EP4735031A2 - Codon optimized pmcv sequences - Google Patents
Codon optimized pmcv sequencesInfo
- Publication number
- EP4735031A2 EP4735031A2 EP24832850.2A EP24832850A EP4735031A2 EP 4735031 A2 EP4735031 A2 EP 4735031A2 EP 24832850 A EP24832850 A EP 24832850A EP 4735031 A2 EP4735031 A2 EP 4735031A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- nucleic acid
- codon optimized
- sequence
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
- C07K14/08—RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Wood Science & Technology (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Zoology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present disclosure provides exemplary codon optimized nucleic acid sequences encoding Piscine Myocarditis Virus (PMCV). Expression vectors comprising one or more of the described codon optimized nucleic acids sequences are also provided.
Description
CODON OPTIMIZED PMCV SEQUENCES
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application Serial No. 63/523,476, filed on June 27, 2023, the entire disclosure of which is incorporated herein by reference.
TECHNICAL FIELD
The disclosure relates to sequences of Piscine Myocarditis Virus (PMCV) sequences that have been modified to comprise codons optimized for expression in cells.
BACKGROUND AND SUMMARY OF THE INVENTION
Cardiomyopathy syndrome (CMS) is an emerging disease of economic importance in salmon. In particular, the Piscine Myocarditis Virus (PMCV) has been identified as a causative link for CMS. PMCV is of large economic concern in the salmonid industry because it causes morbidity and mortality in adult fish that are nearly full grown and almost ready for harvest.
PMCV encodes at least three major proteins: a capsid (ORF1), an RNA- dependent RNA polymerase (ORF2), and a structural protein of unknown function (ORF3) that may be involved in virus assembly or egress. However, attempts to propagate PMCV using in vitro cell culture systems have failed. As a result, traditional live, attenuated, and inactivated vaccine approaches have not yet materialized. Thus, there exists a need for a PMCV vaccine that utilizes DNA, RNA, or recombinant approaches for design, in particular those utilizing nucleic acid sequences that have been modified to comprise codons optimized for improved expression.
Accordingly, the present disclosure, in one aspect, provides nucleic acid molecules (e.g., described in one aspect as sequences) encoding Piscine Myocarditis Virus (PMCV) protein(s). In one example, the nucleic acid sequences of the present disclosure have been modified to comprise codons optimized for improved expression in cells.
DETAILED DESCRIPTION
Various embodiments are described herein as follows.
Illustrative aspects of the present disclosure include SEQ ID NO: 1. As described herein, SEQ ID NO: 1 corresponds to a codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO:
1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 1 is provided.
Illustrative aspects of the present disclosure include SEQ ID NO: 2. As described herein, SEQ ID NO: 2 corresponds to a codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO:
2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 2 is
provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 2 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 2 is provided.
Illustrative aspects of the present disclosure include SEQ ID NO: 3. As described herein, SEQ ID NO: 3 corresponds to a codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 3 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 3 is
provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 3 is provided.
Illustrative aspects of the present disclosure include SEQ ID NO: 4. As described herein, SEQ ID NO: 4 corresponds to a second codon optimized sequence for ORF_1 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 4 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 4 is provided.
Illustrative aspects of the present disclosure include SEQ ID NO: 5. As described herein, SEQ ID NO: 5 corresponds to a second codon optimized sequence for ORF_3 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence
at least 85% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 5 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 5 is provided.
Illustrative aspects of the present disclosure include SEQ ID NO: 6. As described herein, SEQ ID NO: 6 corresponds to second codon optimized sequence for ORF_3 FR13 of PMCV. In an embodiment, a codon optimized nucleic acid sequence comprising SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting essentially of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence consisting of SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized
nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 6 is provided. In an embodiment, a codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO: 6 is provided.
In illustrative aspects, an expression vector is provided. The expression vector comprises one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences can comprise any of the codon optimized nucleic acid sequences described herein.
The following numbered embodiments are contemplated and are non-limiting.
1. A codon optimized nucleic acid sequence comprising SEQ ID NO:1.
2. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:1.
3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.
4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO: 1.
5. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:1.
6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO: 1.
7. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:1.
8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO: 1.
9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ 1D NO:1.
10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO: 1.
11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO: 1.
12. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:1.
13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO: 1.
14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO: 1.
15. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:1.
16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.
17. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:2.
18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.
19. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:2.
20. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:2.
21. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:2.
22. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:2.
23. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:2.
24. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:2.
25. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:2.
26. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:2.
27. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:2.
28. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:2.
29. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:2.
30. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:2.
31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.
32. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:3.
33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3.
34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.
35. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:3.
36. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:3.
37. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:3.
38. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:3.
39. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:3.
40. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:3.
41. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:3.
42. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:3.
43. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:3.
44. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:3.
45. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:3.
46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.
47. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:4.
48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.
49. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:4.
50. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:4.
51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4.
52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.
53. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:4.
54. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:4.
55. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:4.
56. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:4.
57. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:4.
58. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:4.
59. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:4.
60. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:4.
61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.
62. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:5.
63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.
64. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:5.
65. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:5.
66. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:5.
67. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:5.
68. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:5.
69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5.
70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.
71. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:5.
72. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:5.
73. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:5.
74. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:5.
75. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:5.
76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.
77. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:6.
78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.
79. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:6.
80. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:6.
81. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:6.
82. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:6.
83. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:6.
84. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:6.
85. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:6.
86. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:6.
87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6.
88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.
89. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:6.
90. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:6.
91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of clauses 1 to 90 and any combination thereof.
EXAMPLE 1
Exemplary Codon Optimized Nucleic Acid Sequences
Exemplary codon optimized nucleic acid sequence were constructed. The nucleic acid sequences as shown in Table 1 can be utilized according to the present disclosure.
Table 1.
The sequences include the following:
ATGGAGCCCAATACCAGCGTGATCGCTACCGAACAACAACAAGCTGCTATGAGAG
AAGTCGAAGCTGAAGCTGCTGCTAGAGATGAGGTCGTCGAAAAAATTGCCTTTGCC
GAGGGAGCCATGATGGTGCAAACCAGAAGACTGCCCAGCGGAAAATCCAGCGTGG
GCGGATTCCTGGGAGAGCTCGCTCAAAATATCAGGGCTATGAACAGATCCCTGCAT
ACCGACACAAATATGCTCACAGAGGGAGCTATGGTCGATAGGGCTAGAGCCAAGG
TGCATAAGATTATCAGAGAGGGAAACCTGGATTCCAGAGTGTTCAGCAATACCGGC
TCCAATACCATGCTGAGCCTCTGGGTGCCTGCTGTGCCAGGCCCTCCCGCTGTGCCC
GAACACTGGGATGTGGCTCCAAGCTGGTTTGTGTGTAGGCCAGGCAAGAAAGGCG
GAATCAAAATTACCCAGTCCGCTAGCATGGCTGCTCTGAATCCCCTGTTCAGGGGA
GCCGATGTCGGACCTATTGGAACCGCTGTGAGAGCCGACGTGAATGCCTTCTCCAT
GAACGCTGTGCTCGGAGCTCTGAGGGCTGGCGGATTCAATACAGAGCACAGCCTCG
TCAGCTTTGTGGAGCCCCTGATCAGGATTCTGCTGATGGGAGTGCAGACCCAGGAT
AGAGGAACAAGCCCTTGGGACTGGGTGGGCGGAATGTCCAGCAGGATCGTGAACC
CTCTGGTGTTTACCACCTCCGGAAATTTTTTTCCCGGCGGACCTAACCTGAGAGTCT
GGGGCGCTAATGACACCGTCGCTAGAATCGTGAATGTGGAAGATTATATGAGGGA
AGCTGCTGGAGAAGGAAGATTTGATGCTGGATGGGGACCAGAGTTTTGGGGCGGA
ACCGGAGATGATGCTGTCGCTGTCGTGCCAATCAGAGCTGTGGAGGCTGGACTGGG
AGAGGTGAATGCTGGATGGACCCTGGCTCATATGGAGTATCCCGTGAAAGTGAGG
CTGCTGGATGTGGATGATAGAACCATCGGACCCGGCGGAAGCCTCCCACTGAATGC
TAATAGGGAGTATACCGCTGCTGGAGCTACCCACGTGCCAGGACCTTACGCTAGAG
TGCTCTATGTGGTGGTCGATCAGAATGCCGATAGATGTGTCGGAGTCAGAGTCCAA
GGACAAGGAGCTGTGATCGATGTCGACCCCGCCCTGAACTATGTCATCGGCGGAGC
CGACCTGGGAATGCTGCCCCTGATCCAATGGAGCGTGGGACTCGGAGCTGAAGAT
ATGGCTCAAGGATCCATCGCCCAAACCCAAAGATGGGTCAGAATGTACGGCAATG
AAGATGACTGGGAGTCCGCTTGGCACCTGGTCTCCAGCGCCTATACCGTCTATAGC
CCAGCTTTTAGAAGATCCGGAGTGGCTGTCGAAGGCGGATTTTGGGCTCAGCCTGC
TGCTGGAGCTGCTCCCTTCCCCCTGGGCGGACTGGCCGGCTGGGTCAGATATGATA
ACCAAGCTAGAGCTGCTCAAGTGGCTCTGTGTAGGGAAAGAGCTGACATGGCTGA
ATGTCCATGGGGCGGATATAGAGAAAGAGGAGTCAGACCCGGAAGCGTCGCTAAT
TGGCAATATGTGAGATTTGACCCAACCGTCGCTGTGGGAGTGGCTGCCCATTTTTG
GTCCGTGGTCAAAGTCATGGTCGCTCCAGTGCCTGATAGGGCTGCTGCCCTCGCCG
ATATGGCCTGGGGCAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGG
CCAAATGGGACAGCCCGAAAGCATGATGAGGGGAGTCGCTCTCAATGAAAATCAA
GGACTGGCTGCTGCTACCGTGAGAAGAGTCGTGGGCCTCGAAAATGAAAGCATGC
AGACCACCCATTGGTCCACCACCGAAGTGGCCATGAATGGCTATTATGGAAGAGCT
GGAGCTACCGCTCATCATGCTGCTTTCCCCCTGAGCGAAGGCGGAACCATGAGGAA
GAGAATCCCCGCCATCGAAATGAGAGAAAATGGAGTCGAAGGCGATCTCATGAAT
GACGACCTGTACTCCATCGGAACCGCCGCCGGCTATCTCGCTGTGGAAGGAATGGC
TGGAGCTCAAGGCGGAATTTGGGATGTCGTGCAATATCAACTCCCAGGACCAGATG
ACGAAGCTAGAGGAGTCATGAATACCGTCGGAGCTATGGGCGGATGGACCAGAGC
TGTCACCCCTGTGGATAACGTCGCTACAATGAGAGATAATGGAGTGGAAGGCGAG
CCCTGCGGAATCGTCATGAGCCTGCCTACCTCCGGAACAGCTGTCGTCGACAGACT
GGCCAACTTTGGACTGCCTCCCGCTAGAGCTGAGCTGAGAGAGGTGCCTTTCGGAG
GATATCAGAGGTCCGTGACCAATACAAATCATAGAGTGAAAGTCTCCGTCAGCGGC
GGAAGGGCTGTGGTGCAGAAGGGAAATAAGGCTGAAATGAACCCCGTGTTCGTGA
ACAGAACCCCTGGACAGACCACACTGGGACAGCCTACCACCGATACCACCGGAAT
GACCACCGCTGACTTCCTGGACATCTGA (SEQ ID NO: 1)
ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC
CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT
TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCAGCGGCGGAG
GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT
TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT
GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC
GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGGT
GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG
CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTA
GGCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA
GTTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAG
GAAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 2)
ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
GGGTGCCACTGGTCGGAGAAGGAAGAGCTGAAAAAATTGAACTGTTTAACCAATC
CGCTACCTGCCGGAAAAAGGAACTGATCATCACCTGGAAAGGAAAAAGATGGTGT
TATGACATCGGATCCAAAAGGGGCAAGGTGCTGGTGCAGACCCTCAGCGGCGGAG
GCCACCTCGAGCAGGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT
TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGAGGCGGATCCGT
GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC
GACATGCTGCCCCTGGTGGTGGGAATCGCTGGCGGATGCCTGATCGTCATCGTGAT
CCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAGC
CCGTGGAGCCAGAAGAGCATGAAATGAGAGACCTGAGAAGAAGACTGGAACCTAG
GCCTCCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGAG
TTTATGGGAGTGGAGGGATCCGAGAGCCCTGATTCCGGATGTCAAAGCGACGAGG
AAGGCTTTAGGGTGGGAGTGTGA (SEQ ID NO: 3)
ATGGAGCCTAATACTAGCGTTATAGCTACAGAACAACAACAAGCAGCTATGCGCG
AAGTCGAAGCTGAAGCTGCTGCTCGCGATGAGGTCGTCGAAAAAATTGCTTTTGCA
GAGGGGGCTATGATGGTCCAAACAAGAAGACTCCCTAGCGGGAAAAGCAGCGTCG
GGGGATTCTTGGGAGAGCTCGCTCAAAATATTAGAGCTATGAACAGAAGCCTCCAT
ACTGACACAAATATGCTCACAGAGGGAGCTATGGTCGATCGCGCTAGAGCTAAGG
TCCATAAGATTATAAGAGAGGGAAACCTCGATAGCAGAGTCTTCAGCAATACAGG
ATCTAATACAATGCTCAGCCTCTGGGTCCCTGCTGTCCCTGGGCCTCCTGCTGTCCC
TGAACACTGGGATGTCGCTCCTAGCTGGTTTGTCTGTCGCCCTGGAAAGAAAGGAG
GAATTAAAATTACTCAGTCTGCTAGCATGGCTGCTCTCAATCCTCTCTTCCGCGGAG
CTGATGTCGGACCTATTGGAACTGCTGTTAGAGCTGACGTCAATGCTTTCAGCATG
AACGCTGTCCTCGGGGCTCTCCGCGCTGGAGGGTTCAATACAGAGCACAGCCTCGT
CAGCTTTGTCGAGCCTCTCATAAGAATTCTCCTCATGGGAGTCCAGACTCAGGATA
GAGGAACATCTCCTTGGGACTGGGTCGGGGGAATGAGCAGCAGAATTGTTAACCCT
CTCGTCTTTACTACTTCTGGAAATTTTTTTCCTGGAGGGCCTAACCTCAGAGTCTGG
GGGGCTAATGACACTGTCGCTAGAATTGTCAATGTCGAAGATTATATGAGAGAAGC
TGCTGGAGAAGGAAGATTTGATGCAGGGTGGGGGCCTGAGTTTTGGGGAGGAACT
GGAGATGATGCTGTCGCTGTCGTCCCTATTAGAGCTGTCGAGGCTGGACTCGGGGA
GGTCAATGCTGGATGGACTCTCGCTCATATGGAGTATCCTGTTAAAGTCCGCCTCCT
CGATGTTGATGATAGAACTATAGGGCCTGGAGGATCTCTCCCTCTCAATGCTAATC
GCGAGTATACAGCTGCTGGGGCAACACACGTCCCTGGACCTTACGCTAGAGTCCTC
TATGTTGTTGTCGATCAGAATGCTGATAGATGCGTCGGAGTCCGCGTCCAAGGGCA
AGGAGCAGTCATAGATGTCGACCCTGCTCTCAACTATGTCATTGGAGGGGCTGACC
TCGGAATGCTCCCTCTCATTCAATGGAGCGTCGGACTCGGAGCTGAAGATATGGCT
CAAGGGAGCATAGCTCAAACACAAAGATGGGTCAGAATGTACGGGAATGAAGATG
ACTGGGAGAGCGCTTGGCACCTCGTCAGCTCTGCTTATACTGTCTATTCTCCTGCTT
TTAGACGCAGCGGAGTTGCTGTCGAAGGGGGGTTTTGGGCTCAGCCTGCAGCTGGA
GCTGCTCCTTTCCCTCTCGGGGGGCTCGCTGGATGGGTCAGATATGATAACCAAGC
TAGAGCTGCTCAAGTCGCTCTCTGTCGCGAAAGAGCTGACATGGCTGAATGCCCAT
GGGGAGGATATAGAGAACGCGGAGTCCGCCCTGGAAGCGTCGCTAATTGGCAATA
TGTCAGATTTGACCCTACTGTCGCAGTCGGGGTCGCAGCACATTTTTGGAGCGTCGT
CAAAGTCATGGTCGCACCTGTTCCTGATCGCGCTGCAGCACTCGCTGATATGGCTT
GGGGAAAAGGAAAAGTCCAGGCTATGGGAGAAGACGTCATTAATGGACAAATGGG
GCAGCCAGAAAGCATGATGCGCGGAGTCGCTCTCAATGAAAATCAAGGGCTCGCT
GCTGCAACTGTTAGAAGAGTCGTCGGACTCGAAAATGAAAGCATGCAGACTACAC
ATTGGAGCACTACAGAAGTCGCTATGAATGGATATTATGGACGCGCTGGGGCTACT
GCTCATCATGCAGCTTTCCCTCTCAGCGAAGGAGGAACTATGAGAAAGAGAATTCC
TGCAATTGAAATGAGAGAAAATGGAGTCGAAGGAGATCTCATGAATGACGACTTG
TACAGCATAGGGACAGCTGCTGGATATCTCGCTGTCGAAGGAATGGCTGGAGCTCA
AGGAGGAATTTGGGATGTCGTTCAATATCAACTCCCAGGACCAGATGACGAAGCTA
GAGGAGTCATGAATACAGTCGGAGCTATGGGAGGGTGGACAAGAGCTGTCACTCC
TGTCGATAACGTCGCTACAATGAGAGATAATGGAGTCGAAGGAGAGCCATGCGGG
ATTGTCATGAGCCTCCCTACTAGCGGAACAGCAGTCGTCGACAGACTCGCAAACTT
TGGGCTCCCTCCTGCTAGAGCTGAGCTCCGCGAGGTCCCTTTCGGAGGATATCAGC
GCAGCGTTACTAATACAAATCATCGCGTTAAAGTCAGCGTCAGCGGAGGAAGAGC
TGTCGTCCAGAAGGGAAATAAGGCTGAAATGAACCCTGTTTTCGTTAACAGAACTC
CTGGGCAGACAACACTCGGACAGCCTACTACTGATACAACTGGAATGACTACAGCT
GACTTCCTCGACATTTAA (SEQ ID NO: 4)
ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA
GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA
GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC
CGCTACCTGCGGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT
TATGACATCGAATCCAAAAGGGGCAAGATCCTGGTGAAAACCCTCTCTGGCGGAG
GCCACCTCGAGAGAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT
GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG
GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG
GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT
TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT
GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC
GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGGT GCTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGCTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 5)
ATGTCCAATAAAATGAAAAGCTTCCTGCTCGTCCTGCTGTGCCTGTGTGTGGGCGA GGGAATCGTGCCCATGTTTAGAAGAGAGTGGTGCCTGTGTACCGCTGGAAACGCTA GGGTGCCACTGGTCGGGGAAGGGAGAGCAGAAAAAATTGAACTGTTTAACCAATC CGCTACCTGCCGCAAAAAGGAACTGATCATCACCTGGAAAGGGAAAAGATGGTGT TATGACATCGGATCCAAAAGGGGCAAGGTCCTGGTGCAAACCCTCTCTGGCGGAG GCCACCTCGAGCAAGAAGGCAAAGGATATAAACTCGTGAGAAATGGATTTCACCT GGCCAGCTTTGGCGGCAAGAAAGAAGAGATCCAAGACTCCAGCCATATCGAAAAG GTGAATGGCAAGGATGCCATCGTGAAAAAGGGACAGCATGTGGAGCACCTGCCCG GAGGCAATGACCTGATCGTGACCGAAGGAGGCAATCTCTGCGGCAATGTCGGATTT TTTGACAACACCCAATGTACCTATAATTCCGTGATCAACATCGGGGGCGGGTCCGT GGATAACAGCCAGGAAGCTAAAAATGACAAGAGCAATACCATCGATAACCTGATC GACATGCTGCCCCTGGTGGTGGGGATCGCTGGCGGATGCCTGATCGTCATCGTGAT ACTGTATCTGACCATCAAGTATTGCAAGTGTAAAAAAAAAAGAACAAATCCTGAG CCCGTTGAGCCAGAAGAGCATGAAATGAGAGACCTGAGACGCAGACTGGAACCTA GGCCACCCTATCAGAGGCAAATGGGCGTGGAATTCGAGATCAACGAGGCCCTGGA GTTTATGGGAGTGGAGGGATCCGAGTCTCCTGATTCCGGGTGTCAAAGCGACGAGG AAGGCTTTAGGGTGGGGGTGTGA (SEQ ID NO: 6)
EXAMPLE 2
Exemplary Vectors
Exemplary vectors can be constructed using fusion technology to create various plasmids. For instance, starting with an existing plasmid, a variant plasmid can be designed to include one or more codon optimized nucleic acid sequences of the present disclosure.
Claims
1. A codon optimized nucleic acid sequence comprising SEQ ID NO: 1.
2. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:1.
3. A codon optimized nucleic acid sequence consisting of SEQ ID NO:1.
4. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:1.
5. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:1.
6. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:1.
7. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:1.
8. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:1.
9. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:1.
10. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:1.
11. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:1 .
12. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:1.
13. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:1.
14. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:1.
15. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:1.
16. A codon optimized nucleic acid sequence comprising SEQ ID NO:2.
17. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:2.
18. A codon optimized nucleic acid sequence consisting of SEQ ID NO:2.
19. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:2.
20. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:2.
21. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:2.
22. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:2.
23. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:2.
24. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:2.
25. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:2.
26. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:2.
27. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:2.
28. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:2.
29. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:2.
30. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:2.
31. A codon optimized nucleic acid sequence comprising SEQ ID NO:3.
32. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:3.
33. A codon optimized nucleic acid sequence consisting of SEQ ID NO:3.
34. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:3.
35. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:3.
36. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:3.
37. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:3.
38. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:3.
39. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:3.
40. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:3.
41. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:3.
42. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:3.
43. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:3.
44. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:3.
45. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:3.
46. A codon optimized nucleic acid sequence comprising SEQ ID NO:4.
47. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:4.
48. A codon optimized nucleic acid sequence consisting of SEQ ID NO:4.
49. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:4.
50. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:4.
51. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:4.
52. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:4.
53. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:4.
54. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:4.
55. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:4.
56. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:4.
57. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:4.
58. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:4.
59. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:4.
60. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:4.
61. A codon optimized nucleic acid sequence comprising SEQ ID NO:5.
62. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:5.
63. A codon optimized nucleic acid sequence consisting of SEQ ID NO:5.
64. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:5.
65. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:5.
66. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:5.
67. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:5.
68. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:5.
69. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:5.
70. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:5.
71. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:5.
72. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:5.
73. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:5.
74. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:5.
75. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:5.
76. A codon optimized nucleic acid sequence comprising SEQ ID NO:6.
77. A codon optimized nucleic acid sequence consisting essentially of SEQ ID NO:6.
78. A codon optimized nucleic acid sequence consisting of SEQ ID NO:6.
79. A codon optimized nucleic acid sequence comprising a sequence at least 80% identical with SEQ ID NO:6.
80. A codon optimized nucleic acid sequence comprising a sequence at least 85% identical with SEQ ID NO:6.
81. A codon optimized nucleic acid sequence comprising a sequence at least 90% identical with SEQ ID NO:6.
82. A codon optimized nucleic acid sequence comprising a sequence at least 91% identical with SEQ ID NO:6.
83. A codon optimized nucleic acid sequence comprising a sequence at least 92% identical with SEQ ID NO:6.
84. A codon optimized nucleic acid sequence comprising a sequence at least 93% identical with SEQ ID NO:6.
85. A codon optimized nucleic acid sequence comprising a sequence at least 94% identical with SEQ ID NO:6.
86. A codon optimized nucleic acid sequence comprising a sequence at least 95% identical with SEQ ID NO:6.
87. A codon optimized nucleic acid sequence comprising a sequence at least 96% identical with SEQ ID NO:6.
88. A codon optimized nucleic acid sequence comprising a sequence at least 97% identical with SEQ ID NO:6.
89. A codon optimized nucleic acid sequence comprising a sequence at least 98% identical with SEQ ID NO:6.
90. A codon optimized nucleic acid sequence comprising a sequence at least 99% identical with SEQ ID NO:6.
91. An expression vector comprising one or more codon optimized nucleic acids sequences, wherein the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90 and any combination thereof.
92. An immunogenic composition comprising the expression vector of claim 91.
93. A plurality of expression vectors, wherein at least one expression vector comprises the one or more codon optimized nucleic acids sequences are selected from any one of claims 1 to 90.
94. An immunogenic composition comprising the plurality of expression vectors of claim 93.
95. A method of immunizing a non-human animal with the immunogenic composition of claim 94.
96. The method of claim 95, wherein the non-human animal is a fish.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363523476P | 2023-06-27 | 2023-06-27 | |
| PCT/US2024/035572 WO2025006573A2 (en) | 2023-06-27 | 2024-06-26 | Codon optimized pmcv sequences |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4735031A2 true EP4735031A2 (en) | 2026-05-06 |
Family
ID=93940162
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24832850.2A Pending EP4735031A2 (en) | 2023-06-27 | 2024-06-26 | Codon optimized pmcv sequences |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP4735031A2 (en) |
| DK (1) | DK202570141A1 (en) |
| NO (1) | NO20251666A1 (en) |
| WO (1) | WO2025006573A2 (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1615663B1 (en) * | 2003-10-24 | 2007-12-26 | Mologen AG | Agent for treating leishmania infections |
| EP2560985B1 (en) * | 2010-04-21 | 2016-06-29 | Pharmaq AS | Nucleic acid sequences of a fish virus and the use thereof |
-
2024
- 2024-06-26 EP EP24832850.2A patent/EP4735031A2/en active Pending
- 2024-06-26 WO PCT/US2024/035572 patent/WO2025006573A2/en not_active Ceased
-
2025
- 2025-12-12 DK DKPA202570141A patent/DK202570141A1/en unknown
- 2025-12-22 NO NO20251666A patent/NO20251666A1/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| WO2025006573A2 (en) | 2025-01-02 |
| WO2025006573A3 (en) | 2025-03-06 |
| DK202570141A1 (en) | 2026-01-07 |
| NO20251666A1 (en) | 2025-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fodor et al. | Induction of protective immunity in chickens immunised with plasmid DNA encoding infectious bursal disease virus antigens | |
| US10308927B2 (en) | Processing of a modified foot-and-mouth disease virus P1 polypeptide by an alternative protease | |
| Li et al. | Enhancement of the immunogenicity of DNA vaccine against infectious bursal disease virus by co-delivery with plasmid encoding chicken interleukin 2 | |
| US20250127873A1 (en) | Compositions and methods for prevention of piscine myocarditis | |
| WO2014174078A1 (en) | Bacterial artificial chromosomes | |
| WO2019023920A1 (en) | Foot-and-mouth disease virus-like particle vaccine and preparation method therefor | |
| US20250057946A1 (en) | Use of interferon as an adjuvant in vaccines | |
| RU2018130683A (en) | ATTENUATED INFECTIOUS BRONCHITIS VIRUS | |
| EP2992005B1 (en) | Mutant spike protein extending the tissue tropism of infectious bronchitis virus (ibv) | |
| CN111040024A (en) | Type 4 avian adenovirus gene engineering vaccine and preparation method and application thereof | |
| CN111548394A (en) | Fowl bursa virus gene engineering vaccine and its preparation method and use | |
| CN120202019A (en) | Recombinant LSDV vector foot-and-mouth disease antigen construct | |
| WO2025006573A2 (en) | Codon optimized pmcv sequences | |
| DK202470171A1 (en) | Compositions and methods for expressing antigens on cell membrane | |
| US20070207167A1 (en) | Immunologically enhanced recombinant vaccines | |
| Kwon et al. | Sequence analysis of the variable VP2 gene of infectious bursal disease viruses passaged in Vero cells | |
| CN1630662A (en) | Rabbit hemorrhagic disease vaccine and antigen | |
| RU2842174C2 (en) | Compositions and methods for preventing fish myocarditis | |
| RU2854997C2 (en) | Use of interferon as adjuvant in vaccines | |
| CN120775802B (en) | A carp herpesvirus type 3 ORF136 gene-inactivated strain, its preparation method and application | |
| EP1170302B1 (en) | Infectious bursal disease virus vaccines | |
| JP2025091235A (en) | Construct for expressing the E2 subunit of swine fever virus using the baculovirus expression system and its use | |
| Duong et al. | Expression and purification capsid proteins Vp0, Vp1 and Vp3 of foot and mouth disease virus type O in Escherichia coli | |
| Chansuwan et al. | Production of scale drop disease virus self-assembled major capsid protein nanoparticles for fish vaccine development | |
| CN120775801A (en) | Cyprinus Carpio herpesvirus 3 type ORF138 gene inactivated strain, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20260127 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |