ES2240981T3 - NAME CITOCINE LERK-7. - Google Patents

Abstract

The invention is directed to a protein designated Lerk-7, DNA encoding the Lerk-7, and host cells transformed with Lerk-7 DNA. Antibodies directed against Lerk-7 are also provided. The Lerk-7 protein binds to the cell surface receptors known as elk and hek.

Description

Cytokine called Lerk-7.

Background of the invention

Proteins known as receptor tyrosine kinases have an intrinsic kinase activity that is activated after ligand binding. This class of proteins is characterized by structural motifs conserved within the catalytic domains (Hanks et al., Science , 242 : 42, 1988) and can be subdivided into families based on the structural characteristics of the N-terminal regions of the catalytic domain.

The family of eph receptors , named after the first isolated member (Hirai et al., Science , 238: 1717, 1987) is the largest subfamily of receptor tyrosine kinases. Among the members of this family are cek4 (Sajjadi et al., New Biol . 3 : 769, 1991) and cek5 (Pasquale, EB, Cell Regulation 2: 523, 1991) of chicken; mek (Sajjadi et al., above), bsk (Zhou et al., J. Neurosci. Res. , 37: 129, 1994), nuk (Henkemeyer et al., Oncogene 9: 1001, 1994), and sek (Gilardi -Hebenstreit et al., Oncogene 7: 2499, 1992) of murine; elk (Letwin et al., Oncogene 3 : 621, 1988; Lhotak et al., Mol. Cell. Biol. 11 : 2496, 1991), eek (Chan et al., Oncogene 6 : 1057, 1991) ehk-1 and ehk-2 (Maisonpierre et al., Oncogene 8: 3277, 1993) of rat; and hek (Boyd et al., J. Biol. Chem., 267 : 3262, 1992; Wicks et al., PNAS USA , 89: 1611, 1992), hek2 (Bohme et al., Oncogene 8: 2857, 1993) , eck (Lindberg et al., Mol. Cell. Biol. 10 : 6316. 1990), and erk (Chan et al., above) of human beings.

The proteins of this subfamily are related not only in their cytoplasmic domains, but also in their extracellular domains, which are 41 to 68% identical. Interestingly, the tissue distributions of these Various receivers are varied. For example, mRNA expression of elk it has been reported that it is limited to testicles and brain (Lhotak et al, above), while eck is not only found in these two same tissues but in lung, intestine, kidney, spleen, ovary, and skin too. Because most tyrosine Eph-related receptor kinases are primarily expressed in the brain, it has been postulated that these receptors and their ligands may be involved in growth, differentiation, and neuron survival

The so-called cell surface glycoprotein ( human eph / elk kinase type) was purified by Boyd et al. ( J. Biol. Chem ., 267 : 3262, 1992). A monoclonal antibody immunoreactive with hek was used to study the expression of hek in a number of human cell types (Boyd et al., Above). The hek antigen was detected in the human pre-B cell leukemia cell line LK63 (the cell line used as an immunogen against which the antibody was induced) and the JM cell line of human T-cell leukemia. The Raji B lymphoma cell line showed a weak expression of hek antigen, and the remaining cell lines tested (both normal and tumor cell lines, including hematopoietic cell lines that included T and pre-B cell lines) were consistently negative . Of the biopsy samples of normal and tumor tissue that were also tested for hek antigen expression, none of the normal tissues is positive and only a very low proportion of hamatopoietic tumors was positive.

The expression of hek transcripts in the LK63 and JM cell lines described above, as well as the human T-cell leukemia HSB-2 cell line, has been demonstrated by Northern blot analysis (Wicks et al., Proc. Natl Acad. Sci. USA, 89 , 1611, 1992). The amino acid and nucleotide sequences for an isolated hek cDNA clone are also presented in Wicks et al., Above.

A partial clone of the cell surface protein called elk was first discovered in a rat brain cDNA expression library that was screened for proteins that express tyrosine kinase activity (Letwin et al., Oncogene , 3 : 621, 1988). Later, a composite sequence that extends over the entire elk coding region was derived from isolated partial clones of a rat brain cDNA library and a cerebellar brain library using the partial clone as a probe (Lhotak et al., Mol. Cell. Biol. 11 : 2496, 1991).

The ligands that have been identified for receptor tyrosine kinases are a diverse group of proteins that affect cell growth, differentiation, and survival that express the receptors. Due to the homology of the receptors in the eph family, a given ligand for a specific receptor It can also bind to other receptors. The ones have been isolated ligands for hek and elk, as described in more detail more ahead.

The identification of additional ligands for hek and elk that may exist would prove useful in investigating the nature of cellular processes regulated by signaling through these receptors. If enhancement or inhibition of a particular biological signal mediated through these receptors is desired, it is advantageous to identify each of the proteins that can play a role in the transduction of such signals. In addition, it is known that certain proteins can bind to receptors without initiating the transduction signal, including the interleukin-1 receptor antagonist protein (Eisenberg et al., Nature , 343 : 341, 1990; Hannun et al., Nature , 343 : 336, 1990; and Carter et al., Nature 344 : 633, 1990). The identification of additional proteins that bind to hek or elk is also desirable in order to determine whether such proteins function as antagonists.

Summary of the Invention

The present invention relates to a cytokine novel called Lerk-7. They are provided in this Lerk-7 protein descriptive memories purified, together with isolated DNA encoding Lerk-7, expression vectors comprising DNA of Lerk-7, and host cells transformed with Expression vectors The procedures to produce Lerk-7 include culture of such cells hosts transformed into conditions that promote expression from Lerk-7.

Lerk-7 polypeptides bind to the cell surface receptors known as hek, elk, and eck, which have been described above. The invention also encompasses antibodies that specifically bind to polypeptides lerk-7.

Detailed description of the invention

A novel cytokine called Lerk-7 is provided in this specification. This cytokine binds to known receptor tyrosine kinases like elk, hek, and eck.

The present invention encompasses DNA encoding Lerk-7, expression vectors comprising DNA of Lerk-7, and host cells transformed with Expression vectors A procedure to produce Lerk-7 polypeptides comprises cell culture hosts transformed into conditions that lead to Lerk-7 expression, and recovery of Lerk-7 expressed. Polypeptides are described Purified Lerk-7 in both soluble form and membrane bound.

Lerk-7 polypeptides or immunogenic fragments thereof can be used as immunogens to generate antibodies that are immunoreactive with they. In one embodiment of the invention, the antibodies are monoclonal antibodies.

A cDNA encoding Lerk-7 has been isolated from a human fetal brain cDNA library, as described in example 1. The nucleotide sequence of the coding region of this cDNA from Lerk-7 is presented in SEQ ID NO: 4, and the amino acid sequence encoded by it is presented in SEQ ID NO: 5. This protein Lerk-7 comprises a signal peptide N-terminal (amino acids -20 to -1 of SEQ ID NO: 5), an extracellular receptor binding domain (amino acids 1 to 133), a spacer region (amino acids 134 to 183), and a C-terminal elongation of hydrophobic waste (amino acids 194 to 208).

Lerk-7 is predicted to be anchored to the cell surface by means of glycosylphosphatidylinositol (GPI) bond. GPI membrane anchors, including their chemical structure and processing, are described in Ferguson, M. and A. Williams, Ann. Rev. Biochem., 57: 285, 1988. When initially expressed, certain proteins comprise a C-terminal hydrophobic domain that contains signals to anchor GPI. A cleavage site is located upstream, often about 10-12 amino acids upstream of the N-terminus of the hydrophobic domain. The post-translational procedure includes protein cleavage at this cleavage site. A GPI anchor binds to the C-terminal amino acid recently expose the mature, processed protein. Thus, when Lerk-7 proteins are expressed in cells that recognize GPI anchor signals, the full length amino acid sequence of SEQ ID NO: 5 represents a precursor form of the protein.

The GPI binding site predicted in the protein Lerk-7 is the asparagine rest at position 183. After protein cleavage (during post processing translational), this asparagine residue is performed at the C-terminus of The processed protein. A GPI residue joins this asparagine residue. This prediction of the probable cleavage site is based on sequences of consensus found in other proteins anchored by GPI. Is it is possible that the cleavage occurs anywhere upstream of the hydrophobic region.

The present invention provides both cell membrane bound and soluble (secreted) forms of Lerk-7. Soluble Lerk-7 polypeptides include the receptor binding domain of a native Lerk-7, but lacks the GPI signal that would result in retention of the polypeptide in a cell membrane. The soluble Lerk-7 polypeptides encompassed by the invention retain the ability to bind to the hek or elk receptor. The soluble Lerk-7 can also include the spacer region or part of the hydrophobic domain, provided that the Lerk-7 protein can be secreted
soluble.

The soluble Lerk-7 can be identify (and distinguished from their membrane-bound counterparts not soluble) separating intact cells that express a polypeptide Lerk-7 from the culture medium, for example, by centrifugation, and testing the medium (supernatant) for presence of the desired protein. The presence of Lerk-7 in the middle indicates that the protein was secreted from the cells and thus is a soluble form of the desired protein

The soluble forms of Lerk-7 they possess certain advantages over the membrane-bound form of the protein. Protein purification is facilitated from recombinant host cells, since proteins soluble are secreted from the cells. In addition, proteins soluble are generally more suitable for certain applications, for example, for intravenous administration.

Soluble Lerk-7 proteins they are truncated at the C end. Hydrophobic domain suppression It is believed to be sufficient to prevent GPI anchoring of the protein to the cell membrane, although the protein can be truncated additionally to suppress the amino acid that constitutes the site of union to GPI. Examples of Lerk-7 polypeptides soluble humans include, but are not limited to, polypeptides truncated at the C end so that the C-terminal amino acid is any of those between or including the remains in the positions 133 and 193 of SEQ ID NO: 5.

In particular embodiments, the polypeptides Soluble Lerk-7 include those that comprise amino acids 1-133, 1-182, 1-185, or 1-193 of SEQ ID NO: 5. To illustrate one embodiment, an expression vector was prepared that encodes a recombinant fusion protein comprising the amino acids -20 to 185 of SEQ ID NO: 5, followed by a peptide encoded by a multiple cloning site sequence of the vector, followed by a polypeptide of the Fc region (derived from a antibody). This fusion protein was secreted from the host cells in which it was expressed, and showed activity biological, as evidenced by eck binding. In other alternatively, the soluble polypeptide is a fragment of the domain of Lerk-7 receptor binding that retains capacity of joining elk or hek.

When initially expressed in a cell host, soluble Lerk-7 polypeptides advantageously they comprise the native signal peptide or one of the heterologous signal peptides described below which is functional within the host cells used. DNA sequences isolates encoding soluble Lerk-7 proteins are encompassed by the present invention.

The fragments of Lerk-7, which include soluble polypeptides, can be prepared by any of the numerous conventional techniques. A sequence of DNA encoding a truncated Lerk-7 can be chemically synthesize using known techniques. The fragments of DNA can be produced by restriction endonucleas of a full length cloned DNA sequence, and be isolated by electrophoresis on agarose gels. You can use the oligonucleotides that reconstruct the 5 'or 3' end of a DNA fragment at a desired point. The linkers they contain restriction endonbuclease cleavage site (s) were can be used to insert the desired DNA fragment into An expression vector. The chain reaction procedure of the Well-known polymerase (PCR) can also be used to amplify a DNA fragment encoding a protein fragment particular. Primers defining the ends are used in the PCR Desired DNA fragment. As an additional alternative, it they can employ known mutagenesis techniques to insert a stop codon at a desired point, for example, immediately downstream of the codon for the last amino acid in the domain of receptor binding.

Other proteins that bind to both hek and elk, and they are called Lara-1 a Lerk-6 (ligands of kinases related to eoh) Lerk 2 and 5 are transmembrane type 1 proteins, while that Lerks 1, 3, 4, and 6 are anchored to the cell membrane via GPI link. The percent identity of the sequences of amino acids of these proteins vary between 30 and 59%, and each protein It has four preserved cysteine residues.

Holzman et al. ( Mol. Cell. Biol. 10: 5830, 1990) reviewed the cloning of ADnc for a protein called B61. The ability of B61 to bind elk and hek was subsequently discovered, and the B61 protein provided the alternative denomination Lerk-1 (Beckmann et al., EMBO J. 13: 3757, 1994). B61 has also been reported to be a ligand for the receptor tyrosine kinase described above known as eck (Bartley et al., Nature 368: 558, 1994).

Lerk-2, also known as ligand elk, is described in PCT application WO 94/11384. So much Lerk-1 as Lerk-4 are described in U.S. Patent No. 5,516,658. Lerk-5 se described in U.S. Patent No. 6,303,769.

Lerk-6 DNA and proteins described in U.S. Patent No. 5,919,905. A clone of Murine Lerk-6 cDNA named λ13 se isolated from an 11.5 murine embryonic cDNA library days. A substantially complete DNA sequence of the region cDNA encoder of the λ13 clone, and the sequence of amino acids encoded by it, are presented herein descriptive in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The open reading phase within this sequence encodes a 184 amino acid protein. The first amino acid of SEQ ID NO: 2 (Ala) is believed to be located at or very close to the native N end. A cell lysate containing the cDNA of the λ13 clone (DNA of the Lerk-6 in [lambdagt10] was deposited with the American Type Culture Collection, Rockville, MD, United States on July 15, 1994, and common assignment access number with the present ATCC 75829.

The Lerk-7 cDNA of the present invention was discovered during an attempt to isolate cDNA that encodes the human counterpart of human Lerk-6. A mouse Lerk-6 DNA fragment was used as a probe to select a human cDNA library in an attempt to clone the human Lerk-6. Surprisingly, a clone of isolated cDNA encoded a novel protein, the Lerk-7 of the present invention.

The percent identity of the sequence of amino acids of human Lerk-7 of SEQ ID NO: 5 with the amino acid sequence of other various proteins it's like follow, in which "h" represents human being, "m" represents mouse, and "r" represents rat:

       \ dotable {\ tabskip \ tabcolsep # \ hfil \ + # \ hfil \ + # \ hfil \ tabskip0ptplus1fil \ dddarstrut \ cr} {
 h Lerk-1 \ + \ hskip2cm \ + 45.771 \ cr h
Lerk - 2 \ + \ + 27.602 \ cr r Lerk - 2 \ +
\ + 25.676 \ cr m Lerk - 2 \ + \ + 26.126 \ cr h
Lerk - 3 \ + \ + 42.342 \ cr h Lerk - 4 \ +
\ + 42,000 \ cr h Lerk - 5 \ + \ + 25,792 \ cr m
Lerk - 5 \ + \ + 25.114 \ cr m Lerk - 6 \ +
\ +
55.330 \ cr}
    

As used in this specification, the term "Lerk-7" refers to a genre of polypeptides that are substantially homologous with the protein Human Lerk-7 described in example 1. The polypeptides preferably comprise an amino acid sequence which is at least 80% identical, and more preferably at least 90% identical, to the amino acid sequence of SEQ ID NO: 5, as described further below. Polypeptides Lerk-7 are able to bind to receptors described above called hek and elk. Certain uses of Lerk-7 flow from your ability to join elk or hek, as described in more detail below.

Lerk-7 also binds to the receptor called eck (by epithelial cell kinase), which is described in Lindberg and Hunter ( Mol. Cel. Biol. 10: 6316, 1990). Eck is predominantly expressed in cell lines of epithelial origin and in tissues that contain a significant proportion of epithelial cells (Lindnerg and Hunter, above). Eck-expressing cells include both normal and cancerous cell types (Lindberg and Hunter, previously). Additional uses of Lerk-7 flow from its ability to join eck, as described below.

The nucleic acids and proteins of Lerk-7 are provided in this specification. Also within the scope of the present invention are acids Lerk-7 nucleic and proteins derived from others mammal species that include but are not limited to murine, cattle, pigs, horses, or various species of primates.

Lerk-7 polypeptides provided in this specification include variants of native Lerk-7 polypeptides that retain activity a biological activity of a native v. The term "variants of Lerk-7 "as used in this specification refers to polypeptides that are substantially homologous to Native Lerk-7, but they have a sequence of amino acids different from that of a native Lerk-7 because one or more deletions, insertions or substitutions. Of the similarly, the cDNAs encoding Lerk-7 of the present invention include variants that differ from a sequence of Lerk-7 DNA native to one or more deletions, insertions or substitutions, but encoding a polypeptide of Lerk-7 biologically active. The term "biologically active" as it refers to Lerk-7, indicates that the Lerk-7 is able to join hek or elk.

Variant DNA or amino acid sequences are preferably at least 80% identical to a native Lerk-7 sequence, more preferably at least 90% identical. The percent identity can be determined, for example, by comparing the sequence information using the GAP computer program, version 6.0 described by Devereux et al ( Nucl. Acids Res. 12: 387, 1984) and available from the University of Wisconsin Genetics Computer Group (UWGCG). Preferred default parameters for the GAP program include: (19 a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the Gribskov and Burgess, Nucl weight comparison matrix . Acids Res . 14: 6745, 1986, as described by Schwartz and Dayhoff, eds, Atlas of Protein Sequence and Structure , National Biomedical Research Foundation, pp. 353-358, 1979; (2) a penalty of 3.0 for each hole and an additional 0.10 penalty for each symbol in each hole; and (3) no penalty for final holes.

Lerk-7 polypeptides variants thus include fragments of Lerk-7 that retain the ability to join hek or elk. The examples of Lerk-7 polypeptides truncated within range of the present invention are soluble polypeptides (secreted).

Additional embodiments of sequences from variant amino acids are those that comprise substitutions conservative meaning that a given amino acid residue is replace with a rest that has physicochemical characteristics Similar. Examples of conservative substitutions of a residue aliphatic by another, such as Ile, Val, Leu, or Ala by another, or substitutions of one polar moiety for another, such as between Lys and Arg, Glu and Asp; or Gln and Asn. Other such conservative substitutions, for example, substitutions of entire regions that have Similar hydrophobicity characteristics are also known. A substitution (s) of amino acids containing Lerk-7 is considered in this report descriptive that are conservatively substituted when the resulting non-native polypeptide retains a biological activity desired from native Lerk-7.

The invention further includes Lerk-7 polypeptides with or without associated native pattern glycosylation. Lerk-7 expressed in mammalian or yeast expression systems (for example, COS-7 cells) may be similar to or significantly different from a native Lerk-7 polypeptide in molecular weight and glycosylation pattern., Depending on the choice of the expression system. The expression of Lerk-7 polypeptides in bacterial expression systems, such as E. coli , provides non-glycosylated molecules.

N-glycosylation sites in the extracellular domain of Lerk-7 can be modify to avoid glycosylation, allowing expression more homogeneous carbohydrate analog, reduced in systems of expression of mammals and yeasts. The sites of N-glycosylation in eukaryotic polypeptides is characterized by an amino acid triplet Asn-X-Y, in which X is any amino acid except Pro and Y is Ser p Thr. the protein Human Lerk-7 of SEQ ID NO: 5 comprises one or more of such triplets, in amino acids 17-19 of SEQ ID NO: 5. The appropriate substitutions, additions or deletions to the sequence of nucleotides encoding these triplets will result in the prevention of binding of carbohydrate residues to the side chain Asn. Single nucleotide alteration, chosen so that Asn be replaced by a different amino acid, for example, it is enough to inactivate an N-glycosylation site. The known procedures to inactivate the sites of N-glycosylation in proteins include those described in U.S. Patent No. 5,071,972 and EP document 276,846.

In another example of variant sequences that encode Cys residues that are not essential for biological activity they can be altered so that they produce the Cys residues to be suppressed or replace with other amino acids, avoiding the formation of bridges Incorrect intramolecular disulfide after renaturation. The cysteine residues that correspond to the four cysteines that are preserved between the Lerk proteins found in the positions 42, 70, 82, and 131 of SEQ ID NO: 5. To maintain activity Biological native protein, these four cysteines remain Desirably unchanged.

Other variants are prepared by modification of adjacent dibasic amino acid residues that enhance the expression in yeast systems in which the KEX2 protease activity. EP 212,914 describes the use of a site directed images to inactivate sites KEX2 protease processing is inactivated by suppressing, adding or replacing remains that alter the pairs Arg-Arg, Arg-Lys, and Lys-Arg to eliminate the occurrence of these remains adjacent basics. Lys-Lys pairings are considerably less susceptible to cleavage by KEX2, and the fr Arg-Lys or Lys-Arg conversion to Lys-Lys represents a conservative approach and preferred to inactivate KEX2 sites. The Human Lerk-7 contains two processing sites of the KEX2 protease, at amino acids 78-79 and 128-129 of the SEQ ID NO: 5.

The variants or alleles of Lerk-7 Natural origin are also encompassed by the invention. The Examples of such variants are proteins that are produced from of alternative mRNA support cases or from excision proteolytic of the Lerk-7 protein, in which retains the property of binding to elk or hek. The alternative ayuste mRNA can produce a truncated Lerk-7 protein but biologically active, for example, such as a soluble form Natural origin of the protein. Variations attributable to proteolysis include, for example, differences in N or C ends after expression in different types of host cells, due to proteolytic elimination of one or more amino acids Lerk-7 protein terminals (usually between terminal amino acids 1-5).

In relation to the previous description of the signal peptide and various protein domains Lerk-7, those skilled in the art will recognize that the previously described demarcations of such regions of the protein are approximate. For example, although the programs of computer that predict the cleavage site of a signal peptide are available, cleavage occurs at sites other than the predicted In addition, it is recognized that a protein preparation can comprise a mixture of protein molecules that have different N-terminal amino acids, due to the Excision of the signal peptide at one or more sites. In addition, the post-translational processing may vary depending the particular expression system used. In this way, by example, the N- or C-terminal amino acid of a recombinant protein may vary according to cell type hosts in which the protein is expressed.

Variants and derivatives of native Lerk-7 proteins can be prepared by mutation of nucleotide sequences encoding native Lerk-7 polypeptides. Mutations can be introduced into particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites that allow ligation to fragments of the native sequence. After ligation, the resulting reconstructed sequence encodes an analog that has the desired insertion, substitution, or deletion of amino acids. Alternatively, nucleotide site-specific mutagenesis procedures can be employed to introduce a desired mutation. Procedures for making such alterations include those described by Walder et al. ( Gene 42 ; 133, 1986); Bauer et al. ( Gene 37 : 73, 1985); Craik ( BioTechniques , January 1985, 12-19 ); Smith et al. ( Genetic Engineering: Principles and Methods , Plenum Press, 1981); Kunkel) Proc. Natl Acad. Sci. USA 82: 488, 1985); Kunkel et al. (Methods in Enzymol. 154 : 367, 1987); and United States patents Nos. 4,518,584 and 4,737,462.

The Lerk-7 can be modified to create derivatives of Lerk-7 by forming covalent or cumulative conjugates with other chemical moieties, such as glycosyl groups, lipids, phosphate, acetyl groups and Similar. The covalent derivatives of Lerk-7 are they can prepare by joining chemical moieties to groups functional on amino acid side chains of Lerk-7 or at the N end or the C end of a Lerk-7 polypeptide or the extracellular domain of the same. Other derivatives of Lerk-7 within Scope of this invention include cumulative conjugates or covalent polypeptides of Lerk-7 with others proteins or polypeptides, such as by synthesis in recombinant cultures such as N-terminal fusions or C-terminal

Lerk-7 polypeptide fusions may comprise added peptides to facilitate purification and identification of Lerk-7. Such peptides include, for example, poly-His or the antigen identification peptides described in US Patent No. 5,011,912 and in Hopp et al., BioTechnology 6 : 1204, 1988. One such peptide is the Flag® peptide. Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys, which is highly antigenic and provides an epitope reversibly linked by a specific monoclonal antibody, which allows a rapid assay and easy purification of the expressed recombinant protein. A murine hybridoma called 4E11 produces a monoclonal antibody that binds to the Flag® peptide in the presence of certain divalent metal cations, as described in United States Patent 5,011,912. The hybridoma cell line 4E11 has been deposited in the American Type Culture Collection under accession number HB 9259. Monoclonal antibodies that bind to the Flag® peptide are available from Eastman Kodak Co., Scientific Imaging Systems Division, New Haven, Connecticut.

Due to the known degeneracy of the code genetic, in which more than one codon can encode the same amino acid, a DNA sequence may vary between that shown in SEQ ID NO: 4 and still encodes a protein Lerk-7 that has the amino acid sequence of the SEQ ID NO: 5. Such variant DNA sequences can be produced at from silent mutations (for example, those that occur during PCR amplification), or they may be the product of deliberate mutagenesis of a native sequence. In this way, the present invention provides isolated DNA sequences selected from Lerk-7 DNA sequences native (eg cDNA comprising the nucleotide sequence presented in SEQ ID NO: 4) and the DNA that degenerates as genetic code result to a DNA sequence of Native Lerk-7

The variants of Lerk-7 that they have the ability to join hek or elk can be identified by any suitable test. The biological activity of a variant of Lerk-7 can be determined, for example, rehearsing for the variant ability to compete with a Lerk-7 native to join hek or elk (i.e. competitive union trials).

Competitive union trials can be Perform following the conventional methodology. The reagents that are they can employ in competitive binding assays include cells that express intact hek / elk and soluble Lerk-7, radioactively marked. For example, native Lerk-7 radiolabelled can be used to compete with a variant of Lerk-7 to join hek or elk attached to the cell surface Instead of intact cells, you could replace a soluble fusion protein hek / Fc or elk / Fc bound to a solid phase through the interaction of protein A or protein G with the rest Fc. The chromatography columns that contain Protein A and Protein G include those available from Pharmacia Biotech, Inc., Pisacataway, NJ. Other type of binding assay Competitive uses radioactively labeled soluble hek or elk, such as a hek / Fc or elk / Fc fusion protein, and intact cells that express Lerk-7. The qualitative results are can be obtained by autoradiographic plate binding assays competitive, or Scatchard studies can be used to generate quantitative results.

The biological activity of a protein Native Lerk-7 or fragment thereof expressed in a particular expression system can be confirmed using essays of competitive union. For example, the Lerk-7 is you can rehearse to assess the ability to compete with one of the other proteins of Lerk-7 (for example Lerk-6) to join elk or hek.

Lerk-7 also binds to the receptor known as eck (Lindberg and Hunter, Mol. Cell. Biol. 10: 6316, 1990). It is possible that the Lerk-7 of the present invention will bind to other receptors of the eph family (see background section). Such binding can be analyzed using a suitable assay analogous to those described above and in examples 4 and 7.

The uses of Lerk-7 flowing from the ability to join elk, hek, and eck include, but not Limited to the following. Lerk-7 finds use as a protein purification reagent. Polypeptides Lerk-7 can be attached to a support material solid and used to purify hek, elk, or eck proteins by affinity chromatography In certain embodiments, the fragments Lerk-7 or fusion proteins (for example, fusions Lerk-7 / Fc) containing the domain binding to Lerk-7 receptor bind to solid support. The polypeptides can be attached to a solid support material by conventional procedures. As an example, they are available chromatography columns that contain groups functional that will react with functional groups on chains side amino acids of proteins (Pharmacia Biotech, Inc., Pisacataway, NJ). Lerk-7 / Fc fusion proteins can be attached to chromatography columns that contain protein A o Protein G by interaction with the rest Fc.

Lerk-7 proteins too find use in purifying cells that express hek, elk, or eck on the cell surface. The Lerk-7 (or fragments  fusion thereof) binds to a solid phase such as a matrix column chromatography or a similar suitable substrate. By For example, magnetic microspheres can be coated with and maintained in an incubation vessel using a magnetic field. The suspensions of cell mixtures containing cells that express hek / elk / ack get in touch with the solid phase that has Lerk-7 in them. The cells that express hek or elk or eck on the cell surface bind to the Lerk-7 fixed, and unbound cells that are Remove by washing. This affinity binding procedure is useful. to purify or identify such cells that express hek / elk / eck.

Cell release procedures positively selected from the solid phase are known in the technique and cover, for example, the use of enzymes. Enzymes suitable are non-toxic and not harmful to calulae and are directed preferably excision is the hek or elk or eck proteins, so  both releasing the resulting cell suspension from the material of Lerk-7 "strange."

The population of purified cells, especially if they are obtained fetal tissue, after they can use to repopulate mature tissues (adults). For example cells elk-expressing neurals can be isolated by the procedure anterior, after administering to a mammal afflicted with a neurodegenerative disorder

Alternatively, mixtures of cells suspected of containing hek / elk + cells can be incubated first with biotinylated Lerk-7. Incubation periods are typically at least one hour long to ensure sufficient binding to hek / elk. The resulting mixture is then passed through a column compacted with avidin-coated beads, whereby the high affinity of biotin for avidin provides cell binding to the beads. The use of avidin coated beads is known in the art. See Berenson, et al., J. Cell. Biochem., 10D : 239 (1986). Washing of unbound material and release of bound cells and release of bound cells is performed using conventional procedures.

In this way Lerk-7 can be use in the separation or purification of cell types described above that express hek or elk. Lerk-7 also finds use in identifying additional types of cells expressing hek or elk on the cell surface Lerk-7 can be conjugated to a detectable moiety such as a radionuclide to detect cells that express hek / elk. As an example, radioactive labeling with125I It can be done using any of several methodologies conventional that produce a molecule of 1 Lerk-7 marked with 125 I for high activity specific. Another detectable moiety such as an enzyme that can catalyze a colorimetric or fluorometric reaction, can be used biotin or avidin. The cells to be tested to evaluate expression from hek / elk you can contact Lerk-7 marked. After incubation, the Lerk-7 labeled unbound is removed and the presence or absence of the rest is determined detectable on the cells.

Lerk-7 proteins are also can be used to measure the biological activity of elk proteins or hek in terms of its binding affinity for Lerk-7 Lerk-7 proteins as well find use as reagents that can be used by carrying out "quality control" studies, for example, to control the half-life and stability of elk or hek protein in different terms. As additional examples, v is used in the determination of whether biological activity is maintained after modification or an elk or hek protein (for example, modification, truncation, chemical mutation, etc.) Thus the biological activity of a elk or hek protein can be determined before it is used in a research study, or for example, possibly in the clinic.

As an illustration, Lerk-7 se used in a binding affinity study to measure activity biological of an elk protein that has been stored at different temperatures, or occur in different cell types. The binding affinity of the elk protein modified to Lerk-7 compares with that of a non-elk protein modified to detect any adverse impact of modifications on the biological activity of elk. By way of similar, the biological activity of a hek protein can be determine using Lerk-7.

Lerk-7 polypeptides also find use as vehicles for distributing agents bound thereto to cells that carry the elk or hek cell surface receptor. The expression of hek antigen has been reported for certain leukemic cell lines, including the human T-cell leukemia cell line called JM and the human pre-B cell leukemia cell line called LK63 (Boyd et al., J. Biol. Chem. 267: 3262, 1992, and Wicks et al., Proc. Natl. Acad. Sci USA , 89: 1611, 1992). In this way, Lerk-7 proteins can be used to distribute diagnostic or therapeutic agents to these cells (or other types of cells found that express hek or elk on the cell surface) in in vitro or in vivo procedures .

An example of such use is to expose a hek + leukemic cell line to a therapeutic agent / Lerk-7 conjugate to determine if the agent shows cytotoxicity towards leukemic cells. A number of different therapeutic agents bound to Lerk-7 can be included in an assay to detect and compare the cytotoxic effect of the agents on leukemic cells. The Lerk-7 / diagnostic agent conjugates can be used to detect the presence of hek + cells in vitro or in vivo .

Diagnostic or therapeutic agents that can bind to a Lerk-7 polypeptide include, but are not limited to, drugs, toxins, radionuclides, chromophores, enzymes that catalyze a colorimetric or fluorometric reaction, and the like, with the particular agent that It is chosen according to the proposed application. Examples of drugs include those used in the treatment of various forms of cancer, for example, nitrogen mustards such as a nitrogen mustard of L-phenylalanine or cyclophosphamide, intercalating agents such as cis-diaminodichloroplatin, antimetabolites such as 5-fluorouracil, vinca alkaloids such as vincristine, and antibiotics such as bleomycin, doxorubicin, daunorubicin, and derivatives thereof. Among the toxins are ricin, abrin, diphtheria toxin, exotoxin A from Pseudomonas aeruginosa , inactivated ribosome proteins, mycotoxins such as trichothecenes, and derivatives and fragments (for example, individual chains) thereof. Radionuclides suitable for diagnostic use include, but are not limited to, 123 I, 131 I, 99m Tc, 111 In, and 76 Br. Radionuclides suitable for therapeutic use include, but are not limited to, 131 I, 211 At, 77 Br, 186 Re, 188 Re, 212 Pb, 212 Bi, 109 Pg, 64 Cu, and 67 Cu.

Such agents can bind to the Lerk-7 by any conventional procedure suitable. Lerk-7, which is a protein, comprises functional groups on amino acid side chains that can react with functional groups on an agent desired to form covalent bonds, for example. How Alternatively, the protein or agent can be derivatized to generate or join a desired reactive functional group. Derivatization may include the binding of one of the coupling reagents bifunctional available to bind various molecules to proteins (Pierce Chemical Company, Rockford, Illinois). Numerous are known techniques to radioactively label proteins. The metals radionuclides can be attached to Lerk-7 using by example, a suitable bifunctional chelating agent.

In this way the conjugates are prepared that comprise Lerk-7 and a diagnostic agent or therapeutic (preferably covalently bound). The conjugates they are administered or otherwise used in an appropriate amount For the particular application.

Another use of the Lerk-7 of the present invention is a working tool to study the role that Lerk-7, in conjunction with elk or hek, can play in the growth or differentiation of cells carrying the elk or hek receptor. The Lerk-7 polypeptides of the present invention can also be used in in vitro assays for the detection of elk or Lerk-7 or the interactions thereof. Similarly, Lerk-7 finds use in trials to evaluate the interaction of Lerk-7 with hek. The possibility that hek plays a role in tumor genesis has been suggested (Boyd et al., Above). Lerk-7 protein is useful to investigate what effect of binding of Lerk-7 to hek can have on tumor generation.

Although certain uses of Lerk-7 are illustrated herein in relation to the properties of elk binding or hek binding, it is understood that analogous uses arising from Lerk-7's ability to bind to eck. Examples of cancerous cell types that express eck are the HeLa line of human epithelial cells, a human epidermal carcinoma cell line called A431 (Lindberg and Hunter, above), melanoma cell lines (Easty et al., Cancer Research , 55: 2528, 1995) and the HT29 line of human colon adeno carcinoma cells. Lerk-7 can be used to distribute therapeutic or diagnostic agents to such cells, as described above with respect to cells carrying hek.

Lerk-7 nucleic acids can be used in the detection of defects of the Lerk-7 gene, for example, in an in vitro assay conducted on DNA samples derived from an individual to be tested to evaluate such a defect. The DNA of the present invention can be used in the replacement of defective Lerk-7 genes, for example, in gene therapy procedures.

As described above, when analyzed various rat tissues to evaluate elk mRNA, it detected only in the brain and testicles (Lhotak et al., above) The union of Lerk-7 to elk over neural tissue can exert a neuroprotective or neurotrophic

Lerk-7 finds use as a tissue culture reagent. A Lerk-7 protein can be added to in vitro cultured neurons to enhance the viability or prolong the durability of cultured neurons, thereby facilitating research studies, and possible clonal treatment of neural tissue.

The Lerk-7 protein described previously it has been found to exert a neurotrophic effect or neuronal hippocampus, and protect neurons against glutamate mediated excitotoxicity. Similarly the Lerk-7 may show neuroprotective properties or neurotrophic This way Lerk-7 can find use in a procedure to treat neural tissue disorders, which involves contacting the neural tissue with Lerk-7 Such disorders include injury or neurological diseases, either chronic or acute. The use of Lerk-7 in the preparation of a medicine for treat neural tissue disease or injury is contemplated in this descriptive memory.

Compositions comprising an amount Effective of a Lerk-7 Polypeptide of the Present invention, in combination with other components such as a diluent, vehicle or suitable excipient, are provided is this descriptive memory. The Lerk-7 can be formulated according to known procedures used to prepare compositions pharmaceutically useful The Lerk-7 can be combine in mixture, either as the active material alone or with others known active materials, with pharmaceutically diluents suitable (for example, saline, Tris-HCl, acetate, and phosphate buffered solutions), preservatives (for example, thimerosal, benzyl alcohol, parabens), emulsifiers, solubilizers, adjuvants and / or vehicles. The right vehicles and its formulations are described in Remington's Pharmaceutical Sciences, 16th edition of 1980, Mack Publishing Company.

In addition, such compositions may contain Lerk-7 complexed with polyethylene glycol (PEG), metal ions, or incorporated into polymeric compounds such as polycytic acid, polyglycolic acid, hydrogels, dextran, etc., or incorporated into liposomes, microemulsions, micelles, unilamellar vesicles or multilamellar ghosts of erythrocytes or spheroblasts. Such compositions will influence the physical state, solubility, stability in vivo release rate, and in vivo removal rate of v, and are thus chosen according to the proposed application. Alternatively, Lerk-7 is linked by GPI to a substrate, in which the substrate is composed of physiologically acceptable material having a composition suitable for binding of Lerk-7 via GPI bonds. The substrate that carries Lerk-7 can be surgically implanted. Lerk-7 can also be conjugated to antibodies against tissue specific receptors, ligands or antigens, or coupled to tissue specific receptors.

Such compositions may contain a polypeptide of ligands or antigens, in any manner described in this specification, such as native proteins, variants, derivatives, biologically active fragments or oligomers. In a embodiment, the composition comprises a ligand polypeptide or antigens, soluble.

The Lerk-7 can be administered in any suitable way, for example, topically, parenterally, or by inhalation. The term "parenteral" includes injection, for example, by subcutaneous, intravenous, or intramuscular, also including localized injection, for example, at a site of illness or injury. The sustained release from of implants is also contemplated. The right dosages and suitable drug concentrations contained in the Compositions may vary depending on many factors, including the proposed use, body weight and age of the patient, and route of administration Preliminarily the doses of can determine according to animal tests, and the dosage scale for human administration it can be done according to the practices accepted in the art.

Oligomeric forms of Lerk-7

Lerk-7 polypeptides are encompassed by the present invention in the form of oligomers, such as higher dimers, trimers, or higher oligomers covalently bound  or not covalently united. Such oligomers may be of origin. natural or produced by recombinant DNA technology. The oligomers can be joined by disulfide bonds formed between cysteine residues on Lerk-7 polypeptides different.

The oligomers of the present invention include, but are not limited to oligomers comprising two to four Lerk-7 polypeptides. In one embodiment, the Lerk-7 polypeptides are soluble.

Alternatively, an Lerk-7 oligomer is prepared using polypeptides derived from immunoglobulins. The preparation of fusion proteins comprising certain heterologous polypeptides condensed to various portions of antibody-derived polypeptides (including the Fc domain) has been described, for example, by Ashkenazi et al. ( PNAS USA 88 : 10535, 1991), Byrn et al. ( Nature 344 ; 677, 1990), and Hollenbaugh et al. ( Current Protocols in Immunology, Suppl. 4, 1992, pp. 10.19.1-10.19.11), incorporated herein by reference. An embodiment of the present invention relates to a dimer of Lerk-7 created by fusion of Lerk-7 to the Fc region of an antibody (eg, IgG1) in a manner that does not interfere with the binding of Lerk-7 to the ligand binding domain of hek or elk. The Fc polypeptide is preferably condensed to the C-terminus of a soluble Lerk-7 comprising only the extracellular domain.

A gene fusion that encodes the protein of Lerk-7 / Fc fusion is inserted into a vector of appropriate expression Fusion proteins Lerk-7 / Fc are expressed in host cells transformed with the recombinant expression vector, and left assemble many antibody type molecules, after which inter-chain diulfide bonds are formed between Fc polypeptides, producing divalent Lerk-7. If the proteins of fusion are performed with both heavy and light chains of a antibody, it is possible to form an oligomer of Lerk-7 with as many as four extracellular regions of Lerk-7

This description provides fusion proteins that comprise a polypeptide of Lerk-7 condensed to an Fc polypeptide derived from an antibody DNA encoding such are also provided. fusion proteins, as well as dimers containing two proteins of fusion linked by disulfide bonds between Fc moieties of the same. The term "Fc polypeptide" as used herein Descriptive report includes native and mutein forms of polypeptides derived from the Fc region of an antibody. Too truncated forms of such polypeptides containing the hinge region that promotes dimerization. An Fc polypeptide suitable, described in PCT application WO 93/10151, is a single chain polypeptide that extends from the region N terminal hinge to native C end. A mutein of this Fc polypeptide is described in example three below. The Mutein shows reduced affinity for Fc receptors.

A procedure for preparing oligomeric Lerk-7 involves the use of a leucine zipper. Leucine zipper domains are peptides that promote oligomerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA binding proteins (Landschulz et al., Science , 240: 1759, 1988), and then found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and derivatives thereof that are dimerized or trimerized. Examples of leucine zipper domains useful for producing soluble oligomeric proteins are described in PCT application WO 94/10308. In one embodiment, recombinant proteins comprising a soluble Lerk-7 polypeptide condensed to a peptide that is dimerized or trimerized in solution are expressed in suitable host cells. The oligomers of Lerk-7 are recovered from the culture medium.

Alternatively, the oligomer is a protein is a fusion protein comprising polypeptides of Lerk-7 multiple, with or without spacer peptides among the remains of Lerk-7. Such proteins from Fusion occurs using recombinant DNA technology. In a embodiment, a fusion protein comprises two or more polypeptides of soluble Lerk-7, separated by linkers peptides

The oligomers have the property of bivalent, trivalent binding sites, etc. for elk or hek. In addition, the fusion proteins described above comprising Fc moieties (and oligomers formed therefrom) offer the advantage of easy purification by affinity chromatography on protein or protein columns.
G.

Expression systems

Suitable host cells for the expression of Lerk-7 polypeptides include prokaryotic, yeast or higher eukaryotic cells. Cloning and expression vectors suitable for use with bacterial, fungal, yeast, and mammalian hosts are described, for example, in Pouwels et al. Cloning Vectors: A Laboratory Manual, Elsevier, New York, (1985). Cell-free translation systems could also be used to produce Lerk-7 polypeptides using RNA derived from constructs described herein.

The expression vector may include DNA that encodes a signal peptide or condensed guide to the N-terminus or a v polypeptide The signal or guide peptide directs co-translationally or post-translationally transferring the Lerk-7 from its synthesis site to a site in the inside or outside of the cell membrane or cell wall. He signal or guide peptide is cleaved from the mature v polypeptide. The Signal or guide peptide choice depends on cell type host that is used.

Prokaryotic host cells suitable for transformation include, for example, E. coli, Bacillus subtilis, Salmonella typhimurium , and various other species within the genera Pseudomonas, Streptomyces, and Staphylococcus . In a prokaryotic host cell, such as E. coli , a Lerk-7 polypeptide may include an N-terminal methionine moiety to facilitate expression of the recombinant polypeptide in the prokaryotic host cell. The N-terminal Met can be cleaved from the expressed recombinant Lerk-7 polypeptide.

Lerk-7 polypeptides can be expressed in yeast host cells, preferably of the Saccharomyces genus (eg, S. cerevisiae ). Other yeast genera can also be used, such as Pichia, K. lactis or Kluyveromyces . Yeast vectors may contain a replication sequence origin of a 2 µ yeast plasmid, an autonomous replication sequence (ARS), a promoter region, polyadenylation sequences, transcription termination sequences, and a selectable marker gene .

Promoter sequences suitable for yeast vectors include, among others, promoters for metallothionein, 3-phosphoglycerate kinase (Hitzeman et al., J. Biol. Chem . 255 : 2073, 1980) or other glycolytic enzymes (Hess et al., J Adv. Enzyme Reg . 7 ; 149, 1968; and Holland et al., Biochem . 17 : 4900, 1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructoquinse, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosaphosphate isomerase, phosphoglucose isomerase, and glucokinase. Another alternative is the ADH2 promoter that can be repressed by glucose described by Russell et al. ( J. Biol. Chem . 258 : 2674, 1982) and Beier et al. ( Nature 300 : 724, 1982). Other suitable vectors and promoters for use in yeast expression are further described in Hitzeman, EPA-73,657 or in Fleer et al., Gene , 107 : 285-195 (1991); and van den Berg et al., Bio / Technology, 8 : 135-139 (1990). Replicable transfer vectors in both yeast and E. coli can be constructed by inserting DNA sequences from pBR322 for selection and replication in E. coli (den Amp r and origin of replication) in the yeast vectors described above.

A suitable guide sequence (for example, the Saccharomyces ? Factor guide) can be used to direct the secretion of the Lerk-7 polypeptide from yeast cells. The α-factor guide sequence is generally inserted between the promoter sequence and the structural gene sequence. See, for example, Kurjan et al., Cell , 30 : 933, 1982; Bitter et al., Proc. Natl Acad. Sci. USA. 81 : 5330, 1984; U.S. Patent 4,546,082; and EP 324,274. Those skilled in the art are aware of other suitable guide sequences to facilitate the secretion of recombinant polypeptides from yeast hosts. A guide sequence can be modified near its 3 'end to contain one or more restriction sites. This will facilitate the fusion of the guide sequence to the structural gene.

The yeast transformation protocols are known to those skilled in the art. One such protocol is described by Hinnen et al., Proc. Natl Acad. Sci. USA 75 : 1929, 1978. The Hinnen et al. Protocol selects Trp + transformants in a selective medium, in which the selective medium consists of 0.67% yeast nitrogen base, house 0.5% amino acids, 2% glucose, 10 µg / ml of adenine and 20 µg / ml of uracil.

Yeast host cells transformed by vectors containing the promoter sequence of ADH2 can be cultured to induce expression in a medium "rich". An example of a rich environment is one constituted by 1% yeast extract, 2% peptone, and supplemented glucose with 80 µg / ml of adenine and 80 µg / ml of uracil. The Depression of the ADH2 promoter occurs when glucose runs out in the means, medium.

Mammalian or insect host cell culture systems can also be used to express recombinant Lerk-7 polypeptides. Baculovirus systems for the production of heterologous proteins in insect cells are reviewed by Luckow and Summers, Bio / Technology 6: 47 (1988). Established cell lines of mammalian origin can also be used. Examples of suitable mammalian host cell lines include the COS-7 line of monkey kidney cells (ATCC CRL 1651; Gluzman et al., Cell 23 : 175, 1981), L cells, C127 cells, 3T3 cells (ATCC CCL 163), Chinese hamster ovary (CHO) cells, HeLa cells, the BHK cell line (ATCC CRL 10) and the CV-1 / EBNA cell line derived from the African green monkey kidney cell line CV1 (ATCC CCL 70) as described by McMahan et al ( EMBO J. 10: 2821, 1991).

Transcriptional and translational control sequences for mammalian host cell expression vectors can be cleaved from viral genomes. Commonly used promoter sequences and potentiating sequences are derived from polyoma virus, Adenovirus 2, simian virus 40 (SV40), and human cytomegalovirus. DNA sequences derived from the SV40 viral genome, for example, SV40 origin, early and late promoter, enhancer, spindle, and polyadenylation sites can be used to provide other genetic elements for expression of a structural gene sequence in a host cell of mammal. Early and late viral promoters are particularly useful because both can be easily obtained from a viral genome as a fragment that may also contain a viral origin of replication (Fiers et al., Nature 273 : 113, 1978). Smaller or larger fragments of SV40 may also be used, provided that the sequence of approximately 250 base pairs that extends from the Hind III site to the Bgl I site located at the SV40 viral origin of replication is included.

Examples of expression vectors for use in mammalian host cells can be constructed as described by Okayama and Berg ( Mol. Cell. Biol. 3 : 280, 1983). A system useful for stable high level expression of mammalian cDNA in C127 murine mammalian epithelial cells can be constructed substantially as described by Cosman et al ( Mol. Immunol 23 : 935, 1986). A useful high expression vector, PMLSV N1 / N4, described by Cosman et al., Nature 312 : 768, 1984 has been deposited as ATCC 39890. Additional useful mammalian expression vectors are described in EP-A-0367566 , and in WO 91/18982. Vectors can be derived from retroviruses. Instead of the native signal sequence, the heterologous signal sequence may be added, such as the signal sequence for IL-2 described in US Patent 4,965,195; the signal sequence for IL-2 described in Cosman et al., Nature 312 : 768 (1984); the IL-4 signal peptide described in EP 367,566; the type I IL-1 receptor signal peptide described in US Patent 4,968,607; and the type II IL-1 receptor signal peptide described in EP 460,846.

Lerk-7 protein

The Lerk-7 polypeptides of the The present invention can be produced by expression systems recombinant as described above, or purified to from cells of natural origin. A procedure to produce Lerk-7 comprises the culture of a cell host transformed with an expression vector comprising a DNA sequence encoding Lerk-7 in sufficient conditions to promote the expression of Lerk-7 The v recovers after the middle of cell culture or extracts, depending on the expression system employee. In one embodiment, a Lerk-7 protein human comprises the amino acid sequence of the protein that is expressed by host cells transformed with a vector of expression containing the Lerk-7 cDNA found in strain ATCC 75959.

As those skilled in the art know, the procedures to purify a recombinant protein will vary according to factors such as the type of host cells used and if the recombinant protein is secreted or not in the middle of culture. Other considerations include the types of contaminants that have to be removed, which can be varied according to particular host cells used to express the desired protein

For example, when systems of expression that secrete the recombinant protein the culture medium You can first concentrate using a concentration filter of commercially available proteins, for example, a unit of Piconicon ultrafiltration of Amicon O Millipore. After the stage concentration, the concentrate can be applied to a matrix of purification such as a gel filtration matrix. How alternatively, an anion exchange resin can be used, for example, a matrix or substrate that has groups of outstanding diethylaminoethyl (DEAE). The matrices can be archilamide, agarose, dextran, cellulose or other materials of Support commonly used in protein purification. How alternatively, a cation exchange stage can be used. Suitable cation exchangers include various matrices insoluble comprising sulfopropyl or carboxymethyl groups. Be They prefer sulfopropyl groups. In addition, one or more may be used. stages of reverse phase high performance liquid chromatography (RP-HPLC) that employ means of Hydrophobic RP-HPLC (for example, silica gel that it has methyl or other pending aliphatic groups). Some or all the previous stages, in various combinations, can be used to provide a Lerk-7 protein purified.

An additional alternative is chromatography of affinity, which employs a chromatography matrix that contains hek, elk, or an antibody reactive with Lerk-7. The Lerk-7 polypeptides can be recovered from a affinity column using conventional techniques, (for example, elution in a buffer with high salt concentration), after dialysate in a low salt buffer for use.

The recombinant protein produced in culture bacterial can be isolated by initial fragmentation of host cells, centrifugation, sediment extraction cellular if an insoluble polypeptide, or from the fluid supernatant if a soluble polypeptide, followed by one or more steps concentration chromatography, salt precipitation, ion exchange, affinity purification or size exclusion. Finally, RP-HPLC can be used for stages of final purification Microbial cells can be fragmented by any convenient procedure, including cycle freeze-thaw, sonication, mechanical fragmentation, or use of cell lysate agents.

Lerk-7 is preferably expressed as a polypeptide secreted in yeast host cells, in order to simplify purification. The recombinant polypeptide secreted from a fermentation of yeast host cells can be purified by methods analogous to those described by Urdal et al. ( J. Chromatog. 296 : 171, 1984). Urdal et al. Describe two sequential reverse phase HPLC steps for purification of recombinant human IL-2 on a recombinant HPLC column.

The desired degree of purity depends on the proposed use of the protein. For example, a relatively high degree of purity is desired when the protein is to be administered in vivo . Advantageously, the Lerk-7 polypeptides are purified so that no protein band corresponding to other proteins are detectable after analysis by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Those skilled in the art will recognize multiple bands corresponding to the Lerk-7 protein can be visualized by SDS-PAGE, due to differential glycosylation, post-translational differential processing, and the like, as described above. A protein preparation of Lerk-7 is considered to be purified as long as no band corresponding to different proteins (not Lerk-7) is visualized. Most preferably, Lerk-7 is purified to substantial homogeneity, as indicated by a single protein band after analysis by SDS-PAGE.

Nucleic acids

The present invention provides acids isolated nuclei of Lerk-7. Such nucleic acids include, but are not limited to, the DNA of Lerk-7 human of SEQ ID No. 4, both in the form of a single chain and of double chain, as well as the complement RNA of it. The DNA of the Lerk-7 of the present invention includes, by example, cDNA, genomic DNA, chemically synthesized DNA, DNA amplified by PCR, and combinations thereof. Be can isolate genomic DNA by conventional techniques using the CDNA isolated in example 1, or a suitable fragment thereof, as a probe

The present invention further provides fragments of the nucleotide sequences of Lerk-7 presented in this specification. Such fragments desirably comprise at least about 14, preferably at least 17, consecutive nucleotides of the sequence presented in SEQ ID NO: 4. DNA complements and RNA from such fragments are provided herein. descriptive, along with both single and double chain forms Lerk-7 DNA chain.

Among the use of such Lerk-7 nucleic acid fragments are the use as a probe or a primer. Such probes can be used in cross-species hybridization procedures to isolate Lerk-7 DNA from additional mammalian species. As an example, a corresponding probe can be used for the extracellular domain of a Lerk-7. The probes also find use in detecting the presence of Lerk-7 nucleic acid assays in vivo and in such procedures as Northern and Southern blots. The types of cells expressing Lerk-7 can be identified. Such procedures are well known, and those skilled in the art can choose a probe of suitable length, depending on the particular proposed application. The probes can be labeled (for example, with 32 P) by conventional techniques.

The oligonucleotides corresponding to segments of Lerk-7 nucleic acids find use as primers, in procedures such as chain reaction of polymerase (PCR). For example, 5 'and 3' primers corresponding to the ends of a desired Lerk-7 sequence (by example, a fragment of Lerk-7) is used to isolate and amplify that sequence in a conventional procedure of PCR.

Other useful fragments of Lerk-7 nucleic acids include negative polarity or positive polarity oligonucleotides comprising a sequence of a single chain nucleic acid sequence (either RNA or DNA) capable of binding to Lerk-7 RNA sequences target (positive polarity) or v DNA (negative polarity). Oligonucleotides of negative polarity or positive polarity, according to the present invention, comprise a fragment of the Lerk-7 cDNA coding region. Such a fragment generally comprises at least about 14 nucleotides, preferably about 14 to about 30 nucleotides. The ability to derive an oligonucleotide of negative polarity or positive polarity, based on a cDNA sequence encoding a given protein is described, for example, in Stein and Cohen ( Cancer Res , 48: 2659, 1988) and van der Krol et al. ., ( BioTechniques 6: 958, 1988).

The binding of oligonucleotides of positive polarity or negative polarity to target nucleic acid sequences results in the formation of duplexes that block transcription or translation of the target sequence by one or more means, including enhanced degradation of the duplexes, premature termination of the transcription or translation, or by other means. Negative or positive polarity oligonucleotides further comprise oligonucleotides having modified phosphodiester sugar main structures (or other sugar bonds, such as those described in WO 91/06629) and in which such sugar bonds are resistant to endogenous nucleases. Such oligonucleotides with sugar resistant bonds are stable in vivo (ie, capable of resisting enzymatic degradation) but retain sequence specificity to be able to bind nucleotide sequences.
Diana.

Other examples of polarity oligonucleotides positive or negative polarity include oligonucleotides that are covalently bound to organic moieties, such as described in WO 90/10448, and other residues that increase the affinity of the oligonucleotide for a sequence of target nucleic acids, such as poly (L-lysine). Still additionally, intercalating agents can be attached, such as ellipticin, and alkylating agents or metal complexes to oligonucleotides of positive or negative polarity to modify the binding specificities of polarity oligonucleotides Negative or positive polarity.

Oligonucleotides of negative polarity or positive polarity can be introduced into a cell containing the target nucleic acid sequence by a gene transfer method, which includes, for example, CaPO4-mediated DNA transfection, electroporation, or by the use of gene transfer vectors such as Epstein-Barr virus. In a preferred method, an oligonucleotide of negative polarity or positive polarity is inserted into a suitable retroviral vector. A cell containing the target nucleic acid sequence is contacted with the recombinant retroviral vector, either in vivo or ex vivo . Suitable retroviral vectors include, but are not limited to, those derived from the murine retroviruses M-MulV, N2 (a retrovirus derived from M-MulV), or the double copy vectors designated DCT5A, DCT5B and DCT5C (see WO 90/13641).

Oligonucleotides of negative polarity or positive polarity can be introduced into a cell that contains the target nucleotide sequence by forming a conjugated to a ligand binding molecule, as described in WO 91/04753. Target ligand binding molecules include, but are not limited to, cell surface receptors, growth factors, other cytokines, or other ligands that are bind to cell surface receptors. Preferably, the conjugation of the ligand binding molecule does not interfere substantially with the ability of the ligand binding molecule of binding to its corresponding molecule or receptor, or blocking the oligonucleotide input of positive polarity or polarity negative or its conjugated version in the cell.

Alternatively, you can enter a oligonucleotide of positive polarity or negative polarity in a cell that contains the target nucleic acid sequence by the formation of an oligonucleotide-lipid complex, as described in WO 90/10448. The complex oligonucleotide of positive polarity or polarity negative-lipid dissociates preferably within of the cell by an endogenous lipase.

Antibodies

Antibodies are provided that are immunoreactive with Lerk-7 polypeptides described in this specification. Such antibodies bind specifically to Lerk-7 because the antibodies are join Lerk-7 through binding sites to antibody antigen (as opposed to nonspecific binding).

Polyclonal and monoclonal antibodies can be prepared by conventional techniques. See, for example, Monoclonal Antibodies. Hybridomas: A New Dimension in Biological Analyzes , Kennet et al., (Eds.), Plenum Press, New York (1980); and Antibodies: A Laboratory Manual , Harlow and Land (Eds), Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY, (1988). The production of monocloinal antibodies that are immunoreactive with Lerk-7 is further illustrated in example 5 below.

The antigen binding fragments of such antibodies, which can be produced by techniques conventional, are also encompassed by the present invention. Examples of such fragments include, but are not limited to, Fab, F (ab '), and F (ab') 2 fragments. I also know provide antibody fragments and derivatives produced through genetic engineering techniques.

The monoclonal antibodies of the present invention include chimeric antibodies, for example, humanized versions of murine monoclonal antibodies. Such humanized antibodies can be prepared by known techniques, and offer the advantage of reduced immunogenicity when the antibodies are administered to humans. In one embodiment, a humanized monoclonal antibody comprises the variable region of a murine antibody (just the antigen binding site thereof) and a constant region derived from a human antibody. Alternatively, a humanized antibody may comprise an antigen binding site of a murine monoclonal antibody and a variable region fragment (lacking the antigen binding site) derived from a human antibody. Methods for the production of additional genetically engineered monoclonal antibodies include those described in Riechman et al. ( Nature , 332: 323, 1988) Liu et al. ( PNAS 84: 3439, 1987), Larrick et al ( Bio / Technology 7: 934, 1989), and Winter and Harris ( TIPS 14, 139, May 1993).

Among the uses of the antibodies are the use in assays to detect the presence of Lerk-7 polypeptides, either in vitro or in vivo . The antibodies can also be used in the purification of Lerk-7 proteins by immunoaffinity chromatography.

The following examples are provided for further illustrate particular embodiments of the invention, and are not interpreted as limiting the scope of this invention.

Example 1 Cloning of the human Lerk-7 cDNA

The cDNA encoding a Lerk-7 Human of the present invention was isolated by the following process. In summary, DNA was identified from Lerk-7 during the screening of a cDNA library of human fetal brain with a probe that was derived from a murine cDNA called Lerk-6.

Lerk-6 DNA and proteins are described above and in U.S. Patent No. 5,919,905. DNA and amino acid sequences encoded for a Lerk-6 cDNA of murine type are presented in this Descriptive report as SEQ ID numbers 1 and 2.

A cDNA library consisting of cDNA from human fetal brain in vector λgt10 was purchased in Clonetech Laboratories, Inc, Palo Alto, California. An isolated Lerk-6 DNA fragment by PCR for use as probe. The Lerk-6 DNA fragment contained the nucleotides 11 to 443 of SEQ ID NO: 1. A primer used in the PCR added to a T3 RNA polymerase binding site (CTTTAGTGAGGGTTAATCTATAG) (SEQ ID NO: 3) to the 3 'end of the fragment of amplified Lerk-6 DNA.

The probe was labeled with 32 P CTPd using the random priming technique, then allowed to hybridize to cDNA sets derived from the library. Then the filters are washed with 0.5X SSC / 0.1% SDS at 55 ° C for approximately two hours. Hybridization sets were identified, and tracing it was repeated on smaller sets successively, in the same conditions. An individual hybridization clone, called Clone No. 16, was purified after the third round of screening.

The DNA sequence of clone # 16 was determined. Surprisingly, the clone encoded a novel human protein, called Lerk-7 in this specification, in instead of coding the human counterpart of Lerk-6. The nucleotide sequence of the cDNA coding region of Human Lerk-7, and the amino acid sequence encoded in that way, they are described in SEQ ID NO: 4 and SEQ ID Nº: 5, respectively. Lerk-7 protein from the SEQ ID NO: 5 comprises an N-terminal signal peptide (amino acids -20 to -1), an extracellular receptor binding domain (amino acids 1 to 133), a spacer region (amino acids 134 to 183), and a C-terminal hydrophobic region (amino acids 194 to 208).

Samples of a cell lysate containing a recombinant phage vector (λ10 containing the cDNA of Human Lerk-7 of clone # 16 inserted into the site Eco RI restriction of the vector) were deposited in the Collection American Type Crops, Rockville, Maryland. The samples are deposited on December 7, 1994, under the terms of the Treaty of Budapest, and common assignment access number ATCC 75959.

Example 2 Preparation of elk fusion protein: soluble Fc

This example describes the construction of a expression vector encoding an elk fusion protein: Fc soluble. This fusion protein can be used in the assays of union described in this specification.

A DNA and an amino acid sequence encoded by the rat elk cDNA is presented in Lhotak et al. ( Mol Cell. Biol . 11: 2496, 1991). The rat elk protein has an extracellular domain of 538 amino acids, a transmembrane domain of 25 amino acids, and a cytoplasmic domain of 419 amino acids.

A rat elk cDNA fragment was condensed to the 5'0 end of cDNA encoding the Fc portion of an antibody Human IgG1. An Asp restriction endonuclease cleavage site 718 was introduced upstream of the elk coding region. Be isolated an Asp 718-BglII fragment from elk cDNA from rat (comprising the entire extracellular domain, the region transmembrane, and a small part of the cytoplasmic domain).

DNA encoding a single polypeptide chain comprising the Fc region of a human IgG1 antibody was cloned into the Spe I site of pBluscript SK®, a cloning vector that is commercially available from Stratagene Cloning Systems, La Jolla, California. This plasmid vector is replicable in E. coli and contains a polylinker segment that includes 21 unique restriction sites. The nucleotide sequence of the cloned DNA, together with the amino acid sequence of the Fc polypeptide encoded by it, are described in PCT application WO 93/10151, and are also presented in SEQ ID NO: 7 and SEQ ID NO: 8 A unique Bgl II site has been introduced, and encompasses the codons for amino acids three and four of the polypeptide. The encoded Fc polypeptide extends from the N-terminal hinge region to the native C-terminus, that is, it is essentially an Fc region of the full-length antibody.

The elk Asp 718-BglII cDNA fragment described above was cloned into the pBluescript SK® vector containing the Fc cDNA, so that the elk cDNA is positioned upstream of the Fc cDNA. The single stranded DNA derived from the resulting gene fusion was subjected to mutagenesis by the procedure described in Kunkel ( Proc. Natl. Acad. Sci. USA 82: 488, 1985) and Kunkel et al., ( Methods in Enzymol . 154: 367, 1987) in order to perfectly condense the entire extracellular domain of elk to the Fc sequence. The DNA undergoing mutagenesis was sequenced to confirm that the appropriate nucleotide has been removed (i.e., that the transmembrane region and the partial cytoplasmic domain DNA were deleted) and that the elk and Fc sequences were at the same reading stage.

The elk: Fc fusion protein is preferably synthesized in mammalian host cells, such as CV1-EBNA or COS-7 cells. The elk: Fc gene fusion was cleaved and inserted into a mammalian expression vector called HAV-EO (Dower et al., J. Immunol . 142: 4314, 1989). Mammalian host cells were transfected with the resulting recombinant expression vector and cultured to allow transient expression sw the fusion protein, which was secreted into the culture medium by the elk signal peptide. The elk: Fc fusion protein was purified by affinity chromatography, using a protein A sepharose column.

Example 3 Preparation of hek fusion protein: soluble Fc

This example describes the construction of a expression vector encoding a hek: Fc fusion protein soluble. This fusion protein can be used in the assays of union described in this specification.

A DNA and an amino acid sequence encoded by the human hek cDNA is presented in Wicks et al. ( Proc. Natl. Acad. Sci . USA 89 : 1611, 1992) incorporated herein by reference. This hek protein comprises (from the N to C end) an extracellular domain, a transmembrane domain, and a cytoplasmic domain.

Two DNA fragments, one that encodes a N terminal fragment of the extracellular domain of hek and the other that encodes a terminal C fragment of the hek extracellular domain, it isolated by polymerase chain reactions (PCR) brought to carried out under usual conditions, using oligonucleotide primers based on the hek nucleotide sequence published by Wicks et al., above. The template for the PCR was cDNA prepared to from mRNA isolated from a T-cell leukemia cell line called CCRF-HSB-2 (ATCC CCL-120.1).

PCR products containing the 5 'end of hek DNA were digested with SpeI and HindIII to isolate a DNA fragment that extends from the 5 'end of the sequence of mature human hek (i.e. defective DNA encoding the signal sequence) to a HindIII site found in the hek gene. The PCR products containing the 3 'end of the domain DNA Extracellular hek were digested with HindIII and ClaI to isolate a fragment that extends from the internal HindIII site to a Syrian ClaiI just down the 3 'end of the sequence that encodes the extracellular domain hek. The ClaiI site is a site of multiple cloning (mcs) introduced just downstream of the domain extracellular

DNA encoding a mutein from the Fc region of a human IgG1 antibody was isolated. This Fc mutein DNA and the polypeptide encoded by it are described in US Patent No. 5,457,035, entitled "Novel Cytokine Which is a Ligand for OX40". Mutein DNA was derived from a DNA encoding the native Fc polypeptide by site directed mutagenesis carried out substantially as described by Deng and Nickoloff, Anal. Biochem 200 : 81 (1992). The amino acid sequence of the Fc mutein polypeptide is identical to that of the native Fc polypeptide described in PCT application WO 93/10151, except that amino acid 19 has been changed from Leu to Ala, amino acid 20 has been changed from Leu to Glu, and amino acid 22 has been changed is Gly to Ala. This mutein Fc shows reduced affinity for immunoglobulin receptors.

A recombinant vector that contains the DNA of muted from Fc was cleaved with ClaiI and NotI, which cleaves the vector into a region immediately poliengarce chain up and chain down respectively, to the insertion of Fc mutein DNA. It was isolated the fragment encoding the Fc mutein.

A mammalian expression vector called SMAG4 was cleaved with SpeI and NotI. The SMAG4 vector comprises a sequence encoding the mutiny intecleucine 7 signal peptide (described in United States Patent No. 4,965,195) inserted into the high-expression mammalian vector pDC201 (described in Sims et al., Science 241 : 585 , 1988, and in PCT application WO 89/03884), which is also capable of replication in E. coli . SpeI cleaves the vector immediately chain below the sequence encoding the IL-7 signal peptide. NotI cleaves approximately 155 base pairs downstream of the SpeI site at a multiple cloning site of the vector. The large SpeI / NotI fragment containing the vector sequences and the DNA encoding the IL-7 signal peptide was isolated.

A four-way ligation was carried out to insert the two DNA fragments encoding hek and the DNA fragment encoding Fc mutein described above in the SMAG4 expression vector cleaved by SpeI / NotI. E. coli cells were transfected with the ligation mixture and the desired recombinant vector was isolated therefrom. The isolated vector encodes a fusion protein that encodes (between the N and C end) the murine IL-7 signal peptide, the hek extracellular domain, four amino acids encoded by mcs introduced and mutated it with Fc.

The expression vector was then co-transfected with plasmid pSV3.NEO in CV1 / EBNA cells. The CV1 / EBNA cell line (ATCC CRL 10478) was derived from a monkey kidney cell line as described by McMahan et al. ( EMBO J., 10 : 2821, 1991). The vector pSV3.NEO expresses the T antigen of pSV3, which is not produced by host cells. The vector pSV3.NEO is similar to pSV3 (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78 : 2072, 1981), but additionally contains a neomycin resistance gene. The transformed cells were cultured to allow transient expression of the fusion protein, which is secreted in the culture medium by the murine IL-7 signal peptide.

Example 4 Union study

The union of Lerk-7 to elk or hek is You can determine using the following test. The cells are prepared that express Lerk-7 on the cell surface. He V DNA was amplified by PCR. The primers used in the PCR are selected to define the ends of the region Lerk-7 DNA encoder, and also include an Xho I restriction site at the 5 'end and a Not I site at the 3 'end of the amplified DNA. The 5 'primer includes additionally a Kozak consensus sequence upstream of the initiation codon.

The reaction products are digested with Xho I and Not I are inserted into an expression vector pDC410, which is cleaved with Salt I (which is compatible with Xho I) and Not I pDC410, a mammalian expression vector that is also replicated in E. coli , it is similar to pDC406 (McMahan et al, EMBO J. 10: 2821, 1991). The multiple cloning site (mcs) of pDC410 differs from that of pD406 in that it contains additional restriction sites and three stop codons (one at each reading stage). A T7 polymerase promoter downstream of the mcs facilitates the sequencing of DNA inserted into the mcs. In addition, the origin of EVB replication is replaced by DNA encoding the SV40 large T antigen (directed from an SV40 promoter) in pDC410.

CV1-EBNA-1 cells in 10 cm2 plates are transfected with the recombinant expression vector containing Lerk-7 DNA. The CV-1 / EBNA-1 cell line (ATCC CRL 10478) constitutively expresses the EBN nuclear antigen-1 directed from the early CMV promoter / enhancer. CV1-EBNA-1 is derived from the African green monkey kidney CV-1 cell line (ATCC CCL 70), as described by McMahan et al. ( EMBO J. 10: 2821, 1991).

Transfected cells were cultured during 24 hours, and the cells in each plate are then divided into plates 24 wells After cultivating an additional 48 hours, it takes Perform a binding test by the following procedure. The transfected cells (approximately 4 x 10 4 cells / well) they were washed with BM-NFDM, which is a medium of attachment (RPMI 1640 containing 25 mg / ml of bovine serum albumin, 2 mg / ml of sodium azide, 20 mM Hepes pH 7.2) to which 50 mg / ml of dry non-fat milk. The cells are then incubated for 1 hour at 37 ° C with various concentrations of the elk fusion protein: Fc prepared in example 2 or the hek: Fc fusion protein prepared in example 3. The cells were then washed and incubated with a constant saturation concentration of125I -IgG anti-human mouse in a binding medium, with gentle stirring for 1 hour at 37 ° C. After a wash extensive, cells are released by trypsinization.

Mouse anti-human IgG previously employed is directed against the Fc region of human IgG and can be obtained from Jackson Immunoresearch Labotarories, Inc., West Grove, PA The antibody is radiolabelled with iodine using the usual chloramine-T procedure. Antibody will bind to the Fc part of any elk fusion protein: Fc or hek: Fc that has joined the cells. In all trials, it tests the non-specific binding of 125 I-antibody in the absence of elk: Fc (or hek :: Fc), as well as in the presence of elkFc (or hek: Fc) and an excess 200-fold molar of anti-human IgG antibody Unmarked mouse

The antibody -125 I bound to cells is quantified on a Packard Autogramma counter. Affinity calculations (Scatchard, Ann. NY Acad Sci . 51: 660, 1949) are generated on RS / 1 (BBN software, Boston MA) developed on a Microwax computer.

Example 5 Monoclonal antibodies that bind to Lerk-7

This example illustrates a procedure for prepare monoclonal antibodies that bind to Lerk-7 Suitable immunogens that can be employ in the generation of such antibodies include, but not limited to, purified Lerk-7 protein or in a immunogenic fragment thereof such as the extracellular domain, fusion proteins containing n Lerk-7 (for example, a soluble Lerk-7 / Fc fusion protein), or cells expressing Lerk-7 on the surface mobile.

The purified Lerk-7 can be use to generate monoclonal antibodies immunoreactive with them, using conventional techniques such as those described in the U.S. Patent No. 4,411,993. In short, they are immunized mice with Lerk-7 immunogen emulsified in Complete Freund's adjuvant and injected in varying amounts between 10-100 µg subcutaneously or intraperitoneally. After for ten or twelve days, the immunized animals were stimulated with Additional Lerk-7 emulsified in Freund's adjuvant incomplete. Mice are periodically stimulated subsequently. in a weekly immunization program or bi-weekly Samples are taken periodically from serum withdrawing retro-orbital blood or excision in the tip of the tail to analyze antibodies from Lerk-7 by transfer test by points, ELISA (enzyme-linked immunosorbent assay) or hek or elk binding inhibition.

After the detection of a title of appropriate antibody, positive animals are provided an intravenous injection of Lerk-7 in solution saline. Three to four days later, animals are sacrificed, they collect spleen cells and spleen cells condense to a murine myeloma cell line, for example, NS1 or preferably P3 x 63Ag8.653 (ATCC CRL 1580). Mergers generate cells from hybridoma, which are seeded in multiple microtiter plates in a selective HAT medium (hypoxanthine, aminopterin and thymidine) to inhibit the proliferation of uncondensed, hybrid cells of myeloma, and spleen cell hybrids.

The hybridoma cells were screened by ELISA to assess reactivity against purified Lerk-7 by adaptations of the techniques described in Engvall et al., Immunochem. 8 : 871, 1971 and in U.S. Patent No. 4,703,004. A preferred screening technique in the antibody capture technique described in Beckmann et al. ( J. Immunol . 144 : 4212, 1990). Positive hybridoma cells can be injected intraperitoneally into syngeneic BALB / C mice producing ascites containing high concentrations of anti-Lerk-7 monoclonal antibodies. Alternatively, hybridoma cells can be cultured in vitro in flasks or cylindrical bottles by various techniques. Monoclonal antibodies produced in mouse ascites can be purified by precipitation with ammonium sulfate, followed by gel exclusion chromatography. Alternatively, affinity chromatography can also be used based on antibody binding to protein A or protein G, as affinity chromatography based on binding to Lerk-7.

Example 6 Southern transfers

Southern transfers were made murine-type genomics to prove that Lerk-7 Human and murine Lerk-6 are not analogous. Probing the Human DNA with human Lerk-7 or Lerk-6 murine resulted in the following hybridization bands (in thousands of base pairs): Lerk-7 [EcoR1 (12.5, 9, 6, 4, 2.5) and BamH1 (13 and 9)]; Lerk-6 [EcoR1 (5) and Bam H1 (5.3)]. DNA probe murine genomic results in the following bands of hybridization:): Lerk-7 [EcoR1 (12.5, 6) and BamH1 (18.6)]; Lerk-6 [EcoR1 (18) and Bam H1 (2.7, 2.2). Since the hybridization bands of Lerk-7 and Lerk-6 were not identical, these cDNAs define genes unique.

Example 7 Union study

The binding affinity of Lerk-7 for elk or for hek was determined in the following assay. . CDNA encoding the full length Lerk-7 polypeptide of SEQ ID NO: 5 was inserted into SF CAV, a mammalian expression vector that is also replicated in E. coli . The SF CAV vector is described in PCT application WO 93/19777.

Cells CV1-EBNA-1 (described in the example 3) in 10 cm2 plates were transfected with the vector of recombinant expression containing Lerk-7 DNA. Transfected cells were cultured for 24 hours, and the cells in each plate after divided into 24 plates wells. After cultivating an additional 48 hours, it was carried out a binding assay by the following procedure. The cells Transfected (approximately 4 x 10 4 cells / porcillo) were washed with BM-NFDM, which is a medium of attachment (RPMI 1640 containing 25 mg / ml of bovine serum albumin, 2 mg / ml of sodium azide, 20 mM Hepes pH 7.2) to which 50 mg / ml of dry non-fat milk. Then the cells were incubated for 1 hour. at 37 ° C with various concentrations of a fusion protein soluble elk: Fc or hek: Fc. The hek: Fc fusion protein was prepared as described in example 3. The elk: Fc fusion protein is prepared by analogous procedures to those described in the Example 2, except that the mutein Fc polypeptide described in Example 3 was replaced with the native Fc polypeptide.

The cells were then washed and incubated with a constant saturation concentration (20 ng / ml) of an IgG anti-human mouse labeled with125I a medium binding, with gentle stirring for 1 hour at 37 ° C. After a extensive washing, cells were collected by trypsinization

Mouse anti-human IgG previously employed is directed against the Fcx region of IgG human and is available from Jackson Immunoresearch Laboratories, Inc., West Grove, PA. The antibody is radiolabelled with iodine using the chloramine-T procedure habitual. The antibody will bind to the Fc part of any protein. fusion elk: Fc or hek: Fc that has bound to the cells. In all the assays, the non-specific binding of 125 I-antibody in the absence of elk: Fc (or hek: Fc), as well as in the presence of elk: Fc (or hek: Fc) and an excess 200-fold molar of anti-human IgG antibody Unmarked mouse

Antibody -125 I bound to cells is quantified on a Packard Autogramma counter. Affinity calculations (Scatchard, Ann. NY Sci . 51: 660, 1949) were generated on RS / 1 (BBN software, Boston MA) developed on a Microwax computer. The results were as follows.

The binding of elk: Fc to the cells that express Lerk-7 was characterized by a biphasic paton, with affinity constants (K_ {a}) calculated to be K_ {a1} = 1.06 x 10 8 and K a2 = 4.95 x 10 7. The union of hek: Fc showed an individual binding affinity class (K_ {a} = 5.0 x 10 8).

Brief description of the sequence listing

SEQ ID NO. 1 and SEQ ID NO: 2 present the DNA sequence of a cloned cDNA encoding a protein called Lerk-6, and the amino acid sequence encoded by them, respectively. A fragment of the DNA of the SEQ ID NO: 1 was used as a probe to isolate DNA from Lerk-7 of the present invention, as described in Example 1

SEQ ID NO: 3 presents the DNA sequence of a T3 RNA polymerase binding site, as described in the Example 1.

SEQ ID NO: 4 and SEQ ID NO: 5 present the DNA sequence of a human Lerk-7 cDNA cloned, and to the amino acid sequence encoded by them, respectively. CDNA isolation is described in the example one.

SEQ ID NO: 6 presents the sequence of Flag® peptide amino acids.

SEQ ID NO: 7 and SEQ ID NO: 8 present the DNA and amino acid sequences encoded respectively, of a Cloned DNA encoding the Fc region of an IgG1 antibody human.

(1. GENERAL INFORMATION

         \ vskip0.800000 \ baselineskip
      

(i)

APPLICANT:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME: Immunex Corporation

         \ vskip0.500000 \ baselineskip
      

(B)

STREET: 51 University Street

         \ vskip0.500000 \ baselineskip
      

(C)

CITY Seattle

         \ vskip0.500000 \ baselineskip
      

(D)

STATE: Washington 98101

         \ vskip0.500000 \ baselineskip
      

(AND)

COUNTRY: United States

         \ vskip0.500000 \ baselineskip
      

(F)

ZIP CODE: None

         \ vskip0.500000 \ baselineskip
      

(G)

PHONE: 2065870430

         \ vskip0.500000 \ baselineskip
      

(H)

FAX: 2065870606

         \ vskip0.800000 \ baselineskip
      

(i)

TELEX: none

         \ vskip0.800000 \ baselineskip
      

(ii)

TITLE OF THE INVENTION: cytokine called Lerk-7

         \ vskip0.800000 \ baselineskip
      

(iii)

NUMBER OF SEQUENCES: 8

         \ vskip0.800000 \ baselineskip
      

(iv)

READABLE COMPUTER FORM

         \ vskip0.500000 \ baselineskip
      

(TO)

TYPE MEDIUM: Floppy Disk

         \ vskip0.500000 \ baselineskip
      

(B)

COMPUTER: IBM PC Compatible

         \ vskip0.500000 \ baselineskip
      

(C)

OS: PC-DOS / MS-DOS

         \ vskip0.500000 \ baselineskip
      

(D)

SOFTWARE: PatentIn Release No. 1.0, Version No. 1.30 (EPO)

         \ vskip0.800000 \ baselineskip
      

(v)

CURRENT APPLICATION DATA: EP 95944314.4

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 1:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 555 base pairs

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: nucleic acid

         \ vskip0.500000 \ baselineskip
      

(C)

TYPE OF HEBRA: simple

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: cDNA

         \ vskip0.800000 \ baselineskip
      

(iii)

HYPOTHETICAL: no

         \ vskip0.800000 \ baselineskip
      

(iv)

NEGATIVE POLARITY: no

         \ vskip0.800000 \ baselineskip
      

(saw)

ORIGINAL SOURCE:

         \ vskip0.500000 \ baselineskip
      

(TO)

ORGANISM: Lerk-6

         \ vskip0.800000 \ baselineskip
      

(ix)

CHARACTERISTIC:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME / KEY: CDS

         \ vskip0.500000 \ baselineskip
      

(B)

LOCATION: 1 .. 552

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 1:

one

2

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 2:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 184 amino acids

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: amino acid

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: Protein

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 2:

3

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 3:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 23 base pairs

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: nucleic acid

         \ vskip0.500000 \ baselineskip
      

(C)

KIND OF HEBRA: simple

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: cDNA

         \ vskip0.800000 \ baselineskip
      

(iii)

HYPOTHETICAL: no

         \ vskip0.800000 \ baselineskip
      

(iv)

NEGATIVE POLARITY: no

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 3:

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

CTTTAGTGAG GGTTAATCTA TAG

\hfill

23

 \ hskip-.1em \ dddseqskip 

CTTTAGTGAG GGTTAATCTA TAG

 \ hfill 

2. 3

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 4:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 687 base pairs

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: nucleic acid

         \ vskip0.500000 \ baselineskip
      

(C)

KIND OF HEBRA: simple

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: cDNA

         \ vskip0.800000 \ baselineskip
      

(iii)

HYPOTHETICAL: no

         \ vskip0.800000 \ baselineskip
      

(iv)

NEGATIVE POLARITY: no

         \ vskip0.800000 \ baselineskip
      

(saw)

ORIGINAL SOURCE:

         \ vskip0.500000 \ baselineskip
      

(B)

ORGANISM: hulerk-7

         \ vskip0.800000 \ baselineskip
      

(ix)

CHARACTERISTIC:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME / KEY: sig _ peptide

         \ vskip0.500000 \ baselineskip
      

(B)

LOCATION: 1 .. 60

         \ vskip0.800000 \ baselineskip
      

(ix)

CHARACTERISTIC:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME / KEY: CDS

         \ vskip0.500000 \ baselineskip
      

(B)

LOCATION: 1 .. 687

         \ vskip0.800000 \ baselineskip
      

(ix)

CHARACTERISTIC:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME / KEY: CDS

         \ vskip0.500000 \ baselineskip
      

(B)

LOCATION: 61 .. 684

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 4:

4

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 5:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 228 amino acids

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: amino acid

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: Protein

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 5:

         \ vskip1.000000 \ baselineskip
      

5

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 6:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 8 amino acids

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: amino acid

         \ vskip0.500000 \ baselineskip
      

(C)

KIND OF HEBRA: simple

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: Peptide

         \ vskip0.800000 \ baselineskip
      

(iii)

HYPOTHETICAL: no

         \ vskip0.800000 \ baselineskip
      

(iv)

NEGATIVE POLARITY: no

         \ vskip0.800000 \ baselineskip
      

(saw)

IMMEDIATE SOURCE:

         \ vskip0.500000 \ baselineskip
      

(B)

WITH: FLAG peptide

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 6:

         \ vskip1.000000 \ baselineskip
      

\ sa {Asp Tyr Lys Asp Asp Asp Asp Lys}

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 7:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 705 base pairs

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: nucleic acid

         \ vskip0.500000 \ baselineskip
      

(C)

KIND OF HEBRA: simple

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: cDNA a MRNA

         \ vskip0.800000 \ baselineskip
      

(iii)

HYPOTHETICAL: no

         \ vskip0.800000 \ baselineskip
      

(iv)

NEGATIVE POLARITY: no

         \ vskip0.800000 \ baselineskip
      

(saw)

IMMEDIATE SOURCE:

         \ vskip0.500000 \ baselineskip
      

(C)

CLON: hlgG1Fc

         \ vskip0.800000 \ baselineskip
      

(ix)

CHARACTERISTIC:

         \ vskip0.500000 \ baselineskip
      

(TO)

NAME / KEY: CDS

         \ vskip0.500000 \ baselineskip
      

(B)

LOCATION: 1 .. 699

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 7:

         \ vskip1.000000 \ baselineskip
      

6

7

         \ vskip1.000000 \ baselineskip
      

(2) INFORMATION FOR SEC. ID. Nº: 8:

         \ vskip0.800000 \ baselineskip
      

(i)

CHARACTERISTICS OF THE SEQUENCE

         \ vskip0.500000 \ baselineskip
      

(TO)

LENGTH: 232 amino acids

         \ vskip0.500000 \ baselineskip
      

(B)

TYPE: amino acid

         \ vskip0.500000 \ baselineskip
      

(D)

TOPOLOGY: linear

         \ vskip0.800000 \ baselineskip
      

(ii)

TYPE OF MOLECULE: Protein

         \ vskip0.800000 \ baselineskip
      

(xi)

SEQUENCE DESCRIPTION: SEC. ID. Nº: 8:

8

Claims (31)

1. An isolated DNA encoding a polypeptide Lerk-7 that joins hek or elk, in which said Lerk-7 polypeptide comprises a sequence of amino acids that is at least 80% identical to a sequence selected from the group consisting of the remains -20 to 208 of SEQ ID NO: 5 and residues 1 to 208 of SEQ ID NO: 5. 2. A DNA of claim 1, wherein said  Lerk-7 polypeptide comprises a sequence of amino acids that is at least 90% identical to a sequence selected from the group consisting of the remains -20 to 208 of SEQ ID NO: 5 and residues 1 to 208 of SEQ ID NO: 5. 3. A DNA of claim 2, wherein said  Lerk-7 polypeptide comprises a sequence of amino acids selected from the group consisting of the residues -20 to 208 of SEQ ID NO: 5 and residues 1 to 208 of SEQ ID NO: 5. 4. A DNA of claim 3, comprising a nucleotide sequence selected from the group consisting of nucleotides 1-687 of SEQ ID No.: 4 and nucleotides 61 to 687 of SEQ ID NO: 4. 5. An isolated DNA encoding a polypeptide Lerk-7 soluble that binds to hek or elk, in which said Lerk-7 polypeptide comprises a sequence of amino acids that is at least 80% identical to a sequence selected from the group consisting of the remains -20 to x of the SEQ ID NO: 5 and residues 1 to x of SEQ ID NO: 5, in which x represents an integer between 133 and 193, inclusive. 6. An isolated DNA according to claim 5, in which said Lerk-7 polypeptide comprises a amino acid sequence selected from the group constituted for the remains -20 to x of SEQ ID NO: 5 and the remains 1 to x of the SEQ ID NO: 5, in which x represents an integer between 133 and 193, inclusive. 7. A DNA of claim 6, wherein said  Lerk-7 polypeptide comprises a sequence of amino acids selected from the group consisting of the residues -20 to 113, -20 to 182, -20 to 193, 1 to 133, 1 to 182, and 193 of the SEC ID Nº: 5. 8. An expression vector comprising a DNA sequence according to any one of claims 1 to 7. 9. A host cell transformed with a expression vector of claim 8. 10. A procedure to produce a polypeptide Lerk-7, which comprises the culture of a cell host of claim 9 under conditions that promote the expression of said Lerk-7 polypeptide, and Lerk-7 polypeptide recovery. 11. A Lerk-7 polypeptide that encodes a DNA according to any one of claims 1 to 7. 12. A Lerk-7 polypeptide purified comprising an amino acid sequence that is at minus 80% identical to the sequence of amino acid residues 1 to 208 of SEQ ID NO: 5. 13. A Lerk-7 polypeptide of the claim 12, comprising amino acid sequence 1 to 208 of SEQ ID NO: 5. 14. A soluble Lerk-7 polypeptide purified that binds to hek or elk, wherein said polypeptide comprises an amino acid sequence that is at least 80% identical to a sequence of residues 1 to x of SEQ ID NO: 5, in which x represents an integer between 133 and 193, inclusive. 15. A soluble Lerk-7 polypeptide according to claim 14, wherein said polypeptide comprises the amino acid sequence of residues 1 to x of SEQ ID NO: 5, where x represents an integer between 133 and 193, inclusive. 16. A soluble Lerk-7 polypeptide according to claim 15, comprising a sequence of amino acids selected from the group consisting of residues 1 to 133, 1 to 182, and 1 to 193 of SEQ ID NO: 5. 17. A Lerk-7 polypeptide purified which is a protein fragment Lerk-7 of SEQ ID NO: 5, wherein said fragment joins hek or elk. 18. A purified Lerk-7 polypeptide characterized by an N-terminal amino acid sequence Gln-Asp-Pro-Gly-Ser-Lys-Ala-Val-Ala-Asp-Arg-Tyr-Ala-Val-Tyr. 19. A purified protein Purified Lerk-7 comprising the sequence of amino acids of the protein expressed from the insertion of Lerk-7 cDNA of the recombinant vector in ATCC 75959 20. An antibody that specifically binds to a  Lerk-7 polypeptide according to any one of the claims 11 to 19, or an antigen binding fragment of the same. 21. An antibody according to claim 20, in which the antibody is a monoclonal antibody. 22. a monoclonal antibody according to the claim 21, wherein said antibody binds specifically to the Lerk-7 polypeptide of SEQ ID Nº: 5. 23. A fusion protein comprising a soluble Lerk-7 polypeptide and a polypeptide derivative of an antibody, wherein said polypeptide Lerk-7 is a soluble protein fragment Lerk-7 of SEQ ID NO: 5, wherein said fragment He is able to join elk or hek. 24. A fusion protein of claim 23, wherein said antibody derived polypeptide is a Fc polypeptide. 25. A dimer comprising two proteins of fusion of claim 24. 26. An oligomer comprising between two and four  soluble Lerk-7 polypeptides, in which each of said polypeptides is a soluble fragment of the protein Lerk-7 of SEQ ID NO: 5, wherein said fragment He is able to join elk or hek. 27. A composition comprising a polypeptide Lerk-7 or an oligomer according to any one of the claims 11-19, 25 or 26, and a diluent, pharmaceutically acceptable carrier, or excipient. 28. A conjugate comprising a polypeptide Lerk-7 or an oligomer according to any one of the claims 11-19, 25 or 26, and an agent of Diagnostic or therapeutic. 29. A polypeptide, oligomer, composition, or conjugate of Lerk-7 according to any one of the claims 11-19, 25-28 for Use in human medicine. 30. The use of a polypeptide, oligomer, or composition of Lerk-7, according to any one of the claims 11-19, or 25-27 in preparing a medication to treat a tissue disorder neural. 31. The use of a polypeptide, oligomer, or composition of Lerk-7, according to any one of the claims 11-19, or 25-27 for detect or bind to a receptor that binds to Lerk-7