ES2343884T3 - NEW BACTERIAL FITASAS AND PROCEDURE FOR PREPARATION OF SUCH FITASAS. - Google Patents

Abstract

Isolated polynucleotide encoding a phytase, characterized in that it is selected from the group consisting of: (a) an isolated polynucleotide encoding the phytase described by the sequence identifier SEQ ID No. 2 (b) an isolated polynucleotide that hybridizes to polynucleotide according to (a) under astringent conditions (c) an isolated polynucleotide having at least 70% identity with the polynucleotide according to (a) said phytase having an optimum pH of activity less than or equal to 4.

Description

New bacterial phytases and procedure preparation of said phytases.

The present invention relates to new phytases of bacterial origin, as well as their respective preparation procedures. The present invention relates more particularly to new phytases from bacteria of the genus Acidocella , as well as to the polynucleotides encoding these phytases. The invention also relates to vectors containing these polynucleotides, and to transformed host organisms that express said phytases in their tissues. The invention also relates to new bacterial extracts comprising at least one phytase activity.

In particular, the bacterial extracts and phytases of the present invention are particularly adapted to their use in food compositions intended for animal feed. This adaptation is related to its properties, in particular its activity under conditions of temperature and pH corresponding to the conditions of preparation of said compositions as well as those found in the digestive system of
animals.

Phosphorus is an essential element for life of all organisms. In particular, it is essential for farm animal breeders make sure their animals ingest a sufficient quantity to optimize its growth and its developing. Most farm animals are fed with food compositions based on vegetables. These Vegetables contain large amounts of phosphate that store in its tissues in the form of a reserve compound, phytic acid. On average, phytic acid contains 50 to 70% of phosphorus present in plants. Phytic acid is naturally mobilized and the phosphate it contains is released in most of the farm animals, particularly ruminants. However the phytic acid is not metabolized by monogastric animals such as pig and poultry. In these animals, the phytic acid contained in your food ration is therefore evacuated with excrement, and the breeder must complete said ration with inorganic phosphate so that your animals ingest a sufficient amount of phosphorus. This strategy generates an extra cost for the breeder and pollution from the emission into the environment of the non-assimilated phytic acid. This Pollution is even more important in breeding areas intense

Phytic acid is also known to be a chelator of important nutritional elements contained in the food ration, such as magnesium, calcium, zinc or iron This property leads to a decrease in nutritional quality of the food ration that gives phytic acid the property of anti-nutritional agent.

In order to respond to the different inconveniences related to the absence of assimilation of phytic acid by monogastric animals, it is planned to introduce an enzyme, phytase, into the food ration of these breeding animals. Phytase hydrolyzes the phytic acid releasing inositol and inorganic phosphate. Phytases and the genes encoding these phytases have been isolated from numerous organisms. Phytases have been mostly isolated from fungi (Howson and Davis, 1983, Enzyme Microb. Technol. 5, 377-382; Wyss et al ., 1999, Appl. Environ. Microbiol., 65 (2), 359-366 ). Among the fungi that produce a phytase, fungi of the genus Aspergillus , in particular A. ficuum (Ullah and Gibson, 1987, Preparative Biochemistry 17 (1), 63-91; Ullah and Dischinger, 1993, Biochem. Biophys. Res. Commun., 192 (2), 747-753), A. terreus (Mitchell et al ., 1997, Microbiology, 143 (Pt 1), 245-252), A. niger (Dvorakova et al ., 1997, Folia Microbiol (Praha), 42 (4), 349-352), A. fumigatus (Pasamontes et al ., 1997, Appl. Environ. Microbiol., 63 (5), 1696-1700), of the genus Penicillium , in particular P. caseicolum , of the genus Myceliophtora , in particular M. thermophila (Mitchell et al ., 1997, Microbiology, 143 (Pt 1), 245-252), of the genus Talaromyces , in particular T. thermophilus , of the genus Neurospora , in particular N. crassa and N. sitophila , of the genus Thermomyces , in particular T. lanuginosus (Berka et al ., 1998, Appl Environ Microbiol. 64 (11), 4423-4427), or of the genus Monascus , in particular M. anka . Also, some phytases have been found in bacteria. By way of example, the bacteria of the Bacillus genera, in particular B. subtilis (Powar and Jagannathan, 1982, J. Bacteriol. 151 (3), 102-1108; Shimizu, 1992, Biosci. Biotech. Biocem. 56 (8), 1266-1269; Keruvo et al ., 1998, Appl. Environ. Microbiol. 64 (6), 2079-2085), Pseudomonas (Cosgrove, 1970, Austral. J. Biol. Sci. 23, 1207- 1220), Escherichia , in particular E. coli (Golovan et al ., 2000, Can. J. Microbiol. 46, 59-71), Enterobacter (Yoon et al ., 1996, Enzyme and microbiol. Technol; 18, 449- 454), or Streptomyces . Yeast phytases have also been isolated (Dvorakova, 1998, Folia Microbiol. 43 (4), 323-338), such as those of Schwaniiomyces occidentalis and Saccharomyces cerevisiae yeasts. Finally, some phytases have been found in plants, particularly in soybeans (Ullah and Gibson, 1988, Arch. Biochem. Biophys., 260 (2), 514-20), in maize (Maugenest et al ., 1997, Biochem J., 322 (Pt 2), 511-7); Maugenest et al ., 1999, Plant Mol. Biol., 39 (3), 503-14), or in Arabidopsis (Mullaney and Ullah, 1998, Biochem. Biophys. Res. Commun., 251 (1), 252-5).

Among the properties that allow characterization the phytases, is the constant of Michaelis (Km) in front of the phytic acid, the optimal pH and the optimal activity temperature, as well as the stability of this activity at pH and temperatures determined. Data related to the structure of phytases they may also be useful, such as molecular weight (PM), isoelectric point (pl), or the peptide sequence. So that can use in animal feed, phytases must possess properties compatible with the treatments suffered by Food intended for this diet. In particular, the activity of the phytases used should be maintained and if it is possible, be optimal in the temperature and pH conditions of the procedures for preparing these foods as well as in present in the digestive tract of animals that ingest these foods. These obligations lead mainly to seek phytases whose activity resists temperature conditions high, such as those used in the procedures of preparation of food compositions, and under conditions of acidic pH, such as those present in the digestive tract of breeding animals

In order to respond to these criteria, it they have looked for some phytases in some organisms, in particular ones microorganisms, which develop in a medium whose conditions of temperature and pH correspond to these criteria. This strategy has allowed to isolate some phytases resistant to some high temperatures, such as, for example, those described in Patent applications WO 97/305016 or EP 0 684 313, but also  some phytases that have a low Km, such as, for example, described in patent application EP 0 960 934. Another strategy it consisted of artificially modifying the phytase sequence known by directed mutagenesis in order to confer Interesting properties. This strategy has been described in particular in patent applications WO 99/48380, EP 0 897 985 and EP 0 897 010.

Only some active phytases have been identified at a low optimum pH. Such phytases have been identified in particular in fungi, such as the Penicillium caseicolum phytase described in patent application JP 7067635 and that of Monascus anka described in patent application WO 98/13480, but also in yeasts, such as Schwaniiomyces occidentalis phytase described in patent application EP 699 762. However, until now, no bacteria have led to the isolation and identification of a phytase that has a low pH optimum, in particular an optimum pH of less than 4.

Description of the figures

Figure 1: Activity of the phytase of Acidocella aminolytica ATCC 51361 as a function of temperature. The value of 100% of the relative activity corresponds to the optimal activity of the phytase for a given temperature.

Figure 2: Activity of the phytase of Acidocella aminolytica ATCC 51361 as a function of pH. The value of 100% of the relative activity corresponds to the optimal phytase activity for a given pH.

Figure 3: Activity of the phytase Acidocella facilis ATCC 35904 as a function of temperature. The value of 100% of the relative activity corresponds to the optimal activity of the phytase for a given temperature.

Figure 4: Activity of the phytase Acidocella facilis ATCC 35904 as a function of pH. The value of 100% of the relative activity corresponds to the optimal phytase activity for a given pH.

Figure 5: Phytase activity contained in the fraction purified in example 5.5 and encoded by ORF281 in temperature function. The value of 100% of the relative activity corresponds to the optimal phytase activity for a temperature determined.

Figure 6: Phytase activity contained in the fraction purified in example 5.5 and encoded by ORF281 in pH function The value of 100% of the relative activity corresponds to the optimal phytase activity for a given pH.

Description

The present invention relates to isolated polynucleotides encoding a phytase described by the sequence identifier SEQ ID No. 2. This phytase and the polynucleotides encoding it are also characterized in that they originate from a bacterial strain of the genus Acidocella .

According to the present invention, for the term "polynucleotide" means a nucleic acid molecule composed of a sequence of bases, natural or artificial, that it can be of the DNA or RNA type, preferably of the DNA type, in double-stranded particular. When said polynucleotide is natural, it is clear that the invention does not cover this polynucleotide in its natural environment, but the same isolated polynucleotide and purified from the genome of the living organism in which it is found in the natural state This polynucleotide can be obtained in a manner directly, by extraction and purification, or indirectly by copy However, the present invention comprises said polynucleotide when it is artificially integrated into  the genome of a living organism different from that in which it exists in the natural state, or when it is artificially reintroduced into the living organism from which it comes, in one or several specimens in the Genome of this organism. When this polynucleotide is a probe, It is usually single chain.

The invention therefore comprises polynucleotides encoding the peptide sequence of the phytase described by sequence identifier SEQ ID No. 2. It is well known by the person skilled in the art that this definition includes all polynucleotides that, although they comprise a different nucleotide sequences as a result of the degeneracy of the genetic code, code for the same amino acid sequence, therefore the same phytase, which It is represented by the sequence identifier SEQ ID No. 2.

The present invention also comprises homologous polynucleotides of the polynucleotides described above, encoding said homologous polynucleotides for some homologous phytases of the phytase represented by the sequence identifier SEQ ID No. 2. By the term "homologous" means, according to the invention, some polynucleotides encoding phytases and whose sequences they have modifications in relation to polynucleotides encoding the phytase represented by the identifier of sequence SEQ ID No. 2. Homologous polynucleotides are characterized because they have a degree of identity with polynucleotides encoding the phytase represented by the sequence identifier SEQ ID No. 2. The degree of identity between Two homologous polynucleotides are obtained by comparing its sequences and is usually expressed by a percentage of identical nucleotides between these sequences. This degree of identity is measured over a given sequence length, determining the shortest of the sequences compared the size of sequence on which the degree of identity of the homologous sequences. The invention therefore encompasses some polynucleotides that have one or more modifications of sequence in relation to polynucleotides encoding phytase represented by the sequence identifier SEQ ID No. 2, and that code for phytases whose properties are equivalent to of the phytase described by the sequence identifier SEQ ID NO. 2.

Through the expression "phytases equivalents "or" phytases with equivalent properties "are essentially understands, according to the invention, proteins that they have a phytase activity, regardless of their properties intrinsic such as Km, the optimal activity pH or the optimal activity temperature. The level of phytase activity is can measure by any method that allows to characterize a phytase activity Phytase means an enzyme whose activity catalytic is to hydrolyze phytic acid to release inositol and inorganic phosphate. However, since most of phytases do not perform a complete hydrolysis of phytic acid (comprising 6 phosphates), the catalytic activity of a phytase according to the invention can lead to phosphate release inorganic and phosphate myoinositol esters, said esters may be, depending on the ability of hydrolysis of phytase, mono-, di-, myoinositol esters tri-, tetra- or penta phosphate. As an example, Phytase activity can be measured according to the Shimizu method (1992, Biosci. Biotech. Biochem. 56 (8), 1266-1269), in particular as described in example 2. However, you can use any method that allows characterizing a phytase activity, or by measurement of the decrease in the amount of substrate, or by measuring the accumulation of products coming of the enzymatic reaction, to measure phytase activity. In particular similar methods, which use for example another substrate or other reactive agents, also allow to measure said phytase activity

Modifications of sequences present in homologous polynucleotides may be additions, deletions or substitutions of nucleotides that can be natural or obtained by the usual mutagenesis techniques. It is known that said homologous polynucleotides, which code for proteins of equivalent functions, naturally exist in the genomes of different living species, and even in the genomes of different races, varieties or strains. Therefore, it is therefore easy for one skilled in the art, from teaching the polynucleotides encoding the peptide sequence represented by the sequence identifier SEQ ID No. 2 according to the invention, to isolate said homologous polynucleotides using techniques Well-known molecular hybridization (Sambrook et al ., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press).

Molecular hybridization is a mating reaction that takes place between complementary strands of polynucleotides that have a certain degree of identity among their nucleotide sequences. Hybridization therefore allows, from the polynucleotides encoding the phytase represented by the sequence identifier SEQ ID No. 2, to identify homologous polynucleotides of these in the genome of living organisms other than those from, for example, other bacteria, in Particularly other strains of Acidocella , and coding for phytases with the properties equivalent to phytase represented by the sequence identifier SEQ ID No. 2. The stronger the sequence identity between polynucleotides, the more possible and easy hybridization between said polynucleotides, and higher is the probability that these polynucleotides encode proteins with equivalent properties. The methods that allow hybridization of polynucleotides are widely described in the literature (Sambrook et al ., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press) and are well known by the expert in the field. They are based, for example, on the screening of a genomic or cDNA bank created from a living organism or from a tissue of this organism. The screening is carried out with the help of a probe consisting of a known polynucleotide or a fragment thereof, in order to identify in these banks polynucleotides homologous to said probe that will hybridize to it. According to the invention, the probe is constituted by a polynucleotide encoding the phytase represented by the sequence identifier SEQ ID No. 2, or a fragment thereof. In order to identify the polynucleotides on which the probe hybridizes, it is labeled, for example with radioactive elements, such as 32 P. It is also possible to use commercialized non-radioactive markers well known to those skilled in the art.

The present invention therefore also comprises polynucleotides capable of selectively hybridizing to one of the polynucleotides encoding the phytase represented by the sequence identifier SEQ ID No. 2. It is understood that these polynucleotides are part of the present invention only if they encode for a phytase equivalent to that represented by the sequence identifier SEQ ID No. 2. By the expression "polynucleotides capable of selectively hybridizing" it is therefore understood, according to the invention, polynucleotides which, by one of the usual methods of Molecular hybridization (Sambrook et al ., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press), hybridizes with a labeled probe consisting of one of the coding polynucleotides the phytase represented by the sequence identifier SEQ ID No. 2, or a fragment thereof, at a higher level to the non-specific hybridization of said probe with other poorly homologous polynucleotides, in particular other cDNAs if the probed polynucleotides come from a cDNA bank. The level of hybridization is measured thanks to the signal produced by the probe marker. The level of the signal generated by the interaction between the polynucleotides capable of selectively hybridizing and the probe is generally 10 times, preferably 100 times more intense than that generated by the interaction of the probe with the other polynucleotides that generate a "noise of background". Selective hybridization is obtained using astringent or very astringent hybridization and washing conditions (for example hybridization with a buffer containing at least 5 x SSC and 1% SDS at about 50 ° C-60 ° C, and successive washes with 0.1 % of SDS and progressive decrease of the concentration in SSC from 2xSSC to 0.4xSSC as well as temperature increase from 20ºC to 50ºC). The person skilled in the art will know how to adapt the hybridization conditions, that is, essentially the temperature and the salt concentration of the buffers used for the hybridization stage and the washing stage. These conditions must be adapted in particular according to the size of the probe used and the degree of identity of the polynucleotides present in the bank screened with this probe. The adaptation of the hybridization conditions is necessary in order to optimize the signal generated by the homologous sequences that hybridize, while minimizing the background noise.

The polynucleotides capable of selectively hybridizing to the polynucleotides according to the invention can be isolated from genomic banks or cDNA banks produced, for example, from bacterial strains, in particular strains of the genus Acidocella . The isolation of said polynucleotides can be carried out by standard hybridization techniques (Sambrook et al ., 1989, Molecular Cloning: A Laboratory Manual, 2nd edition, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press), using as a probe a polynucleotide encoding the phytase represented by the sequence identifier SEQ ID NO: 2, a fragment of these polynucleotides, or a complementary polynucleotide thereof. When a polynucleotide has been isolated by these techniques, it is necessary to determine its sequence and identify the properties of the protein encoded by this polynucleotide, in particular verify that this protein is a phytase equivalent to the phytase described by the sequence identifier SEQ ID No. 2 .

The hybridization techniques mentioned above therefore allow homologous polynucleotides to be isolated from the polynucleotides encoding the phytase described by the sequence identifier SEQ ID No. 2. Said polynucleotides and the phytases encoding are easily identifiable by one skilled in the art. from the field of biotechnologies that dominates the standard techniques of molecular biology. The invention therefore comprises homologous polynucleotides of the polynucleotides encoding the phytase described by the sequence identifier SEQ ID No. 2. The degree of identity of the homologous polynucleotides will be at least 70% in relation to the polynucleotides encoding the phytase represented by the sequence identifier SEQ ID No. 2, preferably at least 80%, more preferably at least 90% and preferably at least 95%. The methods of measuring and identifying the degree of identity between sequences are also well known to those skilled in the art. For example, the programs PILEUP, BLAST (in particular Altschul et al ., 1993, J. Mol. Evol. 36: 290-300; Altschul et al ., 1990, J. Mol. Biol. 215: 403 can be used -10), or BestFit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711, using the Smith and Waterman algorithm described in Applied Mathematics, 1981, No. 2 , 482-489).

Such homologous polynucleotides can be also obtain artificially using techniques usual mutagenesis.

A preferred polynucleotide encoding the phytase represented by the sequence identifier SEQ ID No. 2 is represented by the sequence identifier SEQ ID No. 1.

According to a particular embodiment of the invention, the polynucleotides encoding a phytase described above come from a bacterium of the genus Acidocella .

Advantageously, the polynucleotides according to the invention encodes a phytase whose optimum activity pH is less than or equal to 4. By optimal activity pH, the pH value at which the activity of the phytase according to the invention is maximum, this activity being measured by the mentioned method above and corresponding to the amount of phytic acid degraded and inorganic phosphate produced.

According to a particular embodiment of the invention, the polynucleotides according to the invention encode a phytase that has the following properties:

(to)

optimum temperature = 70ºC

(b)

pH optimal = 4

       \ vskip1.000000 \ baselineskip
    

According to another particular embodiment of the invention, the polynucleotides according to the invention encode a phytase that has the following properties:

(to)

optimum temperature = 60ºC

(b)

pH optimal = 3.5

       \ vskip1.000000 \ baselineskip
    

Preferably, the polynucleotides according to the invention encode a phytase that comes from a bacterial strain of the Acidocella aminolytica species, in particular strain A. aminolytica ATCC 51361 , or from a bacterial strain of the Acidocella facilis species, in particular strain A. Facilitate ATCC 35904.

       \ global \ parskip0.900000 \ baselineskip
    

The present invention also describes fragments of the polynucleotides described above. The term "fragment" designates in particular a fragment of at least 20 nucleotides, in particular of at least 50 nucleotides, and preferably of at least 100 nucleotides. Such fragments are generally designated oligonucleotides. They can serve as hybridization probes to identify homologous polynucleotides, or primers to identify and amplify said homologous polynucleotides by the PCR technique ("Polymerase Chain Reaction" as described in Ausubel et al ., (1987) Current Protocols in Molecular Biology, edit., John Wiley & Sons, Section 6.3-6.4.

The term fragment also designates fragments of the polynucleotides according to the invention encoding a fragment of the phytase represented by the identifier of sequence SEQ ID No. 2, or a fragment of a homologous phytase or phytase equivalent represented by the identifier of sequence SEQ ID No. 2.

The present invention also relates to some polynucleotides comprising at least one of the polynucleotides such as those described above.

All polynucleotides described previously encoded or else the phytase represented by the sequence identifier SEQ ID No. 2, or a homologous phytase, or an active fragment of these phytases. Consequently, the invention thus extends to all encoded phytases by the set of these polynucleotides. This definition includes therefore the phytase represented by the identifier of sequence SEQ ID No. 2, the homologous phytases of this phytase, and the active fragments of these phytases.

According to a preferred embodiment of the invention, phytase is a protein that comprises at least the peptide sequence described by the SEC sequence identifier ID No. 2. Preferably, the phytase represented by the peptide sequence described by the SEC sequence identifier ID No. 2 hydrolyzes 5 of the 6 phosphates present on a molecule of phytic acid.

The invention therefore also includes the homologous phytases of the phytase represented by the sequence identifier SEQ ID No. 2. The term "homologous phytases" means, according to the invention, the phytases whose sequences have modifications in relation to the phytase represented by the sequence identifier SEQ ID NO. 2. Like homologous polynucleotides, homologous phytases are phytases whose peptide sequences have a certain degree of identity, degree of identity that is generally expressed by a percentage of identical amino acids. The invention therefore encompasses phytases that have one or several sequence modifications in relation to the phytase represented by the sequence identifier SEQ ID No. 2, and whose properties are equivalent to those of the phytase described by the sequence identifier SEQ ID No. 2. These modifications may be additions, deletions or substitutions of amino acids that can be natural or obtained by the usual mutagenesis techniques. The degree of identity of the homologous phytases will be at least 70% in relation to the phytase represented by the sequence identifier SEQ ID No. 2, preferably at least 80%, more preferably at least 90%, and of preferred manner of at least 95%. The methods of measuring and identifying the degree of identity between sequences are well known to those skilled in the art. For example, the programs PILEUP, BLAST (in particular Altschul et al ., 1993, J. Mol. Evol. 36: 290-300; Altschul et al ., 1990, J. Mol. Biol. 215: 403 can be used -10), or BestFit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711, using the Smith and Waterman algorithm described in Applied Mathematics, 1981, No. 2 , 482-489).

According to a particular embodiment of the invention, the phytase according to the invention comes from a bacterium of the genus Acidocella .

Advantageously, the phytase according to the invention has an optimal activity pH less than or equal to 4. By Optimum pH of activity, the pH value at which the phytase activity according to the invention is maximum, this being activity measured by the method mentioned above and that corresponds to the amount of degraded phytic acid and phosphate inorganic produced.

According to a particular embodiment of the invention, phytase has the following properties:

(to)

optimum temperature = 70ºC

(b)

pH optimal = 4

       \ vskip1.000000 \ baselineskip
    

According to another particular embodiment of the invention, phytase has the following properties:

(to)

optimum temperature = 60ºC

(b)

pH optimal = 3.5

       \ vskip1.000000 \ baselineskip
    

According to another particular embodiment of the invention, the phytase according to the invention comes from a bacterial strain of the Acidocella aminolytica species, in particular the A. aminolytica strain ATCC 51361 , or from a bacterial strain of the Acidocella facilis species, in particular strain A. facilis ATCC 35904.

       \ global \ parskip1.000000 \ baselineskip
    

Fragments of the phytase represented by the sequence identifier SEQ ID No. 2 and the fragments of the homologous phytases. By fragment, it is understood essentially a biologically active fragment, that is, a fragment that has a phytase activity equivalent to that of the complete phytase as measured by the test described in Example 2, or a similar essay.

The present invention also relates to a chimeric gene comprising at least, operatively linked together, a functional promoter in a host organism, a polynucleotide encoding a phytase according to the invention, and a functional terminating element in this same organism. host The different elements that a chimeric gene can contain are, on the one hand, regulatory elements for the transcription, translation and maturation of proteins, such as a promoter, a sequence that codes for a signal peptide or a peptide of transit, or a terminating element that constitutes a polyadenylation signal and, on the other hand, a polynucleotide encoding a protein. The term "operatively linked together" means that said elements of the chimeric gene are linked together so that the functioning of one of these elements is affected by that of another. By way of example, a promoter is operatively linked to a coding sequence when it is capable of affecting the expression of said coding sequence. The construction of the chimeric gene according to the invention and the assembly of its different elements is carried out by using techniques well known to those skilled in the art, in particular those described in Sambrook et al . (1989, Molecular Cloning: A Laboratory Manual, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press). The selection of the regulatory elements that constitute the chimeric gene depends essentially on the host organism in which they must function, and the person skilled in the art is able to select functional regulatory elements in a given host organism. By "functional", it is understood as capable of functioning in a specific host organism.

The promoters that the chimeric gene according to the invention may contain are either constitutive or inducible. By way of example, promoters used for expression in bacteria may be selected from among the promoters cited below. For expression in Escherichia coli , the promoters lac, trp, Ipp, phoA, recA, araBAD, proU, cst-1, tetA, cadA, nar, tac, trc, Ipp-lac , P syn, cspA , P can be cited L , P L-9G-50 , P R-PL , T 7 , λ L -PT7, T3- lac , T5- lac , T4 gene 32, nprM-lac , HBV, protein A (Makrides, 1996, Microbiol. Rev. 60: 512-538; Current Opinions in Biotechnology, 1996, 7; Weickert et al ., 1996, Current Opinions in Biotechnology 7: 494-499) or also the P trp promoter (WO 99/64607). For expression in Gram positive bacteria such as Corinebacteria or Streptomyces , the P_A promoters (Holmes et al ., 1993, EMBO J. 12: 3183-3191) or PS1, PS2 (FR 91/09870) ) or those described in application EP 0 629 699 A2. For expression in yeasts and fungi, mention can be made of the P_ACAC4 promoters of K. lactis (Van den Berg et al ., 1990, Bio / Technology 8: 135-139) or P_pgk of K . lactis (patent application FR 91/05294), tef1 or cbh 1 of Trichoderma (WO 94/04673), his, csl, apf of Penicillium (WO 00/68401), Aspergillus gla (Gwynne et al ., 1987, Bio / Technology 5: 713-719).

The chimeric gene may also comprise a subcellular targeting sequence, which encodes a peptide signal or a transit peptide. This sequence, located current up or downstream of the polynucleotide encoding the phytase, allows to direct said phytase specifically to a cellular compartment of the host organism, or direct its secretion in the extracellular space. For example, the chimeric gene may comprise a sequence encoding a signal peptide or a transit peptide that allows the phytase to be directed towards a particular compartment of the cytoplasm such as mitochondria, the plastids, endoplasmic reticulum or vacuoles. By way of preferred, the addressing sequence encodes a peptide signal that directs phytase to apoplast or cell matrix.

According to one embodiment, the peptide of transit can be a chloroplastic addressing signal, vacuolar or mitochondial, which is then cleaved in the chloroplasts, vacuoles or mitochondria. These peptides are described extensively in the literature: Neuhaus and Rodgers, 1998, Plant Molecular Biology 38: 127-144; peptide of EPSPS transit described in US Patent No. 5,188,642; peptide transit of the small sub-unit of the Ribulose biscarboxylase / oxygenase (EP 189 707).

According to another embodiment, the transit peptide may be constituted by a signal peptide targeting the bacterial periplasm such as those of the pac genes (Schumacher et al ., 1986, Nucl. Acids. Res. 14: 5713-5727), ompA (Bowden and Georgiou, 1990, J. Biol. Chem. 265: 16761-16766), phoA (Chang et al ., 1986, Gene 44: 121-124), or by an anchor peptide on the surface of the bacterium as those of the PS1 and PS2 genes (FR 91/09870).

The transit peptides can be either single or double. The double transit peptides are eventually separated by an intermediate sequence. By way of example of a chloroplast transit peptide, one can cite a double transit peptide comprising, in the sense of the transcription, a sequence that codes for a peptide of transit of a plant gene that codes for an enzyme of plastidial location, a sequence part of the mature part N-terminal of a plant gene that codes for a plastidial localization enzyme, and then a sequence that encodes for a second transit peptide of a plant gene that encodes for a plastidial localization enzyme. Such peptides Double chloroplastic transit are described, for example, in the patent application EP 0 508 909.

According to one embodiment, the peptide of transit can be composed of different elements that allow increase the protein index of segregated interest in the medium. Be it can thus cite the association of a carrier protein and a Proteolytic cleavage site fused with the protein of interest (US 6,130,063).

According to the invention, the chimeric gene may also comprise other regulation sequences, which are located between the promoter and the coding sequence, such as transcription activators ( enhancer ).

The present invention also relates to a cloning and / or expression vector comprising a chimeric gene according to the invention. The vector according to the invention is useful for transforming a host organism and expressing a phytase therein. This vector can be a plasmid, a cosmid, a bacteriophage or a virus. Preferably, the transformation vector according to the invention is a plasmid. In general, the main qualities of this vector must be an ability to maintain and self-replicate in the cells of the host organism, in particular thanks to the presence of an origin of replication, and to express a phytase. With the aim of a stable transformation of a host organism, the vector can also be integrated into the genome. Its composition can then be limited to the elements necessary for the synthesis of phytase in these hosts. The choice of said vector as well as the techniques of insertion therein of the chimeric gene according to the invention are described extensively in Sambrook et al . (1989, Molecular Cloning: A Laboratory Manual, Nolan C. ed., New York: Cold Spring Harbor Laboratory Press), and are part of the general knowledge of the subject matter expert. Advantageously, the vector used in the present invention also contains, in addition to the chimeric gene according to the invention, a chimeric gene encoding a selection marker. This selection marker allows to select the effectively transformed host organisms, that is, those that have incorporated the vector. According to a particular embodiment of the invention, the host organism to be transformed is a plant or fungus. Among the selection markers that can be used, mention may be made of markers containing antibiotic or fungicide resistance genes such as, for example, the hygromycin phosphotransferase gene (Gritz et al ., 1983, Gene 25: 179-188; Punt et al ., 1987; Gene, 56: 117-24), that of streptotricine acetyltransferase, which codes for a polypeptide that confers a resistance to fleomycin, that of the mutated beta-tubulin that confers Benomyl resistance (Gold et al ., 1994, Gene 142: 225-30), or that of bialaphos-acetyltransferase (Avalos et al ., 1989, Curr Genet, 16: 369-72). Other markers may be genes that complement an auxotrophy such as the pyrA, pyrB, pyrG, pyr4 genes (Buxton and Radford, 1983, Mol. Gen. Genet. 190: 403-405), arg4, argB (Berse et al ., 1983, Gene 25: 109-117), trpC (Goosen et al ., 1989, Mol Gen Genet, 219: 282-88), the molybdopterin synthase gene (Appleyard et al ., 1998, J Biol Chem 273: 14869 -76; Unkles et al ., 1999; J Biol Chem, 274: 19286-93), or that of acetamidase (Beri and Turner, 1987, Curr Genet, 11: 639-41). Another category of selection markers consists of herbicide tolerance genes such as the bar gene (White et al ., NAR 18: 1062, 1990) for bialaphic tolerance, the EPSPS gene (US No. 5,188,642) for glyphosate tolerance, the HPPD gene (WO 96/38567) for isoxazole tolerance, or also the glyphosate oxidoreductase gene (US No. 5,463,175). Mention may also be made of genes encoding easily identifiable enzymes such as the GUS enzyme, genes encoding pigments or enzymes that regulate the preparation of pigments in transformed cells. Such selection marker genes are described in particular in patent applications WO 91/02071, WO 95/06128, WO 96/38567, and WO 97/04103.

The present invention also relates to transformed host organisms, which contain at least one chimeric gene according to the invention either integrated into its genome, or supported on an extra-chromosomal genetic element, for example a plasmid. By "host organism" is meant any mono or multicellular organism, lower or higher, into which the chimeric gene according to the invention can be introduced, for the preparation of a phytase according to the invention. Preferably, the host organism is a microorganism, in particular a fungus, for example of the genera Penicillium, Aspergillus, Chrysosporium , or Trichoderma , a bacterium, for example of the genus Escherichia , in particular E. coli , of the genus Corynebacterium or genus Streptomyces , a yeast, in particular of the genera Saccharomyces, Kluyveromyces , or Pichia , a baculovirus, or plant cells. The host organism can also be a plant or a part of the plant.

Through the expression "host organism transformed "means a host organism that has incorporated into its genome, or a genetic element extra-chromosomal, for example a plasmid, so less a chimeric gene according to the invention, and produces by consequently a phytase in their tissues, or in a culture medium. In order to obtain the host organisms according to the invention, the subject matter expert can use one of the numerous methods of known transformation.

One of these methods consists in placing the cells or tissues of the host organisms to be transformed in the presence of polyethylene glycol (PEG) and of the vectors of the invention (Chang and Cohen, 1979, Mol. Gen. Genet 168 (1), 111- 115; Mercenier and Chassy, 1988, Biochimie 70 (4), 503-517). Electroporation is another method that involves subjecting the cells or tissues to be transformed and the vectors of the invention to an electric field (Andreason and Evans, 1988, Biotechniques 6 (7), 650-660; Shigekawa and Dower, 1989, Aust. J. Biotechnol. 3 (1), 56-62). Another method is to directly inject vectors into cells or tissues by microinjection (Gordon and Ruddle, 1985, Gene 33 (2), 121-136). Advantageously, the so-called "biolistic" method may be used. It consists of bombarding cells or tissues with particles on which the vectors of the invention are adsorbed (Bruce et al ., 1989, Proc. Natl. Acad. Sci. USA 86 (24), 9692-9696; Klein et al ., 1992, Biotechnology 10 (3), 286-291; US Patent No. 4,945,050).

Several methods of bacterial transformation are described in the literature for Escherichia coli and other Gram negative bacteria (Ausubel et al ., 1995, Current Protocols in Molecular Biology, John Willey and Sons, New York; Inoue et al ., 1990, Gene 96 : 23-28; Chung et al ., 1989, Proc. Natl. Acad. Sci. USA 86: 2172-2175). The conjugation can also be used (Cameron et al ., 1989, J. Bacteriol., 171: 547-557). For Gram positive bacteria, electroporation and protoplast transformation can be used, in particular for Streptomyces genus bacteria (Bonamy et al ., 1990, FEMS Microbio. Lett 66: 263-270; Hopwood et al ., 1985, Genetic Manipulation of Streptomyces: A Laboratory Manual. John Innes Foundation, Norwich).

Several methods of fungal transformation are also described in the literature (Talbot, 2001, Molecular and cellular biology of filamentous fungi, Oxford University Press, New York). The transformation of protoplasts with PEG is described for Aspergillus in EP 0 260 762, and an adaptation of this method to the Penicillium funiculosum species in WO 00/36120. Transformation through assisted integration of restriction enzyme or REMI is also known (Sanchez et al ., 1998, Mol. Gen. Genet. 258; 89-94), as well as the transformation of protoplasts with the help of bacteria of the genus Agrobacterium ( de Groot et al ., 1998, Nature Biotechnology 16: 839-842). Yeast transformation techniques have also been described in the literature, in particular in Ausubel et al . (1995, Current Protocols in Molecular Biology, John Willey and Sons, New York) and Van den Berg et al . (1990, Bio / Technology 8: 135-139).

In the particular case in which the host organism to be transformed is of plant origin, the transformation of cells or plant tissues can be carried out preferably with the help of bacteria of the genus Agrobacterium , preferably by infection of the cells or cells. tissues of these plants by A. tumefaciens (Knopf, 1979, Subcell. Biochem. 6, 143-173; Shaw et al ., 1983, Gene 23 (3): 315-330) or A. rhizogenes (Bevan and Chilton, 1982 , Annu. Rev. Genet. 16: 357-384; Tepfer and Casse-Delbart, 1987, Microbiol. Sci. 4 (1), 24-28). Preferably, the transformation of plant cells or tissues by Agrobacterium tumefaciens is carried out according to the protocol described by Ishida et al . (1996, Nat. Biotechnol. 14 (6), 745-750). The person skilled in the art will select the appropriate method based on the nature of the host organisms to be transformed.

The present invention also relates to a new bacterial extract comprising at least one phytase activity, characterized in that it is derived from a bacterium of the genus Acidocella . By bacterial extract, it is understood according to the present invention, a fraction soluble in water or in an aqueous solution, said fraction proceeding from the trituration of bacteria and the separation by centrifugation of the bacterial constituents thus released in solid fraction and in liquid fraction, the liquid fraction comprising all the soluble bacterial constituents. The phytase activity corresponds to the amount of degraded phytic acid and is generally measured by quantifying the inorganic phosphate released by the enzymatic reaction. In particular, phytase activity is measured according to the method of Shimizu (1992, Biosci. Biotech, Biochem. 56 (8), 1266-1269), in particular as described in example 2 below. However, any method that characterizes a phytase activity can be used, either by measuring the decrease in the amount of substrate, or by measuring the accumulation of products from the enzymatic reaction, to measure the activity phytase of the bacterial extract according to the invention.

The bacterial extract according to the invention is characterized in that it comes from a bacterium of the genus Acidocella . The characteristics of the bacteria grouped in the genus Acidocella are described in Kishimoto et al . (1995, System. Appl. Microbiol. 18, 85-91).

Preferably, the bacterial extract according to the invention expresses a phytase activity whose optimum activity pH is less than or equal to 4. The optimal activity pH corresponds to the pH to which the phytase activity measured in the bacterial extract according to the invention is maximum.

According to a particular embodiment of the invention, the bacterial extract comprises a phytase activity that It has the following properties:

(to)

optimum temperature = 70ºC

(b)

pH optimal = 4

       \ vskip1.000000 \ baselineskip
    

According to another particular embodiment of the invention, the bacterial extract comprises a phytase activity that It has the following properties:

(to)

optimum temperature = 60ºC

(b)

pH optimal = 3.5

       \ vskip1.000000 \ baselineskip
    

By optimum temperature and optimum pH, it is understood the temperature and pH at which the phytase activity measured in the Bacterial extract according to the invention is maximum.

According to another particular embodiment of the invention, the bacterial extract according to the invention is derived from a bacterial strain of the Acidocella aminolytica species, in particular the A. aminolytica strain ATCC 51361 , or from a bacterial strain of the Acidocella facilis species, in particular strain A. facilis ATCC 35904.

       \ newpage
    

       \ global \ parskip0.900000 \ baselineskip
    

The present invention also relates to a method of preparing said bacterial extract. This procedure is characterized because it comprises the stages following:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

       \ vskip1.000000 \ baselineskip
    

According to the present process, a bacterial strain of the genus Acidocella is grown in an appropriate culture medium that allows the bacteria to multiply, and whose pH is adjusted to the pH conditions of the natural environment in which said bacterial strain develops. Numerous culture media for bacteria are described in the literature, and the person skilled in the art will know how to select them and adapt their pH conditions. By way of example, a culture medium for acidophilic bacteria, in particular of the genus Acidocella is described in Kishimoto et al ., 1995, System. Appl. Microbiol 18, 85-91).

After cultivation, the bacteria obtained are concentrate. The concentration of bacteria can lead to carried out by numerous means, in particular by centrifugation or by filtration. After the concentration, The bacteria are crushed. The crushing of bacteria consists in breaking bacterial cells. It can be carried out by different means known to the person skilled in the art. Preferably, the crushing is carried out by exposure of bacteria to an ultrasound field. Crushing  bacterial is then centrifuged in order to separate the non-soluble cellular debris, and then recover the supernatant of centrifugation comprising the soluble cellular elements, and in particular enzymes that express a phytase activity.

According to a particular embodiment of the invention, the bacterial strain used in the process according to the invention is a bacterial strain of the Acidocella aminolytica species, in particular the A. aminolytica strain ATCC 51361 , or a bacterial strain of the Acidocella facilis species , in particular strain A. facilis ATCC 35904.

The present invention also relates to a Phytase preparation process according to the invention. According An embodiment of the invention, this procedure is It characterizes because it comprises the following stages:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e)

       \ vskip1.000000 \ baselineskip
    

The steps (a) to (e) of this procedure are common with steps (a) to (e) of the procedure for preparing a bacterial extract described above. Stage (f) of present procedure for preparing a phytase according to the invention consists in purifying phytase from the supernatant recovered in step (e). The phytase purification can be carry out by any technique of separation of proteins, in particular electrophoresis and Chromatography well known to the person skilled in the art. With the in order to get a purified phytase, the person skilled in the art you will know how to use the phytase activity measurement method mentioned above to identify the fraction (s) of purification containing said phytase.

Preferably, the bacterial strain used in the process according to the invention is a bacterial strain of the Acidocella aminolytica species, in particular the A. aminolytica strain ATCC 51361 , or a bacterial strain of the Acidocella facilis species, in particular the A. facilis strain ATCC 35904.

According to another embodiment of the invention, in particular when the phytase according to the invention is secreted in the culture medium, this procedure is characterized in that it comprises the following stages:

(to)

grow a bacterial strain of the genus Acidocella

(b)

recover the culture medium by the elimination of bacteria

(C)

purify phytase from the medium of crop recovered in step (d)

       \ global \ parskip1.000000 \ baselineskip
    

According to this procedure, the stage of recovery of the culture medium by elimination of the bacteria can be carried out by any method of separation of solid fractions comprised in a liquid fraction. In In particular, filtration and centrifugation are a means adapted to the realization of this stage.

According to another embodiment of the invention, the phytase preparation process according to the invention uses a transformed host organism according to the invention, and It is characterized in that it comprises the following stages:

(to)

cultivate a host organism transformed according to the invention

(b)

concentrate the host organism cultivated in stage (a)

(C)

crush the host organism isolated transform in stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e)

       \ vskip1.000000 \ baselineskip
    

Step (f) of the present procedure of preparation of a phytase according to this embodiment of the invention consists in purifying phytase from the supernatant recovered in step (e). The phytase purification can be carry out by any technique of separation of proteins, in particular electrophoresis and Chromatography well known to the person skilled in the art. With the in order to get a purified phytase, the person skilled in the art you will know how to use the phytase activity measurement method mentioned above to identify the fraction (s) of purification containing said phytase.

Preferably, the transformed host organism used in this process is a microorganism. In particular, said microorganism can be a fungus, for example of the genera Penicillium, Aspergillus, Chrysosporium , or Trichoderma , a bacterium, for example of the genus Escherichia , in particular E. coli , of the genus Corynebacterium or of the genus Streptomyces , a yeast, in particular of the genera Saccharomyces, Kluyveromyces , or Pichia , a baculovirus, or plant cells.

According to another embodiment of the invention, in particular when the phytase according to the invention is secreted in a culture medium, this procedure is characterized in that it comprises the following stages:

to)

cultivate a host organism transformed according to the invention

b)

recover the culture medium by the elimination of said transformed host organism

C)

purify phytase from the medium of culture recovered in step (e).

       \ vskip1.000000 \ baselineskip
    

According to this procedure, the stage of recovery of the culture medium by elimination of the organism transformed host can be performed by any means of separation of solid fractions comprised in a fraction liquid In particular, filtration and centrifugation are about means adapted to the realization of this stage.

The present invention also relates to Enzymatic compositions comprising at least one phytase according to the invention. According to a particular embodiment, the Enzymatic composition according to the invention comprises an extract bacterial according to the invention.

Through the expression "composition enzymatic "means a composition comprising less a phytase according to the invention, phytase that is associated with various adjuvants that favor its stability and its conservation. The enzymatic composition according to the invention can be in liquid form, then said composition and the phytase it contains in an aqueous solution, or in solid form, meeting said composition and the phytase it contains lyophilized in powder form.

According to a particular embodiment of the invention, the enzymatic composition comprises, in addition to phytase according to the invention, at least one additional enzyme. This enzyme additional may either possess a phytase activity, or possess an activity other than phytase activity. In the case where this additional enzyme has a phytase activity, said activity phytase is preferably different and complementary to the phytase activity of phytase according to the invention. In the case in the that this additional enzyme has a different activity from the phytase activity, this may, for example, have an activity xylanase, cellulase, β-glucanase, acid Ferulic esterase, pululanase, amidase, phosphatase or mannanase.

       \ newpage
    

Preferably, said compositions enzymatic are intended to be incorporated into foods for farmed animals, particularly monogastric animals, preferably pigs or poultry.

The present invention also relates to a food composition comprising at least one phytase according to the invention.

Through the expression "composition food "is essentially understood as a food intended for breeding animals, particularly monogastric animals, preferably pigs or poultry. A composition food according to the invention is ideally a food intended for breeding animals added with an enzymatic composition according to the invention. The food composition according to the invention It is, therefore, a food for farmed animals add at least one enzyme composition according to the invention, said food and said enzymatic composition being mixed so that said composition is obtained food

According to a particular embodiment of the invention, said food compositions comprise at least one transformed host organism according to the invention. According to another particular embodiment of the invention, said food compositions comprise at least one bacterium of the genus Acidocella . Preferably, the bacterium of the genus Acidocella is a bacterium of the species Acidocella aminolytica , in particular the strain A. aminolytica ATCC 51361 , or a bacterium of the species Acidocella facilis , in particular the strain A. facilis ATCC 35904.

The invention also relates to some food compositions comprising at least one extract bacterial or a phytase according to the invention.

Advantageously, the food compositions according to the invention are intended to be used in the feeding of monogastric animals. According to a particular way of embodiment of the invention, said food compositions They are intended for feeding pigs. According to another way particular embodiment of the invention, said compositions foodstuffs are intended for feeding the birds of corral.

The present invention also has as its object a process for preparing such a food composition as described above.

According to a particular embodiment of the invention, said method consists in culturing a host organism according to the invention or a bacterium of the genus Acidocella , in concentrating said host organisms or said bacteria by any concentration procedure known to those skilled in the art, in particular filtration or centrifugation, and then incorporating said host organisms or said concentrated bacteria in a food composition. Preferably, when the method according to the invention uses a bacterium of the genus Acidocella , this is a bacterium of the species Acidocella aminolytica , in particular the strain A. aminolytica ATCC 51361 , or a bacterium of the species Acidocella facilis , in particular the strain A. Facilis ATCC 35904.

According to another particular embodiment of the invention, said method consists in isolating an extract bacterial according to the invention by the method of preparation of said extract as described previously, and then to incorporate the supernatant produced in step (e) of said process in a composition food

According to another particular embodiment of the invention, said process consists in preparing a phytase according to the invention by one of the preparation procedures of said phytase as described above, and then in incorporating said phytase produced in a composition food

The present invention also relates to a procedure to increase the assimilation of inorganic phosphate phytase content of plant-based foods for monogastric animals, characterized in that a phytase or an enzymatic composition according to the invention in the feeding of these animals. Preferably, said procedure is characterized because said animals are fed monogastric with a food composition according to the invention.

The invention also relates to a procedure to decrease the addition of phosphorus in the feeding of monogastric animals, characterized in that feed these animals with a food composition according to the invention.

The invention also relates to a procedure to reduce phosphorus emissions from the feeding of monogastric animals, characterized in that said animals are fed a food composition according to the invention.

The following examples allow to illustrate the present invention, without limiting its scope.

       \ vskip1.000000 \ baselineskip
    

Example 1 Cultivation of the bacteria of the genus Acidocella

Acidocella genus bacteria are Gram negative acidophilic bacteria, which develop in acidic pH media. By way of example, the bacteria of strains A. aminolytica ATCC 51361 and A. facilis ATCC 35904 can be used to carry out the present invention. These bacteria can be grown according to a similar method. In particular, they are grown under aerobic conditions at 30 ° C and pH 4 in a medium composed of peptone and glucose. A culture medium is described for example in Kishimoto and Tano (1987, J. Gen. Appl. Microbiol. 33, 11-25). The medium used for phytase expression is free of inorganic phosphate, and supplemented with phytate (0.4%) and in CaCl2 (2.2 g / l).

       \ vskip1.000000 \ baselineskip
    

Example 2 Measurement of phytase activity

The measurement of phytase activity is taken to out in liquid medium. It is carried out on culture samples bacterial or on bacterial extracts according to the invention, or on phytases according to the invention. It is based on the method of Shimizu (1992, Biosci. Biotech. Biochem. 56 (8), 1266-1269). The principle of this method consists in measure the amount of inorganic phosphate released during the reaction enzyme of phytase with its substrate (phytate solution of 1% sodium). The amount of inorganic phosphate released is measured by reacting it with a chromogenic reactive agent (1 volume of 10.8% iron sulfate, mixed extemporaneously with 4 volumes of 0.012M H 2 SO 4 ammonium molybdate). This reaction leads, in very acidic medium, to the formation of a complex of colored phosphomolibdate (in the presence of Fe 2+), and the amount of complex formed is quantified by measuring with the spectrophotometer of the absorbance at 700 nm of the solution colored generated.

Two different reactions allow the measurement of the activity: a first measurement is made at the time of contact of the sample with the substrate (time T0) and a second after 60 minutes of incubation (time T60). The variation of absorbance between times T0 and T60 (against respective targets constituted by buffer instead of the sample) is proportional to the amount of inorganic phosphate released during The enzymatic reaction.

A reference standard range is made mixing 250 µl of KH2PO4 solution at concentrations of 0.1 mM, 0.5 mM, 1 mM, 2 mM and 4 mM in the buffer desired with 250 µl of TCA and revealing by 450 µl of chromogenic reactive agent. An enzymatic unit is defined as the amount of enzyme that releases an inorganic phosphate micromol by minute (at certain temperature and pH).

       \ vskip1.000000 \ baselineskip
    

Example 3 Isolation of a bacterial extract that contains an activity phytase

After cultivation, the bacteria of the genus Acidocella are concentrated by centrifugation for 15 minutes at 5,000 g and 4 ° C. The supernatant is removed and the bacteria thus concentrated are then resuspended in a formate buffer (100 mM) -CaCl2 (1 mM) at pH 3.5 so that they are concentrated approximately 100 times relative to their initial concentration in The culture medium. The concentrated bacteria are then crushed with the aid of a "Cell disrupter" (Cell-d) apparatus used at the rate of two passes in a flow of a pressure of 2.5 kbar. Bacterial shreds are then centrifuged for 15 minutes at 5,000 g and 4 ° C and the supernatant, which constitutes the bacterial extract is recovered, and its phytase activity is measured.

       \ vskip1.000000 \ baselineskip
    

Example 4 Characteristics of the isolated phytases according to the invention 4.1. Phytase activity as a function of temperature

The activity of the phytases according to the invention has been determined at different temperatures. The results of these measurements are presented for the bacteria Acidocella aminolytica ATCC 51361 (figure 1), and Acidocella facilis ATCC 35904 (figure 3). Optimum activity temperatures are 70 ° C and 60 ° C respectively for the Acidocella aminolytica ATCC 51361 and Acidocella facilis ATCC 35904 bacteria .

       \ vskip1.000000 \ baselineskip
    

4.2. Phytase activity as a function of pH

The activity of the phytases according to the invention has been determined at different pH. The results of these measurements are presented for the bacteria Acidocella aminolytica ATCC 51361 (figure 2), and Acidocella facilis ATCC 35904 (figure 4). The optimal activity pH is 4 and 3.5 respectively for the Acidocella aminolytica ATCC 51361 and Acidocella facilis ATCC 35904 bacteria .

       \ vskip1.000000 \ baselineskip
    

Example 5 Purification of a phytase according to the invention 5.1. Preparation of a crude extract

The cells of a bacterial strain of the genus Acidocella are centrifuged and then washed 3 times in MES buffer pH 6.5 (25 mM) containing 1 mM CaCl2 in order to remove phytate from the medium and inorganic phosphate (accumulated during growth). The cell suspension thus obtained is then broken by "Cell disrupter" (1.5 kbar) and then the pH is reduced to 5.5 (by adding 3.7% hydrochloric acid).

The extract thus obtained is centrifuged at 20,000 g for 1 hour. The supernatant is then filtered on a 0.45 µm porosity membrane.

       \ vskip1.000000 \ baselineskip
    

5.2. Anion Exchange Chromatography

The supernatant is passed on a column of 20 HQ POROS type (4.6 / 100 mm: 1.7 ml gel). Elution takes conducted with a 1 mM pH 5.5 (25 mM) MES buffer of CaCl2, 1M of NaCl The phytase activity (50% of the injected activity) is found in the fraction of the dead volume.

       \ vskip1.000000 \ baselineskip
    

5.3. Hydrophobic interaction chromatography

The fraction recovered at the end of the Anion exchange chromatography takes 1.5 M (NH 4) 2 SO 4. This solution is deposited then on a column of type POROS 20 HP2 (HQ 4.6 / 100 mm: 1.7 ml of gel) previously equilibrated with a MES buffer pH 5.5 (25 mM), 1 mM of CaCl 2, 1.5 M of (NH 4) 2 SO 4. The proteins are then eluted by a gradient of 1.5 at 0 M of (NH 4) 2 SO 4 in 20 volumes of column.

Phytase activity is eluted at 0.95 M of (NH 4) 2 SO 4 in 3 fractions of 2 ml. These fractions are collected and then dialyzed against 5 liters of buffer MES pH 5.5 (20 mM), 1 mM CaCl 2 at 4 ° C overnight.

       \ vskip1.000000 \ baselineskip
    

5.4. Cation exchange chromatography

The dialyzed solution is injected onto a POROS 20 HS type column (4.6 / 100 mm: 1.7 ml gel) previously equilibrated with a MES buffer pH 5.5 (20 mM), 1 mM CaCl2. The proteins are eluted by a 0 to 1 M NaCl gradient in 20 column volumes

Protein with phytase activity elutes at a NaCl concentration of 0.35 M.

       \ vskip1.000000 \ baselineskip
    

5.5 Gel filtration

The fractions obtained during the stage previous have been gathered, concentrated and deposited on a SUPEROSE 12 HR 10/30 column (24 ml, Pharmacia®) previously equilibrated with a MES buffer pH 5.5 (25 mM), 1 mM CaCl2, 0.1 M NaCl. Proteins have been eluted with 24 ml of buffer a a flow rate of 0.5 ml / minute. 0.5 fractions have been collected ml. Phytase activity is detected in three fractions between 14 and 15 ml of elution buffer (table 1).

       \ vskip1.000000 \ baselineskip
    

TABLE 1 Activity in the fractions of interest after the gel filtration stage

one

The three fractions that present an activity phytase have been concentrated and deposited on a gel SDS-PAGE of 14.4%. This gel reveals a band main of approximately 63 kDa.

       \ vskip1.000000 \ baselineskip
    

Example 6 Micro-sequencing of internal peptides

The band of interest (at approximately 63 kDa) It has been cut directly on the polyacrylamide gel. He dye contained in the gel is partially removed by 2 50% acetonitrile / 50 mM Tris-HCl pH washes 8.6. The protein, in polyacrylamide gel, is digested in 400 µl of 50 mM Tris-HCl buffer pH 8.6 / 0.03% SDS at 35 ° C for 18 hours in the presence of 0.4 µg of endolysin-C (Roche's Sequencing grade).

The obtained peptides are separated by HPLC on a 2.1 mm DEAE-C18 in-line column diameter. The separation gradient is a gradient of 2 to 45% of acetonitrile / 0.1% TFA.

Four peptides have been purified, and then sequenced using the Edman method with the help of a Applied Biosystems 473A sequencer.

TABLE 2 Sequences of internal peptides obtained

2

Example 7 Cloning of the gene that encodes phytase 7.1. Definition of a probe

Based on the peptide sequences internal, several degenerate oligonucleotides have been synthesized in order to amplify by PCR a fragment of the gene from interest.

Oligo 10:

ATDATDATNGCNGTRTTYTT

Oligo 12:

TCRTCRTASGTGATGATGATSGCSGTRTTYTT

Oligo 22:

AARATGGARGGNCARAAYATHGG

Oligo 23:

ATGGAAGGCCAGAAYATCGGCGA

Oligo 25:

ATCGGCGAYCTBCTBAAYGCCAA

       \ vskip1.000000 \ baselineskip
    

Combinations of Oligo 10 and Oligo 12 primers have been tested with the three Oligo 22, 23 and 25 primers, and the pair of Oligo 12 and Oligo 22 primers has allowed the 500 bp fragment to be isolated from the genomic DNA of a strain of Acidocella genus. After purification, this DNA fragment has been sequenced.

The analysis of this sequence has allowed demonstrate in this fragment a nucleic sequence that codes for peptide 1, which suggests that the sequenced PCR product corresponds effectively to the protein of interest that has been object of microsequencing.

Based on the sequence obtained from PCR product of approximately 500 bp, new ones have been defined primers Oligo 29 and Oligo 30 in order to have a set of specific non-degenerated primers of the gene of interest.

Oligo 29:

TTCATGGGTGGCTTCGATC

Oligo 30:

GCTGCCGCATCAGGAAGTTG

       \ vskip1.000000 \ baselineskip
    

7.2. Southern transfer

The PCR product of approximately 500 bp obtained by amplification with primers Oligo 12 and Oligo 22 has been used as a probe in transfer experiments Southern

In order to mark the probe, 10 have been marked ng of PCR product by "random priming" with the help of Labelling kit Q-BIOgene.

10 µg of genomic DNA have been digested respectively by Eco RI, Sac II or Bam HI and then deposited on a 1% agarose gel. After migration, the DNA has been transferred by capillary over a nylon membrane (BIODYNE® Plus membrane, Pall Gelman).

It has made a pre-hybridization for 4 h at 60 ° C with a 5x buffer SSC, 5x Dehardt, 1% SDS, 100 µg / ml denatured DNA from fish.

Hybridization is carried out below. for 16 h at 60 ° C with a buffer containing 10 ml of buffer pre-hybridization and 10 ng of the probe at 4.08-108 cpm / \ mug (count with dry scintillation counter, i.e. in the absence of scintillation).

Afterwards, several phases of washed:

2 washes: 2x SCC + 0.1% SDS for 3 minutes at 20 ° C

2 washes: 0.5x SCC + 0.1% SDS for 3 minutes at 20 ° C

2 washes: 0.4x SCC + 0.1% SDS for 15 minutes at 50 ° C

       \ vskip1.000000 \ baselineskip
    

The gel has been revealed on film after of a 24 h exposure at -80 ° C.

These experiments have allowed to show that Sac II cuts in the portion of the gene used as a probe, but that there is no Eco RI or Bam HI site in this sequence. The Eco RI and Bam HI digestions respectively release a fragment of approximately 4 kb and a fragment larger than 9 kb on which the target sequence is hybridized.

Knowing, based on biochemical studies, that the protein of interest must be encoded by a gene of approximately 1.6 kb, a genomic DNA bank has been constructed by total Eco RI digestion.

       \ vskip1.000000 \ baselineskip
    

7.3. Construction of a genomic bank

Approximately 30 µg of genomic DNA from a strain of the genus Acidocella have been digested by Eco RI. After migration on 0.7% agarose gel, fragments whose size is between 3 and 4 kb have been purified with the help of the QIAEX II gel extraction kit (Qiagen) and desalted (microbe spin 6, Biorad) . Fragments whose size is between 2.5 and 3 kb have been purified as well as those whose size is between 4 and 5 kb.

The purified fragments have been inserted into a pBlueScript KS (II +) vector with the help of the T4 DNA ligase (QBIOgene). The products of the ligation made with the fragments whose size is between 3 and 4 kb have been used to transform E. coli strain MC 1061 by electroporation. After transformation, the cells are collected in SOC (2% tryptone, 0.5% yeast extract, 0.05% NaCl, 2.5 mM KCl, 10 mM MgCl2, 20 mM glucose) and are placed for 1 hour at 37 ° C before being spread on an LB medium supplemented with ampicillin (100 µg / ml). The Petri dishes are then incubated overnight at 37 ° C.

       \ vskip1.000000 \ baselineskip
    

7.4. Genomic Bank Screening

383 different colonies have been screened by PCR using the Oligo 29 and Oligo primer set 39.

Of these clones, 4 have allowed obtaining a PCR product of approximately 400 bp. Two of the clones that allow amplification of a fragment of expected size have used to perform a mini-preparation of plasmid (with the help of the Qiagen kit).

       \ vskip1.000000 \ baselineskip
    

7.5. Sequencing of genomic inserts

The two identified plasmids have been digested by Eco RI and Eco RV. Sequencing of their inserts has shown that these two plasmids had the same insert. Sequence analysis has allowed to demonstrate an open reading phase of 1,665 bp corresponding to a 554 amino acid protein. In addition, the sequences encoding the 4 internal peptides sequenced in example 6 have been found in this reading phase.

       \ vskip1.000000 \ baselineskip
    

Example 8 Sub-cloning of the identified gene

The sequence that contains the open phase of reading (called ORF281) identified in the genomic insert cloned in example 7 has been amplified by PCR with the 5'ORF281 and 3'ORF281 oligonucleotides.

5'ORF281

5 'TAA CGA TAA \ underline {CAT \ ATG} AAT ATC CGC CGG GCT CT 3 '

3'ORF281

5 'ATA TCT GAT \ underline {AAG \ CTT} TTA TTC GGC GTG CGC GGC 3 '

       \ vskip1.000000 \ baselineskip
    

The PCR product has been purified and digested by the restriction enzymes Nde I and Hind III and then sub-cloned into the pETCm vector digested by the same enzymes. The vector obtained is called pETCm281. The ORF281 insert has been sequenced in order to verify that the cloned sequence is identical to that determined from the previously cloned genomic inserts.

The pETCm vector comprises a chloramphenicol resistance gene. Its use, and therefore that of chloramphenicol resistance as a selection marker, allows expression in vivo in a strain of E. coli resistant to kanamycin: strain BL21 appA (phytase-).

       \ vskip1.000000 \ baselineskip
    

Example 9 Expression of the sub-cloned gene in E. coli 9.1. Preparation of recombinant E. coli strains

In vivo expression assays have been performed in the E. coli BL21 appA strain. This strain no longer expresses any endogenous phytase due to an insertion of a kanamycin resistance gene into the appA gene that codes for E. coli phytase. A control vector has also been prepared with the TEM gene encoding E. coli β-lactamase. The TEM gene has also been cloned into the pETCm vector, and the vector obtained has been called pETCmTEM.

The E. coli BL21 appA strain has been transformed by the pETCmTEM or pETCm281 vectors. Isolated colonies on LB medium added with 60 mg / l of kanamycin and with 20 mg / l of chloramphenicol have been selected. A colony of each type has been grown in an LB medium added with kanamycin and with chloramphenicol at the same concentrations. These cultures have been used to prepare glycerol reserves (a volume of cells for a volume of glycerol of 40%) from which the cultures destined to perform the expression tests are inoculated. These glycerol reserves are stored at -80 ° C.

       \ vskip1.000000 \ baselineskip
    

9.2. Expression tests

E. coli strain BL21 appA pETCm281 has been grown in M98 medium (modified Terrific Broth medium (with glucose) containing, for 1 liter, 12 g of Bacto Tryptone, 24 g of yeast extract, 9.4 g of K_ { 2} HPO4, and 2.2 g of KH2PO4, pH 7.2, autoclaved, to which 20 ml of glucose (50%) are added per liter on average before use ) in parallel with strain E. coli BL21 appA pETCmTEM. Expression is induced by the addition of 0.25 mM of IPTG, and is carried out at two temperatures: 30 and 37 ° C.

After 3 hours of induction, the cultures are centrifuge Phytase activity is determined on each residue resuspended in formate buffer to reach a concentration final 5 mg / ml dry cells. None found activity for the strain that contains pETCm281 as well as the strain that Contains pETCmTEM, whatever the culture conditions.

Aliquots of crop residues Induced and uninduced containing pETCm281 have been treated then with ultrasound and then centrifuged. The supernatant represents the fraction of soluble proteins and the residue insoluble proteins

These two fractions have been deposited on SDS-PAGE denaturing gel.

A protein band of PM 63 kDa clearly appears in the insoluble fraction of E. coli strain BL21 appA pETCm281 induced with the IPTG. No corresponding band is found in the uninduced negative control. ORF281 is therefore well expressed in E. coli . However, the corresponding protein is insoluble and apparently inactive in this way.

       \ vskip1.000000 \ baselineskip
    

9.3. Solubilization and renaturation of the bodies of inclusion

There have been a series of stages that have as a goal to solubilize and then renaturalize the protein encoded by ORF281 in order to determine if this protein owns a phytase activity or not

E. coli strain BL21 appA pETCm281 is grown in M98 medium and then induced with 0.25 mM of IPTG when the OD at 600 nm reaches 0.4. After 3 hours of induction, the culture is centrifuged (final OD about 1). The residue is taken up in 20 mM Tris-HCl buffer, pH 8.0 at a rate of 4 ml for 100 ml of culture. The cells are treated with ultrasound at 4 ° C: 4 cycles of 10 seconds at a power of 500 Watts. The OD 600 goes from 14 to 3. The suspension is then centrifuged for 10 minutes at 16,000 g, and then the supernatant is removed.

The residue is resuspended in 5 ml for 100 ml of solubilization buffer culture: 20 mM Tris-HCl pH 8, 8M urea, 0.5M NaCl, 1mM 2-mercaptoethanol. The suspension is treated with ultrasound at a rate of 4 cycles of 10 seconds at a power of 500 watts, and then stir for 1 Hour at room temperature. Then, 30 ml of this is dialyzed suspension at 4 ° C for 16 hours against 3 liters of buffer renaturation 25 mM MES pH 6.5, 0.5 M NaCl, 1 mM Mercaptoethanol (Cut-off 10 kDa). A second dialysis is performed against 3 liters of 25 mM MES renaturation buffer pH 5.5, 0.5 M NaCl, 1 mM Mercaptoethanol (Cut-off 10 kDa) for 5 hours Then, the suspension is centrifuged for 10 minutes at 16,000 g and stored at 4 ° C before dosing enzymatic

The same culture, solubilization and renaturation protocol has been applied to strain E. coli BL21 appA pETCmTEM.

       \ vskip1.000000 \ baselineskip
    

9.4. Activity of inclusion bodies

The suspensions of the renatured proteins produced by the E. coli BL21 appA strains pETCm281 and pETCmTEM have been concentrated 10 times on Nanosep ™ 10K Omega (Pall). Phytase activity is measured on these concentrated solutions according to a standard protocol (at pH 3.5). This test has been performed in duplicate.

3

Only one phytase activity is detected in E. coli strain BL21 appA pETCm281. This activity is confirmed by a pMUF dosage. Using this fluorometric method, no activity is detected in E. coli strain BL21 appA pETCmTEM, although this dosage is five times more sensitive than the usual colorimetric method.

       \ vskip1.000000 \ baselineskip
    

9.5. Purification of inclusion bodies

The resolubilized fraction of the inclusion bodies of the E. coli BL21 appA pETCm281 strain has been deposited on a POROS 20 HS column (4.6 / 100 mm: 1.7 ml gel) previously equilibrated with a 20 mM MES pH buffer 5.5, 1 mM of CaCl2. The proteins are eluted by a NaCl gradient from 0 to 1 M in 20 column volumes.

Phytase activity elutes at a concentration in 0.35 M NaCl. This result is at all points identical to obtained in example 5.4. With the native phytase.

In parallel, a total extract (soluble and insoluble proteins) of E. coli BL21 appA pETCmTEM has been deposited on the same column, and the proteins have been eluted under the same conditions. No phytase activity could be detected in fractions eluted between 0.15 and 0.45 M NaCl.

       \ newpage
    

9.6. SDS-PAGE gel

The fraction that has a phytase activity, originating from the cation exchange column, has been deposited on an SDS-PAGE gel (10% acrylamide) after the concentration of a factor 10 on Nanosep ™. In the same gel, a cell lysate (induced with IPTG) of E. coli BL21 appA pETCm281 and E. coli BL21 appA pETCmTEM has also been deposited.

It also appears clearly that only the E. coli BL21 appA pETCm281 lysate contains a 63 kDa PM band. In the purified fraction on a column and presenting a phytase activity, a band of PM 61-63 kDa is present and is the majority.

These results show, therefore, after sub-cloning in E. coli BL21 appA , that ORF281 encodes well for a phytase.

       \ vskip1.000000 \ baselineskip
    

Example 10 Characteristics of purified recombinant phytase 10.1. Phytase activity as a function of temperature

The phytase activity contained in the fraction purified in example 5.5 and encoded by ORF281 is It has determined at different temperatures. The results of these measurements are presented in figure 5. The optimum temperature of measured activity is 60 ° C. The dosage has been carried out at pH 3.

       \ vskip1.000000 \ baselineskip
    

4.2. Phytase activity as a function of pH

The phytase activity contained in the fraction purified in example 5.5 and encoded by ORF281 is It has also determined at different pH. The results of these measurements are presented in figure 5. The optimal activity pH is of 3.5 The dosage has been carried out at 60 ° C with the succession of following buffers: Glycine-HCl (for pH 2 to 2.5), Formate (pH 2.5 to 4), Acetate (pH 4 to 5), and MONTH (pH of 5 to 6).

       \ vskip1.000000 \ baselineskip
    

Example 11 Search for homologous sequences

The sequence containing the open reading phase identified in the cloned genomic fragment in Example 7 has been used as a probe to search for homologous sequences between microorganisms of the Acidocella and Acidiphilium genera.

The strains tested belong to the species Acidocella aminolytica, Acidocella facilis, Acidiphilium angustrum , and Acidiphilium multivorum .

10 ng of purified PCR product have been labeled by "random priming" with the aid of the Labelling Q-BlOgene kit. 10 µg of genomic DNA from the different strains to be tested respectively by Eco RI or Eco RV have been digested and then deposited on two 1% agarose gels. After migration, the DNA has been transferred by capillarity onto two nylon membranes (BIODYNE® Plus membrane, Pall Gelman).

It has carried out a pre-hybridization for 4 h at 60 ° C with a 5x buffer SSC, 5x Dehardt, 1% SDS, 100 µg / ml denatured DNA from fish.

Hybridization is then performed during 16 h at 60 ° C with a buffer containing 10 ml of buffer pre-hybridization and 10 ng of the probe a respectively 7.10 8 and 9.10 8 cpm / mug for the membrane 1 (EcoRI) and membrane 2 (EcoRV) (count with counter dry scintillation, that is, in the absence of scintillation).

Several phases of washed:

2 washes: 2x SCC + 0.1% SDS for 3 minutes at 20 ° C

2 washes: 0.5x SCC + 0.1% SDS for 3 minutes at 20 ° C

2 washes: 0.4x SCC + 0.1% SDS for 15 minutes at 50 ° C

       \ vskip1.000000 \ baselineskip
    

The membranes have been revealed on film after an exposure of 65 h at -80 ° C.

No difference has been observed significant between the two autoradiographs.

The results show the presence, in all strains of the genus Acidocella tested, of a selective hybridization of the probe containing the open reading phase identified in example 7. These results suggest that there is a significant sequence homology between bacteria genes of the genus Acidocella and the open reading phase that codes for a phytase. In addition, they strongly suggest that these genes also code for phytases.

Conversely, no hybridization has been obtained with the probe within the microorganisms of the Acidiphilum genus. This observation is in agreement with the absence of detection of a phytase activity by microbiological methods in microorganisms of this genus.

       \ global \ parskip0.000000 \ baselineskip
    

<110> Aventis Animal Nutrition SA

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<120> New bacterial phytases and production process of these phytases

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<130> PM 00080

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<140>

         \ vskip0.400000 \ baselineskip
      

<141>

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<150> FR 0014448

         \ vskip0.400000 \ baselineskip
      

<151> 2000-11-10

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<160> 11

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<170> PatentIn Ver. 2.1

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 1

         \ vskip0.400000 \ baselineskip
      

<211> 1665

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> g. Acidocella

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> CDS

         \ vskip0.400000 \ baselineskip
      

<222> (1) .. (1665)

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

         \ vskip1.000000 \ baselineskip
      

4

5

6

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 2

         \ vskip0.400000 \ baselineskip
      

<211> 554

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> g. Acidocella

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

7

8

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 3

         \ vskip0.400000 \ baselineskip
      

<211> 20

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo10

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

atdatdatng cngtrttytt

\hfill

20

 \ hskip-.1em \ dddseqskip 

atdatdatng cngtrttytt

 \ hfill 

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 4

         \ vskip0.400000 \ baselineskip
      

<211> 32

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo12

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

tcrtcrtasg tgatgatgat sgcsgtrtty tt

\hfill

32

 \ hskip-.1em \ dddseqskip 

tcrtcrtasg tgatgatgat sgcsgtrtty tt

 \ hfill 

32

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 5

         \ vskip0.400000 \ baselineskip
      

<211> 23

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo22

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

aaratggarg gncaraayat hgg

\hfill

23

 \ hskip-.1em \ dddseqskip 

aaratggarg gncaraayat hgg

 \ hfill 

2. 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 6

         \ vskip0.400000 \ baselineskip
      

<211> 23

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo23

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 6

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

atggaaggcc agaayatcgg cga

\hfill

23

 \ hskip-.1em \ dddseqskip 

atggaaggcc agaayatcgg cga

 \ hfill 

2. 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 7

         \ vskip0.400000 \ baselineskip
      

<211> 23

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo 25

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 7

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

atcggcgayc tbctbaaygc caa

\hfill

23

 \ hskip-.1em \ dddseqskip 

atcggcgayc tbctbaaygc caa

 \ hfill 

2. 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 8

         \ vskip0.400000 \ baselineskip
      

<211> 19

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo29

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 8

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

ttcatgggtg gcttcgatc

\hfill

19

 \ hskip-.1em \ dddseqskip 

ttcatgggtg gcttcgatc

 \ hfill 

19

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 9

         \ vskip0.400000 \ baselineskip
      

<211> 20

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: Oligo30

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 9

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

gctgccgcat caggaagttg

\hfill

20

 \ hskip-.1em \ dddseqskip 

gctgccgcat caggaagttg

 \ hfill 

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 10

         \ vskip0.400000 \ baselineskip
      

<211> 32

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: 5'ORF281

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 10

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

taacgataac atatgaatat ccgccgggct ct

\hfill

32

 \ hskip-.1em \ dddseqskip 

taacgataac atatgaatat ccgccgggct ct

 \ hfill 

32

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 11

         \ vskip0.400000 \ baselineskip
      

<211> 33

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> Sequence description artificial: 3'ORF281

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 11

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

atatctgata agcttttatt cggcgtgcgc ggc

\hfill

33

 \ hskip-.1em \ dddseqskip 

atatctgata agcttttatt cggcgtgcgc ggc

 \ hfill 

33

Claims (47)

1. Isolated polynucleotide encoding a phytase, characterized in that it is selected from the group consisting of:

(to)

a isolated polynucleotide encoding the phytase described by the sequence identifier SEQ ID No. 2

(b)

a isolated polynucleotide that hybridizes to the polynucleotide according to (a) in astringent conditions

(C)

a isolated polynucleotide that has at least 70% identity with the polynucleotide according to (a)

presenting said phytase an optimum pH of activity less than or equal to Four.

         \ vskip1.000000 \ baselineskip
      

2. A polynucleotide according to claim 1, characterized in that it is represented by the sequence identifier SEQ ID No. 1. 3. Polynucleotide according to one of claims 1 or 2, characterized in that it is derived from a bacterium of the genus Acidocella . 4. Isolated polynucleotide comprising a polynucleotide according to one of claims 1 to 3. 5. Phytase characterized in that it is encoded by a polynucleotide according to one of claims 1 to 4, said phytase having an optimum pH of activity less than or equal to 4. 6. Phytase according to claim 5, characterized in that it is selected from the group consisting of:

(to)

the phytase represented by sequence identifier SEQ ID NO. 2

(b)

a phytase that has at least 70% identity with phytase according to

(C)

a biologically active fragment of a phytase according to (a) or (b).

         \ vskip1.000000 \ baselineskip
      

7. Phytase according to one of claims 5 or 6, characterized in that it is derived from a bacterium of the genus Acidocella . 8. Chimeric gene that comprises at least linked together operatively:

(to)

a functional promoter in a host organism

(b)

a polynucleotide according to one of claims 1 to 4

(C)

a functional terminating element in a host organism.

         \ vskip1.000000 \ baselineskip
      

9. The chimeric gene according to claim 8, characterized in that it further comprises a signal peptide or a functional transit peptide in said host organism. 10. Expression or transformation vector that it contains a chimeric gene according to one of claims 8 or 9. 11. Vector according to claim 10, characterized in that it is a plasmid, a phage or a virus. 12. Transformed host agency that It contains a vector according to claim 10. 13. Host organism according to claim 12, characterized in that it is a microorganism. 14. Host organism according to claim 13, characterized in that the microorganism is selected from bacteria, fungi, yeasts or viruses. 15. Host organism according to claim 14, characterized in that the microorganism is a bacterium selected from the genera Corynebacterium, Streptomyces and Escherichia , in particular E. coli . 16. Host organism according to claim 14, characterized in that the microorganism is a fungus selected from the genera Penicillium, Aspergillus, Chrysosporium and Trichoderma . 17. Host organism according to claim 14, characterized in that the microorganism is a yeast selected from the genera Saccharomyces, Kluyveromyces and Pichia . 18. Host organism according to claim 12, characterized in that it is a plant cell, a plant or a plant part. 19. Bacterial extract comprising at least one phytase activity, characterized in that it comes from a bacterium of the genus Acidocella and whose optimum pH of activity of said phytase activity is less than or equal to 4. 20. Bacterial extract according to claim 19, characterized in that the phytase activity has the following properties:

(to)

optimum temperature = 70ºC

(b)

pH optimal = 4.

         \ vskip1.000000 \ baselineskip
      

21. Bacterial extract according to claim 19, characterized in that the phytase activity has the following properties:

(to)

optimum temperature = 60ºC

(b)

pH optimal = 3.5.

         \ vskip1.000000 \ baselineskip
      

22. Method of preparing a bacterial extract according to one of claims 19 to 21, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d).

         \ vskip1.000000 \ baselineskip
      

23. Method of producing a phytase according to one of claims 5 to 7, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e).

         \ vskip1.000000 \ baselineskip
      

24. Method of producing a phytase according to one of claims 5 to 7, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

recover the culture medium by bacteria removal

(C)

purify phytase from the medium of culture recovered in step (d).

         \ newpage
      

25. Method of producing a phytase according to one of claims 5 to 7, characterized in that it comprises the following steps:

(to)

cultivate a host organism transformed according to one of claims 12 to 18

(b)

concentrate the host organism cultivated in stage (a)

(C)

crush the host organism isolated transform in stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e).

         \ vskip1.000000 \ baselineskip
      

26. Method of producing a phytase according to one of claims 5 to 7, characterized in that it comprises the following steps:

(to)

cultivate a host organism transformed according to one of claims 12 to 18

(b)

recover the culture medium by the elimination of said transformed host organism

(C)

purify phytase from the medium of culture recovered in step (b).

         \ vskip1.000000 \ baselineskip
      

27. Enzymatic composition, characterized in that it comprises at least one bacterial extract according to one of claims 19 to 21. 28. Enzymatic composition, characterized in that it comprises at least one phytase according to one of claims 5 to 7. 29. Food composition, characterized in that it comprises at least one transformed host organism according to one of claims 12 to 18. 30. Food composition, characterized in that it comprises at least one bacterium of the genus Acidocella that expresses a phytase according to one of claims 5 to 7. 31. Food composition according to claim 30, characterized in that the bacterium is selected from the species Acidocella aminolytica and Acidocella facilis . 32. Food composition, characterized in that it comprises at least one bacterial extract according to one of claims 19 to 21. 33. Food composition, characterized in that it comprises at least one phytase according to one of claims 5 to 7. 34. Use of a food composition according to one of claims 29 to 33, for feeding monogastric animals. 35. Use of a food composition according to claim 34, characterized in that it is intended for feeding pigs. 36. Use of a food composition according to claim 34, characterized in that it is intended for feeding poultry. 37. Method of preparing a food composition according to claim 33, characterized in that it comprises the following steps:

(to)

cultivate a host organism according to one of claims 12 to 18

(b)

concentrate the host organism cultivated in stage (a)

(C)

incorporate the host organism isolated in step (b) in said food composition.

         \ newpage
      

38. Method of preparing a food composition according to one of claims 30 or 31, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

incorporate isolated bacteria into step (b) in said food composition.

         \ vskip1.000000 \ baselineskip
      

39. Method of preparing a food composition according to claim 32, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

incorporate the recovered supernatant in step (e) in said food composition.

         \ vskip1.000000 \ baselineskip
      

40. Method of preparing a food composition according to claim 33, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

concentrate cultured bacteria on the stage

(C)

crush the bacteria isolated in the stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e)

(g)

incorporate purified phytase into the step (f) in said food composition.

         \ vskip1.000000 \ baselineskip
      

41. Method of preparing a food composition according to claim 33, characterized in that it comprises the following steps:

(to)

grow a bacterial strain of the genus Acidocella

(b)

recover the culture medium by the elimination of bacteria

(C)

purify phytase from the medium of crop recovered in stage (b)

(d)

incorporate purified phytase into the step (c) in said food composition.

         \ vskip1.000000 \ baselineskip
      

42. Method of preparing a food composition according to claim 33, characterized in that it comprises the following steps:

(to)

cultivate a host organism transformed according to one of claims 12 to 18

(b)

concentrate the host organism transformed grown in stage (a)

(C)

crush the host organism isolated transform in stage (b)

(d)

centrifuge the crushing obtained in the stage (c)

(and)

recover the supernatant that has the phytase activity from stage (d)

(F)

purify phytase from supernatant recovered in step (e)

(g)

incorporate purified phytase into the step (f) in said food composition.

         \ vskip1.000000 \ baselineskip
      

43. Method of preparing a food composition according to claim 33, characterized in that it comprises the following steps:

(to)

cultivate a host organism transformed according to one of claims 12 to 18

(b)

recover the culture medium by the elimination of said transformed host organism

(C)

purify phytase from the medium of crop recovered in stage (b)

(d)

incorporate purified phytase into the step (c) in said food composition.

         \ vskip1.000000 \ baselineskip
      

44. Method for increasing the assimilation of inorganic phosphate contained in the phytic acid of plant-based foods by monogastric animals, characterized in that a phytase according to one of claims 5 to 7 or an enzymatic composition according to one of the claims is incorporated 27 and 28 in the feeding of said animals. 45. Method according to claim 44, characterized in that said monogastric animals are fed with a food composition according to one of claims 29 to 33. 46. Method for reducing the addition of phosphorus in the feeding of monogastric animals, characterized in that said animals are fed with a food composition according to one of claims 29 to 33. 47. Procedure for reducing phosphorus emissions from the feeding of monogastric animals, characterized in that said animals are fed with a food composition according to one of claims 29 to 33.