EP4665357A2 - Verbindungen und verfahren zur modulation der alpha-synuclein-expression - Google Patents

Verbindungen und verfahren zur modulation der alpha-synuclein-expression

Info

Publication number
EP4665357A2
EP4665357A2 EP24757730.7A EP24757730A EP4665357A2 EP 4665357 A2 EP4665357 A2 EP 4665357A2 EP 24757730 A EP24757730 A EP 24757730A EP 4665357 A2 EP4665357 A2 EP 4665357A2
Authority
EP
European Patent Office
Prior art keywords
modified
oligomeric compound
sugar moiety
certain embodiments
nucleobase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24757730.7A
Other languages
English (en)
French (fr)
Inventor
Hien Thuy ZHAO
Susan M. Freier
W. Brad WAN
Antony Thomas
Michael T. Migawa
Punit P. Seth
Bethany FITZSIMMONS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ionis Pharmaceuticals Inc
Original Assignee
Ionis Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ionis Pharmaceuticals Inc filed Critical Ionis Pharmaceuticals Inc
Publication of EP4665357A2 publication Critical patent/EP4665357A2/de
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/711Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/7125Nucleic acids or oligonucleotides having modified internucleoside linkage, i.e. other than 3'-5' phosphodiesters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • C12N2310/33415-Methylcytosine
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/341Gapmers, i.e. of the type ===---===
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3525MOE, methoxyethoxy

Definitions

  • SNCA alpha-synuclcin
  • Such compounds, pharmaceutical compositions, and methods are useful to ameliorate at least one symptom or hallmark of a synucleinopathy (or alpha-synucleinopathy).
  • Such symptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, and seizures.
  • Such synucleinopathies include Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease.
  • Alpha-synuclein is a small, highly charged 140-amino acid residue protein, predominantly expressed in central nervous system (CNS) neurons, where it is localized at presynaptic terminals in close proximity to synaptic vesicles (Iwai, et al., Neuron. 1995. 14: 467-475).
  • Alpha-synuclein is encoded by the SNCA gene.
  • Alpha-synuclein can associate with lipid membranes by forming amphipathic a-helices, as shown in vitro (Davidson, et al., J. Biol. Chem. 1998. 273: 9443-9449).
  • alpha-synuclein is implicated as critical factors in several neurodegenerative diseases, including, Parkinson's disease, Lewy body variant of Alzheimer's disease, diffuse Lewy body disease, dementia with Lewy bodies, and multiple system atrophy (Schulz-Schaeffer, Acta Neuropathol. 2010. 120: 131-143; Yoshida. Neuropathology. 2007. 27: 484-493).
  • alpha-synuclein protein is misfolded and assembles in aggregates in Lewy bodies and Lewy neurites (Uversky. J. Neurochem. 2007. 103: 17-37).
  • Point mutations, genomic duplications, or genomic triplications in SNCA have been associated with Parkinson’s disease and other synucleinopathies.
  • six missense mutations in the SNCA gene have been associated with autosomal dominant Parkinson’s disease ( A53T. A30P. E46K, H50Q, G5 ID. and A53E).
  • the mutations are clustered within the membrane-binding domain, suggesting a contribution of this region to SNCA dysfunction. See. e.g., Bras et al., Cells. 2021. 10: 375.
  • synucleinopathies such as Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease. It is therefore an objective herein to provide compounds, pharmaceutical compositions, and methods of use for the treatment of such synucleinopathies.
  • SNCA RNA compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of SNCA RNA, and in certain embodiments reducing the amount of alpha-synuclein protein in a cell or subject.
  • the subject has a synucleinopathy.
  • the subject has Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • compounds useful for reducing the amount or activity of SNCA RNA are oligomeric compounds.
  • compounds useful for reducing the amount or activity of SNCA RNA are modified oligonucleotides.
  • compounds useful for reducing tire amount of alpha-synuclein protein are oligomeric compounds.
  • compounds useful for reducing tire amount of alpha-synuclein protein are modified oligonucleotides.
  • tire synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • the symptom or hallmark includes motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • amelioration of one or more of these symptoms or hallmarks result in improved motor function, reduction of alpha-synuclein aggregates, slowed ncurodcgcncration, slowed cognitive decline, reduced dementia, improved sleep, improved sense of smell, slowed autonomic failure, slowed ataxia, reduced hallucination, and/or reduced seizures.
  • FIG. 1 illustrates a duration of action study using illustrative modified oligonucleotides described herein.
  • FIG. 2 illustrates tissue concentration of exemplary modified oligonucleotides described herein.
  • FIG. 3 illustrates ASO concentration using illustrative modified oligonucleotides described herein. Detailed Description
  • 2’-deoxynucleoside means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety.
  • a 2’-deoxynucleoside is a 2’-p-D-deoxynucleoside and comprises a 2’-p-D-deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA).
  • a 2 ’-deoxy nucleoside or a nucleoside comprising an unmodified 2’-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
  • 2’-M0E means a 2’-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety .
  • a “2 ’-MOE sugar moiety ” means a sugar moiety with a 2’-OCH 2 CH2OCH 3 group in place of the 2’ -OH group of a ribosyl sugar moiety .
  • a 2’-M0E sugar moiety' is in the P-D configuration.
  • MOE means O-mcthoxy ethyl.
  • 2’-M0E nucleoside or “2‘- O(CH 2 )2OCH 3 nucleoside” means a nucleoside comprising a 2’- MOE sugar moiety' (or 2’-OCH 2 CH 2 OCH 3 ribosyl sugar moiety).
  • 2’-0Me means a 2’-OCH 3 group in place of the 2’-OH group of a ribosyl sugar moiety'.
  • a “2’-O-methyl sugar moiety” means a sugar moiety' with a 2’-OCH 3 group in place of the 2’-OH group of a ribosyl sugar moiety.
  • a 2’-0Me has the P-D ribosyl stereochemical configuration.
  • 2’-0Me nucleoside means a nucleoside comprising a 2’-OMe sugar moiety.
  • 2’-F means a 2’-fluoro group in place of the 2’-OH group of a furanosyl sugar moiety.
  • a “2’- F sugar moiety” means a sugar moiety' with a 2’-F group in place of the 2 ’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the P-D-ribosyl configuration.
  • 2’-F nucleoside means a nucleoside comprising a 2’-F modified sugar moiety.
  • 2 ’-substituted nucleoside means a nucleoside comprising a 2 ’-substituted furanosyl sugar moiety.
  • 2 ’-substituted in reference to a sugar moiety means a sugar moiety comprising at least one 2'- substituent group other than H or OH.
  • 5-melhylcylosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methylcytosine is a modified nucleobase.
  • abasic sugar moiety means a sugar moiety that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
  • administering means providing a pharmaceutical agent or composition to a subject.
  • ameliorate in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in tire absence of the treatment.
  • amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark.
  • the symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein. neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • the progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in tire art.
  • antisense activity means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid.
  • antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of tire antisense compound.
  • antisense agent means an antisense compound and optionally one or more additional features, such as a sense compound.
  • antisense compound means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • sense compound means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
  • antisense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.
  • Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
  • sense oligonucleotide means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide.
  • Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.
  • bicyclic nucleoside or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
  • bicyclic sugar or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure.
  • the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety.
  • the furanosyl sugar moiety is a ribosyl sugar moiety.
  • the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
  • RNAi agent blunt or blunt ended in reference to an oligomeric duplex formed by two oligonucleotides means that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of a doublestranded RNAi agent can be blunt.
  • cell-targeting moiety means a conjugate moiety or portion of a conjugate moiety that is capable of binding to a particular cell type or particular cell types.
  • Cerebrospinal fluid or “CSF” means the fluid filling the space around the brain and spinal cord.
  • Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity. pH. and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
  • chirally enriched in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than tire number or percentage of molecules expected to contain tire same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers.
  • the molecules are modified oligonucleotides.
  • the molecules are oligomeric compounds comprising modified oligonucleotides.
  • the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage.
  • cleavable moiety means a bond or group of atoms that is cleaved upon administration to a subject, for example, inside a cell, a subject, or a human.
  • complementary in reference to an oligonucleotide means that at least 70% of the nucleobases of tire oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when tire nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions.
  • complementary nucleobases means nucleobases that are capable of forming hydrogen bonds with one another.
  • Complementary' nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cy tosine (C) and guanine (G), 5 -methylcy tosine ( m C) and guanine (G).
  • Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases arc known in the art.
  • inosine can pair with adenosine, cytosine, or uracil.
  • Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated.
  • oligonucleotide or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
  • complementary region in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.
  • conjugate group means a group of atoms directly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide.
  • Conjugate groups comprise a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
  • conjugate linker means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
  • conjugate moiety means a group of atoms that when covalently bound to a molecule modifies one or more properties of such molecule compared to the identical molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
  • oligonucleotide refers to nucleosides, nucleobases, sugar moieties. or intemucleoside linkages that are immediately adjacent to each other.
  • contiguous nucleobases means nucleobases that are immediately adjacent to each other in a sequence.
  • constrained ethyl or “cEf ’ or “cEt sugar moiety” means a 0-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is fonned via a bridge connecting the 4 ’-carbon and the 2 ’-carbon of the
  • cEt nucleoside means a nucleoside comprising a cEt sugar moiety.
  • deoxy region means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a 2 ’-deoxy sugar moiety.
  • each nucleoside is selected from a 2’-p-D- deoxynucleoside, a bicyclic nucleoside, and a 2 ’-substituted nucleoside.
  • a deoxy region supports RNase H activity.
  • a deoxy region is tire gap or internal region of a gapmer.
  • diluent means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary' or desirable.
  • the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution.
  • double-stranded in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another.
  • the two strands of a double-stranded region are separate molecules.
  • the two strands are regions of the same molecule that lias folded onto itself (e.g., a hairpin structure).
  • duplex or “duplex region” means the structure formed by two oligonucleotides or portions thereof that arc hybridized to one another.
  • gapmer means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions.
  • the internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.”
  • the internal region is a deoxy region.
  • the positions of the internal region or gap refer to the order of tire nucleosides of the internal region and are counted starting from the 5 ’-end of tire internal region.
  • each nucleoside of the gap is a 2’-P-D-deoxynucleoside.
  • the gap comprises one 2’-substituted nucleoside at position 1. 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-0- D-deoxynucleosides.
  • MOE gapmer indicates a gapmer having a gap comprising 2’-0-D- deoxynucleosides and wings comprising 2 ’-MOE nucleosides.
  • the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
  • hotspot region is a range of nucleobases on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent. Hotspot regions comprise at least one portion that is complementary to an active antisense oligonucleotide.
  • hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases.
  • complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to. an oligonucleotide and a nucleic acid target.
  • intemucleoside linkage means the covalent linkage between contiguous nucleosides in an oligonucleotide.
  • modified intemucleoside linkage means any intemucleoside linkage other than a phosphodiester intemucleoside linkage.
  • Phosphorothioate intemucleoside linkage or “PS intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
  • inverted nucleoside means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
  • inverted sugar moiety means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5 ‘ to 5’ intemucleoside linkage.
  • linked nucleosides are nucleosides that are coimected in a contiguous sequence (i.e. , no additional nucleosides are presented between those that are linked).
  • linker-nucleoside means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they arc contiguous with the oligonucleotide.
  • mismatch or “non-complementary” means a nuclcobasc of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions.
  • motif means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
  • non-bicyclic modified sugar moiety means a modified sugar moiety that comprises a modification, such as a substituent, that does not fomi a bridge betw een tw o atoms of the sugar to form a second ring.
  • nucleobase means an unmodified nucleobase or a modified nucleobase.
  • an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a “modified nucleobase” is a group of atoms other than unmodified A, T. C, U, or G capable of pairing w ith at least one unmodified nucleobase.
  • a “5-methylcytosine” is a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
  • nucleobase sequence of a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each intemucleoside linkage, independently, may be modified or unmodified, irrespective of the presence or absence of modifications, indicated in the referenced SEQ ID NO.
  • nucleoside means a compound, or fragment of a compound, comprising a nucleobase and a sugar moiety.
  • the nucleobase and sugar moiety are each, independently, unmodified or modified.
  • modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety.
  • Linked nucleosides are nucleosides that are connected in a contiguous sequence (i.e. , no additional nucleosides are presented between those that are linked).
  • oligomeric agent means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound.
  • An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
  • oligomeric compound means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group.
  • An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired.
  • a “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
  • oligomeric duplex means a duplex fomred by two oligomeric compounds having complementary nucleobase sequences.
  • Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
  • oligonucleotide means a polymer of linked nucleosides comiected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
  • modified oligonucleotide means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified.
  • unmodified oligonucleotide means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications.
  • An oligonucleotide may be paired with a second oligonucleotide that is complementary’ to the oligonucleotide or it may be unpaired.
  • a “single-stranded oligonucleotide” is an unpaired oligonucleotide.
  • a “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide.
  • pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
  • a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
  • pharmaceutically acceptable salts means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically’ acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
  • pharmaceutical composition means a mixture of substances suitable for administering to a subject.
  • a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution.
  • a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
  • prodrag means an inactive or less active form of a compound which, when administered to a subject, is metabolized to form the active, or more active, compound.
  • a prodrag comprises a cell-targeting moiety and at least one active compound.
  • reducing or inhibiting the amount or activity refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
  • RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • RNAi agent means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics.
  • RNAi agents may comprise conjugate groups and/or terminal groups.
  • an RNAi agent modulates the amount, activity, and/or splicing of a target nucleic acid.
  • the tenn RNAi agent excludes antisense agents that act principally through RNase H.
  • RNase H agent means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid.
  • RNase H agents are singlestranded.
  • RNase H agents are double-stranded.
  • RNase H agents may comprise conjugate groups and/or terminal groups.
  • an RNase H agent modulates the amount and/or activity of a target nucleic acid. The tenn RNase H agent excludes antisense agents that act principally through RISC/Ago2.
  • antisense RNase H oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase Id- mediated nucleic acid reduction.
  • RNAi oligonucleotide means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mcdiatcd nucleic acid reduction.
  • oligonucleotide that at least partially hybridizes to itself.
  • single-stranded means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex.
  • Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.
  • stabilized phosphate group means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’ -phosphate as naturally occurs on DNA or RNA.
  • standard in vitro assay means the assay described in Example 1, 2, 3, 4, 5, 6, 7. or 8, and reasonable variations thereof.
  • standard in vivo assay means the assay described in Example 10,11, 12, 13, 14. or 15. and reasonable variations thereof.
  • stereoorandom or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”).
  • the stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration.
  • the stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoramidate intemucleoside linkage.
  • subject means a human or non-human animal. In certain embodiments, the subject is a human.
  • sugar moiety means an unmodified sugar moiety or a modified sugar moiety.
  • unmodified sugar moiety means a 2’-0H(H) p-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) p-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”).
  • Unmodified sugar moieties have one hydrogen at each of the 1’. 3 ’, and 4 ’ positions, an oxygen at the 3 ’ position, and two hydrogens at the 5’ position.
  • modified sugar moiety or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
  • sugar surrogate means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
  • symptom or hallmark means any physical feature or test result that indicates tire existence or extent of a disease or disorder.
  • a symptom is apparent to a subject or to a medical professional examining or testing said subject.
  • a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests.
  • sy mptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclcin, ncurodcgcncration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • target nucleic acid and “target RNA” mean a nucleic acid that an antisense compound is designed to affect.
  • Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
  • target region means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
  • terminal group means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
  • treating means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein.
  • treating a subject improves a symptom relative to the same symptom in the absence of the treatment.
  • treatment reduces in the severity or frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
  • terapéuticaally effective amount means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom of a disease.
  • Embodiment 1 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a SNCA nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified intemucleoside linkage.
  • Embodiment 4 An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11. at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18. at least 19, or 20 contiguous nucleobases of:
  • SEQ ID NO: 78 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189, or 3271;
  • modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • Embodiment 5 The oligomeric compound of any of embodiments 1-4. wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%. or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-9 when measured across the entire nucleobase sequence of the modified oligonucleotide.
  • Embodiment 6 The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide consists of 12 to 20. 12 to 25. 12 to 30, 12 to 50. 13 to 20. 13 to 25, 13 to 30, 13 to 50. 14 to 20, 14 to 25, 14 to 30. 14 to 50. 15 to 20, 15 to 25, 15 to 30. 15 to 50, 16 to 18,16 to 20, 16 to 25. 16 to 30, 16 to 50, 17 to 20. 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25. 18 to 30, 18 to 50, 19 to 20. 19 to 25, 19 to 30, 19 to 50. 20 to 25, 20 to 30, or 20 to 50 linked nucleosides.
  • Embodiment 7 The oligomeric compound of any of embodiments 1-6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.
  • Embodiment 8 The oligomeric compound of embodiment 7, wherein the modified nucleoside comprises a modified sugar moiety.
  • Embodiment 9 The oligomeric compound of embodiment 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
  • Embodiment 10 The oligomeric compound of embodiment 9, wherein the bicyclic sugar moiety comprises a 2’-4‘ bridge selected from -O-CH2-; and -O-CH(CH3)-.
  • Embodiment 11 The oligomeric compound of any of embodiments 7-10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.
  • Embodiment 12 The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-p-D-deoxyxylosyl sugar moiety, or a 2‘-a-L- dco.wribosyl sugar moiety.
  • Embodiment 13 The oligomeric compound of any of embodiments 7-12, wherein the modified nucleoside comprises a sugar surrogate.
  • Embodiment 14 The oligomeric compound of embodiment 13, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).
  • the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).
  • Embodiment 15 The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide is a gapmer.
  • Embodiment 16 The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
  • Embodiment 17 The oligomeric compound of embodiment 16, wherein at least one intemucleoside linkage is a phosphodiester intemucleoside linkage.
  • Embodiment 18 The oligomeric compound of embodiment 16 or embodiment 17, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
  • Embodiment 19 The oligomeric compound of any of embodiments 16-18, wherein at least one modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 20 The oligomeric compound of any of embodiments 16-19, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage, a phosphorothioate intemucleoside linkage, and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 21 The oligomeric compound of any of embodiments 16. 18, or 19, wherein each intemucleoside linkage is independently selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 22 The oligomeric compound of any of embodiments 16-18. wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
  • Embodiment 23 The oligomeric compound of any of embodiments 16-22. wherein at least 4, at least 5. at least 6, at least 7. at least 8, at least 9, at least 10, at least 11, at least 12. at least 13, at least 14, at least 15, at least 16, at least 17. at least 18, or 19 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
  • Embodiment 24 The oligomeric compound of any of embodiments 16-21, wherein at least 1, at least 2. at least 3, at least 4. at least 5, at least 6, at least 7. or at least 8 intemucleoside linkages of tire modified oligonucleotide are mesyl phosphoramidate intemucleoside linkages.
  • Embodiment 26 The oligomeric compound of any of embodiments 1-25. wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.
  • Embodiment 27 The oligomeric compound of embodiment 26, wherein the modified nucleobase is a 5- methylcytosine.
  • Embodiment 28 The oligomeric compound of embodiment 27, wherein each cytosine is a 5-methylcytosine.
  • Embodiment 29 The oligomeric compound of any of embodiments 1-28. wherein each nucleoside of the modified oligonucleotide is unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5- methylcytosine.
  • Embodiment 30 The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide comprises a deoxy region.
  • Embodiment 31 The oligomeric compound of embodiment 30. wherein each nucleoside of the deoxy region is a 2’-P-D-deoxynucleoside.
  • Embodiment 32 The oligomeric compound of embodiment 30 or embodiment 31, wherein the deoxy region consists of 6, 7, 8. 9. 10, or 6-10 linked nucleosides.
  • Embodiment 33 The oligomeric compound of any of embodiments 30-32. wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
  • Embodiment 34 The oligomeric compound of any of embodiments 30-33, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5’-region nucleosides and on the 3’-side by a 3’-region consisting of 1-6 linked 3 ’-region nucleosides: wherein at least one nucleoside of the 5’-region comprises a modified sugar moiety; and at least one nucleoside of the 3 ’-region comprises a modified sugar moiety.
  • Embodiment 35 The oligomeric compound of embodiment 34, wherein each nucleoside of the 5’-region comprises a modified sugar moiety.
  • Embodiment 36 The oligomeric compound of embodiment 34 or embodiment 35, wherein each nucleoside of the 3 ’-region comprises a modified sugar moiety.
  • Embodiment 37 The oligomeric compound of any of embodiments 1-36, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
  • Embodiment 38 The oligomeric compound of any of embodiments 1-37, wherein the modified oligonucleotide consists of 20 linked nucleosides.
  • Embodiment 39 The oligomeric compound of any of embodiments 1-38, wherein the modified oligonucleotide comprises: a 5 ’-region consisting of 1-6 linked 5 ’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3 ’-region consisting of 1-6 linked 3 ’-region nucleosides; wherein each of tire 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2 ’-P-D-deoxy ribosyl sugar moiety.
  • Embodiment 40 The oligomeric compound of any of embodiments 1-39, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides: and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2 ’-P-D-deoxy ribosyl sugar moiety.
  • Embodiment 41 The oligomeric compound of embodiment 40, wherein the modified oligonucleotide has a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-M0E sugar moiety and each of the central region nucleosides comprises a 2’-P-D-deoxyribosyl sugar moiety.
  • Embodiment 42 The oligomeric compound of any of embodiments 1-39, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 6 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 4 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety.
  • Embodiment 43 The oligomeric compound of embodiment 42, wherein the modified oligonucleotide has a 5 ’-region consisting of 6 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’ -region consisting of 4 linked 3 ’ -region nucleosides; wherein each of the 5‘-region nucleosides and each of tire 3’-region nucleosides comprises a 2’-MOE sugar moiety and each of the central region nucleosides comprises a 2 ’-p-D-deoxy ribosyl sugar moiety.
  • Embodiment 44 The oligomeric compound of any of embodiments 1-43, consisting of tire modified oligonucleotide.
  • Embodiment 45 The oligomeric compound of any of embodiments 1-43, wherein the oligomeric compound comprises a conjugate group.
  • Embodiment 46 The oligomeric compound of embodiment 45, wherein the conjugate group comprises a conjugate moiety’ and a conjugate linker.
  • Embodiment 47 The oligomeric compound of embodiment 46, wherein the conjugate linker is a phosphodiester linker.
  • Embodiment 48 The oligomeric compound of embodiment 46, wherein the conjugate linker consists of a single bond.
  • Embodiment 49 The oligomeric compound of any of embodiments 46 - 48, wherein the conjugate linker is cleavable.
  • Embodiment 50 The oligomeric compound of any of embodiments 46, 47, or 49, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside by a phosphodiester bond.
  • Embodiment 51 The oligomeric compound of any of embodiments 45-50, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
  • Embodiment 52 The oligomeric compound of any of embodiments 45-50, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
  • Embodiment 53 The oligomeric compound of any of embodiments 1-49 or 51 -52, wherein the oligomeric compound does not comprise linker-nucleosides.
  • Embodiment 54 The oligomeric compound of any of embodiments 1-53. comprising a terminal group.
  • Embodiment 55 The oligomeric compound of embodiment 54, wherein the terminal group is an abasic sugar moiety.
  • Embodiment 56 The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound is an RNase H agent.
  • Embodiment 57 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Ae S m Ce S Ae S Ge S Ae S TdzAdzTdzTd z Td s Td s Td s Gd s Td s Td s m Ce S T es Ge S m Ce S m Ce (SEQ ID NO: 3335), wherein:
  • A an adenine nucleobase.
  • mC a 5-methylcytosine nucleobase,
  • G a guanine nucleobase
  • T a thymine nucleobase
  • e a 2 ’-MOE sugar moiety
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • z a mesyl phosphoramidate intemucleoside linkage
  • the oligomeric compound optionally comprises a conjugate group or a terminal group.
  • Embodiment 58 An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: Ae S ,n Ce S Ge O Aeo ,n C es AdzTd s Td s Td s Td s m Cd s Tci s TdzGd s m Cci s m Ce S Teo m Ce S Te S Te (SEQ ID NO: 3336), wherein:
  • A an adenine nucleobase
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase.
  • T a thymine nucleobase.
  • e a 2’-MOE sugar moiety,
  • m C a 5-methylcytosine nucleobase.
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • d a 2’-P-D-deoxyribosyl sugar moiety.
  • s a phosphorothioate intemucleoside linkage.
  • Embodiment 66 An oligomeric compound according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • Embodiment 67 An oligomeric compound according to the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • Embodiment 68 The oligomeric compound of any of embodiments 64-67, wherein N 1 is an adenine nucleobase.
  • Embodiment 69 The oligomeric compound of any of embodiments 64-67, wherein N 1 is an unmodified adenine.
  • Embodiment 73 The oligomeric compound of any of embodiments 64-67. wherein N 1 is a terminal group.
  • Embodiment 75 The oligomeric compound of any of embodiments 64-74, wherein N 2 is a modified cytosine.
  • Embodiment 76 The oligomeric compound of any of embodiments 64-74, wherein N 2 is 5-methylcytosine.
  • Embodiment 77 The oligomeric compound of any of embodiments 64-74, wherein N 2 is an unmodified cytosine.
  • Embodiment 79 The oligomeric compound of any of embodiments 64-74, wherein N 2 is a terminal group.
  • Embodiment 80 The oligomeric compound of any of embodiments 64-74, wherein N 2 is absent.
  • Embodiment 83 The oligomeric compound of any of embodiments 64-74, wherein N 3 is an abasic sugar moiety.
  • Embodiment 85 The oligomeric compound of any of embodiments 64-74, wherein N 3 is absent.
  • Embodiment 86 The oligomeric compound of any of embodiments 64-80, wherein N 1 is an adenine nucleobase and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 92 The oligomeric compound of any of embodiments 64-80 or 91 , wherein N 1 is a modified adenine and N 2 is a modified cytosine.
  • Embodiment 95 The oligomeric compound of any of embodiments 64-80 or 91, wherein N 1 is a modified adenine and N 2 is a terminal group.
  • Embodiment 96 The oligomeric compound of any of embodiments 64-80 or 91, wherein N 1 is a modified adenine and N 2 is absent.
  • Embodiment 97 The oligomeric compound of any of embodiments 64-80 or 91, wherein N 1 is a hypoxanthine and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 98 The oligomeric compound of any of embodiments 64-80 or 97, wherein N 1 is a hypoxanthine and N 2 is a modified cytosine.
  • Embodiment 99 The oligomeric compound of any of embodiments 64-80 or 97, wherein N 1 is a hypoxanthine and N 2 is 5-methylcytosine.
  • Embodiment 100 The oligomeric compound of any of embodiments 64-80 or 97, wherein N 1 is a hypoxanthine and N 2 is an abasic sugar moiety.
  • Embodiment 101 The oligomeric compound of any of embodiments 64-80 or 97, wherein N 1 is a hypoxanthine and N 2 is a terminal group.
  • Embodiment 102 The oligomeric compound of any of embodiments 64-80 or 97, wherein N 1 is a hypoxanthine and N 2 is absent.
  • Embodiment 103 The oligomeric compound of any of embodiments 64-80, wherein N 1 is an abasic sugar moiety and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety , a terminal group, or is absent.
  • Embodiment 104 The oligomeric compound of any of embodiments 64-80, wherein N 1 is a terminal group and N 2 is a cy tosine nucleobase, a modified cy tosine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 105 The oligomeric compound of any of embodiments 64-80, wherein N 1 is absent and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 106 The oligomeric compound of any of embodiments 64-80, wherein N 1 is absent and N 2 is absent.
  • Embodiment 108 The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N 1 is an adenine nucleobase and N 3 is a thymine nucleobase.
  • Embodiment 109 The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N 1 is an adenine nucleobase and N 3 is a modified thymine.
  • Embodiment 110 The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N 1 is an adenine nucleobase and N 3 is an abasic sugar moiety.
  • Embodiment 111 The oligomeric compound of any of embodiments 64-74. 81 -85, or 107. wherein N 1 is an adenine nucleobase and N 3 is a terminal group.
  • Embodiment 112. The oligomeric compound of any of embodiments 64-74. 81-85, or 107. wherein N 1 is an adenine nucleobase and N 3 is absent.
  • Embodiment 113 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is a modified adenine and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 114 The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N 1 is a modified adenine and N 3 is an unmodified thymine.
  • Embodiment 115 The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N 1 is a modified adenine and N 3 is an abasic sugar moiety.
  • Embodiment 116 The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N 1 is a modified adenine and N 3 is a terminal group.
  • Embodiment 117 The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N 1 is a modified adenine and N 3 is absent.
  • Embodiment 118 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is a hypoxanthine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 119 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N 1 is a hypoxanthine and N 3 is an unmodified thymine.
  • Embodiment 120 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N 1 is a hypoxanthine and N 3 is an abasic sugar moiety.
  • Embodiment 121 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N 1 is a hypoxanthine and N 3 is a terminal group.
  • Embodiment 122 The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N 1 is a hypoxanthine and N 3 is absent.
  • Embodiment 123 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is an abasic sugar nioiely and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety’, a terminal group, or is absent.
  • Embodiment 124 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is a terminal group and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 125 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is absent and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • Embodiment 126 The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N 1 is absent and N 3 is absent.
  • Embodiment 127 The oligomeric compound of any of embodiments 64-126, wherein the conjugate group comprises a conjugate moiety’ and a conjugate linker.
  • Embodiment 128 The oligomeric compound of embodiment 127, wherein the conjugate linker is a phosphodiester linker.
  • Embodiment 129 The oligomeric compound of embodiment 127, wherein the conjugate linker consists of a single bond.
  • Embodiment 130 The oligomeric compound of any of embodiments 127-129, wherein the conjugate linker is cleavable.
  • Embodiment 131 The oligomeric compound of any of embodiments 127. 128, or 130. wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the oligomeric compound, or to another linker-nucleoside by a phosphodiester bond.
  • Embodiment 132 The oligomeric compound of any of embodiments 64-131. wherein the conjugate group is attached to the oligomeric compound at the 5 ’-end of the oligomeric compound.
  • Embodiment 133 The oligomeric compound of any of embodiments 64-131. wherein the conjugate group is attached to the oligomeric compound at the 3 ’-end of the oligomeric compound.
  • Embodiment 134 The oligomeric compound of any of embodiments 64-133. wherein the oligomeric compound is a pharmaceutically acceptable salt.
  • Embodiment 135. The oligomeric compound of embodiment 133. wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
  • Embodiment 136 An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-135.
  • Embodiment 137 The oligomeric duplex of embodiment 136, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of Hie first modified oligonucleotide.
  • Embodiment 138 The oligomeric duplex of embodiment 136 or embodiment 137, wherein the modified oligonucleotide of tire first oligomeric compound comprises a 5 ‘-stabilized phosphate group.
  • Embodiment 139 The oligomeric duplex of embodiment 138, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphorate.
  • Embodiment 140 The oligomeric duplex of any of embodiments 136-139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety’.
  • Embodiment 141 The oligomeric duplex of embodiment 140. wherein the modified sugar moiety' of the second modified oligonucleotide comprises a bicyclic sugar moiety.
  • Embodiment 142 The oligomeric duplex of embodiment 141. wherein the bicyclic sugar moiety’ of the second modified oligonucleotide comprises a 2 ‘-4’ bridge selected from -O-CH 2 -; and -O-CH(CH 3 )-.
  • Embodiment 143 The oligomeric duplex of embodiment 140. wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
  • Embodiment 144 The oligomeric duplex of embodiment 143. wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F modified sugar moiety, or 2’-OMe modified sugar moiety.
  • Embodiment 145 The oligomeric duplex of any of embodiments 136-144, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a modified intemucleoside linkage.
  • Embodiment 146 The oligomeric duplex of embodiment 145. wherein at least one modified intemucleoside linkage of the second modified oligonucleotide is a phosphorothioate intemucleoside linkage.
  • Embodiment 147 The oligomeric duplex of any of embodiments 136-146, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a phosphodiester intemucleoside linkage.
  • Embodiment 148 The oligomeric duplex of any of embodiments 145-147, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 149 The oligomeric duplex of any of embodiments 136-148, wherein each intemucleoside linkage of tire second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage, a phosphorothioate intemucleoside linkage, or a mesyl phosphoramidate intemucleoside linkage.
  • Embodiment 150 The oligomeric duplex of any of embodiments 136-149. wherein the second modified oligonucleotide comprises at least one modified nucleobase.
  • Embodiment 151 The oligomeric duplex of embodiment 150, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.
  • Embodiment 153 The oligomeric duplex of embodiment 152, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
  • Embodiment 155 The oligomeric duplex of embodiment 153 or embodiment 154, wherein the conjugate linker is cleavable.
  • Embodiment 156 The oligomeric duplex of embodiment 153 or embodiment 155, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside by a phosphodiester bond.
  • Embodiment 157 The oligomeric duplex of any of embodiments 153-156, wherein the conjugate linker is a phosphodiester linker.
  • Embodiment 158 The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached to the 5 ’-end of the second modified oligonucleotide.
  • Embodiment 159 The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached to the 3 ’-end of the second modified oligonucleotide.
  • Embodiment 160 The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.
  • Embodiment 161 The oligomeric duplex of any of embodiments 152-160, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl. CIO alkyl. C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl. C13 alkyl. C12 alkyl. Cl 1 alkyl, C9 alkyl, C8 alkyl. C7 alkyl, C6 alkyl. C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl.
  • CIO alkenyl C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl.
  • C13 alkenyl. C12 alkenyl. Cl 1 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • Embodiment 162 The oligomeric duplex of any of embodiments 152-161, wherein the conjugate group comprises a cell-targeting moiety.
  • Embodiment 163. The oligomeric duplex of any of embodiments 136-162, wherein the second modified oligonucleotide comprises a terminal group.
  • Embodiment 164 The oligomeric duplex of embodiment 163. wherein the terminal group is an abasic sugar moiety.
  • Embodiment 165 An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-135.
  • Embodiment 166 An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 136-164.
  • RNase H or ii) an RN Ai agent capable of reducing the amount of SNCA nucleic acid through the activation of
  • Embodiment 168 The antisense agent of any of embodiments 165-167, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting moiety.
  • Embodiment 169 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 170 A modified oligonucleotide according to the following chemical structure:
  • T1 Embodiment 172 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 173 The modified oligonucleotide of any of embodiments 169-172, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
  • Embodiment 177 A modified oligonucleotide according to the following chemical structure:
  • Embodiment 178 A population of oligomeric compounds of any of embodiments 1-135 or a population of modified oligonucleotides of any of embodiments 169-177. wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
  • Embodiment 179 The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having tire (S'p) configuration.
  • Embodiment 180 The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having tire (Ap) configuration.
  • Embodiment 181 The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 182. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having the (.S'p) configuration at each phosphorothioate intemucleoside linkage or for modified oligonucleotides having the (7?p) configuration at each phosphorothioate intemucleoside linkage.
  • Embodiment 183 The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (.S'p) configuration at each of the remaining phosphorothioate intemucleoside linkages.
  • Embodiment 184 The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the .S'p, S'p. and 7?p configurations, in the 5’ to 3’ direction.
  • Embodiment 185 A population of oligomeric compounds of any of embodiments 1-135, modified oligonucleotides of any of embodiments 169-177, oligomeric duplexes of any of embodiments 136-164, or antisense agents of any of embodiments 165-168, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 186 A population of oligomeric compounds of any of embodiments 1-135, modified oligonucleotides of any of embodiments 169-177, oligomeric duplexes of any of embodiments 136-164, or antisense agents of any of embodiments 165-168, wherein all of the mesyl phosphoramidate intemucleoside linkages of the modified oligonucleotide are stereorandom.
  • Embodiment 187 A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136- 164, an antisense agent of any of embodiments 165-168, or a population of any of embodiments 178-186, and a pharmaceutically acceptable diluent.
  • Embodiment 188 The pharmaceutical composition of embodiment 187, wherein the pharmaceutically acceptable diluent is artificial cerebral spinal fluid (aCSF) or phosphate-buffered saline (PBS).
  • aCSF artificial cerebral spinal fluid
  • PBS phosphate-buffered saline
  • Embodiment 189 The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, or the population of any of embodiments 178-186, and aCSF.
  • Embodiment 190 The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, or the population of any of embodiments 178-186, and PBS.
  • Embodiment 191 A method comprising administering to a subject an oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178- 186, or a pharmaceutical composition of any of embodiments 187-190.
  • Embodiment 192 The method of embodiment 191. wherein the subject lias or is at risk of developing a synucleinopathy.
  • Embodiment 193. The method of embodiment 191. wherein the subject lias or is at risk of developing Parkinson’s disease.
  • Embodiment 194. The method of embodiment 191. wherein the subject has or is at risk of developing multiple system atrophy (MSA).
  • MSA multiple system atrophy
  • Embodiment 195 The method of embodiment 191. wherein the subject has or is at risk of developing dementia with Lewy bodies (DLB). diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • DLB dementia with Lewy bodies
  • Parkinson’s disease dementia (PDD) pure autonomic failure
  • neuronopathic Gaucher's disease or Alzheimer’s disease.
  • Embodiment 196 A method of treating a synucleinopathy comprising administering to a subject having or at risk of developing a synucleinopathy a therapeutically effective amount of an oligomeric compound of any of embodiments 1-135. a modified oligonucleotide of any of embodiments 169-177. an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168. a population of any of embodiments 178- 186, or a pharmaceutical composition of any of embodiments 187-190.
  • Embodiment 197 The method of embodiment 196, wherein tire synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • DLB dementia with Lewy bodies
  • PDD Parkinson’s disease dementia
  • MSA multiple system atrophy
  • GMA multiple system atrophy
  • Alzheimer's disease Alzheimer’s disease.
  • Embodiment 198 The method of embodiment 196, wherein tire synucleinopathy is Parkinson’s disease.
  • Embodiment 199 The method of embodiment 196, wherein tire synucleinopathy is multiple system atrophy (MSA).
  • MSA multiple system atrophy
  • Embodiment 200 The method of any of embodiments 196-199, wherein at least one symptom or hallmark of synucleinopathy is ameliorated.
  • Embodiment 201 The method of embodiment 200, wherein the symptom or hallmark is motor dysfunction, aggregation of alplia-synuclein. neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • Embodiment 202 The method of any of embodiments 196-201, wherein administering tire oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, tire antisense agent of any of embodiments 165-168, the population of any of embodiments 178-186, or the pharmaceutical composition of any of embodiments 187-190 reduces or delays the onset or progression of motor dysfunction, aggregation of alp ha-sy nuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • Embodiment 203 The method of any of embodiments 191-202, wherein the oligomeric compound of any of embodiments 1-135, tire modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, the population of any of embodiments 178- 186, or the pharmaceutical composition of any of embodiments 187-190 is administered to the central nervous system or systemically.
  • Embodiment 204 The method of any of embodiments 191-203, wherein the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, the population of any of embodiments 178- 186, or the pharmaceutical composition of any of embodiments 187-190 is administered intrathecally.
  • Embodiment 205 The method of any of embodiments 191-204, wherein the subject is a human.
  • Embodiment 206 A method of reducing expression of SNCA in a cell comprising contacting the cell with oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164. an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186. or a pharmaceutical composition of any of embodiments 187-190.
  • Embodiment 207 The method of embodiment 206. wherein the cell is a brain cell.
  • Embodiment 208 The method of embodiment 206 or embodiment 207. wherein the cell is a neuron or an oligodendrocyte.
  • Embodiment 209 The method of any of embodiments 206-208, wherein the cell is a human cell.
  • Embodiment 210 Use of oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186, or a pharmaceutical composition of any of embodiments 187-190 for treating a synucleinopathy.
  • Embodiment 211 Use of oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186, or a pharmaceutical composition of any of embodiments 187-190 for the manufacture of a medicament for treating a synucleinopathy.
  • Embodiment 212 The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • DLB dementia with Lewy bodies
  • PDD Parkinson’s disease dementia
  • MSA multiple system atrophy
  • neuronopathic Gaucher's disease or Alzheimer’s disease.
  • Embodiment 213. The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson’s disease.
  • Embodiment 214 The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is multiple system atrophy (MSA).
  • MSA multiple system atrophy
  • oligomeric compounds comprising oligonucleotides, w hich consist of linked nucleosides.
  • Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides.
  • Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nuclcobasc) and/or at least one modified intcmuclcosidc linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in modified oligonucleotides are described below.
  • Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety 7 and a modified nucleobase.
  • modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into oligonucleotides.
  • modified sugar moieties are non-bicyclic modified sugar moieties.
  • modified sugar moieties are bicyclic or tricyclic sugar moieties.
  • modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
  • modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited to, substituents at the 2’, 3’, 4’, and/or 5’ positions.
  • the furanosyl sugar moiety is a ribosyl sugar moiety.
  • one or more acyclic substituent of non-bicyclic modified sugar moieties is branched.
  • non-bicyclic modifed sugar moieties comprise a substituent group at the 2 ’-position.
  • substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F. -OCH 3 (“OMe” or “O-methyl”), and -OCH 2 CH 2 OCH 3 (“MOE”).
  • 2 ’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF 3 , OCF 3 . O-Ci-Cio alkoxy. O-Ci-Cio substituted alkoxy.
  • Synthetic methods for some of these 2 ’-substituent groups can be found in ,e.g., Cook et al., U.S. 6,531,584; and Cook et al., U.S. 5,859,221.
  • Certain embodiments of these 2’-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO 2 ), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
  • 2 ‘-substituent group selected from: F, OCF 3 , OCH 3 , OCH 2 CH 2 OCH 3 , O(CH 2 ) 2 SCH 3 , O(CH 2 ) 2 ON(CH 3 ) 2 , O(CH 2 ) 2 O(CH 2 ) 2 N
  • a 2 ’-substituted sugar moiety of a modified nucleoside comprises 2 ‘-substituent group selected from: F, OCH 3 , and OCH 2 CH 2 OCH 3 .
  • modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration.
  • a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring 0-D-deoxyribosyl configuration.
  • Such modified sugar moieties are described in, e.g., W02020/072991.
  • a 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations.
  • Non-bicyclic modified sugar moieties are stereoisomers of DNA, such as 2’-0-D- deoxyxylosyl sugar moiety:
  • a non-bicyclic modified nucleoside comprises a 2’-a-L-deoxyribosyl sugar moiety:
  • non-bicyclic modified sugar moieties comprise a substituent group at the 4 ’-position.
  • substituent groups suitable for the 4’-position of modified sugar moieties include, but are not limited to. alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al.. WO 2015/106128.
  • non-bicyclic modified sugar moieties comprise a substituent group at the 3 ’-position.
  • substituent groups suitable for the 3 ’-position of modified sugar moieties include, but are not limited to. alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
  • non-bicyclic modified sugar moieties comprise a substituent group at the 5 ’-position.
  • substituent groups suitable for the 5’-position of modified sugar moieties include, but are not limited to. vinyl, alkoxy (e.g., methoxy), and alkyl (e g., methyl (R or S'), ethyl).
  • non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2’-F-5’-methyl sugar moieties, such as described in Migawa et al., US2010/0190837, or alternative 2’- and 5’-modified sugar moieties as described inRajeev et al., US2013/0203836.
  • oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2‘ position or inverted 5’ to 3’.
  • the linkage is at the 2’ position
  • the 2 ’-substituent groups may instead be at the 3 ’-position.
  • modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety.
  • the bicyclic sugar moiety comprises a bridge between the 4’ and the 2’ furanose ring atoms.
  • Examples of such 4’ to 2’ bridging sugar substituents include, but arc not limited to: 4’-CH 2 -2’, 4’-(CH 2 ) 2 -2’, 4‘-(CH 2 ) 3 -2’, 4’-CH 2 -O-2’ (“LNA”), 4’-CH 2 -S-2’, 4’-(CH 2 ) 2 -O-2’ (“ENA”), 4’- CH(CH 3 )-O-2’ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH 2 -O-CH 2 -2’, 4’-CH 2 - N(R)-2’, 4’-CH(CH 2 OCH 3 )-O-2’ (“constrained MOE” or“cMOE”) and analogs thereof, 4’-C(CH 3 )(CH 3 )-O-2’ and analogs thereof, 4’-CH 2 -N(OCH 3 )-2’ and analogs thereof , 4’-CH 2
  • such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(R a )(R b )] n -, -[C(Ra)(R b )] n -O-.
  • -S( O)x-, and -N(R a )-; wherein: x is 0, 1, or 2; n is 1, 2, 3.
  • each Ra and R b is. independently. H, a protecting group, hydroxyl.
  • bicyclic sugar moieties are known in the art, see, for example: Wan. et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al.. U.S. 8,080,644; Ramasamy et al., U.S. 6,525,191; Seth et al., U.S. 7,547,684; and Seth et al., U.S. 7,666,854.
  • bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration.
  • an LNA nucleoside (described herein) may be in the a-L configuration or in the p-D configuration.
  • bicyclic nucleosides include both isomeric configurations.
  • positions of specific bicyclic nucleosides e g., LNA or cEt
  • they are in the p-D configuration, unless otherwise specified.
  • modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2‘ bridged sugars).
  • modified sugar moieties are sugar surrogates.
  • the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom.
  • such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein.
  • certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position and/or the 5’ position.
  • sugar surrogates comprise rings having other than 5 atoms.
  • a sugar surrogate comprises a six-membered tetrahydropyran (“THP”).
  • THP tetrahydropyran
  • Such tetrahydropyrans may be farther modified or substituted.
  • Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”), fluoro HNA:
  • F-HNA see e.g., Egli, et. al, J Am Chem (2011) 133(41):16642-16649, Swayze et al, U.S. 8,088,904; and Swayze et al, U.S. 8,440,803
  • F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside:
  • Bx is a nucleobase moiety:
  • T 3 and T 4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T 3 and T 4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T 3 and T 4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q 3 , q 3 , q 4 , q 3 , qeand q?
  • modified THP nucleosides are provided wherein qi, q 2 , q 3 , q 4 , q 3 , qe and q? are each H. In certain embodiments, at least one of qi, q 3 , q 3 , q 4 , qs, qe and q? is other than H. In certain embodiments, at least one of qi, q2, q 3 , q 4 , qe, qeand q- is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R 2 is F.
  • Ri is F and R 2 is H
  • Ri is methoxy' and R 2 is H
  • Ri is methoxy ethoxy and R2 is H
  • sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom.
  • nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported.
  • morpholino means a sugar surrogate having the following structure:
  • morpholinos may be modified, for example, by adding or altering various substituent groups from the above morpholino structure.
  • Such sugar surrogates are referred to herein as “modified morpholinos.”
  • sugar surrogates comprise acyclic moieties.
  • nucleosides and oligonucleotides comprising such acy stunt sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid ), and nucleosides and oligonucleotides described in Manoharan et al., U.S. 10,913,767.
  • Representative U.S. patents that teach tire preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5.719.262.
  • sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides.
  • UNA is a nucleoside wherein any of the bonds of tire sugar moiety has been removed, forming an unlocked sugar surrogate.
  • a representative U.S. publication that teaches the preparation of UNA includes, but is not limited to. US Patent Publication No 2011/0313020.
  • sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: 6S)-GNA where Bx represents any nucleobase.
  • modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase).
  • An “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G).
  • a modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase.
  • a 5-methylcytosine is an example of a modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • modified adenine has structure (I): wherein: R 2A is H. Ci-Ce alkyl, substituted Ci-Ce alky l, Ci-Ce thioalkyl, or substituted Ci-Ce thioalkyl, Ci-Ce alkyloxy, or substituted Ci -Cs alkyloxy; R 6A is H, N(R a )(R b ), acetyl, formyl, or O-phenyl; Y 7A is N and R 7A is absent or is Ci -Ce alkyl; or Y 7A is C and R 7A is selected from H, Ci -Ce alkyl, or CN(R a )(R b ); Y 8A is N and R 8A is absent, or Y 8A is C and R 8A is selected from H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; R a and R b are
  • modified guanine has structure (II):
  • R 2G is N(R a )(R b ); R 6G is oxo and R 1G is H, or R 6G is selected from O-Ci-C,, alky l or S-Ci-Ce alkyl and R 1G is absent; Y 7G is N and R 7A is absent or is Cj-C 6 alkyd; or Y 7G is C and R 7G is selected from H, Ci-C 6 alky l, or CN(R a )(R b ); Y 8G is N and R 8G is absent, or Y 8G is C and R 8G is selected from H, a halogen, OH, Ci-C 6 alky l, or substituted Ci-Cg alky 1; R a and R b are independently selected from H, Ci-Ce alky 1, substituted Ci-Ce alky 1, Ci-Cg alkenyl, substituted Ci-Cg alkenyl, acetyl, formyl, or together
  • modified thymine or modified uracil has structure (III): wherein: X is selected from O or S and R" is selected from H. OH. halogen. O-Ci -Ci 2 alkyl, O-Ci -Ci 2 substituted alkyl, C1-C12 alkyl , substituted C1-C12 alkyl. C1-C12 alkenyl, substituted C1-C12 alkenyl; wherein if each X is O, R 5U is not H or CH 3 (unmodified uracil and unmodified thymine, respectively).
  • modified cytosine has structure (IV):
  • X is selected from O or S
  • R 4C is N(R a )(R b )
  • R 5C is selected from H, OH. halogen, O-C1-C12 alkyl, O- C1-C12 substituted alky l, C1-C12 alkyl .
  • R a and R b are independently selected from H, Ci-Cg alky l, substituted Ci-Ce alky l, Ci-Ce alkeny l, substituted Ci-Ce alkeny l, acetyl, formyl, or together form a 5-7 -membered heterocycle; excluding where X is O, R 4C is NH2 and R bC is H (unmodified cytosine).
  • modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines. alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines.
  • modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine. 2-aminoadenine. 6-N-methylguanine, 6-N-methyladenine. 2-propyladenine. 2- thiouracil.
  • nucleobases include tricyclic pyrimidines, such as 1.3-diazaphenoxazine- 2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp).
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30.
  • each nucleobase of a modified oligonucleotide of the invention is selected from A, G. C, T, U. and m C.
  • each nucleobase of a modified oligonucleotide of the invention is selected from A. G, T, and m C (i.e., unmodified purines and 5-methyl pyrimidines).
  • RNA and DNA are a 3' to 5' phosphodiester linkage.
  • nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages.
  • the two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom.
  • Modified intemucleoside linkages compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide.
  • intemucleoside linkages having a chiral atom can be prepared as a racemic mi xture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
  • a modified intemucleoside linkage is any of those described in WO2021/030778, incorporated by reference herein.
  • a modified intemucleoside linkage comprises the formula: o
  • X is selected from O or S
  • Ri is selected from H, Ci-Cg alkyl, and substituted Ci-Cg alkyl;
  • R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazolc, a substituted diazolc, a Ci-Cg alkoxy, Ci-Cg alkyl, Ci-C 6 alkenyl. Ci-C 6 alkynyl, substituted Ci-Cg alkyl, substituted Ci-Cg alkeny l substituted Ci-Cg alkynyl, and a conjugate group;
  • R3 is selected from an aryl, a substituted ary l, CH 3 , N(CH 3 )2, OCH 3 and a conjugate group;
  • R4 is selected from OCH 3 , OH, Ci-Cg alkyl, substituted Ci-Cg alkyd and a conjugate group; and R 5 is selected from OCH 3 , OH, Ci-C 6 alky l, and substituted Ci-C 6 alky l.
  • a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group which has the formula:
  • the mesyl phosphoramidate intemucleoside linkage comprises a chiral center.
  • modified oligonucleotides comprise (Rp) and/or O'p) mesyl phosphoramidates. which are shown in the following formulas, respectively , wherein “B” indicates a nucleobase:
  • a phosphorothioate intemucleoside linkage may comprise a chiral center.
  • modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
  • Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates.
  • Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising such intemucleoside linkages in particular stereochemical configurations.
  • populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of tire phosphorothioate intemucleoside linkages are stereorandom.
  • populations of modified oligonucleotides comprise mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom.
  • modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each intemucleoside linkage having a chiral center. Nonetheless, each individual intemucleoside linkage having a chiral center of each individual oligonucleotide molecule has a defined stereoconfiguration.
  • populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and/or mesyl phosphoramidate intemucleoside linkages, each independently in a particular, independently selected stereochemical configuration.
  • the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population.
  • the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, tire particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population.
  • Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nucleic Acids Res. 42, 13456 (2014). and WO 2017/015555.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and/or mesyl phosphoramidate in the (Sp) configuration.
  • a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and/or mesyl phosphoramidate in the (Rp) configuration.
  • intemucleoside linkages having chiral centers of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
  • Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxanc).
  • modified oligonucleotides comprise one or more inverted nucleoside, as shown below: wherein each Bx independently represents any nucleobase.
  • an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present.
  • additional features such as a conjugate group may be attached to the inverted nucleoside.
  • Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
  • nucleic acids can be linked 2’ to 5’ rather than tire standard 3’ to 5’ linkage. Such a linkage is illustrated below. wherein each Bx represents any nucleobase.
  • modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases. and intemucleoside linkages are each independent of one another.
  • a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
  • oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif.
  • sugar motifs include but are not limited to any of the sugar modifications discussed herein.
  • modified oligonucleotides comprise a deoxy region.
  • each nucleoside of the deoxy region is a 2’-p-D-deoxynucleoside.
  • the deoxy region consists of 5-12 linked nucleosides.
  • the deoxy region consists of 6. 7, 8, 9, 10, or 6-10 linked nucleosides.
  • at least one nucleoside within tire deoxy region comprises a modified sugar moiety.
  • exactly one nucleoside within the deoxy region comprises a modified sugar moiety'.
  • two or three nucleosides within the deoxy region comprise a modified sugar moiety.
  • the deoxy region is flanked on the 5 ’-side by a 5 ’-region consisting of linked 5 ’-region nucleosides and on the 3 ’-side by a 3 ‘-region consisting of linked 3‘-region nucleosides; wherein the 3 ‘-most nucleoside of the 5’-region is a modified nucleoside and the 5‘-most nucleoside of the 3‘-region is a modified nucleoside. At least one nucleoside of the 5 ’-region comprises a modified sugar moiety'; and at least one nucleoside of the 3 ’-region comprises a modified sugar moiety.
  • the three regions form a contiguous sequence of nucleosides.
  • the sugar moiety of tire 3 ’ -most nucleoside of the 5 ’ -region and the sugar moiety of the 5 ’-most nucleoside of the 3 ’-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5 ’-region, the deoxy region, and the 3’- region.
  • each nucleoside of the 5 ’-region and each nucleoside of tire 3 ’-region comprises a modified sugar moiety .
  • the nucleosides within tire 5 ‘-region comprise tire same sugar modification. In certain embodiments, the nucleosides within the 5 ’-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides within tire 3 ’-region comprise the same sugar modification. In certain embodiments, the nucleosides w ithin the 3’-region comprise two or more different sugar modifications.
  • the 5 ’-region and the 3 ’-region of a modified oligonucleotide each comprises 1-8 nucleosides. In certain embodiments, the 5 ’-region comprises 1-7 nucleosides. In certain embodiments, the 5 ’-region comprises 1-6 nucleosides. In certain embodiments, the 5’-region comprises 1, 2, 3, 4, 5. 6, 7, or 8 nucleosides. In certain embodiments, the 3 ’-region comprises 1-7 nucleosides. In certain embodiments, the 3 ’-region comprises 1-6 nucleosides. In certain embodiments, the 3 ’-region comprises 1, 2, 3. 4, 5, 6, 7, or 8 nucleosides.
  • modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or ‘"wings” and a central or internal region or “gap.”
  • the three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap.
  • the sugar moieties of the nucleosides of each wing that are closest to the gap differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e.. the wing/gap junction).
  • the sugar moieties within the gap are the same as one another.
  • the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap.
  • the sugar motifs of the two wings are the same as one another (symmetric gapmer).
  • the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
  • the wings of a gapmer comprise 1-6 nucleosides.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety.
  • at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety'.
  • at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety'.
  • at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety'.
  • the gap of a gapmer comprises 7-12 nucleosides.
  • each nucleoside of the gap of a gapmer comprises a 2’-p-D-deoxyribosyl sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • the gapmer is a deoxy gapmer.
  • tire nucleosides on the gap side of each wing/gap junction comprise 2’-p-D-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap j miction comprise modified sugar moieties.
  • each nucleoside of the gap comprises a 2’-p-D-deoxyribosyl sugar moiety.
  • each nucleoside of each wing of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
  • at least one nucleoside of the gap of a gapmer comprises a 2’-0Me sugar moiety'.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif.
  • each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety.
  • each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety.
  • modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, w herein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif.
  • a fully modified oligonucleotide is a uniformly modified oligonucleotide.
  • each nucleoside of a uniformly modified oligonucleotide comprises tire same 2 ’-modification.
  • the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5 ’ -w ing] - [# of nucleosides in the gap] - [# of nucleosides in the 3 ’ -w ing] .
  • a 3 - 10-3 gapmer consists of 3 linked nucleosides in each w ing and 10 linked nucleosides in the gap.
  • that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2 ’-P-D-deoxy ribosyl sugar moieties.
  • a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing. 10 linked 2’- P-D-deoxynucleosides in the gap. and 5 linked 2’-MOE nucleosides in the 3’-wing.
  • a 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’- P-D- deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing.
  • a 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked 2’-P-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3 ’-wing.
  • a 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5 ’ - and/or the 3 ’ -wing, two different modified sugar moieties in the gap region, or a combination thereof.
  • modified oligonucleotides disclosed herein are modified by a specific sugar modification.
  • modified oligonucleotides are 5-10-5 MOE gapmers.
  • modified oligonucleotides are 3-10-3 BNA gapmers.
  • modified oligonucleotides are 3-10-3 cEt gapmers.
  • modified oligonucleotides are 3-10-3 LNA gapmers.
  • modified oligonucleotides are 3-10-4 cEt gapmers.
  • modified oligonucleotides are 4-10-3 cEt gapmers.
  • modified oligonucleotides are 4-10-4 cEt gapmers.
  • modified oligonucleotides are 6-10-4 MOE gapmers.
  • modified oligonucleotides disclosed herein are modified by two or more sugar modifications.
  • modified oligonucleotides are 3-10-3 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties.
  • modified oligonucleotides are 3-10-4 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2‘-p-D-deoxyribosyl sugar moieties.
  • modified oligonucleotides are 3-10-5 mixed gapmers, wherein each nucleoside within tire 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’- MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties.
  • modified oligonucleotides are 4-9-4 mixed gapmers, wherein each nucleoside within tire 5’ and the 3 ’ wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties.
  • modified oligonucleotides are 5-10-5 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2‘-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties.
  • modified oligonucleotides arc 6-10-4 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2 ’-p-D-deoxy ribosyl sugar moieties.
  • modified oligonucleotides disclosed herein are modified by two or more sugar modifications within the gap region.
  • modified oligonucleotides are 3-10-3 mixed gapmers, wherein each nucleoside within tire 5’ and the 3’ wings comprises a 2’-cEt sugar moiety, and each nucleoside within the gap comprises a sugar moiety selected from a 2’-OMe sugar moiety or a 2’-P-D-deoxyribosyl sugar moiety.
  • modified oligonucleotides are 5-10-5 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a 2 ’-MOE sugar moiety, and each nucleoside within the gap comprises a sugar moiety selected from a 2’-p-D-deoxyxylosyl sugar moiety, a 2’-a-L-deoxyribosyl sugar moiety, and 2’-P-D-deoxyribosyl sugar moiety.
  • modified oligonucleotides have a sugar motif selected from 5’ - kkkdddddddddddddkkk - 3’, 5’- kkkddddddddddkkkk -3’. 5’ - kkkkddddddddddddkkk -3’, 5’- kkkkdddddddddddkkkk -3’, 5’- kkkkkdddddddddddkkkkk -3’, 5’ - kkkdydddddddddkkk -3’, 5’ - kkkddddddddddkeee -3’.
  • modified oligonucleotides have a sugar motif of 5’- eeeeeddddddddddeeee -3’, wherein each "e” represents a 2’-M0E sugar moiety, and each “d” represents a 2’-P-D-deoxyribosyl sugar moiety.
  • modified oligonucleotides have a sugar motif of 5’- eeeeeeddddddddddeeee -3’, wherein each "e” represents a 2’-M0E sugar moiety, and each “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
  • oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each nucleobase is modified.
  • none of the nucleobases are modified.
  • each purine or each pyrimidine is modified.
  • each adenine is modified.
  • each guanine is modified.
  • each thymine is modified.
  • each uracil is modified.
  • each cytosine is modified.
  • cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of tire modified oligonucleotide are unmodified nucleobases.
  • modified oligonucleotides comprise a block of modified nucleobases.
  • the block is at the 3 ’-end of the oligonucleotide.
  • the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide.
  • the block is at tire 5 ‘-end of the oligonucleotide. In certain embodiments tire block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
  • oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase.
  • one nucleoside comprising a modified nucleobase is in tire central gap of an oligonucleotide having a gapmer motif.
  • the sugar moiety of said nucleoside is a 2’- p-D- dcoxynbosyl sugar moiety.
  • the modified nucleobase is selected from a 2-thiopyrimidinc and a 5 -propynepyrimidine .
  • oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif.
  • each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage.
  • each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (7?p) phosphorothioate.
  • the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified.
  • the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages.
  • the terminal intemucleoside linkages are modified.
  • the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages.
  • all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates. and the gap comprises at least one Sp. Sp. or Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
  • modified oligonucleotides have an intemucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups.
  • one or more phosphorothioate intemucleoside linkages or one or more phosphodiester intemucleoside linkages of tire intemucleoside linkage motifs herein is substituted with a mesyl phosphoramidate linking group.
  • modified oligonucleotides have an intemucleoside linkage motif of 5’- soossssssssos -3’, 5’- soosssssssssoos -3’, 5’- sooossssssssos -3’. 5’- sooosssssssssoos -3’.
  • modified oligonucleotides have an intemucleoside linkage motif of 5'- ssssszzssssss -3’. wherein each “s’’ represents a phosphorothioate intemucleoside linkage and each "z " represents a mesyl phosphoramidate intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of 5’- ssooszssssszssoss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside linkage, and each “z” represents a mesyl phosphoramidate intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of 5’- ssssszzzzsssssssss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “z” represents a mesyl phosphoramidate intemucleoside linkage.
  • modified oligonucleotides have an intemucleoside linkage motif of 5’- sooooossssssssoss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • oligonucleotide it is possible to increase or decrease the length of an oligonucleotide without eliminating activity.
  • Woolf et al. Proc. Natl. Acad. Sci. USA 89:7305-7309. 1992
  • a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model.
  • Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches.
  • target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
  • oligonucleotides can have any of a variety of ranges of lengths.
  • oligonucleotides consist of X to Y linked nucleosides, where X represents tire fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range.
  • X and Y are each independently selected from 8, 9, 10, 11, 12. 13, 14, 15. 16, 17, 18, 19. 20, 21, 22. 23, 24. 25, 26, 27, 28. 29, 30, 31. 32, 33, 34, 35. 36, 37, 38. 39, 40, 41, 42. 43, 44, 45. 46, 47, 48, 49. and 50; provided that X ⁇ Y.
  • oligonucleotides consist of 12 to 13, 12 to 14. 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30. 13 to 14, 13 to 15, 13 to 16. 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19. 14 to 20, 14 to 21, 14 to 22.
  • oligonucleotides consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.
  • the above modifications are incorporated into a modified oligonucleotide.
  • modified oligonucleotides are characterized by their modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications.
  • the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif.
  • sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
  • Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population.
  • the modified oligonucleotides of a chirally enriched population are enriched for 0-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom.
  • the modified oligonucleotides of a chirally enriched population are enriched for both p-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
  • oligonucleotides (or portions thereof) have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (or portion thereof), such as a target nucleic acid.
  • tire nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or identified reference nucleic acid (or portion thereof), such as a target nucleic acid.
  • arc oligomeric compounds which comprises an oligonucleotide and optionally one or more conjugate groups and/or terminal groups.
  • a conjugate group consists of a conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached to either or both ends of an oligonucleotide (such conjugate groups are also terminal groups). In certain such embodiments, conjugate groups or terminal groups are attached at the 3 ’ and/or 5 ’-end of oligonucleotides.
  • oligonucleotides are covalently attached to one or more conjugate groups.
  • conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
  • conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide.
  • the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide.
  • the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand.
  • a ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety.
  • RRMS ribose replacement modification subunit
  • a cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur.
  • the cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings.
  • the cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds.
  • the modified oligonucleotide is a gapmer.
  • conjugate groups impart a new property on the attached oligonucleotide, e.g. , Ihiorophores or reporter groups that enable detection of the oligonucleotide.
  • Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al.. Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett.. 1994, 4. 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.
  • a phospholipid e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucleic Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim.
  • a phospholipid e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-O-hexadecyl
  • a conjugate group consists of a lipid and a conjugate linker.
  • a conjugate group is a phosphate linked lipid having the following structure:
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties. polyethylene glycols, thioethers, poly ethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen. (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod. flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin. a barbiturate, a cephalosporin, a sulfa dmg. an antidiabetic, an antibacterial or an antibiotic.
  • active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen. (S)-(+)-pranoprofen
  • conjugate moieties are selected from any of C22 alkyl, C20 alkyl, C16 alkyl. CIO alkyl. C21 alkyl. C19 alkyl. C18 alkyl. C17 alkyl. C15 alkyl. C14 alkyl. C13 alkyl. C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl. C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl.
  • Cll alkenyl. C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
  • conjugate moieties are selected from any of C22 alkyl.
  • Conjugate moieties are attached to oligonucleotides through conjugate linkers.
  • tire conjugate linker is a single chemical bond (i.e. , the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a drain structure, such as a hydrocarbyl drain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises pyrrolidine.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, Hie conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyd and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety . In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, tire conjugate linker includes at least one neutral linking group.
  • conjugate linkers including the conjugate linkers described above, arc bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety’ include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxy lic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • ADO 8-amino-3,6-dioxaoctanoic acid
  • SMCC succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate
  • AHEX or AHA 6-aminohexanoic acid
  • conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzy l, phenyl, nitro, thiol, thioalkoxy 7 , halogen, alkyl, ary l, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methylcytosine. 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and tire oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides. those linker-nucleosides are not counted toward tire length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for tire reference nucleic acid.
  • an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide.
  • the total number of contiguous linked nucleosides in such an oligomeric compound is more than 30.
  • an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30.
  • conjugate linkers comprise no more than 10 linker-nucleosides.
  • conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linkcr-nuclcosidc.
  • a conjugate group it is desirable for a conjugate group to be cleaved from tire oligonucleotide.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that tire conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two. three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker-nucleosides.
  • the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • such cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2'-deoxyadenosine.
  • a conjugate group comprises a cell-targeting moiety.
  • the celltargeting moiety targets neurons.
  • the cell-targeting moiety targets a neurotransmitter receptor.
  • the cell targeting moiety targets a neurotransmitter transporter.
  • the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.
  • conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR 1 and CD71).
  • TfR transferrin receptor
  • a conjugate group described herein comprises an anti-TfRl antibody or fragment thereof.
  • the conjugate group comprises a protein or peptide capable of binding TfRl.
  • the conjugate group comprises an aptamer capable of binding TfRl .
  • the anti-TfRl antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991/004753; W02013/103800; WO2014/144060; WO2016/081643; WO2016/179257; WO2016/207240; WO2017/221883; WO2018/129384; WO2018/124121; WO2019/151539; WO2020/132584; W02020/028864; US 7,208,174; US 9,034,329; and US 10,550,188.
  • a fragment of an anti-TfRl antibody is F(ab')2, Fab, Fab', Fv, or scFv.
  • tire conjugate group comprises a protein or peptide capable of binding TfRl.
  • tire protein or peptide capable of binding TfRl can be any known in the art including but not limited to those described in W02019/140050; W02020/037150; W02020/124032; and US 10,138,483.
  • the conjugate group comprises an aptamer capable of binding TfRl.
  • tire aptamer capable of binding TfRl can be any known in tire art including but not limited to those described in WO2013/163303; WO2019/033051; and WO2020/245198.
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates.
  • terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides.
  • a terminal group comprises an inverted abasic sugar moiety’.
  • the inverted abasic sugar moiety may be further attached to a conjugate group.
  • terminal groups comprise one or more 2’-linked nucleosides or sugar moieties.
  • the 2’-linked group is an abasic sugar moiety.
  • Such terminal abasic sugar moieties can be attached to either or both ends of an oligonucleotide.
  • oligomeric compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity.
  • an oligomeric compound forms an oligomeric duplex with a second oligomeric compound comprising a complementary nucleobase sequence.
  • Such oligomeric compounds and oligomeric duplexes are antisense compounds.
  • antisense compounds are deemed to have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 50% or more in the standard in vitro assay.
  • antisense compounds selectively affect one or more target nucleic acid.
  • Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
  • hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid.
  • certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid.
  • RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex.
  • the DNA in such an RNA:DNA duplex need not be unmodified DNA.
  • described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity.
  • one or more non-DNA-like nucleoside in tire gap of a gapmer is tolerated.
  • an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of tire target nucleic acid.
  • RISC RNA-induced silencing complex
  • certain antisense compounds result in cleavage of the target nucleic acid by Argonaute.
  • Antisense compounds that are loaded into RISC are RNAi agents.
  • RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).
  • hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
  • Antisense activities may be observed directly or indirectly.
  • observ ation or detection of an antisense activity involves observ ation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
  • oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid.
  • the target nucleic acid is an endogenous RNA molecule.
  • the target nucleic acid encodes a protein.
  • the target nucleic acid is selected from: a mature mRNA and a pre-mRNA. including intronic, exonic and untranslated regions.
  • the target RNA is a mature mRNA.
  • the target nucleic acid is a pre- mRNA.
  • the target region is entirely within an intron.
  • the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron.
  • the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
  • oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%. 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or hilly complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20. 10 to 18, or 18 to 20 nucleobases in length.
  • oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid.
  • antisense activity against the target is reduced by such mismatch, but activity' against a non-target is reduced by a greater amount.
  • selectivity of the oligonucleotide is improved.
  • a mismatch is specifically positioned within an oligonucleotide having a gapmer motif.
  • the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of tire gap region.
  • tire mismatch is at position 9, 8, 7, 6. 5, 4, 3, 2, 1 from tire 3 ‘-end of the gap region.
  • tire mismatch is at position 1, 2, 3, or 4 from the 5 ’-end of the wing region.
  • the mismatch is at position 4, 3, 2, or 1 from the 3 -end of the wing region.
  • oligomeric compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary' to a target nucleic acid, wherein tire target nucleic acid is SNCA.
  • the oligomeric compounds may target the SNCA nucleic acid.
  • tire SNCA nucleic acid has the sequence set forth in SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022), SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1), SEQ ID NO: 4 (Ensembl ID ENST00000618500.4, Ensembl release 106-Apr 2022), SEQ ID NO: 5 (GENBANK Accession No: NM 000345.3). SEQ ID NO: 6 (GENBANK Accession No: JN709863.1), SEQ ID NO: 7 (GENBANK Accession No: BC013293.2). SEQ ID NO: 8 (GENBANK Accession No:
  • contacting a cell in a subject with an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 ameliorates one or more symptoms or hallmarks of a synucleinopathy.
  • the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • the one or more symptoms or hallmarks include Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease.
  • the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • DLB dementia with Lewy bodies
  • DMD dementia with Lewy bodies
  • MSA multiple system atrophy
  • neuronopathic Gaucher's disease or Alzheimer’s disease.
  • the subject lias dementia with Levy bodies DLB. In certain embodiments, the subject lias diffuse Lewy body disease. In certain embodiments, the subject lias Parkinson’s disease dementia (PDD). In certain embodiments, the subject has pure autonomic failure. In certain embodiments, the subject lias multiple system atrophy (MSA). In certain embodiments, the subject has neuronopathic Gaucher’s disease. In certain embodiments, the subject lias Alzheimer’s disease.
  • a method for treating a synucleinopathy comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid.
  • the subject has or is at risk for developing a synucleinopathy.
  • the subject has or is at risk for developing Parkinson’s disease, dementia with Lewy 7 bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • the subject has Parkinson’s disease.
  • the subject has multiple system atrophy (MSA). Tn certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, at least one symptom or hallmark of the synucleinopathy is ameliorated. In certain embodiments, the at least one symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
  • MSA system atrophy
  • a method of reducing expression of SNCA, for example RNA, or reducing tire expression of alpha-synuclein protein in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid.
  • the subject has or is at risk for developing a synucleinopathy.
  • the subject has or is at risk for developing Parkinson’s disease, dementia with Lew bodies (DLB). diffuse Lewy body disease.
  • Parkinson’s disease dementia PPD
  • pure autonomic failure multiple system atrophy
  • MSA multiple system atrophy
  • the subject has Alzheimer’s disease.
  • tire cell is a brain cell.
  • the cell is a neuron.
  • the cell is an oligodendrocyte.
  • the cell is a human cell.
  • Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid, for use in treating a synucleinopathy or for use in the manufacturing of a medicament for treating a synucleinopathy .
  • the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
  • the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or tire antisense agent can be any described herein.
  • compositions comprising one or more oligomeric compounds.
  • the one or more oligomeric compounds each consists of a modified oligonucleotide.
  • the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier.
  • a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound.
  • the sterile saline is pharmaceutical grade saline.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile w ater.
  • the sterile w ater is pharmaceutical grade w ater.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate- buffered saline (PBS).
  • PBS phosphate- buffered saline
  • the sterile PBS is pharmaceutical grade PBS.
  • a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid ('‘artificial CSF” or “aCSF”).
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF).
  • a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid.
  • a pharmaceutical composition consists essentially of a modified oligonucleotide and artificial cerebrospinal fluid.
  • the artificial cerebrospinal fluid is pharmaceutical grade.
  • aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate.
  • the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.
  • compositions comprise one or more oligomeric compound and one or more excipients.
  • excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone .
  • oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
  • compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters.
  • pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof.
  • the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.
  • pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts.
  • Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts.
  • prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within tire body.
  • oligomeric compounds are lyophilized and isolated as sodium salts.
  • tire sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent.
  • the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF.
  • the sodium salt of an oligomeric compound is mixed with PBS.
  • the sodium salt of an oligomeric compound is mixed with aCSF.
  • Lipid moieties have been used in nucleic acid therapies in a variety of methods.
  • the nucleic acid such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids.
  • DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue.
  • a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
  • compositions comprise a delivery system.
  • delivery systems include, but are not limited to. liposomes and emulsions.
  • Certain delivery systems are useful for preparing certain pharmaceutical compositions including those comprising hydrophobic compounds.
  • certain organic solvents such as dimethylsulfoxide are used.
  • compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types.
  • pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
  • compositions comprise a co-solvent system.
  • co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase.
  • co-solvent systems are used for hydrophobic compounds.
  • a non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80TM and 65% w/v polyethylene glycol 300.
  • the proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics.
  • co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80TM; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
  • compositions are prepared for oral administration.
  • pharmaceutical compositions are prepared for buccal administration.
  • a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.).
  • a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer.
  • other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives).
  • injectable suspensions are prepared using appropriate liquid carriers, suspending agents and tire like.
  • compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.
  • Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • Certain solvents suitable for use in pharmaceutical compositions for injection include, but arc not limited to, lipophilic solvents and fatty oils, such as sesame oil, sy nthetic fatty acid esters, such as ethyl oleate or trigly cerides, and liposomes.
  • certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms.
  • a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.
  • modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
  • a dose may be in the form of a dosage unit.
  • a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound.
  • the free acid is in equilibrium with anionic and salt forms.
  • the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
  • a modified oligonucleotide or an oligomeric compound may be partially or fully deprotonated and in association with sodium ions.
  • tire mass of the protons is nevertheless counted toward tire weight of the dose, and tire mass of the sodium ions is not counted toward tire weight of the dose.
  • a dose, or dosage unit, of 10 mg of Compound No. 1482139 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1482139.
  • tire modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium.
  • aCSF a solution
  • tire modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium.
  • the mass of the protons is nevertheless counted toward the weight of the dose, and tire mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of tire dose.
  • tire mass of the conjugate group may be included in calculating the dose of such oligomeric compound. If tire conjugate group also has an acid, tire conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
  • an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16. at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-3334.
  • the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
  • an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12. at least 13, at least 14, at least 15, at least 16. at least 17. at least 18, at least 19, or 20 contiguous nucleobases of 5’- ACAGATATTTTTGTTCTGCC -3 ’ (SEQ ID NO: 3318).
  • the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-(3-D-deoxyxylosyl sugar moiety, and a 2’-a-L-deoxyribosyl sugar moiety'.
  • the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • At least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
  • the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3318.
  • tire modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2‘-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety.
  • the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5 -methylcytosine.
  • the modified oligonucleotide lias a nucleobase sequence of SEQ ID NO: 3318.
  • the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “c” is a 2 ’-MOE sugar moiety and each “d” is a 2’-p-D-dcoxyribosyl sugar moiety.
  • the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssssszzzzsssssssss, wherein each “s” is a phosphorothioate intemucleoside linkage and each “z” is a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • at least one cytosine of the modified oligonucleotide is a modified cytosine.
  • each cytosine of the modified oligonucleotide is a 5-methylcytosine.
  • the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2 ’-MOE sugar moiety and each “d” is a 2’-P-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssssszzsssszzssssss.
  • each “s” is a phosphorothioate intemucleoside linkage and each “z” is a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • at least one cytosine of the modified oligonucleotide is a modified cytosine.
  • each cytosine of the modified oligonucleotide is a 5-methylcytosine.
  • an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12. at least 13, at least 14, at least 15, at least 16, at least 17. at least 18, at least 19, or 20 contiguous nucleobases of 5’- ACGACATTTTCTTGCCTCTT -3 ’ (SEQ ID NO: 3319).
  • the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-
  • the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • At least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, tire oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
  • the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3319. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5‘ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2‘-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cy tosine of the modified oligonucleotide is a 5-mcthylcytosinc.
  • the modified oligonucleotide lias a nucleobase sequence of SEQ ID NO: 3319.
  • the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2 ’-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety.
  • the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssooszssssszssoss, wherein each “s” is a phosphorothioate intemucleoside linkage, each “o” is a phosphodiester intemucleoside linkage, and each “z” is a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • at least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • at least one cytosine of the modified oligonucleotide is a modified cytosine.
  • each cytosine of the modified oligonucleotide is a 5-methylcytosine.
  • an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16. at least 17, at least 18, at least 19, or 20 contiguous nucleobases of 5’- ATCACGACATTTTCTTGCCT -3’ (SEQ ID NO: 3328).
  • the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
  • the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-(3-D-deoxyxylosyl sugar moiety, and a 2’-a-L-deoxyribosyl sugar moiety.
  • the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase.
  • At least one nucleobase of the modified oligonucleotide is a modified nucleobase.
  • the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
  • the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeeddddddddddeeee, wherein each “e” is a 2’-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
  • each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of tire modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
  • the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeeddddddddddeeee, wherein each “e” is a 2‘-MOE sugar moiety and each “d” is a 2 ’-p-D-deoxy ribosyl sugar moiety.
  • the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5‘ to 3’) sooooossssssssoss, wherein each “s’’ is a phosphorothioate intemucleoside linkage and each “o” is a phosphodicstcr intemucleoside linkage.
  • each nucleobase of tire modified oligonucleotide is an unmodified nucleobase.
  • at least one nucleobase of tire modified oligonucleotide is a modified nucleobase.
  • at least one cytosine of tire modified oligonucleotide is a modified cytosine.
  • each cytosine of the modified oligonucleotide is a 5-methylcytosine.
  • an oligomeric compound according to the following chemical notation: N 1 e S ln Ce S A es Ge S A es T dz A dz T dz T dz T*T ds T ds G ds T ds T ds m Ce S T es Ge S ln Ce S N 2 e (SEQ ID NO: 3346), wherein:
  • A an adenine nucleobase
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • N 1 is an adenine nucleobase. In certain embodiments. N 1 is an unmodified adenine.
  • N 1 is a modified adenine. In certain embodiments, N 1 is a hypoxanthine. In certain embodiments. N 1 is an abasic sugar moiety. In certain embodiments. N 1 is a terminal group. In certain embodiments. N 1 is absent. In certain embodiments, N 2 is a modified cytosine. In certain embodiments. N 2 is 5-methylcytosine. In certain embodiments, N 2 is an unmodified cytosine. In certain embodiments, N 2 is an abasic sugar moiety. In certain embodiments, N 2 is a terminal group. In certain embodiments. N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine.
  • N 3 is an abasic sugar moiety. In certain embodiments, N 3 is a terminal group. In certain embodiments. N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a tenninal group. In certain embodiments.
  • N 1 is an adenine nucleobase and N 2 is absent.
  • N 1 is a modified adenine and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a tenninal group, or is absent.
  • N 1 is a modified adenine and N 2 is a modified cytosine.
  • N 1 is a modified adenine and N 2 is 5- methylcytosine.
  • N 1 is a modified adenine and N 2 is an abasic sugar moiety.
  • N 1 is a modified adenine and N 2 is a tenninal group.
  • N 1 is a modified adenine and N 2 is absent.
  • N 1 is a hypoxanthine and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a hypoxanthine and N 2 is a modified cytosine.
  • N 1 is a hypoxanthine and N 2 is 5-methylcytosine.
  • N 1 is a hypoxanthine and N 2 is an abasic sugar moiety .
  • N 1 is a hypoxanthine and N 2 is a tenninal group.
  • N 1 is a hypoxanthine and N 2 is absent.
  • N 1 is an abasic sugar moiety and N 2 is a cytosine nucleobase, a modified cy tosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a terminal group and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety', a tenninal group, or is absent.
  • N 1 is absent and N 2 is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety', a terminal group, or is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase.
  • N 1 is an adenine nucleobase and N 3 is a modified thymine.
  • N 1 is an adenine nucleobase and N 3 is an abasic sugar moiety.
  • N 1 is an adenine nucleobase and N 3 is a terminal group.
  • N 1 is an adenine nucleobase and N 3 is absent. In certain embodiments. N 1 is a modified adenine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a modified adenine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine and N 3 is an abasic sugar moiety. In certain embodiments. N 1 is a modified adenine and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine and N 3 is absent.
  • N 1 is a hypoxanthine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a hypoxanthine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a hypoxanthine and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a hypoxanthine and N 3 is a terminal group. In certain embodiments, N 1 is a hypoxanthine and N 3 is absent. In certain embodiments, N 1 is an abasic sugar moiety and N 3 is a thymine nucleobase.
  • N 1 is a terminal group and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is absent and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is absent and N 3 is absent.
  • an oligomeric compound according to the following chemical notation: N 1 e S m Ce S GeoAeo m Ce S AdzTd s Td s T*Td s m Cd s Td s TdzGd s m Cd s m Ce S T eo m Ce S Te S N 3 e (SEQ ID NO: 3347).
  • A an adenine nucleobase.
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • d a 2’-p-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • z a mesyl phosphoramidate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage
  • the oligomeric compound optionally comprises a conjugate group.
  • N 1 is an adenine nucleobase.
  • N 1 is an unmodified adenine. In certain embodiments, N 1 is a modified adenine. In certain embodiments, N 1 is a hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety . In certain embodiments, N 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine. In certain embodiments, N 2 is 5-methylcytosine. In certain embodiments, N 2 is an unmodified cytosine. In certain embodiments, N 2 is an abasic sugar moiety. In certain embodiments, N 2 is a terminal group. In certain embodiments, N 2 is absent.
  • N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. In certain embodiments, N 3 is an abasic sugar moiety. In certain embodiments, N 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments. N 1 is an adenine nucleobase and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase and N 2 is an abasic sugar moiety.
  • N 1 is an adenine nucleobase and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase and N 2 is absent. In certain embodiments. N 1 is a modified adenine and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a modified adenine and N 2 is a modified cytosine. In certain embodiments, N 1 is a modified adenine and N 2 is 5- methylcytosine. In certain embodiments. N 1 is a modified adenine and N 2 is an abasic sugar moiety.
  • N 1 is a modified adenine and N 2 is a terminal group. Tn certain embodiments. N 1 is a modified adenine and N 2 is absent. In certain embodiments, N 1 is a hypoxanthine and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a hypoxanthine and N 2 is a modified cytosine. In certain embodiments, N 1 is a hypoxanthine and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a hypoxanthine and N 2 is an abasic sugar moiety.
  • N 1 is a hypoxanthine and N 2 is a terminal group. In certain embodiments, N 1 is a hypoxanthine and N 2 is absent. In certain embodiments, N 1 is an abasic sugar moiety and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a terminal group and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments.
  • N 1 is absent and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is absent and N 2 is absent. In certain embodiments. N 1 is an adenine nucleobase and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is an adenine nucleobase and N 3 is a thymine nucleobase. In certain embodiments, N 1 is an adenine nucleobase and N 3 is a modified thymine.
  • N 1 is an adenine nucleobase and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase and N 3 is a terminal group. In certain embodiments. N 1 is an adenine nucleobase and N 3 is absent. In certain embodiments, N 1 is a modified adenine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a modified adenine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine and N 3 is an abasic sugar moiety.
  • N 1 is a modified adenine and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine and N 3 is absent. In certain embodiments, N 1 is a hypoxanthine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a hypoxanthine and N 3 is an umnodified thymine. In certain embodiments, N 1 is a hypoxanthine and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a hypoxanthine and N 3 is a terminal group.
  • N 1 is a hypoxanthine and N 3 is absent.
  • N 1 is an abasic sugar moiety and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a terminal group and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 3 is absent.
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • N 1 is an adenine nucleobase. In certain embodiments. N 1 is an unmodified adenine. In certain embodiments. N 1 is a modified adenine. In certain embodiments. N 1 is a hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. In certain embodiments, N 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments. N 2 is a modified cytosine. In certain embodiments. N 2 is 5-methylcytosine.
  • N 2 is an unmodified cytosine. In certain embodiments, N 2 is an abasic sugar moiety. In certain embodiments, N 2 is a terminal group. In certain embodiments. N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine. In certain embodiments, N 3 is an abasic sugar moiety. In certain embodiments, N 3 is a terminal group. In certain embodiments. N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is an adenine nucleobase and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a terminal group. In certain embodiments. N 1 is an adenine nucleobase and N 2 is absent. In certain embodiments, N 1 is a modified adenine and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a modified adenine and N 2 is a modified cytosine.
  • N 1 is a modified adenine and N 2 is 5- methylcytosine. In certain embodiments, N 1 is a modified adenine and N 2 is an abasic sugar moiety. In certain embodiments. N 1 is a modified adenine and N 2 is a terminal group. In certain embodiments, N 1 is a modified adenine and N 2 is absent. In certain embodiments, N 1 is a hypoxanthine and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a hypoxanthine and N 2 is a modified cytosine.
  • N 1 is a hypoxanthine and N 2 is 5-methylcytosine. In certain embodiments, N 1 is a hypoxanthine and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is a hypoxanthine and N 2 is a terminal group. In certain embodiments, N 1 is a hypoxanthine and N 2 is absent. In certain embodiments, N 1 is an abasic sugar moiety and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a terminal group and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety’, a terminal group, or is absent.
  • N 1 is absent and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety , a terminal group, or is absent.
  • N 1 is absent and N 2 is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase. In certain embodiments, N 1 is an adenine nucleobase and N 3 is a modified thymine. In certain embodiments, N 1 is an adenine nucleobase and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase and N 3 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase and N 3 is absent. In certain embodiments.
  • N 1 is a modified adenine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a modified adenine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine and N 3 is an abasic sugar moiety. In certain embodiments. N 1 is a modified adenine and N 3 is a terminal group. In certain embodiments, N 1 is a modified adenine and N 3 is absent.
  • N 1 is a hypoxanthine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N 1 is a hypoxanthine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a hypoxanthine and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a hypoxanthine and N 3 is a terminal group. In certain embodiments, N 1 is a hypoxanthine and N 3 is absent. In certain embodiments, N 1 is an abasic sugar moiety and N 3 is a thymine nucleobase.
  • N 1 is a terminal group and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is absent and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is absent and N 3 is absent.
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase
  • T a thymine nucleobase
  • N 1 an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N 1 is absent its sugar and intemucleoside linkage are also absent,
  • N 1 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine.
  • N 1 is a modified adenine. In certain embodiments, N 1 is a hypoxanthine. In certain embodiments, N 1 is an abasic sugar moiety. In certain embodiments, N 1 is a terminal group. In certain embodiments, N 1 is absent. In certain embodiments, N 2 is a modified cytosine. In certain embodiments, N 2 is 5-methylcytosine. In certain embodiments, N 2 is an unmodified cytosine. In certain embodiments, N 2 is an abasic sugar moiety. In certain embodiments, N 2 is a terminal group. In certain embodiments, N 2 is absent. In certain embodiments, N 3 is a modified thymine. In certain embodiments, N 3 is an unmodified thymine.
  • N 3 is an abasic sugar moiety. In certain embodiments, N 3 is a terminal group. In certain embodiments, N 3 is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a modified cytosine. In certain embodiments, N 1 is an adenine nucleobase and N 2 is an abasic sugar moiety. In certain embodiments, N 1 is an adenine nucleobase and N 2 is a terminal group.
  • N 1 is an adenine nucleobase and N 2 is absent.
  • N 1 is a modified adenine and N 2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a modified adenine and N 2 is a modified cytosine.
  • N 1 is a modified adenine and N 2 is 5- methylcytosine.
  • N 1 is a modified adenine and N 2 is an abasic sugar moiety.
  • N 1 is a modified adenine and N 2 is a terminal group.
  • N 1 is a modified adenine and N 2 is absent.
  • N 1 is a hypoxanthine and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a hypoxanthine and N 2 is a modified cytosine.
  • N 1 is a hypoxanthine and N 2 is 5-methylcytosine.
  • N 1 is a hypoxanthine and N 2 is an abasic sugar moiety.
  • N 1 is a hypoxanthine and N 2 is a terminal group.
  • N 1 is a hypoxanthine and N 2 is absent.
  • N 1 is an abasic sugar moiety and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a terminal group and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 2 is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is an adenine nucleobase and N 3 is a thymine nucleobase.
  • N 1 is an adenine nucleobase and N 3 is a modified thymine.
  • N 1 is an adenine nucleobase and N 3 is an abasic sugar moiety.
  • N 1 is an adenine nucleobase and N 3 is a tenninal group. In certain embodiments. N 1 is an adenine nucleobase and N 3 is absent. In certain embodiments, N 1 is a modified adenine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N 1 is a modified adenine and N 3 is an unmodified thymine. In certain embodiments, N 1 is a modified adenine and N 3 is an abasic sugar moiety. In certain embodiments, N 1 is a modified adenine and N 3 is a tenninal group.
  • N 1 is a modified adenine and N 3 is absent.
  • N 1 is a hypoxanthine and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is a hypoxanthine and N 3 is an umnodified thymine.
  • N 1 is a hypoxanthine and N 3 is an abasic sugar moiety.
  • N 1 is a hypoxanthine and N 3 is a tenninal group, hr certain embodiments, N 1 is a hypoxanthine and N 3 is absent.
  • N 1 is an abasic sugar moiety and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a tenninal group, or is absent.
  • N 1 is a terminal group and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
  • N 1 is absent and N 3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a tenninal group, or is absent.
  • N 1 is absent and N 3 is absent.
  • Compound No. 1601260 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 6-15 are 2‘-p-D-deoxynucleosides, wherein tire intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15. 15 to 16, 16 to 17, 17 to 18.
  • 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7, 7 to 8, 8 to 9, and 9 to 10 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1601260 is represented by the following chemical notation:
  • A an adenine nucleobase
  • mC a 5-methylcytosine nucleobase
  • G a guanine nucleobase.
  • T a thymine nucleobase.
  • e a 2’-MOE sugar moiety
  • d a 2’-P-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • z a mesyl phosphoramidate intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
  • Compound No. 1601260 is represented by the following chemical structure: (SEQ ID NO: 3335) (Structure 1), or a pharmaceutically acceptable salt thereof.
  • Compound No. 1601260 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
  • the sodium salt of Compound No. 1601260 is represented by the following chemical structure:
  • Compound No. 1616039 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACGACATTTTCTTGCCTCTT (SEQ ID NO: 3319), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2'-f>-D-deoxynucleosides. wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 5 to 6, 7 to 8, 8 to 9. 9 to 10, 10 to 11, 11 to 12, 12 to 13, 14 to 15. 15 to 16, 16 to 17, 18 to 19.
  • phosphorothioate intemucleoside linkages wherein the intemucleoside linkages between nucleosides 3 to 4, 4 to 5, and 17 to 18 are phosphodiester intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7 and 13 to 14 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
  • G a guanine nucleobase
  • T a thymine nucleobase.
  • e a 2’-M0E sugar moiety
  • d a 2’-P-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • z a mesyl phosphoramidate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage
  • the compound does not include a conjugate group or a terminal group.
  • Compound No. 1616039 is represented by the following chemical structure:
  • the pharmaceutically acceptable salt of Compound No. 1616039 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
  • the sodium salt of Compound No. 1616039 is represented by the following chemical structure:
  • Compound No. 1616357 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 6-15 are 2'-[l-D-deo. ⁇ ynucleosides. wherein tire intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5. 5 to 6, 8 to 9, 9 to 10.
  • 10 to 11, 11 to 12, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7, 7 to 8, 12 to 13, and 13 to 14 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1616357 is represented by the following chemical notation:
  • T a thymine nucleobase.
  • e a 2’-MOE sugar moiety
  • d a 2’-P-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • z a mesyl phosphoramidate intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
  • SEQ ID NO: 333-7 (Structure 5), or a pharmaceutically acceptable salt thereof.
  • Compound No. 1616357 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
  • the sodium salt of Compound No. 1616357 is represented by the following chemical structure:
  • Compound No. 1620605 is characterized as a 6-10-4 MOE gapmer of linked nucleosides having a nuclcobasc sequence (from 5’ to 3’) of ATCACGACATTTTCTTGCCT (SEQ ID NO: 3328), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 7-16 are 2'-[l-D-deo. ⁇ ynucleosides.
  • tire intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
  • Compound No. 1620605 is represented by the following chemical notation:
  • G a guanine nucleobase
  • T a thymine nucleobase.
  • e a 2’-MOE sugar moiety
  • d a 2’-P-D-deoxyribosyl sugar moiety
  • s a phosphorothioate intemucleoside linkage
  • o a phosphodiester intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
  • the pharmaceutically acceptable salt of Compound No. 1620605 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
  • the sodium salt of Compound No. 1620605 is represented by the following chemical structure:
  • compound 827599 is a comparator compound and is previously described in WO 2019/164562.
  • Compound 827599 consists of the nucleobase sequence (from 5’ to 3’): ACAGATATTTTTGTTCTGCC, designated herein as SEQ ID NO: 3318.
  • the sugar motif for Compound No. 827599 is (from 5’ to 3 ’): cccccdddddddddddccccc; wherein each “d’‘ represents a 2'-[TD-dcoxyribosyl sugar moiety’, and each “c’‘ represents a 2‘- MOE sugar moiety’.
  • 827599 is (from 5’ to 3’): sosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine nucleobase in Compound No. 827599 is a 5-methylcytosine.
  • compound 763364 is a comparator compound and is previously described in WO 2019/164562.
  • Compound 763364 consists of the nucleobase sequence (from 5’ to 3’): ACGACATTTTCTTGCCTCTT, designated herein as SEQ ID NO: 3319.
  • the sugar motif for Compound No. 763364 is (from 5’ to 3 ’): eeeeeddddddddddeeee; wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety.
  • 763364 is (from 5’ to 3’): sooosssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine nucleobase in Compound No. 763364 is a 5-methylcytosine.
  • compounds described herein are superior relative to compounds described in WO2019/164562, because they demonstrate one or more improved properties, such as duration of action and potency.
  • Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each demonstrated a longer duration of action in vivo as compared to Compound No. 827599 in the assay shown in Example 13.
  • Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 achieved a 48%, 58%. and 60% reduction of human SNCA RNA. respectively, at day 224 post-dose.
  • Compound No. 827599 achieved a 0% reduction of human SNCA RNA at day 224 post-dose. Therefore, each of Compound No. 1601260.
  • Compound No. 1616357. and Compound No. 1616039 exhibited a longer duration of action compared to Compound No. 827599 in this assay.
  • Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each demonstrated improved potency in vivo compared to Compound No. 827599 (see Example 14) and to Compound No. 763364 (see Example 22).
  • Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 achieved an ED 5 o in the cortical brain tissue of 46 pg. 29pg. and 23 pg. respectively.
  • Compound No. 827599 achieved an ED 50 in the cortical brain tissue of 122pg
  • Compound No. 763374 achieved an ED 50 in the cortical brain tissue of 63pg.
  • each of Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 was more potent than Compound No. 827599 and Compound No. 763364 in these assays.
  • nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 16,692-16,716 of SEQ ID NO: 1 or within nucleobases 18,758-18,782 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides arc gapmers. In certain embodiments, modified oligonucleotides arc cEt gapmers. In certain embodiments, modified oligonucleotides arc MOE gapmers. In certain embodiments, modified oligonucleotides arc mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddddkkee, kkkddddddddddkeee, ekkddddddddddddkeeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2 ’-MOE sugar moiety, and ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety'.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos. soossssssssssssooos. sooosssssssssssos, sooossssssssssssoos.
  • nucleobase sequences of SEQ ID NOs: 78. 2564. 2697, 2747, 2789, 2936, 3063, 3081. 3142. 3189, and 3271 are complementary to an equal length portion within nucleobases 16,692-16.716 of SEQ ID NO: 1 or within nucleobases 18,758-18.782 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1483635. 1484499, 1485433. 1486327, 1486437, 1486657. 1535220, 1535277, 1535335, 1535391, 1535466. 1535496, 1535524. 1535578, and 1535629 are complementary to an equal length portion within nucleobases 16,692-16,716 of SEQ ID NO: 1 or within nucleobases 18.758-18,782 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 16.692-16,716 of SEQ ID NO: 1 or within nucleobases 18,758-18.782 of SEQ ID NO: 2 achieve at least 72% reduction of SNCA mRNA in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 16,692-16.716 of SEQ ID NO: 1 or within nucleobases 18.758-18,782 of SEQ ID NO: 2 achieve an average of 88.9% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2 are nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2
  • nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 18,568-18,593 of SEQ ID NO: 1 or within nucleobases 20,634-20,659 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers arc 4-10-3 cEt gapmers. In certain embodiments, the gapmers arc 4- 10-4 cEt gapmers. In certain embodiments, the gapmers arc 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkee, kkkddddddddddkeee, kkkddddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety 7 , “e” represents a 2’-M0E sugar moiety, and “d” represents a 2 -p-D- deoxyribosyl sugar moiety 7 .
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos, soosssssssssssooos. sooossssssssssssos, sooossssssssssssoos.
  • nucleobase sequences of SEQ ID NOs: 206, 231. 270, 316, 2486, 2558, 3041. 3076. 3137, 3184, and 3266 are complementary to an equal length portion within nucleobases 18.568-18,593 of SEQ ID NO: 1 or within nucleobases
  • nucleobase sequences of Compound Nos: 1482920. 1484352, 1534261, 1534329, 1534428, 1534460. 1535214, 1535272. 1535330, 1535386, 1535439. 1535460, 1535518. and 1535573 are complementaiy to an equal length portion within nucleobases 18,568-18.593 of SEQ ID NO: 1 or within nucleobases 20.634-20,659 of SEQ ID NO:
  • modified oligonucleotides complementaiy to an equal length portion within nucleobases 18.568-18,593 of SEQ ID NO: 1 or within nucleobases 20,634-20.659 of SEQ ID NO: 2 achieve at least 73% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 18,621-18,649 of SEQ ID NO: 1 or within nucleobases 20,687-20,715 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkcc, kkkddddddddddkccc, ckkddddddddddkccc, kkkdddddddddkkccc, or kkkdddddddkeeee; wherein “k” represents a cEt sugar moiety , “e’’ represents a 2’-MOE sugar moiety, and “d” represents a 2'-[i-D-deoxy ribosyl sugar moiety.
  • the intemucleoside linkages of tire modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos, soossssssssssooos.
  • sooossssssssssssssos sooosssssssssssssssos, soossssssssssssss, or soooosssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 64, 128, 289, 921. 2744, 2853, 2922, 3031, 3057, 3099, 3123. 3132. 3160, 3207, 3231, 3289, and 3313 are complementary to an equal length portion within nucleobases 18,621- 18,649 of SEQ ID NO: 1 or within nucleobases 20,687-20,715 of SEQ ID NO: 2.
  • 1535355, 1535381, 1535411 , 1535437, 1535455. 1535487, 1535513, 1535543, 1535568, 1535598. and 1535628 are complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2 achieve at least 61% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2 achieve an average of 85.7% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2 are nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2
  • nucleobases 18,721-18.752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, fire gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkee, kkkddddddddddkeee, ekkddddddddddddkeeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-[5-D-dcoxyribosyl sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intcmuclcosidc linkages and phosphodicstcr intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos, soossssssssssoos, soosssssssssooos.
  • sooossssssssssssssos sooossssssssssssssssssss, or soosssssssssssss; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 227, 427. 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176. and 3305 are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1482396, 1483241, 1485037, 1485579, 1486302, 1486305. 1533429, 1534037, 1534406, 1535257, 1535316. 1535372, 1535428, 1535446, 1535504, 1535615, and 1535621 are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 18,721-18.752 of SEQ ID NO: 1 or within nucleobases 20.787-20,818 of SEQ ID NO: 2 achieve at least 66% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2 achieve an average of 85.6% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 19.423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 19.423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21.509 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, tire gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for tire mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkdddddddddddkkee, kkkddddddddddkeee.
  • k represents a cEt sugar moiety
  • e‘‘ represents a 2‘-MOE sugar moiety
  • d represents a 2’-p-D- deoxyribosyl sugar moiety
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooosssssssssos, sooossssssssssoos, or soooossssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nuclcobasc sequences of SEQ ID NOs: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, and 3280 arc complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1484583, 1485328, 1485484, 1534314, 1534320, 1535215, 1535230, 1535287, 1535345, 1535401, 1535477. 1535533, and 1535588 are complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2 achieve at least 79% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2 achieve an average of 88.6% reduction of SNCA mRNA in the standard in vitro assay. 6. Nucleobases 19,555-19,575 of SEO ID NO: 1 or nucleobases 21,621-21,641 of SEO ID NO: 2
  • modified oligonucleotides comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 19,555-19.575 of SEQ ID NO: 1 or within nucleobases 21.621-21,641 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length.
  • modified oligonucleotides are gapmers.
  • modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkdddddddddkeee.
  • kkkdddddddddddddkkeee or kkkdddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 '): soosssssssssos, soosssssssssoos, soossssssssssooos, sooosssssssssoos, sooosssssssssssos, or soooossssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 205, 2594, 2686, 3028, 3097, 3158, 3205, and 3287 are complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1485166, 1486157, 1534324, 1535238, 1535292, 1535295, 1535352, 1535409, 1535484, 1535540, and 1535596 arc complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2.
  • modified oligonucleotides complementary’ to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2 achieve at least 77% reduction of SNCA mRNA in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2 achieve an average of 89.5% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 21.457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 21,457-21.501 of SEQ ID NO: 1 or within nucleobases 23.523-23,567 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments. modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkdddddddddkeee.
  • k represents a cEt sugar moiety
  • e represents a 2’-MOE sugar moiety
  • d represents a 2’-p-D-deoxyribosyl sugar moiety
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooossssssssssoos, sooossssssssssssssss, soossssssssssssssss, or soooosssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 214, 247, 865, 1887, 1948, 3067. 3085, 3146, 3193, and 3275 are complementary to an equal length portion within nucleobases 21,457-21.501 of SEQ ID NO: 1 or within nucleobases
  • nucleobase sequences of Compound Nos: 1483319, 1483650, 1483923, 1485260, 1534362, 1535224, 1535282, 1535339, 1535396, 1535470, 1535528, 1535563, 1535583, and 1535631 are complementary to an equal length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or within nucleobases 23,523-23,567 of SEQ ID NO: 2.
  • modified oligonucleotides complementary' to an equal length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or within nucleobases 23,523-23,567 of SEQ ID NO: 2 achieve at least 73% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24.074-24,096 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. Tn certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddddkkee, kkkddddddddddkeee, ekkdddddddddddkeeee. kkkddddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety.
  • nucleobase sequences of SEQ ID NOs: 167. 208, 248, 304, 1930, 3054, 3120, 3129, 3228. and 3310 are complementary to an equal length portion within nucleobases 22,008-22.030 of SEQ ID NO: 1 or within nucleobases 24.074-24,096 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24,074-24,096 of SEQ ID NO: 2 achieve at least 75% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24,074-24,096 of SEQ ID NO: 2 achieve an average of 89% reduction of SNCA mRNA in the standard in vitro assay.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkdddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2’-P-D- deoxyribosyl sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooosssssssssos, sooossssssssssoos, or soooossssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 196. 1814. 1909, 3042, 3109, 3170, 3217. and 3299 are complementary to an equal length portion within nucleobases 22,507-22.529 of SEQ ID NO: 1 or within nucleobases
  • nucleobase sequences of Compound Nos: 1484851, 1485878. 1534284, 1535251, 1535308, 1535365, 1535422. 1535440, 1535498. 1535553, and 1535609 are complementary to an equal length portion within nucleobases 22.507-22,529 of SEQ ID NO: 1 or within nucleobases 24,573-24.595 of SEQ ID NO: 2.
  • nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2 are nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos. soossssssssssssooos. sooosssssssssssos, sooossssssssssssoos.
  • each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 171, 207. 245. 489, 2390, 3053. 3119. 3128. 3227, and 3309 are complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24.680-24,703 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1482571, 1486455. 1533179, 1534179, 1534332. 1535205, 1535262. 1535320, 1535376. 1535433, 1535451, 1535509. and 1535564 are complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24,680-24.703 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24,680-24.703 of SEQ ID NO: 2 achieve at least 57% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,614-22.637 of SEQ ID NO: 1 or within nucleobases 24.680-24,703 of SEQ ID NO: 2 achieve an average of 87.2% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 25,049-25,090 of SEQ ID NO: 1 or within nucleobases 27,115-27,156 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers arc 3-10-3 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkdddddddddddkkee, kkkddddddddddkeee, ekkddddddddddddkeeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e’’ represents a 2’-M0E sugar moiety', and “d” represents a 2’-P-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos, soosssssssssssooos. sooossssssssssssos, sooossssssssssssoos.
  • nucleobase sequences of SEQ ID NOs: 24. 133, 199, 228. 230, 276, 314, 946. 2759. 2818, 2873, 3069, 3087. 3148, 3195, and 3277 are complementary to an equal length portion within nucleobases 25.049-25,090 of SEQ ID NO: 1 or within nucleobases 27.115-27, 156 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1484502. 1484512, 1484515, 1485351, 1485506, 1485716. 1534281, 1534299. 1534409, 1534422, 1534454. 1535227, 1535284. 1535342, 1535398. 1535472, 1535530, 1535585. 1535592, and 1535633 are complementary to an equal length portion within nucleobases 25,049-25.090 of SEQ ID NO: 1 or within nucleobases 27,115-27,156 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 25.049-25,090 of SEQ ID NO: 1 or within nucleobases 27,115-27.156 of SEQ ID NO: 2 achieve at least 71% reduction of SNCA mRNA in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 25,049-25.090 of SEQ ID NO: 1 or within nucleobases 27.115-27,156 of SEQ ID NO: 2 achieve an average of 85.5% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2 are nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2
  • nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 26,367-26,388 of SEQ ID NO: 1 or within nucleobases 28,433-28,454 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkcc, kkkddddddddddkccc, ckkddddddddddkccc, kkkdddddddddkkccc, or kkkdddddddkeeee; wherein “k” represents a cEt sugar moiety , “e’’ represents a 2’-MOE sugar moiety, and “d” represents a 2'-[i-D-deoxy ribosyl sugar moiety.
  • the intemucleoside linkages of tire modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos. soosssssssssoos, soossssssssssooos.
  • sooossssssssssssssos sooosssssssssssssssos, soossssssssssssss, or soooosssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 168, 193. 236, 313, 2446, 3049, 3116, 3177. 3224, and 3306 are complementary to an equal length portion within nucleobases 26,367-26,388 of SEQ ID NO: 1 or within nucleobases 28,433-28,454 of SEQ ID NO: 2.
  • the nucleobase sequences of Compound Nos: 1485739, 1486339, 1534264, 1534442, 1534444, 1535258. 1535317, 1535373, 1535429, 1535447, 1535505. 1535560, 1535616. and 1535622 are complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2 achieve at least 76% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2 achieve an average of 90.5% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2 are nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2
  • nucleobases 26,508-26.531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkee, kkkddddddddddkeee, ekkddddddddddddkeeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety , “e’’ represents a 2‘-MOE sugar moiety, and “d” represents a 2’-p-D-dcoxyribosyl sugar moiety.
  • the intcmuclcosidc linkages of tire modified oligonucleotides arc phosphorothioatc intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos, soosssssssssoos, soosssssssssooos.
  • sooossssssssssssssos sooosssssssssssssssos, soossssssssssssss, or soooosssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 210, 223. 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197. and 3279 are complementary to an equal length portion within nucleobases 26,508-26.531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1484579, 1485953, 1534266, 1534267, 1534268, 1534341. 1534391, 1535203, 1535229, 1535286, 1535344. 1535400, 1535476. 1535532, 1535587, and 1535636 are complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 26,508-26.531 of SEQ ID NO: 1 or within nucleobases 28.574-28,597 of SEQ ID NO: 2 achieve at least 78% reduction of SNCA mRNA in the standard in vitro assay.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2 achieve an average of 89.3% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 30,207-30.226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 30.207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32.292 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddddkkee, kkkddddddddddkeee, ekkddddddddddddkeeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2‘-MOE sugar moiety, and “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooossssssssssoos, sooosssssssssssssoos, soosssssssssssssssss, or soooossssssssssssooos; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o’‘ represents a phosphodicstcr intemucle
  • nucleobase sequences of SEQ ID NOs: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225, and 3307 are complementary’ to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1485060, 1485105, 1486348, 1534322, 1535260, 1535318, 1535374, 1535430, 1535448, 1535506, 1535561. 1535617, and 1535623 are complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2 achieve at least 81% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2 achieve an average of 92.9% reduction of SNCA mRNA in the standard in vitro assay. 15. Nucleobases 31,412-31,438 of SEO ID NO: 1 of nucleobases 33,478-33,504 of SEQ TD NO: 2
  • nucleobases 31.412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complemenlan to an equal length portion within nucleobases 31,412-31.438 of SEQ ID NO: 1 or within nucleobases 33.478-33,504 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkdddddddddkeee.
  • k represents a cEt sugar moiety
  • c represents a 2’-MOE sugar moiety
  • d represents a 2’-p-D-deoxyribosyl sugar moiety
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3‘): soosssssssssos, soosssssssssoos, soossssssssssooos, sooossssssssssoos, sooossssssssssssoos, soosssssssssssssssss, or soooossssssssssssooos; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o’- represents a phosphodiester intemucleoside linkage
  • nucleobase sequences of SEQ ID NOs: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226, and 3308 are complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1484891, 1485806, 1486424, 1486626, 1535204, 1535261, 1535319, 1535375, 1535432, 1535449, 1535508, 1535562, and 1535624 arc complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2 achieve at least 79% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2 achieve an average of 86.8% reduction of SNCA mRNA in the standard in vitro assay.
  • nucleobases 33.027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 33,027-33.057 of SEQ ID NO: 1 or within nucleobases 35.093-35,123 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkdddddddddkeee.
  • k represents a cEt sugar moiety
  • e represents a 2’-MOE sugar moiety
  • d represents a 2’-p-D-deoxyribosyl sugar moiety
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooossssssssssoos, sooossssssssssssssss, soossssssssssssssss, or soooosssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 194, 277, 1113. 1185, 1309, 3024, 3093, 3154, 3201, and 3283 are complementary to an equal length portion within nucleobases 33,027-33.057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1484757, 1485131, 1486277, 1534265, 1534282, 1535233, 1535248, 1535290, 1535348, 1535404, 1535480, 1535536, 1535591, and 1535637 are complementary to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2.
  • modified oligonucleotides complementary' to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2 achieve at least 66% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2 achieve an average of 86.9% reduction of SNCA mRNA in tire standard in vitro assay.
  • nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50,555 of SEQ ID NO: 2 comprise a hotspot region.
  • modified oligonucleotides are complementary to an equal length portion within nucleobases 48,460-48.489 of SEQ ID NO: 1 or within nucleobases 50.526-50,555 of SEQ ID NO: 2.
  • modified oligonucleotides are 16 nucleobases in length.
  • modified oligonucleotides are 17 nucleobases in length.
  • modified oligonucleotides are 18 nucleobases in length.
  • modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
  • the gapmers are 3-10-3 cEt gapmers. Tn certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers.
  • the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkdddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-(j-D- deoxyribosyl sugar moiety.
  • the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssos, soosssssssssoos, soossssssssssooos, sooosssssssssos, sooossssssssssoos, or soooossssssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • nucleobase sequences of SEQ ID NOs: 310. 803, 919, 1582, 1674, 3032. 3032. 3032, 3100, 3161, 3208, 3290, and 3290 are complementary to an equal length portion within nucleobases 48,460-48.489 of SEQ ID NO: 1 or within nucleobases 50.526-50,555 of SEQ ID NO: 2.
  • nucleobase sequences of Compound Nos: 1485242, 1485665. 1533161, 1533933, 1534424, 1535241, 1535298, 1535327, 1535356. 1535412, 1535488, 1535544, and 1535599 are complementary to an equal length portion within nucleobases 48.460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50.555 of SEQ ID NO: 2.
  • modified oligonucleotides complementary to an equal length portion within nucleobases 48,460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50,555 of SEQ ID NO: 2 achieve at least 70% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 48,460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50,555 of SEQ ID NO: 2 achieve an average of 89.2% reduction of SNCA mRNA in the standard in vitro assay.
  • an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety 7 and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (5 -methyl uracil)) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified sugar moieties having 2’-substituent(s) that are neither OH nor H.
  • labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.
  • nucleobase sequence of a SEQ ID NO. describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or intemucleoside linkage modifications or presence or absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of’ a SEQ ID NO. include such compounds having modified forms of the identified nucleobases as described herein.
  • the description of compounds by chemical notation without reference to a specific Compound No. include only each noted modification, but may include additional substituents, such as a conjugate group, unless otherwise indicated.
  • the chemical notation of “A es Tko in Ce Z G ds Cd” indicates a compound wherein the first nucleoside comprises a 2’-M0E sugar moiety (indicated by tire “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the "s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar
  • a es Tko m Ce Z G ds Cd indicates a compound wherein the first nucleoside comprises a 2’-M0E sugar moiety (indicated by the “c” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s’’ subscript); tire second nucleoside comprises a cEt sugar moiety (indicated by the “k’‘ subscript) and an umnodified thy mine nucleobase linked to tire third nucleoside via a phosphodiester linkage (indicated by tire “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety' and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mes
  • sugar, intemucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds).
  • each nucleobase. sugar, and intemucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure.
  • drawn compounds may exist in equilibrium between tautomeric forms and/or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds.
  • the compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element.
  • compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of *H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 1S O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new' properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • radioactive isotopic substitutions may make tire compound suitable for research or diagnostic purposes such as imaging.
  • Example 1 Design and Effect of 3-10-3 cEt gapmers complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in tire table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkk; wherein "k” represents a cEt sugar moiety, and “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • “Start site” indicates the 5 ‘-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which Hie modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SNCA RNA levels were measured by human primer-probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT, designated herein as SEQ ID NO: 10; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 11 ; probe sequence TGCTCCCAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID NO: 12).
  • SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
  • the modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1). as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • RNA samples were treated with modified oligonucleotide at a concentration of 1.000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to tire amount of SNCA RNA in untreated control cells (% UTC).
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complcmcntan in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1), as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Table 5 Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1), as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Example 2 Design and Effect of 3-10-4 cEt gapmers complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in tire table below are 17 nucleosides in length. wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkdddddddddkkkk; wherein “k” represents a cEt sugar moiety. and “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both.
  • N/A indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • Example 3 Design and Effect of 4-10-3 cEt gapmers complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkkdddddddddkkk; wherein ‘ k” represents a cEt sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooossssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • RNA samples were treated with modified oligonucleotide at a concentration of 2.000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC).
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both.
  • N/A indicates that the modified oligonucleotide is not 100% complementaiy to that particular target nucleic acid sequence.
  • Example 4 Design and Effect of 4-10-4 cEt gapmers complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkkdddddddddkkkk: wherein “k” represents a cEt sugar moiety, and “d” represents a 2 ’-p-D-deoxy ribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooossssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both.
  • N/A indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • Example 5 Design and Effect of 5-10-5 cEt gapmers complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkkkdddddddddkkkkk; wherein “k” represents a cEt sugar moiety, and “d” represents a 2 ’-p-D-deoxy ribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soooossssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both.
  • N/A indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • Example 6 Design and effect of modified oligonucleotides complementary to human SNCA RNA
  • Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5 ’ to 3 ’ ) : kkkdydddddddkkk; wherein “k” represents a cEt sugar moiety, “y” represents a 2’-O-methyl sugar moiety and ‘ d” represents a 2’-
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine. unless otherwise specified. Non-methylated cytosines are bolded and underlined.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • SNCA RNA levels were measured by human primer-probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT. designated herein as SEQ ID NO: 10; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 11; probe sequence TGCTCCCAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID NO: 12).
  • SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in tins example is identified by an Assay Identification letter in the table column labeled “AID”.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1). as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • Example 7 Design and Effect of cEt gapmers containing 2’-MOE modifications complementary to human SNCA RNA
  • Modified oligonucleotides complementary’ to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro.
  • the modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
  • “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence.
  • Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both.
  • ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
  • RNA samples were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkddddddddkeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssoos; wherein each “s” represents a phosphorotliioate intemucleoside linkage, and each "o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkdddddddddkkee; wherein “k” represents a cEt sugar moiety, “c” represents a 2’-MOE sugar moiety, and “d” represents a 2'-[TD-dcoxyribosyl sugar moiety.
  • the intemucleoside linkage motif for tire modified oligonucleotides is (from 5" to 3‘): soossssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2 ’-P-D-deoxy ribosyl sugar moiety.
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each "o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): ekkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2'-
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soosssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • Table 15 cEt gapmers containing 2’-M0E modifications with mixed PS/PO linkages complementary to human SNCA
  • the modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages.
  • the modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkdddddddddkkeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety .
  • the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
  • Each cytosine residue is a 5-methylcytosine.
  • Example 8 Dose-dependent inhibition of human SNCA in SH-SY5Y cells by modified oligonucleotides, in vitro
  • Modified oligonucleotides selected from the example above were tested at various doses in SH-SY5Y cells.
  • SH- SY5Y cells plated at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR.
  • Human primerprobe set hSNCA LTS00672 MGB forward sequence TGGCAGAAGCAGCAGGAAA, designated herein as SEQ ID NO: 3339; reverse sequence TCCTTGGTTTTGGAGCCTACA.
  • probe sequence CAAAAGAGGGTGTTCTC designated herein as SEQ ID NO: 3341
  • SEQ ID NO: 3341 probe sequence CAAAAGAGGGTGTTCTC, designated herein as SEQ ID NO: 3341
  • Modified oligonucleotides selected from the example above were tested at various doses in SH-SY5Y cells.
  • SH- SY5Y cells plated at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below.
  • total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR.
  • Human SNCA primer-probe set RTS2621 (described herein above) was used to measure RNA levels as described above. SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
  • SNCA RNA Reduction of SNCA RNA is presented in the tables below as percent SNCA RNA, relative to tire amount of SNCA RNA in untreated control cells (% UTC).
  • IC50 half maximal inhibitory concentration

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Psychology (AREA)
  • Psychiatry (AREA)
  • Saccharide Compounds (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
EP24757730.7A 2023-02-17 2024-02-16 Verbindungen und verfahren zur modulation der alpha-synuclein-expression Pending EP4665357A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202363485845P 2023-02-17 2023-02-17
US202363587718P 2023-10-03 2023-10-03
PCT/US2024/016097 WO2024173759A2 (en) 2023-02-17 2024-02-16 Compounds and methods for modulating alpha-synuclein expression

Publications (1)

Publication Number Publication Date
EP4665357A2 true EP4665357A2 (de) 2025-12-24

Family

ID=92420759

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24757730.7A Pending EP4665357A2 (de) 2023-02-17 2024-02-16 Verbindungen und verfahren zur modulation der alpha-synuclein-expression

Country Status (8)

Country Link
EP (1) EP4665357A2 (de)
JP (1) JP2026507572A (de)
KR (1) KR20250158088A (de)
CN (1) CN120958135A (de)
AU (1) AU2024220937A1 (de)
IL (1) IL322701A (de)
MX (1) MX2025009645A (de)
WO (1) WO2024173759A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220062517A (ko) 2019-08-15 2022-05-17 아이오니스 파마수티컬즈, 인코포레이티드 결합 변형된 올리고머 화합물 및 이의 용도

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2817960C (en) * 2010-11-17 2020-06-09 Ionis Pharmaceuticals, Inc. Modulation of alpha synuclein expression
BR122020018668B1 (pt) * 2012-08-27 2022-05-17 Evogene Ltd. Método para aumentar o rendimento, taxa de crescimento, biomassa, vigor, rendimento da semente, rendimento da fibra, capacidade fotossintética, e/ou tolerância ao estresse abiótico em uma planta
SG11202006528XA (en) * 2018-01-12 2020-08-28 Bristol Myers Squibb Co Antisense oligonucleotides targeting alpha-synuclein and uses thereof
WO2023215863A2 (en) * 2022-05-06 2023-11-09 Ionis Pharmaceuticals, Inc. Rnai agents for modulating snca

Also Published As

Publication number Publication date
WO2024173759A2 (en) 2024-08-22
CN120958135A (zh) 2025-11-14
WO2024173759A3 (en) 2024-10-24
MX2025009645A (es) 2026-01-07
IL322701A (en) 2025-10-01
AU2024220937A1 (en) 2025-10-02
JP2026507572A (ja) 2026-03-04
KR20250158088A (ko) 2025-11-05

Similar Documents

Publication Publication Date Title
AU2018409843A1 (en) Compounds and methods for reducing SNCA expression
WO2020106996A1 (en) Compounds and methods for reducing prion expression
AU2020241693B2 (en) Compounds and methods for reducing KCNT1 expression
AU2020253821A1 (en) Compounds and methods for modulating UBE3A-ATS
EP4189090A1 (de) Verbindungen und verfahren zur verminderung der expression von app
EP4433591A1 (de) Verbindungen und verfahren zur modulation der progranulinexpression
WO2020132558A1 (en) Compounds and methods for reducing pmp22 expression
US12180479B2 (en) Compounds and methods for modulating ATXN1
US20240285669A1 (en) Compounds and Methods for Modulating GFAP
WO2020243292A1 (en) Compounds and methods for reducing fus expression
WO2024173759A2 (en) Compounds and methods for modulating alpha-synuclein expression
WO2022066956A1 (en) Compounds and methods for reducing apoe expression
WO2024173783A2 (en) Allele-selective compounds and methods for modulating huntingtin expression
AU2024221236A1 (en) Compounds and methods for reducing app expression
WO2021263082A2 (en) Compounds and methods for reducing kcnt1 expression
AU2021299290A1 (en) Compounds and methods for modulating PLP1

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250911

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

P01 Opt-out of the competence of the unified patent court (upc) registered

Free format text: CASE NUMBER: UPC_APP_0004097_4665357/2026

Effective date: 20260204