63 imagen1
<210> 64
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-103
<400> 64 imagen1
<210> 65
<211> 109 ’
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-104
<400> 65 imagen1 imagen1
<210> 66
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-108
<400> 66 imagen1
<210> 67
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-120
<400> 67 <210> 68 imagen1
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-125
<400> 68 <210> 69 imagen1 imagen1
<211> 109
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-126
<400> 69 imagen1
<210> 70
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-140
<400> 70 imagen1
<210> 71
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-144
<400> 71 <210> 72 imagen1 imagen1
<211> 107
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-146
<400> 72 imagen1
<210> 73
<211> 107 <212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de SC04-164
<400> 73 imagen1
<210> 74
<211> 351
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-001
<400> 74 imagen1
<210> 75
<211> 354
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-004
<400> 75 imagen1
<210> 76
<211> 360
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-008
<400> 76 imagen1
<210> 77
<211> 369
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-010
<400> 77 <210> 78 imagen1
<211> 357
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-018
<400> 78 imagen1
<210> 79
<211> 357
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-021
<400> 79 imagen1
<210> 80 <211> 363
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de SC04-026
<400> 80 imagen1
<210> 81
<211> 357
<212> ADN
<213> Secuencia artificial Example 11
Identification of epitopes recognized by recombinant human antibodies against rabies virus by PEPSCAN-ELISA
Loop / cyclic and linear 15-mer peptides were synthesized from the extracellular domain of the G protein of the ERA strain of rabies virus (see SEQ ID NO: 207 for the complete amino acid sequence of the G glycoprotein of the strain ERA of rabies virus, the extracellular domain consists of amino acids 20-458; the protein ID of the glycoprotein of the ERA strain of rabies virus in the EMBL database is J02293) and were examined using mini-cards PEPSCAN in credit card format (455 peptide formats / card) as described above (Slootstra et al., 1996; WO 93/09872). All peptides were acetylated at the amino-terminal end. In all loop peptides, position 2 and position 14 were replaced by a cysteine (acetyl-XCXXXXXXXXXXXCX-mini-card). If other cysteines were present in addition to the cysteines at position 2 and position 14 in a prepared peptide, the other cysteines were replaced by an alanine. Loop peptides were synthesized using conventional Fmoc chemistry and deprotected using trifluoroacetic acid with scavengers. Subsequently, the unprotected peptides on the cards were reacted with a 0.5 mM solution of 1,3-bis (bromomethyl) benzene in ammonium bicarbonate (20 mM, pH 7.9 / acetonitril (1: 1 (v / v )) The cards were gently shaken in the solution for 30-60 minutes, while they were completely covered in the solution.Finally, the cards were thoroughly washed with an excess of H2O and sonicated in an alteration buffer containing 1% of SDS / 0.1% beta-mercaptoethanol in PBS (pH 7.2) at 70 ° C for 30 minutes, followed by sonication in H2O for another 45 minutes.
Human monoclonal antibodies were prepared as described above. The binding of these antibodies to each linear and loop peptide was tested in an enzyme linked immunoassay based on PEPSCAN (ELISA). Polypropylene cards were incubated in a 455-well credit card format, containing the covalently bound peptides, with the antibodies (10 µg / ml; diluted in blocking solution, containing 5% horse serum (v / v) and 5% ovalbumin (w / v)) (4 ° C, overnight). After washing, the peptides were incubated with anti-human antibody with peroxidase (1/1000 dilution) (1 hour, 25 ° C), and subsequently, after washing the peroxidase, 2,2'-azino sulfonate substrate was added -di-3-ethylbenzothiazoline (ABTS) and 2 µl / ml of 3% H2O2. Controls (for linear and loop) were incubated with anti-human antibody with peroxidase only. After 1 hour the color development was measured. ELISA color development was quantified with a CCD camera and an image processing system. The configuration consisted of a CCD camera and a 55mm lens (Sony XC-77RR CCD camcorder, 55mm f / 2.8 Nikon micronikkor lens), a camera adapter (Sony DC-77RR camera adapter) and Optimas image processing software package, version 6.5 (Media Cybernetics, Silver Spring, MD 20910, USA). Optimas was run on a pentium II computer system.
Human rabies virus anti-protein G monoclonal antibodies were tested to determine the binding to loop / cyclic and linear peptides of 15 mer synthesized as described above. A peptide is considered to be relevantly bound to an antibody when the OD values are equal to or greater than double the average OD value of all peptides (per antibody). See Table 14 for results of the binding of human monoclonal antibodies called CR57, CRJB and CR04-010 to the linear peptides of the G-glycoprotein extracellular domain of ERA strain of rabies virus. Regions showing significant binding to the respective antibodies are highlighted in gray (see table 14).
The CR57 antibody bound to linear peptides that had an amino acid sequence selected from the group consisting of SLKGACKLKLCGVLG (SEQ ID NO: 314), LKGACKLKLCGVLGL (SEQ ID NO: 315), KGACKLKLCGVLGLR (SEQ ID NO: 316), GACKLKLCGVLGLRL ( SEQ ID NO: 317), ACKLKLCGVLGLRLM (SEQ ID NO: 318), CKLKLCGVLGLRLMD (SEQ ID NO: 319), KLKLCGVLGLRLMDG (SEQ ID NO: 320), LKLCGVLGLRLMDGT (SEQ ID NO: 321) and KLCG NO: 321 (SEQ ID NO: 321) ) (see table 14). Peptides having the amino acid sequences GACKLKLCGVLGLRL (SEQ ID NO: 317), ACKLKLCGVLGLRLM (SEQ ID NO: 318) have an OD value that is less than twice the average value. However, these peptides are claimed because they are in close proximity to a region of antigenic peptides recognized by the CR57 antibody. Binding was most prominent to the peptide with the amino acid sequence KLCGVLGLRLMDGTW (SEQ ID NO: 322).
The CR04-010 antibody bound to linear peptides that had an amino acid sequence selected from the group consisting of GFGKAYTIFNKTLME (SEQ ID NO: 323), FGKAYTIFNKTLMEA (SEQ ID NO: 324), GKAYTIFNKTLMEAD (SEQ ID NO: 325), KAYTIFNKTLMEADA (SEQ ID NO: 326), AYTIFNKTLMEADAH (SEQ ID NO: 327), YTIFNKTLMEADAHY (SEQ ID NO: 328), TIFNKTLMEADAHYK (SEQ ID NO: 329), IFNKTLMEADAHYKS (SEQ ID NOKY SEK ID 330: : 331). The peptides that have the sequences of
5
fifteen
25
35
Four. Five
amino acids AYTIFNKTLMEADAH (SEQ ID NO: 327), YTIFNKTLMEADAHY (SEQ ID NO: 328) have an OD value that is less than twice the average value. However, these peptides are claimed because they are in close proximity to a region of antigenic peptides recognized by the CR04-010 antibody. Binding was most prominent to the peptides with the amino acid sequence TIFNKTLMEADAHYK (SEQ ID NO: 329), IFNKTLMEADAHYKS (SEQ ID NO: 330) and FNKTLMEADAHYKSV (SEQ ID NO: 331).
CRJB and the antibodies designated CR04-040, CR04-098 and CR04-103 (data not shown) did not recognize a region of linear antigenic peptides.
Any of the above peptides or parts thereof represent good candidates for a neutralizing epitope against rabies virus and could form the basis for a vaccine or to prepare neutralizing antibodies to treat and / or prevent a rabies virus infection.
SLKGACKLKLCGVLGLRLMDGTW (SEQ ID NO: 332) and GFGKAYTIFNKTLMEADAHYKSV (SEQ ID NO: 333) are particularly interesting regions of glycoprotein based on their high reactivity in PEPSCAN.
From the previous PEPSCAN data it can be further deduced that human monoclonal antibodies called CR57 and CR04-010 bind to different regions of the rabies virus G protein which indicates that they recognize non-competitive epitopes.
Example 12
Determination of neutralizing potency of anti-rabies G protein IgG using an in vitro neutralization assay (modified RFFIT).
The neutralizing potency of each of the human monoclonal antibodies produced in a modified RFFIT was determined as described in Example 1. Sixteen IgG neutralized the rabies strain CVS-11 with a potency greater than 1000 IU / mg, while only two IgGs had a potency of less than 2 IU / mg (see table 15). Eight of the sixteen antibodies worked better than CR-57 produced transiently with respect to potency, suggesting superior efficacy in prophylaxis after exposure to rabies virus than CR-57. The CR-57 potency produced transiently was approximately 3800 IU / mg protein (see Tables 1 and 15), while CR-57 stably produced had a potency of 5400 IU / mg protein (data not shown). Interestingly, most of the identified human monoclonal neutralizing antibodies contained a 3-30 variable heavy germline gene (see table 9).
Based on the affinity of the antibodies for the rabies virus (data not shown) and a dilution of 100% titration criteria of the antibodies in a modified RFFIT assay (data not shown), a panel of six IgGs was chosen unique, that is CR04-010, CR04-040, CR04-098, CR04-103, CR04-104, and CR04-144, for further development. Within this panel, the CR04-098 antibody was particularly interesting because it showed the greatest potency, ie approximately 7300 IU / mg protein (see table 15). A similar power was also found for CR04-098 produced stably (data not shown).
Example 13
In vitro neutralization of E57 escape virus by anti-rabies virus IgG
To further characterize the novel anti-rabies human monoclonal antibodies, the neutralizing activity of IgG against E57 escape virus was tested in a modified RFFIT as described above. Most of the rabies anti-virus IgGs had good neutralizing activity against the six E57 escape viruses (see table 16). In contrast, CR04-008, CR04-018 and CR04-126 did not neutralize 6/6, 2/6 and 3/6 E57 escape virus, respectively. Absence of neutralization means that the 50% titration criterion at an antibody dilution of 1: 100 was not reached. CR04-021, CR04-108, CR04-120, CR04-125, and CR04-164 showed a significant decrease in neutralizing activity against several escape viruses. This suggests that the epitope of these antibodies has been included either directly or indirectly in the E57 escape virus glycoprotein. Based on the above, several anti-rabies virus IgG can be compatible with CR-57 in an anti-rabies cocktail for the treatment of prophylaxis after exposure. In particular, the panel of six unique IgGs as defined above, that is to say antibodies CR04-010, CR04-040, CR04-098, CR04-103, CR04-104, and CR04-144, presented good neutralizing power against the E57 escape virus suggesting that that / those epitope (s) recognized by those antibodies was not affected by the amino acid mutations induced by CR-57. The CR04-098 antibody seemed the most promising since it had a potency greater than 3000 IU / mg for each of the escape viruses.
Example 14
Recognition of anti-rabies CR-57 and CR04-098 antibody epitopes
To confirm that human monoclonal antibodies called CR-57 and CR04-098 recognize non-overlapping, non-competitive epitopes, escape viruses of human monoclonal antibody called CR04098 were generated essentially as described for CR57 escape viruses (see example one). In summary, the number of foci per well was scored by immunofluorescence and the medium was chosen from wells preferably containing a focus for virus amplification. All E98 escape viruses were generated from 1
Only focus with the exception of E98-2 (2 bulbs) and E98-4 (4 bulbs). A virus was defined as an escape variant if the neutralization index was <2.5 log The neutralization index was determined by subtracting the number of particles from
4 IU / ml)
׽ infectious virus / ml produced in cultures of BSR cells infected with virus plus monoclonal antibody (
of the number of infectious virus particles / ml produced in cultures of BSR or MNA cells infected with virus-only virus ([log of foci-forming units / ml of virus in the absence of monoclonal antibody minus log of uff / ml of virus in the presence of monoclonal antibody]). An index below 2.5 log was considered to be evidence of escape.
To further investigate that CR04-098 binds to a non-overlapping, non-competitive epitope, different from CR-57, CR-57 was tested against E98 escape virus in a modified RFFIT assay as described above. . As shown in Table 17, CR-57 had good neutralizing activity against the five E98 escape viruses. Additionally, the CR04-010 and CR04-144 antibodies were tested for neutralizing activity against E98 escape viruses. Neither antibody neutralized the E98 escape virus (data not shown) suggesting that the epitope recognized by both antibodies is affected either directly or indirectly by the amino acid mutation induced by the CR04-098 antibody. The CR04-018 and CR04-126 antibodies were tested for neutralizing activity against only one of the E98 escape virus, ie E98-4. CR04-018 could neutralize the escape virus, while CR04-126 had only a weak neutralizing power against the escape virus. This suggests that the epitope recognized by CR04-018 is not affected by the mutation induced by the CR04-098 antibody. Additionally, antibodies CR04-010, CR04-038, CR04-040, CR04-073, CR04-103, CR04-104, CR04-108, CR04-120, CR04-125, CR04-164 did not neutralize E98-4 which suggests that they recognize the same epitope as CR04098 (data not shown).
To identify possible mutations in the rabies glycoprotein of each of the E98 escape viruses, the nucleotide sequence of the glycoprotein open reading frame (ORF) was determined as described above for the E57 and EJB escape viruses. . All E98 escape viruses showed the N to D mutation at amino acid position 336 of rabies glycoprotein (see Figure 8). This region of glycoprotein has been defined as antigenic site III consisting of amino acids 330-338 (numbering without signal peptide). Instead, CR-57 recognized an epitope located at amino acids 226-231 (numbering without signal peptide), which overlaps with antigenic site I. In addition to the N336D mutation, the E98 escape virus called E98-5 showed the H mutation a Q at amino acid position 354 (codon change from CAT to CAG) of rabies glycoprotein (data not shown).
In addition, a Pepscan analysis of the binding of CR57 to peptides that harbor the mutated CR57 epitope (as seen in the E57 escape virus) did not show that the interaction of CR57 will be eliminated (data not shown). Surprisingly, CR04-098 could still bind to the mutated glycoprotein (which comprises the N336D mutation) expressed in PER.C6® cells, as measured by flow cytometry (data not shown), although the viruses that contained this mutation were no longer They neutralized.
In addition, epitope mapping studies and affinity classification studies were performed using a surface plasmon resonance analysis using a BIAcore3000 ™ analytical system. Purified rabies glycoprotein (ERA strain) was immobilized as ligand on a research quality CM5 flow channel (Fc) sensor chip (Biacore AB, Sweden) using amine coupling. The classification was performed at 25 ° C with HBS-EP (Biacore AB, Sweden) as the execution buffer. 50 µl of each antibody was injected at a constant flow rate of 20 µl / min. Then, execution buffer was applied for 750 seconds followed by regeneration of the CM5 chip with 5 µl of 2 M NaOH, 5 µl of 45 mM HCl and 5 µl of 2 mM NaOH. Resonance signals expressed as resonance units (UR) were plotted as a function of time and the increase and decrease of UR was determined as a measure of association and dissociation, respectively, and used for the classification of antibodies. The actual KD values for CR57 and CR04-098 as determined by surface plasmon resonance analysis were 2.4 nM and 4.5 nM, respectively. Epitope mapping studies further confirmed that CR57 and CR04-098 bind to different epitopes in rabies glycoprotein. CR57 injection resulted in a response of 58 UR (data not shown). After injection of CR04098, an additional increase in the level of response (24 UR) was obtained, suggesting that the binding sites for CR04-098 were not occupied (data not shown). Similar results were obtained when the reverse order was applied which shows that each antibody reached similar UR levels regardless of the order of injection (data not shown). These results further demonstrate that CR57 and CR04-098 can bind simultaneously and recognize different epitopes in the rabies virus glycoprotein.
In general, the above data further confirm that the CR-57 and CR04-098 antibodies recognize non-overlapping epitopes other epitopes, ie epitopes at the antigenic site I and III, respectively. The data agree well with the ELISA / FACS competition data indicating that CR-57 and CR04-098 do not compete for the G protein binding of the ERA strain and the good neutralizing activity of the CR04-098 antibody against all E57 escape virus. Based on these results and the fact that in vitro exposure of rabies virus to the combination of CR57 and CR04-098 (selection in the presence of 4 IU / ml of any antibody) did not provide
5
10
fifteen
twenty
25
30
35
Escape virus (data not shown), it was concluded that antibodies CR-57 and CR04-098 recognize non-overlapping, non-competitive epitopes, and can advantageously be used in a cocktail of rabies anti-virus antibodies for the treatment of prophylaxis after The exhibition.
Example 15
Evaluation of epitope conservation recognized by CR57 and CR04-098
The minimum binding region of CR-57 (KLCGVL amino acids within SEQ ID NO: 332, the rabies virus glycoprotein region recognized by CR57 as determined by means of PEPSCAN and alanine scanning technology) was aligned with Nucleotide sequences of 229 isolated from genotype 1 rabies virus to assess epitope conservation (see Table 18). The set of samples contained human isolates, isolated from bat and isolated from dogs or domestic animals most likely bitten by dogs with rabies. A frequency analysis of the amino acids at each position within the minimum binding region revealed that the critical residues constituting the epitope were highly conserved. Lysine in position one was retained in 99.6% of the isolates, while only in 1/229 isolates a conservative K> R mutation was observed. Positions two and three (L and C) were completely preserved. It is believed that the central cysteine residue is structurally involved in the folding of the glycoprotein and is conserved in all lyssaviruses (see Badrane and Tordo, 2001). Glycine at position four was conserved in 98.7% of the isolates, while in 3/229 isolates mutations were observed towards charged amino acids (G> R in 1/229; G> E in 2/229). The fifth position was also retained with the exception of an isolate in which a conservative V> I mutation was observed. In the sixth position, which is not a critical residue as determined by alanine substitution scanning, significant heterogeneity was observed in natural isolates: L in 70.7%, P in 26.7% and S in the 2.6% of the strains, respectively. Together, it is predicted that approximately 99 percent of the rabies viruses that can be found are recognized by the CR-57 antibody.
123 of these 229 virus isolates were analyzed to determine the presence of mutations in both the epitope of CR-57 and CR04-098. None of these 123 natural viruses contained mutations in both epitopes. The N> D mutation as observed in E98 escape viruses was only present in five virus isolates. These viruses were geographically distinct and were isolated from animals in Africa (see Figure 9 for a phylogenetic tree; the five virus isolates, ie AF325483, AF325482, AF325481, AF325480 and AF325485, are indicated in bold). Phylogenetic analysis of glycoprotein sequences revealed that rabies viruses with mutated CR57 epitopes are only distantly related to rabies viruses carrying a mutated CR04-098 epitope. Therefore, the probability of finding a neutralization resistant rabies virus by a cocktail of CR-57 and CR04-098 is practically non-existent.
Table 1: Neutralizing power of CR-57 and CR-JB against wild-type and escape viruses

Virus

Power Power Virus Power Power

CR-57 (IU / mg)

CR-JB (IU / mg) CR-57 (IU / mg) CR-JB (IU / mg)

CVS-11

3797 605 CVS-11 3797 605

E57A2

0 <0.2 EJB2B 0.004 0.6

E57A3

0 419 EJB2C <0.004 2

E57B1

0 93 EJB2D <0.004 3

E57B2

0 <0.3 EJB2E <0.2 <0.3

E57B3

0 419 EJB2F <0.06 3

E57C3

0 31 EJB3F <0.04 0.06

Table 2: Variable region primers of human lambda chain (sense). Table 3: Variable region primers of human kappa chain (sense).

Primer Name

Primer nucleotide sequence SEQ ID NO

HuV1A

SEQ ID NO: 208

HuV1B

SEQ ID NO: 209

HuV1C

SEQ ID NO: 210

HuV2

SEQ ID NO: 211

HuV3A

SEQ ID NO: 212

HuV3

SEQ ID NO: 213

HuV4

SEQ ID NO: 214

HuV5

SEQ ID NO: 215

HuV6

image 1 SEQ ID NO: 216

HuV7 / 8

SEQ ID NO: 217

HuV9

SEQ ID NO: 218

Primer Name

Primer nucleotide sequence SEQ ID NO

HuV1B

SEQ ID NO: 219

HuV2

SEQ ID NO: 220

HuV3

SEQ ID NO: 221

HuV4

SEQ ID NO: 222

HuV5

SEQ ID NO: 223

HuV6

SEQ ID NO: 224

Table 4: Extended human kappa chain variable region primers with SalI restriction sites (sense), extended human kappa chain J region primers with NotI restriction sites (antisense), extended human lambda chain variable region primers with sites of restriction SalI (sense) and primers of region J of human lambda chain extended with restriction sites NotI (antisense).

Primer Name

Primer nucleotide sequence SEQ ID NO

HuVB-SalI

SEQ ID NO: 225

HuV2-SalI

SEQ ID NO: 226

HuV3B-SalI

SEQ ID NO: 227

HuV4B-SalI

SEQ ID NO: 228

HuV5-SalI

SEQ ID NO: 229

HuV6-SalI

SEQ ID NO: 230

HuV1-NotI

image 1 SEQ ID NO: 231

HuJ2-NotI

SEQ ID NO: 232

HuJ3-NotI

image 1 SEQ ID NO: 233

HuV4-NotI

image 1 SEQ ID NO: 234

HuV5-NotI

SEQ ID NO: 235

HuV1A-SalI

SEQ ID NO: 236

HuV1B-SalI

SEQ ID NO: 237

HuV1C-SalI

SEQ ID NO: 238

HuV2-SalI

SEQ ID NO: 239

HuV3A-SalI

SEQ ID NO: 240

HuV3B-SalI

SEQ ID NO: 241

HuV4-SalI

SEQ ID NO: 242

HuV5-SalI

SEQ ID NO: 243

HuV6-SalI

image 1 SEQ ID NO: 244

HuV7 / 8-SalI

SEQ ID NO: 245

HuV9-SalI

SEQ ID NO: 246

HuJ-NotI

image 1 SEQ ID NO: 247

HuV2 / 3-NotI

SEQ ID NO: 248

HuJ4 / 5-NotI

image 1 SEQ ID NO: 249

Table 5: Distribution of the different light chain products throughout the 10 fractions. image 1
Table 6: Heavy chain variable region primers of human IgG (sense).

Primer Name

Primer nucleotide sequence SEQ ID NO

HuVH1B / 7A

SEQ ID NO: 250

HuVH1C

SEQ ID NO: 251

HuVH2B

SEQ ID NO: 252

HuVH3B

SEQ ID NO: 253

HuVH3C

SEQ ID NO: 254

HuVH4B

image 1 SEQ ID NO: 255

HuVH4C

SEQ ID NO: 256

HuVH5B

SEQ ID NO: 257

HuVH6A

SEQ ID NO: 258

Table 7: Extended human IgG heavy chain variable region primers with SfiI / NcoI (sense) restriction sites and extended human IgG heavy chain J region primers with XhoI / BstEII (antisense) restriction sites. image2

HuVH1B / 7A-SfiI

SEQ ID NO: 259

HuVHIC-SfiI

image 1 SEQ ID NO: 260

HuVH2B-SfiI

SEQ ID NO: 261

HuVH3B-SfiI

SEQ ID NO: 262

HuVH3C-SfiI

SEQ ID NO: 263

HuVH4B-SfiI

SEQ ID NO: 264

HuVH4C-SfiI

SEQ ID NO: 265

HuVH5B-SfiI

image 1 SEQ ID NO: 266

HuVH6A.SfiI

image 1 SEQ ID NO: 267

HuJH1 / 2-XhoI

SEQ ID NO: 268

HuJH3-XhoI

SEQ ID NO: 269

HuJH4 / 5-XhoI

image 1 SEQ ID NO: 270

HuJH6-XhoI

image 1 SEQ ID NO: 271

Table 8: Binding of single-stranded phage antibodies (scFv) to rabies virus G protein (ERA strain) and to FBS as measured by ELISA.

Phage Antibody Name

Rabies virus G protein (OD at 492 nm) FBS (OD at 492 nm)

SC04-001

0.828 0.053

SC04-004

0.550 0.054

SC04-008

0.582 0.058

SC04-010

0.915 0.043

SC04-018

0.247 0.052

SC04-021

0.278 0.052

SC04-026

0.212 0.054

SC04-031

0.721 0.065

SC04-038

0.653 0.061

SC04-040

0.740 0.053

SC04-060

0.923 0.056

SC04-073

0.657 0.054

SC04-097

0.835 0.056

SC04-098

0.798 0.060

SC04-103

0.606 0.059

SC04-104

0.566 0.063

SC04-108

0.363 0.052

SC04-120

0.571 0.052

SC04-125

0.735 0.049

SC04-126

0.232 0.051

SC04-140

0.865 0.057

SC04-144

0.775 0.054

SC04-146

0.484 0.057

SC04-164

0.547 0.057

Control (SO57)

0.650 0.055

Control (02-007)

0.063 0.052

Table 9: Data of single chain Fv that can bind to rabies virus G protein.

ScFv name (bib.)

SEQ ID NO of nucl sequence. SEQ ID NO of amino acid sequence HCDR3 (SEQ ID NO :) VH Locus VL Locus

sc04-001 (JK1994)

157 158 GLYGELFDY (SEQ ID NO: 1) 3-20 (DP32) V13 (31 -V213)

sc04-004 (WT2000)

159 160 DYLYPTTDFDY (SEQ ID NO: 2) 3-23 (DP47) VkI (012 / 02DPK9)

sc04-008 (RAB03- G01)

161 162 MGFTGTYFDY (SEQ ID NO: 3) 2-70 (DP28) V13 (3h -V214)

sc04-010 (RAB03- G01)

163 164 3-30 (DP49) VkI (L11 DPK3)

sc04-018 (RAB03- G01)

165 166 VSVTTGAFNI (SEQ ID NO: 5) 4-04 (DP70) V11 (1c -V116)

sc04-021 (RAB03- G01)

167 168 GSVLGDAFDI (SEQ ID NO: 6) 3-30 (DP49) VkI (L8)

sc04-026 (RAB03- G01)

169 170 TSNWNYLDRFDP (SEQ ID NO: 7) 5-51 (DP73) VkII (A 19/03 -DPK15)

sc04-031 (RAB03- G01)

171 172 GSVLGDAFDI (SEQ ID NO: 8) 3-30 (DP49) VkI (L5 -DPK5)

sc04-038 (RAB03- G01)

173 174 GSVLGDAFDI (SEQ ID NO: 9) 3-30 (DP49) VkI (L5 -DPK5)

sc04-040 (RAB03- G01)

175 176 GSKVGDFDY (SEQ ID NO: 10) 3-30 (DP49) V13 (3h -V214)

sc04-060 (RAB04- G01)

177 178 4-59 (DP71) VkI (O12 / 02 DPK9)

sc04-073 (RAB04- G01)

179 180 image 1 3-30 (DP49) VkI (L12)

sc04-097 (RAB04- G01)

181 182 TASNLGRGGMDV (SEQ ID NO: 13) 3-23 (DP47) VkI (L8)

sc04-098 (RAB04- G01)

183 184 VAVAGTHFDY (SEQ ID NO: 14) 3-30 (DP49) VkI (A30)

sc04-103 (RAB04- G01)

185 186 VAVAGESFDS (SEQ ID NO: 15) 3-30 (DP49) VkI (L5 -DPK5)

sc04-104 (RAB04- G01)

187 188 IVVVTALDAFDI (SEQ ID NO: 16) 3-30 (DP49) VkI (L12)

sc04-108 (RAB

189 190 FMIVADDAFDI 3-30 (DP49) VkI (L1)

04- G01)

(SEQ ID NO: 17)

sc04-120 04- G01)

(RAB 191 192 GGKTGEFDY (SEQ ID NO: 18) 3-30 (DP49) VkI (L8)

sc04-125 04- G01)

(RAB 193 194 IATAGTGFDY (SEQ ID NO: 19) 3-30 (DP49) VkI (L8)

sc04-126 04- G01)

(RAB 195 196 MGFTGTYTDY (SEQ ID NO: 20) 2-70 (DP28) V13 (3h -V214)

sc04-140 04- G01)

(RAB 197 198 VTNPGDAFDI (SEQ ID NO: 21) 3-30 (DP49) VkI (L4 / 18a)

sc04-144 04- G01)

(RAB 199 200 GGKTGEFDY (SEQ ID NO: 22) 3-30 (DP49) VkI (L8)

sc04-146 04- G01)

(RAB 201 202 GGKTGEFDY (SEQ ID NO: 23) 3-30 (DP49) VkIII (L2 -DPK21)

sc04-164 04- G01)

(RAB 203 204 GSVLGDAFDI (SEQ ID NO: 24) 3-30 (DP49) VkI (L19 DPK6)

SO57

205 206 1-69 (DP10) V12 (2e -VI3)

SOJB

312 313 RQHISSFPWFDS (SEQ ID NO: 276) 2-05 V13 (3h -V214)

Table 10: Test data to determine the neutralizing activity against scFv rabies virus.

ScFv name

Dilution of 50% assessment criteria WHO standard for dilution of 50% assessment criteria (2 IU / ml) Power (IU / ml)

SC04-001

270 405 1.3

SC04-004

3645 405 18

SC04-008

> 10935 405> 54

SC04-010

810 405 4

SC04-018

15 405 0.1

SC04-021

270 405 1.3

SC04-026

45 270 0.3

SC04-031

90 270 0.7

SC04-038

270 270 2

SC04-040

45 270 0.3

SC04-060

30 270 0.2

SC04-073

405 270 3

SC04-097

30 270 0.2

SC04-098

1215 270 9

SC04-103

45 270 0.3

SC04-104

135 270 1

SC04-108

135 270 1

SC04-120

810 270 6

SC04-125

405 270 3

SC04-126

10 270 0.1

SC04-140

135 270 1

SC04-144

810 270 6

SC04-146

405 270 3

SC04-164

45 270 0.3

Table 11A: Test data to measure scFv neutralizing activity for E57 E57A2, E57A3 and E57B1 escape virus.

ScFv name

E57A2 E57A3 E57B1

one*

2 * 3 * 1 * 2 * 3 * 1 * 2 * 3 *

SC04-001

10 90 0.2 10 90 0.2 30 45 1.3

SC04-004

810 90 18.0 1215 90 27.0 810 45 36.0

SC04-008

10 90 0.2 15 90 0.3 270 45 12.0

SC04-010

270 90 6.0 270 90 6.0 270 45 12.0

SC04-018

5 90 0.1 15 90 0.3 15 45 0.7

SC04-021

10 90 0.2 30 90 0.7 10 90 0.2

SC04-026

<5 90 0.0 <5 45 0.0 <5 90 0.0

SC04-031

10 90 0.2 30 90 0.7 10 90 0.2

SC04-038

90 90 2.0 90 90 2.0 45 90 1.0

SC04-040

15 90 0.3 5 90 0.1 5 90 0.1

SC04-060

5 90 0.1 5 90 0.1 <5 90 0.0.

SC04-073

135 90 3.0 90 30 6.0 30 30 2.0

SC04-097

<5 90 0.0 <5 90 0.0 <5 90 0.0

SC04-098

810 90 18.0 270 30 18.0 270 30 18.0

SC04-103

<5 90 0.0 10 90 0.2 5 90 0.1

SC04-104

90 90 2.0 30 30 2.0 30 30 2.0

SC04-108

15 90 0.3 <5 90 0.0 <5 90 0.0

SC04-120

45 90 1.0 30 30 2.0 10 30 0.7

SC04-125

135 90 3.0 135 30 9.0 90 30 6.0

SC04-126

<5 90 0.0 <5 45 0.0 <5 90 0.0

SC04-140

30 45 1.3 90 30 6.0 45 90 1.0

SC04-144

270 45 12.0 270 30 18.0 135 90 3.0

SC04-146

90 45 4.0 90 30 6.0 90 90 2.0

SC04-164

15 45 0.7 30 30 2.0 15 90 0.3

1 * is the dilution of the evaluation criteria of 50% 2 * is the WHO standard of dilution of the evaluation criteria of 50% (2 IU / ml) 3 * is the potency (IU / ml)
Table 11 B: Test data to measure scFv neutralizing activity for E57 E57B2, E57B3 and E57C3 escape virus.

ScFv name

E57B2 E57B3 E57C3

one*

2 * 3 * 1 * 2 * 3 * 1 * 2 * 3 *

SC04-001

30 45 1.3 90 270 0.7 5 90 0.1

SC04-004

5 45 0.2 2430 270 18.0 270 90 6.0

SC04-008

5 45 0.2 45 270 0.3 10 90 0.2

SC04-010

45 45 2.0 405 270 3.0 270 90 6.0

SC04-018

15 45 0.7 15 270 0.1 30 90 0.7

SC04-021

10 90 0.2 30 270 0.2 10 90 0.2

SC04-026

<5 45 0.0 <5 45 0.0 <5 30 0.0

SC04-031

10 90 0.2 30 270 0.2 30 90 0.7

SC04-038

30 90 0.7 90 270 0.7 90 90 2.0

SC04-040

5 90 0.1 15 135 0.2 10 90 0.2

SC04-060

<5 90 0.0 10 135 0.1 5 90 0.1

SC04-073

30 90 0.7 90 270 0.7 90 90 2.0

SC04-097

<5 90 0.0 <5 135 0.0 <5 90 0.0

SC04-098

90 90 2.0 810 270 6.0 270 90 6.0

SC04-103

<5 90 0.0 10 135 0.1 10 90 0.2

SC04-104

45 90 1.0 45 270 0.3 90 90 2.0

SC04-108

10 90 0.2 <5 135 0.0 15 90 0.3

SC04-120

15 90 0.3 45 270 0.3 30 90 0.7

SC04-125

90 90 2.0 270 270 2.0 270 90 6.0

SC04-126

<5 45 0.0 <5 45 0.0 <5 30 0.0

SC04-140

30 90 0.7 90 90 2.0 270 90 6.0

SC04-144

90 90 2.0 270 90 6.0 405 90 9.0

SC04-146

30 90 0.7 90 90 2.0 90 90 2.0

SC04-164

15 90 0.3 15 90 0.3 30 90 0.7

1 * is the dilution of the evaluation criteria of 50% 2 * is the WHO standard of dilution of the evaluation criteria of 50% (2 IU / ml) 3 * is the potency (IU / ml)
Table 12: Oligonucleotides used for amplification by PCR of VH genes.

Name and nucleotide sequence

VH SEQ ID NO gene:

5H-B:

SC04-001 280

acctgtcttgaattctccatggccgaggtgcagctggtggagtctg

5H-C: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgg

SC04-021 SC04-031 SC04-125 SC04-164 281

5H-C-long: acctgtcttgaattctccatggcccaggtgcagctggtggagtctgggg

SC04-010 SC04-038 SC04-040 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-120 SC04-140 SC04-144 SC04-146 282

5H-F: acctgtcttgaattctccatggcccaggtgcagctgcaggagtccggccc

SC04-018 SC04-060 283

5H-H: acctgtcttgaattctccatggccgaggtgcagctggtgcagtctgg

SC04-026 284

5H-I: acctgtcttgaattctccatggccgaggtgcagctgctggagtctgg

SC04-004 SC04-097 285

5H-M: acctgtcttgaattctccatggcccaggtgaccttgaaggagtctgg

SC04-008 SC04-126 286

sy3H-A: gcccttggtgctagcgctggagacggtcaccagggtgccctggcccc

SC04-001 SC04-004 SC04-008 SC04-010 SC04-026 SC04-040 SC04-073 SC04-098 SC04-120 SC04-125 SC04-126 SC04-144 SC04-146 287

sy3H-C: gcccttggtgctagcgctggagacggtcacggtggtgccctggcccc

SC04-097 288

sy3H-C-long:

SC04-060 289

sy3H-D: gcccttggtgctagcgctggacacggtcaccatggtgccctggcccc

SC04-018 SC04-021 SC04-031 SC04-038 SC04-104 SC04-108 SC04-140 SC04-164 290

sy3H-E: gcccttggtgctagcgctggacacggtcaccagggtgccccggcccc

SC04-103 291

Table 13: Oligonucleotides used for PCR amplification of VL genes.

Name and nucleotide sequence

VL SEQ ID NO gene:

3L-B:

SC04-001 292

ttttccttagcggccgcgactcacctaggacggtcagcttggtc

5K-B: acctgtctcgagttttccatggctgacatccagatgacccagtc

SC04-031 SC04-060 SC04-073 SC04-098 SC04-103 SC04-104 SC04-108 SC04-164 293

5K-C: acctgtctcgagttttccatggctgacatccagatgacccagtctccatcct ccc

SC04-004 294

5K-G: acctgtctcgagttttccatggctgacatcgtgatgacccagtctcc

SC04-026 295

5K-K: acctgtctcgagttttccatggctgccatccagatgacccagtctcc

SC04-010 296

5K-M: acctgtctcgagttttccatggctgacatccagctgacccagtc

SC04-021 SC04-097 SC04-120 SC04-125 SC04-144 297

5K-N: acctgtctcgagttttccatggctgacatccagatgactcagtc

SC04-038 298

5K-O: acctgtctcgagttttccatggctgccatccagctgacccagtc

SC04-140 299

5K-Q: acctgtctcgagttttccatggctgagatcgtgatgactcagtc

SC04-146 300

5L-E: acctgtctcgagttttccatggcttcctacgtgctgactcagccg

SC04-008 301

5L-F: acctgtctcgagttttccatggctcagtccgtgctgactcagcc

SC04-018 302

5L-G: acctgtctcgagttttccatggcttcctacgtgctgactcagcc

SC04-040 303

SC04-126

sy3K-F: gctgggggcggccacggtccgcttgatctccaccttggtccc

SC04-004 SC04-010 SC04-021 SC04-031 SC04-098 SC04-104 SC04-125 SC04-140 SC04-144 SC04-164 304

sy3K-I: gctgggggcggccacggtccgcttgatctccagccgtgtccc

SC04-038 SC04-097 SC04-103 SC04-108 SC04-146 305

sy3K-J: gctgggggcggccacggtccgcttgatctccagcttggtccc

SC04-026 SC04-060 SC04-073 306

sy3K-K: gctgggggcggccacggtccgcttgatgtccaccttggtccc

SC04-120 307

sy3L-A: ccagcacggtaagcttcagcacggtcaccttggtgccagttcc

SC04-018 SC04-126 308

sy3L-C: ccagcacggtaagcttcagcacggtcagcttggtgcctccgcc

SC04-040 309

sy3L-D: ccagcacggtaagcttcaacacggtcagctgggtccc

SC04-008 310

sy5L-A:

SC04-001 311

Table 14: Binding of human monoclonal antibodies CR57, CRJB and CR04-010 (10 µg / ml) to linear peptides of the extracellular domain of glycoprotein G of the ERA strain of rabies virus.

Amino acid sequence of linear peptide

CR57 CRJB CR04-010

KFPIYTILDKLGPWS

71 97 1

FPIYTILDKLGPWSP

42 105 39

PIYTILDKLGPWSPI

36 89 87

IYTILDKLGPWSPID

44 97 104

YTILDKLGPWSPIDI

48 114 91

TILDKLGPWSPIDIH

76 96 88

ILDKLGPWSPIDIHH

54 104 69

LDKLGPWSPIDIHHL

55 99 107

DKLGPWSPIDIHHLS

62 103 93

KLGPWSPIDIHHLSC

72 105 45

LGPWSPIDIHHLSCP

69 112 19

GPWSPIDIHHLSCPN

68 114 33

PWSPIDIHHLSCPNN

62 104 47

WSPIDIHHLSCPNNL

80 106 11

SPIDIHHLSCPNNLV

74 85 1

PIDIHHLSCPNNLVV

46 93 90

IDIHHLSCPNNLVVE

69 102 55

DIHHLSCPNNLVVED

38 96 78

IHHLSCPNNLVVEDE

37 85 113

HHLSCPNNLWEDEG

56 76 117

HLSCPNNLVVEDEGC

65 119 111

LSCPNNLVVEDEGCT

69 117 127

SCPNNLVVEDEGCTN

83 114 91

CPNNLVVEDEGCTNL

77 97 49

PNNLVVEDEGCTNLS

78 107 97

NNLVVEDEGCTNLSG

72 99 97

NLVVEDEGCTNLSGF

75 119 55

LVVEDEGCTNLSGFS

76 103 52

VVEDEGCTNLSGFSY

73 107 91

VEDEGCTNLSGFSYM

74 103 31

EDEGCTNLSGFSYME

54 90 7

DEGCTNLSGFSYMEL

1 23 1

EGCTNLSGFSYMELK

51 114 129

GCTNLSGFSYMELKV

55 114 118

CTNLSGFSYMELKVG

47 110 137

TNLSGFSYMELKVGY

43 106 161

NLSGFSYMELKVGYI

61 115 170

LSGFSYMELKVGYIL

71 132 169

SGFSYMELKVGYILA

79 132 161

GFSYMELKVGYILAI

65 111 141

FSYMELKVGYILAIK

89 112 192

SYMELKVGYILAIKM

65 123 152

YMELKVGYILAIKMN

78 114 150

MELKVGYILAIKMNG

76 141 107

ELKVGYILAIKMNGF

87 132 76

LKVGYILAIKMNGFT

78 112 118

KVGYILAIKMNGFTC

78 118 68

VGYILAIKMNGFTCT

77 93 1

GYILAIKMNGFTCTG

75 90 1

YILAIKMNGFTCTGV

47 107 107

ILAIKMNGFTCTGVV

79 103 104

LAIKMNGFTCTGVVT

68 130 159

AIKMNGFTCTGVVTE

47 103 152

IKMNGFTCTGVVTEA

68 108 138

KMNGFTCTGVVTEAE

76 104 133

MNGFTCTGVVTEAEN

69 99 148

NGFTCTGVVTEAENY

69 101 138

GFTCTGVVTEAENYT

71 86 129

FTCTGVVTEAENYTN

83 125 154

TCTGVVTEAENYTNF

92 112 129

CTGVVTEAENYTNFV

76 123 150

TGVVTEAENYTNFVG

85 110 154

GVVTEAENYTNFVGY

86 111 110

VVTEAENYTNFVGYV

87 106 114

VTEAENYTNFVGYVT

79 90 73

TEAENYTNFVGYVTT

68 84 8

EAENYTNFVGYVTTT

69 117 142

AENYTNFVGYVTTTF

66 106 110

ENYTNFVGYVTTTFK

44 112 183

NYTNFVGYVTTTFKR

49 114 174

YTNFVGYVTTTFKRK

51 104 138

TNFVGYVTTTFKRKH

71 125 165

NFVGYVTTTFKRKHF

65 107 154

FVGYVTTTFKRKHFR

70 111 152

VGYVTTTFKRKHFRP

75 113 155

GYVTTTFKRKHFRPT

70 123 160

YVTTTFKRKHFRPTP

85 106 160

VTTTFKRKHFRPTPD

79 105 119

TTTFKRKHFRPTPDA

80 108 137

TTFKRKHFRPTPDAC

74 99 110

TFKRKHFRPTPDACR

96 111 108

FKRKHFRPTPDACRA

64 92 62

KRKHFRPTPDACRAA

65 93 1

RKHFRPTPDACRAAY

64 107 99

KHFRPTPDACRAAYN

73 112 124

HFRPTPDACRAAYNW

46 113 118

FRPTPDACRAAYNWK

43 112 148

RPTPDACRAAYNWKM

77 101 129

PTPDACRAAYNWKMA

99 125 143

TPDACRAAYNWKMAG

92 132 160

PDACRAAYNWKMAGD

61 124 147

DACRAAYNWKMAGDP

84 113 136

ACRAAYNWKMAGDPR

82 116 138

CRAAYNWKMAGDPRY

87 118 137

RAAYNWKMAGDPRYE

90 130 120

AAYNWKMAGDPRYEE

68 106 120

AYNWKMAGDPRYEES

96 94 77

YNWKMAGDPRYEESL

83 118 116

NWKMAGDPRYEESLH

58 101 69

WKMAGDPRYEESLHN

69 101 1

KMAGDPRYEESLHNP

62 102 84

MAGDPRYEESLHNPY

64 116 112

AGDPRYEESLHNPYP

40 101 125

GDPRYEESLHNPYPD

36 98 123

DPRYEESLHNPYPDY

57 110 118

PRYEESLHNPYPDYR

73 115 129

RYEESLHNPYPDYRW

69 112 125

YEESLHNPYPDYRWL

58 106 120

EESLHNPYPDYRWLR

76 123 141

ESLHNPYPDYRWLRT

92 132 125

SLHNPYPDYRWLRTV

78 111 137

LHNPYPDYRWLRTVK

79 106 142

HNPYPDYRWLRTVKT

86 108 146

NPYPDYRWLRTVKTT

85 102 151

PYPDYRWLRTVKTTK

65 93 103

YPDYRWLRTVKTTKE

72 97 97

PDYRWLRTVKTTKES

76 85 27

DYRWLRTVKTTKESL

54 111 105

YRWLRTVKTTKESLV

46 117 125

RWLRTVKTTKESLVI

40 110 120

WLRTVKTTKESLVII

41 104 125

LRTVKTTKESLVIIS

65 104 161

RTVKTTKESLVIISP

82 120 150

TVKTTKESLVIISPS

76 116 150

VKTTKESLVIISPSV

71 120 154

KTTKESLVIISPSVA

101 112 147

TTKESLVIISPSVAD

78 121 141

TKESLVIISPSVADL

86 112 132

KESLVIISPSVADLD

86 117 111

ESLVIISPSVADLDP

88 125 143

SLVIISPSVADLDPY

68 105 125

LVIISPSVADLDPYD

85 107 93

VIISPSVADLDPYDR

59 98 50

IISPSVADLDPYDRS

83 125 14

ISPSVADLDPYDRSL

50 119 91

SPSVADLDPYDRSLH

59 114 118

PSVADLDPYDRSLHS

44 114 118

SVADLDPYDRSLHSR

49 106 129

VADLDPYDRSLHSRV

71 113 141

ADLDPYDRSLHSRVF

70 121 141

DLDPYDRSLHSRVFP

111 152 127

LDPYDRSLHSRVFPS

99 142 106

DPYDRSLHSRVFPSG

90 120 134

PYDRSLHSRVFPSGK

86 120 130

YDRSLHSRVFPSGKC

364 818 127

DRSLHSRVFPSGKCS

98 142 141

RSLHSRVFPSGKCSG

87 141 156

SLHSRVFPSGKCSGV

69 111 141

LHSRVFPSGKCSGVA

78 114 129

HSRVFPSGKCSGVAV

97 118 111

SRVFPSGKCSGVAVS

100 125 24

RVFPSGKCSGVAVSS

69 110 106

VFPSGKCSGVAVSST

74 114 142

FPSGKCSGVAVSSTY

64 134 146

PSGKCSGVAVSSTYC

56 112 132

SGKCSGVAVSSTYCS

64 121 120

GKCSGVAVSSTYCST

92 143 145

KCSGVAVSSTYCSTN

88 130 130

CSGVAVSSTYCSTNH

110 165 143

SGVAVSSTYCSTNHD

79 110 115

GVAVSSTYCSTNHDY

79 114 108

VAVSSTYCSTNHDYT

85 114 118

AVSSTYCSTNHDYTI

71 105 102

VSSTYCSTNHDYTIW

78 107 121

SSTYCSTNHDYTIWM

76 107 121

STYCSTNHDYTIWMP

86 99 119

TYCSTNHDYTIWMPE

96 107 74

YCSTNHDYTIWMPEN

47 92 29

CSTNHDYTIWMPENP

52 106 86

STNHDYTIWMPENPR

60 112 107

TNHDYTIWMPENPRL

69 129 119

NHDYTIWMPENPRLG

71 119 130

HDYTIWMPENPRLGM

82 125 123

DYTIWMPENPRLGMS

93 127 123

YTIWMPENPRLGMSC

97 132 143

TIWMPENPRLGMSCD

69 106 134

IWMPENPRLGMSCDI

98 110 101

WMPENPRLGMSCDIF

88 113 120

MPENPRLGMSCDIFT

105 121 143

PENPRLGMSCDIFTN

83 111 104

ENPRLGMSCDIFTNS

71 118 111

NPRLGMSCDIFTNSR

90 113 138

PRLGMSCDIFTNSRG

72 112 105

RLGMSCDIFTNSRGK

88 106 113

LGMSCDIFTNSRGKR

76 110 114

GMSCDIFTNSRGKRA

54 120 101

MSCDIFTNSRGKRAS

46 110 106

SCDIFTNSRGKRASK

44 111 98

CDIFTNSRGKRASKG

42 104 117

DIFTNSRGKRASKGS

70 107 111

IFTNSRGKRASKGSE

77 125 87

FTNSRGKRASKGSET

83 111 119

TNSRGKRASKGSETC

68 108 110

NSRGKRASKGSETCG

92 100 119

SRGKRASKGSETCGF

64 93 90

RGKRASKGSETCGFV

75 104 115

GKRASKGSETCGFVD

92 124 118

KRASKGSETCGFVDE

92 106 129

RASKGSETCGFVDER

86 110 134

ASKGSETCGFVDERG

97 108 103

SKGSETCGFVDERGL

92 102 76

KGSETCGFVDERGLY

90 97 44

GSETCGFVDERGLYK

57 115 92

SETCGFVDERGLYKS

33 116 86

ETCGFVDERGLYKSL

64 120 138

TCGFVDERGLYKSLK

47 120 125

CGFVDERGLYKSLKG

72 115 120

GFVDERGLYKSLKGA

84 120 129

FVDERGLYKSLKGAC

86 121 124

VDERGLYKSLKGACK

50 108 110

DERGLYKSLKGACKL

90 119 54

ERGLYKSLKGACKLK

90 118 106

RGLYKSLKGACKLKL

90 121 121

GLYKSLKGACKLKLC

94 129 92

LYKSLKGACKLKLCG

93 136 141

YKSLKGACKLKLCGV

80 112 110

KSLKGACKLKLCGVL

129 113 110

SLKGACKLKLCGVLG

200 111 124

LKGACKLKLCGVLGL

340 90 23

KGACKLKLCGVLGLR

181 111 100

GACKLKLCGVLGLRL

123 134 129

ACKLKLCGVLGLRLM

148 117 142

CKLKLCGVLGLRLMD

410 111 147

KLKLCGVLGLRLMDG

273 120 114

LKLCGVLGLRLMDGT

918 145 148

KLCGVLGLRLMDGTW

3152 132 86

LCGVLGLRLMDGTWV

83 138 129

CGVLGLRLMDGTWVA

99 117 104

GVLGLRLMDGTWVAM

89 148 117

VLGLRLMDGTWVAMQ

90 141 127

LGLRLMDGTWVAMQT

102 115 97

GLRLMDGTWVAMQTS

104 138 120

LRLMDGTWVAMQTSN

103 114 118

RLMDGTWVAMQTSNE

100 113 130

LMDGTWVAMQTSNET

96 106 106

MDGTWVAMQTSNETK

97 97 110

DGTWVAMQTSNETKW

69 114 92

GTWVAMQTSNETKWC

58 113 82

TWVAMQTSNETKWCP

78 118 107

WVAMQTSNETKWCPP

50 114 116

VAMQTSNETKWCPPD

86 104 151

AMQTSNETKWCPPDQ

104 114 128

MQTSNETKWCPPDQL

104 132 125

QTSNETKWCPPDQLV

92 120 155

TSNETKWCPPDQLVN

97 111 90

SNETKWCPPDQLVNL

99 129 110

NETKWCPPDQLVNLH

90 128 107

ETKWCPPDQLVNLHD

105 120 118

TKWCPPDQLVNLHDF

85 125 125

KWCPPDQLVNLHDFR

89 113 121

WCPPDQLVNLHDFRS

101 119 99

CPPDQLVNLHDFRSD

93 137 127

PPDQLVNLHDFRSDE

107 120 56

PDQLVNLHDFRSDEI

35 106 63

DQLVNLHDFRSDEIE

54 117 97

QLVNLHDFRSDEIEH

60 113 106

LVNLHDFRSDEIEHL

47 104 100

VNLHDFRSDEIEHLV

83 129 98

NLHDFRSDEIEHLVV

83 113 110

LHDFRSDEIEHLVVE

93 115 121

HDFRSDEIEHLVVEE

69 107 150

DFRSDEIEHLVVEEL

99 103 110

FRSDEIEHLVVEELV

86 114 116

RSDEIEHLVVEELVR

100 138 104

SDEIEHLVVEELVRK

101 117 118

DEIEHLVVEELVRKR

94 123 143

EIEHLWEELVRKRE

82 113 121

IEHLVVEELVRKREE

90 129 118

EHLVVEELVRKREEC

82 114 106

HLVVEELVRKREECL

82 123 46

LVVEELVRKREECLD

64 100 79

VVEELVRKREECLDA

62 108 97

VEELVRKREECLDAL

58 111 101

EELVRKREECLDALE

69 112 123

ELVRKREECLDALES

82 113 117

LVRKREECLDALESI

86 130 124

VRKREECLDALESIM

58 181 151

RKREECLDALESIMT

73 110 137

KREECLDALESIMTT

102 113 97

REECLDALESIMTTK

94 110 106

EECLDALESIMTTKS

82 120 133

ECLDALESIMTTKSV

91 112 125

CLDALESIMTTKSVS

101 146 155

LDALESIMTTKSVSF

97 116 152

DALESIMTTKSVSFR

104 120 188

ALESIMTTKSVSFRR

97 132 137

LESIMTTKSVSFRRL

48 114 130

ESIMTTKSVSFRRLS

62 111 114

SIMTTKSVSFRRLSH

54 130 97

IMTTKSVSFRRLSHL

43 101 111

MTTKSVSFRRLSHLR

59 116 125

TTKSVSFRRLSHLRK

66 118 111

TKSVSFRRLSHLRKL

83 125 123

KSVSFRRLSHLRKLV

108 124 129

SVSFRRLSHLRKLVP

64 123 117

VSFRRLSHLRKLVPG

90 111 105

SFRRLSHLRKLVPGF

92 110 96

FRRLSHLRKLVPGFG

90 108 111

RRLSHLRKLVPGFGK

92 143 118

RLSHLRKLVPGFGKA

93 123 148

LSHLRKLVPGFGKAY

96 139 150

SHLRKLVPGFGKAYT

113 132 132

HLRKLVPGFGKAYTI

99 111 102

LRKLVPGFGKAYTIF

83 118 82

RKLVPGFGKAYTIFN

47 115 86

KLVPGFGKAYTIFNK

47 114 123

LVPGFGKAYTIFNKT

54 112 139

VPGFGKAYTIFNKTL

58 114 138

PGFGKAYTIFNKTLM

78 113 157

GFGKAYTIFNKTLME

78 123 320

FGKAYTIFNKTLMEA

90 151 356

GKAYTIFNKTLMEAD

76 127 418

KAYT1FNKTLMEADA

101 123 554

AYTIFNKTLMEADAH

86 121 197

YTIFNKTLMEADAHY

104 147 161

TIFNKTLMEADAHYK

107 123 1405

IFNKTLMEADAHYKS

100 118 1828

FNKTLMEADAHYKSV

111 141 2736

NKTLMEADAHYKSVR

104 116 141

KTLMEADAHYKSVRT

91 98 123

TLMEADAHYKSVRTW

100 114 90

LMEADAHYKSVRTWN

73 107 97

MEADAHYKSVRTWNE

62 129 83

EADAHYKSVRTWNEI

58 97 106

ADAHYKSVRTWNEIL

56 100 100

DAHYKSVRTWNEILP

59 121 112

AHYKSVRTWNEILPS

112 160 125

HYKSVRTWNEILPSK

80 130 123

YKSVRTWNEILPSKG

66 137 116

KSVRTWNEILPSKGC

115 125 114

SVRTWNEILPSKGCL

106 138 118

VRTWNEILPSKGCLR

90 124 133

RTWNEILPSKGCLRV

120 127 120

TWNEILPSKGCLRVG

97 146 127

WNEILPSKGCLRVGG

102 136 117

NEILPSKGCLRVGGR

104 130 163

EILPSKGCLRVGGRC

104 112 128

ILPSKGCLRVGGRCH

79 113 107

LPSKGCLRVGGRCHP

77 119 100

PSKGCLRVGGRCHPH

69 138 91

SKGCLRVGGRCHPHV

72 121 103

KGCLRVGGRCHPHVN

68 130 115

GCLRVGGRCHPHVNG

85 125 123

CLRVGGRCHPHVNGV

102 132 134

LRVGGRCHPHVNGVF

104 143 133

RVGGRCHPHVNGVFF

86 143 99

VGGRCHPHVNGVFFN

120 136 120

GGRCHPHVNGVFFNG

86 119 119

GRCHPHVNGVFFNGI

117 113 117

RCHPHVNGVFFNGII

98 141 143

CHPHVNGVFFNGIIL

97 150 151

HPHVNGVFFNGIILG

104 138 164

PHVNGVFFNGIILGP

93 173 146

HVNGVFFNGIILGPD

97 123 114

VNGVFFNGIILGPDG

68 116 85

NGVFFNGIILGPDGN

66 117 97

GVFFNGIILGPDGNV

58 116 100

VFFNGIILGPDGNVL

55 132 108

FFNGIILGPDGNVLI

92 143 105

FNGIILGPDGNVLIP

61 139 130

NGIILGPDGNVLIPE

102 146 141

GIILGPDGNVLIPEM

107 132 123

IILGPDGNVLIPEMQ

85 118 93

ILGPDGNVLIPEMQS

125 134 119

LGPDGNVLIPEMQSS

100 134 150

GPDGNVLIPEMQSSL

86 154 157

PDGNVLIPEMQSSLL

87 129 139

DGNVLIPEMQSSLLQ

123 134 169

GNVLIPEMQSSLLQQ

96 120 168

NVLIPEMQSSLLQQH

72 120 150

VLIPEMQSSLLQQHM

92 104 142

LIPEMQSSLLQQHME

89 111 85

IPEMQSSLLQQHMEL

89 128 129

PEMQSSLLQQHMELL

62 133 93

EMQSSLLQQHMELLE

58 129 142

MQSSLLQQHMELLES

65 113 117

QSSLLQQHMELLESS

82 114 132

SSLLQQHMELLESSV

90 128 132

SLLQQHMELLESSVI

124 163 133

LLQQHMELLESSVIP

78 111 121

LQQHMELLESSVIPL

106 134 128

QQHMELLESSVIPLV

103 134 133

QHMELLESSVIPLVH

98 146 139

HMELLESSVIPLVHP

110 129 134

MELLESSVIPLVHPL

90 125 152

ELLESSVIPLVHPLA

90 133 155

LLESSVIPLVHPLAD

72 117 118

LESSVIPLVHPLADP

90 128 128

ESSVIPLVHPLADPS

104 138 143

SSVIPLVHPLADPST

73 104 93

SVIPLVHPLADPSTV

72 137 107

VIPLVHPLADPSTVF

69 141 123

IPLVHPLADPSTVFK

96 156 188

PLVHPLADPSTVFKD

93 112 138

LVHPLADPSTVFKDG

164 174 188

VHPLADPSTVFKDGD

98 138 125

HPLADPSTVFKDGDE

74 141 117

PLADPSTVFKDGDEA

99 125 90

LADPSTVFKDGDEAE

68 116 113

ADPSTVFKDGDEAED

147 152 110

DPSTVFKDGDEAEDF

98 147 137

PSTVFKDGDEAEDFV

104 143 141

STVFKDGDEAEDFVE

104 120 125

TVFKDGDEAEDFVEV

107 124 96

VFKDGDEAEDFVEVH

100 106 93

FKDGDEAEDFVEVHL

65 76 119

KDGDEAEDFVEVHLP

72 93 76

DGDEAEDFVEVHLPD

85 123 91

GDEAEDFVEVHLPDV

46 124 113

DEAEDFVEVHLPDVH

68 136 123

EAEDFVEVHLPDVHN

76 117 114

AEDFVEVHLPDVHNQ

123 138 123

EDFVEVHLPDVHNQV

90 141 123

DFVEVHLPDVHNQVS

96 141 118

FVEVHLPDVHNQVSG

92 143 102

VEVHLPDVHNQVSGV

106 141 123

EVHLPDVHNQVSGVD

91 150 139

VHLPDVHNQVSGVDL

110 114 137

HLPDVHNQVSGVDLG

104 150 129

LPDVHNQVSGVDLGL

104 154 154

PDVHNQVSGVDLGLP

106 129 115

DVHNQVSGVDLGLPN

117 133 113

VHNQVSGVDLGLPNW

100 119 38

HNQVSGVDLGLPNWG

76 106 38

NQVSGVDLGLPNWGK

78 138 98

Average

91.9 119.5 130.9

FROM

157.9 37.6 169.8

Table 15: Neutralizing powers of rabies virus anti-protein G IgG.

IgG Name

IU / mg

CR04-001

89

CR04-004

5

CR04-008

1176

CR04-010

3000

CR04-018

1604

CR04-021

1500

CR04-026

<2

CR04-031

272

CR04-038

2330

CR04-040

3041

CR04-060

89

CR04-073

6116

CR04-097

<1

CR04-098

7317

CR04-103

3303

CR04-104

4871

CR04-108

4871

CR04-120

4938

CR04-125

4718

CR04-126

2655

CR04-140

478

CR04-144

6250

CR04-146

ND

CR04-164

4724

CR57

3800

CRJB

605

ND = not determined
Table 16: Neutralizing powers of anti-protein G IgG of rabies virus against E57 escape virus.

Name

E57A2 E57A3 E57B1 E57B2 E57B3 E57C3

from IgG

(IU / mg) (IU / mg) (IU / mg) (IU / mg) (IU / mg) (IU / mg)

CR04-008

0 * 0 0 0 0 0

CR04-010

8127 1355 5418 1355 2709 4064

CR04-018

1604 0 1604 0 59 535

CR04-021

450 2 150 8 50 50

CR04-038

9437 1573 9437 1049 6291 1573

CR04-040

8209 2736 24628 1368 5473 912

CR04-073

8256 1835 11008 1835 3669 1835

CR04-098

9878 3293 9878 3293 3293 3293

CR04-103

8917 2972 17835 2972 5945 2972

CR04-104

3288 2192 6576 2192 4384 1096

CR04-108

3288 731 4384 731 2192 731

CR04-120

1111 14 741 82 247 41

CR04-125

708 39 236 79 157 79

CR04-126

88 0 18 0 18 0

CR04-144

5625 2813 11250 2813 5625 1875

CR04-164

4252 472 4252 472 945 709

* 0 indicates absence of 50% titration criteria at a 1: 100 dilution of the antibody
Table 17. Neutralizing power of CR-57 against E98 escape virus.

E98-2 (IU / mg)

E98-4 (IU / mg) E98-5 (IU / mg) E98-6 (IU / mg) E98-7 (IU / mg)

CR-57

2813 8438 4219 2813 8438

CR04-098

0 * 0 0 0 0

* Zero indicates absence of 50% titration criteria at a 1: 1000 dilution of the antibody.
Table 18: Appearance of amino acid residues in the minimum binding region of CR57 within 10 genotype 1 rabies virus.

Natural type

KLCGVL

K (99.6%) *

L (100%) C (100%) G (98.7%) V (99.6%) L (70.7%)

R (0.4%)

E (0.9%) I (0.4%) P (26.7%)

R (0.4%)

S (2.6%)

* The percentage of occurrence of each amino acid is shown within 229 rabies virus isolates.
BIBLIOGRAPHY
Ameyama S, Toriumi H, Takahashi T, Shimura Y, Nakahara T, Honda Y, Mifune K, Uchiyama T and Kawai A (2003), Monoclonal antibody # 3-9-16 recognizes one of the two isoforms of rabies virus matrix protein that exposes its Nterminus on the virion surface. Microbiol Immunol 47: 639-651.
Badrane H and Tordo N (2001), Host switching in Lyssavirus history from the Chiroptera to the Carnivora orders. J. Virol. 75: 8096-8104.
Benmansour A, Leblois H, Coulon P, Tuffereau C, Gaudin Y, Flamand A, and Lafay F (1991), Antigenicity of rabies virus glycoprotein. J. Virol. 65: 4198-4203.
Bunschoten H, Gore M, Claassen IJ, Uytdehaag FG, Dietzschold B, Wunner WH, and Osterhaus AD (1989), Characterization of anewvirus-neutralizing epitope that denotes a sequential determinant on the rabies virus glycoprotein. J. Gen. Virol. 70 (Pt 2): 291-8.
Champion JM, Kean RB, Rupprecht CE, Notkins AL, Koprowski H, Dietzschold B, and Hooper DC (2000), The development of monoclonal human rabies virus-neutralizing antibodies as a substitute for pooled human immune globulin in the prophylactic treatment of rabies virus exposure. J. Immunol. Methods 235: 81-90.
Chou TC and Talalay P (1984), Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv. Enzyme Regul. 22: 27-55.
Coulon P, Ternaux JP, Flamand A, and Tuffereau C (1998), An avirulent mutant of rabies virus is unable to infect motoneurons in vivo and in vitro. J. Virol. 72: 273-278.
From Kruif J, Terstappen L, Boel E and Logtenberg T (1995a), Rapid selection of cell subpopulation-specific human monoclonal antibodies from a synthetic phage antibody library. Proc. Natl Acad. Sci. USA 92: 3938.
From Kruif J, Boel E and Logtenberg T (1995b), Selection and application of human single-chain Fv antibody fragments from a semi-synthetic phage antibody display library with designed CDR3 regions. J. Mol. Biol. 248: 97-105.
Dietzschold B, Wunner WH, Wiktor TJ, Lopes AD, Lafon M, Smith CL, and Koprowski H (1983), Characterization of an antigenic determinant of the glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl Acad. Sci. USA 80: 70-74. Dietzschold B, Gore M, Casali P, Ueki Y, Rupprecht CE, Notkins AL, and Koprowski H (1990), Biological characterization of human monoclonal antibodies to rabies virus. J. Virol. 64: 3087-3090.
Hanlon CA, DeMattos CA, DeMattos CC, Niezgoda M, Hooper DC, Koprowski H, Notkins A, and Rupprecht CE (2001), Experimental utility of rabies virus neutralizing human monoclonal antibodies in post-exposure prophylaxis. Vaccine 19: 3834-3842.
Jones D, Kroos N, Anema R, van Montfort B, Vooys A, van der Kraats S, van der Helm E, Smits S, Schouten J, Brouwer K, Lagerwerf F, van Berkel P, Opstelten DJ, Logtenberg T and Bout A (2003), High-level expression of recombinant IgG in the human cell line PER.C6. Biotechnol Prog. 19: 163-168.
Lafon M, Wiktor TJ, and Macfarlan RI (1983), Antigenic sites on the CVS rabies virus glycoprotein: analysis with monoclonal antibodies. J. Gen. Virol. 64 (Pt 4): 843-851.
Luo TR, Minamoto N, Ito H, Goto H, Hiraga S, Ito N, Sugiyama M, and Kinjo T (1997), A virus-neutralizing epitope on the glycoprotein of rabies virus that contains Trp251 is a linear epitope. Virus Res. 51: 35-41.
Madhusudana SN, Shamsundar R and Seetharaman S (2004), In vitro inactivation of the rabies virus by ascorbic acid. Int. J. Infect. Dis. 8: 21-25.
Ni Y, Tominaga Y, Honda Y, Morimoto K, Sakamoto S, and Kawai A (1995), Mapping and characterization of a sequential epitope on the rabies virus glycoprotein which is recognized by a neutralizing monoclonal antibody, RG719. Microbiol Immunol 39: 693-702.
Prehaud C, Coulon P, LaFay F, Thiers C, and Flamand A (1988), Antigenic site II of the rabies virus glycoprotein: structure and role in viral virulence. J. Virol. 62: 1-7.
Schumacher CL, Dietzschold B, Ertl HC, Niu HS, Rupprecht CE, and Koprowski H (1989), Use of mouse monoclonal anti-rabies antibodies in postexposure treatment of rabies. J. Clin. Invest. 84: 971-975.
Seif I, Coulon P, Rollin E, and Flamand A (1985) Rabies virulence: effect on pathogenicicty and sequence characterization of rabies virus mutations affecting antigenic site III of the glycoprotein. J. Virol. 53: 926-934.
Slootstra JW, Puijk WC, Ligtvoet GJ, Langeveld JP, Meloen RH 1996. Structural aspects of antibody-antigen interaction revealed through small random peptide libraries. Mol. Divers 1: 87-96.
Tordo N (1996), Characteristics and molecular biology of rabies virus. In Meslin FX, Kaplan MM, Koprowski H, editors. Laboratory Techniques in rabies, 4th edition Geneva, Switzerland: World Health Organization.
White LA and Chappell WA (1982), Inactivation of rabies virus in reagents used for the fluorescent rabies antibody test. J. Clin. Microbiol 16: 253-256.
SEQUENCE LIST
<110> Crucell Holland BV Bakker, Alexander BH Marissen, Willem E. Kramer, Robert A. De Kruif, Cornelis A.
<120> Human binding molecules that can neutralize the rabies virus and their uses
<130> 0110 WO 00 ORD
<160> 337
<170> Patent In version 3.1
<210> 1
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-001
<400> 1 image 1
<210> 2
<211> 11
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-004
<400> 2 image 1
<210> 3
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-008
<400> 3 <210> 4 image 1
<211> 14
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-010
<400> 4 image 1
<210> 5
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-018
<400> 5 image 1
<210> 6
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-021
<400> 6 image 1
<210> 7
<211> 12
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-026
<400> 7 image 1
<210> 8
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-031
<400> 8 image 1
<210> 9
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-038
<400> 9 image 1
<210> 10
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-040
<400> 10 image 1
<210> 11
<211> 20
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-060
<400> 11 image 1
<210> 12
<211> 14
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-073
<400> 12 image 1
<210> 13
<211> 12
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-097
<400> 13 image 1
<210> 14
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-098
<400> 14 image 1
<210> 15
<211> 10
<212> PRT <213> Artificial sequence
<220>
<223> CDR3 of SC04-103
<400> 15 image 1
<210> 16
<211> 12
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-104
<400> 16 image 1
<210> 17
<211> 11
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-108
<400> 17 image 1
<210> 18
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-120
<400> 18 image 1
<210> 19
<211> 10
<212> PRT <213> Artificial sequence
<220>
<223> CDR3 of SC04-125
<400> 19 image 1
<210> 20
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-126
<400> 20 image 1
<210> 21
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-140
<400> 21 image 1
<210> 22
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-144
<400> 22 image 1
<210> 23
<211> 9
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-146
<400> 23 image 1
<210> 24
<211> 10
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SC04-164
<400> 24 image 1
<210> 25
<211> 18
<212> PRT
<213> Artificial sequence
<220>
<223> CDR3 of SO57
<400> 25 image 1
<210> 26
<211> 117
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-001 heavy chain variable region
<400> 26 <210> 27 image 1
<211> 118
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-004 heavy chain variable region
<400> 27 <210> 28 image 1 image 1
<211> 120
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-008 heavy chain variable region
<400> 28 image 1
<210> 29
<211> 123
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-010 heavy chain variable region
<400> 29 <210> 30 image 1
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-018 heavy chain variable region
<400> 30 <210> 31 image 1
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-021 heavy chain variable region
<400> 31 <210> 32 image 1 image 1
<211> 121
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-026 heavy chain variable region
<400> 32 image 1
<210> 33
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-031 heavy chain variable region
<400> 33 image 1
<210> 34
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-038 heavy chain variable region
<400> 34 <210> 35 image 1
<211> 118
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-040 heavy chain variable region
<400> 35 <210> 36 image 1 image 1
<211> 128
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-060 heavy chain variable region
<400> 36 image 1
<210> 37 <211> 123
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-073 heavy chain variable region
<400> 37 image 1
<210> 38
<211> 121
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-097 heavy chain variable region
<400> 38 <210> 39 image 1
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-098 heavy chain variable region
<400> 39 <210> 40 image 1 image 1
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-103 heavy chain variable region
<400> 40 image 1
<210> 41 <211> 121
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-104 heavy chain variable region
<400> 41 image 1
<210> 42
<211> 120
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-108 heavy chain variable region
<400> 42 <210> 43 image 1
<211> 118
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-120 heavy chain variable region
<400> 43 image 1
<210> 44 <211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-125 heavy chain variable region
<400> 44 image 1
<210> 45
<211> 120
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-126 heavy chain variable region
<400> 45 <210> 46 image 1
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-140 heavy chain variable region
<400> 46 <210> 47 image 1
<211> 118
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-144 heavy chain variable region
<400> 47 image 1
<210> 48
<211> 118
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-146 heavy chain variable region
<400> 48 image 1
<210> 49
<211> 119
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-164 heavy chain variable region
<400> 49 <210> 50 image 1
<211> 108
<212> PRT
<213> Artificial sequence
<223> SC04-001 light chain variable region
<400> 50 <210> 51 image 1
<211> 103
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-004 light chain variable region
<400> 51 image 1
<210> 52
<211> 109
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-008 light chain variable region
<400> 52 <210> 53 image 1
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-010 light chain variable region
<400> 53 <210> 54 image 1
<211> 110
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-018 Light Chain Variable Region <400> 54 image 1
<210> 55
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-021 light chain variable region
<400> 55 <210> 56 image 1 image 1
<211> 112
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-026 light chain variable region
<400> 56 image 1
<210> 57
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-031 light chain variable region
<400> 57 <210> 58 image 1
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-038 light chain variable region
<400> 58 <210> 59 image 1 image 1
<211> 108
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-040 light chain variable region
<400> 59 image 1
<210> 60
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-060 light chain variable region
<400> 60 image 1
<210> 61
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-073 Light Chain Variable Region
<400> 61 <210> 62 image 1 image 1
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-097 Light Chain Variable Region
<400> 62 image 1
<210> 63
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-098 Light Chain Variable Region
<400> 63 image 1
<210> 64
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-103 light chain variable region
<400> 64 image 1
<210> 65
<211> 109 '
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-104 light chain variable region
<400> 65 image 1 image 1
<210> 66
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-108 light chain variable region
<400> 66 image 1
<210> 67
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-120 light chain variable region
<400> 67 <210> 68 image 1
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-125 light chain variable region
<400> 68 <210> 69 image 1 image 1
<211> 109
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-126 light chain variable region
<400> 69 image 1
<210> 70
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-140 light chain variable region
<400> 70 image 1
<210> 71
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-144 light chain variable region
<400> 71 <210> 72 image 1 image 1
<211> 107
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-146 light chain variable region
<400> 72 image 1
<210> 73
<211> 107 <212> PRT
<213> Artificial sequence
<220>
<223> SC04-164 light chain variable region
<400> 73 image 1
<210> 74
<211> 351
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-001 heavy chain variable region
<400> 74 image 1
<210> 75
<211> 354
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-004 heavy chain variable region
<400> 75 image 1
<210> 76
<211> 360
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-008 heavy chain variable region
<400> 76 image 1
<210> 77
<211> 369
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-010 heavy chain variable region
<400> 77 <210> 78 image 1
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-018 heavy chain variable region
<400> 78 image 1
<210> 79
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-021 heavy chain variable region
<400> 79 image 1
<210> 80 <211> 363
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-026 heavy chain variable region
<400> 80 image 1
<210> 81
<211> 357
<212> DNA
<213> Artificial sequence

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de E57A3

<400> 131

atacaacatc tc

12

<210> 132

<211> 18

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de CVS-11

<400> 132

ctcaagttat gtggagtt

18

<210> 133

<211> 18

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de E57A2

<400> 133

ctcaagttat gtgaagtt

18

<210> 134

<211> 18

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de E57A3, E57B1 y E57B3

<400> 134

ctcgagttat gtggagtt

18

<210> 135

<211> 18

<213> Virus de la rabia
<220>
<221> misc_feature
<223> Parte de la glicoproteína de E57B2 y E57C3
<400> 135 ctcaatttat gtggagtt
<210> 136
<211> 16
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de CVS-11, E57A2, E57B1, E57B2, E57B3 y E57C3
<400> 136 imagen1
<210> 137
<211> 16
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de E57A3
<400> 137 imagen1
<210> 138
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de CVS-11
<400> 138 <210> 139 imagen1
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de E57A2
<400> 139 imagen1
<210> 140
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de E57A3, E57B1 y E57B3
<400> 140 imagen1
<210> 141
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de E57B2 y E57C3
<400> 141 imagen1

<210> 142

<211> 15

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de CVS-11

<400> 142

cccgagaatc cgaga

15

<210> 143

<211> 15

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de EJB2B, EJB2C, EJB2D, EJB2E, EJB2F y EJB3F

<400> 143

cccgaggatc cgaga

15

<210> 144

<211> 15

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de CVS-11

<400> 144

tgtggagttc ttgga

15

<210> 145

<211> 15

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de EJB2B, EJB2C y EJB2F

<400> 145

tgtgaagttc ctgga

15

<210> 146

<211> 15

<212> ADN

<213> Virus de la rabia

<220>

<221> misc_feature

<223> Parte de la glicoproteína de EJB2D, EJB2E y EJB3F

<400> 146

tgtggagttc ctgga

15

<210> 147

<211> 13

<212> PRT

<213> Virus de la rabia

<220>

<221> MISC_FEATURE

<223> Parte de la glicoproteína de CVS-11

<400> 147

imagen1
<210> 148
<211> 13
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de EJB2B, EJB2C, EJB2D, EJB2E, EJB2F y EJB3F
<400> 148 imagen1
<210> 149
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de CVS-11
<400> 149 imagen1
<210> 150
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de EJB2B, EJB2C y EJB2F
<400> 150 imagen1
<210> 151
<211> 23
<212> PRT
<213> Virus de la rabia
<220>
<221> MISC_FEATURE
<223> Parte de la glicoproteína de EJB2D, EJB2E y EJB3F
<400> 151 imagen1
<210> 152
<211> 24
<212> ADN
<213> Secuencia artificial

<220>

<223> Cebador antisentido HuCkappa

<400> 152

acactctccc ctgttgaagc tctt

24

<210> 153

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador antisentido HuClambda2

<400> 153

tgaacattct gtaggggcca ctg

23

<210> 154

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador antisentido HuClambda7

<400> 154

agagcattct gcaggggcca ctg

23

<210> 155

<211> 4941

<212> ADN

<213> Secuencia artificial

<220>

<223> Vector PDV-C06

<400> 155

imagen1 imagen1 imagen1 imagen1
<210> 156
<211> 24
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador antisentido HuCIgG
<400> 156 gtccaccttg gtgttgctgg gctt
<210> 157
<211> 741
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-001
<220>
<221> CDS
<222> (1)..(741)
<223>
<400> 157 imagen1 imagen1
<210> 158
<211> 247
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-001
<400> 158 <210> 159 imagen1
<211> 741
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-004
<220>
<221> CDS
<222> (1)..(741)
<223>
<400> 159 <210> 160 imagen1 imagen1
<211> 247
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-004
<400> 160 <210> 161 imagen1 imagen1
<211> 756
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-008
<220>
<221> CDS
<222> (1) .. (756)
<223>
<400> 161 <210> 162 imagen1 imagen1
<211> 252
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-008
<400> 162 <210> 163 imagen1 imagen1
<211> 759
<212> ADN.
<213> Secuencia artificial
<220>
<223> SC04-010
<220>
<221> CDS
<222> (1) .. (759)
<223>
<400> 163 <210> 164 imagen1 imagen1
<211> 253
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-010
<400> 164 imagen1
<210> 165
<211> 756
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-018
<220>
<221> CDS
<222> (1)..(756)
<223>
<400> 165 <210> 166 imagen1 imagen1
<211> 252
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-018
<400> 166 <210> 167 imagen1 imagen1
<211> 747
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-021
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 167 <210> 168 imagen1 imagen1
<211> 249
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-021
<400> 168 <210> 169 imagen1 imagen1
<211> 768
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-026
<220>
<221> CDS
<222> (1) .. (768)
<223>
<400> 169 <210> 170 imagen1
<211> 256
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-026
<400> 170 <210> 171 imagen1 imagen1
<211> 747
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-031
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 171 <210> 172 imagen1 imagen1
<211> 249
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-031
<400> 172 <210> 173 imagen1
<211> 747
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-038
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 173 <210> 174 imagen1 imagen1
<211> 249
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-038
<400> 174 <210> 175 imagen1 imagen1
<211> 747
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-040
<220>
<221> CDS
<222> (1)..(747)
<223>
<400> 175 <210> 176 imagen1
<211> 249
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-040
<400> 176 <210> 177 imagen1 imagen1
<211> 774
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-060
<220>
<221> CDS
<222> (1) .. (774)
<223>
<400> 177 <210> 178 imagen1 imagen1
<211> 258
<212> PRT
<213> Secuencia artificial
<220>
<223> SC04-060
<400> 178 imagen1 imagen1
<210> 179
<211> 759
<212> ADN
<213> Secuencia artificial
<220>
<223> SC04-073
<220>
<221> CDS
<222> (1)..(759)
<223>
<400> 179 <210> 180 imagen1
<220>
<223> SC04-031 heavy chain variable region
<400> 81 image 1
<210> 82
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-038 heavy chain variable region
<400> 82 <210> 83 image 1
<211> 354
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-040 heavy chain variable region
<400> 83 image 1
<210> 84
<211> 384
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-060 heavy chain variable region
<400> 84 image 1
<210> 85
<211> 369 <212> DNA
<213> Artificial sequence
<220>
<223> SC04-073 heavy chain variable region
<400> 85 image 1
<210> 86
<211> 369
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-097 heavy chain variable region
<400> 86 image 1
<210> 87
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-098 heavy chain variable region
<400> 87 <210> 88 image 1 image 1
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-103 heavy chain variable region
<400> 88 image 1
<210> 89
<211> 363
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-104 heavy chain variable region
<400> 89 image 1
<210> 90 <211> 360
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-108 heavy chain variable region
<400> 90 image 1
<210> 91
<211> 354
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-120 heavy chain variable region
<400> 91 image 1
<210> 92
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-125 heavy chain variable region
<400> 92 <210> 93 image 1
<211> 360
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-126 heavy chain variable region
<400> 93 image 1
<210> 94
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-140 heavy chain variable region
<400> 94 image 1
<210> 95
<211> 354
<212> DNA <213> Artificial sequence
<220>
<223> SC04-144 heavy chain variable region
<400> 95 image 1
<210> 96
<211> 354
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-146 heavy chain variable region
<400> 96 image 1
<210> 97
<211> 357
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-164 heavy chain variable region
<400> 97 <210> 98 image 1
<211> 324
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-001 light chain variable region
<400> 98 image 1
<210> 99
<211> 309
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-004 light chain variable region
<400> 99 image 1
<210> 100
<211> 327 <212> DNA
<213> Artificial sequence
<220>
<223> SC04-008 light chain variable region
<400> 100 image 1
<210> 101
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-010 light chain variable region
<400> 101 image 1
<210> 102
<211> 330
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-018 Light Chain Variable Region
<400> 102 <210> 103 image 1
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-021 light chain variable region
<400> 103 image 1
<210> 104
<211> 336
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-026 light chain variable region
<400> 104 image 1
<210> 105
<211> 321
<212> DNA <213> Artificial sequence
<220>
<223> SC04-031 light chain variable region
<400> 105 image 1
<210> 106
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-038 light chain variable region
<400> 106 image 1
<210> 107
<211> 324
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-040 light chain variable region
<400> 107 <210> 108 image 1 image 1
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-060 light chain variable region
<400> 108 image 1
<210> 109
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-073 Light Chain Variable Region
<400> 109 image 1
<210> 110
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-097 Light Chain Variable Region
<400> 110 image 1
<210> 111
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-098 Light Chain Variable Region
<400> 111 image 1
<210> 112
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-103 light chain variable region
<400> 112 image 1
<210> 113
<211> 327 <212> DNA
<213> Artificial sequence
<220>
<223> SC04-104 light chain variable region
<400> 113 image 1
<210> 114
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-108 light chain variable region
<400> 114 image 1
<210> 115
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-120 light chain variable region
<400> 115 <210> 116 image 1
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-125 light chain variable region
<400> 116 image 1
<210> 117
<211> 327
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-126 light chain variable region
<400> 117 image 1
<210> 118
<211> 321 <212> DNA
<213> Artificial sequence
<220>
<223> SC04-140 light chain variable region
<400> 118 image 1
<210> 119
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-144 light chain variable region
<400> 119 image 1
<210> 120
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-146 light chain variable region
<400> 120 <210> 121 image 1
<211> 321
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-164 light chain variable region
<400> 121 image 1
<210> 122
<211> 2107
<212> DNA
<213> Artificial sequence
<220>
<223> CR57 heavy chain
<220>
<221> Intron
<222> (382) .. (508)
<223>
<220>
<221> Intron
<222> (803) .. (1193)
<223>
<220>
<221> Intron
<222> (1239) .. (1356)
<223>
<220>
<221> Intron
<222> (1687) .. (1783)
<223>
<400> 122 <210> 123 image 1 image 1
<211> 457
<212> PRT
<213> Artificial sequence
<220>
<223> CR57 heavy chain
<400> 123 image 1 image 1 image 1
<210> 124
<211> 859
<212> DNA
<213> Artificial sequence
<220>
<223> CR57 light chain
<220>
<221> Intron
<222> (337) .. (538)
<223>
<400> 124 <210> 125 image 1 image 1
<211> 218
<212> PRT
<213> Artificial sequence
<220>
<223> CR57 light chain
<400> 125 <210> 126 image 1 image 1
<211> 2089
<212> DNA
<213> Artificial sequence
<220>
<223> CRJB heavy chain
<400> 126 <210> 127 image 1 image 1
<211> 452
<212> PRT
<213> Artificial sequence
<220>
<223> CRJB heavy chain
<400> 127 image 1 image 1
<210> 128
<211> 841
<212> DNA
<213> Artificial sequence
<220>
<223> CRJB light chain
<400> 128 image 1
<210> 129
<211> 213
<212> PRT
<213> Artificial sequence
<220>
<223> CRJB light chain
<400> 129 <210> 130 image 1 image 1
<211> 12
<212> DNA
<213> Rabies virus
<220>
<221> misc_feature
<223> Part of the glycoprotein of CVS-11, E57A2, E57B1, E57B2, E57B3 and E57C3
<400> 130 atacaccatc tc
<210> 131
<211> 12 <212> DNA

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the E57A3 glycoprotein

<400> 131

atacaacatc tc

12

<210> 132

<211> 18

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of CVS-11 glycoprotein

<400> 132

ctcaagttat gtggagtt

18

<210> 133

<211> 18

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the E57A2 glycoprotein

<400> 133

ctcaagttat gtgaagtt

18

<210> 134

<211> 18

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the glycoprotein of E57A3, E57B1 and E57B3

<400> 134

ctcgagttat gtggagtt

18

<210> 135

<211> 18

<213> Rabies virus
<220>
<221> misc_feature
<223> Part of the glycoprotein of E57B2 and E57C3
<400> 135 ctcaatttat gtggagtt
<210> 136
<211> 16
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of CVS-11, E57A2, E57B1, E57B2, E57B3 and E57C3
<400> 136 image 1
<210> 137
<211> 16
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the E57A3 glycoprotein
<400> 137 image 1
<210> 138
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of CVS-11 glycoprotein
<400> 138 <210> 139 image 1
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the E57A2 glycoprotein
<400> 139 image 1
<210> 140
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of E57A3, E57B1 and E57B3
<400> 140 image 1
<210> 141
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of E57B2 and E57C3
<400> 141 image 1

<210> 142

<211> 15

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of CVS-11 glycoprotein

<400> 142

cccgagaatc cgaga

fifteen

<210> 143

<211> 15

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the glycoprotein of EJB2B, EJB2C, EJB2D, EJB2E, EJB2F and EJB3F

<400> 143

cccgaggatc cgaga

fifteen

<210> 144

<211> 15

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of CVS-11 glycoprotein

<400> 144

tgtggagttc ttgga

fifteen

<210> 145

<211> 15

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the glycoprotein of EJB2B, EJB2C and EJB2F

<400> 145

tgtgaagttc ctgga

fifteen

<210> 146

<211> 15

<212> DNA

<213> Rabies virus

<220>

<221> misc_feature

<223> Part of the glycoprotein of EJB2D, EJB2E and EJB3F

<400> 146

tgtggagttc ctgga

fifteen

<210> 147

<211> 13

<212> PRT

<213> Rabies virus

<220>

<221> MISC_FEATURE

<223> Part of CVS-11 glycoprotein

<400> 147

image 1
<210> 148
<211> 13
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of EJB2B, EJB2C, EJB2D, EJB2E, EJB2F and EJB3F
<400> 148 image 1
<210> 149
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of CVS-11 glycoprotein
<400> 149 image 1
<210> 150
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of EJB2B, EJB2C and EJB2F
<400> 150 image 1
<210> 151
<211> 23
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Part of the glycoprotein of EJB2D, EJB2E and EJB3F
<400> 151 image 1
<210> 152
<211> 24
<212> DNA
<213> Artificial sequence

<220>

<223> HuCkappa antisense primer

<400> 152

acactctccc ctgttgaagc tctt

24

<210> 153

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuClambda2 antisense primer

<400> 153

tgaacattct gtaggggcca ctg

2. 3

<210> 154

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuClambda7 antisense primer

<400> 154

agagcattct gcaggggcca ctg

2. 3

<210> 155

<211> 4941

<212> DNA

<213> Artificial sequence

<220>

<223> Vector PDV-C06

<400> 155

image 1 image 1 image 1 image 1
<210> 156
<211> 24
<212> DNA
<213> Artificial sequence
<220>
<223> HuCIgG antisense primer
<400> 156 gtccaccttg gtgttgctgg gctt
<210> 157
<211> 741
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-001
<220>
<221> CDS
<222> (1) .. (741)
<223>
<400> 157 image 1 image 1
<210> 158
<211> 247
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-001
<400> 158 <210> 159 image 1
<211> 741
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-004
<220>
<221> CDS
<222> (1) .. (741)
<223>
<400> 159 <210> 160 image 1 image 1
<211> 247
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-004
<400> 160 <210> 161 image 1 image 1
<211> 756
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-008
<220>
<221> CDS
<222> (1) .. (756)
<223>
<400> 161 <210> 162 image 1 image 1
<211> 252
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-008
<400> 162 <210> 163 image 1 image 1
<211> 759
<212> DNA.
<213> Artificial sequence
<220>
<223> SC04-010
<220>
<221> CDS
<222> (1) .. (759)
<223>
<400> 163 <210> 164 image 1 image 1
<211> 253
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-010
<400> 164 image 1
<210> 165
<211> 756
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-018
<220>
<221> CDS
<222> (1) .. (756)
<223>
<400> 165 <210> 166 image 1 image 1
<211> 252
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-018
<400> 166 <210> 167 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-021
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 167 <210> 168 image 1 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-021
<400> 168 <210> 169 image 1 image 1
<211> 768
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-026
<220>
<221> CDS
<222> (1) .. (768)
<223>
<400> 169 <210> 170 image 1
<211> 256
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-026
<400> 170 <210> 171 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-031
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 171 <210> 172 image 1 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-031
<400> 172 <210> 173 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-038
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 173 <210> 174 image 1 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-038
<400> 174 <210> 175 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-040
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 175 <210> 176 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-040
<400> 176 <210> 177 image 1 image 1
<211> 774
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-060
<220>
<221> CDS
<222> (1) .. (774)
<223>
<400> 177 <210> 178 image 1 image 1
<211> 258
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-060
<400> 178 image 1 image 1
<210> 179
<211> 759
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-073
<220>
<221> CDS
<222> (1) .. (759)
<223>
<400> 179 <210> 180 image 1

<210> 208

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda1A

<400> 208

cagtctgtgc tgactcagcc acc

23

<210> 209

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda1B

<400> 209

cagtctgtgy tgacgcagcc gcc

23

<210> 210 <223> Cebador HuVlambda4 <212> ADN

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda1C

<400> 210

cagtctgtcg tgacgcagcc gcc

23

<210> 211

<211> 21

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda2

<400> 211

cartctgccc tgactcagcc t

21

<210> 212

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador BuVlambda3A

<400> 212

tcctatgwgc tgactcagcc acc

23

<210> 213

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda3B

<400> 213

tcttctgagc tgactcagga ccc

23

<210> 214

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<400> 214

cacgttatac tgactcaacc gcc

23

<210> 215

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda5

<400> 215

caggctgtgc tgactcagcc gtc

23

<210> 216

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador RuVlambda6

<400> 216

aattttatgc tgactcagcc cca

23

<210> 217

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda7/8

<400> 217

cagrctgtgg tgacycagga gcc

23

<210> 218

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda9

<400> 218

cwgcctgtgc tgactcagcc mcc

23

<210> 219

<211> 23

<213> Secuencia artificial
<220>
<223> Cebador HuVkappa1B
<400> 219 gacatccagw tgacccagtc tcc 23
<210> 220
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVkappa2
<400> 220 gatgttgtga tgactcagtc tcc 23
<210> 221
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVkappa3
<400> 221 gaaattgtgw tgacrcagtc tcc 23
<210> 222
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVkappa4
<400> 222 gatattgtga tgacccacac tcc 23
<210> 223
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVkappa5
<400> 223

gaaacgacac tcacgcagtc tcc

23

<210> 224

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa6

<400> 224

gaaattgtgc tgactcagtc tcc

23

<210> 225

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa1B-SalI

<400> 225

tgagcacaca ggtcgacgga catccagwtg acccagtctc c

41

<210> 226

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa2-SalI

<400> 226

tgagcacaca ggtcgacgga tgttgtgatg actcagtctc c

41

<210> 227

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa3B-SalI

<400> 227

tgagcacaca ggtcgacgga aattgtgwtg acrcagtctc c

41

<210> 228

<211> 41

<212> ADN

<213> Secuencia artificial

<220> <211> 48 <400> 237 <213> Secuencia artificial <210> 247

<223> Cebador HuVkappa4B-SalI

<400> 228

tgagcacaca ggtcgacgga tattgtgatg acccacactc c

41

<210> 229

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa5-SalI

<400> 229

tgagcacaca ggtcgacgga aacgacactc acgcagtctc c

41

<210> 230

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVkappa6-SalI

<400> 230

tgagcacaca ggtcgacgga aattgtgctg actcagtctc c

41

<210> 231

<211> 48

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJkappa1-NotI

<400> 231

gagtcattct cgacttgcgg ccgcacgttt gatttccacc ttggtccc

48

<210> 232

<211> 48

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJkappa2-NotI

<400> 232

gagtcattct cgacttgcgg ccgcacgttt gatctccagc ttggtccc

48

<210> 233

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJkappa3-NotI

<400> 233

gagtcattct cgacttgcgg ccgcacgttt gatatccact ttggtccc

48

<210> 234

<211> 48

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJkappa4-NotI

<400> 234

gagtcattct cgacttgcgg ccgcacgttt gatctccacc ttggtccc

48

<210> 235

<211> 48

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJkappa5-NotI

<400> 235

gagtcattct cgacttgcgg ccgcacgttt aatctccagt cgtgtccc

48

<210> 236

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda1A-SalI

<400> 236

tgagcacaca ggtcgacgca gtctgtgctg actcagccac c

41

<210> 237

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador BuVlambda1B-SalI

tgagcacaca ggtcgacgca gtctgtgytg acgcagccgc c

41

<210> 238

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda1C-SalI

<400> 238

tgagcacaca ggtcgacgca gtctgtcgtg acgcagccgc c

41

<210> 239

<211> 39

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda2-SalI

<400> 239

tgagcacaca ggtcgacgca rtctgccctg actcagcct

39

<210> 240

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda3A-SalI

<400> 240

tgagcacaca ggtcgacgtc ctatgwgctg actcagccac c

41

<210> 241

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda3B-SalI

<400> 241

tgagcacaca ggtcgacgtc ttctgagctg actcaggacc c

41

<210> 242

<211> 41

<212> ADN

<220>

<223> Cebador HuVlambda4B-SalI

<400> 242

tgagcacaca ggtcgacgca cgttatactg actcaaccgc c

41

<210> 243

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda5B-SalI

<400> 243

tgagcacaca ggtcgacgca ggctgtgctg actcagccgt c

41

<210> 244

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda6-SalI

<400> 244

tgagcacaca ggtcgacgaa ttttatgctg actcagcccc a

41

<210> 245

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda7/8-SalI

<400> 245

tgagcacaca ggtcgacgca grctgtggtg acycaggagc c

41

<210> 246

<211> 41

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVlambda9-SalI

<400> 246

tgagcacaca ggtcgacgcw gcctgtgctg actcagccmc c

41

<211> 48
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuJlambda1-NotI
<400> 247 gagtcattct cgacttgcgg ccgcacctag gacggtgacc ttggtccc 48
<210> 248
<211> 48
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador RuJlambda2/3-NotI
<400> 248 gagtcattct cgacttgcgg ccgcacctag gacggtcagc ttggtccc 48
<210> 249
<211> 48
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuJlambda4/5-NotI
<400> 249 gagtcattct cgacttgcgg ccgcacytaa aacggtgagc tgggtccc 48
<210> 250
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH1B/7A
<400> 250 cagrtgcagc tggtgcartc tgg 23
<210> 251
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH1C <212> ADN

<400> 251

saggtccagc tggtrcagtc tgg

23

<210> 252

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH2B

<400> 252

saggtgcagc tggtggagtc tgg

23

<210> 253

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH3B

<400> 253

saggtgcagc tggtggagtc tgg

23

<210> 254

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH3C

<400> 254

gaggtgcagc tggtggagwc ygg

23

<210> 255

<211> 23

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH4B

<400> 255

caggtgcagc tacagcagtg ggg

23

<210> 256

<211> 23

<213> Secuencia artificial
<220>
<223> Cebador HuVH4C
<400> 256 cagstgcagc tgcaggagtc sgg 23
<210> 257
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH5B
<400> 257 gargtgcagc tggtgcagtc tgg 23
<210> 258
<211> 23
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH6A
<400> 258 caggtacagc tgcagcagtc agg 23
<210> 259
<211> 56
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH1B/7A-SfiI
<400> 259 gtcctcgcaa ctgcggccca gccggccatg gcccagrtgc agctggtgca rtctgg 56
<210> 260
<211> 56
<212> ADN
<213> Secuencia artificial
<220>
<223> Cebador HuVH1C-SfiI
<400> 260

gtcctcgcaa ctgcggccca gccggccatg gccsaggtcc agctggtrca gtctgg

56

<210> 261

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH2B-SfiI

<400> 261

gtcctcgcaa ctgcggccca gccggccatg gcccagrtca ccttgaagga gtctgg

56

<210> 262

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH3B-SfiI

<400> 262

gtcctcgcaa ctgcggccca gccggccatg gccsaggtgc agctggtgga gtctgg

56

<210> 263

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH3C-SfiI

<400> 263

gtcctcgcaa ctgcggccca gccggccatg gccgaggtgc agctggtgga gwcygg

56

<210> 264

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH4B-SfiI

<400> 264

gtcctcgcaa ctgcggccca gccggccatg gcccaggtgc agctacagca gtgggg

56

<210> 265

<211> 56

<212> ADN

<213> Secuencia artificial

<220> <211> 36

<223> Cebador HuVH4C-SfiI

<400> 265

gtcctcgcaa ctgcggccca gccggccatg gcccagstgc agctgcagga gtcsgg

56

<210> 266

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH5B-SfiI

<400> 266

gtcctcgcaa ctgcggccca gccggccatg gccgargtgc agctggtgca gtctgg 56

<210> 267

<211> 56

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuVH6A-SfiI

<400> 267

gtcctcgcaa ctgcggccca gccggccatg gcccaggtac agctgcagca gtcagg

56

<210> 268

<211> 36

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJH1/2-XhoI

<400> 268

gagtcattct cgactcgaga cggtgaccag ggtgcc

36

<210> 269

<211> 36

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJH3-XhoI

<400> 269

gagtcattct cgactcgaga cggtgaccat tgtccc

36

<210> 270

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJH4/5-XhoI

<400> 270

gagtcattct cgactcgaga cggtgaccag ggttcc

36

<210> 271

<211> 36

<212> ADN

<213> Secuencia artificial

<220>

<223> Cebador HuJH6-XhoI

<400> 271

gagtcattct cgactcgaga cggtgaccgt ggtccc

36

<210> 272

<211> 381

<212> ADN

<213> Secuencia artificial

<220>

<223> Región variable de cadena pesada de CR57

<400> 272

imagen1
<210> 273
<211> 127
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena pesada de CR57
<400> 273 <210> 274 imagen1
<211> 336
<212> ADN
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de CR57
<400> 274 imagen1
<210> 275
<211> 112
<212> PRT
<213> Secuencia artificial
<220>
<223> Región variable de cadena ligera de CR57
<400> 275 imagen1
<210> 276
<211> 12
<212> PRT
<213> Secuencia artificial
<220>
<223> CDR3 de CRJB
<400> 276 imagen1
<210> 277
<211> 6778
<212> ADN
<213> Secuencia artificial
<220>
<223> vector pSyn-C03-HCgamma1
<400> 277 imagen1 imagen1 imagen1 imagen1 imagen1
<210> 278
<211> 6283
<212> ADN
<213> Secuencia artificial
<220>
<223> Vector pSyn-C04-Clambda
<400> 278 imagen1 imagen1 imagen1 imagen1 imagen1
<210> 279
<211> 6267
<212> ADN
<213> Secuencia artificial
<220>
<223> Vector pSyn-C05-Ckappa
<400> 279 imagen1 imagen1 imagen1 imagen1
<210> 280
<211> 46
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido 5H-B
<400> 280 acctgtcttg aattctccat ggccgaggtg cagctggtgg agtctg
<210> 281
<211> 47
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido 5H-C
<400> 281

acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgg

47

<210> 282

<211> 49

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5H-C-long

<400> 282

acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgggg

49

<210> 283

<211> 50

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5H-F

<400> 283

acctgtcttg aattctccat ggcccaggtg cagctgcagg agtccggccc

50

<210> 284

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5H-H

<400> 284

acctgtcttg aattctccat ggccgaggtg cagctggtgc agtctgg

47

<210> 285

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5H-I

<400> 285

acctgtcttg aattctccat ggccgaggtg cagctgctgg agtctgg

47

<210> 286

<211> 47

<212> ADN

<213> Secuencia artificial

<220> <211> 47 <400> 295 <213> Secuencia artificial <210> 305

<223> Oligonucleótido 5H-M

<400> 286

acctgtcttg aattctccat ggcccaggtg accttgaagg agtctgg

47

<210> 287

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3H-A

<400> 287

gcccttggtg ctagcgctgg agacggtcac cagggtgccc tggcccc

47

<210> 288

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3H-C

<400> 288

gcccttggtg ctagcgctgg agacggtcac ggtggtgccc tggcccc

47

<210> 289

<211> 54

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3H-C-long

<400> 289

gcccttggtg ctagcgctgg agacggtcac ggtggtgccc ttgccccaga cgtc

54

<210> 290

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3H-D

<400> 290

gcccttggtg ctagcgctgg acacggtcac catggtgccc tggcccc

47

<210> 291

<212> ADN

<213> Secuencia artificial

<220>

<223> oligonucleótido sy3H-E

<400> 291

gcccttggtg ctagcgctgg acacggtcac cagggtgccc cggcccc

47

<210> 292

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 3L-B

<400> 292

ttttccttag cggccgcgac tcacctagga cggtcagctt ggtc

44

<210> 293

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-B

<400> 293

acctgtctcg agttttccat ggctgacatc cagatgaccc agtc

44

<210> 294

<211> 55

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-C

<400> 294

acctgtctcg agttttccat ggctgacatc cagatgaccc agtctccatc ctccc

55

<210> 295

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-G

acctgtctcg agttttccat ggctgacatc gtgatgaccc agtctcc

47

<210> 296

<211> 47

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-K

<400> 296

acctgtctcg agttttccat ggctgccatc cagatgaccc agtctcc

47

<210> 297

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-M

<400> 297

acctgtctcg agttttccat ggctgacatc cagctgaccc agtc

44

<210> 298

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-N

<400> 298

acctgtctcg agttttccat ggctgacatc cagatgactc agtc

44

<210> 299

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5K-O

<400> 299

acctgtctcg agttttccat ggctgccatc cagctgaccc agtc

44

<210> 300

<211> 44

<212> ADN

<220>

<223> Oligonucleótido 5K-Q

<400> 300

acctgtctcg agttttccat ggctgagatc gtgatgactc agtc

44

<210> 301

<211> 45

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5L-E

<400> 301

acctgtctcg agttttccat ggcttcctac gtgctgactc agccg

45

<210> 302

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5L-F

<400> 302

acctgtctcg agttttccat ggctcagtcc gtgctgactc agcc

44

<210> 303

<211> 44

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido 5L-G

<400> 303

acctgtctcg agttttccat ggcttcctac gtgctgactc agcc

44

<210> 304

<211> 42

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3K-F

<400> 304

gctgggggcg gccacggtcc gcttgatctc caccttggtc cc

42

<211> 42
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido sy3K-I
<400> 305 gctgggggcg gccacggtcc gcttgatctc cagccgtgtc cc 42
<210> 306
<211> 42
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido sy3K-J
<400> 306 gctgggggcg gccacggtcc gcttgatctc cagcttggtc cc 42
<210> 307
<211> 42
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido sy3K-K
<400> 307 gctgggggcg gccacggtcc gcttgatgtc caccttggtc cc 42
<210> 308
<211> 43
<212> ADN
<213> Secuencia artificial
<220>
<223> Oligonucleótido sy3L-A
<400> 308 ccagcacggt aagcttcagc acggtcacct tggtgccagt tcc 43
<210> 309
<211> 43
<212> ADN
<213> Secuencia artificial
<220>

<223> Oligonucleótido sy3L-C

<400> 309

ccagcacggt aagcttcagc acggtcagct tggtgcctcc gcc

43

<210> 310

<211> 37

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy3L-D

<400> 310

ccagcacggt aagcttcaac acggtcagct gggtccc

37

<210> 311

<211> 52

<212> ADN

<213> Secuencia artificial

<220>

<223> Oligonucleótido sy5L-A

<400> 311

acctgtctcg agttttccat ggcttcctcc gagctgaccc aggaccctgc tg

52

<210> 312

<211> 756

<212> ADN

<213> Secuencia artificial

<220>

<223> scFv SOJB

<400> 312

imagen1
<210> 313
<211> 252
<212> PRT
<213> Secuencia artificial
<220>
<223> scFv SOJB
<400> 313 <210> 314 imagen1 imagen1
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 314 imagen1
<210> 315
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 315 imagen1
<210> 316
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 316 imagen1
<210> 317
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 317 imagen1
<210> 318
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 318 imagen1
<210> 319
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 319 imagen1
<210> 320
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 320 imagen1
<210> 321
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 321 imagen1
<210> 322
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 322 imagen1
<210> 323
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 323 imagen1
<210> 324
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 324 imagen1
<210> 325
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 325 imagen1
<210> 326
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 326 imagen1
<210> 327
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 327 imagen1
<210> 328
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 328 imagen1
<210> 329
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 329 imagen1
<210> 330
<211> 15
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 330 imagen1
<210> 331
<211> 15
<212> PRT <213> Secuencia artificial
<220>
<223> Péptido
<400> 331 imagen1
<210> 332
<211> 23
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 332 imagen1
<210> 333
<211> 23
<212> PRT
<213> Secuencia artificial
<220>
<223> Péptido
<400> 333 imagen1
<210> 334
<211> 2083
<212> ADN
<213> Secuencia artificial
<220>
<223> Cadena pesada de CR04-098
<220>
<221> Intrón
<222> (358)..(484)
<223>
<220>
<221> Intrón
<222> (779)..(1169)
<223>
<220>
<221> Intrón
<222> (1215)..(1332)
<223>
<220>
<221> Intrón
<222> (1663)..(1759)
<223>
<400> 334 imagen1 imagen1
<210> 335
<211> 449
<212> PRT
<213> Secuencia artificial
<220>
<223> Cadena pesada de CR04-098
<400> 335 imagen1 imagen1 imagen1
<210> 336
<211> 847
<212> ADN
<213> Secuencia artificial
<220>
<223> Cadena ligera de CR04-098
<220>
<221> Intrón
<222> (322)..(526)
<223>
<400> 336 <210> 337 imagen1 imagen1
<211> 213
<212> PRT
<213> Secuencia artificial
<220>
<223> Cadena ligera de CR04-098
<400> 337 imagen1 imagen1 image 1
<211> 253
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-073
<400> 180 <210> 181 image 1 image 1
<211> 753
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-097
<220>
<221> CDS
<222> (1) .. (753)
<223>
<400> 181 <210> 182 image 1 image 1
<211> 251
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-097
<400> 182 <210> 183 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-098
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 183 <210> 184 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-098
<400> 184 <210> 185 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-103
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 185 <210> 186 image 1 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-103
<400> 186 <210> 187 image 1
<211> 759
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-104
<220>
<221> CDS
<222> (1) .. (759)
<223>
<400> 187 <210> 188 image 1 image 1
<211> 253
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-104
<400> 188 <210> 189 image 1 image 1
<211> 750
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-108
<220>
<221> CDS
<222> (1) .. (750)
<223>
<400> 189 image 1
<210> 190 <211> 250
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-108
<400> 190 <210> 191 image 1 image 1
<211> 744
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-120
<220>
<221> CDS
<222> (1) .. (744)
<223>
<400> 191 <210> 192 image 1 image 1
<211> 248
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-120
<400> 192 image 1
<210> 193
<211> 747 <212> DNA
<213> Artificial sequence
<220>
<223> SC04-125
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 193 <210> 194 image 1 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-125
<400> 194 <210> 195 image 1 image 1
<211> 756
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-126
<220>
<221> CDS
<222> (1) .. (756)
<223>
<400> 195 <210> 196 image 1 image 1
<211> 252
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-126
<400> 196 <210> 197 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-140
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 197 <210> 198 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-140
<400> 198 <210> 199 image 1 image 1
<211> 744
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-144
<220>
<221> CDS
<222> (1) .. (744)
<223>
<400> 199 <210> 200 image 1 image 1
<211> 248
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-144
<400> 200 <210> 201 image 1 image 1
<211> 744
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-146
<220>
<221> CDS
<222> (1) .. (744)
<223>
<400> 201 <210> 202 image 1 image 1
<211> 248
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-146
<400> 202 <210> 203 image 1 image 1
<211> 747
<212> DNA
<213> Artificial sequence
<220>
<223> SC04-164
<220>
<221> CDS
<222> (1) .. (747)
<223>
<400> 203 <210> 204 image 1
<211> 249
<212> PRT
<213> Artificial sequence
<220>
<223> SC04-164
<400> 204 <210> 205 image 1 image 1
<211> 786
<212> DNA
<213> Artificial sequence
<220>
<223> SO57
<220>
<221> CDS
<222> (1) .. (786)
<223>
<400> 205 <210> 206 image 1 image 1
<211> 262
<212> PRT
<213> Artificial sequence
<220>
<223> SO57
<400> 206 image 1
<210> 207
<211> 524
<212> PRT
<213> Rabies virus
<220>
<221> MISC_FEATURE
<223> Protein G of the ERA strain of rabies virus
<400> 207 image 1 image 1 image 1

<210> 208

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda1A

<400> 208

cagtctgtgc tgactcagcc acc

2. 3

<210> 209

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda1B

<400> 209

cagtctgtgy tgacgcagcc gcc

2. 3

<210> 210 <223> Primer HuVlambda4 <212> DNA

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda1C

<400> 210

cagtctgtcg tgacgcagcc gcc

2. 3

<210> 211

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda2 primer

<400> 211

cartctgccc tgactcagcc t

twenty-one

<210> 212

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> BuVlambda3A primer

<400> 212

tcctatgwgc tgactcagcc acc

2. 3

<210> 213

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda3B primer

<400> 213

tcttctgagc tgactcagga ccc

2. 3

<210> 214

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<400> 214

cacgttatac tgactcaacc gcc

2. 3

<210> 215

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda5

<400> 215

caggctgtgc tgactcagcc gtc

2. 3

<210> 216

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> RuVlambda6 primer

<400> 216

aattttatgc tgactcagcc cca

2. 3

<210> 217

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda primer

<400> 217

cagrctgtgg tgacycagga gcc

2. 3

<210> 218

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda9 primer

<400> 218

cwgcctgtgc tgactcagcc mcc

2. 3

<210> 219

<211> 23

<213> Artificial sequence
<220>
<223> Primer HuVkappa1B
<400> 219 gacatccagw tgacccagtc tcc 23
<210> 220
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVkappa2 primer
<400> 220 gatgttgtga tgactcagtc tcc 23
<210> 221
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVkappa3 primer
<400> 221 gaaattgtgw tgacrcagtc tcc 23
<210> 222
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVkappa4 primer
<400> 222 gatattgtga tgacccacac tcc 23
<210> 223
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVkappa5 primer
<400> 223

gaaacgacac tcacgcagtc tcc

2. 3

<210> 224

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVkappa6 primer

<400> 224

gaaattgtgc tgactcagtc tcc

2. 3

<210> 225

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVkappa1B-SalI

<400> 225

tgagcacaca ggtcgacgga catccagwtg acccagtctc c

41

<210> 226

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVkappa2-SalI

<400> 226

tgagcacaca ggtcgacgga tgttgtgatg actcagtctc c

41

<210> 227

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVkappa3B-SalI

<400> 227

tgagcacaca ggtcgacgga aattgtgwtg acrcagtctc c

41

<210> 228

<211> 41

<212> DNA

<213> Artificial sequence

<220><211> 48 <400> 237 <213> Artificial sequence <210> 247

<223> Primer HuVkappa4B-SalI

<400> 228

tgagcacaca ggtcgacgga tattgtgatg acccacactc c

41

<210> 229

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVkappa5-SalI

<400> 229

tgagcacaca ggtcgacgga aacgacactc acgcagtctc c

41

<210> 230

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVkappa6-SalI

<400> 230

tgagcacaca ggtcgacgga aattgtgctg actcagtctc c

41

<210> 231

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJkappa1-NotI

<400> 231

gagtcattct cgacttgcgg ccgcacgttt gatttccacc ttggtccc

48

<210> 232

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJkappa2-NotI

<400> 232

gagtcattct cgacttgcgg ccgcacgttt gatctccagc ttggtccc

48

<210> 233

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJkappa3-NotI

<400> 233

gagtcattct cgacttgcgg ccgcacgttt gatatccact ttggtccc

48

<210> 234

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJkappa4-NotI

<400> 234

gagtcattct cgacttgcgg ccgcacgttt gatctccacc ttggtccc

48

<210> 235

<211> 48

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJkappa5-NotI

<400> 235

gagtcattct cgacttgcgg ccgcacgttt aatctccagt cgtgtccc

48

<210> 236

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda1A-SalI

<400> 236

tgagcacaca ggtcgacgca gtctgtgctg actcagccac c

41

<210> 237

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> BuVlambda1B-SalI primer

tgagcacaca ggtcgacgca gtctgtgytg acgcagccgc c

41

<210> 238

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda1C-SalI

<400> 238

tgagcacaca ggtcgacgca gtctgtcgtg acgcagccgc c

41

<210> 239

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> HuVlambda2-SalI primer

<400> 239

tgagcacaca ggtcgacgca rtctgccctg actcagcct

39

<210> 240

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda3A-SalI

<400> 240

tgagcacaca ggtcgacgtc ctatgwgctg actcagccac c

41

<210> 241

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda3B-SalI

<400> 241

tgagcacaca ggtcgacgtc ttctgagctg actcaggacc c

41

<210> 242

<211> 41

<212> DNA

<220>

<223> Primer HuVlambda4B-SalI

<400> 242

tgagcacaca ggtcgacgca cgttatactg actcaaccgc c

41

<210> 243

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda5B-SalI

<400> 243

tgagcacaca ggtcgacgca ggctgtgctg actcagccgt c

41

<210> 244

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda6-SalI

<400> 244

tgagcacaca ggtcgacgaa ttttatgctg actcagcccc a

41

<210> 245

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda7 / 8-SalI

<400> 245

tgagcacaca ggtcgacgca grctgtggtg acycaggagc c

41

<210> 246

<211> 41

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVlambda9-SalI

<400> 246

tgagcacaca ggtcgacgcw gcctgtgctg actcagccmc c

41

<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuJlambda1-NotI
<400> 247 gagtcattct cgacttgcgg ccgcacctag gacggtgacc ttggtccc 48
<210> 248
<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223> RuJlambda primer 2/3-NotI
<400> 248 gagtcattct cgacttgcgg ccgcacctag gacggtcagc ttggtccc 48
<210> 249
<211> 48
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuJlambda4 / 5-NotI
<400> 249 gagtcattct cgacttgcgg ccgcacytaa aacggtgagc tgggtccc 48
<210> 250
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuVH1B / 7A
<400> 250 cagrtgcagc tggtgcartc tgg 23
<210> 251
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuVH1C <212> DNA

<400> 251

saggtccagc tggtrcagtc tgg

2. 3

<210> 252

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH2B primer

<400> 252

saggtgcagc tggtggagtc tgg

2. 3

<210> 253

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3B primer

<400> 253

saggtgcagc tggtggagtc tgg

2. 3

<210> 254

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH3C primer

<400> 254

gaggtgcagc tggtggagwc ygg

2. 3

<210> 255

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> HuVH4B primer

<400> 255

caggtgcagc tacagcagtg ggg

2. 3

<210> 256

<211> 23

<213> Artificial sequence
<220>
<223> HuVH4C primer
<400> 256 cagstgcagc tgcaggagtc sgg 23
<210> 257
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVH5B primer
<400> 257 gargtgcagc tggtgcagtc tgg 23
<210> 258
<211> 23
<212> DNA
<213> Artificial sequence
<220>
<223> HuVH6A primer
<400> 258 caggtacagc tgcagcagtc agg 23
<210> 259
<211> 56
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuVH1B / 7A-SfiI
<400> 259 gtcctcgcaa ctgcggccca gccggccatg gcccagrtgc agctggtgca rtctgg 56
<210> 260
<211> 56
<212> DNA
<213> Artificial sequence
<220>
<223> Primer HuVH1C-SfiI
<400> 260

gtcctcgcaa ctgcggccca gccggccatg gccsaggtcc agctggtrca gtctgg

56

<210> 261

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH2B-SfiI

<400> 261

gtcctcgcaa ctgcggccca gccggccatg gcccagrtca ccttgaagga gtctgg

56

<210> 262

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH3B-SfiI

<400> 262

gtcctcgcaa ctgcggccca gccggccatg gccsaggtgc agctggtgga gtctgg

56

<210> 263

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH3C-SfiI

<400> 263

gtcctcgcaa ctgcggccca gccggccatg gccgaggtgc agctggtgga gwcygg

56

<210> 264

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH4B-SfiI

<400> 264

gtcctcgcaa ctgcggccca gccggccatg gcccaggtgc agctacagca gtgggg

56

<210> 265

<211> 56

<212> DNA

<213> Artificial sequence

<220><211> 36

<223> Primer HuVH4C-SfiI

<400> 265

gtcctcgcaa ctgcggccca gccggccatg gcccagstgc agctgcagga gtcsgg

56

<210> 266

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH5B-SfiI

<400> 266

gtcctcgcaa ctgcggccca gccggccatg gccgargtgc agctggtgca gtctgg 56

<210> 267

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuVH6A-SfiI

<400> 267

gtcctcgcaa ctgcggccca gccggccatg gcccaggtac agctgcagca gtcagg

56

<210> 268

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJH1 / 2-XhoI

<400> 268

gagtcattct cgactcgaga cggtgaccag ggtgcc

36

<210> 269

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJH3-XhoI

<400> 269

gagtcattct cgactcgaga cggtgaccat tgtccc

36

<210> 270

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJH4 / 5-XhoI

<400> 270

gagtcattct cgactcgaga cggtgaccag ggttcc

36

<210> 271

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Primer HuJH6-XhoI

<400> 271

gagtcattct cgactcgaga cggtgaccgt ggtccc

36

<210> 272

<211> 381

<212> DNA

<213> Artificial sequence

<220>

<223> CR57 heavy chain variable region

<400> 272

image 1
<210> 273
<211> 127
<212> PRT
<213> Artificial sequence
<220>
<223> CR57 heavy chain variable region
<400> 273 <210> 274 image 1
<211> 336
<212> DNA
<213> Artificial sequence
<220>
<223> CR57 light chain variable region
<400> 274 image 1
<210> 275
<211> 112
<212> PRT
<213> Artificial sequence
<220>
<223> CR57 light chain variable region
<400> 275 image 1
<210> 276
<211> 12
<212> PRT
<213> Artificial sequence
<220>
<223> CRRB CDR3
<400> 276 image 1
<210> 277
<211> 6778
<212> DNA
<213> Artificial sequence
<220>
<223> vector pSyn-C03-HCgamma1
<400> 277 image 1 image 1 image 1 image 1 image 1
<210> 278
<211> 6283
<212> DNA
<213> Artificial sequence
<220>
<223> Vector pSyn-C04-Clambda
<400> 278 image 1 image 1 image 1 image 1 image 1
<210> 279
<211> 6267
<212> DNA
<213> Artificial sequence
<220>
<223> Vector pSyn-C05-Ckappa
<400> 279 image 1 image 1 image 1 image 1
<210> 280
<211> 46
<212> DNA
<213> Artificial sequence
<220>
<223> 5H-B oligonucleotide
<400> 280 acctgtcttg aattctccat ggccgaggtg cagctggtgg agtctg
<210> 281
<211> 47
<212> DNA
<213> Artificial sequence
<220>
<223> 5H-C oligonucleotide
<400> 281

acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgg

47

<210> 282

<211> 49

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-C-long oligonucleotide

<400> 282

acctgtcttg aattctccat ggcccaggtg cagctggtgg agtctgggg

49

<210> 283

<211> 50

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-F oligonucleotide

<400> 283

acctgtcttg aattctccat ggcccaggtg cagctgcagg agtccggccc

fifty

<210> 284

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-H oligonucleotide

<400> 284

acctgtcttg aattctccat ggccgaggtg cagctggtgc agtctgg

47

<210> 285

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5H-I oligonucleotide

<400> 285

acctgtcttg aattctccat ggccgaggtg cagctgctgg agtctgg

47

<210> 286

<211> 47

<212> DNA

<213> Artificial sequence

<220><211> 47 <400> 295 <213> Artificial sequence <210> 305

<223> 5H-M oligonucleotide

<400> 286

acctgtcttg aattctccat ggcccaggtg accttgaagg agtctgg

47

<210> 287

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-A

<400> 287

gcccttggtg ctagcgctgg agacggtcac cagggtgccc tggcccc

47

<210> 288

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-C

<400> 288

gcccttggtg ctagcgctgg agacggtcac ggtggtgccc tggcccc

47

<210> 289

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-C-long

<400> 289

gcccttggtg ctagcgctgg agacggtcac ggtggtgccc ttgccccaga cgtc

54

<210> 290

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3H-D

<400> 290

gcccttggtg ctagcgctgg acacggtcac catggtgccc tggcccc

47

<210> 291

<212> DNA

<213> Artificial sequence

<220>

<223> oligonucleotide sy3H-E

<400> 291

gcccttggtg ctagcgctgg acacggtcac cagggtgccc cggcccc

47

<210> 292

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 3L-B oligonucleotide

<400> 292

ttttccttag cggccgcgac tcacctagga cggtcagctt ggtc

44

<210> 293

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-B oligonucleotide

<400> 293

acctgtctcg agttttccat ggctgacatc cagatgaccc agtc

44

<210> 294

<211> 55

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-C oligonucleotide

<400> 294

acctgtctcg agttttccat ggctgacatc cagatgaccc agtctccatc ctccc

55

<210> 295

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-G oligonucleotide

acctgtctcg agttttccat ggctgacatc gtgatgaccc agtctcc

47

<210> 296

<211> 47

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-K oligonucleotide

<400> 296

acctgtctcg agttttccat ggctgccatc cagatgaccc agtctcc

47

<210> 297

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-M oligonucleotide

<400> 297

acctgtctcg agttttccat ggctgacatc cagctgaccc agtc

44

<210> 298

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-N oligonucleotide

<400> 298

acctgtctcg agttttccat ggctgacatc cagatgactc agtc

44

<210> 299

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5K-O oligonucleotide

<400> 299

acctgtctcg agttttccat ggctgccatc cagctgaccc agtc

44

<210> 300

<211> 44

<212> DNA

<220>

<223> 5K-Q oligonucleotide

<400> 300

acctgtctcg agttttccat ggctgagatc gtgatgactc agtc

44

<210> 301

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> 5L-E oligonucleotide

<400> 301

acctgtctcg agttttccat ggcttcctac gtgctgactc agccg

Four. Five

<210> 302

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5L-F oligonucleotide

<400> 302

acctgtctcg agttttccat ggctcagtcc gtgctgactc agcc

44

<210> 303

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> 5L-G oligonucleotide

<400> 303

acctgtctcg agttttccat ggcttcctac gtgctgactc agcc

44

<210> 304

<211> 42

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3K-F

<400> 304

gctgggggcg gccacggtcc gcttgatctc caccttggtc cc

42

<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> Oligonucleotide sy3K-I
<400> 305 gctgggggcg gccacggtcc gcttgatctc cagccgtgtc cc 42
<210> 306
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> Oligonucleotide sy3K-J
<400> 306 gctgggggcg gccacggtcc gcttgatctc cagcttggtc cc 42
<210> 307
<211> 42
<212> DNA
<213> Artificial sequence
<220>
<223> Oligonucleotide sy3K-K
<400> 307 gctgggggcg gccacggtcc gcttgatgtc caccttggtc cc 42
<210> 308
<211> 43
<212> DNA
<213> Artificial sequence
<220>
<223> Oligonucleotide sy3L-A
<400> 308 ccagcacggt aagcttcagc acggtcacct tggtgccagt tcc 43
<210> 309
<211> 43
<212> DNA
<213> Artificial sequence
<220>

<223> Oligonucleotide sy3L-C

<400> 309

ccagcacggt aagcttcagc acggtcagct tggtgcctcc gcc

43

<210> 310

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy3L-D

<400> 310

ccagcacggt aagcttcaac acggtcagct gggtccc

37

<210> 311

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<223> Oligonucleotide sy5L-A

<400> 311

acctgtctcg agttttccat ggcttcctcc gagctgaccc aggaccctgc tg

52

<210> 312

<211> 756

<212> DNA

<213> Artificial sequence

<220>

<223> scFv SOJB

<400> 312

image 1
<210> 313
<211> 252
<212> PRT
<213> Artificial sequence
<220>
<223> scFv SOJB
<400> 313 <210> 314 image 1 image 1
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 314 image 1
<210> 315
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 315 image 1
<210> 316
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 316 image 1
<210> 317
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 317 image 1
<210> 318
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 318 image 1
<210> 319
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 319 image 1
<210> 320
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 320 image 1
<210> 321
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 321 image 1
<210> 322
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 322 image 1
<210> 323
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 323 image 1
<210> 324
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 324 image 1
<210> 325
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 325 image 1
<210> 326
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 326 image 1
<210> 327
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 327 image 1
<210> 328
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 328 image 1
<210> 329
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 329 image 1
<210> 330
<211> 15
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 330 image 1
<210> 331
<211> 15
<212> PRT <213> Artificial sequence
<220>
<223> Peptide
<400> 331 image 1
<210> 332
<211> 23
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 332 image 1
<210> 333
<211> 23
<212> PRT
<213> Artificial sequence
<220>
<223> Peptide
<400> 333 image 1
<210> 334
<211> 2083
<212> DNA
<213> Artificial sequence
<220>
<223> Heavy chain of CR04-098
<220>
<221> Intron
<222> (358) .. (484)
<223>
<220>
<221> Intron
<222> (779) .. (1169)
<223>
<220>
<221> Intron
<222> (1215) .. (1332)
<223>
<220>
<221> Intron
<222> (1663) .. (1759)
<223>
<400> 334 image 1 image 1
<210> 335
<211> 449
<212> PRT
<213> Artificial sequence
<220>
<223> Heavy chain of CR04-098
<400> 335 image 1 image 1 image 1
<210> 336
<211> 847
<212> DNA
<213> Artificial sequence
<220>
<223> CR04-098 light chain
<220>
<221> Intron
<222> (322) .. (526)
<223>
<400> 336 <210> 337 image 1 image 1
<211> 213
<212> PRT
<213> Artificial sequence
<220>
<223> CR04-098 light chain
<400> 337 image 1 image 1

Claims (15)

one.

Binding molecule that has neutralizing activity against rabies virus, characterized in that the binding molecule comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 39 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 63, or a heavy and light chain variable region that has at least 80% sequence homology thereto and in which one or more amino acids are altered compared to SEQ ID NO : 39 and SEQ ID NO: 63 and which can compete to specifically bind rabies virus or a fragment thereof with the binding molecule comprising SEQ ID NO: 39 and SEQ ID NO: 63, and still It has neutralizing activity against rabies virus.

2.

Binding molecule according to claim 1, characterized in that the binding molecule is human.

3.

Binding molecule according to claim 1 or 2, the binding molecule being an IgG.

Four.

Immunoconjugate comprising a binding molecule according to any of claims 1-3, the immunoconjugate further comprising at least one therapeutic agent and / or detectable agent.

5.

Nucleic acid molecule encoding a binding molecule according to any one of claims 1-3.

6.

Vector comprising at least one nucleic acid molecule according to claim 5.

7.

Host cell comprising at least one vector according to claim 6.

8.

Host cell according to claim 7, which is a human cell.

9.

Method of production of a binding molecule according to any of claims 1-3, the method comprising the steps of:

a) culturing a host cell according to claim 7 or 8 under conditions that lead to the expression of the binding molecule, and optionally, b) recover the expressed binding molecule.

10.

Pharmaceutical composition comprising a binding molecule according to any one of claims 1-3, the pharmaceutical composition further comprising at least one pharmaceutically acceptable excipient.

eleven.

Pharmaceutical composition according to claim 10, comprising at least one additional binding molecule, which has neutralizing activity against the rabies virus and which binds to a different, non-competitive epitope of the rabies virus.

12.

Pharmaceutical composition according to claim 11, characterized in that the additional binding molecule comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 273 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 275.

13.

Binding molecule according to any one of claims 1-3, immunoconjugate according to claim 4, or pharmaceutical composition according to any one of claims 10-12 for use as a medicament.

14.

Binding molecule according to any one of claims 1-3, immunoconjugate according to claim 4, or pharmaceutical composition according to any one of claims 10-12, for use in prophylaxis or for use in the treatment, or combination of the themselves, of rage.

fifteen.

Kit comprising at least one binding molecule according to any one of claims 1-3, an immunoconjugate according to claim 4, or a pharmaceutical composition according to any one of claims 10-12, or a combination thereof.