ES2350974T3 - INHIBITING OLIGONUCLEOTIDES AND THEIR USE TO SPECIFICALLY REPRESS A GENE THAT CODES FOR AN ANDROGEN RECEPTOR. - Google Patents

Abstract

Double-stranded oligonucleotide, characterized in that it is made up of two complementary oligonucleotide sequences that form a hybrid that each comprise at one of their 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded ends overflowing the hybrid, one of them being oligonucleotide sequences complementary to a target sequence that belongs to a DNA or RNA molecule of a gene that encodes a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the sequence listing in annex with the SEQ number ID No. 15 or SEQ ID No. 16.

Description

The present invention relates to the field of genetic research and treatment of human pathologies, in particular cancers or infectious diseases. More particularly, the invention envisages providing means for determining the function of a gene or a family of genes involved in a cellular process, and for repressing a harmful gene responsible for a pathology in humans or animals. The invention relates to active agents for carrying out these methods and to compositions containing them.

Anti-sense oligonucleotide techniques are known in the prior art that allow a gene to be specifically inhibited in mammalian cells. These techniques are based on the introduction into cells of a short DNA oligonucleotide complementary to the target gene. This oligonucleotide induces the degradation of the messenger RNA transcribed by the target gene. Another mode of action of the antisense is to introduce into the cell a DNA oligonucleotide that will form a triple helix with the target gene. The formation of this triple helix represses the gene, either blocking access to activator proteins, or in more sophisticated approaches, inducing degradation of the gene. Neither of these approaches appears to rely on a cellular mechanism existing in mammalian cells, and they have been shown to be ineffective. Indeed, the use of antisense in the clinic is reduced to some rare cases, and there is no possible use of the oligonucleotides that form a triple helix.

The method of the invention is based on RNA interference also designated "RNA'inh" or "RNAi" or also co-suppression, which has been demonstrated in plants. In plants, the introduction of a long double-stranded RNA, corresponding to a gene, has been found to induce specific and efficient repression of the target gene. The mechanism of this interference involves the degradation of double-stranded RNA into short duplexes of oligonucleotides of 20 to 22 nucleotides.

The inventors have now shown that this principle can be applied to mammalian genes that play an important role in the control of cell fate.

The "RNA'inh" approach referred to more generally according to the invention inhibitory oligonucleotides or RNAi is based on a cellular mechanism whose importance is underlined by its high degree of conservation since this mechanism is conserved across kingdoms and species, and has been demonstrated not only in the plant, but also in the worm Caenorhabditis Elegans and yeast and mammals, humans and mice.

Research studies carried out within the framework of the invention have shown that this approach is much more efficient in specifically repressing genes than the techniques envisaged in the prior art. In addition, it potentially combines the advantages of antisense and anti-genes. Indeed, in the plant, co-suppression takes place at the post-transcriptional level, in the mature RNA, but also at the transcriptional level, therefore, in the gene itself. Indeed, repression is transmitted from generation to generation and

it would therefore allow a gene to be repressed for a long time, even permanently.

The object of the invention is therefore a double-stranded oligonucleotide made up of two complementary oligonucleotide sequences that form a hybrid that each comprises at one of its 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded ends overflowing the hybrid , one of said oligonucleotide sequences being complementary to a target sequence that belongs to a DNA or RNA molecule of a gene encoding a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the sequence listing in annex with the number SEQ ID No. 15 or SEQ ID No. 16.

Each of the two complementary oligonucleotide sequences comprises at one of the 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded overflowing ends of the hybrid.

Advantageously, the two oligonucleotide sequences have the same size.

Due to the base pairing law, one or other of the sequences of the double-stranded oligonucleotide of the invention that is complementary to a target sequence belonging to a DNA molecule will also be designated interchangeably below by oligonucleotide of the invention. or from RNA of a gene that encodes a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the annexed sequence listing with SEQ ID No. 15 or SECID No. 16.

The oligonucleotides can be ribonucleotide, deoxyribonucleotide or mixed in nature. The oligonucleotide complementary to the target sequence, also designated antisense strand, mostly ribonucleotide in nature, is also described. The sense strand can be ribonucleotide, deoxyribonucleotide or mixed in nature. Some examples of oligonucleotides of the RNA / RNA or DNA / RNA type are provided in the experimental part below.

Indeed, RNA / RNA hybrids are more stable than DNA / DNA or DNA / RNA hybrids and much more stable than single-stranded nucleic acids used in antisense strategies.

By oligonucleotide is also understood a polynucleotide from 2 to 100, and more generally from 5 to 50, nucleotides of the ribo-, deoxyribo- or mixed type.

The part of the oligonucleotide sequence that hybridizes to and complements the target sequence is described and has a size between 15 and 25 nucleotides, and most preferably 20 to 30 nucleotides.

The double-stranded oligonucleotides of the invention comprise at one of their 3 'to 5' ends of each strand, from 1 to 5 nucleotides, preferably from 2 to 3, and most preferably 2 nucleotides overflowing from the hybrid. These nucleotides overflowing the hybrid may or may not be complementary to the target sequence. Thus, according to the invention, the overflowing nucleotides of the hybrid are nucleotides

any, for example thymines.

A double-stranded oligonucleotide of the invention can be represented as follows, in which each dash corresponds to a nucleotide and in which each strand comprises at its 3 'end two thymines overflowing from the hybrid.

image 1

The sequence of the oligonucleotides described is substantially complementary to a target sequence belonging to a DNA or messenger RNA molecule of a gene that it is specifically desired to repress. Although oligonucleotides perfectly complementary to the target sequence are preferred, it is understood by substantially complementary, the fact that the oligonucleotide sequence can comprise some nucleotides mutated with respect to the target sequence since the repression properties of the gene in question are not altered. Thus, a described oligonucleotide sequence can comprise 1 to 3 mutated nucleotides.

These mutated nucleotides described can therefore be the overflowing nucleotides of the hybrid or nucleotides within the oligonucleotide sequence.

An oligonucleotide of the invention is a perfect hybrid. The part of the oligonucleotide sequence that hybridizes is perfectly complementary to the target sequence, while the nucleotides overflowing from the hybrid can be any and in particular thymine. In this way, it is also understood by perfectly complementary the fact that the oligonucleotide of the invention is complementary to a sequence belonging to a DNA or RNA of a gene encoding a mutated or non-mutated androgen receptor. The oligonucleotides of the invention can thus make it possible to discriminate between the sequence of the wild-type gene and the mutated gene, which may be of particular interest both in the analysis of genes and in the therapeutic uses of the oligonucleotides of the invention.

The oligonucleotides of the invention generally consist of natural nucleotide bases (A, T, G, C, U), but they can also comprise modified nucleotides or nucleotides containing reactive groups or bridging agents or intercalating agents that can react with the target sequence complementary to the oligonucleotide.

The oligonucleotides of the invention can be prepared by conventional methods of chemical or biological synthesis of the oligonucleotides.

The invention also provides oligonucleotides coupled to substances that promote or allow their penetration, targeting or targeting into cells, they can be lipids, proteins, polypeptides or peptides, or any other natural or synthetic substance. Indeed, the oligonucleotides of the invention are intended to be internalized in cells and advantageously, in some cases, even in the nucleus of cells, where they will interact with nucleic acid molecules containing the target sequence of the oligonucleotide. Likewise, it may be interesting to promote its penetration into a particular tissue such as a tumor, bone, etc.

The oligonucleotides described are useful for the very efficient and very specific repression of a gene or a set of genes and, therefore, for the treatment of numerous human pathologies. They are also a search tool for research and understanding of gene function.

The object of the invention is therefore a composition, in particular a pharmaceutical one to be used in the search for gene function or for therapeutic or diagnostic purposes, which comprises as active agent at least one double-stranded oligonucleotide made up of two complementary oligonucleotide sequences. that form a hybrid that each comprise at one of their 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded ends overflowing the hybrid, one of said oligonucleotide sequences being complementary to a target sequence that belongs to a molecule DNA or RNA of a gene that encodes a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the annexed sequence listing with the number SEQ ID No. 15 or SEQ ID No. 16, or an oligonucleotide as defined above, coupled with substances that favor or allow its penetration, re knowledge or addressing in cells.

The oligonucleotides of the invention can be used in ex vivo applications, for example during grafting. In this way, the oligonucleotides can be transfected into cells, in particular tumor cells, which will be injected or injected into tissues, for example, of already developed tumors, for example by local, systemic or aerosol routes, etc. with possibly necessary vectorization agents.

The oligonucleotides will be used at sufficient concentrations depending on the application and the form of administration used with appropriate pharmaceutical excipients. Depending on the nature of the oligonucleotides (DNA / RNA or RNA / RNA), different doses may be used to obtain the desired biological effect.

The oligonucleotides described in the present invention are also useful as diagnostic tools that make it possible to establish in vitro the genetic profile of a patient from a cellular sample thereof. The use of the oligonucleotides described in said analysis procedure allows knowing or anticipating the response of the cancer cells of this patient and establishing a personalized treatment or also adjusting the treatment of a patient.

The oligonucleotides of the invention have several advantages over classical chemotherapeutic agents:

-RNA-RNA hybrids are more stable than DNA-DNA or DNA-RNA hybrids and much more stable than single-stranded nucleic acids used in anti-sense strategies.

-They constitute natural compounds, and no immunological reaction or drug intolerance should be feared a priori,

-The transfection experiments carried out within the framework of the invention show better penetration of RNAi into tumor cells than that obtained with plasmids. This point is essential in the case of tumor cells that are generally very difficult to transfect.

-The experiments of systemic injection of siRNA in vivo show a very good penetration of these molecules in the tissues.

-It is easy to mix several RNAi together in order to target several cellular genes at the same time.

The oligonucleotides described and the compositions containing them are useful for the treatment or for the prevention of infectious or viral diseases, in particular AIDS, unconventional infectious diseases, in particular ESB or Jacob Kreutzfeld. They are very particularly indicated to treat viral diseases originating from cancers. The following table lists some examples of viruses implicated in

15 some carcinogenic pathologies in humans.

Table 1

Virus

Associated human cancer type

Hepatitis B virus (HBV)

Liver carcinoma

Epstein-Barr virus (EBV)

Burkitt's lymphoma, nasopharyngeal cancer, Hodgkin's disease, non-Hodgkin's lymphomas, gastric cancer, breast cancer.

Human herpes virus 8 or HHV-8 / KSHV

Kaposi sarcoma (KS), primitive serous lymphomas (PEL), multifocal Castelman disease (MCD)

HPV

Cervix, head, neck, skin, nasopharynx

T lymphocyte virus (HTLV)

Type T leukemia

Hepatitis C virus (HCV)

Liver carcinoma

The oligonucleotides described and the compositions containing them are also useful for the treatment or for the prevention of diseases related to hypervascularization such as age-related macular degeneration, tumor angiogenesis, diabetic retinopathies, psoriasis or arthritis. rheumatoid.

The investigations carried out have shown that these oligonucleotides are particularly adapted to suppress harmful genes involved in cancerization and are therefore very particularly useful for the treatment or prevention of cancers and more generally of oncological diseases.

The oligonucleotides of the invention are useful for the preparation of a pharmaceutical composition useful for the prevention or treatment of cancer.

Preferably, the oligonucleotides of the invention are useful for the preparation of a pharmaceutical composition useful for the prevention or treatment of prostate cancer.

An ideal anti-cancer treatment should cause the death of the tumor cell

while avoiding resistance phenomena. Cell death can be

get by:

40 -Inhibition of cell division, blocking of the cell cycle, -Induction of apoptosis of tumor cells,

-Induction of senescence,

-Induction of necrosis,

-Induction of differentiation. In this case, the treatments lead the cell to become normal.

Thus, in the present invention, a different oligonucleotide or set of oligonucleotides is described, each one comprising an oligonucleotide sequence complementary to a target sequence that belongs to a DNA or messenger RNA molecule of a gene whose repression induces the apoptosis, or senescence, or necrosis, or differentiation of tumor cells or prevents their division, or several of these phenomena.

The induction of apoptosis of tumor cells is based on the fact that the function of numerous cellular genes (eg members of the BCL2 family, BCL XL) is to protect cells from apoptosis. The loss of expression of these genes induced by RNAi therefore allows passage into apoptosis.

Cell death can also be caused by loss of adhesion of cells to the matrix (anoikis). This effect can be obtained by disturbing the balance between proteases and protease inhibitors in tumors and their stromal environment. This disturbance also has the effect of diminishing the capacities of tumor cells to invade healthy tissues and to metastasize. The siRNAs can therefore be used to prevent the synthesis of proteins of the families of matrix metalloproteases (MMP), of membrane matrix metalloproteases, of their inhibitors (TIMP), as well as that of inhibitor activators. of proteases such as, for example, PAI-1 and of proteases themselves such as, for example, urokinase.

Induction of senescence is based on the fact that normal cells can divide only a limited number of times. This number is programmed to approximately 50 divisions for example for embryonic fibroblasts, and "measured" by the length of telomeres which shortens as cell divisions take place. Below a certain size, the telomeres are no longer functional and the cell, unable to divide, enters senescence. In germ cells, however, this length is kept constant by the action of an enzyme, telomerase. Telomerase is re-expressed in numerous cancers, allowing tumor cells to multiply indefinitely. An RNAi that blocks telomerase expression would have no effect on normal somatic cells and should lead tumor cells to senescence.

Blocking cell division also leads cells to senescence. This block can be obtained by inhibiting essential cell receptors. Depending on the nature of the cell, these receptors may belong to the class of growth factor receptors (EGF, SST2, PDGF, FGF, in particular), whether or not they are mutated, or to that of the nuclear receptors of hormones

(androgens, estrogens, glucocorticoids, in particular).

Hormone receptors are frequently mutated in cancers, and the invention relates in this case to the use of oligonucleotides that recognize the mutated forms of these receptors and that do not inhibit the synthesis of the wild-type forms. This allows, for example, in the case of prostate carcinomas that have become resistant by mutation of the androgen receptor, to treat patients systemically with siRNAs that block the synthesis of the mutated receptor without inducing any castration effect related to inhibition. of the wild forms of the receptor in other organs. An example of the use of oligonucleotides that recognize mutated forms of the receptor is presented.

The cell cycle can also be stopped by inhibiting the synthesis of proteins essential for its development, such as cyclins, cyclin-dependent kinases, DNA replication enzymes, transcription factors such as E2F.

The induction of necrosis results from the tumor cells' need for oxygen and nutrients. Initially, a tumor ensures its development from the host's pre-existing vessels. Beyond 1 to 2 mm in diameter, cells in the center of the tumor are hypoxic. This hypoxia, by means of a proline hydroxylase, causes the stabilization of the transcription factor Hif1α, whose sequence SEQ ID No. 59 is provided in annex, which, by attaching itself to HRE sequences in the promoters of its target genes, initiates the hypoxic reaction. This reaction leads to the activation of a hundred genes, allowing the activation of the anaerobic glycolysis pathway, the response to stress and angiogenesis. This last mechanism activates in particular the VEGF gene, whose sequence SEQ ID No. 60 is provided in annex, the main tumor angiogenic factor.

In this way, oligonucleotides that block, for example, the expression of the Hif1α transcription factor or, for example, that of VEGF put tumor cells in the inability to mount a hypoxic or angiogenic response. Angiogenesis is a normally repressed mechanism in the adult, with the exception of the menstrual cycle (uterus, ovaries). Inhibition of this mechanism therefore has little consequence for normal tissues.

In the present invention, an oligonucleotide of which one of said oligonucleotide sequences is substantially complementary to a target sequence belonging to a DNA or messenger RNA molecule of the gene encoding is described:

- the transcription factor Hif1α;

- one or more of the isoforms of VEGF A or of a member of the family of this growth factor.

In some cancers, the tumor phenotype results from, or is maintained by, the expression of a protein normally absent from normal cells. This protein can result from the current or old expression of a viral genome in the cell such as that of the papilloma virus, HPV, or the hepatitis B virus. This protein can also result from mutation (point, deletion, insertion) of a normal cellular gene. In this case, the mutated protein thus produced often has negative transdominant properties with respect to the normal protein. The specificity of siRNAs makes it possible to inhibit the synthesis of the mutant protein without blocking the synthesis of wild-type proteins. Two examples that refer to mutated forms of the p53 protein and the androgen receptor are set out in the experimental part below.

The investigations carried out within the framework of the invention have made it possible to show that these oligonucleotides are particularly adapted to repress harmful genes involved in cancerization and very particularly those that lead to the formation of fusion protein in cancer cells, such as the protein of PML-RAR alpha fusion.

In the present invention, oligonucleotides are described whose sequence is complementary to a target sequence belonging to a gene that results from a chromosomal translocation in such a way that the effects of the fusion protein expressed by this gene are inhibited. In this way, the target sequence is the one that corresponds to the binding sequence of the fusion protein.

Table 2 of Annex A at the end of the present description is a non-exhaustive list of fusion proteins that represent therapeutic or diagnostic targets for the described oligonucleotides.

The fact of targeting with a described oligonucleotide the union between two genes, for example the two genes pml and rarα, allows to reach the specific inhibition of the fusion protein without affecting the biological role of the natural proteins that can be encoded by the second. allele. This embodiment therefore encompasses all fusion proteins involved in cancerogenesis, particularly leukemias. The reciprocal forms, if they exist, as well as all the variants of the fusion proteins mentioned in the annex also constitute targets. The invention therefore relates very particularly to the use of oligonucleotides as defined above for the preparation of a pharmaceutical composition intended for the treatment of cancers.

Current anti-cancer therapies target cancer cells, through different approaches, considered in isolation or in combination with each other (chemotherapy, surgery, radiotherapy, immunotherapy). Therapeutic failures are due massively or to cells that have not been reached by the treatment,

or, for the most part, to cells that have mutated in response to treatment. This capacity for mutation is greatly facilitated by the genetic instability of tumor cells. The inhibition of tumor vascularization, which deprives cells of oxygen and nutrients, has opened, for some years, new therapeutic perspectives in cancerology. This strategy, complementary to the previous ones, considers the normal endothelial cell of the host as a target, genetically stable, and therefore theoretically not very susceptible to mutating. Numerous clinical trials that envisage inhibiting tumor angiogenesis through different approaches are ongoing around the world. However, the first results presented seem quite disappointing.

The inventors have shown that tumors are capable of compensating for the inhibitory effects of angiogenesis, selecting sub-populations of cells that secrete high concentrations of pro-angiogenic factors.

Tumors are not made up of homogeneous cells in terms of their gene expression. This is demonstrated by numerous studies in which immunolabels have been performed for a wide variety of antigens in tumors. Macroscopically, a tumor is frequently composed of highly vascularized regions that frequent areas of necrosis or, on the contrary, avascular ones.

This tumor heterogeneity favors the escape of tumors to applied treatments, whatever their nature. The greater the diversity of gene expression in a tumor, the higher the probability that there is at least one cell capable of resisting an anti-tumor agent. It therefore seems essential to associate different strategies in order to reduce tumor heterogeneity in the first place and avoid escape phenomena.

In the present invention, siRNAs that inhibit the expression of genes responsible for the inactivation of p53 and their use in the treatment of cancers are described. P53 is the product of a tumor suppressor or anti-oncogenic gene, mutated in more than 50% of tumors in humans. P53 is thus considered a "guardian of the genome". It is activated in cells under genotoxic stress and participates in various processes including the induction of the programmed death process.

In 74% of mono allelic mutation cases, the inactivation of p53 is due to a point mutation that leads to the expression of a normal-sized but mutated protein. The mutated form is generally considered to form heteromers with the wild-type allele product on which it acts as a "negative transdominant" and blocks its activity. The mutant form appears to have oncogenic activity itself as well. In this way, mutated forms of p53 are capable of activating the MDR gene, which facilitates the resistance of cancer cells to chemotherapies. Furthermore, the expression of p53 mutants is associated with stronger tumor angiogenesis, probably due to the fact that mutant forms of p53 are no longer capable of stimulating transcription of the thrombospondin gene, one of the most powerful repressors. of angiogenesis, and activate VEGF and bFGF, two potent activators of angiogenesis. Furthermore, cells in which a mutated form of p53 is expressed lose various levels of regulation. In particular, they are no longer capable of initiating a programmed death process, which is one of the main protective processes against tumorigenesis. The restoration of wild-type p53 activity causes, in cultured tumor cells, the restoration of this cellular response. Thus, inhibition of the expression of mutated forms of p53 potentially represents a potent tool in anticancer therapy.

There is currently no effective means of restoring p53 activity in human cancer cells. As regards cancers in which both alleles are inactivated, attempts to restore p53 activity by gene therapy are envisaged. These approaches are complicated by the use of viral vectors and are currently not very efficient.

On the other hand, it has been specifically observed in cervical cancers

related to HPV virus infection of cervical cells, that p53

it can be inactivated by overexpression of a viral protein. Indeed, this

5 virus codes for a protein, the E6 protein, that inactivates p53. In this type of cancer, it is the inhibition of the E6 protein that can restore wild-type p53 activity.

In the present invention, new means are described that allow activating p53

10 inhibiting the expression of genes responsible for its deactivation. The investigations carried out within the framework of the present invention have thus made it possible to demonstrate that it was possible to suppress the expression of a mutant form of p53 very efficiently and very specifically.

In the present invention, oligonucleotides are described that have a complementary sequence to a specific polynucleotide sequence of the mutated p53 gene. They are therefore oligonucleotides whose sequence contains a mutation with respect to the sequence of wild-type p53. The sequence of the wild gene of p53 is indicated in the annexed sequence list with the number SEQ ID No. 1. The different

20 mutations that can intervene on the sequence of p53 are indicated in table 3 of annex B at the end of this description.

The most frequently observed mutations in cancer pathologies are listed in Table 4 below. 25 Table 4

Position

P53 wild SEQ ID No.

R273H

GAGGTGCGTGTTTGTGC SEQ ID No. 61

R248Q

gcaTgaaccggaggcccaT SEQ ID No. 62

R248W

gcaTgaaccggaggcccaT SEQ ID No. 63

R249S

gcaTgaaccggaggcccaT SEQ ID No. 64

G245S

CTGCATGGGCGGCATGAAC SEQ ID No. 65

R282W

TGGGAGAGACCGGCGCACA SEQ ID No. 66

R175H

TGTGAGGCACTGCCCCCAC SEQ ID No. 67

C242S

TAACAGTTCCTGCATGGGCG SEQ ID NO: 68

Position

P53 mutated

R273H

GAGGTGCATGTTTGTGC SEQ ID No. 69

R248Q

gcaTgaacCAgaggcccaT SEQ ID No. 70

R248W

GCATGAACTGGAGGC CAT SEQ ID NO: 71

R249S

gcaTgaaccggagTcccaT SEQ ID NO: 72

G245S

CTGCATGC, GCAGCATGAAC SEQ ID No. 73

R282W

TGGGAGAGACTGGCGCACA SEQ ID No. 74

R175H

TGTGAGGCGCTGCCCCCAC SEQ ID NO: 75

C242S

TAACAGTTCCTCCATGGGCG SEQ ID No. 76

In this way, some of the oligonucleotides described are complementary to a

target sequence belonging to the mutated p53 gene that contains at least one

of the mutations provided in table 3 and very particularly one at least

of the mutations in Table 4 above.

These oligonucleotides are able to efficiently discriminate between the wild type and the mutated form of p53. Indeed, the strategy is to block the expression of the mutated form to reactivate the wild form and induce in the cells a programmed death process for which the wild form is indispensable, and / or to block any other process induced by the mutated form of p53. Furthermore, this ability to discriminate the oligonucleotides of the invention makes it possible to touch only cancer cells and save normal cells, which do not express this mutated form of p53.

In the present invention, the treatment or prevention of diseases induced by an inactivation of the p53 protein and very particularly the cancers resulting from the expression of the mutated p53 protein and the cancers resulting from the expression of p53 inhibitor genes is described. . In the present invention, the prevention of the occurrence of cancers in subjects expressing a mutated form of p53, such as in the case of Li Fraumeni syndrome, is described.

P53 can be deactivated through several different mechanisms. In particular, in most cervical cancers, p53 is inactivated by a protein encoded by the human papillomavirus, the E6 protein. E6 causes ubiquitinylation of p53, which leads to its degradation by the proteasome. In this case, the expression of P53 can be restored by inhibiting the expression of the E6 protein. In the present invention, oligonucleotides are described that have a complementary sequence to a specific polynucleotide sequence of the HPV E6 protein gene. The sequence of the HPV E6 protein gene is provided in Figure 6A as well as in the annexed sequence listing with SEQ ID No. 2.

As indicated above, a strategy according to the invention aims to block with the help of RNAi the expression of the androgen receptor in carcinomas. The sequence of the androgen receptor is provided in the annexed sequence listing under SEQ ID NO: 77. To treat carcinomas before they become resistant or those that have already become resistant by mutation-free receptor amplification, have used homologous siRNAs from a region for which no mutation has been described in the androgen receptor mutation databases (annotated siRNAs AR). To specifically treat prostate carcinomas that have become androgen-resistant by mutation, a sequencing of the mRNA encoding the receptor will be carried out in the patient's cells in order to conceive a specific sequence of the mutation, allowing the patient to be treated without consequence. for normal cells. An example is presented by using siRNAs that specifically recognize the androgen receptor mutation present in the LNCaP cell line (siRNA LNCaP).

Consequently, the invention relates to double-stranded oligonucleotides made up of two complementary oligonucleotide sequences that form a hybrid that each comprise at one of their 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded ends overflowing the hybrid , one of said oligonucleotide sequences being complementary to a target sequence that belongs to a DNA or RNA molecule of a gene encoding a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the sequence listing in annex with the number SEQ ID No. 15 or SEQ ID No. 16. It is, for example, the androgen receptor that contains at least one of the mutations provided in table 5 of annex C. These oligonucleotides of the invention specific to the Androgen receptor are useful to treat or prevent androgen-dependent diseases, such as, po r example, prostate cancer.

Other advantages and characteristics of the invention will become more apparent in the following examples, which refer to:

-Example 1: Inhibition of the PML-RARα protein associated with acute promyelocytic leukemia (APL).

-Example 2: To the inhibition of tumor angiogenesis induced by VEGF.

-Example 3: To the inhibition of the hypoxic response induced by HIF1α.

-Example 4: To the inhibition of wild or mutant forms of androgen receptors in prostate carcinoma cells.

-Example 5: To the inhibition of wild or mutant forms of the p53 protein.

-Example 6: To the inhibition of the viral protein E6.

-Example 7: To the use of DNA / RNA hybrids to inhibit the expression of different proteins.

-Example 8: In vivo administration of siRNA by different routes.

In the examples reference is made to the figures, in which:

-Figure 1A is a schematic representation of the RARα, PML proteins and the associated fusion protein, PML-RARα. Figure 1B represents the results of transfections with a siRNA directed against PML-RARα.

-Figure 2 refers to the inhibition of VEGF expression by siRNAs directed against this protein and the consequences of this inhibition. Figure 2A represents the immunodetection of VEGF in cJ4 or LNCaP cells transfected by the control siRNA or a siRNA directed against VEGF. Figure 2B represents the ELISA quantification of VEGF in conditioned medium of cj4 cells transfected by control siRNA or VEGF siRNA as a function of time after transfection. Figure 2C represents the growth curve in mice without previous tumor treatments that come from the subcutaneous injection of 10 6 non-transfected cJ4 cells, transfected by the control siRNA or the VEGF siRNA. Figure 2D represents the appearance of the tumors on the 7th day after the injection of the cells. Figure 2E represents the immunodetection of VEGF in tumors derived from the injection of cj4 cells transfected with the control siRNA or the VEGF siRNA after 12 days of development in vivo.

-Figure 3 refers to the effect of inhibition by a specific siRNA of the expression of a transcription factor, HIFIalpha, on the transcriptional response to hypoxia. The figure represents the measurement of the activity of a VEGF luciferase reporter in response to hypoxia in untransfected cJ4 cells, transfected by the control siRNA or by the siRNA directed against HIFIalpha.

-Figure 4 refers to the inhibition by specific siRNAs of the androgen receptor expression in cells, and the functional consequences of these inhibitions. Figure 4A represents the detection by immunoblotting of the androgen receptor expression 48h after the transfection of the LNCaP cells by a control siRNA or an siRNA directed against the androgen receptor (AR). Figure 4B represents the measurement of the activity of an axARE luciferase reporter at R1881 in various clones of the LNCaP line not transfected, or transfected by the control siRNA or the siRNA AR. Figure 4C represents the comparison of the response to R1881 of non-transfected LNCaP cells (100%), and of LNCaP cells transfected by a control siRNA, an siRNA directed against the androgen receptor (AR) or an siRNA that recognizes specifically a point mutation present in the androgen receptor of the LNCaP line. Figure 4D represents the growth in pretreated mice of tumors resulting from the subcutaneous injection of LNCaP cells transfected by a control siRNA or by an siRNA directed against the androgen receptor. Figure 4E represents the growth of LNCaP tumors in mice that have received on the 40th day after implantation of the cells an intravenous injection in the tail vein of 2 µg of siRNA directed against VEGF or of control siRNA. Figure 4F represents the growth of LNCaP tumors in mice that have received on the 34th day and on the 40th day after the implantation of the tumor cells an intraperitoneal injection of 2 µg of siRNA directed against the androgen receptor or siRNA. of control.

-Figure 5 refers to the inhibition of the expression of wild or mutant forms of p53 by siRNAs and the functional consequences of these inhibitions. Figure 5A depicts the human p53 protein sequence. Figure 5B represents the specific and dose-dependent inhibition by siRNAs of the expression of wild-type or mutant forms of p53 transfected in cells that do not express it initially. Figure 5C represents the specific inhibition by siRNAs of the simultaneous or non-simultaneous expression of wild-type or mutant forms of p53 transfected in cells that do not express it initially. Figure 5D represents the inhibition of the expression of endogenous wild-type p53 or a transfected mutant form of p53 by siRNAs. Figure 5E represents the effect of the inhibition of p53 by siRNAs on resistance to genotoxic stress. Figures 5F, G, H and I show the inhibition of the expression of a mutant form of p53 in the cells of a patient suffering from Li Fraumeni syndrome at the level of mRNA (5G), and the expression of the protein by immunoblotting (5F) or indirect immunofluorescence (5H) and the consequences on the resistance of these cells to genotoxic stress. Figure 5J shows the inhibition by specific siRNAs of p53-dependent transcription in cells expressing wild-type or mutant forms of p53 by transfection. Figure 5K shows the inhibition of the expression of one of the target genes of p53, p21, a protein that inhibits cell proliferation, through the co-expression of mutant forms of p53 and the restoration of this expression by treating the cells. with a siRNA that inhibits the synthesis of the mutant form of p53.

-Figure 6 refers to the inhibition of the expression of the E6 protein of the human papillomavirus HPV by specific siRNAs and the consequences of this inhibition. Figure 6A represents the sequence of the HPV protein. Figure 6B represents the effect of the inhibition by specific siRNAs of the expression of the HPV E6 protein in cells expressing this virus, on the expression of p53 and p21. Figures 6C and 6D depict the effect of inhibition of HPV E6 protein expression on the cell cycle.

-Figure 7 refers to the use of hybrid siRNAs, which comprise DNA bases and RNA bases. Figures 7A and 7B represent the effect of DNA / RNA hybrid siRNAs on the expression of GFP expressed by transfection in cells. Figure 7C compares the effect of constant dose RNA / RNA, DNA / RNA, or RNA / DNA siRNA on androgen receptor-induced transcription inhibition. Figures 7D and 7E represent the effects of a substitution of RNA bases for DNA bases in the siRNA sequence that inhibits the synthesis of p53.

-Figure 8 refers to the inhibition of luciferase in tumors that express this enzyme by injecting siRNA subcutaneously, intra-tumor or intra-peritoneal or intra-venous.

EXAMPLE 1: INHIBITION OF THE PROTEIN PML-RAR image2 ASSOCIATED WITH ACUTE PROMYELOCITARY LEUKEMIA (APL)

Introduction.

Acute promyelocytic leukemia (APL) is caused by the t (15; 17) translocation on chromosome 15. In patients with it, the retinoic acid receptor RARα (RARα) fuses to the protein PML (promyelocytic leukemia protein) thus generating the PML-RARα fusion protein. So far, five fusion proteins using RARα have been identified. All of these types of leukemias involve the RARα receptor and are clinically similar, suggesting that disruption of the retinoic acid transduction pathway is crucial in the pathogenesis of APL leukemias.

The PML-RARα fusion protein has guarded the DNA and retinoic acid binding domains of RARα. The PML-RARα fusion protein has been shown to repress the expression of the target genes for retinoic acid and thus causes the blocking of promyelocytic cell differentiation. Only the administration of pharmacological doses of retinoic acid can lift the transcriptional repression exerted by PML-RARα and increase cell differentiation. Furthermore, the PML protein portion of the fusion protein could also play a role in blocking the retinoic acid transduction pathway. To the extent that PML functions as a growth inhibitor and an apoptotic agent and is necessary for the expression of certain genes induced by retinoic acid, the dominant negative effect of PML-RARα on PML could allow cells to acquire a growth ability, a resistance to apoptosis and a stop of differentiation.

Cell biology studies on PML have shown that this protein has a particular location in the nucleus, in particular structures called nuclear bodies. It seems that the role of these structures is directly related to the antioncogenic role of PML. In malignant APL cells, the PML-RARα protein causes, by heterodimerization with PML, the delocalization of PML from nuclear bodies towards micropunctuated structures that may correspond to PML-RARα anchoring sites on chromatin. This delocalization could block the pro-apoptotic function of PML and its role in myeloid differentiation. Several teams have shown that the combined treatment with retinoic acid and AS2O3 on cell lines that express the fusion protein PML-RARα allows the degradation of the fusion proteins at the same time as a relocation of PML on the nuclear bodies. This reorganization of the nuclear bodies restores PML functions and contributes to increased differentiation.

Finally, the chimeric protein PML-RARα would therefore have a double negative dominant effect, on RARα and on PML, while allowing cells to escape apoptosis and block the differentiation of promyelocytes thus transformed.

More than 98% of patients with APL leukemia have the t (15; 17) (q22; q21) translocation that leads to the formation of fused PMLRARα and RARα-PML genes. There are two subtypes of PML-RARα fusion proteins, the S (short) and L (Long) fusions. The long form of the PML-RARα fusion protein, which corresponds to a protein of 955 amino acids, represents the majority expressed form and has therefore been considered as a model in this study (annexes A, B and C). This protein comprises amino acids 1 to 552 of the PML protein fused with amino acids 59 to 462 of the retinoic acid receptor α (RARα).

II -Preparation and administration of oligonucleotides.

Complementary RNA oligonucleotides have been synthesized that correspond to the junction sequence of the fusion protein gene, that is, 10 nucleotides of the PML gene and 10 nucleotides of the RARα gene, with the addition of two deoxythymidines in the 3 'direction (Figure 1 ). These oligonucleotides have been hybridized and the obtaining of the double-stranded oligonucleotide on acrylamide gel has been verified.

The sequences of the PML-RAR and control siRNAs used (5'-3 ') are provided below.

Control:

FW: [CAUGUCAUGUGUCACAUCUC] RNA [TT] DNA (SEQ ID No. 3)

REV: [GAGAUGUGACACAUGACAUG] RNA [TT] DNA (SEQ ID No. 4)

PR:

Sense: [GGGGAGGCAGCCAUUGAGAC] RNA [TT] DNA (SEQ ID No. 5)

Antisense: [GUCUCAAUGGCUGCCUCCCC] RNA [TT] DNA (SEQ ID No. 6)

III -Results

NIH3T3 fibroblasts have been co-transfected with lipofectamine using a vector for the expression of the PML-RARα protein (100 ng) and with 500 ng of control siRNA (C) or directed against PML-RARα (PR). 48 hours after transfection, a western blot (FIG. 1B) was performed on total cell extracts using an antibody that recognizes the RARα protein, whole or in the form of a fusion protein.

Figure 1B shows that transfection of the PR siRNA greatly inhibits the expression of the PML-RARα fusion protein relative to cells transfected with the control siRNA (C), without modifying the expression of the RARα protein.

EXAMPLE 2: INHIBITION OF TUMOR ANGIOGENESIS BY VEGF

Introduction

VEGF (vascular endothelial growth factor) is one of the most potent angiogenic factors identified. These factors are overexpressed in numerous situations of pathological hypervascularizations and in particular in tumor development. Inhibition of this angiogenesis makes it possible to block tumor growth. The present method aims to inhibit tumor angiogenesis by blocking the expression of one of these angiogenic factors and in this example, that of VEGF by tumor cells.

II -Preparation and administration of oligonucleotides

Two RNA oligonucleotides have been synthesized, complementary to a region of the sequence encoding human VEGF, conserved in the rat and in the mouse. Two deoxynucleotides (TT) have been added at 3 '.

-VEGF RNAi sequence:

5 '[AUGUGAAUGCAGACCAAAGAA] TT-RNA [DNA] (SEQ ID No. 7) 5 '[UUCUUUGGUCUGCAUUCACAU] TT-RNA [DNA] (SEQ ID No. 8)

-Sequence of control RNAi:

5 '[CAUGUCAUGUGUCACAUCUC] TT-RNA [DNA] (SEQ ID NO: 9) 5 '[GAGAUGUGACACAUGACAUg] TT-RNA [DNA] (SEQ ID No. 10)

These oligonucleotides or control oligonucleotides, whose sequence does not show any homology with the sequences cataloged in the databases, have been hybridized and transfected using the polyfect kit (Qiagen) in cells of a rat fibrosarcoma (cJ4) or in the human LNCaP prostate carcinoma cells.

III -Results

Indirect immunofluorescence has been performed, 48 hours after transfection, to detect the expression of the protein in the cells. Figure 2A shows a massive inhibition of VEGF expression.

To quantify this effect, VEGF was dosed by ELISA (quantikine, R&D) in cJ4 cells transfected in parallel with the control RNAi or with the VEGF RNAi. The cells were incubated 48 hours before dosing in a medium containing 1% serum. Dosing was done 4 days and 6 days after transfection. Under these conditions, Figure 2B shows an inhibition of VEGF secretion of 85% at 4 days and 75% at 6 days, and 60% at 13 days in the cells transfected with VEGF RNAi compared to those transfected with the Control RNAi (Figure 2B).

The effect of inhibition of VEGF expression by tumor cells has been tested in vivo: 3 days after transfection, three groups of 4 4-week-old naïve female mice were injected subcutaneously at a rate of one million of cells per mouse: the first group was injected with non-transfected cells, the second with cells transfected by control RNAi, and the third by cells transfected with VEGF RNAi. No selection of the transfected cells was carried out prior to injection.

Tumor growth has been monitored by measuring the volume of the tumors at regular intervals (Figure 2C).

Figures 2C and 2D do not show any significant difference between the sizes of the tumors in groups A and B. A very strong reduction in tumor volume is observed in group C. The appearance of the tumors, much whiter in group C (Figure 2D) reflects a marked decrease in tumor vascularization. After the animals were sacrificed, on the 12th day after the injection, the tumors were dissected, fixed and VEGF immunodetection was carried out on sections of these tumors. A very strong reduction in VEGF expression is observed in group C tumors compared to group B (Figure 2E).

In another experiment, tumors have been induced in untreated male mice by injection of LNCaP prostate carcinoma cells. Having reached the volume of the tumors 1 to 1.5 cm3 40 days after the injection, the mice were divided into two groups. The first group (4 mice) received an intravenous tail vein injection of 2 micrograms of control siRNA in 100 µl of PBS. The second group received an equivalent dose of VEGF siRNA under the same conditions. VEGF siRNA, but not control siRNA, is observed to induce a transient arrest of tumor growth. (figure 4D).

EXAMPLE 3: INHIBITION OF THE HYPTOXIC RESPONSE

Introduction

Certain tumors are capable of developing under conditions of strong anoxia. Very little vascularized regions are very frequently observed in tumors. This low sensitivity to hypoxia has two consequences: on the one hand, an anti-angiogenic treatment has little chance of being effective on these tumors or these tumor sub-populations. On the other hand, this low vascularization makes it difficult to supply therapeutic molecules. The Hif1α transcription factor regulates the activity of more than 100 genes that enable the hypoxic response. The inhibition of this transcription factor in hypoxic tumors aims to block their growth.

II -Preparation of oligonucleotides

-RNAi Hif1α

5 '[CAUGUGACCAUGAGGAAAUGA] TT-RNA [DNA] (SEQ ID No. 11) 5 '[UCAUUUCCUCAUGGUCACAUG] TT-RNA [DNA] (SEQ ID No. 12)

-RNA control

5 '[GAUAGCAAUGACGAAUGCGUA] TT-RNA [DNA] (SEQ ID No. 13) 5 '[UACGCAUUCGUCAUUGCUAUC] RNA-TT [DNA] (SEQ ID No. 14)

III -Results

The VEGF promoter contains a response element to the transcription factor Hif1α. To test in vitro the effect of an RNAi directed against Hif1α, cJ4 cells have been transfected with a VEGF-luciferase reporter vector, alone or in association with a Hif1α or control RNAi.

The cells were incubated 24 hours after transfection for 18 hours in a medium without serum, added or not with 100 µM of cobalt chloride in order to produce hypoxic conditions, and then the luciferase activity was measured.

Figure 3 shows a complete inhibition of the induction of the VEGF promoter response to hypoxia that was observed when cells are transfected with Rifα RNAi but not with control RNAi.

EXAMPLE 4: Inhibition of wild-type or mutant forms of androgen receptors in prostate carcinomas

Introduction

Prostatic carcinomas are the second leading cause of cancer mortality for humans in industrialized countries. In France, they are the cause of more than

9,500 deaths per year. Prostatic epithelial cells are dependent on endogenous cells for their growth. Prostatic carcinomas are initially androgen dependent. A chemical castration allows in the first stage to block the growth of the carcinoma. However, in all cases, these carcinomas become androgen-independent and their prognosis is therefore very pessimistic. This androgenoindependence is due, according to individuals, most frequently to a mutation of the receptor (which confers, for example, a response to estrogens or glucocorticoids) or to an amplification of the receptor.

II -Preparation of oligonucleotides

Two RNA oligonucleotides have been synthesized, complementary to a region of the sequence that encodes the human non-mutated androgen receptor (AR). Two deoxynucleotides (TT) have been added at 3 '. In other experiments, siRNAs, called LNCaP, have been used that specifically recognize the androgen receptor (T877A) mutation in LNCaP human prostate carcinoma cells.

-AR:

5 '[GACUCAGCUGCCCCAUCCACG] TT-RNA [DNA] (SEQ ID NO: 15)

5 '[CGUGGAUGGGGCAGCUGAGUC] TT-RNA [DNA] (SEQ ID No. 16)

-Control:

5 '[GAUAGCAAUGACGAAUGCGUA] TT-RNA [DNA] (SEQ ID No. 17)

5 '[UACGCAUUCGUCAUUGCUAUC] RNA-TT [DNA] (SEQ ID No. 18)

-LNCap:

5 '[GCAUCAGUUCGCUUUUGAC] TT-RNA [DNA] (SEQ ID NO: 19)

5 '[GUCAAAAGCGAACUGAUGC] TT-RNA [DNA] (SEQ ID NO: 20)

Several sub-clones of the human prostate carcinoma line LNCaP have been used in this study. The original line, LNCaP is androgen-dependent. LN70 cells, obtained by repeated passages of the LNCaP line in vitro, have a decreased response to androgens. The LNS5 clone, obtained after passage of the cells in the animal, is androgen-resistant.

III -Results

LNCaP cells have been transfected in vitro with siRNAs AR or control siRNAs using the polyfect transfection agent (Qiagen). The cells were released from their support 48 hours after transfection. Half of the cells have been used for western blot detection of the androgen receptor, and the other half have been recultured. The androgen receptor (band at 110 kDa) is no longer detectable by western in cells transfected by siRNA AR (Figure 4A). Cells transfected by the recultured siRNA have been unable to continue their growth, in contrast to cells transfected by the control siRNA.

The level of response to androgens has been measured by transfecting different cell clones of the LNCaP line with a reporter vector arranging the sequence encoding luciferase downstream of a minimal promoter flanked by 4 repeats of the androgen response element (4xARE). After transfection, cells were incubated for 18 hours in the absence of serum and in the presence or absence of a metabolically stable analog of dihydrotestosterone, R1881 (NEN). The relationship of the luciferase activities under these two conditions allows the level of response to androgens of the reporter vector to be measured.

The effect of the cotransfection in these cells of the control RNAi or the RNAi AR on the response to androgens of the different clones of the LNCaP line has been measured.

Figure 4B shows a complete inhibition of the androgen response in the two androgen sensitive clones: LNCaP and LNCaP p70. This method does not allow to measure the response of the androgen-resistant clone LNS5 to treatment by RNAi AR.

The androgen receptor present in the LNCaP line carries a mutation. Two different siRNAs have been used to inhibit its synthesis, the previously used siRNA AR and the LNCaP siRNA which specifically recognizes the LNCaP mutation. The response to androgens has been measured as in experiment 4B (figure 4C).

To study the effect of the inhibition of androgen receptor expression on the in vivo tumor growth of prostate carcinoma cells, LNCaP carcinoma cells, transfected by a control siRNA (group A) or AR (group b) have been injected subcutaneously into male mice without prior treatment. Tumor growth has been monitored at regular intervals. It is observed that the tumors of the animals of group B have started later than those of group A and that the volume of the tumors of group B on the 48th day is clearly smaller than that of the tumors of group A (Figure 4D) .

In another experiment, LNCaP cells have been injected into untreated male mice. When, on the 34th day, the tumors had reached a volume between 1.2 and 1.5 cm 3, the mice received intraperitoneally an injection of 2 µg of control siRNA or AR in 100 µl of PBS. This injection was repeated on the 40th day. It is observed that the administration of siRNA AR causes a

decrease in the rate of tumor growth (Figure 4E).

EXAMPLE 5: Inhibition of wild-type or mutant forms of p53 protein

I-Preparation of oligonucleotides

The three siRNAs whose sequence is indicated below have been prepared, one directed against the wild form of p53, and the other directed against the mutated form expressed in a patient and which has led to the establishment of a line.

This mutation corresponds to one of the three most frequently observed in human tumors.

-

p53 wild:

Sense: [GCAUGAACCGGAGGCCCAU] RNA [TT] DNA (SEQ ID NO: 21) Anti: [AUGGGCCUCCGGWCAUGC] RNA [TT] DNA (SEQ ID NO: 22)

-

p53 MT1 (r248w):

Sense: [GCAUGAACUGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 23) Anti: [AUGGGCCUCCAGWCAUGC] RNA [TT] DNA (SEQ ID No. 24)

-

p53 MT2 (r248w):

Sense: [UCAUGAACUGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 25) Anti: [AUGGGCCUCCAGWCAUGA] RNA [TT] DNA (SEQ ID No. 26)

The

nucleotides underlined on the p53 wild are the mutated on the shape

mutant, and which are italicized in the sequences of the mutated forms of the mutated p53 (p53 MT1 and MT2). The bases above in bold are mutations that have been introduced to increase specificity.

II -Results

As shown in Figure 5B, H1299-NCl cells, which do not express p53, have been transfected (using lipofectamine) by expression vectors (400 ng) of wild-type (WT) or mutated (mt .). SiRNAs (in increasing doses: 0, 125 ng, 250 ng, 500 ng and 1,000 ng) directed against the wild type (WT), the mutated form (MT1 and MT2), or an irrelevant siRNA (C) have been transfected to the Same time. The cells were harvested 24 hours later, and analyzed by western blotting with an antibody directed against p53.

As shown in Figure 5C, the H1299-NCl cells, which do not express p53, have been transfected (using lipofectamine) by the expression vectors (400 ng) of the wild-type (WT), mutated (mt. ), or a mixture of the two (WT + MT), as indicated. SiRNAs (400 ng) directed against the wild type (WT), the mutated form (MT1), or an irrelevant siRNA (C) have been transfected at the same time. The cells were harvested 24 hours later, and analyzed by western blotting (ib: immunoblot) with an antibody directed against p53 (DO1, Santa Cruz), or cellular actin (Sigma) to control the amount of proteins used in essay.

As shown in Figure 5D, U2OS cells (human osteosarcoma expressing a wild type of p53) have been stably transfected either by a vector expressing a mutant form of p53 (R248W), or by the corresponding empty vector (pCDNA3). These lines have been transfected by the indicated siRNAs and the expression of the indicated proteins has been detected by western blotting.

In all cases, siRNA directed against the mutated form of the protein inhibits the mutated form and siRNA directed against the wild-type form inhibits the wild-type form. Furthermore, there is no "cross reaction", since siRNA directed against the wild-type form has no effect on the mutated form and vice versa. It should be noted that the expression of the mutant stabilizes the wild type protein when it is co-expressed. Consequently, the inhibition of the mutant returns, through this indirect effect, the wild form to its base level, without there being any inhibition of the expression of the protein.

As shown in Figure 5E, the cells used in Figure 5D have been transfected by the indicated siRNAs. The cells were then subjected to genotoxic stress by treatment with doxorubicin (200 ng / ml) for 24 hours). Figure 5E shows cell cycle analysis of these cells by propidium iodide incorporation and FACS analysis. Cells not transfected with the mutant form, and therefore expressing only the wild form (PCDNA cells) show a high percentage of stop in G1 in the presence of doxorubicin. Treatment of these cells by wild-type siRNA, decreasing p53, reduces this stop in G1. Cells expressing the mutated and wild-type form (R248W) are poorly stationary in G1 in the presence of doxorubicin, showing that the mutated form inhibits the activity of the wild-type form. When these cells are treated with the mt1 siRNA, they regain a normal ability (to be compared to untreated PCDNA controls) to stand on G1, showing restoration of wild-type p53 activity in these cells.

As shown in Figures 5F, G, H, MDA 087 cells (originating from a patient suffering from Li Fraumeni syndrome and expressing the R248W mutant) have been transfected with a siRNA directed against the mutant form (MT1 ) of p53, or also with an irrelevant siRNA (C) (1.6 µg). The expression of p53 has been detected in these cells by western blotting (Figure 5F), the messenger RNAs have been measured by quantitative PCR (Light cycler, Roche) (Figure 5G)

or immunofluorescence (Figure 5H).

The MDA 087 cells have been transfected with an siRNA that recognizes the wild type (WT) or the mutated form of p53 (mtl) or also with a control siRNA, and then subjected to genotoxic stress by treatment with doxorubicin (200 ng / ml) for 24 hours. The expression of the mutant form of p53 has been detected by western blotting in cells. It is observed that cells that have received mt1 siRNA are not able to stabilize p53 in response to doxorubicin (Figure 5I).

Figure 5J shows the effect of siRNAs mt1 and mt2 in cells expressing wild-type and mutated forms of p53. H1299-NCl cells, which do not express p53, have been transfected (using lipofectamine) by a reporter vector comprising the luciferase gene under the control of a p53 response element and expression vectors (400 ng ) of wild-type (WT), mutated (MT) or a mixture of the two (WT + MT), as indicated. SiRNAs (400 ng) directed against the wild type (WT), the mutated form (mt1, mt2), or an irrelevant siRNA

(C) have been transfected at the same time. The cells were harvested 24 hours later, and analyzed for luciferase expression. Wild p53 alone activates the reporter vector, and co-expression of the mutant form inhibits this activity. Co-transfection of the wild-type siRNA inhibits the expression of the wild-type protein and thus the residual activation of the reporter gene. Co-transfection of the mt1 and mt2 siRNAs, on the contrary, restores this activation by selectively blocking the expression of the mutated form and preventing the negative transdominant effect it exerts on the wild-type p53 form.

Figure 5K shows a similar result on the expression of one of the targets of p53, the cell proliferation inhibitor protein p21, in cells treated as in Figure 5F. Expression of p21, detected by western blotting, is activated by wild-type p53 and is inhibited when the mutant is co-expressed. This inhibition is lifted in the presence of mt1 siRNA.

EXAMPLE 6: Inhibition of the viral protein E6

I-Preparation of oligonucleotides

An siRNA directed against the HPV E6 protein has also been prepared. Respond to the following sequence:

-HPV-16-S2

Direction: 5 '[CCACAGUUAUGCACAGAGC] RNA [TT] DNA (SEQ ID No. 27) Anti: 5 '[GCUCUGUGCAUAACUUGG] RNA [TT]] DNA (SEQ ID NO: 28)

II -Results

As shown in Figure 6B, CasKi and SiHA cells, both expressing the HPV E6 protein, have been transfected with the indicated siRNAs, treated or not as indicated by doxorubicin and analyzed by western blotting using the antibodies. indicated. Treatment of cells by siRNA E6 induces increased expression of p53. This expression of p53 is translated by an increase in the expression of the protein p21.

As shown in Figure 6C, the cell cycle of SiHA cells treated as in Figure 6B has been analyzed by FACS. The figure represents a typical experiment. An increase in cells in G1 phase (Figure 6D) is observed in cells treated by siRNA E6, an increase that is also observed in these cells when they are treated with doxorubicin.

EXAMPLE 7: Effect of RNA / RNA oligonucleotides and DNA / RNA hybrids

Introduction

The invention envisions the use of hybrid DNA / RNA oligonucleotides as an alternative to RNA / RNA oligonucleotides to specifically inhibit the expression of a gene. In the case of DNA / RNA hybrids, the sense strand is preferably DNA in nature and the anti-sense strand is RNA in nature. The other aspects that refer in particular to the size of the oligonucleotides, the nature of the 3 'ends and the mode of synthesis, are the same as for the RNA / RNA oligonucleotides. The applications of these DNA / RNA hybrids are identical to those described above for siRNA / RNA, in particular with regard to therapeutic applications, for the purpose of diagnosis or gene validation. The oligonucleotide doses used to obtain the same effects with DNA / RNA and RNA / RNA hybrids may however be different.

II -Preparation of oligonucleotides

The sense strand is one whose sequence is identical to that of the messenger RNA. The antisense strand is the complementary strand of the sense strand. By convention, in a duplex, the nature of the strands is indicated in the sense / anti-sense order. Thus, for example, a DNA / RNA hybrid, annotated D / R is an oligonucleotide whose sense strand is DNA in nature and the antisense strand is RNA in nature and has a complementary sequence to messenger RNA.

In the experiments described, the oligonucleotides whose sequence is indicated below have been used.

-For GFP:

GAP

Sense: [GCAAGCTGACCCTGAAGTTCAT] DNA (SEQ ID No. 29)

Antisense: [GAACUUCAGGGUCAGCUUGCCG] RNA (SEQ ID No. 30)

GFP control:

Sense: [CAUGUCAUGUGUCACAUCUC] RNA [TT] DNA (SEQ ID No. 31)

Antisense: [GAGAUGUGACACAUGACAUG] RNA [TT] DNA (SEQ ID No. 32)

-For LNCaP: The underlined bases below correspond to the androgen receptor mutation expressed in human prostate carcinoma cells (LNCap).

LNCaP: Sense: [GCATCAGTTCGCTTTTGACTT] DNA (SEQ ID No. 33)

[GCAUCAGUUCGCUUUUGAC] RNA-TT [DNA] (SEQ ID No. 34) Antisense: [GTCAAAAGCGAACTGATGCTT] DNA (SEQ ID No. 35)

[GUCAAAAGCGAACUGAUGC] RNA-TT [DNA] (SEQ ID No. 36) LNCaP control: Sense: [GUUCGGUCUGCUUACACUA] RNA-TT [DNA] (SEQ ID No. 37) Antisense: [UAGUGUAAGCAGACCGAAC] RNA-TT [DNA] (SEQ ID NO: 38)

-For P53: The DNA strands of the annotated hybrids H1 comprise RNA bases (U,

underlined). The mutation present in the MT1 oligonucleotides is indicated in italics. WT: Sense: 5 '[GCAUGAACCGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 39)

Anti: 5 '[AUGGGCCUCCGGUUCAUGC] RNA [TT] DNA (SEQ ID NO: 40) wtH1 D / R: Direction: 5 '[GCAUGAACCGGAGGCCCAUTT] DNA (SEQ ID No. 41)

Anti: 5 '[AUGGGCCUCCGGWCAUGC] RNA [TT] DNA (SEQ ID NO: 42) wt H1 R / D: Direction: 5 '[GCAUGAACCGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 43)

Anti: 5 '[AUGGGCCUCCGGUUCAUGCTT] DNA (SEQ ID NO: 44) wt H2 D / R: Sense: 5 '[GCATGAACCGGAGGCCCATTT] DNA (SEQ ID No. 45)

Anti: 5 '[AUGGGCCUCCGGUUCAUGC] RNA [TT] DNA (SEQ ID No. 46)

wt H2 R / D:

Direction: 5 '[GCAUGAACCGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 47) Anti: 5' ATGGGCCUTCCGGTTCATGCTT] DNA (SEQ ID No. 48)

Mtl (r248w) **:

Direction: 5 '[GCAUGAACUGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 49) Anti: 5' [AUGGGCCUCCAGUUCAUGC] RNA [TT] DNA (SEQ ID No. 50)

Mtl H1 D / R:

Direction: 5 '[GCAUGAACUGGAGGCCCAUTT] DNA (SEQ ID No. 51) Anti: 5' [AUGGGCCUCCAGUUCAUGC] RNA [TT] DNA (SEQ ID No. 52)

Mtl H1 R / D:

Direction: 5 '[GCAUGAACUGGAGGCCCAU] RNA [TT] DNA (SEQ ID No. 53) Anti: 5' AUGGGCCUCCAGUUCAUGCTT] DNA (SEQ ID No. 54)

Mtl H2 D / R:

Direction: 5 '[GCATGAACTGGAGGCCCATTT] DNA (SEQ ID No. 55) Anti: 5' [AUGGGCCUCCAGUUCAUGC] RNA [TT] DNA (SEQ ID No. 56)

Mtl H2 R / D:

Direction: 5 '[GCATGAACTGGAGGCCCAT] RNA [TT] DNA (SEQ ID No. 57) Anti: 5' [AUGGGCCUCCAGUUCAUGCTT] DNA (SEQ ID No. 58)

II -Results

1) Inhibition of GFP (Green Fluorescent Protein) by DNA / RNA hybrids

The control siRNAs (R / R) or GFP (D / R) in increasing doses have been introduced by transfection using the Polyfect kit into the myoblasts of C2C12 mice, at the same time as a GFP expression vector. The level of GFP has been monitored by western blotting (Figure 7A) and by direct measurement of the fluorescence emitted by GFP with the help of a fluorimeter (Figure 7B). Strong inhibition (up to 80%) of GFP expression by DNA / RNA hybrid siRNAs is observed.

2) Inhibition of the androgen receptor by DNA / RNA hybrids.

LNCaP cells have been transfected with a reporter vector that puts luciferase under the control of a promoter containing 4 androgen receptor response elements. The R / R, D / R or R / D siRNAs indicated in the figure were transfected 24 hours later by the transfection agent Transit-tKO (Mirus) at a rate of 250 ng of each double stranded for 80,000 cells. The cells were incubated in a complete medium containing androgens, and the luciferase activity, normalized with respect to the amount of proteins in each sample, was measured 24 hours later (FIG. 7C). The R / D hybrids did not show any inhibitory activity in this experiment. LNCaP D / R hybrids inhibit the androgen receptor as effectively as R / R siRNAs.

3) Inhibition of p53 by DNA / RNA hybrids

Figure 7D shows that H1 D / R hybrids are as effective as R / R in inhibiting gene expression. The H1299-NCl cells, which do not express p53, have been transfected (using lipofectamine) by expression vectors (400 ng) of wild type (WT), mutated (MT) or a mixture of the two (WT + MT), as indicated. A CMV-GFP vector has also been transfected as an internal control. SiRNAs (400 ng) directed against the wild type (WT), the mutated form (MT), or an irrelevant siRNA (CTRL) have been transfected at the same time. The cells were harvested 24 hours later, and analyzed by western blotting with an antibody directed against p53 (DO1, Santa Cruz), or GFP (Sant-Cruz) to monitor the efficiency of transfection. Note: expression of the mutated form of the protein stabilizes the wild-type form.

Figure 7E shows that H2 D / R hybrids are as effective as R / Rs in inhibiting gene expression. The H1299-NCl cells, which do not express p53, have been transfected (using lipofectamine) by expression vectors (400 ng) of wild type (WT), mutated (MT) or a mixture of the two (WT + MT), as indicated. SiRNAs (400 ng) directed against the wild type (WT), the mutated form (MT), or an irrelevant siRNA (C) have been transfected at the same time. The cells were harvested 24 hours later and analyzed by western blotting with an antibody directed against p53 (DO1, Santa Cruz).

EXAMPLE 8: In vivo administration of siRNA by different routes

Tumor cells stably expressing luciferase have been injected subcutaneously into naive mice (1 million cells on the right flank). On the 8th day of tumor growth, tumors having a mean volume of 200 mm3 were injected either with a control siRNA (mixed sequence of HIF1 alpha, see example 3), or with a siRNA directed against luciferase. The control siRNAs (3 µg / mouse) were injected in a volume of 50 µl of PBS subcutaneously in the flank of the animal.

The siRNAs luciferase have been injected at a rate of 3 µg / mouse (3 animals in each group) in 50 µl of PBS subcutaneously (sc), intraperitoneally (ip) or intravenously (iv) (vein of the tail) or intratumorally (it). In the latter case, the siRNAs luciferase (3 µg / mouse) have been diluted in 20 µl of PBS only.

Three days after the injection of the siRNAs, the animals have been sacrificed, the tumors have been extracted and homogenized with the help of a polytron grinder. On the homogenates, a dosage of the proteins and a measurement of the luciferase activity have been carried out in a luminometer.

The results represented in figure 8 show the luciferase activity applied to the amount of protein.

Table 2 Annex A

APL disease (acute promyelocytic leukemia)

PML-RARalpha fusion protein PLZF-RARalpha NPM-RARalpha NuMA-RARalpha STATSbeta / RARalpha Chromosomal translocation t (15, 17) (q22, q21) t (11, 17) (q23, q21) t (5, 17) (q32, q12) t (5, 17) (q13, q21)

ALL (acute lymphoblastic leukemia)

TEL-AML1 BCR / ABL MLLIAF4 t (12,21) (p13, q22) t (9,22) (q34, q 11) t (4,11) (q21, q23)

ALL-translocation CALM / AF10 ALL1 / AF4

t (12:21) (q12; q22) t (10; 11) (p12-p13; q14-q21) t (4; 11)

E2A / HLF

t (17,19) (q22, p13)

AML (acute myeloid leukemia)

TLS / FUS-ERG MLL-AF10 MLL-ABI1 t (16; 21) (p11; q22) AML (M7) t (10; 11) (p12-p13; q23); t (10; 11)

HLXB9-ETV6 MLL-ELL CBFbeta / MYH11 AML1-MTG8 TEL-TRKC AML1 / ETO CALM / AF10 ETV6-BTL CBFbeta-SMMHC FUS / ERG

t (7; 12) (q36; p13) t (11; 19) (q23; p13.1) inv [16] t (8; 21) t (12; 15) (p13; q25) t (8; 21 ) t (10,11) (p12-p13; q 14-q21) t (4; 12) (q11-q12; p13). inv (16) (p13; q22) t (16; 21) (p11; q22)

DEK / CAN MLL-AF9

t (6,9) (p23; q34). t (9; 11) (p22; q23)

MLL-ENL MLL-AF4

(11q23) t (4,11) (q21, q23)

MLL-AF6 MLL-AF17

t (6,11) (q27,23) t (11,17) (q23, q21)

MLL-AFX

t (X; 11) (q13; q23).

MLL-AF1p

MLL-AF1q

t (1,11) (q21, q23)

MLL self MLL-CBP

t (11,16) (q23, p13)

References

From The et al. Cell 1991, 66: 675 ChenZ et al. EMBOJ 1993, 12: 1161 Redner RL et al. Blood 1996, 87: 882 Wells RA et al. Leukemia 1996, 10: 735 Arnould C et al. Hum. Mol Genet. 1999, 8: 1741

Domer PH et al. Proc Natl Acad Sci USA 1993, 90: 7884-8

Dreyling MH et al. Proc Natl Acad Sci USA 1996, 93: 4804 Janssen JW et al. Blood 1994, 84: 3835

Hunger SP

et to the. Genes Dey 1992,

6: 1608

Ichikawa

H et to the. Cancer Beef 1994,

54: 2865

Borkhardt A et al. Leukemia 1995, 9: 1796

Shibuya et al. Genes Chromosomes Cancer 2001, 32: 1 Beverloo et al. Cancer Res 2001, 61: 5374 Rubnitz JE et al. Blood 1996, 87: 4804 Tobal K et al. BrJ Haematol 1995, 91: 104 Miyoshi et al. EMBO J 1993, 12: 2715 Eguch et al. Blood, 1999, 93: 1355 Kusec R et al. Leukemia, 1994, 8: 735 Dreyling MH et al. Proc Natl Acad Sci USA 1996, 93: 4804

Cools et al. Blood 1999, 94: 1820 Wijmenga C et al. Proc Natl Acad Sci U S A 1996, 93: 1630

Panagopoulos I et al. Genes Chromosomes Cancer, 1994, 11: 256

on Lindem M et al. Mol Cell Biol, 1992, 12: 1687 Super HJ et al. Blood, 1995, 85: 855 Schreiner SA et al. Leukemia 1999, 13: 1525 Domer PH et al. Proc NatI Acad Sci USA 1993, 90: 7884 Tanabe S et al. Genes Chromosomes Cancer 1996, 15: 206 Prasad R et al. Proc Natl Acad Sci U S A 1994, 91: 8107 Borkhardt A et al. Oncogene 1997,14: 195 So CW et al. Leukemia 2000, 14: 594

Table 2 (continued) Annex A

Disease

Protein Translocation References

fusion

chromosome

AML1-ETO

t (8; 21) Busson-Le Coniat M et to the. Leukemia

1999, 13: 302

So CW et al. Cancer Res 1997, 57: 117

Taki T et al. Blood 1997, 89: 3945

Erickson P et al. Blood 1992, 80: 1825

MDS / AML

NPM-MLF1 t (3,5) (q25.1, q34) Yoneda-Kato N et to the. Oncogene 1996,

(myelodysplasia /

12: 265

acute myeloid

leukemia)

CML (chronic

Bcr-Ab1 / p210 Ben-neriah AND et to the. Science 1986,

myelogenous

233: 212

leukemia)

AML1-MDS1-EVI1 t (3,21) (q26, q22) Fears S et al. Proc Natl Acad Sci U S A

1996, 93: 1642

(AME)

BpALL (cell acute

TEL-AML1 t (12; 21) (p13; q22) Golub TR et al. Proc Natl Acad Sci U S A

lymphoblastic

1995, 92: 4917

leukemia)

MPD

TEL-JAK2 t (9; 12) (p24; q13) Lacronique et to the. Science 1997, 278

(myeloproliferative

: 1309

disease)

TEL-PDGFbetaR t (5,12) (q33, p13) Jousset C et al. EMBO J, 1997, 16: 69

TEL-TRKC

t (12; 15) (p13; q25) Eguch et al. Blood, 1999, 93: 1355

CMML (chronic

involving PDGFbetaR t (5,17) (q33, p13) Magnusson et al. Blood 2001 98: 2518

myelomonocytic

HIP1 / PDGFbetaR t (5,7) (q33; q11.2) Ross TS et al. Blood 1998, 91: 4419

leukemia)

TEL / PDGFbetaR t (5,12) (q33, p13) Tomasson MH et al. Blood 1999, 93: 1707

MALT (gastric

API2-MALT1 t (11,18) (q21, q21) Motegi M et to the. A.M J Pathol 2000,

mucous membrane

156: 807

associated

lymphoid tissue

lymphoma)

ALCL (anaplastic

NPM-ALK t (2; 5) (p23; q35) Waggott W et to the. Br J Haematol 1995,

large cell

89: 905

lymphoma)

SU-DHL-1 t (2; 5) Siminovitch KA et al. Blood 1986, 67: 391

ATIC-ALK

inv (2) (p23q35) Colleoni GW et al. Am J Pathol 2000,

156: 781

ALK-related

t (2,17) (p23, q25) Maes et al. Am J Pathol 2001, 158: 2185

translocation

MPD

NUP98-HOXA9 t (7; 11) (p15; p15) Nakamura T et to the. Nat Genet nineteen ninety six,

(myeloproliferative

12: 154

disease)

APP (amyloid

APP + 1 (38-kDa) Hersberger et to the. J Neurochem 2001

protein precursor)

76 (5): 1308-14

in sporadic

Alzheimer's

disease (AD) or

Down's syndrome

primary pleural

SYT-SSX1 t (X; 18) (p11.2; q11.2) Crew AJ et al. EMBO J 1995,14: 2333

monophasic

SYT-SSX2 t (X; 18) (p11.2; q11.2) Crew AJ et al. EMBO J 1995,14: 2333

synovial sarcomas

(H.H)

Dermatofibrosarco COL1A1 / PDGFB

t (17; 22) O'Brien KP et al. Chromosomes genes

ma protuberans

rearrangement Cancer 1998, 23: 187

(DP)

Table 2 (continued) Annex A

Disease

Protein Translocation References

fusion

chromosome

ARMS (pediatric

EWS-FLII Athale et to the. J Pediatr Hematol Oncol

alveolar

2001, 23:99

rhabdomyosarcom EWS-ERG

t (11; 22) (q24; q12) Sorensen PH et to the. Nat Genet 1994,

to)

6: 146

ESFT (Ewing

PAX3-FKHR t (2,13) (q35, q14) Fredericks W J et to the. Mol Cell Biol

sarcoma family of

1995.15: 1522

tumors)

PAX7-FKHR t (1,13) (p36, q14) Barr FG et al. Hum Mol Genet 1996, 5:15

DSRCT

EWS-WTI t (11:22) (p13: q12) Benjamin et al. Med Pediatr Oncol 1996

(desmoplastic

27 (5): 434-9

small round cell

EWS / FI-1 t (11-22) (q24; q12) Fidelia-Lambert et al. Hum Pathol 1999,

tumors)

30:78

MM (multiple

IGH-MMSET t (4; 14) (p16.3; q32) Malgeri et al. Cancer Res 2000 60: 4058

myeloma)

MPD (stem cell

FGFR1-CEP110 t (8,9) (p12, q33) Guasch et al. Blood 2000 95: 1788

myeloproliferative

disorder)

Ewing sarcoma

EWS-FEV t (2,22) (q13, q22, t (3, 18) Llombart-Bosch et to the. Diagn Mol Pathol

(EN) -peripheral

(p21; q23) 2000, 9: 137

primitive

EWS-FLI1 t (11; 22; 14) (q24; q12; q11) Bonin G et al. Cancer Res 1993, 53: 3655

neuroectodermal

tumor (pPNET)

EWS-ERG

t (21; 22) (q22; q12) Sorensen PH et to the. Nat Genet. 1994,

6: 146

ETV6 / CBFA2

t (12; 21) (p12; q22) Fears S et to the. Genes Chromosomes

Cancer 1996, 17: 127

MLS (myxoid

FUS / CHOP t (12,16) (q13, p11) Rabbitts TH et al. Nat Genet 1993, 4: 175

liposarcomas)

EWS / CHOP t (12; 22; 20) (q13; q12; q11) Zinszner H et al. Genes Dev 1994, 8: 2513

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

image 1

SEQUENCE LIST

<110> CENTER NATIONAL DE LA RECERCHE SCIENTIFIQUE

<120> Inhibitory oligonucleotides, and their use to specifically repress a gene

<130> 24240PCT November 2002

<140> pct / fr02 / xxxxx

<141> 11/08/2002

<150> FR01 / 14549

<151> 11/09/2001

<150> FR02 / 04474

<151> 04/10/2002

<160> 77

<170> Patentln version 3.1

<210> 1

<211> 1182

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (1182)

<223> Sequence of the p53 gene

<400> 1 <210> 2

image 1

<211> 7904 <212> DNA 5 <213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (7904) 10 <223> HPV16 variant

<400> 2

image3

image 1

image 1

<210> 3

<211> 22

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (20)

<223> sense strand of PML-rare

<220>

<221> misc_feature

<222> (21) .. (22)

<223> thymine residues added

<400> 3

caugucaugu gucacaucuc tt

<210> 4

<211> 22

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature <222> (1) .. (20) <223> anti-sense strand of PML-rare

<220> <221> misc_feature <222> (21) .. (22) <223> thymine residues added

<400> 4

gagaugugac acaugacaug tt

22

<210> 5 <211> 22 <212> DNA <213> Homo sapiens <220> <221> misc_feature <222> (1) .. (20) <223> strand sense PLM-rare <220> <221> misc_feature <222> (21) .. (22) <223> added thymine residues <400> 5

ggggaggcag ccauugagac tt

22

<210> 6 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> anti-sense strand PML-rare

<220> <221> misc_feature <222> (21) .. (22) <223> Added thymine residues

<400> 6

gucucaaugg cugccucccc tt

22

<210> 7

<211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> Sequence from human VGEF

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 7

augugaaugc agaccaaaga att

2. 3

<210> 8 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from human VEGF

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 8

uucuuugguc ugcauucaca utt

2. 3

<210> 9 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> sequence from human VEGF

<220> <221> misc_feature

<222> (21) .. (22) <223> thymine residues added

<400> 9

caugucaugu gucacaucuc tt

22

<210> 10 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> sequence from human VEGF

<220> <221> misc_feature <222> (21) .. (22) <223> thymine residues added

<400> 10

gagaugugac acaugacaug tt

22

<210> 11 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from human HIF 1 alpha

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 11

caugugacca ugaggaaaug att

2. 3

<210> 12 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from human HIF 1 alpha

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 12

ucauuuccuc auggucacau gtt

2. 3

<210> 13 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from human HIF 1 alpha

<220> <221> misc feature <222> (22) .. (23) <223> thymine residues added

<400> 13

gauagcaaug acgaaugcgu att

2. 3

<210> 14 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> Sequence from human HIF 1 alpha

<220> <221> misc_feature <222> (22) .. (23) <223> Sequence from human HIF 1 alpha

<400> 14

uacgcauucg ucauugcuau ctt

2. 3

<210> 15 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from the human androgen receptor

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 15

gacucagcug ccccauccac gtt

2. 3

<210> 16 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (21) <223> sequence from human HIF 1 alpha

<220> <221> misc_feature <222> (22) .. (23) <223> thymine residues added

<400> 16

cguggauggg gcagcugagu ctt

2. 3

<210> 17 <211> 23 <212> DNA <213> Homo sapiens

<220> <221> misc_feature

<222> (1) .. (21)

<223> sequence from human HIF 1 alpha

<220>

<221> misc_feature

<222> (22) .. (23)

<223> thymine residues added

<400> 17

gauagcaaug acgaaugcgu att 23

<210> 18

<211> 23

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (21)

<223> sequence from human HIF 1 alpha

<220>

<221> misc_feature

<222> (22) .. (23)

<223> thymine residues added

<400> 18

uacgcauucg ucauugcuau ctt 23

<210> 19

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> Sequence from the androgen receptor containing the T8 77A mutation

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 19 gcaucaguuc gcuuuugact t 21

<210> 20

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from the androgen receptor containing the T8 77A mutation

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 20

gucaaaagcg aacugaugct t 21

<210> 21

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from wild-type human p53 (sense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 21

gcaugaaccg gaggcccaut t 21

<210> 22

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from wild-type human p53 gene (antisense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 22

augggccucc gguucaugct t 21

<210> 23

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc feature

<222> (1) .. (19)

<223> sequence from mutated human p53 containing the mutation MT1 (r248w) (sense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 23

gcaugaacug gaggcccaut t 21

<210> 24

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human p53 containing the MT1 (r248w) mutation (antisense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 24 augggccucc aguucaugct t 21

<210> 25

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human p53 containing the mutation MT2 (r248w) (sense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 25

ucaugaacug gaggcccaut t 21

<210> 26

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human p53 containing the MT2 (r248w) mutation (antisense)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 26

augggccucc aguucaugat t 21

<210> 27

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19) <223> sequence from HPV E6 (sense)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 27

ccacaguuau gcacagagctt

twenty-one

<210> 28 <211> 20 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (18) <223> sequence from HPV E6 (antisense)

<220> <221> misc_feature <222> (19) .. (20) <223> thymine residues added

<400> 28

gcucugugca uaacuuggtt

twenty

<210> 29 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (22) <223> sequence from the gene that encodes GFP (sense strand)

<400> 29

gcaagctgac cctgaagttc at

22

<210> 30 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (22) <223> sequence from the gene that encodes GFP (anti-sense strand)

<400> 30

gaacuucagg gucagcuugc cg

22

<210> 31 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> sequence from the gene that encodes GFP (sense strand)

<220> <221> misc_feature <222> (21) .. (22) <223> thymine residues added

<400> 31

caugucaugu gucacaucuc tt

22

<210> 32 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> sequence from the gene that encodes GFP (antisense strand)

<220> <221> misc_feature <222> (21) .. (22) <223> thymine residues added

<400> 32

gagaugugac acaugacaug tt

22

<210> 33

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (21)

<223> sequence from mutated human androgen receptor (sense strand)

<400> 33

gcatcagttc gcttttgact t 21

<210> 34

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human androgen receptor (sense strand)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 34

gcaucaguuc gcuuuugact t 21

<210> 35

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (21)

<223> sequence from mutated human androgen receptor (sense strand)

<400> 35

gtcaaaagcg aactgatgct t

twenty-one

<210> 36

<211> 21

<212> DNA <213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human androgen receptor (sense strand)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 36

gucaaaagcg aacugaugct t 21

<210> 37

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human androgen receptor (sense strand)

<220>

<221> misc_feature

<222> (20) .. (21)

<223> thymine residues added

<400> 37

guucggucug cuuacacuat t 21

<210> 38

<211> 21

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from mutated human androgen receptor (antisense strand)

<220>

<221> misc_feature

<222>

(20) .. (21)

<222>

(1) .. (3933)

-103

<223> thymine residues added

<400> 38

uaguguaagc agaccgaact t

twenty-one

<210> 39 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 39

gcaugaaccg gaggcccaut t

twenty-one

<210> 40 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 40

augggccucc gguucaugct t

twenty-one

<210> 41 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 41

gcaugaaccg gaggcccaut t

twenty-one

<210> 42 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 42

augggccucc gguucaugct t

twenty-one

<210> 43 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from the mutated p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 43

gcaugaaccg gaggcccaut t

twenty-one

<210> 44 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 44

augggccucc gguucaugct t

twenty-one

<210> 45 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from the mutated p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 45

gcatgaaccg gaggcccattt

twenty-one

<210> 46 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19)

<223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 46

augggccucc gguucaugct t

twenty-one

<210> 47 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 47

gcaugaaccg gaggcccaut t

twenty-one

<210> 48 <211> 22 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (20) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (21) .. (22) <223> thymine residues added

<400> 48

atgggccutc cggttcatgc tt

22

<210> 49 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 49

gcaugaacug gaggcccaut t

twenty-one

<210> 50 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc feature <222> (20) .. (21) <223> thymine residues added

<400> 50

augggccucc aguucaugct t

twenty-one

<210> 51 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220>

<221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 51

gcaugaacug gaggcccaut t

twenty-one

<210> 52 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 52

augggccucc aguucaugct t

twenty-one

<210> 53 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 53

gcaugaacug gaggcccaut t

twenty-one

<210> 54 <211> 21 <212> DNA

<213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 54

augggccucc aguucaugct t

twenty-one

<210> 55 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 55

gcatgaactg gaggcccatt t

twenty-one

<210> 56 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 56

augggccucc aguucaugct t

twenty-one

<210> 57 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (sense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> added thymine residues <400> 57

gcatgaactg gaggcccatt t

twenty-one

<210> 58 <211> 21 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from mutated human p53 gene (antisense strand)

<220> <221> misc_feature <222> (20) .. (21) <223> thymine residues added

<400> 58

augggccucc aguucaugct t

twenty-one

<210> 59 <211> 3933 <212> DNA <213> Homo sapiens

<220> <221> misc_feature

<223> Homo sapiens hypoxia-inducible factor 1 sub-unit alpha. (HIF-1 alpha)

<400> 59

image 1

image 1

<210> 60 5 <211> 3166

<212> DNA

<213> Homo sapiens

<220> 10 <221> misc_feature

<222> (1) .. (3166)

<223> VEGF A human

<400> 60 15

image 1

image 1

<210> 61 <211> 17 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (17) <223> sequence from wild-type human p53 gene

<400> 61

gaggtgcgtg tttgtgc

17

<210> 62 <211> 19 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene

<400> 62

gcatgaaccg gaggcccat

19

<210> 63 <211> 19 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene

<400> 63

gcatgaaccg gaggcccat

19

<210> 64 <211> 19 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene

<400> 64

gcatgaaccg gaggcccat

19

<210> 65 <211> 19 <212> DNA <213> Homo sapiens

<220> <221> misc_feature <222> (1) .. (19) <223> sequence from wild-type human p53 gene

<400> 65

ctgcatgggc ggcatgaac

19

<210> 66 <211> 19 <212> DNA <213> Homo sapiens

<220> <221> misc_feature

<222> (1) .. (19)

<223> sequence from wild-type human p53 gene

<400> 66

tgggagagac cggcgcaca

19

<210> 67

<211> 19

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from wild-type human p53 gene

<400> 67

tgtgaggcac tgcccccac 19

<210> 68

<211> 20

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (20)

<223> sequence from wild-type human p53 gene

<400> 68

taacagttcc tgcatgggcg 20

<210> 69

<211> 17

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (17)

<223> sequence from the mutated human p53 gene containing the r273h mutation

<400> 69

gaggtgcatg tttgtgc

17

<210> 70

<211> 19

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from the mutated human p53 gene containing the r248q mutation

<400> 70

gcatgaacca gaggcccat 19

<210> 71

<211> 18

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (18)

<223> sequence from the mutated human p53 gene containing the r248w mutation

<400> 71

gcatgaactg gaggccat 18

<210> 72

<211> 19

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from the mutated human p53 gene containing the r249s mutation

<400> 72

gcatgaaccg gagtcccat

19

<210> 73

<211> 19

<212> DNA

<213> Homo sapiens

<220> <221> misc_feature

<222> (1) .. (19)

<223> sequence from the mutated human p53 gene containing the g245s mutation

<400> 73

ctgcatgggc agcatgaac 19

<210> 74

<211> 19

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from the mutated human p53 gene containing the r282w mutation

<400> 74

tgggagagac tggcgcaca 19

<210> 75

<211> 19

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (19)

<223> sequence from the mutated human p53 gene containing the r175h mutation

<400> 75

tgtgaggcgc tgcccccac 19

<210> 76

<211> 20

<212> DNA

<213> Homo sapiens

<220>

<221> misc_feature

<222> (1) .. (20)

<223> sequence from the mutated human p53 gene containing the c242s mutation

<400> 76

taacagttcc tccatgggcg

twenty

5

<210> 77 <211> 3231 <212> DNA <213> Homo sapiens

10

<220> <221> misc_feature <222> (1) .. (3231) <223> sequence encoding the human androgen receptor.

<400> 77

image 1

image 1

Claims (5)

Claims

1.

Double-stranded oligonucleotide, characterized in that it is made up of two complementary oligonucleotide sequences that form a hybrid that each comprise at one of their 3 'or 5' ends from one to five unpaired nucleotides that form single-stranded ends overflowing the hybrid, one of them being oligonucleotide sequences complementary to a target sequence that belongs to a DNA or RNA molecule of a gene that encodes a mutated or non-mutated androgen receptor, one of said oligonucleotide sequences being represented in the sequence listing in annex with the SEQ number ID No. 15 or SEQ ID No. 16.

2.

The oligonucleotide according to claim 1, characterized in that it is coupled to substances that promote or allow its penetration, targeting or targeting into cells.

3.

Composition, in particular pharmaceutical, to be used for therapeutic or diagnostic purposes, characterized in that it comprises as active agent at least one oligonucleotide according to any of claims 1 or 2.

Four.

Use of an oligonucleotide according to any one of claims 1 or 2, for the treatment of cancer.

5.

Use according to claim 4, characterized in that said cancer is prostate cancer.

1/14