ES2315096B1 - VECTORS IN WHICH GEN C7L IS INSERTED AND USE OF THE SAME IN THE MANUFACTURE OF VACCINES AND COMPOSITIONS FOR GENE THERAPY. - Google Patents

Abstract

Vectors in which the C7L gene is inserted and used thereof in the manufacture of vaccines and compositions for gene therapy. The recombinant vectors of the invention, present an insert with the coding sequence of the C7L gene of Vaccinia or a homologous gene under the control of a promoter that Allow your expression. These vectors protect from the development of apoptosis to the cells in which they express themselves. The reintegration of C7L gene in the NYVAC genome reverses the apoptotic phenotype of virus without losing its attenuation characteristics. The protection against apoptosis conferred by C7L makes the use of vectors of the invention for manufacturing live vaccines, by increasing Expression time and presentation of additional antigens encoded in its genome, or to prepare compositions for prolonged time acting gene therapy in cells Diana.

Description

Vectors in which the C7L gene is inserted and used thereof in the manufacture of vaccines and compositions for gene therapy.

Field of the Invention

The invention relates to recombinant vectors lacking as such the Vaccinia C7L gene or an equivalent gene belonging to another Orthopoxvirus or homologue thereof, in which said gene is inserted under the control of a promoter that allows its expression, thus acquiring the vector an ability to protect the cells into which they penetrate from the development of apoptosis. In particular, the invention relates to the NYVAC virus in whose genome the C7L gene is reinserted, reversing the apoptotic phenotype of said virus without losing its attenuation characteristics. The invention also relates to the use of the vectors of the invention for the manufacture of live vaccines to generate and / or enhance in an individual an immunogenic response against an antigen that is included in said vectors, taking advantage of the protection against apoptosis. which confers the C7L gene, allows a longer time of expression and presentation of the antigen.

State of the art

Apoptosis or programmed cell death is a conserved mechanism, present in multicellular organisms, which consists of an orderly pattern of events that lead to death and elimination of the cells in which it is triggered. The cellular machinery involved in apoptosis and the processes that lead to it seem to be as intrinsic to the cell as, for example, those related to mitosis, although they may be triggered both by signals that arise within one's own cell as by external apoptosis activators that bind to the cell surface Mitochondria seem to play a role. fundamental in these processes through various mechanisms interrelated such as the interruption of transport of electrons and oxidative phosphorylation and cessation of production of adenosine triphosphate (ATP), the release of proteins that trigger protease activation of the caspases family and the alteration of the potential of oxidation-reduction (redox) cell.

As a consequence of the processes that develop in them, the cells in which apoptosis is induced decrease in size, show bubble-like bumps on its surface, they suffer the degradation of nuclear chromatin (both DNA and associated proteins), experience the cytlasmic release of mitochondrial proteins such as the cytochrome c, are divided into smaller fragments surrounded by a outer membrane, have exposed on its surface the phospholipid phosphatidylserine (which is normally hidden within the plasma membrane), which binds to cell receptors phagocytic such as macrophages and dendritic cells, which they include the fragments they find and secrete cytokines to inhibit the appearance of inflammation.

There are several different mechanisms through which apoptosis occurs. One of them, in which they are Mitochondria directly involved, requires the activation of a protein that is normally found on the surface, external mitochondria, Bcl-2, which, before a internal damage in the cell, activates a related protein, Bax, which causes the appearance of discontinuities in the outer membrane of the mitochondria, producing release to the cell cytoplasm of cytochrome c which, in turn, binds to protein Apaf-1 forming some aggregates called apoptosomes, which bind and activate caspase-9, a protease that activates other caspases and activates a cascade of proteolytic activity that leads to protein digestion Structural cytoplasm, degradation of chromosomal DNA and, finally, to phagocytosis of the cell.

The induction of programmed cell death it seems to be necessary, on the one hand, during the development stage, to facilitate processes such as the formation of fingers and toes in the fetus thanks to the elimination of the tissues present between them or as the absorption of the tadpoles tail in the moment they experience the transformation into frogs. Besides, the apoptosis is necessary to destroy cells that represent a threat to the integrity of the organism, such as cells that have suffered damage to their DNA and that can lead to congenital defects or carcinogenic processes, the cells that are have already become cancerous, the effector cells of the system immune (which can attack its own components if they are not made disappear when the microorganism has been neutralized trigger and decreases the need for an immune response cell-mediated) as well as virus-infected cells (which are eliminated by cytotoxic T lymphocytes by various mechanisms among which induction of apoptosis is found, although some viruses have developed mechanisms aimed at prevent the destruction of the host cell). For all this, the deregulation of the apoptotic process can lead to many diseases and pathological conditions such as cancer, autoimmune diseases or even when it occurs in excess, It can lead to neurodegenerative processes.

Although the correct regulation of apoptosis is generally beneficial for body homeostasis, its existence can be inconvenient for the success of therapies in which recombinant vectors are involved, that is, DNA molecules that penetrate the cells as such or taking advantage of the mechanism of entry of infective viruses that constitute their genome and that contain sequences encoding proteins of interest that are desired to be expressed in the infected or transfected cell. However, apoptosis that the presence and / or expression of many of these vectors triggered in the cell may result in the elimination of the vector along with the cell that contains it earlier than would be desirable. That is the case, for example, of the NYVAC virus, a poxvirus derived from the Copenhagen strain of vaccinia virus which, like other poxviruses, is considered as a first-order candidate for use as recombinant vaccines, because it shows an efficient expression of the exogenous antigen and unique immunological properties to trigger humoral and long-lasting cell-mediated protective immune responses (27). Unlike other strains derived from poxvirus vaccinia, MVA (Ankara modified vaccinia virus, another important candidate to be used as live vaccines against numerous infectious diseases and in cancer therapy), which was classically attenuated by growing chicken embryonic fibroblast virus (CEF) virus after more than 500 passes (23), a process during which 15% of the parental viral genome was lost, as well as the ability to grow in human cells and in most cells In mammals (1, 7, 12, 26), NYVAC attenuation occurred genetically, by deletion of 18 nonessential genes involved in virulence, host range or pathogenicity. The result of these modifications was a strain with a weakened in vitro replicative capacity in cells derived from humans, mice and equine origin, but with the ability to replicate with the efficiency of the wild-type virus in primary CEF cells and in cells Vero, an African green monkey kidney epithelium cell line (46-48). Its genome shows coincidences and differences with MVA with respect to the genes deleted or conserved with respect to the genome of the vaccinia virus from which both derive (see Figure 1, adapted from Antoine et al . (1)). As in the case of MVA, there are numerous examples in which the NYVAC vector is used as a recombinant vaccine delivery system in various animal and human models, with promising results (32, 34, 46). Although NYVAC is a highly attenuated virus, it retains the ability to induce a protective immune response against exogenous antigens similar to the mutant in the thymidine kinase of the parental strain (31). To date, data obtained from clinical studies in humans using NYVAC-based vectors illustrate a positive safety profile and the induction of high levels of immunity against expressed heterologous antigens (2, 4, 11, 14, 18, 29 , 32, 35). However, the current NYVAC virus has a disadvantage to be used in recombinant live vaccines that express antigens of interest and is the fact that it induces apoptosis in the cells infected by it, apoptosis that appears to be mediated by the activation of caspase 9 , which depends on the mitochondria (17). With the development of the apoptotic process, the capacity of the infected cell to increase the amount of antigen expressed in it and that can be presented to the immune system after endogenous processing is reduced, which is a disadvantage for the NYVAC virus to be used in recombinant vaccines From the point of view of its industrial production, moreover, the induction of apoptosis in the cells infected by the NYVAC virus hinders its production with high virus titers and increases production costs. For all this, it would be of great interest to find some modification of the current NYVAC virus that diminishes or reverses its ability to induce apoptosis, but without losing its attenuated phenotype, which does not give rise to the appearance of pathological effects in animals infected with it, conserving Its security features. Such modification would be more useful, in addition, if its use could be extended to other vectors of therapeutic interest that, such as NYVAC, induce apoptosis in the cells in which they penetrate, reducing their ability to act.

So far, some attempts had been made in this regard, which had not been successful. Thus, for example, it had been observed that transfection into human HeLa cells infected with NYVAC of one of the missing genes of NYVAC, the K1L host range gene, NF-KB factor inhibitor, was not able to reverse the apoptotic phenotype from NYVAC (17). This finding was hopeless with respect to the possible utility in that same sense of another of the vaccinia host rank genes that NYVAC lacks, the C7L. This designation refers to the open reading frame (ORF) located at position 7 of the Hindi-C region of the genome of the Copenhagen strain of Vaccinia, which encodes a protein named identically to the gene, C7L. This gene is highly conserved within the Orthopoxvirus genus, showing a homology in the sequence of its proteins of 98 to 100% among the species of this genus, although at present its denomination differs depending on the species. For example, it is also called C7L in the case of the Indian strain of smallpox virus Variola major (also known by the abbreviations VARV-1ND or VAV-I), but the same gene receives the designation 018L in the strain MVA or D1 1L in the Bangladesh strain of smallpox virus Variola major (also known by the abbreviations VARV-BSH or VAR-BSH). In the rest of the poxvirus genera included in the Chordopoxviridae family the homology of the gene is lower, in some of them they do not even have it. Regarding the C7L gene (or any of the homologous genes of different denomination) there is limited information available, but it has been suggested that it could act in some cell lines as a gene equivalent to K1L and the bovine poxvirus gene CP77, although there is no similarity in the amino acid sequence of their corresponding proteins. According to this theory, the deletion of one host rank gene could be compensated for by the presence of another, suggesting that these host rank genes act in common pathways (20,33,36,37). With this background, despite its clinical and industrial interest, it was still unknown what modifications would be necessary to make on NYVAC so that its apoptotic phenotype could be reversed without decreasing its safety and if such modifications could be used in other vectors of a poxviral or non-poxviral nature to stop or delay the apoptotic process triggered in cells infected or transduced by them, thereby increasing the stability of said vectors when used in gene therapy. The present invention provides a solution to this problem.

Description of the invention

In the present invention it is shown that the reintegration into the NYVAC genome of one of the deleted genes during its obtaining from vaccinia virus, the C7L gene, is able to reverse the apoptotic phenotype of NYVAC, without losing its attenuated phenotype in human cells. With this, it increases its capacity of expression of any exogenous antigen present in its genome and the time during which the infected cell may present in its surface antigen fragments generated by processing endogenous, facilitating the interaction cell presenter - T cell and expanding the number of effector cells, which will have immunological consequences in the production of Th1 type cells (producers of interferon-gamma). It has not only been found that in cells infected with a NYVAC virus that the C7L gene has been inserted induction of apoptosis is much lower than in cells infected with the parental NYVAC virus but, in addition, it has been found that cells infected with a poxvirus that expresses the C7L gene, either from its location natural or reinserted by genetic engineering techniques in some point of the poxvirus genome, they turn out to be protected in a very high percentage against agent-induced apoptosis toxic chemical, such as DTT (dithiothreitol). Moreover, it has found that the insertion of the C7L gene into a non-poxviral vector, specifically a plasmid designed for gene expression in mammalian cells, is able to protect cells by 95% transfected with it against apoptosis induced by same chemical agent (DTT). Therefore, the invention provides both recombinant vectors comprising an insert of the C7L gene of the vaccinia virus as well as the use of said vectors to prepare vaccines

Thus, one aspect of the invention is constituted recombinant vectors comprising the coding sequence of the C7L gene obtained from a poxvirus, under the control of a promoter that allows its expression.

As used in the invention, the term "vector" comprises any particle capable of transfecting a cell. As used in the invention, the term "transfect" refers to the introduction of DNA, RNA or any or other genetic material in an animal cell.

Vectors known in the art include, for example, viruses, spheroplasts or liposomes that contain genes, or nucleic acids that contain genes, such plasmids or nucleic acid fragments. When the vector is a plasmid or a  nucleic acid fragment, the coding sequence of the C7L gene and the promoter will be part of the DNA molecule itself that constitutes the plasmid or the nucleic acid fragment, being inserted in it. When the vector is, for example, a virus, the coding sequence of the C7L gene and the promoter that controls its expression will be inserted into the genome the virus. Among the viruses known in the art for being suitable for use as vectors may be mentioned poxviruses, retroviruses, adenoviruses, baculovirus, polyomavirus, herpes virus, papillomavirus, virus of the SV40 type, adeno-associated viruses or viruses Epstein-Barr.

As used in the invention, the term "inserted sequence" implies that said sequence is not found in the genetic material of the starting vector from which said sequence becomes part to give rise to a vector of the invention. "Genetic material" means any nucleic acid molecule that comprises at least one gene.

In one embodiment of the invention, the vector Recombinant is a recombinant live virus whose genome comprises a insert with the C7L coding sequence of a poxvirus. When the recombinant live virus is a poxvirus, they will be comprised within the vectors of the invention those strains whose genome does not  naturally contain the C7L gene or a gene that has a high degree of homology with it, the strains that have lost naturally the C7L gene or, as in the case of NYVAC, those strains in which said gene has been deleted by techniques of genetic engineering, and in which a sequence has been reinserted coding corresponding to said gene, either in its location natural or at any other insertion site, under the control of a promoter that allows its expression. In a preferred embodiment, the recombinant live virus whose genome comprises an insert with the coding sequence of the C7L gene is the NYVAC virus. In this case, it is especially preferred that the C7L gene is inserted into the locus of hemagglutinin (HA), a gene that is inactivated in NYVAC, does not give place to alterations of the attenuated NYVAC phenotype when inserting genes in it and also is a locus that has proven to lead to that the insertions in it are very stable (16).

In another embodiment, the recombinant vector that comprises an insert with the coding sequence of the C7L gene of a Poxvirus is a plasmid.

As it happens it is described later in the Example of obtaining the NYVAC-C7L vector, the insertion of one or more genes in the genome of a virus, in a locus specifically, to obtain a recombinant live virus, it is facilitated if done by pre-construction of a plasmid recombinant comprising the gene of interest together with the promoter that you want to control your expression, inserted both in the plasmid so that they are flanked by paths sequences corresponding to each of the ends of the locus viral in which it is desired to insert promoter and coding sequence; both for plasmid amplification, by selecting the colonies of bacteria that contain it, as for later selection of the recombinant viruses in which it has been inserted the coding sequence of the C7L gene, it is also interesting that the plasmid additionally presents a marker gene located between the insert and one of the flanking sequences. Such plasmids, besides being useful as intermediates in the construction of viruses recombinants of the invention, may themselves be valid also as vectors. Therefore, said plasmids constitute also an object of the invention, especially those in that the coding sequence of the C7L gene is the sequence represented by SEQ ID NO: 7, and very particularly the plasmid pJR101-C7L, whose structure and construction are described later herein.

In the Examples described below, vectors have been used that comprise the coding sequence of the gene homologous to the C7L gene of the MVA virus, 018L, which gives rise to a protein sequence that, as can be seen in Figure 2, differs from the Protein sequence corresponding to the C7L gene of the Copenhagen strain of the Vaccinia virus only in one amino acid, 119. When the vector of the invention comprising the coding sequence of the C7L gene is derived from the NYVAC virus, it is especially preferred that the coding sequence inserted into the same is that of the vaccinia virus C7L gene or a derivative thereof, such as MVA, and particularly, the sequence represented by SEQ ID NO: 7 is preferred. However, as can be seen in Figure 2, which shows a comparison of the protein sequences resulting from the expression of the C7L gene of different species of the Orthopoxvirus genus, the protein corresponding to the C7L gene is highly conserved among the different species of that genre. Therefore, although in the Examples described below the MVA 018L gene, homologue of the Vaccinia C7L gene, has been used within the scope of the invention any vector comprising an insert with a protein coding sequence corresponding to the gene C7L of any Orthopoxvirus . Said coding sequence may be identical to that of the gene present in nature or it may be a nucleotide sequence that results in a protein with a sequence analogous to that of the natural protein, although, due to the degeneracy of the genetic code, there are differences in the nucleotide triplets of the insert with respect to those of the natural sequence. Also within the scope of the invention is any vector comprising an insert with the coding sequence of a protein that has a homology in its amino acid sequence of at least 98% with the protein of the C7L gene of Vaccinia or with the encoded protein by the MVA 018L gene. By simplifying the nomenclature, as used in the invention, "coding sequence of the C7L gene" should be understood as any coding sequence that gives rise to a protein whose amino acid sequence is identical to the C7L Vaccinia protein, identical to that encoded by the homologous gene present in MVA, the 018L gene, identical to that encoded by the C7L gene or the homologue to the C7L gene of any other Orthopoxvirus , or that results in a protein that has at least 98% sequence homology with the amino acid sequence of any of said proteins, C7L and 018L. Similarly, when talking about the "C7L gene" reference will be made both to the C7L gene of an Orthopoxvirus in which it receives this denomination and to the homologous gene present in an Orthopoxvirus , regardless of whether or not the denomination is the same. Therefore, the 018L genes of MVA and D11 L of the Bangladesh strain of Variola are specifically included under the name "C7L"
better.

When the vector comprising the sequence C7L gene encoder is a virus derived from a poxvirus, such as it can be the NYVAC virus, the promoter under whose control it is inserted the coding sequence corresponding to the C7L gene may be any poxvirus promoter. Promoters that are preferred are preferred. allow expression both early and in stages delayed poxviral infection, so it is preferred especially the early / late synthetic promoter pE / L (8). At case of other vectors, such as plasmid vectors, the promoter will be chosen to allow expression at least in the target cells of said vectors.

The protection of apoptosis conferred by vectors of the invention, thanks to sequence insertion C7L gene encoder, makes them suitable for use to any purpose in which protection is an advantage against apoptosis. In particular, in those vectors in that a prolonged expression of any sequence is desired additional present in the vector, protection against apoptosis causes the time during which that additional sequence can express itself is not necessarily determined by the triggering apoptotic phenomena, which lead to cell death Therefore, it is within the scope of the invention any vector that, in addition to the sequence of the C7L gene, understand another coding sequence. In the case of that the sequence corresponds to an antigen against which it is desired that triggers and / or potentiates an immune response in a individual to whom the vector of the invention is supplied, the protection against apoptosis that confers on the cell in which penetrate the vector allows to increase the time interval during which said antigen can be expressed in the cell and time during which the cell in which the vector is being expressed may present on its surface fragments of the antigen, which it is an advantage when the individual develops a Antigen response. Therefore, they are realizations preferred of the vectors of the invention comprising sequences additional to the coding sequence of the C7L gene those in the that the vectors of the invention are designed to be used in vaccine manufacturing, especially if, as happens with NYVAC, the vector that lacks the sequence of the C7L gene It is a virus that triggers apoptotic processes in the cell. At specific case of vectors derived from NYVAC virus, in addition, these advantages are achieved without the modification made on the parenteral NYVAC suppose to compromise the security of the individual that it is desired to vaccinate then, as demonstrated later in the Examples described below, the NYVAC virus that incorporates the coding sequence of the C7L gene maintains its phenotype attenuated. For the immunogenic capacity demonstrated so far by recombinant viruses derived from NYVAC, are embodiments Especially preferred vectors of the invention are recombinant vectors derived from the NYVAC virus which, in addition to the coding sequence of the C7L gene, they present minus a second sequence that encodes an antigen against the which one wants to trigger and / or enhance an immune response in a human or animal being, sequence that will be under control of a natural or synthetic poxvirus promoter that enables its expression.

For all the above, it is also an aspect further of the invention the use of any vector of the invention for the manufacture of a vaccine intended to be administered to a human or animal being.

The induction of apoptosis can also be an unwanted effect when produced by expression in the cell of a vector designed for gene therapy. The unleashing of apoptosis involves both the elimination of the vector and the cell and, with it, concludes the expression of the gene whose effect is I was looking for. The inclusion of the gene coding sequence C7L under the control of a suitable promoter implies an increase in time during which the therapeutic gene can be expressed, at protect the cell from the development of apoptosis. Therefore, they are also an object of the present invention the vectors designed for gene therapy that comprise the gene coding sequence C7L under the control of a suitable promoter that allows C7L gene expression in the cell or target cells to which you go Directed the vector. In these cases, the vector will present, in addition to the coding sequence of the C7L gene, at least another sequence, which will encode a protein of therapeutic interest, well because you want to increase your expression temporarily to alleviate some disorder or illness, well because the individual present a defect in the gene that encodes said protein that results in a reduced expression of it, or even null, with respect to the average levels of the population, or giving rise to a defective protein with reduced functionality. In the case of defects in the individual's own gene to which one wishes to administer a vector of the invention, it may be interesting that the sequence in addition to that of the C7L gene, it is integrated into the genome of the individual, so integrative vectors, such as retroviruses, can be especially suitable for that purpose. When you want one expression of the sequence additional to that of the C7L gene during a limited time, although prolonged, vectors derived from adenoviruses may be more suitable for that purpose; in that case, the protection against the development of apoptosis that the expression of C7L gene grants, will help prolong the life of cells in the that adenovirus be expressed, by protecting them against phenomena apoptotics that often triggers the immune system of the individual against cells in which proteins are expressed own adenovirus.

For all this, it is another aspect of the invention the use of any vector of the invention for the preparation of compositions intended for use in therapy gene.

The invention is explained in more detail by middle of the Figures and Examples that appear at continuation.

Brief description of the figures

Figure 1 shows two maps of the genomes of the MVA and NYVAC viruses, under which it has been marked with padding dark areas corresponding to the genes deleted in each one of them and its position with respect to the terminal regions left (RTI), central (RCC) and right terminal (RTD). Immediately below the deletion zones are indicated abbreviated names of genes; underlined names correspond to genes deleted in MVA and present in NYVAC; the names in italics correspond to deleted genes from NYVAC and present in MVA; Bold names correspond to missing genes from both MVA as of NYVAC.

Figure 2 shows the alignment of the protein sequences corresponding to the C7L genes of different Orthopoxviruses : the Copenhagen strain of Vaccinia (VACV-COP_024), the MVA strain of Vaccinia (VACV-MVA_006),
the Western Reserve strain of Vaccinia (VACV-WR 021), the Bangladesh strain of the human smallpox virus Variola major (VARV-BSH_011), the Indian strain of the smallpox virus Variola major (VARV-IND_008), the CMS strain of camel smallpox (CMLV-CMS_021), strain GRI90 of bovine smallpox virus (CPXV-GRI_027), strain Moscow of ectromelia virus (ECTV-MOS_015), strain Zaire of smallpox virus ( MPXV-ZRE_013), or the Lausanne strain of rabbit myxomatosis virus (MYXV-LAU_066).

Figure 3 shows the cytopathic effects in HeLa cells in which the infection (M) was simulated or infected with Vaccinia Western Reserve (WR) strains, modified from Ankara (MVA), or NYVAC, after the time elapsed from the moment of infection indicated in hours (h p.i.) on each of the columns of photographs, taken thanks to a microscope of phase contrast

Figure 4 shows graphs in which represents the logarithm of the virus title, expressed in units plate-forming per milliliter (PFU / ml), detected after infection with Western Reserve strains (data represented by filled squares joined by continuous lines, - \ ding {110} -), NYVAC (data represented with filled triangles joined by dashed lines, - \ ding {115} -) or MVA (data represented by circumferences without filling joined by points, \ cdot \ cdot \ medcirc \ cdot \ cdot), elapsed since time of infection (t p.i.) indicated in hours in abscissa. The graphs A and C correspond to virus associated to cells (Cel-as), while graphics B and D correspond to viruses present in supernatants (Sn), quantified in all cases by immunostaining assay. The Graphs A and B correspond to infection of HeLa cells and the C and D graphs of BHK-21 cell infection. In In all cases, each data represents the average value of three Independent experiments with the standard error bar.

Figure 5 shows comparative analyzes of the protein synthesis during infections with NYVAC and MVA. The photographs of the upper row correspond to autoradiographs of BHK-21 cell lysates (panel A) or HeLa (panel B) infected with MVA or NYVAC viruses and metabolically labeled with 35 S-Met-Cys elapsed since the time of infection the time indicated, in hours, about each lane The photographs of the intermediate row, C and D, correspond to immunostaining of VV antigens performed on Western blots of BHK-21 cell lysates (C) or HeLa (D) infected with the MVA and NYVAC viruses after the time from the time of infection indicated, in hours, on each lane The photographs in the bottom row correspond to the analysis of Western transfers of the levels of phospho-eIF2α (eIF2αP) proteins and eIF2α also detected in cell lysates BHK-21 (E) or HeLa (F) infected with MVA viruses and NYVAC after the time from the moment of infection indicates, in hours, on each lane.

Figure 6 corresponds to the expression of specific viral proteins during infection with NYVAC and MVA under permissive conditions (BHK-21 cells) or not permissive (HeLa cells). Panel A shows the results obtained after submitting cell lysates obtained within 24 hours post-infection electrophoresis, transfer type Western and immunoassay with specific antibodies for each of the proteins indicated to the right of the panel. Panel B is obtained by getting the PCR products electrophoresis in time real (RT-PCR) of the total RNA of cells in which  simulated infection (M) or infected with Western Reserve strains (WR), MVA and NYVAC; as a positive control (C +) the DNA was used extracted from cells infected with MVA; the position of RNAs corresponding to the E3L (early) and A27L genes (late). Panel C shows the product of the extension of A27L gene primers in total RNA isolated from HeLa cell infected with the NYVAC strains (graphic above) or Western Reserve (bottom chart); the scale located on each of the two graphics indicates the size, in base pairs, of the peaks; the arrows indicate the extension products of the primers (cDNA marked with VIC).

Figure 7 shows images, obtained by electron microscopy of the morphogenesis of NYVAC (A) and MVA (B) in HeLa cells infected with 5 pfu / cell at 16 hours after infection. Panels C to E show the characteristics of the apoptosis in cells infected with NYVAC C: represents a cell infected with nuclear condensation (*); D: cytoplasm of a cell infected with extensive vacuolization (*); E: cytoplasm of a cell infected with dense mitochondria (indicated by arrows, \ ding {212}). The magnification of each panel is indicated by bars in the lower right corner: all bars = 500 nm.

Figure 8 shows induction data of the NYVAC apoptosis in non-permissive cells. A: Analysis by Western blot of PARP cleavage in HeLa cells infected with 5 pfu / cell of the MVA or NYVAC strains at different post-infection times; as quantity control of loading was used? -actin (? act). B: DAPI staining of HeLa cells infected with 5 pfu / cell MVA or NYVAC at 24 h p.i. C: Increase factor in cells apoptotic with respect to the control (M) observed in HeLa cells infected with WR, MVA or NYVAC at 5 pfu / cell in the presence or absence of zVAD (40 µ) and stained at 24 h p.i with iodide of propidium followed by cell cycle analysis using a flow cytometer to detect cells with hypodiploid DNA. The percentage of apoptotic cells is indicated on the bars. D: Bands corresponding to ribosomal RNAs 28S and 18S and a characteristic degradation products thereof (indicated by arrows) detected after infection of HeLa cells with the WR, MVA or NYVAC strains at 5 pfu / cell, total RNA isolation at 18 and 24 h p.i, and 2 \ mug electrophoresis of each of the samples; M: infection simulation.

Figure 9 shows the process of construction and purity verification of the NYVAC-C7L virus. Part A shows the structure of plasmid pJR101 and plasmid pJR101-C7L generated from it after the introduction of the C7L gene. Part B shows the results of the electrophoresis of the PCR products performed with primers that hybridized with the right and left flanking arms of the hemagglutinin locus (Figure on the left, marked HA-1 / HA2) or with the primers directed to the coding part of the C7L gene (figure on the right, marked C7L-1 / C7L-2), in each case on DNA extracted from cells infected with the viruses indicated on the lanes:
NYVAC-C7L, parental NYVAC (NYVAC-WT), MVA (MVA-WT) or transfected with plasmid pJR101-C7L.

Figure 10 shows comparative results of inhibition of the apoptotic phenotype of NYVAC by introduction of the C7L gene. A: phase contrast photographs of HeLa cells in which the infection (M) was simulated or infected with MVA (MVA-WT), parental NYVAC (NYVAC-WT) or NYVAC with the C7L gene (NYVAC-C7L) taken at 24 hours post-infection B: Analysis by type transfer Western and immunoassay of PARP cleavage in HeLa cells infected with the vectors indicated on each lane. C: Increase factor in apoptotic cells with respect to infection simulation (M) detected in HeLa cells stained with  propidium iodide and analyzed in a flow cytometer at 24 post-infection hours. D: Bands corresponding to 28S and 18S ribosomal RNAs and characteristic products of degradation thereof (indicated by arrows) detected after  HeLa cell infection with the NYVAC strains or NYVAC-C7L at 5 pfu / cell, total RNA isolation at 18 and 24 h p.i, and electrophoresis of 2 \ mug of each of the samples.

Figure 11 shows comparative data on the Rescue of translation capacity and virus growth NYVAC-C7L with respect to the parental NYVAC virus. TO: Western blot analysis and immunoassay of the concentration of phospho-eIF2-? (eIF2? P), Total eIF2-?, and late viral proteins p21 and p14 in uninfected (M) or infected HeLa cells with 5 pfu / cell of the WR, MVA, NYVAC or NYVAC-C7L strains at 24 hours post-infection. B: logarithm of cell-associated virus titer, expressed in units plate former per milliliter (pfu / ml), detected by immunostaining after infection with NYVAC strains (bars with continuous dark fill) or NYVAC-C7L (bars filled with inclined lines, \\), after passing from the time of infection the time (t p.i.) indicated in hours at abscissa In all cases, each data represents the average value of two independent experiments with the error bar standard.

Figure 12 shows the percentage loss of weight detected in Balb / c mice inoculated intranasally with 10 6 pfu / cell of the Western Reserve strain (data represented with filled circles, - \ ding {108} -), 10 8 pfu / cell of the NYVAC strain (data represented with filled triangles, - 115 {115} -) or 10 8 pfu / strain cell NYVAC-C7L (data represented with circumferences no padding joined by points, - \ boxempty-), calculated after the time indicated in days on the abscissa axis. \ ding {61}: moment of slaughter of animals that suffered severe systemic infection and they had lost more than 25% of body weight.

Figure 13 shows the analysis by Western blotting and immunoassay with a polyclonal antibody directed against the PARP protein, both complete and proteolyzed, performed on lysates of HeLa cells infected to a multiplicity of 5 pfu / cell with the WR strains or NYVAC-C7L and treated at 6 hours after infection with the concentrations of the chemical agent DTT (dithiothreitol) that indicated at the top of the figure. M: cells in which Simulated the infection.

Figure 14 shows the structure of the plasmid pClneo-C7L (part A), and the immunoassay on a Western transfer (part B) in which the expression was checked of the C7L-Flag fusion protein from said plasmid at 48 hours after transfection of HeLa cells with said plasmid. M: cells in which the transfection was simulated; pClneo-?: cells transfected with the plasmid pClneo without insert.

Examples

The examples described below describe the tests performed to locate the gene or genes that could reverse the apoptotic phenotype of NYVAC without losing the safety characteristics for use in humans that confer the weakened replicative capacity it shows in cells of human origin. To do this, different trials were first conducted to characterize the in vitro behavior of NYVAC, comparing it with that of MVA, attenuated poxvirus also derived from vaccinia virus (VV) whose capacity to induce apoptosis in infected cells seems to be much smaller than that of NYVAC (17), thus revealing distinctive biological characteristics between both strains. Once these differences were established, an attempt was made to find a gene deleted in NYVAC and intact in the MVA genome that could be responsible for part of these biological differences, finding that the reintroduction of the C7L gene into the NYVAC genome resulted in a block in apoptosis. induced by this virus.

The tests described in the Examples are They carried out using the following techniques:

Cell and virus culture

The cells were kept in an atmosphere of humidified air with 5% CO2 at 37 ° C. The cells of African green monkey kidney (BSC40) and human cells (HeLa) They were grown in the middle of Eagle modified by Dulbecco (DMEM) supplemented with 10% newborn calf serum (NCS). The Mouse cells similar to fibroblasts (3T3) cells hamster baby kidney (BHK-21) cells Chicken embryonic fibroblasts (CEF) and human cells (TK-143) were grown in the middle of Eagle modified by Dulbecco (DMEM) supplemented with 10% fetal serum Veal (FCS).

The vaccinia virus (VV) strains used in This work includes: Western Reserve (WR), MVA obtained after 586 passes in CEFs (the MVA corresponding to pass 585 was assigned kindly by G. Sutter, Munich, Germany), and NYVAC (provided by J. Tartaglia de Aventis-Pasteur), which were grown and titrated in BSC40 (WR) cells or in CEF cells (MVA or NYVAC). All viruses were purified by two sucrose cushions and were titrated by immunostaining (fifteen). The proportion of particles with respect to the forming units of plaque (pfu) in different virus preparations are determined by optical density measurements at 260 nm (DO260) and virus titration (1 unit of DO260 is related to 1.2 x 10 10 particles per ml, (13)).

Evaluation of ECPs using contrast microscopy of phase

In the evaluation of cytopathic effects (ECP) under permissive and non-permissive conditions, the seeds were sown cell lines indicated on tissue culture plates of twelve wells and were grown until confluence. The cells (in duplicate wells) were infected with 5 pfu / cell with WR, MVA, NYVAC or NYVAC-C7L virus and were visualized in them with a phase contrast microscope, at various times post-infection, ECPs (such as rounding off cells, cytoplasmic contraction and slow separation of the culture surface and the rest of the cells). Also I know analyzed these effects in infected HeLa cells treated with a DNA synthesis inhibitor, Ara C, at a concentration of 50 \ mug / ml. A total of three experiments were carried out independent.

Virus Growth Analysis

To determine the growth profiles of virus, HeLa cell monolayers were infected or BHK-21 grown in tissue culture plates of 12 wells with 0.01 pfu / cell of the WR, MVA or NYVAC strains. After Adsorption of the virus for 60 min at 37 ° C, the inoculum was removed. Infected cells were washed twice with DMEM medium without serum, and incubated with fresh DMEM containing 2% FCS at 37 ° C in an atmosphere with 5% CO2. At different times post-infection, supernatants were removed from the cells scraping with a pipette and the monolayer cells are collected independently in serum free medium. The supernatants were stored at 4 ° C for no more than 48 hours before of the titration of viruses, and viruses associated with cells of The collected monolayer was released from the cells by freeze-thaw and brief sonication. Be plated serial dilutions of the resulting cell lysates and of the supernatants in confluent monolayers of BHK-21 grown in 6-well plates per duplicate. After adsorption of the virus for 60 min at 37 ° C, it is He removed the inoculum. Infected cells were washed twice with serum-free DMEM medium, and incubated with fresh DMEM containing a 2% FCS at 37 ° C in an atmosphere with 5% CO2. Past 24 h p.i, virus titers were determined by an assay of immunostaining with anti-VV antibodies such as has been previously described (19). With the samples containing the virus released to the environment during infection (supernatant) and the virus that remained associated with cells (monolayer cells) was carried out at least three virus titers independent.

Metabolic protein labeling

HeLa cells were infected and BHK-21 grown in 12-well plates with 5 pfu / cell of the MVA or NYVAC strains. At different times post-infection (4, 8 and 16 h), the cells are washed three times and incubated with DMEM free of Met-Cys for 30 minutes prior to marking. After incubation, the medium was removed and 50 were added µCi of [35 S] -Met-Cys Promix per mL in DMEM free of Met-Cys for 30 minutes additional. After three washes with buffered saline solution with phosphate (PBS), cells were resuspended in buffer to Laemmli samples and equal amounts of protein were analyzed (20 µg) by dodecyl sulfate gel electrophoresis sodium polyacrylamide (SDS-PAGE) followed by autoradiography.

Western transfer analysis. Antibodies

For the identification of viral proteins antibodies that specifically recognize the products of early and late viral genes, such as E3L (p25), A14L (p16), A4L (p39), A17L (p21), A27L (p14) and L1R (p27.5). The anti-E3L was kindly assigned by B. Moss and B. Jacobs and the anti-L1R by Y. Ichihashi. The remaining antibodies were generated in the laboratory of the inventors and have already been described (9, 39, 40, 41). The antiserum rabbit polyclonal generated against live VV has been described previously (39). Rabbit polyclonal antibody phosphospecific anti-eIF2α [PS 51] was supplied by BIOSOURCE. The monoclonal antibody against β-actin was supplied by SIGMA. He rabbit polyclonal anti-eIF2α antibody It was supplied by Santa Cruz, CA. The polyclonal antibody of Human anti-PARP rabbit was supplied by Cell Signaling

For type transfer analysis Western, total cell extracts were boiled in buffer for Laemmli samples, and the proteins were fractionated by 10% SDS-PAGE. After electrophoresis, the proteins were transferred to nitrocellulose membranes using a device for semi-dry transfers (Gelman Sciences). The filters were incubated for 30 minutes with PBS containing milk 5% skimmed powder (BLOTTO) at room temperature (RT), mixed with the antisera in BLOTTO, they were incubated throughout the overnight at 4 ° C, washed three times with PBS, and incubated additionally with peroxidase-coupled secondary antibodies of radish in BLOTTO. After washing with PBS, the immunocomplexes were detected by transfer reagents Western type with increased chemiluminescence (ECL) (Amersham)

RT-PCR

The infection was simulated or cells were infected HeLa grown in 6-well plates with WR, MVA, NYVAC or NYVAC-C7L at 5 pfu / cell. Total RNA was isolated at 24 h p.i using the RNA purification system by Ultraspec-II (Biotecx) resins following the manufacturer's instructions 1.5 µg of total RNA was digested with DNAsas to avoid contamination with genomic DNA (Ambion Turbo Kit) PCR was performed with Taq Platinum DNA polymerase (Invitrogen) and primers targeting a viral control gene for make sure there was no contamination with DNA. The RT-PCR (polymerase chain reaction of real time) was carried out with 150 ng of total RNA (DNA free contaminant) using the Invitrogen kit ONE-STEP Primers for E3L amplification were:

5'-GAGATTGTGTGTGAGGCT (SEQ ID NO: 1) Y 5'-TCTTCTCTAACCAGAAAA (I KNOW THAT ID NO: 2)

       \ vskip1.000000 \ baselineskip
    

The primers for A27L were:

5'-GCGCTCGAGATGCATCATCATCATCATCATGACGGAACTCTTTTCCCC (direct) (SEQ ID NO: 3), Y 5'-CGCGGTACCTTACTCATATGGGCGCCGTCCAGTC (reverse) (SEQ ID NO: 4).

       \ vskip1.000000 \ baselineskip
    

Primer extension

The extension of the primers was carried out in the following conditions: 2 pmoles of primer marked with the Applied Biosystem VIC fluorophore (specific for the viral gene A27L), 2 µg of total RNA and 0.5 mM of mixture of dNTPs in a tube 0.5 mL microcentrifuge. The samples were heated at 65 ° C for 5 minutes before stopping the reaction on ice for at minus 5 min. The synthesis of the first strand of cDNA led to out using SuperScript ™ II RT and RNX 5x Buffer (Invitrogen), following the manufacturer's instructions, for 50 minutes at 42 ° C. The samples were then incubated for 15 min at 70 ° C and the reaction was stopped on ice before precipitation. The cDNAs labeled with VIC were allowed to precipitate for 30 min at 40 ° C after the addition of 0.7 volumes of isopropanol The cDNAs were sedimented by centrifugation at 15,000 rpm for 10 min and washed with 70% ethanol before drying in air and store at -20ºC. Each cDNA sample was dissolved in a solution consisting of 2.5 µL of formamide (Promega), 0.5 µL of the GeneScan® -500 internal electrophoresis standard ROX ™ (Applied Biosystem) and 2 µL loading buffer (Applied Biosystem) per sample. The size of the products of the primer extension was evaluated using software GeneScan® version 3.7 analysis (Applied Biosystem).

Electron microscopy

Monolayers of HeLa cells were infected at 5 pfu / cell with the MVA or NYVAC strains. At 16 h pi, the cells were fixed in situ with a mixture of 2% glutaraldehyde and 1% tannic acid in 0.4 M HEPES buffer (pH 7.5) for 1 h at room temperature. The fixed monolayers were removed from the culture plates with a fixing agent and transferred to Eppendorf tubes. After centrifugation and washing with HEPES buffer, the cells were stored at 4 ° C until the time of use. For ultrastructural studies, the fixed cells were processed to be embedded in the epoxy resin EML-812 (TAAB Laboratories, Ltd., Berkshire, United Kingdom) as previously described (39). Post-fixation of the cells was completed with a mixture of 1% osmium tetroxide and 0.8% potassium ferricyanide in distilled water for 1 h at 4 ° C. After two washes with HEPES buffer, the samples were treated with 2% uranyl acetate, washed again, and dehydrated in increasing concentrations of acetone for 10 minutes each time at 4 ° C. The infiltration in the resin was carried out at room temperature for 1 day. Polymerization of the infiltrated samples was carried out at 60 ° C for 3 days. Ultra-thin sections (20 to 30 nm thick) of the samples were stained with saturated uranyl acetate and lead citrate by standard procedures. Image collection of negative staining and ultra-thin sections was performed on a JEOL 1200-EX II electron microscope that operated at 100 kV (15, 39).

DAPI staining

Cells were grown to confluence HeLa in 12-well plates containing glass coverslips 12 mm in diameter that remained uninfected or infected with WR, MVA or NYVAC at 5 pfu / cell. The cells stained 24 hours after infection with DAPI (4 ', 6-diamidino-2-phenylindole) (10 µg / ml) for 30 minutes at room temperature and They photographed in a fluorescence microscope.

RRNA degradation

The infection was simulated or cells were infected HeLa grown in 6-well plates with WR, MVA, NYVAC or NYVAC-C7L at 5 pfu / cell. Total RNA was isolated at 18 and 24 h p.i using the RNA purification system by Ultraspec-II (Biotecx) resins following the manufacturer's instructions The fractionation of the rRNA took carried out by 1% agarose gel electrophoresis with formaldehyde containing 2 µg of total RNA per lane. The rRNA rupture was visualized after staining the gel with bromide of ethidium

Measurement of apoptotic cell death by analysis of cellular cycle

The different stages of the cell cycle and the percentage of cells with subG0 DNA content were analyzed by staining with propidium iodide (YP) (21). Briefly, I know infected HeLa cells at 5 pfu / cell with strains WR, MVA, NYVAC or NYVAC-C7L in the presence or absence of zVAD-frnk, a general caspases inhibitor (40 µM, Calbiochem). As a negative control cells were used in those that simulated the infection. At 24 p.m., the cells by pipetting, washed once with cold PBS, and permeabilized with 70% ethanol in PBS at 4 ° C throughout the night. After three washes with PBS, the cells were incubated for 45 minutes at 37 ° C with RNAse-A and stained with propidium iodide (10 µg / ml). The percentage of cells with a hypodiploid DNA content was determined by cytometry flow. Data were obtained from 15,000 cells per sample and were analyzed as described above; the results are express as an increase factor in apoptotic cells with regarding uninfected cells.

Virus pathogenicity

Groups of female BALB / c mice were inoculated from 10 weeks of age (n = 4 per group) intranasally (i.n) with different challenge doses of NYVAC or NYVAC-C7L (10 6 to 10 8 pfu / mouse) or with 10 6 pfu / mouse of WR (diluted in 50 µl of PBS). Mortality and weight loss body were followed for at least 2 weeks, with measures Daily of individual animals. The animals that suffered severe systemic infection and who had lost> 25% of the weight body were sacrificed. The average change in body weight is calculated as the percentage of the average weight for each group with respect to The day of the challenge.

Example 1 Comparison of the cytopathic effect triggered by NYVAC and MVA

VV infection induces dramatic changes in the functions, metabolism and morphology of cells, to all of which is collectively called cytopathic effect (ECP). In order to characterize the ECP produced by the VV WR strains, NYVAC and MVA, monolayers of different cell lines were infected at 5 pfu / cell with each virus and the degree of ECP was analyzed by phase contrast microscopy at different times post-infection In the trial both were used permissive as non-permissive cell lines, understood by permissive cell lines which allow the completion of the viral cycle when exposed to a certain virus and by non-permissive lines those in which the viral cycle is blocked at some stage before it is completed, so that there is no way out of the culture medium of new viruses replicated and assembled in the infected cell so they can Infect new cells. To the non-permissiveness of a line for a certain virus is also called "restriction of host ", which can occur at different stages of the cycle viral depending on the virus and the infected cell line. All cell lines used in assay were permissive for the strain WR; As for the MVA and NYVAC strains, the permissiveness of each of the cell lines indicated below in Table 1, in which permissive lines are indicated by the "+" sign and non-permissive by means of the "-" sign:

TABLE 1 Cell line permittivity for MVA and NYVAC

one

       \ vskip1.000000 \ baselineskip
    

The relationships of particles with respect to units plate former (pfu) determined in the different viral preparations were 302 for MVA, 272 for NYVAC and 310 for WR, demonstrating the same infectivity of purified viruses. Be followed characteristics such as cytoplasmic contraction, the rounding of the cells, and their separation.

All cell lines infected with NYVAC (HeLa, BHK-21, BSC-40, 3T3), regardless of host restriction, they exhibited a Cellular rounding evident already at 2 p.m. p.i. In the course of the infection with NYVAC, the ECP increased over time and towards 24 h p.i, a high level of cell separation was noted, such as can be seen in Figure 3, corresponding to HeLa cells time elapsed in hours since infection with WR, MVA or NYVAC indicated on each column of photographs. The same effects were observed in cells infected with NYVAC treated with Ara C, a drug that blocks DNA replication. By contrast, ECP was delayed and significantly reduced in cells infected with MVA whose morphology, as can be seen in the photograph of Figure 3, was very similar to that of the cells in those that simulated the infection (M). The morphology of the ECP in NYVAC infected cells, unlike cells infected with WR or MVA, it was similar to that of apoptosis.

       \ vskip1.000000 \ baselineskip
    

Example 2 MVA and NYVAC virus growth in cell lines permissive and non-permissive

The deletions of genes caused for NYVAC generation from the VV virus have resulted in a reduced ability of the virus to replicate in a wide range of cell lines of human origin, as well as in kidney cells of rabbit and pig kidney (30, 48). Still, NYVAC can replicate with a wild type efficiency in Vero cells and primary CEF cells (46, 47). For its part, the range phenotype of host observed with MVA includes a late block characteristic after a non-productive infection in many cells mammalian, with non-prevented viral DNA replication and expression of late genes (45, 49). As previously described, the restriction shown by MVA in non-permissive cell lines is a consequence of a defect in the morphogenesis of the virus (3, 9, 22). The restriction observed in NYVAC may also be due to a defect in the morphogenesis of the virus or a defect in the virus spread.

To analyze the characteristics of viral growth of MVA and NYVAC under permissive conditions and not permissive, cell monolayers were infected BHK-21 and HeLa at 0.01 pfu / cell with each of the virus for 0, 24, 48 and 72 hours. The cells were collected by centrifugation and both infectious viruses were quantified that remained associated with cells such as those released at medium in the course of infection, using a test of immunostaining It was also used in the trial, for purposes comparative, the competent strain for WR replication.

It was observed that in HeLa cells infected with WR, the virus titer increased over time over 10,000 times, although there was no increase in the virus titer in infection with MVA or with NYVAC (Figures 4A and 4B). By contrast, under permissive conditions, the growth kinetics of the three Virus strains were similar (Figures 4C and 4D). It is interesting that virus titres associated with cells in cells BHK-21 infected with NYVAC were lower than those titres obtained in cells infected with WR or MVA (Figure 4C). This finding was consistent in three experiments. independent.

The results in Figure 4 demonstrate that, under non-permissive conditions, there is a similar restricted production of infectious viral particles in cells infected with NYVAC and MVA, while under permissive conditions, total virus yields are not affected. Even so, the virus that remains associated with cells in late stages of infection is reduced in cells infected with NYVAC compared to MVA or WR. This reduction is probably the consequence of severe cell destruction that followed infection with NYVAC (see
Figure 3).

       \ vskip1.000000 \ baselineskip
    

Example 3 Protein synthesis during infection with NYVAC and MVA

In order to compare the silencing and the kinetics of viral protein synthesis in cell lines permissive and non-permissive infected with MVA and NYVAC, it infected BHK-21 and HeLa cells with 5 pfu / cell each virus, and at 2, 4, 8 and 16 h p.i infected cells were metabolically labeled for 30 min with 35 S-Met-Cys Promix. Lysates of the cells were fractionated by SDS-PAGE, and The protein pattern was examined by autoradiography. How is shown in Figure 5A, in BHK-21 cells infected with MVA and NYVAC, the pattern of viral proteins and the cell protein silencing occurs with kinetics similar between the two viruses, although some differences were noted in the abundance of proteins. This was confirmed by analysis. by Western transfer of the same homogenates of cells. The accumulation of viral proteins during infection is reduced in cells infected with NYVAC compared to BHK-21 cells infected with MVA (Figure 5C). In HeLa cells infected with NYVAC or MVA, a pattern was observed similar of viral proteins between the two viruses while the silencing was more pronounced in cells infected with NYVAC in late stages of infection (Figure 5B). They also noticed some differences in protein abundance between NYVAC and MVA, a finding confirmed by analysis by type transfer Western (Figure 5D). The accumulation of viral proteins in cells infected with NYVAC in permissive and non-permissive cells will reduced compared to MVA infected cells, which could be due to a defect in translation, transcription a effect of cell lysis.

It is well established that phosphorylation of the subunit a of the eukaryotic translation initiation factor 2 (eIF-2) on serine 51 leads to regulation towards lower values of translation initiation (42). As such, it was determined if infection with NYVAC alters this stage of initiation So, the levels of phospho-eIF2-?-S51 in BHK-21 and HeLa cells infected with MVA or NYVAC were determined by immunoblot analysis with a specific antibody anti-eIF2-? -S51. As demonstrated in both cell lines (Figures 5E and 5F), it was a low level of eIF2-? detectable, phosphorylated in the cells in which the infection was simulated and in early stages after infection with NYVAC or MVA. Without However, with the time of infection there was an increase in phosphorylation of eIF2-? in cells infected with NYVAC but not in cells infected with MVA. He increase in phosphorylation of eIF2-? se correlates with the silencing of protein synthesis of host, suggesting that viral protein levels in cells infected with NYVAC could be compromised by the degree of phosphorylation of induced eIF2-? because of the virus

       \ vskip1.000000 \ baselineskip
    

Example 4 Differences in late viral proteins between infection with MVA and NYVAC in non-permissive cells

Poxvirus gene expression is regulated in the form of a waterfall. In this way, the early genes are transcribe immediately after infection by enzymes and transcription factors contained within the infective virion, while intermediate and late genes are transcribed after of the beginning of viral DNA replication (5, 24, 28). Consequently, in view of the translation control exercised by phosphorylation of eIF2-? during infection with NYVAC, it was determined then if the translation of Early and late specific viral genes were blocked. This was analyzed by Western blotting in lysates of BHK-21 and HeLa cells infected with WR, MVA or NYVAC, using different antibodies that recognized specifically the early viral protein p25 (E3L) and the late viral proteins p14 (A27L), p21 (A17L), p16 (A14L), p39 (A4L) or p27.5 (L1R). For this, the infection was simulated (M) or infected BHK-21 and HeLa cell monolayers with 5 pfu / cell of the WR, MVA and NYVAC strains and lysates were collected from the cells at 24 post-infection. They split by SDS-PAGE equal amounts of protein, they were transferred to nitrocellulose membranes and made react with different antibodies that recognized proteins specific virals indicated above.

As shown in Figure 6A, under conditions permissive (BHK-21 cells) viral proteins Early and late were efficiently detected in lysates of cells infected with WR, MVA or NYVAC. However, in conditions non-permissive (HeLa cells) apparent differences were observed in specific proteins between NYCAC and MVA. Viral proteins Early were detected efficiently in cell lysates infected with the three viruses. On the other hand, viral proteins delays corresponding to the gene products of A27L, A17L and L1R, were not detected in the lysates of cells infected with NYVAC, while in cell lysates infected with MVA or WR, all proteins were produced. It is interesting that others late proteins such as p16 (A14L) and p39 (A4L), were efficiently detected in cells infected with NYVAC. The results were confirmed by immunofluorescence analysis confocal

To determine a possible level defect transcriptional, early and late transcription of viral genes in HeLa cells infected with WR, MVA and NYVAC. With For this purpose, total RNA was isolated at 24 h p.i and followed by RT-PCR the mRNA levels of a viral gene specific early (E3L), and a late viral gene (A27L). How I know shown in Figure 6B, the transcription of viral genes both early as late it happened similarly in all infections

Due to the extensive reading that characterizes Late viral RNA once transcribed, was analyzed in more detail the integrity of the mRNA of one of said late genes, A27L, using extension analysis of 2? RNA primers total asylum of HeLa cells infected with WR or NYVAC, at 5 pfu / cell, for 16 hours. As shown in Figure 6C, the same 263 bp cDNA product was identified using total RNA isolated from HeLa cells infected with NYVAC and WR. The heights of the peaks, which are a measure of the fluorescence intensity of The primer extension products marked with VIC were: 177 for NYVAC and 164 for WR. Thus, the inability to produce some of NYVAC's late proteins seemed to be a consequence of a blockage in the translation and not due to a specific inhibition of late viral transcription.

Since it has been well established that VV mutants lacking one of the late p21 proteins (A17L), p14 (A27L) or p27.5 (L 1 R) are locked in different Stages of viral morphogenesis (40, 44), the absence of these proteins in cells infected with NYVAC are likely to lead to a blockage in viral morphogenesis. Therefore, it was analyzed then the morphogenetic process during infection with NYVAC and MVA in non-permissive cells (HeLa).

Example 5 NYVAC morphogenesis block

The morphogenesis of MVA under permissive conditions and non-permissive has been widely studied (6, 15, 25, 43, 45). The stage in which this process is blocked is dependent of the cell type. In HeLa cells, the program block Morphogenetic MVA occurs in stages following the formation of immature viral forms (VI), without an alteration in expression of early or late viral genes (15, 43). In contrast, no Studies based on the morphogenesis of NYVAC are available. To characterize this process under non-permissive conditions, They infected HeLa cells with NYVAC or MVA at 5 pfu / cell. At 4pm p.i, infected cells were examined by microscopy transmission electronics in search of the presence of intermediates of viral morphogenesis.

As shown in Figure 7, they were detected less immature viral forms (VI) in the cell cytoplasm infected with NYVAC (Figure 7A) than in cells infected with MVA (Figure 7B). Minimal mature viruses were detected intracellular in HeLa cells infected with NYVAC, suggesting that the blocking of the morphogenetic program of this virus occurs in stages coinciding or prior to the formation of VIs.

Transmission electron micrographs of HeLa cells infected with NYVAC also revealed the severity of viral infection in the ultrastructure of the cell. How I know shown in Figure 7 (panels C, D and E), milestones were observed morphological apoptosis that included condensation and chromatin marginalization, marked nuclear invagination, and cytoplasmic vascularization. None of these features are they saw in cells infected with MVA or WR, as noted previously (15).

Example 6 Induction of apoptosis by NYVAC in human cells: caspase activation and rRNA degradation

To specify the extent to which infection by NYVAC was responsible for the induction of the apoptotic phenotype, it analyzed by Western transfer, at different times post-infection, excision of PARP (polymerase from polyADP-ribose, whose cleavage usually occurs in apoptotic cells by activating caspases (38)) in HeLa cells infected with 5 pfu / MVA or NYVAC cell. How I know shown in Figure 8A, the 116 KDa PARP, present in stages Early post-infection, was completely cleaved (89 KDa) in cells infected with NYVAC at 4 p.m. In contrast, the PARP excision did not take place or was less in infected cells with MVA.

Apoptotic cells are also characterized by the presence of fragmented DNA in their nuclei. So cells HeLa infected with 5 pfu / cell of MVA or NYVAC viruses stained at 24 hours post-infection with the DAPI reagent and analyzed by microscopy of fluorescence. As shown in Figure 8B, numerous cores of HeLa showed apoptotic morphology (chromatin condensation and disintegration) at 24 h p.i in cells infected with NYVAC. In  contrast, a very low percentage of total infected cells with MVA he presented this phenotype. These results were seen confirmed by an ELISA type assay that detected the amount of DNA fragments associated with cytoplasmic histones.

To quantify the percentage of cell death after infection, flow cytometry was used. When cells are stained with propidium iodide, apoptotic cells show reduced levels of fluorescence compared to normal cells and appear in the sub-G0 / G1 peak (10). Thus, HeLa cells were infected with WR, MVA or NYVAC at 5 pfu / cell in the presence or absence of zVAD (a general caspase inhibitor), at a concentration of 40 µM. At 24 h pi, the infected cells were stained with propidium iodide, followed by cell cycle analysis, using flow cytometry, to detect hypodiploid DNA. As a negative control, HeLa cells were used in which the infection was simulated. As shown in Figure 8C, which represents the apoptotic cell growth factor detected in each case with respect to the cells in which the infection was simulated, approximately 42% of the cells infected with NYVAC were present in the sub-GO / G1 peak, which represents an increase of approximately 7 times with respect to uninfected cells, compared with 17.6% and 9.3% obtained in cells infected with MVA or WR, respectively. In the presence of zVAD, the percentage of apoptotic cells was significantly reduced.
cativamente (3.67%) demonstrating that apoptosis induced by infection with NYVAC is dependent on caspases.

Nuclease activation seems to be a stage Final commitment in the apoptosis process. So then the effect of nuclease activation on the integrity of the rRNA. Total RNA was isolated from both infected cells with 5 pfu / cell of the WR, MVA and NYVAC strains, as of cells in which the infection was simulated, and it was fractionated by formaldehyde-agarose gel electrophoresis. How shown in Figure 8D, the bands corresponding to rRNA 28S and 18S were intact in the infected cell samples with WR, MVA or in which the infection was simulated. In contrast, in NYVAC infected cells there was a degradation of the rRNA. The rRNA fragments generated by infection with NYVAC were similar to those that occur after the activation of the RNase L. enzyme Clearly, around 24 p.m. NYVAC induces a severe excision of the rRNA. These biochemical findings indicate a Notable apoptotic process during infection with NYVAC.

Example 7 Construction of the NYVAC-C7L vector

In order to know if the reintroduction of C7L in the NYVAC genome could rescue some of the properties Biological methods of NYVAC described in the previous Examples, was used the C7L gene of MVA for the generation of the recombinant virus NYVAC-C7L.

The C7L gene was obtained by chain reaction. of the MVA genomic DNA polymerase (PCR) using the following set of primers:

5'-CG GGATCC CATGGGTATACAGCACGAATTCG (I KNOW THAT ID NO: 5) 5'-TCCC CCGGG TAATCCATGGACTCATAATCTCTATACG (I KNOW THAT ID NO: 6)

that contained targets of recognition for BamHI restriction endonucleases (nucleotides underlined in SEQ ID NO: 5) and SmaI (nucleotides underlined in SEQ ID NO 6).

The amplified fragments of purified DNA were digested with restriction endonucleases BamHI and SmaI, and were cloned into vector pJR101 (16) previously digested with BglII and SmaI and dephosphorylated with the prawn alkaline phosphatase enzyme (CIP). The resulting plasmid, pJR101-C7L, contains the C7L gene under the transcriptional control of the synthetic promoter early / late (pE / L) poxvirus, as well as the marker gene β-Gus under the transcriptional control of early / late viral promoter p7.5 in the opposite orientation. Both genes are flanked by the left flanking arms and right of the hemagglutinin (HA) locus of vaccinia virus. So, plasmid pJR101-C7L directs gene insertion C7L in the HA locus of the NYVAC genome. The structure of this plasmid, pJR101-C7L, as well as that of the plasmid pJR101 used in its construction, are shown in Figure 9A.

Next, cells were infected BSC-40 with the attenuated NYVAC strain at one multiplicity of 0.01 pfu / cell, and then transfected with 10 gg of plasmid pJR101-C7L DNA using the lipofectamine reagent according to the instructions of the manufacturer (Invitrogen). The recombinant NYVAC viruses that contained the C7L gene were selected by consecutive rounds of purification of plates in stained BSC-40 cells with X-Gluc (acid 5-bromo-4-chloro-3-indoxy-? -D-glucuronidase). The presence of the C7L gene in the recombinant virus NYVAC-C7L was confirmed by PCR and analysis of the DNA sequence The C7L gene had the nucleotide sequence represented by SEQ ID NO: 7. In the right panel of Figure 9B, marked as "C7L-1 / C7L-2" the results of the electrophoresis of the PCR products performed using a pair of oligonucleotides that hybridize with the coding region of the gene C7L:

C7Lupper:

5' CGGGATCCCATGGGTATACAGCACGAATTCG (SEQ ID NO: 8), Y

       \ vskip1.000000 \ baselineskip
    

C7Llower:

5' TCCCCCGGGTAATCCATGGACTCATAATCTCTATACG (SEQ ID NO: 9),

that demonstrate the presence of the gene C7L in NYVAC-C7L, resulting in a band that appears at a height similar to that corresponding to the C7L gene of the MVA unmodified (MVA-WT).

The left panel of Figure 9B, marked as "HA-1 / HA2" shows the results of the electrophoresis of PCR products performed using a  pair of oligonucleotides corresponding to the regions Hemagglutinin (HA) gene flanking agents:

HA-1:

5' GTCACGTGTTACCACGCA (SEQ ID NO: 10), Y

       \ vskip1.000000 \ baselineskip
    

HA-2:

5'- GATCCGCATCATCGGTGG (SEQ ID NO: 11),

an essay conducted in order to check the purity of the recombinant NYVAC-C7L. Both PCR were performed on 100 ng of viral DNA, extracted and infected cells at a multiplicity of infection of 5 pfu / cell, 0.3 mM dNTPs, 100 ng of each primer, 2.5 mM of MgC12 and 2.5 U of the Platinum enzyme Taq.

       \ vskip1.000000 \ baselineskip
    

Example 8 The C7L viral gene blocks infection-induced apoptosis with NYVAC and rescue the biological and biochemical properties assigned to NYVAC

Once the viral vector is obtained NYVAC-C7L, it was checked whether or not he was capable of inhibit apoptosis induced by the parental NYVAC vector (NYVAC-WT) in HeLa cells. As in the essays previous, apoptosis was followed evaluating morphological changes, PARP cleavage, rRNA degradation and cell cycle assays. The  Figure 10 shows the results obtained.

The morphological signs of apoptosis observed in HeLa cells infected with NYVAC, were not evident after infection with NYVAC-C7L (Figure 10A), which gave place to a cell morphology closer to that observed in cells infected with the MVA virus (MVA-WT), after 24 hours from the moment of infection with 5 pfu / cell. In addition, the recombinant virus was able to prevent excision of PARP (Figure 10B), reduced the percentage of cells in apoptosis (Figure 10C) and inhibited rRNA degradation (Figure 10D). These observations clearly revealed that the NYVAC-C7L vector has an effect with respect to the induction of apoptosis in infected cells different from Parenteral NYVAC, with apoptosis induced by vector of the invention.

Since during infection with NYVAC the increase in gene silencing correlated with the phosphorylation of eIF2-?, then investigated the role of C7L in translation control by measuring phosphorylation of eIF2-? and expression of late proteins of the p14 (A27L) and p21 (A 17L) virus. How I know shown in Figure 11A, in HeLa cells infected with NYVAC-C7L there was rescue of protein synthesis late virals (p14 and p21) at 24 h p.i compared to the infection with parental NYVAC and levels of phosphorylated eIF2-? were similar to those of MVA infected cells. It was thought that this rescue of the synthesis of late viral proteins is likely to favor Virus replication in human cells. Thus, the viral growth efficiency of NYVAC-C7L in HeLa cells. HeLa cell monolayers were infected with NYVAC and NYVAC-C7L at 0.01 pfu / cell, and at times 0, 24, 48 and 72 hours, the cells were collected from the medium and determined virus titers in cell homogenates by immunostaining assay. As shown in Figure 11B, the reintroduction of the C7L gene into the NYVAC genome rescues the ability of this virus to replicate in HeLa cells.

       \ vskip1.000000 \ baselineskip
    

Example 9 Confirmation of the maintenance of the attenuated phenotype of NYVAC-C7L

To confirm whether the vector of the invention NYVAC-C7L maintained the attenuated virus phenotype Parental NYVAC, thereby maintaining its vector characteristics safe to be used to produce from the same virus recombinants that can be used as live vaccines for immunize humans and animals, BALB / c mice were infected (n = 4) intranasally with different doses of NYVAC challenge or NYVAC-C7L (from 10 6 to 10 8 pfu / mouse) or with 10 6 pfu of WR as a control. Daily follow-up was done in lethality animals and weight loss along a two week period

Unlike the WR infection, which caused a drastic weight loss and severe signs of illness, the infection of mice with NYVAC or with the recombinant NYVAC-C7L did not lead to any obvious disease, even at the highest dose used, 10 8 pfu / mouse, dose at which corresponds to the graph obtained for NYVAC-C7L depicted in Figure 12. These results reveal that the reintroduction of the C7L gene in the NYVAC skeleton maintains an attenuated virus phenotype recombinant, reversing the apoptotic phenotype of NYVAC that lacks such a gene.

Example 10 NYVAC-C7L's ability to inhibit apoptosis induced by external stimuli

Once the capacity of the C7L gene has been checked inserted in NYVAC to reverse the apoptotic phenotype of the NYVAC gene, it was wanted to check if said vector was also capable of control the development of apoptosis due to cell damage produced by chemical agents, such as DTT (dithiothreitol). For this, HeLa cells were infected, at a multiplicity of 5 pfu / cell, or with the WR strain virus (which has the C7L gene) or with the NYVAC-C7L virus, with a control in which the infection was simulated (M). At 6 hour post-infection, some and other cells were treated with different DTT proapoptotic chemical agent concentrations. After two hours of treatment, the cells were collected in buffer of lysis and excision of PARP in Western blots was analyzed using a polyclonal antibody against said protein cell phone, which recognizes both the complete form and the form Proteolized by the action of caspases.

The results obtained, which are shown in the Figure 13, show how in cells infected with viruses possessing the C7L gene (lanes 2 and 3), no excision of PARP protein, even after treating the cells with a 5 mM DTT concentration; instead, in the control cells in those that the infection was simulated (lane 1 of each of the treatments), excision of the PARP protein is observed.

These results seem to indicate that the C7L gene It has an anti-apoptotic capacity against external proapoptotic stimuli, foreign to the infective virus, such as they can be chemical agents toxic to the cell.

       \ vskip1.000000 \ baselineskip
    

Example 11 Anti-apoptotic vector capacity plasmids with the C7L gene

To check if the C7L gene maintained its anti-apoptotic ability outside the viral context, it was decided to insert said gene into an expression plasmid in cells of mammalian, specifically in the vector pCIneo, giving rise to pCIneo-C7L vector, whose structure is shown in the Figure 14A To facilitate the study, the C7L gene was inserted ligated in open reading frame next to a sequence corresponding to the Flag protein, so the expression of the insert from the pCIneo-C7L vector results in a fusion protein C7L-Flag in which the Flag protein is found bound to the C7L protein in the carboxyl terminal region.

Next, HeLa cells were transfected with 3 gg of the pCIneo-C7L vector or vector pCIneo without insert (pCIneo- \ phi, including in the test a control with cells in which the transfection (M). At 48 hours post-transfection, the cells were collected in lysis buffer and the expression of C7L gene was analyzed by Western blotting using a monoclonal antibody that recognizes the Flag protein, thereby recognizes the synthesized C7L-Flag fusion protein from the pCIneo-C7L vector. The results, shown in Figure 14B, demonstrates the existence of expression of fusion protein from the expression vector pCIneo-C7L in transfected HeLa cells.

To check if the expression of the C7L gene in said cells was able to protect them from induced apoptosis by chemical agent, HeLa cells transfected with 3 µg of the pCIneo-4 or pCIneo-C7L vectors were treated with the proapoptotic chemical agent DTT at a final concentration of 5 mM at 46 hours. Two hours after treatment, the cells were fixed and permeabilized, after which was carried out an incubation with specific antibodies that recognize the active caspase 3 protein, indicator of apoptosis, and the Flag protein, fused to the C7L protein expressed from pCIneo-C7L in its carboxyl terminal region. The samples were incubated with secondary antibodies corresponding conjugates with different fluorophores, in order of analyzing them in a confocal microscope. In addition, the DNA was labeled with the reagent To-pro (Invitrogen). Be quantified in each sample the number of cells apoptotic present using the criterion of considering that the cells that presented fragmentation of the nucleus and / or active caspase 3 brand, expressing the number of apoptotic cells with respect to the total. In transfected cells with the vector pCIneo-C7L, the percentage of cells Protected was determined by quantifying in those positive cells for Flag the number of cells that did not have a brand of apoptosis, according to the above criteria. In the cells transfected with the vector pCIneo- \ phi or without transfect, protection was evaluated as the number of cells not apoptotic with respect to the total.

The results obtained are shown at continued in Table 2, which shows that the percentage of cells protected with the pCIneo- \ phi or without Transfect was very similar (16-19%), which indicates that the treatment does not produce an apoptosis in 100% of the cells: this percentage would correspond to the baseline level of protection after treatment with DTT.

TABLE 2 Protection against DTT-induced apoptosis 5 mM in HeLa cells transfected with pCIneo-C7L or pCIneo-4

2

       \ vskip1.000000 \ baselineskip
    

The results show that the C7L gene, inserted into the expression vector in pCIneo mammalian cells, It is capable of protecting transfected cells by almost 95% against the apoptosis induced by the chemical agent DTT in comparison with the parental expression vector (pCIneo-4).

       \ vskip1.000000 \ baselineskip
    

References

1. Antoine , G., F. Scheiflinger , F. Dorner , FG Falkner . 1998 The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other Orthopoxviruses. Virology 244 : 365-96.

2. Belyakov , IM, P. Earl , A. Dzutsev , VA Kuznetsov , M. Lemon , LS Wyatt , JT Snyder , JD Ahlers , G. Franchini , B. Moss , and JA Berzofsky . 2003 Shared modes of protection against poxvirus infection by attenuated and conventional smallpox vaccine viruses. Proc Natl Acad Sci USA 100 : 9458-63.

3. Blasco , R., and B. Moss . 1991 Extracellular vaccinia virus formation and cell-to-cell virus transmission are prevented by deletion of the gene encoding the 37,000-Dalton outer envelope protein. J Virol 65 : 5910-20.

4. Brockmeier , SL, and WL Mengeling . 1996 Comparison of the protective response induced by NYVAC vaccinia recombinants expressing either gp50 or gil and gp50 of pseudorabies virus. Can J Vet Res 60 : 315-7.

5. Broyles , SS 2003 . Vaccinia virus transcription. J Gen Virol 84 : 2293-303.

6. Carroll , MW, and B. Moss . 1997 Host range and cytopathogenicity of the highly attenuated MVA strain of vaccinia virus: propagation and generation of recombinant viruses in a nonhuman mammalian cell line. Virology 238 : 198-211.

7. Carroll , MW, WW Overwijk , RS Chamberlain , SA Rosenberg , B. Moss , and NP Restifo . 1997 Highly attenuated modified vaccinia virus Ankara (MVA) as an effective recombinant vector: a murine tumor model. Vaccine 15 : 387-94.

8. Chakrabarti , S., Sisler , RJ, Moss , B. 1997 . Compact, synthetic, vaccinia virus early / late promoter for protein expression. BioTechniques 23, 1094-1097.

9. Dallo , S., JF Rodriguez , and M. Esteban . 1987 . A 14K envelope protein of vaccinia virus with an important role in virus-host cell interactions is altered during virus persistence and determines the plaque size phenotype of the virus. Virology 159 : 423-32.

10. Darzynkiewicz , Z., S. Bruno , G. Del Bino , W. Gorczyca , MA Hotz , P. Lassota, and F. Traganos. 1992 . Features of apoptotic cells measured by flow cytometry. Cytometry 13 : 795-808.

11. Didierlaurent , A., JC Ramirez , M. Gherardi , SC Zimmerli , M. Graf , HA Orbea , G. Pantaleo , R. Wagner , M. Esteban , JP Kraehenbuhl , and JC Sirard . 2004 Attenuated poxviruses expressing a synthetic HIV protein stimulate HLA-A2-restricted cytotoxic T-cell responses. Vaccine 22 : 3395-403.

12. Drexler , I., K. Heller , B. Wahren , V. Erfle , and G. Sutter . 1998 Highly attenuated modified vaccinia virus Ankara replicates in baby hamster kidney cells, a potential host for virus propagation, but not in various human transformed and primary cells. J Gen Virol 79 ( Pt 2 ): 347-52.

13. Esteban , M. 1984 . Defective vaccinia virus particles in interferon-treated infected cells. Virology 133 : 220-7.

14. Franchini , G., J. Benson , R. Gallo , E. Paoletti , and J. Tartaglia . 1996 Attenuated poxvirus vectors as carriers in vaccines against human T cell leukemia-lymphoma virus type I. AIDS Res Hum Retroviruses 12 : 407-8.

15. Gallego-Gomez , JC, C. Risco , D. Rodriguez , P. Cabezas , S. Guerra , JL Carrascosa , and M. Esteban . 2003 Differences in virus-induced cell morphology and in virus maturation between MVA and other strains (WR, Ankara, and NYCBH) of vaccinia virus in infected human cells. J Virol 77 : 10606-22.

16. Gherardi , MM, JC Ramirez , D. Rodriguez , JR Rodriguez , G. Sano , F. Zavala , and M. Esteban . 1999 IL-12 delivery from recombinant vaccinia virus attenuates the vector and enhances the cellular immune response against HIV-1 Env in a dose-dependent manner. J Immunol 162 : 6724-33.

17. Guerra , S., LA Lopez-Fernandez , A. Pascual-Montano , JL Najera , A. Zaballos , and M. Esteban . 2006 Host response to the attenuated poxvirus vector NYVAC: upregulation of apoptotic genes and NF-kappaB-responsive genes in infected HeLa cells. J Virol 80 : 985-98.

18. Hel , Z., J. Nacsa , WP Tsai , A. Thornton , L. Giuliani , J. Tartaglia , and G. Franchini . 2002 Equivalent immunogenicity of the highly attenuated poxvirus-based ALVAC-SIV and NYVAC-SIV vaccine candidates in SIVmac251-infected macaques. Virology 304 : 125-34.

19. Hornemann , S., O. Harlin , C. Staib , S. Kisling , V. Erfle , B. Kaspers , G. Hacker , and G. Sutter . 2003 Replication of modified vaccinia virus Ankara in primary chicken embryo fibroblasts requires expression of the interferon resistance gene E3L. J Virol 77 : 8394-407.

20. Hsiao , JC, CS Chung , R. Drillien , and W. Chang . 2004 The cowpox virus host range gene, CP77, affects phosphorylation of eIF2 alpha and vaccinia viral translation in apoptotic HeLa cells. Virology 329 : 199-212.

21. Martin , AG, and HO Fearnhead . 2002 Apocytochrome c blocks caspase-9 activation and Bax-induced apoptosis. J Biol Chem 277 : 50834-41.

22. Martinez-Pomares , L., RJ Stern , and RW Moyer . 1993 The ps / hr gene (B5R open reading frame homolog) of rabbitpox virus controls pock color, is a component of extracellular enveloped virus, and is secreted into the medium. J Virol 67 : 5450-62.

23. Mayr , A., H. Stickl , HK Muller , K. Danner , and H. Singer . 1978 . [The smallpox vaccination strain MVA: marker, genetic structure, experience gained with the parenteral vaccination and behavior in organisms with a debilitated defense mechanism (author's transl)]. Zentralbl Bakteriol [B] 167 : 375-90.

24. McFadden , G. 2005 . Poxvirus tropism. Nat Rev Microbiol 3 : 201-13.

25. Meiser , A., D. Boulanger , G. Sutter , and J. Krijnse Locker . 2003 Comparison of virus production in chicken embryo fibroblasts infected with the WR, IHD-J and MVA strains of vaccinia virus: IHD-J is most efficient in trans-Golgi network wrapping and extracellular enveloped virus release. J Gen Virol 84 : 1383-92.

26. Meyer , H., G. Sutter , and A. Mayr . 1991 Mapping of deletions in the genome of the highly attenuated vaccinia virus MVA and their influence on virulence. J Gen Virol 72 ( Pt 5 ): 1031-8.

27. Moss , B. 1996 . Genetically engineered poxviruses for recombinant gene expression, vaccination, and safety. Proc Natl Acad Sci USA 93 : 11341-8.

28. Moss , B., and JL Shisler . 2001 Immunology 101 at poxvirus U: immune evasion genes. Semin Immunol 13 : 59-66.

29. Ockenhouse , CF, PF Sun , DE Lanar , BT Wellde , BT Hall , K. Kester , JA Stoute , A. Magill , U. Krzych , L. Farley , RA Wirtz , JC Sadoff , DC Kaslow , S. Kumar , LW Church , JM Crutcher , B. Wizel , S. Hoffman , A. Lalvani , AV Hill , JA Tine , KP Guito , C. de Taisne , R. Anders , WR Ballou , and et al . 1998 Phase I / IIa safety, immunogenicity, and efficacy trial of NYVAC-Pf7, a pox-vectored, multiantigen, multistage vaccine candidate for Plasmodium falciparum malaria. J Infect Dis 177 : 1664-73.

30. Oguiura , N., D. Spehner , and R. Drillien . 1993 Detection of a protein encoded by the vaccinia virus C7L open reading frame and study of its effect on virus multiplication in different cell lines. J Gen Virol 74 ( Pt 7 ): 1409-13.

31. Paoletti , E. 1996 . Applications of pox virus vectors to vaccination: an update. Proc Natl Acad Sci USA 93 : 11349-53.

32. Paoletti , E., J. Tartaglia , and J. Taylor . 1994 Safe and effective poxvirus vectors-NYVAC and ALVAC. Dev Biol Stand 82 : 65-9.

33. Perkus , ME, SJ Goebel , SW Davis , GP Johnson , K. Limbach , EK Norton, and E. Paoletti. 1990 Vaccinia virus host range genes. Virology 179 : 276-86.

       \ newpage
    

34. Pincus , S., J. Tartaglia , and E. Paoletti . 1995 Poxvirus-based vectors as vaccine candidates. Biologicals 23 : 159-64.

35. Raengsakulrach , B., A. Nisalak , M. Gettayacamin , V. Thirawuth , GD Young , KS Myint , LM Ferguson , CH Hoke , Jr., BL Innis , and DW Vaughn . 1999 Safety, immunogenicity, and protective efficacy of NYVAC-JEV and ALVAC-JEV recombinant Japanese encephalitis vaccines in rhesus monkeys. Am J Trop Med Hyg 60 : 343-9.

36. Ramsey-Ewing , A., and B. Moss . 1996 Recombinant protein synthesis in Chinese hamster ovary cells using a vaccinia virus / bacteriophage T7 hybrid expression system. J Biol Chem 271 : 16962-6.

37. Ramsey-Ewing , A., and B. Moss . 1995 Restriction of vaccinia virus replication in CHO cells occurs at the stage of viral intermediate protein synthesis. Virology 206 : 984-93.

38. Riedl , SJ, and Y. Shi . 2004 Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol 5 : 897-907.

39. Risco , C., JR Rodriguez , W. Demkowicz , R. Heljasvaara , JL Carrascosa , M. Esteban , and D. Rodriguez . 1999 The vaccinia virus 39-kDa protein forms a stable complex with the p4a / 4a major core protein early in morphogenesis. Virology 265 : 375-86.

40. Rodriguez , D., M. Esteban , and JR Rodriguez . 1995 Vaccinia virus A17L gene product is essential for an early step in virion morphogenesis. J Virol 69 : 4640-8.

41. Rodriguez , JR, C. Risco , JL Carrascosa , M. Esteban , and D. Rodriguez . 1998 Vaccinia virus 15-kilodalton (A14L) protein is essential for assembly and attachment of viral crescents to virosomes. J Virol 72 : 1287-96.

42. Rowlands , AG, R. Panniers , and EC Henshaw . 1988 The catalytic mechanism of guanine nucleotide exchange factor action and competitive inhibition by phosphorylated eukaryotic initiation factor 2. J Biol Chem 263 : 5526-33.

43. Sancho , MC, S. Schleich , G. Griffiths , and J. Krijnse-Locker . 2002 The block in assembly of modified vaccinia virus Ankara in HeLa cells reveals new insights into vaccinia virus morphogenesis. J Virol 76 : 8318-34.

44. Smith , GL, A. Vanderplasschen , and M. Law . 2002 The formation and function of extracellular enveloped vaccinia virus. J Gen Virol 83 : 2915-31.

45. Sutter , G., and B. Moss . 1992 . Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc Natl Acad Sci USA 89 : 10847-51.

46. Tartaglia , J., WI Cox , S. Pincus , and E. Paoletti . 1994 Safety and immunogenicity of recombinants based on the genetically-engineered vaccinia strain, NYVAC. Dev Biol Stand 82 : 125-9.

47. Tartaglia , J., WI Cox , J. Taylor , M. Perkus , M. Riviere , B. Meignier , and E. Paoletti . 1992 . Highly attenuated poxvirus vectors. AIDS Res Hum Retroviruses 8 : 1445-7.

48. Tartaglia , J., ME Perkus , J. Taylor , EK Norton , JC Audonnet , WI Cox , SW Davis , J. van der Hoeven , B. Meignier , M. Riviere , and et al . 1992 . NYVAC: a highly attenuated strain of vaccinia virus. Virology 188 : 217-32.

49. Wyatt , LS, MW Carroll , CP Czerny , M. Merchlinsky , JR Sisler , and B. Moss . 1998 Marker rescue of the host range restriction defects of modified vaccinia virus Ankara. Virology 251 : 334-42.

<110> SUPERIOR RESEARCH CENTER SCIENTISTS

         \ vskip0.400000 \ baselineskip
      

<120> VECTORS IN WHICH THE GEN C7L AND USE OF THE SAME IN THE MANUFACTURE OF VACCINES AND OF COMPOSITIONS FOR GENE THERAPY

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<130> P-100435

         \ vskip0.400000 \ baselineskip
      

<160> 11

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 1

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Direct primer of RNA RT-PCR of the E3L gene of Vaccinia

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

         \ vskip1.000000 \ baselineskip
      

17

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 2

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Reverse primer of RNA RT-PCR of the E3L gene of Vaccinia

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 3

         \ vskip0.400000 \ baselineskip
      

<211> 48

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Direct primer of RNA RT-PCR of the A27L gene of Vaccinia

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

19

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 4

         \ vskip0.400000 \ baselineskip
      

<211> 34

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Reverse primer of RNA RT-PCR of the A27L gene of Vaccinia

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

twenty

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 5

         \ vskip0.400000 \ baselineskip
      

<211> 31

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Recognition sequence of restriction endonuclease

         \ vskip0.400000 \ baselineskip
      

<222> 3..8

         \ vskip0.400000 \ baselineskip
      

<223> Sequence of recognition of the BamHI endonuclease

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Direct PCR primer of the C7L gene from MVA

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

twenty-one

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 6

         \ vskip0.400000 \ baselineskip
      

<211> 37

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Recognition sequence of restriction endonuclease

         \ vskip0.400000 \ baselineskip
      

<222> 4..9

         \ vskip0.400000 \ baselineskip
      

<223> Sequence of recognition of the SmaI endonuclease

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> Reverse PCR primer of the C7L gene from MVA

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 6

         \ vskip1.000000 \ baselineskip
      

22

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 7

         \ vskip0.400000 \ baselineskip
      

<211> 453

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Modified Ankara Vaccinia Virus (MVA)

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Variation

         \ vskip0.400000 \ baselineskip
      

<222> 355..357

         \ vskip0.400000 \ baselineskip
      

<223> Methionine substituted by Asparagine in the Copenhagen line of Vaccinia

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> CDS

         \ vskip0.400000 \ baselineskip
      

<223> C7L gene coding sequence of the MVA virus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 7

         \ vskip1.000000 \ baselineskip
      

2. 3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 8

         \ vskip0.400000 \ baselineskip
      

<211> 31

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> C7Lupper: Direct PCR primer of the M7 C7L (018L) gene

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 8

         \ vskip1.000000 \ baselineskip
      

24

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 9

         \ vskip0.400000 \ baselineskip
      

<211> 37

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> C7Llower: Reverse PCR primer of the M7 C7L (018L) gene

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 9

         \ vskip1.000000 \ baselineskip
      

25

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 10

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> HA-1: Primer Direct PCR for the flanking region of the MVA HA locus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 10

         \ vskip1.000000 \ baselineskip
      

26

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 11

         \ vskip0.400000 \ baselineskip
      

<211> 18

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<221> Primer

         \ vskip0.400000 \ baselineskip
      

<223> HA-2: Primer Inverse PCR for the flanking region of the MVA HA locus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 11

         \ vskip1.000000 \ baselineskip
      

27

Claims (28)

1. A recombinant vector comprising the coding sequence of the C7L gene inserted in its material genetic, under the control of a promoter that allows its expression. 2. Vector according to claim 1, which It consists of a plasmid. 3. Plasmid according to claim 2, which comprises the protein coding sequence expressed by the C7L gene of the Vaccinia virus or of a virus derived therefrom. 4. Plasmid according to claim 3, which It comprises the sequence represented by SEQ ID NO: 7. 5. Plasmid according to claim 4, which consists of plasmid pCIneo-C7L, which is a plasmid derived from the expression plasmid in mammalian cells He wore that inserted the sequence represented by SEQ ID NO: 7 linked in open reading frame next to a sequence corresponding to the flag protein. 6. Plasmid according to claim 2, wherein the insert comprising the coding sequence of the C7L gene and the promoter who controls his expression is flanking, in one of his extremes, by a sequence corresponding to one of the extremes of the genome locus of one virus and, in the other, by a sequence corresponding to the opposite end of the same viral locus, the plasmid additionally presenting a marker gene located between the insert and one of the flanking sequences. 7. Plasmid according to claim 6, wherein flanking sequences correspond to the hemagglutinin locus of vaccinia, the marker gene is the β-Gus gene and  the coding sequence of the C7L gene is the sequence represented by SEQ ID NO: 7 and the promoter that controls the expression of said sequence is the synthetic promoter of early / late poxvirus pE / L. 8. Plasmid according to claim 7, which consists of plasmid pJR101-C7L, which is a plasmid derived from plasmid pJR101 presenting between flanking regions of the vaccinia hemagglutinin locus the sequence represented by SEQ ID NO: 7 under control transcriptional promoter of poxvirus E / L and, in the orientation opposite, the β-Gus marker gene under control Transcriptional early / late viral promoter p7.5. 9. Vector according to claim 1, which It consists of a live virus. 10. Vector according to claim 9, which consists of a poxvirus characterized in that its genome has lost the C7L gene naturally or through genetic engineering techniques. 11. Vector according to claim 10, which It is derived from the NYVAC virus. 12. Vector according to claim 11, wherein the coding sequence of the C7L gene is inserted into the genome of the NYVAC virus in the hemagglutinin locus. 13. Vector according to claim 11 or 12, in that the coding sequence of the C7L gene is under control of the early / late poxvirus synthetic promoter pE / L. 14. Vector according to any one of the claims 11 to 13, wherein the coding sequence of the C7L gene encodes the amino acid sequence of the protein expressed by the C7L gene of the Vaccinia virus or a derivative yours. 15. Vector according to claim 14, wherein the coding sequence of the C7L gene is represented by SEQ ID NO: 7. 16. Vector according to claim 15, wherein the coding sequence of the C7L gene is represented by SEQ ID NO: 7 and in which said sequence is under the control of the promoter synthetic early / late poxvirus pE / L and is inserted into the NYVAC genome in the hemagglutinin locus. 17. Vector according to any one of the claims 1 to 16, further comprising at least one coding sequence of any protein, under the control of a promoter that allows its expression in eukaryotic cells. 18. Vector according to claim 17, wherein the promoter allows the expression of the coding sequence of a any protein, in at least one tissue, of a human being or of an animal. 19. Vector according to claim 18, wherein the protein whose expression allows the promoter is a protein exogenous to the human being or the animal or comprising at least one antigen fragment recognizable as foreign by the immune system of the human being or the animal. 20. Vector according to claim 19, wherein the exogenous protein to the human being or the animal or the fragment antigen recognized as foreign by the immune system of being human or animal is typical of a virus, bacteria or protozoan pathogen for the human being or for the animal. 21. Vector according to claim 18, which is a integrative vector. 22. Vector according to claim 21, which is a recombinant vector derived from a retrovirus. 23. Vector according to claim 18, which is a non integrative vector. 24. Vector according to claim 23, which is a recombinant vector derived from an adenovirus. 25. Use of a vector according to claim 20 for the manufacture of a vaccine intended to protect prevent or treat a human or animal being faced with a disease that can develop in it by being infected by the virus, bacteria or protozoan of which the protein or fragment is own antigen thereof which can be expressed by said vector, in addition to the protein of the C7L gene. 26. Use according to claim 25, wherein the vector consists of a recombinant vector derived from a virus alive. 27. Use according to claim 26, wherein the vector consists of a recombinant vector derived from the virus NYVAC 28. Use of a vector according to any one of the claims 20 to 24 for the preparation of a composition intended to be used in gene therapy.