EP4677091A2 - Zusammensetzungen und verfahren zur modulierung von grin2a - Google Patents
Zusammensetzungen und verfahren zur modulierung von grin2aInfo
- Publication number
- EP4677091A2 EP4677091A2 EP24767911.1A EP24767911A EP4677091A2 EP 4677091 A2 EP4677091 A2 EP 4677091A2 EP 24767911 A EP24767911 A EP 24767911A EP 4677091 A2 EP4677091 A2 EP 4677091A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- isolated nucleic
- seq
- set forth
- grin2a
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
Definitions
- Glutamate is the anion of glutamic acid and acts as an excitatory neurotransmitter that is involved in modulating a variety of biological processes. Glutamate signals through three different receptor types: AMP A receptors, NMD A receptors, and metabotropic glutamate receptors. Glutamate signaling through NMDA receptors is important for controlling synaptic plasticity and mediating learning and memory functions.
- aspects of the disclosure relate to isolated nucleic acids that bind to mRNA transcripts of genes involved in certain psychiatric diseases and disorders, for example genes encoding subunits of N-methyl-D-aspartate (NMDA) receptors.
- the subunit is a Glutamate [NMDA] receptor subunit epsilon- 1 (GRIN2A) subunit.
- compositions of the disclosure are useful for treating diseases or disorders associated with psychiatric diseases and disorders, such as schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression and major depressive disorder), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- the disclosure is based, in part, on compositions and methods for modulating a level, transcription, splicing, and/or translation of one or more RNA transcripts (e.g., mRNA transcripts (
- the disclosure provides an isolated nucleic acid that comprises a region of complementarity with a human GRIN2A mRNA transcript, has at least 60% identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, 95-99%, or 100% identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269 (e.g., as listed in Column A of Table 1), and upon binding to the mRNA transcript decreases a level, transcription, splicing, and/or translation of functional GRIN2A protein from the mRNA transcript.
- 60% identity e.g., 60-70%, 70-80%, 80-90%, 90-95%, 95-99%, or 100% identity
- the isolated nucleic acid comprises RNA. In some embodiments, the isolated nucleic acid is an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- the isolated nucleic acid comprises or consists of between 10 and 40 nucleotides. In some embodiments, the isolated nucleic acid comprises or consists of between 18 and 25 nucleotides.
- the isolated nucleic acid comprises one or more chemical modifications, for example as listed in Column B of Table 1.
- the one or more chemical modifications comprise one or more nucleoside modifications and/or one or more sugar-phosphate backbone modifications.
- the one or more nucleoside modifications comprises a 2'-O-methyl (2'-OMe) modification, 2'-0-M0E modification, 2’-fluoro modification, or a locked nucleic acid (LNA) modification.
- the one or more sugar-phosphate backbone modifications comprises a phosphorothioate backbone modification.
- the isolated nucleic acid is fully chemically modified (e.g., contains a fully modified sugar-phosphate backbone, and all nucleotides of the isolated nucleic acid are chemically modified).
- the isolated nucleic acid comprises one or more deoxyribonucleotides. In some embodiments, the isolated nucleic acid is a gapmer. In some embodiments, the region of complementarity is located in an untranslated region of the GRIN2A mRNA transcript. In some embodiments, the untranslated region comprises a 5' UTR, intron, or a 3' UTR of the GRIN2A mRNA transcript.
- the region of complementarity is located in a protein coding region of the GRIN2A mRNA transcript.
- the region of complementarity is located on an intron-exon boundary (e.g., the region of complementarity spans an intron exon boundary, such that the isolated nucleic acid hybridizes binds to both an intron and an exon at the same time) of the GRIN2A mRNA transcript.
- the region of complementarity comprises at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 continuous nucleotides of the sequence set forth in any one of SEQ ID NOs: 270-272.
- the nucleotide sequence comprises the nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1. In some embodiments, the nucleotide sequence comprises one or more chemical modifications (or combinations of chemical modifications) set forth in Column B of Table 1. In some embodiments, the nucleotide sequence comprises a nucleic acid sequence set forth in any one of the nucleotide sequences set forth in Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) set forth in Column B of Table 1. In some embodiments, the nucleic acid sequence from Column A and the one or more chemical modifications (or combinations of chemical modifications) in Column B are taken from the same row of Table 1.
- the disclosure provides a method for decreasing glutamate signaling in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.
- the cell is a neuronal cell. In some embodiments, the neuronal cell is a postsynaptic neuronal cell.
- the subject comprises one or more mutations in a gene that is associated with glutamate signaling.
- the gene is GRIN2A.
- the cell or subject is a human cell or subject.
- the subject has or is suspected of having a psychiatric disease or disorder.
- the disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- schizophrenia e.g., treatment resistant schizophrenia
- depression e.g., treatment resistant depression, major depressive disorder, etc.
- AD Alzheimer’s disease
- PD Parkinson’s disease
- the administration is systemic administration.
- the systemic administration comprises intravenous injection.
- the administration comprises direct administration to a target tissue of the subject.
- the direct administration comprises direct injection to the central nervous system (CNS) of the subject.
- the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.
- the administration comprises placing the subject in a Trendelenburg position during the administration.
- the disclosure provides a method for reducing NMDA receptor- mediated exci totoxi city in a subject, the method comprising administering an isolated nucleic acid as described herein, to a subject in need thereof.
- the subject does not comprise one or more mutations in a gene associated with glutamate signaling. In some embodiments, a subject does not have a mutation in a GRIN2A gene.
- the subject comprises one or more mutations in a gene that is associated with glutamate signaling.
- the gene is GRIN2A.
- the subject is a human subject.
- the subject has or is suspected of having a psychiatric disease or disorder.
- the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- schizophrenia e.g., treatment resistant schizophrenia
- depression e.g., treatment resistant depression, major depressive disorder, etc.
- AD Alzheimer’s disease
- PD Parkinson
- the administration is systemic administration.
- the systemic administration comprises intravenous injection.
- the administration comprises direct administration to a target tissue of the subject.
- the direct administration comprises direct injection to the central nervous system (CNS) of the subject.
- the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.
- the administration comprises placing the subject in a Trendelenburg position during the administration.
- the disclosure provides a method for preventing or treating a psychiatric disease or disorder in a subject in need thereof, the method comprising administering to the subject an isolated nucleic acid as described herein.
- the subject is a human.
- the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- schizophrenia e.g., treatment resistant schizophrenia
- depression e.g., treatment resistant depression, major depressive disorder, etc.
- AD Alzheimer’s disease
- PD Parkinson’s disease
- epilepsy e.g., refractory epilepsy
- the administration comprises direct administration to a target tissue of the subject.
- the direct administration comprises direct injection to the central nervous system (CNS) of the subject.
- the direct administration comprises direct injection to the peripheral nervous system (PNS) of the subject.
- FIG. 1 shows a schematic depicting modulation of RNA (e.g., mRNA, such as mature mRNA or pre-mRNA) levels, transcription, splicing, and/or translation by antisense oligonucleotides (ASOs).
- RNA e.g., mRNA, such as mature mRNA or pre-mRNA
- ASOs antisense oligonucleotides
- Composition “A” represents an ASO that binds to the 5' untranslated region (5' UTR) of an RNA.
- Composition “B” represents an ASO that binds to an intron of an RNA.
- Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA.
- a splice boundary e.g., a splice junction
- Composition “D” represents an ASO that binds to an exon (e.g., protein coding region) of an RNA.
- Composition “E” represents a combination of an ASO binding to a 3' UTR of an RNA, alone or with a trans-regulator.
- Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay.
- Composition “G” represents a “gapmer” ASO that binds to a 3' UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay.
- ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.
- FIGs. 2A-2C show representative data regarding expression profiling of human Glutamate ionotropic receptor NMDA type subunit 2A (GRIN2A).
- FIG. 2A shows bulk tissue gene expression of human GPJN2A ⁇ data indicate GRIN2A mRNA is expressed in various tissues.
- FIG. 2B shows a schematic depicting exons and introns present in the GRIN2A gene.
- FIG. 2C shows representative data for exon expression analysis of human GRIN2A splice variants in tissue.
- FIG. 3 is a schematic depicting the primary AUG, and upstream regions of GRIN2A mRNA transcript.
- FIGs. 4A-4C show representative in vitro data for ASOs targeting GRIN2A RNA.
- FIG. 4A shows a diagram of GRIN2A RNA within which exons are indicated as boxes and introns are indicated as dashed lines.
- the 181 designed ASOs (rectangles; Table 1) are shown based on the location of their target region on GRIN2A RNA. Ten of the most potent ASOs of each chemistry are shaded.
- FIG. 4B shows GRIN2A RNA levels after ASO treatment.
- GRIN2A RNA Normalized levels of GRIN2A RNA in U-138 MG cells as measured by branched DNA (bDNA) in a bDNA signal amplification assay 48 hours after transfection with mock and non-targeting control ASOs (shaded), an siRNA targeting GRIN2A (shaded), or ASOs targeting GRIN2A at both 5 nM and 20 nM doses are presented.
- FIG. 4C shows GRIN2A RNA down-regulation by select ASOs.
- GRIN2A RNA in U-138 MG cells Normalized levels of GRIN2A RNA in U-138 MG cells, as measured by bDNA 48 hours after transfection with mock and non-targeting control ASOs (grey) or 10 of the most potent GRIN2A ASOs of each chemistry at both 5 nM and 20 nM doses are presented.
- FIG. 5 shows high concordance of GRIN2A knockdown in cells treated during separate two-dose and ten-dose series.
- 22 ASOs targeting GRIN2A were tested in U138-MG cells as part of a ten-dose series and knockdown was compared with that observed previously in U138-MG cells treated in a two-dose series.
- U138-MG cells were forward transfected with ASOs at either a 5 nM dose or a 20 nM dose (chemistry 1 (skipmer); chemistry 2 (gapmer)) and GRIN2A expression was measured after 48 hours by bDNA assay.
- FIGs. 6A and 6B show dose response of GRIN2A -targeting ASOs in U138-MG cells. 7 distinct ASOs were assayed in U138-MG cells in vitro at 10 doses: 40 nM, 20 nM, 10 nM, 5 nM, 2.5 nM, 1.25 nM, 0.625 nM, 0.3125 nM, 0.15625 nM, and 0.078125 nM.
- U-138 MG cells were treated in 96 well plate format by forward transfection and GRIN2A expression (FIG. 6A) and GAPDH expression (FIG. 6B) was assayed after 48 hours by bDNA assay. ASO treatments were normalized to control transfected cells.
- the ASOs shown in the data include: an ASO comprising the nucleotide sequence of SEQ ID NO: 1, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 2 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 106, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 107 of Table 1; an ASO comprising the nucleotide sequence of SEQ ID NO: 136, a gapmer structure , and the chemical modifications as set forth in Columns A and B of row 137 of Table 1; and an ASO comprising the nucleotide sequence of SEQ ID NO: 230, a skipmer structure, and the chemical modifications as set forth in Columns A and B of row 231 of Table 1.
- FIGs. 7A-7G show representative data for in vitro dose-dependent reduction of GRIN2A mRNA in IPS-derived glutaminergic neurons.
- FIG. 7A shows RT-qPCR results from screening of GRIN2A ASOs comprising skipper or gapmer chemistries.
- FIG. 7B shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 237, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 238 of Table 1.
- FIG. 7A shows RT-qPCR results from screening of GRIN2A ASOs comprising skipper or gapmer chemistries.
- FIG. 7B shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 237, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 238 of Table 1.
- FIG. 7C shows RT-qPCR analyses of GRIN2A dosedependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 251 a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 252 of Table 1.
- FIG. 7D shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 252, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 253 of Table 1.
- FIG. 7E shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 254, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 255 of Table 1.
- FIG. 7F shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) .
- FIG. 1 shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 254, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) .
- FIG. 7G shows RT-qPCR analyses of GRIN2A dose-dependent knockdown using an ASO comprising the nucleotide sequence of SEQ ID NO: 269, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 270 of Table 1.
- FIGs. 8A-8B show in vivo Grin2a expression data from mouse subjects administered ASOs targeting Grin2a mRNA.
- ASO refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein).
- FIG. 8A shows Grin2a mRNA expression in cortex and hippocampus tissue of mouse subjects who received a single intracerebroventricular injection of 100 pg of ASOs.
- FIG. 8B shows Grin2a mRNA expression in cortex and hippocampus tissue of mouse subjects after the last of two intracerebroventricular injections of 50 pg or 100 pg of ASOs.
- Expression analysis data was averaged across 3 technical replicates and shown as a percentage of the vehicle-control group. Each dot represents an animal; bars show mean +/- standard deviation.
- N (# of subjects treated with vehicle/# of subjects treated with ASO) 12/12; 12/12 and 5,5,5 /4,5,5 for cortex/hippocampus in FIG. 8A and FIG. 8B, respectively.
- Statistical analysis was performed using a linear model comparing treatment groups to the vehicle group and adjusting for RNA isolation batch (*:p ⁇ 0.05, **:p ⁇ 0.01, ***:p ⁇ 0.001).
- FIGs. 9A-9B show ASO levels in tissue samples from mouse subjects administered ASOs targeting Grin2a mRNA.
- ASO refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein).
- FIG. 9A shows ASO levels in frontal cortex and hippocampus tissue samples of mouse subjects who received a single intracerebroventricular injection of 100 pg of ASOs, FIG.
- FIG. 9B shows ASO levels in frontal cortex and hippocampus tissues of mouse subjects after the last of two intracerebroventricular injections of 50pg or lOOpg of ASO.
- Expression analyses data was averaged across 3 technical replicates and shown as a percentage of the vehicle-control group. Each dot represents an animal; bars show mean +/- standard deviation.
- N (# of subjects treated with vehicle/# of subjects treated with ASO) 12/12; 12/12 and 5,5,5 /4,5,5 for frontal cortex/hippocampus in FIG. 9A and FIG. 9B, respectively.
- FIGs. 10A-10D show the representative data for silencing of Grin2a in mouse subjects following intracerebroventricular injection of three doses of GRIN2A ASOs.
- ASO refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein).
- FIG. 10A shows a schematic depicting a study design wherein mouse subjects received either vehicle or 100 pg of ASOs via intracerebroventricular injection which was performed at weeks three, four, and five after cannulation.
- FIG. 10C shows the composite data derived from the RT-qPCR analyses of Grin2a mRNA expression in frontal cortex tissue as shown in FIG. 10B (***:p ⁇ 0.001 by linear regression).
- FIGs. 11A-11B show representative data of GRIN2A ASO pharmacokinetics (ASO levels) and pharmacodynamics (Grin2a mRNA expression) in brain tissue samples obtained from mouse subjects.
- ASO refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein), “pg/g” refers to micrograms of ASO per gram of tissue sample.
- 11A is a table showing ASO levels and Grin2a mRNA levels as a result of unilateral intracerebroventricular (“ICV”) injection of ASO into the frontal cortex and hippocampus of mouse subjects. mRNA knockdown is shown as a negative range indicating the percent reduction of Grin2a mRNA levels relative to subjects that underwent ICV injection with vehicle (artificial CSF). *:p ⁇ 0.05, **:p ⁇ 0.01, ***:p ⁇ 0.001. “NS” indicates not statistically significant.
- FIG. 11B shows the correlation (“PK/PD Correlation”) between ASO pharmacokinetics (x-axis; ASO levels) and ASO pharmacodynamics (y-axis; Grin2a mRNA knockdown) in hippocampus tissue samples obtained from injected mouse subjects.
- P value indicates statistical significance of “R” correlation coefficient which were determined from the statistical analysis of the data shown in FIG. 11 A.
- FIG. 12 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of two intrathecal injections of either vehicle (artificial CSF), ASO at a dose of 20 mg (10 mg+10 mg), or ASO at a dose of 40 mg (20 mg+20mg). Each intrathecal injection was performed two weeks apart (days 1 and 14).
- FIGs. 13A-13G show representative ASO pharmacokinetics data (ASO levels) and pharmacodynamics (GRIN2A mRNA expression) in central nervous system tissue samples obtained from non-human primate and mouse subjects injected with ASOs.
- Non-human primate (“NHP”) subjects were administered a series of two intrathecal injections performed two weeks apart, wherein subjects underwent intrathecal injection with either vehicle (artificial CSF), ASO at a “low dose” of 20 mg (10 mg+10 mg), or ASO at a “high dose” of 40 mg (20 mg+20mg).
- Mouse subjects were administered a single intracerebroventricular injection or a series of two intracerebroventricular injections performed one week apart, wherein mouse subjects underwent intracerebroventricular injection with either vehicle (artificial CSF), ASO at a “low dose” of 100 pg (50 pg+50 pg), or ASO at a “high dose” of 200 pg (100 pg+100 pg).
- FIG. 13A shows ASO levels in frontal cortex samples obtained from injected non-human primate subjects (left panel) and injected mouse subjects (right panel). Bars indicate mean +/- standard deviation.
- FIG. 13B shows ASO levels in frontal cortex samples obtained from injected non-human primate subjects (left panel) and injected mouse subjects (right panel).
- FIG. 13C shows ASO levels in hippocampus samples obtained from injected non-human primate subjects (left panel) and mouse subjected (right panel). Bars indicate mean +/- standard error of the mean.
- FIG. 13D shows ASO levels in frontal cortex (“Cortex”), hippocampus, and lumbar spinal cord (“Lumbar SC”) samples obtained from injected non-human primate subjects that received either a low dose (left panel) or a high dose (right panel) of ASO. Bars indicate mean +/- standard deviation.
- FIG. 13E shows RT-qPCR analysis data for GRIN2A mRNA expression in frontal cortex tissue samples obtained from injected non-human primate subjects that that received a high dose of ASO.
- FIG. 13F shows RT- qPCR analysis data which was obtained using two different GRIN2A probes (dark and light shaded bars) measuring GRIN2A mRNA expression in frontal cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a non-specific ASO, or a high dose of ASO or a non-specific ASO.
- GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean +/- standard deviation.
- FIG. 13G shows a comparison of the data in FIG.
- FIG. 13F obtained by RT-qPCR analysis of GRIN2A mRNA expression in frontal cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle, a low dose of ASO, or a high dose of ASO.
- GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean +/- standard deviation. (*): p ⁇ 0.1 by ANOVA.
- FIG. 13H shows RT-qPCR analysis data for GPJN2A mRNA expression in frontal cortex tissue samples obtained from injected non-human primate subjects that that received either a low dose or a high dose of ASO. Bars indicate mean +/- standard error of the mean. *: p ⁇ 0.1 by ANOVA.
- RT-qPCR analysis data which was obtained using two different GPJN2A probes (dark and light shaded bars) measuring GPJN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a non-specific ASO, or a high dose of ASO or a non-specific ASO.
- GPIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean +/- standard deviation.
- FIG. 13J shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) for measuring GRIN2A mRNA expression in sensory cortex tissue samples obtained from injected non-human primate subjects that that received either a low dose or a high dose of ASO. Bars indicate mean +/- standard deviation.
- FIG. 13K shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) measuring GRIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a high dose of ASO.
- FIG. 13L shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) measuring GRIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF) or a high dose of ASO.
- GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean +/- standard deviation. P-values were determined by unpaired T-test.
- FIG. 13L shows RT-qPCR analysis data which was obtained using two different GRIN2A probes (left and right panels) measuring GRIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF) or a high dose of ASO.
- GRIN2A mRNA expression was normalized to PGK1 mRNA expression and shown as percent of vehicle group. Bars indicate mean +/- standard deviation. P
- 13M shows RT-qPCR analysis data which was obtained using two different GPIN2A probes (left and right panels) measuring GPIN2A mRNA expression in sensory cortex tissue of non-human primate subjects harvested after intrathecal injections with either vehicle (artificial CSF), a low dose of ASO or a high dose of ASO.
- FIG. 130 shows a table representation of the data shown in FIGs. 13F-13M. Mean knockdown levels are shown as the percent difference from the vehicle group. Mean knockdown levels were analyzed over a 95% confidence interval (“CI”) (lower and upper limits shown in brackets). P-values associated with the mean knockdown levels as determined from confidence interval analysis are shown in scientific notation.
- the “IDT” probe and the “Thermo” probe corresponds to the dark and light shaded bars, respectively, in FIGs. 13F, 13G, and 131.
- ASO 1 refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 .
- ASO 2 refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1.
- 14A shows a schematic depicting a study design wherein mouse subjects received either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2 via intracerebroventricular injection which was performed at weeks three, four, and five after cannulation. Prior to observations, all mouse subjects received 85 mg/kg pentylenetetrazol. A positive control group was also used wherein mouse subjects received 400 mg/kg of Valproate via intraperitoneal injection.
- FIG. 14B shows latency to death analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14B shows latency to death analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14C shows survival analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14D shows latency to first tonic seizure analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14C shows survival analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14E shows latency to first twitch analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14F shows latency to first clonic seizure/tonic seizure analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- FIG. 14E shows latency to first twitch analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- 14G shows a line plot of seizure scoring data from analyses of mouse subjects after intraperitoneal injection of 400 mg/kg of Valproate or intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2.
- ASO 1 refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1
- ASO 2 refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1.
- FIG. 15A shows RT-qPCR analysis data for Grin2a mRNA expression in cortex tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using a single qPCR probe.
- FIG. 15B shows RT-qPCR analysis of Grin2a mRNA expression in cortex tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using two different qPCR probe sets represented by dark/light shades.
- FIG. 15A shows RT-qPCR analysis data for Grin2a mRNA expression in cortex tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg)
- FIG. 15C shows RT-qPCR analysis of Grin2a mRNA expression in hippocampus tissue of mouse subjects harvested after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using a single qPCR probe.
- FIG. 15D shows RT-qPCR analysis of Grin2a mRNA expression in hippocampus tissue of mouse subjects after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) of ASO 1 or ASO 2. Expression analysis data was obtained using two different qPCR probe sets represented by dark/light shades.
- FIGs. 16A-16B show statistical analyses of representative pharmacodynamics data for silencing of Grin2a in brain tissue samples from mouse seizure model subjects.
- Samples were harvested from mouse subjects after intracerebroventricular injections with either vehicle (artificial CSF) or 300 pg (100 pg + 100 pg + 100 pg) with an ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) or an ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to herein as “ASO 2”).
- FIG. 16A shows RT-qPCR analysis data for Grin2a mRNA expression in cortex tissue samples from mouse seizure models.
- FIG. 16B shows RT-qPCR analysis data for Grin2a mRNA expression in hippocampus tissue samples from mouse seizure models.
- FIGs. 17A-17J show representative immunostimulatory effects of GRIN2A ASO on human peripheral blood mononuclear cells (huPBMCs) that were harvested from healthy donors.
- huPBMCs were either untreated (“mock” and “media”), treated with a cytokine/chemokine response control agent (CL097, TL8-506, R837, XD-01024, poly(l:c), ODN2006, or ODN2006 negative control), or treated with ASO at a concentration of 1 pM, 3pM, or lOpM for 24 hours (indicated on x-axes). Cytokine/chemokine levels were then analyzed using the MSD-U-Plex platform (indicated by y-axes).
- FIG. 17A shows analyses of IFN-a2a levels.
- FIG. 17B shows analyses of IFN-b levels.
- FIG. 17C shows analyses of IL- IB levels.
- FIG. 17D shows analyses of IL-6 levels.
- FIG. 17E shows analyses of IL-10 levels.
- FIG. 17F shows analyses of IP-10 levels.
- FIG. 17G shows analyses of MCP-1 levels.
- FIG. 17H shows analyses of MIP-la levels.
- FIG. 171 shows analyses of MIP-lb levels.
- FIG. 17J shows analyses of TNF-a levels.
- FIG. 18 shows a non-limiting example of a study design wherein non-human primate subjects were administered a series of four intrathecal injections of either vehicle (artificial CSF) or ASO at a dose of 100 mg (30 mg + 30 mg + 20 mg + 20 mg). Each intrathecal injection was performed two weeks apart (days 0, 14, 28 and 42).
- FIG. 19 shows ASO levels in dorsal root ganglion (DRG), hippocampus, lumbar spinal cord, motor cortex, prefrontal cortex, and temporal cortex samples obtained from injected nonhuman primate subjects and assessed by liquid chromatography -tandem mass spectrometry (LC- MS/MS).
- DRG dorsal root ganglion
- hippocampus hippocampus
- lumbar spinal cord motor cortex
- prefrontal cortex prefrontal cortex
- temporal cortex samples obtained from injected nonhuman primate subjects and assessed by liquid chromatography -tandem mass spectrometry (LC- MS/MS).
- Non-human primate subjects received ASO at a dose of 100 mg (30 mg + 30 mg + 20 mg + 20 mg) by intrathecal injection as illustrated in FIG. 18.
- the indicated samples were obtained at two weeks post-final injection of ASO (day 56).
- Each dot represents a sample from obtained from a different non-human primate subject.
- N 2-3 for each of the indicated groups of samples. Bars show mean +/- standard error of the mean.
- ASO 1 refers to an antisense oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1.
- compositions and methods for modulating a level, transcription, splicing, and/or translation of one or more RNA transcripts e.g., mRNA transcripts
- the disclosure is based, in part, on isolated nucleic acids that bind to mRNA transcripts of genes involved in glutamate signaling, for example genes encoding subunits of NMD A receptors, for example GRIN2A.
- compositions of the disclosure are useful for treating diseases or disorders associated with dysregulation of glutamate signaling, such as schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- compositions of the disclosure are useful for treating (e.g., reducing) NMDA receptor-mediated excitotoxicity in a subject in need thereof.
- Glutamate Signaling Glutamate is the anion of glutamic acid and acts as an excitatory neurotransmitter that is involved in modulating a variety of biological processes. Glutamate signals through three different receptor types: AMP A receptors, NMD A receptors, and metabotropic glutamate receptors. Glutamate signaling through NMDA receptors is important for controlling synaptic plasticity and mediating learning and memory functions.
- aspects of the disclosure relate to compositions for altering a level, transcription, splicing, and/or translation of genes associated with glutamate signaling.
- a “gene associated with glutamate signaling” refers to a gene encoding a gene product (e.g., an mRNA, protein, etc.) that is genetically, biochemically, or functionally associated with the release, reuptake, and or interaction between glutamate and a glutamate receptor (e.g., an NMDA receptor, for example an NMDA receptor comprising at least one GRIN2A subunit) in a cell or subject.
- a gene associated with glutamate signaling is a gene comprising a gain-of-function mutation in an NMDA subunit encoding sequence.
- a gene associated with glutamate signaling is GRIN2A.
- a gene associated with glutamate signaling is a GRIN2A gene comprising a gain-of-function mutation.
- a gene associated with glutamate signaling encodes an mRNA encoding a GRIN2A protein.
- GRIN2A is encoded by the GRIN2A gene, located on chromosome 16 (e.g., encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand).
- GRIN2A encodes the GluN2A component of the NMDA receptor.
- GRIN2A encodes a peptide that is represented by NCBI Reference Sequence NP_000824.1, NP_001127879.1, or NP_001127880.1.
- a GRIN2A gene encodes an mRNA comprising the sequence set forth in NCBI Reference Sequence NM_000833.5, NM_001134407.3, or NM_001134408.2.
- an mRNA is encoded by a GRIN2A gene and comprises one of the sequences set forth below: TCACTGGGAAGGGATGCTAATTGCCTACTTAAGATATAAGTTCAAGAATAACATTTTCATAGAAAATTCAGAAAACT GCTTGACACAGCAGTGACATAGTTAGATGTGGCTCAGATGCCTTCCAAACCTGAGGGTCCCCAAAGATTTCTTTACC AGTTGTTTTTAACTATGAATCTTAATCTTGTTCATTCCCCTGCCAAAACAAATTTAAAAGCATAAACCTGCTGAATT AAT T GGCAGAAT T GAG CAT AGT TAT AT CAC C C CAGAAT GT TAT GT GT AT AT GT T TAT GT AT AGT AT AT AT T T C AAGCTGAATGTTCAGA
- aspects of the disclosure relate to methods for reducing glutamate signaling in subjects having certain psychiatric diseases and disorders.
- the subjects do not have any mutations in either allele of their GRIN2A gene (e.g., the subjects have wild type GRIN2A protein).
- a GRIN2A gene (or an mRNA encoded by a GRIN2A gene) comprises one or more nucleotide substitutions, the one or more nucleotide insertions, and/or the one or more nucleotide deletions relative to a wild type GRIN2A gene (or mRNA encoded by a wild type GRIN2A gene), and may be referred to as a “mutant” GRIN2A gene or a GRIN2A variant.
- the number of nucleotide substitutions, nucleotide insertions, and/or nucleotide deletions in a GRIN2A variant may vary.
- a GRIN2A variant comprises between 1 and 20, 5 and 10, 2 and 15, 10 and 30, or 20 and 100 nucleotide substitutions, nucleotide insertions, and/or nucleotide deletions relative to a wild type GRIN2A gene (or mRNA encoded by a wild type GRIN2A gene).
- the one or more nucleotide substitutions, the one or more nucleotide insertions, and/or the one or more nucleotide deletions results in an amino acid substitution in the protein encoded by the GRIN2A variant.
- the one or more nucleotide substitutions, the one or more nucleotide insertions, and/or the one or more nucleotide deletions results in a nonsense mutation (e.g., insertion of a premature stop codon) in an mRNA encoded by the GRIN2A variant.
- a nonsense mutation e.g., insertion of a premature stop codon
- the one or more nucleotide substitutions, the one or more insertions, and/or the one or more deletions results in a frameshift mutation of the GRIN2A variant relative to a wild type GRIN2A gene.
- a mutation or mutations present in a GRIN2A variant result in the production of one or more splice variants of GRIN2A mRNA.
- a “splice variant” may refer to a mRNA resulting from one or more mutations in a DNA sequence that occur at the boundary of an exon and an intron (splice site) of a gene. Splice site mutations generally disrupt RNA splicing and result in the loss of exons or the inclusion of introns and an altered protein-coding sequence (e.g., a “splice variant”).
- RNA processing modulators e.g., ASOs
- the isolated nucleic acids bind to more or more splice variants of a GRIN2A gene (e.g., a human GRIN2A splice variant).
- an isolated nucleic acid described by the disclosure binds to a region of a GRIN2A splice variant (e.g., mRNA encoded by a GRIN2A variant) selected from an untranslated region (UTR).
- UTR untranslated region
- the UTR is a 5' UTR. In some embodiments, the UTR is a 3' UTR. In some embodiments, the UTR is an intron. In some embodiments, an isolated nucleic acid described by the disclosure binds to an intron-exon boundary of a GRIN2A splice variant (e.g., mRNA encoded by a GRIN2A variant).
- An intron-exon boundary refers to a contiguous nucleotide sequence that includes portions of an intron and exon that are adjacent to one another in the mRNA transcript.
- an isolated nucleic acid binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner).
- a nucleic acid is an isolated nucleic acid.
- nucleic acids are alternatively referred to as oligonucleotides.
- an isolated nucleic acid comprises DNA (e.g., deoxyribonucleotides).
- an isolated nucleic acid comprises RNA (e.g., ribonucleotides).
- an isolated nucleic acid comprises both DNA (e.g., deoxyribonucleotides) and RNA (e.g., ribonucleotides), such as an isolated nucleic acid comprising a gapmer structure that comprises a region of deoxyribonucleotides which are flanked by regions of ribonucleotides.
- An isolated nucleic acid may be single stranded or double stranded.
- the isolated nucleic acid is an RNA oligonucleotide.
- the isolated nucleic acid is a single stranded RNA oligonucleotide (which may also be referred to as a single stranded RNA polynucleotide).
- isolated means artificially produced. Artificial production of an isolated nucleic acid may be achieved, for example, through amplification in vitro through polymerase chain reaction (PCR), recombinant cloning, or chemical synthesis. Methods of synthesizing isolated nucleic acids, for example RNAs, are known in the art, for example as described by Soukchareun et al. Preparation and characterization of antisense oligonucleotidepeptide hybrids containing viral fusion peptides. Bioconjug Chem. 1995 Jan-Feb;6(l):43-53. doi: 10.1021/bc00031a004. PMID: 7711103.
- an isolated nucleic acid may vary.
- an isolated nucleic acid e.g., a single stranded RNA
- an isolated nucleic acid is 10, 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or up to 100 nucleotides in length.
- an isolated nucleic acid ranges from about 1 to 100, 2 to 30, 5 to 20, 10 to 40, or 20 to 80 nucleotides in length.
- an isolated nucleic acid is between 10 and 50 nucleotides in length.
- an isolated nucleic acid is more than 50 nucleotides in length (e.g., 60, 70, 80, 90, 100, etc., nucleotides in length). In some embodiments, an isolated nucleic acid is no greater than 200 nucleotides in length. In some embodiments, an isolated nucleic acid comprises a nucleotide sequence that encodes a full length, wild type GRIN2A protein.
- an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1). In some embodiments, an isolated nucleic acid of the disclosure comprises an antisense oligonucleotide comprising at least 15 nucleotides (e.g., at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides) of the any one of the sequences set forth in SEQ ID NOs: 1-269 (provided in column A of Table 1).
- the one or more modifications is between 1 and 50 modifications, 2 and 20, 5 and 30, 10 and 40, or 15 and 50 modifications.
- an isolated nucleic acid comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,
- an isolated nucleic acid comprises more than 50 modifications (e.g., up to 60, 70, 80, 90, or 100, etc., modifications).
- an isolated nucleic acid comprises chemical modifications on each nucleotide and each sugarphosphate backbone linkage. Such a modified isolated nucleic acid may be referred to as a “fully modified” isolated nucleic acid.
- not all nucleotides of an isolated nucleic acid are modified.
- a chemical modification may comprise a modification of a nucleobase or a nucleotide, and/or a modification of a sugar-phosphate backbone (e.g., modification of one or more sugarphosphate backbone linkages).
- an isolated nucleic acid of the disclosure comprises one or more chemical modification(s) listed in Column B of Table 1. In some embodiments, an isolated nucleic acid of the disclosure comprises a modification pattern (e.g., all of the mutations) listed in a line of Column B of Table 1. In some embodiments, an isolated nucleic acid comprises one or more modifications to a 5' carbon atom (e.g., a 5'-carbon atom of a sugar) and/or one or more modifications to a 5-carbon of a nucleobase.
- a 5' carbon atom e.g., a 5'-carbon atom of a sugar
- nucleic acid modification is targeted to the 6-carbon atom of a nucleobase.
- an isolated nucleic acid comprises one or more modifications to a 6-carbon atom (e.g., a 6-carbon atom of a nucleobase) for example a 6-(2-amino)propyl uridine.
- an isolated nucleic acid comprises one or more modifications to an 8-carbon atom (e.g., an 8-carbon atom of a nucleobase).
- 8 modifications include, but are not limited to, 8-bromo guanosine, 8-chloro guanosine, and 8-fluoroguanosine.
- an isolated nucleic acid comprises one or more modifications to a 2' carbon of the sugar group.
- a modified sugar moiety comprises a hexose and incorporated into an oligonucleotide as described (Augustyns, K., et al., Nucl. Acids. Res. 18:4711 (1992)).
- Other examples of 2' modifications include, but are not limited to, substitutions of the bound OH group with H, OR, R, F, Cl, Br, I, SH, SR, NH, NHR, NR, COOR, or, wherein R is a substituted or unsubstituted aliphatic group.
- R is a substituted or unsubstituted aliphatic group.
- aliphatic includes both saturated and unsaturated, straight chain (i.e., unbranched), branched, acyclic, cyclic, or polycyclic aliphatic hydrocarbons, which are optionally substituted with one or more functional groups.
- “aliphatic” is intended herein to include, but is not limited to, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, and cycloalkynyl moieties.
- an isolated nucleic acid modification a sugar-phosphate backbone modification.
- a phosphate group modifications is substitution of an oxygen atom with a sulfur atom.
- the backbone of the nucleic acid is modified.
- backbone modifications include, but are not limited to, phosphorothioate, borano- phosphate, alkyl phosphonate nucleic acid, peptide nucleic acid, and morpholino. Morpholino backbones are described, for example by Corey and Abrams Genome Biol. 2001; 2(5): reviews 1015.1-reviews 1015.3.
- modified bases include N4,N4-ethanocytosine, 7-deazaxanthosine, 7- deazaguanosine, 8-oxo-N6-methyladenine, 4-acetylcytosine, dihydrouracil, inosine, N6- isopentenyl-adenine, 1 -methyladenine, 1 -methylpseudouracil, 1-methylguanine, 1- methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5- methylcytosine, N6 -methyladenine, 7-methylguanine, 2-methylthio-N6-isopentenyladenine, pseudouracil, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 2-thiocytosine, and 2,6- diaminopurine.
- nucleic acid modifications are described for example by Eckstein, Antisense Nucleic Acid Drug Dev. 2000 Apr. 10(2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. 2000 Oct. 10(5): 333-45, Stein, Antisense Nucleic Acid Drug Dev. 2001 Oct. 11(5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. 2001 Apr. 11(2):77-85, Duffy. BMC Bio. 2020 Sep. 2(8): 112, and US Patent No. US5684143.
- ASOs isolated nucleic acids
- an isolated nucleic acid of the disclosure comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications, such as a modification pattern) from Column B of Table 1, optionally where Columns A and B are from the same row of Table 1.
- compositions e.g., isolated nucleic acids, agents, etc.
- modulate mRNAs encoded by genes associated with glutamate signaling e.g., the gene associated with glutamate signaling is GRIN2A (e.g., a human GRJN2A gene).
- a composition comprises an RNA processing modulator.
- an “RNA processing modulator” or “RPM” refers to an agent that binds to, and up- regulates, down-regulates, or otherwise change function or activity, of a target mRNA (e.g., an mRNA encoded by a gene associated with glutamate signaling, such as GRIN2A, or a gene product, such as a protein encoded by the mRNA) by affecting transcription, levels, splicing, and/or translation of the mRNA.
- a target mRNA e.g., an mRNA encoded by a gene associated with glutamate signaling, such as GRIN2A, or a gene product, such as a protein encoded by the mRNA
- An RNA processing modulator may be an isolated nucleic acid or ASO as described herein.
- an RNA processing modulator is an isolated nucleic acid that affects transcription, levels, splicing, and/or translation of a target mRNA (e.g., an mRNA encoded by a GRIN2A gene).
- an RNA processing modulator is an ASO that affects transcription, levels, splicing, and/or translation of a target mRNA (e.g., an mRNA encoded by a GRIN2A gene).
- an mRNA (e.g., a target mRNA, such as an mRNA encoded by a GRIN2A gene) is a pre-mRNA (e.g., an RNA that has been transcribed from a gene, such as a GRIN2A gene, but has not been processed to remove introns, for example by splicing).
- an mRNA is a mature mRNA that has been processed (e.g., an mRNA transcribed from a GRIN2A gene and that has undergone processing).
- an RNA processing modulator upregulates transcription, levels, splicing, and/or translation of a target mRNA.
- Upregulation of transcription, levels, splicing, and/or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and reducing non-productive splicing or translation initiation from alternative start codons present in the target mRNA, for example through steric blocking of non-productive splice site(s) or alternative start codons (such as “upstream alternative start codons” located in the 5' UTR of the target mRNA), or causing a mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that lacks one or more inhibitory domains.
- a regulatory region e.g., an untranslated region, such as a 5' UTR or 3' UTR
- an RNA processing modulator increases transcription, levels, splicing, and/or translation of a target mRNA transcript (e.g., increases relative to a cell or subject prior to the administration of the RPM, or increases relative to a control cell or subject) between 1-fold and 100-fold, 2-fold and 10-fold, 5- fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween.
- an RNA processing modulator increases transcription, levels, splicing, and/or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400-fold, 500-fold, or 1000-fold. In some embodiments, an RNA processing modulator increases transcription, levels, splicing, and/or translation of a target mRNA transcript no more than 1000-fold. In some embodiments, upregulation of a level, transcription, splicing, and/or translation of a target mRNA is useful to increase expression of a desired (e.g., wild-type) allele encoding the target mRNA.
- a desired e.g., wild-type
- an RNA processing modulator downregulates transcription, levels, splicing, and/or translation of a target mRNA.
- Downregulation of transcription, levels, splicing, and/or translation may comprise binding to a regulatory region (e.g., an untranslated region, such as a 5' UTR or 3' UTR) of a target mRNA and blocking transcription the target mRNA, for example through steric blocking of a transcription initiation site, binding to an mRNA and subsequently initiating RNAse H-mediated degradation (e.g., in the context of a ‘gapmer’ RNA processing modulator), or causing an mRNA frameshift (e.g., a splice variant) resulting in translation of a protein variant from the target mRNA that is inactive, or has reduced function or activity (e.g., enzymatic activity, the ability to interact with other proteins to form protein complexes, etc.).
- a regulatory region e.g., an untranslated region, such
- the resulting protein variant is a dominant negative protein variant.
- downregulation of a level, transcription, splicing, and/or translation of a target mRNA is useful to increase expression of an undesirable (e.g., mutant, or disease-associated) allele encoding a target mRNA.
- an RNA processing modulator decreases transcription, levels, splicing, and/or translation of a target mRNA transcript between 1-fold and 100-fold, 2-fold and 10-fold, 5-fold and 20-fold, 10-fold and 30-fold, 20-fold and 50-fold, or 25-fold and 100-fold, or any value therebetween.
- an RNA processing modulator decreases transcription, levels, splicing, and/or translation of a target mRNA transcript more than 100-fold, for example at least 200-fold, 400- fold, 500-fold, or 1000-fold.
- an RNA processing modulator decreases transcription, levels, splicing, and/or translation of a target mRNA transcript no more than 1000- fold.
- An RNA processing modulator may alter the number and/or character of splice variants of a target mRNA. In some embodiments, an RNA processing modulator increases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA. In some embodiments, an RNA processing modulator decreases (relative to natural transcription or translation of a target mRNA) the number of different splice variants of an mRNA, or the ratio between different splice variants of an mRNA.
- contacting a target mRNA with an RNA processing modulator results in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more splice variants of the target mRNA being transcribed and/or translated. In some embodiments, contacting a target mRNA with an RNA processing modulator results in a single splice variant of the target mRNA being transcribed and/or translated.
- an RNA processing modulator affects splicing of the target mRNA.
- an RNA processing modulator may bind to the target mRNA at a splice junction (e.g., a location spanning an intron-exon boundary) and mediate skipping of one or more exons in the mRNA transcript.
- skipping of one or more exons in the target mRNA results in production of a truncated protein variant of the protein encoded by the target mRNA.
- an RNA processing modulator may bind to the target mRNA at a splice junction and mediate alternative splicing in which an intron is translated, and a protein variant of the target gene is produced.
- an RNA processing modulator binds a target mRNA at a location comprising a coding sequence (e.g., a protein coding sequence or an exon).
- an RNA processing modulator comprises an agent selected from the group consisting of nucleic acid, peptide (including polypeptide), and small molecule.
- small molecule RNA processing inhibitors include but are not limited to translational readthrough-inducing drugs (TRIDs), such as certain aminoglycosides, nonaminoglycoside antibiotics (e.g., negamycin), ataluren (PTC 124), and amlexanox).
- RNA processing modulator comprises an antisense oligonucleotide (ASO).
- ASO antisense oligonucleotide
- antisense nucleic acid refers to a single stranded nucleic acid that has sequence complementarity to a target sequence and is specifically hybridizable, e.g., under stringent conditions, with a nucleic acid having the target sequence.
- An antisense nucleic acid is specifically hybridizable when binding of the antisense nucleic acid to the target nucleic acid is sufficient to produce complementary base pairing between the antisense nucleic acid and the target nucleic acid, and there is a sufficient degree of complementarity to reduce or avoid non-specific binding of the antisense nucleic acid to non-target nucleic acid under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed.
- an ASO is chemically synthesized.
- An ASO may be a DNA polynucleotide, an RNA polynucleotide, or a DNA/RNA polynucleotide (e.g., an ASO comprising a gapmer structure that comprises a region of deoxyribonucleotides flanked by regions comprising ribonucleotides; for example, in some embodiments, a “5-10-5” gapmer comprises a region of 10 deoxyribonucleotides flanked by two ribonucleotide regions each being 5 nucleotides in length).
- Complementary refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an antisense nucleic acid is capable of hydrogen bonding with a nucleotide at the corresponding position of a target nucleic acid (e.g., target RNA), then the antisense nucleic acid and target nucleic acid are considered to be complementary to each other at that position.
- the antisense nucleic acid and target nucleic acid are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides that can hydrogen bond with each other through their bases.
- complementar is a term that is used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the antisense nucleic acid and target nucleic acid. However, it should be appreciated that 100% complementarity is not required.
- an antisense nucleic acid may be at least 80% complementary to (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to) the consecutive nucleotides of a target nucleic acid (e.g., a target nucleic acid comprising an mRNA sequence encoded by any one of SEQ ID NOs: 270-272).
- Sequence identity including determination of sequence complementarity for nucleic acid sequences, may be determined by sequence comparison and alignment algorithms known in the art. To determine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the first sequence or second sequence for optimal alignment). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same residue as the corresponding position in the second sequence, then the molecules are identical at that position.
- an antisense oligonucleotide has a length in a range of 5 to 40 nucleotides, 5 to 30 nucleotides, 10 to 30 nucleotides, 10 to 25 nucleotides, or 15 to 25 nucleotides. In some embodiments of the disclosure, an antisense oligonucleotide comprises a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.
- an antisense nucleic acid comprises a region of complementarity that is perfectly complementary to a portion of a target nucleic acid (e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)).
- a target nucleic acid e.g., 100% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)).
- an antisense nucleic acid comprises less than 100% sequence complementarity with a target nucleic acid (e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)).
- a target nucleic acid e.g., 50%, 60%, 70%, 80%, 90%, 95%, or 99% of the nucleotides of the ASO hybridize to the nucleotides of the target RNA, such as a target mRNA (e.g., an mRNA sequence encoded by any one of SEQ ID NOs: 270-272)).
- an antisense nucleic acid may be designed to ensure that it does not have a sequence (e.g., of 5 or more consecutive nucleotides) that is complementary with an off-target nucleic acid (e.g., an mRNA that is not transcribed from a GRIN2A gene).
- a sequence e.g., of 5 or more consecutive nucleotides
- an off-target nucleic acid e.g., an mRNA that is not transcribed from a GRIN2A gene.
- an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a GRIN2A gene. In some embodiments, an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by the sequence as set forth in any one of SEQ ID NOs: 270-272.
- the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., an mRNA encoded by the sequence set forth in any one of SEQ ID NOs: 270-272).
- a target nucleic acid e.g., an mRNA encoded by the sequence set forth in any one of SEQ ID NOs: 270-272.
- an antisense oligonucleotide comprises a region of complementarity with a 5' UTR, 3' UTR, an exonic sequence, a splice donor sequence, a splice acceptor sequence, or a lariat branch point encoded by a human GRIN2A gene.
- an oligonucleotide binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner).
- an antisense oligonucleotide comprises a region of complementarity with an mRNA encoded by (e.g., transcribed from) a GRIN2A gene.
- an antisense oligonucleotide comprises a region of complementarity with a pre- mRNA sequence encoded by a human GRIN2A gene, for example (e.g., Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand).
- the region of complementarity of the antisense nucleic acid hybridizes with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of a target nucleic acid (e.g., a pre-mRNA encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand).
- a target nucleic acid e.g., a pre-mRNA encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404-10,182,928 reverse strand.
- the antisense oligonucleotide comprises a region of complementarity with at least 6, e.g., at least 7, at least 8, at least 9, at least 10, at least 15 or more consecutive nucleotides of an intron encoded by Ensembl ID NO: ENSG00000183454, Chromosome 16: 9,753,404- 10,182,928 reverse strand.
- ENSG00000183454 the forward strand of such a nucleic acid encoding a pre-mRNA transcript or mRNA transcript may also be targeted.
- an antisense oligonucleotide comprising a region of complementarity with an mRNA transcript encoded by any one of SEQ ID NOs: 270-272 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID NOs: 1-269, as recited in Column A of Table 1.
- an antisense oligonucleotide comprises a nucleotide sequence having one or more mismatches (e.g., one or more bases that is not complementary to the nucleotide at a given position of the target mRNA) relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOs: 270-272.
- an antisense oligonucleotide comprises a sequence having 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches relative to an mRNA transcript encoded by the sequence set forth in any one of SEQ ID NOs: 270-272.
- an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID NOs: 270-272 comprises at least 60% sequence identity (e.g., 60-70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-269, as recited in Column A of Table 1.
- an antisense oligonucleotide comprising at least 60% sequence identity to a sequence of 10 or more contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, or more contiguous nucleotides) of any one of one of the sequences set forth in SEQ ID Nos: 1-269 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the sequence of 10 or more contiguous nucleotides of any one of the sequences set forth in SEQ ID Nos: 1-269.
- nucleotide positions e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion
- an antisense oligonucleotide comprising one or more mismatches relative to an mRNA transcript encoded by any one of SEQ ID Nos: 270-272 comprises at least 60% sequence identity (e.g., 60- 70%, 70-80%, 80-90%, 90-95%, or more than 95% sequence identity) to a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269.
- an antisense oligonucleotide comprising at least 60% sequence identity to a nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269 differs at one or more nucleotide positions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotide positions comprising a substitution, an insertion, or a deletion) relative to the nucleic acid sequence set forth in any one of SEQ ID Nos: 1-269.
- RNA processing modulators e.g., antisense oligonucleotides
- a homogeneous preparation e.g., in which at least 85%, at least 90%, at least 95%, or at least 99% of the RNA processing modulators (e.g., antisense oligonucleotides) are identical.
- a homogeneous preparation is stereo-pure (e.g. diastereomeric).
- homogeneous preparations of antisense oligonucleotides are provided in which at least 85%, at least 90%, at least 95%, or at least 99% of the oligonucleotides in the preparation are 10 to 25 nucleotides in length and comprise a region of complementarity that is complementary with at least 6 contiguous nucleotides of an mRNA transcript encoded by a GRIN2A gene (e.g., a GRIN2A gene encoding an mRNA comprising the nucleic acid sequence set forth in any one of SEQ ID Nos: 270-272).
- a GRIN2A gene e.g., a GRIN2A gene encoding an mRNA comprising the nucleic acid sequence set forth in any one of SEQ ID Nos: 270-272.
- RNA processing modulators e.g., antisense oligonucleotides
- a heterogeneous preparation e.g., comprising at least 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different RNA processing modulators (e.g., antisense oligonucleotides each targeting a different sequence of a GRIN2A mRNA transcript).
- RNA processing modulators e.g., antisense oligonucleotides
- RNA processing modulators e.g., antisense oligonucleotides
- an antisense nucleic acid is modified such that when present in a cell that contains a GRIN2A gene, it is capable of hybridizing with RNA (e.g., an mRNA, such as a mature mRNA or a pre-mRNA) transcribed from the GRIN2A gene without inducing cleavage of the RNA by an RNase.
- RNA e.g., an mRNA, such as a mature mRNA or a pre-mRNA
- an antisense nucleic acid is modified such that when present in a cell that contains a GRIN2A gene, it is capable of hybridizing with RNA transcribed from the GRIN2A gene and inducing cleavage of the RNA by an RNase.
- RNA processing modulators e.g., antisense oligonucleotides, e.g. a nucleic acid comprising the sequence set forth in any one of SEQ ID NOs: 1-269, as recited in column A of Table 1
- RNA processing modulators e.g., antisense oligonucleotides
- an RNA processing modulator (e.g., antisense oligonucleotide) comprises no more than 100 modifications.
- an RNA processing modulator (e.g., antisense oligonucleotide) comprises chemical modifications on each nucleotide and each sugar-phosphate backbone linkage.
- Such a modified RNA processing modulator (e.g., antisense oligonucleotide) may be referred to as a “fully modified” RNA processing modulator (e.g., antisense oligonucleotide).
- a fully modified antisense oligonucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 1-269. In some embodiments, not all of the nucleotides of an antisense oligonucleotide are modified.
- RNA processing modulators may include ribonucleotides, deoxyribonucleotides, and combinations thereof (e.g., RNA processing modulators comprising a gapmer structure).
- modified nucleotides which can be used in antisense nucleic acids include, for example, 5-fluorouracil, 5 -bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6- isopentenyladenine, 1-methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3 -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5
- a modified nucleotide is a 2'-modified nucleotide.
- the 2'-modified nucleotide may be a 2'-deoxy, 2'-fluoro, 2'-O-methyl, 2'-O-methoxy ethyl, 2'- amino or 2'-aminoalkoxy modified nucleotide.
- the 2'-modified nucleotide comprises a 2'-O-4'-C methylene bridge, such as a locked nucleic acid (LNA) nucleotide.
- LNA locked nucleic acid
- RNA processing modulators may include combinations of LNA nucleotides and unmodified nucleotides.
- Antisense nucleic acids may include combinations LNA and RNA nucleotides.
- Antisense nucleic acids may include combinations LNA and DNA nucleotides.
- a further preferred oligonucleotide modification includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring thereby forming a bicyclic sugar moiety.
- LNAs Locked Nucleic Acids
- RNA processing modulators e.g., antisense oligonucleotides
- acids may also include nucleobase-modified nucleotides, e.g., nucleotides containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase.
- Bases may be modified to block the activity of adenosine deaminase, for example.
- antisense oligonucleotides may include non-ionic DNA analogs, such as alkyland aryl-phosphates (in which the charged non-bridging oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated.
- Nucleic acids which contain a diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation and may be used herein.
- antisense nucleic acids may include at least one lipophilic substituted nucleotide analog and/or a pyrimidine-purine dinucleotide.
- RNA processing modulators may have one or two accessible 5' ends. It is possible to create modified oligonucleotides having two such 5' ends, for instance, by attaching two oligonucleotides through a 3 '-3' linkage to generate an oligonucleotide having one or two accessible 5' ends.
- the 3 '-3 '-linkage may be a phosphodiester, phosphorothioate, or any other modified internucleoside bridge.
- 3 '-3 '-linked oligonucleotides where the linkage between the 3' terminal nucleosides is not a phosphodiester, phosphorothioate, or other modified bridge, can be prepared using an additional spacer, such as tri- or tetra-ethylenglycol phosphate moiety.
- a phosphodiester internucleotide linkage of an RNA processing modulator can be replaced with a modified linkage.
- the modified linkage may be selected from, for example, phosphorothioate, phosphorodithioate, NRlR2-phosphoramidate, borano-phosphate, a-hydroxybenzyl phosphonate, phosphate-(Cl-C21) — O-alkyl ester, phosphate-[(C6-C12)aryl-(Cl-C21) — O-alkyl] ester, (Cl-C8)alkylphosphonate and/or (C6- C12)arylphosphonate bridges, and (C7-C12)-a-hydroxymethyl-aryl.
- a triazole ring is used.
- RNA processing modulators e.g., antisense oligonucleotides
- a “gapmer” refers to an antisense oligonucleotide comprising the following formula Xni-(Y)n2-(X)n3, where (X) is a ribonucleotide (e.g., an RNA base) and (Y) is a deoxyribonucleotide (e.g., DNA base), and where each of nl, n2, and n3 are an integer ranging from 1 to 50 (inclusive of all integers therebetween).
- antisense oligonucleotides having a gapmer structure bind (e.g., hybridize) to a target mRNA (e.g., an mRNA encoded by a GRIN2A gene) and induce ribonuclease Hl (RNAseHl)-mediated degradation of the target mRNA.
- a target mRNA e.g., an mRNA encoded by a GRIN2A gene
- RNAseHl ribonuclease Hl
- Gapmer antisense oligonucleotides are known in the art, for example as described by Kasuya et al. Sci Rep. 2016; 6: 30377.
- the number of DNA bases in a gapmer may vary.
- a gapmer comprises between 1 and 10 DNA bases (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 DNA bases).
- a gapmer comprises between 2 and 6 DNA bases (e.g., 2, 3, 4, 5, or 6 DNA bases).
- the DNA bases of a gapmer antisense oligonucleotide may be positioned toward to 5' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 5' terminal nucleotide of the ASO), toward the 3' end of the ASO (e.g., within 1, 2, 3, 4, 5, etc. nucleotides of the 3' terminal nucleotide of the ASO), or in the middle of the ASO (e.g., having an equal number of RNA bases flanking the DNA bases).
- an RNA processing modulator e.g., antisense oligonucleotide
- oligonucleotide reagents of the disclosure also may be modified with chemical moi eties (e.g., cholesterol) that improve the in vivo pharmacological properties of the RNA processing modulator.
- a functional group comprises a peptide, small molecule, sugar, lipid, nucleic acid, or combination of any of the foregoing.
- Table 1 Representative RPMs targeting GRIN2A 245 ACTAGGCATTTTCTTGTACA Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end
- an RNA processing modulator (e.g., an antisense oligonucleotide) comprises at least 18 continuous nucleotides (e.g., comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 nucleotides) of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1).
- an RNA processing modulator consists of 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1.
- an RNA processing modulator comprises 18 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “18mers” in Column B of the same row in Table 1 and comprises one additional nucleotide (either at the 5' end or 3' end) or two additional nucleotides (either both at the 5' end, both at the 3' end, or one at the 5' end and the other at the 3' end) which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 18 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1.
- an RNA processing modulator consists of 19 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one additional nucleotide either at the 5' end or 3' end which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1.
- an RNA processing modulator comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1.
- an RNA processing modulator comprises 20 continuous nucleotides of any one of the nucleic acid sequences set forth in Column A of Table 1 which are labeled “20mers” in Column B of the same row in Table 1 and comprises one or more additional nucleotides either at the 5' end, at the 3' end, or both the 5' end and the 3' end which are complementary to a target sequence in a GRIN2A mRNA that hybridizes to the 20 continuous nucleotides of the nucleic acid sequence selected from Column A of Table 1.
- an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1.
- an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1) comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 1.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 106. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 134. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 136. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 234.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 237. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 251. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 252. In some embodiments, the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 269.
- an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and/or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and/or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.
- a GRIN2A mRNA e.g., a mature mRNA
- an RNA processing modulator comprising the at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1, 106, 134, 136, 234, 237, 251, 252, 254, and 269 reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and/or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and/or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.
- a GRIN2A mRNA e.g., a mature mRNA or a pre-mRNA
- a GRIN2A protein
- an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue.
- an RNA processing modulator comprises or consists of 18 continuous nucleotides, comprises or consists of 19 continuous nucleotides, or comprises or consists of 20 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (see Column A of Table 1), wherein each position comprising a “T” residue is substituted for a “U” residue.
- an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises one or more chemical modifications as set forth in any one of the rows in Column B of Table 1.
- an RNA processing modulator comprising at least 18 continuous nucleotides of any one of the nucleic acid sequences set forth in SEQ ID NOs: 1-269 (e.g., an ASO comprising or consisting of 18 nucleotides, 19 nucleotides, or 20 continuous nucleotides of any one of the nucleic acid sequences shown in Column A of Table 1), wherein one or more of positions comprising a “T” residue is substituted for a “U” residue and wherein the RNA processing modulator comprises a pattern of chemical modifications as set forth in any one of the rows in Column B of Table 1.
- one or more positions in an RNA processing modulator comprising “U” residues comprises a uracil nitrogenous base or a chemically modified uracil nitrogenous base described herein and a deoxyribose sugar or a chemically modified deoxyribose sugar described herein.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 1, wherein one or more of positions in SEQ ID NO: 1 comprising a “T” residue (e.g., each position in SEQ ID NO: 1 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 106, wherein one or more of positions in SEQ ID NO: 106 comprising a “T” residue (e.g., each position in SEQ ID NO: 106 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 134, wherein one or more of positions in SEQ ID NO: 134 comprising a “T” residue (e.g., each position in SEQ ID NO: 134 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 136, wherein one or more of positions in SEQ ID NO: 136 comprising a “T” residue (e.g., each position in SEQ ID NO: 136 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 234, wherein one or more of positions in SEQ ID NO: 234 comprising a “T” residue (e.g., each position in SEQ ID NO: 234 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 237, wherein one or more of positions in SEQ ID NO: 237 comprising a “T” residue (e.g., each position in SEQ ID NO: 237 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 251, wherein one or more of positions in SEQ ID NO: 251 comprising a “T” residue (e.g., each position in SEQ ID NO: 251 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 252, wherein one or more of positions in SEQ ID NO: 252 comprising a “T” residue (e.g., each position in SEQ ID NO: 252 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 254, wherein one or more of positions in SEQ ID NO: 254 comprising a “T” residue (e.g., each position in SEQ ID NO: 254 comprising a “T” residue) is substituted for a “U” residue.
- the at least 18 continuous nucleotides comprised in an RNA processing modulator are set forth in the nucleic acid sequence of SEQ ID NO: 269, wherein one or more of positions in SEQ ID NO: 269 comprising a “T” residue (e.g., each position in SEQ ID NO: 269 comprising a “T” residue) is substituted for a “U” residue.
- an RNA processing modulator e.g., an antisense oligonucleotide
- 1, 2, 3, or 4 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification.
- 1, 2, 3, or 4 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage.
- 1-10 deoxyribose sugars e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars
- 1-10 deoxyribose sugars comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage.
- one or more ribose sugars comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage.
- 16 out of the 18 positions are linked by phosphorothioate linkages.
- 16 out of the 18 positions are linked by phosphorothioate linkages, wherein the second position is linked to the third position (relative to the 5' terminal end) by a phosphodiester linkage and the sixteenth position is linked to the seventeenth position (relative to the 5' terminal end) by a phosphodiester linkage.
- an RNA processing modulator e.g., an antisense oligonucleotide
- an RNA processing modulator comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 134.
- an RNA processing modulator e.g., an antisense oligonucleotide comprising the gapmer structure comprises or consists of 18 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 136.
- an RNA processing modulator comprising the gapmer structure reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and/or a GRIN2A protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and/or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.
- a GRIN2A mRNA e.g., a mature mRNA or a pre-mRNA
- a GRIN2A protein by 50% or more (e.g., 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or
- an RNA processing modulator e.g., an antisense oligonucleotide
- 1, 2, 3, 4, or 5 ribonucleotides in each of the regions flanking the region of 10 deoxyribonucleotides comprise a 2'-O-methoxy ethyl (- OCH2CH2OCH3 (2' MOE)) modification.
- 1, 2, 3, 4, or 5 ribose sugars comprised in each region flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage or a phosphodiester linkage.
- 1-10 deoxyribose sugars e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deoxyribose sugars
- 1 deoxyribose sugars comprised in the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage.
- one or more ribose sugars comprised in each of the regions flanking the region of 10 deoxyribonucleotides is linked by a phosphorothioate linkage.
- 18 out of the 20 positions are linked by phosphorothioate linkages.
- 18 out of the 20 positions are linked by phosphorothioate linkages, wherein the second position and third position (relative to the 5' terminal end) are linked by a phosphodiester linkage and the seventeenth position and eighteenth position (relative to the 5' terminal end) are linked by a phosphodiester linkage.
- an RNA processing modulator e.g., an antisense oligonucleotide comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 234.
- an RNA processing modulator e.g., an antisense oligonucleotide comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 252.
- an RNA processing modulator e.g., an antisense oligonucleotide comprising the gapmer structure comprises or consists of 20 continuous nucleotides of the nucleic acid sequence of SEQ ID NO: 254.
- an RNA processing modulator comprising the gapmer structure reduces the levels of a GRIN2A mRNA (e.g., a mature mRNA or a pre-mRNA) and/or a GRIN2A protein by 50% or more (e.g., 50-60%, 60- 70%, 70-80%, 80-90%, 90-95%, or 95-100%) in a cell or one or more tissues, such as a cell or one or more tissues (e.g., cerebrospinal fluid, plasma, and/or a brain tissue) in a subject when the RNA processing modulator or a composition thereof is administered to the subject in an effective amount.
- a GRIN2A mRNA e.g., a mature mRNA or a pre-mRNA
- a GRIN2A protein e.g., 50-60%
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 1 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 2 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 3 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 4 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 5 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 6 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 7 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 8 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 9 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 10 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 11 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 12 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 13 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 14 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 15 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 16 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 17 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 18 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 19 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 20 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 21 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 22 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 23 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 24 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 25 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 26 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 27 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 28 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 29 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 30 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 31 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 32 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 33 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 34 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 35 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 36 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 37 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 38 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 39 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 40 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 41 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 42 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 43 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 44 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 45 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 46 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 47 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 48 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 49 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 50 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 51 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 52 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 53 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 54 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 55 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 56 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 57 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 58 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 59 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 60 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 61 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 62 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 63 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 64 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 65 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 66 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 67 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 68 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 69 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 70 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 71 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 72 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 73 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 74 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 75 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 76 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 77 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 78 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 79 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 80 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 81 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 82 and the following modification pattern: Full PS; 2'MOE;
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 83 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 84 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 85 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 86 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 87 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 88 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 89 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 90 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 91 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 92 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 93 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 94 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 95 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 96 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 97 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 98 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 99 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 100 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 101 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 102 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 103 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 104 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 105 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 106 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 107 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 108 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 109 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 110 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 111 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 112 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 113 and the following modification pattern: Full PS;
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 114 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 115 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 116 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 117 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 118 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10- 5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 119 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 120 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 121 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 122 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 123 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 124 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 125 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 126 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 127 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 128 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 129 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 130 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 131 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 132 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 133 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 134 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 135 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 136 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 137 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 138 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 139 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 140 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 141 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 142 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 143 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 144 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 145 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 146 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 147 and the following modification pattern: Full PS; 2'MOE; 20mer; 5- 10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 148 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 149 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 150 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 151 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 152 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 153 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 154 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 155 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 156 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10-5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 157 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 158 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 159 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 160 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5; PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 161 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 162 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 163 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 164 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 165 and the following modification pattern: Full PS;
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 166 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 167 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 168 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 169 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 170 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 171 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 172 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 173 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 174 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 175 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 176 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 177 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 178 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 179 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 180 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 181 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 182 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 183 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 184 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 185 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 186 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 187 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 188 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 189 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 190 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 191 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 192 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 193 and the following -n - modification pattern: Full PS; 2'MOE; 18mer; 4-10-4, PO after 2nd from 5' end, PO after 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 194 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 195 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 196 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 197 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 198 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 199 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 200 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 201 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 202 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 203 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 204 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 205 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 206 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 207 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 208 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10- 4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 209 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 210 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 211 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 212 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 213 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 214 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 215 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10- 4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 216 and the following modification pattern: Full PS; 2'MOE; 18mer; 4-10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 217 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 218 and the following modification pattern: Full PS; 2'MOE; 18mer; 4- 10-4.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 219 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 220 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 221 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 222 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer 5-10- 5; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 223 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 224 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 225 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 226 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 227 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 228 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 229 and the following modification pattern: Full PS; 2'MOE; 18mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 230 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 231 and the following modification pattern: Full PS; 2'MOE; 20mer; 5-10-5.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 232 and the following modification pattern: Full PS; 2'MOE; 18mer; gapmer 4-10-4; PO at 2nd from 5' end, PO at 3rd position from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 233 and the following modification pattern: Full PS; 2'MOE; 20mer.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 234 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 235 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 236 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 237 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 238 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 239 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 240 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 241 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 242 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 243 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 244 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 245 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 246 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 247 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 248 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 249 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 250 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 251 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 252 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 253 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 254 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 255 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 256 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 257 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 258 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 259 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 260 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 261 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 262 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 263 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 264 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 265 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 266 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 267 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 268 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- an isolated nucleic acid (e.g., an RNA processing modulator, such as an antisense oligonucleotide) comprises the nucleic acid sequence set forth in SEQ ID NO: 269 and the following modification pattern: Full PS; 2'MOE; 20mer; gapmer; 5-10-5; PO after 2nd base from 5' end, PO after 3rd base from 3' end.
- RNA processing modulators e.g., antisense oligonucleotides
- the compositions are designed to enhance the therapeutic effect of the RNA processing modulators, for example by increasing biocompatibility, targeting the RNA processing modulator to a site of interest in vivo, reducing clearance of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing the stability of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo, increasing uptake of an isolated nucleic acid (e.g., an antisense oligonucleotide) in target cells, or amplifying the intended effect of an isolated nucleic acid (e.g., an antisense oligonucleotide) in vivo.
- an isolated nucleic acid e.g., an antisense oligonucleotide
- the RNA processing modulator e.g., antisense oligonucleotide
- a pharmaceutically acceptable carrier means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound useful within the invention within or to the patient such that it may perform its intended function.
- RNA processing modulator e.g., antisense oligonucleotide
- the RNA processing modulators may be used in methods of modulating transcription, translation, function, or activity of genes associated with glutamate signaling, e.g. in a cell or subject.
- the RNA processing modulators may also be used in methods for reducing NMDA receptor-mediated exci totoxi city in a subject.
- RNA processing modulators may be used in methods of preventing or treating a psychiatric disease or disorder in a subject in need thereof.
- the methods comprise administering a composition comprising one or more RNA processing modulators (e.g., 1, 2, 3, 4, 5, or more RNA processing modulators, for example 1, 2, 3, 4, 5, or more antisense oligonucleotides) to a cell or subject.
- administration of the compositions results in decreased sensitivity to glutamate in the cell or subject, or alteration of levels of one or more biological products dependent upon glutamate signaling in the subject.
- the cell may be in vivo, ex vivo, or in vitro.
- RNA processing modulator e.g., an antisense oligonucleotide
- administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting GRIN2A mRNA results in a decrease of glutamate signaling in the cell or subject.
- administration of an RNA processing modulator (e.g., an antisense oligonucleotide) targeting GRIN2A mRNA results in an increase of glutamate signaling in the cell or subject.
- the disclosure is based, in part, on the recognition that contacting a cell or subject with an RNA processing modulator that decreases transcription, translation, function or activity of GRIN2A protein results in decreased glutamate signaling and/or reduction of exci totoxi city (e.g., NMDA receptor-mediated exci totoxi city) in the subject.
- exci totoxi city e.g., NMDA receptor-mediated exci totoxi city
- NMDA receptor-mediated exci totoxi city refers to a condition in which neuronal dysfunction and death occur due to uncontrolled activation of NMDA receptor signaling and high levels of excitatory postsynaptic potentials.
- the disclosure provides a method for decreasing glutamate signaling in a cell or subject, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.
- the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269.
- the isolated nucleic acid e.g., antisense oligonucleotide
- the isolated nucleic acid is administered as a monotherapy.
- the isolated nucleic acid e.g., antisense oligonucleotide
- the isolated nucleic acid e.g., antisense oligonucleotide
- the isolated nucleic acid is administered as a component of a combination therapy with one or more additional therapeutic agents (e.g., one or more selective serotonin reuptake inhibitors (SSRIs), other antidepressants, or antipsychotics).
- additional therapeutic agents e.g., one or more selective serotonin reuptake inhibitors (SSRIs), other antidepressants, or antipsychotics.
- SSRIs selective serotonin reuptake inhibitors
- it is desirable to decrease glutamate signaling e.g., by reducing GRIN2A levels, transcription, splicing, and/or translation
- certain subjects e.g., subjects having certain psychiatric diseases or disorders, for example diseases associated with NMDA receptor- mediated exci totoxi city.
- the disclosure provides a method for increasing glutamate signaling in a cell or subject (e.g., by increasing GRIN2A levels, transcription, splicing, and/or translation), the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.
- the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).
- an isolated nucleic acid binds to an mRNA expressed from a particular allele of GRIN2A (e.g., binds to a target mRNA in an allele-specific manner).
- RNA processing modulators e.g., antisense oligonucleotides
- RNA processing modulators e.g., antisense oligonucleotides described by the disclosure are useful for treating a disease or disorder associated with dysregulation of glutamate signaling.
- RNA processing modulators e.g., antisense oligonucleotides described by the disclosure for use in a method of treating a disease or disorder associated with dysregulation of glutamate signaling.
- a disease or disorder associated with dysregulation of glutamate signaling refers to a disease or disorder in which the subject (e.g., patient) is 1) characterized as having dysfunctional glutamate signaling, and/or 2) has one or more mutations in one or more genes associated with glutamate signaling, and/or 3) has one or more mutations in one or more genes that are involved in a biological pathway that utilizes glutamate (e.g., release of other neurotransmitters, paracrine signaling, etc.).
- a glutamate level of a subject is determined by measuring the concentration of glutamate in a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc.
- a biological sample obtained from the subject, for example a blood sample, serum sample, cerebrospinal fluid (CSF) sample, etc.
- a subject has one or more mutations in a GRIN2A gene. In some embodiments, a subject having one or more mutations in a GRIN2A gene has (or is at risk of developing) a psychiatric disease or disorder.
- Methods of detecting mutations in a subject’s genes are known in the art and include, for example DNA sequencing, RNA sequencing, microarray analysis, etc.
- the disclosure provides a method for treating a disease or disorder associated with glutamate signaling, the method comprising administering an isolated nucleic acid as described herein to a subject in need thereof.
- an RNA processing modulator e.g., antisense oligonucleotide
- the method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof.
- the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).
- the disease is a psychiatric disease or disorder.
- the disease is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- the disease is a disease associated with seizures, for example Rett’s syndrome, Fragile X syndrome, etc.
- RNA processing modulators e.g., antisense oligonucleotides
- Dysregulated NMDA receptor-mediated excitotoxicity can be present in a subject having or suspected of having a psychiatric disease or disorder.
- the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drugresistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- schizophrenia e.g., treatment resistant schizophrenia
- depression e.g., treatment resistant depression, major depressive disorder, etc.
- AD Alzheimer’s disease
- PD Parkinson’s disease
- epilepsy e.g., refractory epilepsy,
- the method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof (e.g., a subject characterized as having or suspected of having dysregulated NMDA receptor-mediated excitotoxicity, such as a subject having or suspected of having a psychiatric disease or disorder).
- the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).
- administering an isolated nucleic acid as described herein to a subject characterized as having or suspected of having dysregulated NMDA receptor-mediated excitotoxicity is used to treat the subject (e.g., to treat the subject for a psychiatric disease or disorder).
- RNA processing modulators e.g., antisense oligonucleotides described by the disclosure for use in a method of preventing or treating a psychiatric disease or disorder in a subject.
- the psychiatric disease or disorder is schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain-of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevelopmental disorders, etc.).
- the method may comprise administering an isolated nucleic acid as described herein to a subject in need thereof.
- the isolated nucleic acid comprises an antisense oligonucleotide comprising the sequence set forth in any one of SEQ ID NOs: 1-269 (provided in column A of Table 1, optionally comprising one or more modifications in column B of Table 1, and optionally wherein the sequence in column A and the chemistry in column B are provided in the same row of Table 1).
- the disclosure provides a method for treating a subject having or suspected of having a disease caused by dysregulated glutamate signaling.
- Treatment of a subject involves administration of a composition to the subject (e.g., an RNA processing modulator, such as an antisense oligonucleotide) as described herein.
- treating refers to the application or administration of a composition (e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein) to a subject who has a disease or disorder associated with high levels of glutamate, or with dysregulation of glutamate signaling, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disorder, the symptom of the disease, or the predisposition toward the disease.
- a composition e.g., an RNA processing modulator, such as an antisense oligonucleotide as described herein
- Alleviating a disease associated with glutamate signaling includes delaying the development or progression of the disease, or reducing disease severity. Alleviating the disease does not necessarily require curative results. As used therein, "delaying" the development of a disease (such as a disease associated with glutamate signaling) means to defer, hinder, slow, retard, stabilize, and/or postpone progression of the disease. This delay can be of varying lengths of time, depending on the history of the disease and/or individuals being treated.
- a method that "delays" or alleviates the development of a disease, or delays the onset of the disease is a method that reduces probability of developing one or more symptoms of the disease in a given time frame and/or reduces extent of the symptoms in a given time frame, when compared to not using the method. Such comparisons are typically based on clinical studies, using a number of subjects sufficient to give a statistically significant result.
- “Development” or “progression” of a disease means initial manifestations and/or ensuing progression of the disease. Development of the disease can be detectable and assessed using standard clinical techniques as well known in the art. However, development also refers to progression that may be undetectable. For purpose of this disclosure, development or progression refers to the biological course of the symptoms. “Development” includes occurrence, recurrence, and onset. As used herein "onset” or “occurrence” of a disease associated with high glutamate levels and/or dysregulation of glutamate signaling.
- a subject may be a human, a mouse, a rat, a pig, a dog, a cat, or a non-human primate.
- a subject has or is suspected of having a disease or disorder associated with high glutamate levels and/or dysregulation of glutamate signaling.
- a subject having a disease or disorder associated with high glutamate levels and/or dysregulation of glutamate signaling comprises at least one GRIN2A allele having a mutation.
- a GRIN2A allele having a mutation comprises a frameshift mutation, a splice site mutation, a missense mutation, a truncation mutation or a nonsense mutation.
- a subject may have two GRIN2A alleles having the same mutations (homozygous state) or two GRIN2A alleles having different mutations (compound heterozygous state).
- RNA processing modulators e.g., antisense oligonucleotides
- administration refers to contacting cells with an RNA processing modulator and can be performed in vitro or in vivo.
- compositions e.g., pharmaceutical compositions
- administration comprises administration to cerebral spinal fluid, and/or direct administration to an affected site (e.g., a target tissue, for example central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue).
- a target tissue for example central nervous system (CNS) tissue, or peripheral nervous system (PNS) tissue.
- CNS central nervous system
- PNS peripheral nervous system
- administration e.g., injection
- compositions are administered to a subject through only one administration route.
- multiple administration routes may be exploited (e.g., serially, or simultaneously) for administration of the composition to a subject.
- RNA processing modulators e.g., antisense oligonucleotides
- CNS CNS all cells and tissue of the brain and spinal cord of a vertebrate.
- the term includes, but is not limited to, neuronal cells, glial cells, astrocytes, cerebrospinal fluid (CSF), interstitial spaces, bone, cartilage and the like.
- RNA processing modulators e.g., antisense oligonucleotides
- the disclosure may be delivered directly to the CNS or brain by injection into, e.g., the ventricular region, as well as to the striatum (e.g., the caudate nucleus or putamen of the striatum), spinal cord and neuromuscular junction, or cerebellar lobule, with a needle, catheter or related device, using neurosurgical techniques known in the art, such as by stereotactic injection (see, e.g., Stein et al., J Virol 73:3424-3429, 1999; Davidson et al., PNAS 97:3428-3432, 2000; Davidson et al., Nat. Genet. 3:219-223, 1993; and Alisky and Davidson, Hum. Gene Ther.
- RNA processing modulators e.g., antisense oligonucleotides
- the disclosure are administered by intravenous injection.
- the RNA processing modulators e.g., antisense oligonucleotides
- the disclosure are administered by intracerebral injection.
- the RNA processing modulators e.g., antisense oligonucleotides
- the disclosure are administered by intracerebroventricular (ICV) injection.
- the RNA processing modulators e.g., antisense oligonucleotides of the disclosure are administered by intrathecal injection.
- the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered by intrastriatal injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by intracranial injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cisterna magna injection. In some embodiments, the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are delivered by cerebral lateral ventricle injection.
- RNA processing modulators e.g., antisense oligonucleotides
- RNA processing modulators e.g., antisense oligonucleotides of the disclosure may be administered to a subject once (e.g., a single dose) or more than once (e.g., as multiple doses).
- the RNA processing modulators e.g., antisense oligonucleotides
- the RNA processing modulators are administered to a subject one time by any administration method described herein.
- the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than one time by any administration method described herein.
- the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject one, two, three, four, five, six, or more times by any administration method described herein.
- the RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are administered to a subject more than six times (e.g., seven , eight, nine, ten, or more times) by any administration method described herein.
- RNA processing modulators e.g., antisense oligonucleotides
- the time between each administration may be on the order of hours, days, or weeks.
- multiple administrations of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure are performed on the same day (e.g., one, two, three, four, five, six, seven, eight, etc. hours apart).
- RNA processing modulators e.g., antisense oligonucleotides
- the time between each administration may be equal or different.
- the time between each administration may be determined by the levels of glutamate signaling, GRIN2A mRNA, GRIN2A protein, or symptoms of the subject or any combination thereof using methods described herein.
- RNA processing modulators e.g., antisense oligonucleotides
- administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed before, during, and/or after the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and/or altered GRIN2A activity.
- RNA processing modulators e.g., antisense oligonucleotides
- administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed hours, days, weeks, or years after the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and/or altered GRIN2A activity.
- RNA processing modulators e.g., antisense oligonucleotides
- administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed throughout the duration that a subject is being administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and/or altered GRIN2A activity.
- RNA processing modulators e.g., antisense oligonucleotides
- administration of RNA processing modulators (e.g., antisense oligonucleotides) of the disclosure to a subject may be performed hours, days, weeks, or years before the subject has been administered other treatments for diseases or disorders associated with dysfunctional glutamate signaling, altered NMDA receptor levels, altered NMDA receptor activity, altered GRIN2A levels, and/or altered GRIN2A activity.
- the other treatment for the disease or disorder is a treatment for schizophrenia (e.g., treatment resistant schizophrenia), depression (e.g., treatment resistant depression, major depressive disorder, etc.), Alzheimer’s disease (AD), Parkinson’s disease (PD), or epilepsy (e.g., refractory epilepsy, drug-resistant epilepsy, genetic epilepsy (such as epilepsy seen in patients with gain- of-function mutations in GRIN2A or other NMD AR subunits), severe focal epilepsy, generalized epilepsies (such as Lennox Gastaut Syndrome) and diseases associated with seizures, for example Rett’s syndrome, Fragile X syndrome, tuberous sclerosis, neurofibromatosis type 1 (NF1), other genetic neurodevel opmental disorders, etc.).
- schizophrenia e.g., treatment resistant schizophrenia
- depression e.g., treatment resistant depression, major depressive disorder, etc.
- AD Alzheimer’s disease
- PD Parkinson’s disease
- epilepsy e.g.,
- Non-limiting examples of treatments for schizophrenia include antipsychotics, Seroquel, Chlorpromazine, Invega, Latuda, Perphenazine, Trifluoperazine, Brexpiprazole, Risperidone, Olanzapine, Haolperidol, Fluphenazine, Saphris, Molindone, Clozaril, Aripiprazole, Geodon, Loxapine, Fanapt, Cariprazine, Thiothixene, Fluphenazine decanoate, and any brand name or generic (e.g., non-brand name) version thereof.
- Non-limiting examples of treatments for depression include selective serotonin reuptake inhibitors (SSRIs) (e.g., fluoxetine, paroxetine, fluvoxamine, citalopram, escitalopram, sertraline, etc.), selective norepinephrine reuptake inhibitors (SNRIs) (e.g., venlafaxine, duloxetine, levomilnacipran, desvenlafaxine, etc.), norepinephrine and dopamine reuptake inhibitors (NDRIs) (e.g., bupropion), noradrenergic and specific serotonergic antidepressant (e.g., mirtazapine), non- selective cyclic (e.g., amitriptyline, imipramine, desipramine, nortriptyline, trimipramine, clomipramine, etc.), monoamine oxidase inhibitors (MAO)
- Non-limiting examples of treatments for Alzheimer’s Disease include Donepezil, Rivastigmine, Galantamine, Memantine, combination of Memantine and Donepezil, Aducanumab, Lacanemab and generic (e.g., non-brand name) version thereof.
- Non-limiting examples of treatments for Parkinson’s Disease include Levodopa, catechol-O-methyltransferase inhibitors, Cogentin, Azilect, Neupro, Safinamide, dopamine agonists, anticholinergics, Ropinirole, Trihexyphenidyl, Entacapone, Amantadine, Selegiline, Carbidopa, combination of Carbidopa and Levodopa, Tolcapone, and any brand name or generic (e.g., non-brand name) version thereof.
- Non-limiting examples of treatments for epilepsy include Gabapentin, Lamotrigine, Levetiracetam, Oxcarbazepine, Ethosuximide, Lyrica, Gabtril, Perampanel, Phenytoin, Valproic acid, Topiramate, Clonazepam, Lacosamide, Felbatol, Rufinamide, Acetazolamide, Phenobarbital, Carbamazepine, anticonvulsants, Zonisamide, Primi
- a disease or disorder associated with dysregulation of glutamate signaling is refractory epilepsy.
- a disease or disorder associated with dysregulation of glutamate signaling is drug-resistant epilepsy.
- a subject having or suspected of having refractory epilepsy or drug-resistant epilepsy is characterized as being resistant to a treatment for epilepsy, such as Gabapentin, Lamotrigine, Levetiracetam, Oxcarbazepine, Ethosuximide, Lyrica, Gabtril, Perampanel, Phenytoin, Valproic acid, Topiramate, Clonazepam, Lacosamide, Felbatol, Rufinamide, Acetazolamide, Phenobarbital, Carbamazepine, anticonvulsants, Zonisamide, Primidone, Clobazam, Vigabatrin, Eslicarbazepine acetate, and any brand name or generic (e.g., non-brand name) version
- an effective amount e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA
- an effective amount of an RNA processing modulator e.g., antisense oligonucleotide
- an effective amount of an RNA processing modulator is an amount sufficient to increase transcription, translation, function, or activity of a target mRNA (e.g., of a desired mutant, variant, and/or allele).
- an effective amount of an RNA processing modulator e.g., antisense oligonucleotide
- is an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA e.g., of an undesired mutant, variant, and/or allele.
- an effective amount will depend primarily on factors such as the species, age, weight, health of the subject, and the tissue to be targeted, and may thus vary among animal and tissue. In some embodiments, an effective amount can be a combination of an effective dosage, frequency, and duration for administration. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1 ng-100 mg. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-1000 ng.
- an effective amount of (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 1-10, 10-50, 50-100, 100- 200, 200-300, 300-500, 500-750, or 750-1000 ng. In some embodiments, an effective amount (e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA) is 0.1 pg-100.0 pg.
- an effective amount e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA
- an effective amount is 1 pg-1000 pg.
- an effective amount e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA
- an effective amount is 100-250, 250-500, 500-750, or 750-1000 pg.
- an effective amount e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA
- an effective amount e.g., an amount sufficient to increase transcription, translation, function, or activity of a target mRNA or an amount sufficient to decrease transcription, translation, function, or activity of a target mRNA
- an effective amount is 0.1-1.0, 1.0-20.0, 20.0-50.0, 50.0-200.0, or 200.0-500.0 mg.
- administration of the composition may be altered or adjusted accordingly.
- expression of the protein encoded by the nucleic acid targeted by the isolated nucleic acid of the pharmaceutical composition may be monitored to inform methods of use of the composition.
- Expression information may be obtained, for example, through measuring changes in the levels of the protein or RNA products of the target nucleic acid.
- sequencing analyses of the target nucleic acid may be employed to determine if expression changes include alterations in the structure or sequence of the protein or RNA product of the target nucleic acid sequence.
- the amount of the composition will vary depending on a number of factors such as, but not limited to, clinical features (e.g. disease severity, rate of disease progression, physical characteristics, etc.) of a subject and the mode of administration. Accordingly, the composition may, in certain instances, be administered once or more than one to a single subject. In certain instances, the composition may be administered to the same subject through different modes or routes at different times during the treatment process.
- RPMs RNA Processing Modulators
- an RPM is an antisense oligonucleotide (ASO).
- ASOs Antisense oligonucleotides typically range from about 10 to 30 nucleotides in length, and may comprise a non-natural sugar-phosphate backbone (e.g., phosphorodiamidate morpholino backbone, phosphorothioate backbone, etc.) and/or one or more modified sugar moieties (e.g., 2 '-O-m ethoxy ethyl ribose (2'-0-M0E) modifications, etc.).
- a non-natural sugar-phosphate backbone e.g., phosphorodiamidate morpholino backbone, phosphorothioate backbone, etc.
- modified sugar moieties e.g., 2 '-O-m ethoxy ethyl ribose (2'-0-M0E) modifications, etc.
- an RPM targets a structural element of an mRNA transcript, for example an untranslated region (UTR) to modulate the expression of the target (e.g., the target gene encoding the mRNA transcript) by increasing or decreasing transcription and/or translation of the protein encoded by the mRNA transcript (alternatively referred to as modulating expression in the up or the down direction).
- an RPM e.g., an ASO
- an RPM may target a splice site (e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region) to modulate the expression of the target in the up or the down direction (and thus generating novel protein variants).
- a splice site e.g., a splice acceptor site or a splice donor site or one or more nucleotide positions thereof in a UTR region
- Additional examples of structural elements that can be targeted by RPMs include, but are not limited to, intronic regulatory sites, exonic regulatory sites, exonintron boundaries, antisense binding sites of a target mRNA transcript, long-non-coding RNA (LncRNA) binding sites of a target gene, and a retained exon of a canonical mRNA.
- Non-limiting examples of ASOs targeting various structural elements of an mRNA are show in FIG. 1.
- Composition “A” represents an ASO that binds to the 5’ untranslated region (5’ UTR) of an RNA.
- Composition “B” represents an ASO that binds to an intron of an RNA.
- Composition “C” represents an ASO that binds to a splice boundary (e.g., a splice junction) between an exon and intron of an RNA.
- Composition “D” represents an ASO that binds to an exon (e.g., a protein coding region) of an RNA.
- Composition “E” represents a combination of an ASO binding to a 3’ UTR of an RNA, alone or with a trans-regulator.
- Composition “F” represents a “gapmer” ASO that binds to an exon (e.g., protein coding region) of an RNA and mediates RNaseH decay.
- Composition “G” represents a “gapmer” ASO that binds to a 3’ UTR of an RNA, alone or with a trans-regulator, and mediates RNaseH decay.
- ASOs binding to an RNA result in translation of a truncated protein that has a dominant negative effect on the wild-type, full-length protein.
- This example describes diseases and disorders that are associated with glutamate signaling, particularly psychiatric diseases and disorders. Many of the diseases and disorders are associated with aberrant (e.g., abnormal) signaling through glutamate receptors, for example N- methyl-D-aspartate (NMDA) receptors.
- NMDA N- methyl-D-aspartate
- NMDA receptors are ionotropic glutamate receptors that consist of four subunits. Certain NMDA receptors comprise two GluNl subunits and two GRIN2A subunits. Activation of NMDA results in opening of a cation-selective ion channel, which in turn produces an excitatory postsynaptic potential.
- NMDA dysfunction has been associated with schizophrenia, and epileptic disorders (e.g., seizures). Overstimulation of NMDA receptors has also been implicated in excitotoxicity, which has been linked to certain neurodegenerative disorders, such as Alzheimer’s disease (AD).
- AD Alzheimer’s disease
- NMDA receptors have not been attractive therapeutic targets, due to a lack of selective agonists or antagonists, and also due to the challenges of delivering small molecule agents into portions of the brain important for NMDA signaling.
- currently available NMDA agonists lack subunit-level specificity needed to target specific NMDA receptor subtypes.
- Example 3 ASOs targeting GRIN2A
- RPMs e.g., ASOs
- RPMs e.g., ASOs
- reducing the level of GRIN2A reduces the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR).
- ASOs are designed to target regions of GRIN2A mRNA that will result in increased translation of GRIN2A protein and/or increased activity of GRIN2A protein. In some embodiments, increasing the level of GRIN2A increases the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR). In other embodiments, ASOs are designed to target regions of GRIN2A mRNA that will result in decreased translation of GRIN2A protein and/or decreased activity of GRIN2A protein. In some embodiments, decreasing the level of GRIN2A decreases the level or activity of NMDA receptors that incorporate GRIN2A subunit (e.g., NMD AR).
- FIGs. 2A-2C show representative data regarding expression profiling of human Glutamate ionotropic receptor NMDA type subunit 2A (GRIN2A).
- FIG. 2A shows bulk tissue gene expression of human GRIN2A ⁇ data indicate GRIN2A mRNA is expressed in various tissues.
- FIG. 2B shows a schematic depicting exons and introns present in the GRIN2A gene.
- FIG. 2C shows representative data for exon expression analysis of human GRIN2A splice variants in tissue.
- FIG. 3 is a schematic depicting the primary AUG, and upstream regions of GRIN2A mRNA transcript.
- any one of the ASOs comprise one or more chemical modifications and/or comprise a non-natural sugar-phosphate backbone (e.g., a phosphorothioate backbone).
- the ASO has a “gapmer” structure.
- any one of the ASOs comprise one or more chemical modification(s) listed in Column B of Table 1.
- an ASO comprises a nucleic acid sequence from Column A of Table 1 and one or more chemical modifications (or combinations of chemical modifications) from Column B of Table 1, wherein the nucleic acid sequence from Column A and the one or more chemical modifications (or combinations of chemical modifications) from Column B are from the same row of Table 1.
- Cell lines e.g., U-138 MG human glioblastoma cells
- appropriate media e.g., Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum.
- cell lines may be engineered to stably express NMDA receptors containing GRIN2A.
- glutamate-deficient media is optionally used.
- a screen of ASOs targeting GRIN2A RNA was performed in 96 well plate format, seeding about 20,000 U-138 MG cells per well and treating with the ASOs at different concentrations of 5 nM and 20 nM using the RNAiMAX Lipofectamine protocol. Each concentration was transfected in 4 independent wells for biological quadruplicates. Two different ASO chemistries were assayed for targeting of GRIN2A RNA. Short interfering RNAs (siRNAs) were used as a positive control for GRIN2A expression measurements. A nontargeting ASO sequence with matched chemistry and length was used as a negative control, in addition to mock transfected wells treated with PBS or water.
- siRNAs Short interfering RNAs
- RNA expression levels were measured and reported as a luminescence signal in arbitrary Relative Light Units (RLUs) for both GRJN2A and GAPDH. Measured luminescence levels were then used for analysis.
- RLUs Relative Light Units
- GRJN2A gene expression levels were normalized to both GAPDH and the negative controls.
- GRIN2A gene expression levels provided as RLUs, were first normalized to the housekeeping gene GAPDH (GRIN2A RLU / GAPDH RLU). Outliers were detected by testing the value furthest from the mean using the Dixon test on log2 -transformed data within each treatment group per plate. Values with a p-value below 0.01 were removed from subsequent analysis.
- GRIN2A expression relative to controls was then calculated for each sample based on the mean values of the mock and non-targeting control wells within each plate and shown as a percentage ((Sample/Control Mean) * 100). Resulting values for all treatment groups are shown in FIG. 4B.
- Three (3) ASOs resulted in a decrease in GRIN2A RNA expression by more than 50% at the 20 nM dose and achieved knock-down comparable to the siRNA positive control.
- the effects of 10 of the most potent ASOs of each chemistry at the 5 nM dose and the 20 nM dose are shown in FIG. 4C.
- ASO efficacy may be determined by comparing the levels of glutamate signaling between treated and untreated cells.
- cytotoxicity may be measured to understand the physiological impact of changes in glutamate levels.
- Cell viability may be measured by generating survival curves through manually counting Trypan blue staining of cells following ASO treatment.
- propidium iodide staining of cells followed by flow cytometry analysis may be used to measure cell death.
- ASOs targeting GRIN2A were assayed in U138-MG cells over a 10-dose series, and knockdown efficacy was compared to results obtained previously as part of a 2-dose series.
- ASOs were assayed over a 10-dose series by treating cells with a dosage of 40 nM ASO, 20 nM ASO, 10 nM ASO, 5 nM ASO, 2.5 nM ASO, 1.25 nM ASO, 0.625 nM ASO, 0.3125 nM ASO, 0.156250 nM ASO, or 0.078125 nM ASO.
- the ASOs included ASOs of either a gapmer chemistry or a skipmer chemistry.
- U138-MG cells were plated in 96-well plates at 1.5 x 10 4 cells per well, then forward transfected with ASOs using the RNAiMAX protocol, with 4 biological replicates per transfection condition. Control cells were transfected with water and a non-targeting control. After incubation at 37 °C for 48 hours, GRJN2A gene expression levels were analyzed by a branched DNA (bDNA) assay as described previously. The effect of GRJN2A -targeting ASOs on GRIN2A gene expression was compared against corresponding conditions previously tested in a 2-dose series of U138-MG cells.
- bDNA branched DNA
- the efficacy of 4 select ASOs (e.g., as described in Table 1) was specifically examined in the 10-dose series. Each of these skipmer ASOs were observed to effectively inhibit GRIN2A expression in U138-MG cells, attaining >50% knockdown between 10 nM and 40 nM, with most ASOs attaining >50% knockdown around 10 nM (FIG. 6A). The 4 assayed ASOs did not significantly affect the expression of GAPDH, even at the highest tested concentration (FIG. 6B).
- iPSC-Derived Glutamatergic Neurons (FujiCDI) plated 67k cells/well were treated with a panel of 64 GRIN2A ASOs by gymnotic delivery at 4 concentrations (3 uM, 1 uM, 0.3 uM, and 0.1 uM).
- RT-qPCR assay was performed to determine normalized expression levels of GRIN2A mRNA (Taqman Hs00168219_ml assay, Thermofisher), using 18S rRNA as a normalizer (Taqman Hs03003631_gl assay, Thermofisher).
- ASOs SEQ ID NOs: 234-269 were designed and screened in iPSC derived neurons. Assays were performed in a 96 well plate format and iPSCs were treated with ASOs at concentrations of 0.08 pM, 0.4 pM, 2.0 pM, or 10.0 pM. Biological duplicates of each ASO treatment were performed. All ASOs were provided comprising a gapmer chemistry as set forth in rows 235-269 of column B of Table 1.
- GRIN2A gene expression levels were normalized to the housekeeping gene HPRT1 (2'( GRIN2A ct ⁇ HPRT1 ct )y GRIN2A expression relative to controls was then calculated for each sample based on the mean values of non-transfected control wells treated with PBS and shown as a percentage ((Sample/Control Mean) * 100). Resulting values for all treatment groups are shown in FIGs. 7B-7G. Five of the tested GRIN2A ASOs resulted in a decrease in GRIN2A RNA expression by more than 50% at the 2 pM dose.
- Ct cycle threshold
- a rodent model of schizophrenia for example as described by Jones et al. Br J Pharmacol. 2011 Oct; 164(4): 1162-1194, may be used. Animals are maintained in a consistent light and dark cycle and allowed to acclimate for at least five days prior to experiments. Regular feedings are executed at a consistent time, frequency, and amounts each day. ASOs targeting GRIN2A are administered to the animals by infusion. When multiple ASO infusions are performed, administration of the ASO is done at the same time each day to minimize changes in metabolism due to circadian rhythm. ASO infusions are either directly provided to the affected area or into the cerebral spinal fluid (CSF).
- CSF cerebral spinal fluid
- Animals may be placed in the Trendelenburg position during and after the infusion to aid in distribution of the ASOs into the tissue (e.g., CNS tissue) of the animals.
- ASOs are solubilized in an appropriate buffer and sterilized prior to infusions. Following infusions, animals are maintained for a predetermined period of time prior to analysis. In some instances, animals are fed a diet with radioactive glutamate to determine the extent of glutamate signaling.
- animals are anesthetized, and tissue is harvested.
- Harvested tissue samples are flash frozen in appropriate extraction buffers. Blood samples are isolated, when appropriate, and mixed with buffer for preservation purposes.
- Harvested tissue samples are cryosectioned and used for immunohistochemistry analysis. Tissue samples are used for measuring glutamate levels.
- ASO injection comprised either single or repeated administration.
- Single administration comprised unilateral ICV injection of 100 pg of ASO through a canula.
- Repeated administration comprised two unilateral ICV injections through a canula, with a 1-week interval, at either 50 pg or 100 pg of ASO.
- Cortex and hippocampus samples were harvested from injected mouse subjects at 2 weeks post-treatment.
- Grin2a mRNA levels were measured by RT-qPCR using two independent assays (light/dark colors).
- frozen tissues were lysed and homogenized in RLT buffer using beads (MP Biomedical) before RNA extraction using RNeasy Mini Kit (Qiagen) in a QIAcube station (Qiagen).
- RNA concentration was evaluated using a nanodrop spectrometer (ThermoFisher).
- RNA integrity was evaluated using 2100 Bioanalyzer LabChip (Agilent). Then, 500 ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen).
- qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for GRIN2A (Thermofi scher and IDT721, IDT).
- VIC Taqman
- PGK1 levels were measured using a Taqman (FAM) assay (Mm00435617_ml, Thermofi scher) for normalization using the Delta Delta Ct method.
- Grin2a mRNA was significantly knocked down (-50-90%) in cortex tissue samples from injected mouse subjects (FIG. 8B).
- mice subjects (BalbJ/C) at 8-9 weeks of age underwent cannulation. Three weeks later, mouse subjects received either vehicle or 100 pg of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) via intracerebroventricular injection. Additional injections were performed at week four and week five using the same approach.
- an open-field assay was performed to determine the effect of in vivo ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) administration on animal subjects, wherein an Open Field Assay was used.
- the Open Field Assay comprised placing the subject in the center of a field for thirty minutes and the time spent in the center was recorded approximately every 5 min. The recordings were plotted, and the median total time spent in the center was calculated.
- FIG. 10A tissue samples from the cortex, cerebellum, hippocampus, striatum, and cerebrospinal fluid were harvested for further analyses.
- RT-qPCR analyses of harvested brain tissue samples showed significant knockdown of Grin2a mRNA in cortex and hippocampus tissues ( ⁇ 60-65% and -50-60%, respectively) of injected subjects (FIGs. 10B- 10C).
- ASOs comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) significantly increased the amount of time the subjects spent in the center of the field relative to vehicle- treated control subjects (FIG. 10D).
- ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)
- administration reduced anxiety and depression-like behavior and occurred in conjunction with Grin2a mRNA knockdown.
- mice subjects received ICV injection of either vehicle (artificial CSF) or a single dose of 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)).
- mice subjects received repeated ICV injection with either vehicle, a total dose of 100 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) (50 pg+50 pg), or a total dose of 200 pg ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) (100 pg+100 pg) as described herein.
- 100 pg ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)
- ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels and Grin2a mRNA knockdown in hippocampus tissue samples were correlated.
- ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a concentration of 10 pg/g tissue correlated with an approximate 40% knockdown in Grin2a mRNA in mouse hippocampus tissue samples (FIG. 1 IB).
- Non-human primate subjects were used to compare in vivo pharmacokinetics (ASO levels) between non- human primate subjects and mouse subjects that underwent injection with ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)).
- non-human primate subjects were administered a series of two intrathecal (“IT”) injections of either vehicle (artificial CSF), ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “low dose” of 20 mg (10 mg+10 mg), or ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “high dose” of 40 mg (20 mg+20mg).
- IT intrathecal
- the vehicle- injected non-human primate group consisted of two male subjects and one female subject.
- the low ASO dose-injected non-human primate group consisted of one male subject and one female subject.
- the high ASO dose-injected non-human primate group consisted of one male subject and two female subjects.
- each round of IT injection was performed two weeks apart (days 1 and 14).
- Non-human primate treatment groups, administrations to each treatment group, and ASO pharmacokinetic results observed in each treatment group are summarized in Table 2.
- Non-human primate subjects were sacrificed at day 28 (two weeks after the last IT injection) and samples of cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected. Additionally, serum and plasma were collected 3 days prior to day 1 and before day 14 (FIG. 12). Liquid chromatography-mass spectrometry analysis was used to measure ASO pharmacokinetics (ASO levels) and RT-qPCR was used to measure ASO pharmacodynamics (GRIN2A mRNA expression) in tissue samples obtained from injected non-human primates. ASO concentrations in frontal cortex, hippocampus, and lumbar spinal cord samples were quantified to determine ASO levels as a result of IT injection.
- mouse subjects were administered a series of two unilateral intracerebroventricular (“ICV”) injections through a cannula of either vehicle (artificial CSF), ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “low dose” of 100 pg (50 pg+50 pg), or ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) at a “high dose” of 200 pg (100 pg+100 pg).
- ICV intracerebroventricular
- mice subject ICV injection was performed one week apart. A total of 4-5 mouse subjects were used in each group. Mouse subjects were sacrificed two weeks after the last ICV injection and samples from frontal cortex and hippocampus tissues were collected. Hybridization ELISA analysis was used to measure ASO levels in tissue samples of mouse subjects. Further details regarding mouse subject ICV injection and hybridization ELISA methods are provided in Example 7.
- Low dose ASO and high dose ASO treatments groups received an ASO comprising the nucleotide sequence of SEQ ID NO: 134 (*) and chemical modifications (**) as set forth in Columns A and B, respectively, of row 135 of Table 1 (also referred to as “ASO 1” herein)
- No ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) was detected in tissue samples from non-human primate subjects that underwent two IT injections with vehicle.
- ASO In frontal cortex and hippocampus samples obtained from non-human primate subjects that underwent two IT injections of a low dose of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) targeting GRIN2A mRNA, ASO was detected at a mean concentration of approximately 11-13 pg/g tissue (FIGs. 13A-13D and Table 2).
- ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) was detected at a mean concentration of approximately 16 pg/g tissue (Table 2).
- ASO In frontal cortex and hippocampus tissue samples obtained from non-human primate subjects that underwent two IT injections of a high dose of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) targeting GRIN2A mRNA, ASO was detected at a mean concentration of approximately 25-47 pg/g tissue (FIGs. 13A-13D and Table 2).
- ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) was detected at a mean concentration of approximately 51 pg/g tissue (Table 2).
- ASO pharmacokinetics in tissue samples obtained from non-human primate subjects that underwent two IT injections of ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) far exceeded levels of the same ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) that resulted in Grin2a mRNA knockdown in CNS tissue samples obtained from mouse subjects that underwent ICV injection with ASO.
- ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) levels greater than 10 pg/g tissue correlated with 50% knockdown of Grin2a mRNA (FIG. 8 A, FIGs. 10B-10C, FIGs. 11A-11B, FIGs. 13A-13O, and Table 2).
- ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) pharmacokinetics in tissue samples obtained from non-human primate subjects that underwent two IT injections of ASO met or exceeded pharmacokinetic data in non-human primate ASO studies that have been previously described (see, e.g., Malatl ASO administration in Jafar-Nejad et al. (2021). Nucleic Acids Research. 49 (2): 657-673).
- the pharmacokinetic effects associated with a series of four IT injections of ASO were assessed in additional non-human primate subjects.
- Three male non-human primate subjects were administered a series of four IT injections of either vehicle (artificial CSF) or ASO 1 (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein))) at a dose of 100 mg (30 mg+30 mg+20 mg+20 mg).
- each round of IT injection was performed two weeks apart (days 0, 14, 28, and 42).
- cerebrospinal fluid as well as brain (frontal cortex, sensory cortex, and hippocampus), lumbar spinal cord, dorsal root ganglion, kidney, liver, spleen, heart, stomach, and gonads tissues were collected at two weeks following the last IT injection (FIG. 18).
- Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis was used to measure ASO pharmacokinetics (levels of ASO comprising the nucleotide sequence of SEQ ID NO: 134 and - I l l - chemical modifications as set forth in Columns A and B, respectively, of row 135 of Table 1 (also referred to as “ASO 1” herein)) in tissue samples obtained from injected non-human primates.
- ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein)) concentrations in tissue samples were quantified to determine ASO levels as a result of IT injection (FIG. 19).
- mice were evaluated for the effect of Grin2a silencing on seizure phenotypes associated with epilepsy.
- vehicle artificial CSF
- ICV injections were performed at week four and week five using the same approach.
- intraperitoneal injection of 85 mg/kg of a GABAA agonist, pentylenetetrazol (PTZ) was used to induce acute seizure phenotypes in all subjects.
- Positive control group mouse subjects received 400 mg/kg of an antiepileptic agent, Valproate, 30 minutes prior to seizure analyses.
- brain tissues were harvested from vehicle- and ASO-injected subjects and used for Grin2a mRNA knockdown analyses (FIG. 14A).
- Acute PTZ-induced seizures were observed and scored against several endpoints over a 30-minute period. Endpoints included: latency to first twitch, latency to first clonic seizure/tonic seizure, latency to first tonic seizure, latency to death, and survival 1-hour post-PTZ administrated. Indicators of seizure phenotypes were also scored in 10-minute bins over a 30- minute period following PTZ administration. Scoring comprised ranking seizure phenotypes as shown below.
- Rank 1 staring, moving into prone posture, ears flattened, mouth or facial movement, slight tremor, small movements, sight intermittent twitch, tail elevated, increased respiration, ataxia.
- Rank 2 prone, immobility, hindlimb splay, increased tremor intensity, absence seizure, ataxia, head nod/bow, isolated body twitches, straub or elevated tail, tail wag.
- Rank 3 slight clonic/tonic seizures less than 5 sec in duration, muscle fasciculation, straub tail, tonic praying seizure; salivation.
- Rank 4 rearing, pawing, chomping, head bow, head arch, salivation, absence seizure, praying seizure, trumpet seizure, pop seizure, clonic/tonic seizure with increased frequency and duration.
- Rank 5 clonic/tonic seizure greater than 5 sec in duration with loss of right reflex.
- Vehicle-treated subjects exhibited low latency to death and low percent survival. These results were observed in concert with seizure incidence. Specifically, vehicle-treated subjects exhibited low latencies to first twitch, first clonic/tonic seizure, and first tonic seizure. In contrast, Valproate-treated subjects exhibited significantly increased latency to death and percent survival relative to vehicle-treated subjects. This was observed in concert with significantly increased latencies to first twitch, first clonic/tonic seizure, and first tonic seizure relative to vehicle-treated subjects. Importantly, GRIN2A ASO administration produced similar results to that of Valproate treatment.
- GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to as “ASO 1” herein) resulted in significantly increased latency to death, percent survival, latency to first twitch, latency to first clonic/tonic seizure, and latency to first tonic seizure.
- GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 234, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 235 of Table 1 (also referred to as “ASO 2” herein) (FIGs. 14A-14F). Additionally, when seizure phenotype scores were measured over time, vehicle-treated subjects exhibited no change in phenotype over the 30 minutes following PTZ administration. However, similar to Valproate-treated subjects, GRIN2A ASO-treated subjects exhibited decreases in seizure phenotypes scores across the 30-minute time frame (FIG. 14G).
- RNA concentration was evaluated using a nanodrop spectrometer (ThermoFisher).
- RNA integrity was evaluated using 2100 Bioanalyzer LabChip (Agilent). Then, 500 ng of RNA was reverse-transcribed using SuperScript IV VILO Master Mix ezDNase (Invitrogen).
- qPCR was performed with TaqMan Fast Advance Master Mix (Invitrogen) in a Quantstudio thermocycler (Applied Biosystems) with 2 independent Taqman (VIC) assays for GRIN2A (TF066, Thermofischer and IDT721, IDT).
- VIC Taqman
- PGK1 levels were measured using a Taqman (FAM) assay (Mm00435617_ml, Thermofischer) for normalization using the DeltaDeltaCt method.
- Grin2a mRNA in cortex tissue samples from mouse subjects that received repeated ICV injection of the GRIN2A ASOs were significantly reduced.
- the highest levels of Grin2a mRNA silencing in the cortex was achieved using the ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) (FIGs. 15A-15B).
- ASO 1 the nucleotide sequence of SEQ ID NO: 134
- FIGs. 15A-15B also referred to herein as “ASO 1”
- This Example relates to analyses of immunostimulatory effects of GRIN2A ASOs in human peripheral blood mononuclear cells (huPBMCs).
- huPBMCs were harvested from healthy donors and went either untreated, treated with a cytokine/chemokine response control agent, or treated with a GRIN2A ASO (comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) ) at a concentration of IpM, 3pM, or lOpM for 24 hours.
- GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) ) at a concentration of IpM, 3pM, or lOpM for 24 hours.
- FIGs. 17A-17J Representative data from these analyses are shown in FIGs. 17A-17J. Negative control cells exhibited minimal increases or no detectable increase in chemokine/cytokine levels following treatment. Treatment with TLR agonist positive controls resulted in increased chemokine/cytokine levels as expected.
- immunogenic responses to GRIN2A ASO comprising the nucleotide sequence of SEQ ID NO: 134, a gapmer structure, and the chemical modifications as set forth in Columns A and B of row 135 of Table 1 (also referred to herein as “ASO 1”) were either minimal or not detected (FIGs. 17A-17J).
- inventive embodiments are presented by way of example only and that, within the scope of the appended claims and equivalents thereto, inventive embodiments may be practiced otherwise than as specifically described and claimed.
- inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and/or method described herein.
- a reference to “A and/or B”, when used in conjunction with open-ended language such as “comprising” can refer, in one embodiment, to A only (optionally including elements other than B); in another embodiment, to B only (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); etc.
- the phrase “at least one,” in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed within the list of elements and not excluding any combinations of elements in the list of elements.
- This definition also allows that elements may optionally be present other than the elements specifically identified within the list of elements to which the phrase “at least one” refers, whether related or unrelated to those elements specifically identified.
- “at least one of A and B” can refer, in one embodiment, to at least one, optionally including more than one, A, with no B present (and optionally including elements other than B); in another embodiment, to at least one, optionally including more than one, B, with no A present (and optionally including elements other than A); in yet another embodiment, to at least one, optionally including more than one, A, and at least one, optionally including more than one, B (and optionally including other elements); etc.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Applications Claiming Priority (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363489234P | 2023-03-09 | 2023-03-09 | |
| US202363492600P | 2023-03-28 | 2023-03-28 | |
| US202363500071P | 2023-05-04 | 2023-05-04 | |
| US202363512295P | 2023-07-07 | 2023-07-07 | |
| US202363519212P | 2023-08-11 | 2023-08-11 | |
| US202363580796P | 2023-09-06 | 2023-09-06 | |
| US202363588143P | 2023-10-05 | 2023-10-05 | |
| US202463550523P | 2024-02-06 | 2024-02-06 | |
| US202463556385P | 2024-02-21 | 2024-02-21 | |
| PCT/US2024/019111 WO2024187106A2 (en) | 2023-03-09 | 2024-03-08 | Compositions and methods for modulating grin2a |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4677091A2 true EP4677091A2 (de) | 2026-01-14 |
Family
ID=92675733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24767911.1A Pending EP4677091A2 (de) | 2023-03-09 | 2024-03-08 | Zusammensetzungen und verfahren zur modulierung von grin2a |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4677091A2 (de) |
| WO (1) | WO2024187106A2 (de) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2017010369A (es) * | 2015-02-10 | 2017-12-14 | Genzyme Corp | Arni variante. |
| CN111936163B (zh) * | 2017-10-23 | 2025-04-04 | 斯托克制药公司 | 用于治疗基于无义介导的rna衰变的病况和疾病的反义寡聚体 |
-
2024
- 2024-03-08 EP EP24767911.1A patent/EP4677091A2/de active Pending
- 2024-03-08 WO PCT/US2024/019111 patent/WO2024187106A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024187106A3 (en) | 2024-11-14 |
| WO2024187106A2 (en) | 2024-09-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7354342B2 (ja) | タウ発現を調節するための組成物 | |
| US11111494B2 (en) | Compositions for modulating Ataxin 2 expression | |
| US11781135B2 (en) | Methods for treating Alzheimer's disease | |
| US10533178B2 (en) | Methods for modulating Ataxin 2 expression | |
| EP3394259B1 (de) | Zusammensetzungen und verfahren zur verminderung der tau-expression | |
| JP6290316B2 (ja) | ベータ−ENaC−関連疾患を処置するための有機組成物 | |
| RS60707B1 (sr) | Kompozicije za modulaciju ekspresije sod-1 | |
| US20170211064A1 (en) | Compositions and methods for modulating tau expression | |
| US20240043843A1 (en) | Treatment for lysine degradation-associated disorders | |
| US20180044673A1 (en) | Methods for modulating mecp2 expression | |
| WO2024187106A2 (en) | Compositions and methods for modulating grin2a | |
| WO2024187088A2 (en) | Compositions and methods for modulating gls1 | |
| WO2024259232A2 (en) | Compositions and methods for modulating apoe | |
| AU2024231822A1 (en) | Compositions and methods for modulating sptlc1 | |
| WO2025136934A1 (en) | Compositions and methods for modulating sptlc2 | |
| WO2024187102A2 (en) | Compositions and methods for modulating c3 | |
| WO2024251725A1 (en) | Oligonucleotides targeting gal3st1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251008 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |