EP4658809A1 - Kappungstest - Google Patents

Kappungstest

Info

Publication number
EP4658809A1
EP4658809A1 EP24749812.4A EP24749812A EP4658809A1 EP 4658809 A1 EP4658809 A1 EP 4658809A1 EP 24749812 A EP24749812 A EP 24749812A EP 4658809 A1 EP4658809 A1 EP 4658809A1
Authority
EP
European Patent Office
Prior art keywords
mrna
cap
capping
heavy
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24749812.4A
Other languages
English (en)
French (fr)
Inventor
Jiang Qian
Ying Zhang
Zhichun Wang
Zhijun Cao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seqirus Inc
Original Assignee
Seqirus Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seqirus Inc filed Critical Seqirus Inc
Publication of EP4658809A1 publication Critical patent/EP4658809A1/de
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/25Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving enzymes not classifiable in groups C12Q1/26 - C12Q1/66
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2560/00Chemical aspects of mass spectrometric analysis of biological material

Definitions

  • the present disclosure relates to methods for quantifying mRNA capping efficiency.
  • the present disclosure also relates to kits which can be used for quantifying mRNA capping efficiency.
  • Vaccines are the critical health intervention to prevent infectious diseases.
  • the recent severe acute respiratory syndrome coronavirus (SARS-CoV-2) pandemic has seen the unprecedented development of multiple vaccines in a very short space of time, with mRNA vaccines used for the first time as part of a global vaccination strategy.
  • mRNA vaccines comprise synthetic mRNA molecules that encode for an antigen that will generate an immune response.
  • Synthetic mRNA has a similar structure to endogenous mRNA and typically includes from 5’ to 3’: a 5’cap, 5’ untranslated region (5’UTR), an open reading frame encoding the antigen, a 3’UTR and a polyA tail.
  • mRNA for therapeutic purposes, including in vaccines, requires large amounts of mRNA to be synthesized and thoroughly characterized for properties such as capping.
  • characterisation of mRNA requires techniques that are quantitative, robust, accurate, and able to process many samples quickly.
  • Previous methods for studying the 5' cap have traditionally relied upon radiolabel detection of 32 P incorporated as the 5' terminal phosphate.
  • More recently capping efficiency has been determined using a biotin-tagged RNase H cleavage probe that is complementary to the 5' end of the mRNA.
  • a disadvantage of this method that it requires a specific probe for each mRNA being analysed. Accordingly, there is still a need for assays that can be used to characterise mRNA for therapeutic purposes, and in particular assays which can be used to quantitatively determine the percentage of mRNA with a 5’cap.
  • the present application provides methods for quantitatively determining the capping efficiency of mRNA, in particular, mRNA synthesized using in vitro transcription.
  • Capping efficiency may be expressed, for example, as a ratio or percentage of the total mRNA present in the sample or as a ratio or percentage of the capped mRNA present in the sample.
  • the present disclosure provides a method of quantifying mRNA capping efficiency, the method comprising: treating an mRNA sample with capping enzyme in the presence of heavy labelled reagent to form a treated mRNA sample; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • the treated mRNA sample optionally comprises a heavy labelled 5’ cap.
  • the heavy labelled reagent comprises a heavy labelled substrate and/or cofactor.
  • the heavy labelled substrate and/or cofactor comprises heavy GTP or heavy SAM or a combination thereof.
  • the heavy labelled substrate and/or cofactor comprises heavy GTP and/or heavy SAM.
  • the heavy labelled substrate and/or cofactor comprises 13 C, 15 N - GTP and/or heavy CD3-SAM.
  • the heavy labelled substrate and/or cofactor comprises 13 Cw, 15 N 5 - GTP and/or heavy CD3-SAM.
  • the present disclosure also provides a method of quantifying mRNA capping efficiency, the method comprising: treating an mRNA sample with capping enzymes in the presence of heavy GTP to form a treated mRNA sample; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • the treated mRNA sample optionally comprises a heavy labelled 5’ cap.
  • the present disclosure also provides a method of quantifying mRNA capping efficiency, the method comprising: treating an mRNA sample with capping enzymes in the presence of heavy SAM to form a treated mRNA sample; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • the treated mRNA sample optionally comprises a heavy labelled 5’ cap.
  • the present disclosure also provides a method of quantifying mRNA capping efficiency, the method comprising: treating an mRNA sample with capping enzymes in the presence of heavy GTP and heavy-SAM to form a treated mRNA sample; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • the treated mRNA sample optionally comprises a heavy labelled 5’ cap.
  • the mRNA sample comprises mRNA with an unlabelled 5’cap. In one example, the treated mRNA sample comprises mRNA with a heavy labelled 5’cap. In one example, the treated mRNA sample comprises mRNA with an unlabelled 5’cap and a heavy labelled 5’cap.
  • the heavy GTP comprises 13 C, 15 N - GTP. In one example, the heavy GTP comprises 13 Cw, 15 Ns - GTP. In one example, the heavy GTP is a compound of formula I: In one example, the heavy SAM comprises D-SAM. In one example, the heavy SAM comprises CD3-SAM. In one example, the heavy SAM is a compound of formula II:
  • the nuclease comprises RNAse T1 , Nuclease NP1 or RNAse A or combinations thereof. In one example, the nuclease comprises RNAse T1 . In one example, the nuclease comprises Nuclease NP1.
  • the step of quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample comprises analysing the released 5’ cap by liquid chromatography/mass spectrometry (LC-MS) and determining the relative amount of heavy labelled and unlabelled 5’cap fragments.
  • LC-MS liquid chromatography/mass spectrometry
  • the capping enzyme comprises vaccinia capping enzymes or poxvirus capping enzymes. In one example, the capping enzyme comprises vaccinia capping enzymes. In one example, the capping enzyme comprises a triphosphatase, a guanylyltransferase or a guanine methyltransferase or a combination thereof. In one example, the capping enzyme comprises an mRNA Cap 2'-O-Methyltransferase.
  • the mRNA sample is synthesized by in vitro transcription.
  • the mRNA sample comprises capped mRNA that is produced by a post- transcriptional capping reaction or a co-transcriptional capping reaction.
  • the mRNA sample comprises capped mRNA, uncapped mRNA or unmethylated capped mRNA or a combination thereof.
  • the mRNA sample (i.e. the RNA sample used in the methods described herein) comprises capped mRNA having a 5’ cap selected from the group consisting of CapO, Cap1 , Cap2, Cap4, anti-reverse cap analogue (ARCA), inosine, N7,2'-0- dimethyl-guanosine (mCAP), N1-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, 2-azido-guanosine, N6,2'-O- dimethyladenosine, 7-methylguanosine (m 7 G) and CAP-003-CAP-225.
  • the 5’cap is CapO or Cap1 .
  • the 5’ cap is CapO.
  • the 5’cap is Cap1 .
  • the mRNA sample (i.e. the RNA sample used in the methods described herein) comprises capped mRNA having a 5’ cap selected from the group consisting of m7GTPG, m7GTPGp, m7GTPA, m7GTPAp, m7GTPGm and m7GTPAm.
  • the mRNA sample comprises capped mRNA having a 5’ cap having a structure of formula (III): wherein B is a nucleobase; R 1 is selected from H, halogen, OH, and OCH 3 ; R 2 is selected from H, OH and OCH 3 ; R 3 is CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or is absent; R 4 is NH 2; R 5 is OH; n is 1 , 2, or 3; and M is a nucleotide of the mRNA; and wherein the nuclease is RNAse T1 .
  • B is a nucleobase
  • R 1 is selected from H, halogen, OH, and OCH 3
  • R 2 is selected from H, OH and OCH 3
  • R 3 is CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or is absent
  • R 4 is NH 2
  • R 5 is OH
  • n is 1 , 2, or 3
  • M is
  • B is guanine or adenine. In one example, B is guanine.
  • R 1 is selected from halogen, OH, and OCH 3 . In one example, R 1 is selected from H, OH, and OCH 3 . In one example, R 1 is selected from OH, and OCH 3 . In one example, R 1 is OH.
  • R 1 , R 2 and R 5 are independently OH.
  • R 3 is CH 3 . In one example, R 3 is absent.
  • n 1 .
  • the mRNA sample comprises capped mRNA having a 5’ cap which is CapO and wherein the nuclease is RNAse T1 .
  • the mRNA sample comprises capped mRNA having a 5’ cap having a structure of formula (III): wherein B is a nucleobase; R 1 is selected from a H, halogen, OH, and OCH 3 ; R 2 is selected from H, OH and OCH 3 ; R 3 is CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or is absent; R 4 is NH 2; R 5 is OH or OCH 3 ; n is 1 , 2, or 3; and M is a nucleotide of the mRNA; and wherein the nuclease is Nuclease NP1.
  • R 1 is selected from halogen, OH, and OCH 3 . In one example, R 1 is selected from H, OH, and OCH 3 . In one example, R 1 is selected from OH and OCH 3 . In one example, R 1 is OH. In one example, B is guanine or adenine. In one example, B is guanine.
  • R 1 and R 2 are independently OH.
  • R 5 is OH. In one example, R 5 is OCH 3 .
  • the mRNA sample comprises capped mRNA having a 5’ cap which is CapO or Cap1 and wherein the nuclease is Nuclease NP1 .
  • the mRNA sample comprises uncapped mRNA having 5’triphosphate group or a 5’diphosphate group or a combination thereof.
  • the mRNA sample comprises unmethylated capped mRNA having a 5’ GpppN group, wherein N is any nucleotide.
  • N is G.
  • N is A.
  • quantifying mRNA capping efficiency comprises quantifying the absolute amount of capped mRNA in the mRNA sample. In one example, quantifying mRNA capping efficiency comprises quantifying the total amount of labelled and unlabelled capped mRNA in the mRNA sample. In one example, quantifying mRNA capping efficiency comprises quantifying the percentage of labelled 5’cap in the digested mRNA sample. In one example, quantifying mRNA capping efficiency comprises quantifying the percentage of labelled 5’cap in the digested mRNA sample relative to total mRNA. In one example, quantifying mRNA capping efficiency comprises quantifying the percentage of unlabelled 5’cap in the digested mRNA sample relative to total mRNA.
  • kits for quantifying mRNA capping efficiency comprising one or more of the following: heavy labelled substrate and/or cofactor; capping enzymes; and nuclease.
  • the kit comprises heavy labelled reagent and capping enzymes. In one example, the kit comprises heavy labelled reagent and capping enzymes. In one example, the heavy labelled reagent is a heavy labelled reagent described herein. In one example, the capping enzyme is a capping enzyme described herein. In one example, the nuclease is a nuclease described herein.
  • Figure 1 exemplifies a method of quantifying mRNA capping efficiency as described herein.
  • the exemplified method treats an mRNA sample comprising capped and uncapped mRNA with a capping enzyme in the presence of heavy labelled GTP and unlabelled SAM.
  • the treated mRNA is digested using a nuclease releasing heavy labelled and unlabelled 5’cap (e.g. the dinucleotide m 7 GpppGp).
  • the amount of heavy labelled and unlabelled 5’cap is quantified using LC-MS and the capping efficiency may be quantified by calculating the relative abundance of unlabelled 5’cap to total 5’cap in the sample. This is expressed as a percentage (e.g. of total mRNA).
  • Figure 2 exemplifies a method of quantifying mRNA capping efficiency as described herein.
  • the exemplified method treats an mRNA sample comprising capped, unmethylated capped and uncapped mRNA with a capping enzyme in the presence of heavy labelled GTP and heavy labelled SAM.
  • the exemplified method may be used to quantify the abundance of mRNA capped with CapO in the sample.
  • the exemplified method may be used to quantify the amount of uncapped mRNA, unmethylated capped mRNA and capped mRNA present in the sample. This may be expressed as a percentage (e.g. of total mRNA).
  • Figure 3 exemplifies a method of quantifying mRNA capping efficiency as described herein.
  • the exemplified method may be used to quantify the abundance of mRNA capped with Cap1 in the sample.
  • the exemplified method may be used to quantify the amount of uncapped mRNA, unmethylated capped (capO or cap1) mRNA and capped (capO or cap1) mRNA present in the sample. This may be expressed as a percentage (e.g. of total mRNA).
  • Figure 4 illustrates a proposed reaction mechanism for nucleases like RNase A or T1 , which involves formation of a cyclic phosphate intermediate.
  • Figure 5 illustrates use of the methods described herein for determining mRNA capping efficiency through conversion of uncapped mRNA to labelled capO.
  • Each trace shown is a total ion chromatogram (TIC) from the corresponding MRM transitions for each cap species.
  • Figure 5A shows results from T1 digestion of an uncapped mRNA.
  • Figure 5B shows results from NP1 digestion of an uncapped mRNA.
  • Figure 5C and 5D respectively show results from T1 (C) and NP1 (D) digestion of an mRNA sample with unknown capping efficiency. For this mRNA sample, there is a minor labelled peak and a significant unlabelled peak in the TIC.
  • FIG. 6 illustrates use of the methods described herein for quantifying mRNA capping species.
  • dual labelling dasheavy methylation via heavy SAM and heavy cap via heavy GTP
  • Figure 6A shows the result of the exemplified assay on an unmethylated Gcapped sample (with some background uncapped species). The results show incorporation of the heavy methyl group via heavy SAM into the Gcapped and uncapped species.
  • Figure 6B shows the result of the exemplified assay on a test article with unknown capping efficiency. The percentage of each cap species can be quantified using the relative peak areas.
  • Figure 6C shows a blended sample of an uncapped, an unmethylated capped, and a capped mRNA.
  • the measured capping percentages in the blended sample are aligned with the expected percentages.
  • the results from RNAse T1 (i) and Nuclease P1 (ii) digestion are consistent in all three samples, (iii) summarises the results.
  • Figure 7 illustrates use of the methods described herein for quantifying mRNA capping species in a serial blended samples.
  • dual labelling dasheavy methylation via heavy SAM and heavy cap via heavy GTP
  • Figure 7A, 7B and 7C show the results of the exemplified assay on blends containing uncapped, unmethylated Gcapped sample, m7Gcapped species using RNAse T1.
  • composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of steps or groups of compositions of matter.
  • the term “derived from” shall be taken to indicate that a specified integer may be obtained from a particular source albeit not necessarily directly from that source.
  • the term “based on” shall be taken to indicate that a specified integer may be developed or used from a particular source albeit not necessarily directly from that source.
  • the term “approximately” or “about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11 %, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • nucleoside refers to adenine ("A"), guanine (“G”), cytosine ("C”), uracil (“U”), thymine (“T”) and analogs thereof linked to a carbohydrate, for example D-ribose (in RNA) or 2'-deoxy-D-ribose (in DNA), through an N- glycosidic bond between the anomeric carbon of the carbohydrate (1 ’-carbon atom of the carbohydrate) and the nucleobase.
  • the carbon atoms of the ribose present in nucleotides are designated with a prime character (') to distinguish them from the backbone numbering in the bases.
  • the nucleobase is purine, e.g., A or G
  • the ribose sugar is generally attached to the N9-position of the heterocyclic ring of the purine.
  • the nucleobase is pyrimidine, e.g., C, T or U
  • the sugar is generally attached to the Nl -position of the heterocyclic ring.
  • the carbohydrate may be substituted or unsubstituted.
  • Substituted ribose sugars include, but are not limited to, those in which one or more of the carbon atoms, e.g.
  • the 2'-carbon atom is substituted with one or more of the same or different Cl, F,-R,-OR, - NR 2 or halogen groups, where each R is independently H, Ci-C 6 alkyl or C 5 -Ci 4 aryl.
  • Ribose examples include ribose, 2'-deoxyribose, 2',3'-dideoxyribose, 2'-haloribose, 2'- fluororibose, 2'-chlororibose, and 2'-alkylribose, e.g., 2'-O-methyl, 4'-alpha-anomeric nucleotides, T-alpha- anomeric nucleotides (Asseline et al, NUCL.
  • alkyl refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds).
  • the alkyl group may have 1 to 20 carbon atoms (whenever it appears herein, a numerical range such as “1 to 20” refers to each integer in the given range; e.g., “1 to 20 carbon atoms” means that the alkyl group may consist of 1 carbon atom, 2 carbon atoms, 3 carbon atoms, etc., up to and including 20 carbon atoms, although the present definition also covers the occurrence of the term “alkyl” where no numerical range is designated).
  • the alkyl group may also be a medium size alkyl having 1 to 9 carbon atoms.
  • the alkyl group could also be a lower alkyl having 1 to 4 carbon atoms.
  • the alkyl group may be designated as “Ci- 4 alkyl” or similar designations.
  • “Ci- 4 alkyl” indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, and tert-butyl.
  • Typical alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like.
  • nucleotide refers a nucleoside in a phosphorylated form (a phosphate ester of a nucleoside), as a monomer unit or within a polynucleotide polymer.
  • Nucleotide 5 '-triphosphate refers to a nucleotide with a triphosphate ester group at the 5' position, sometimes denoted as “NTP", or “dNTP” and “ddNTP” to particularly point out the structural features of the ribose sugar.
  • the triphosphate ester group may include sulfur substitutions for the various oxygen moieties, e.g., alpha-thio-nucleotide 5'- triphosphates.
  • Nucleotides can exist in the mono-, di-, or tri-phosphorylated forms.
  • nucleic acid refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double-stranded form and includes DNA, RNA, and hybrids thereof.
  • the nucleotides may be genomic, synthetic or semi-synthetic in origin. Unless otherwise stated, the terms encompass nucleic acid-like structures with synthetic backbones, as well as amplification products.
  • polynucleotides can be linear, branched linear, or circular molecules. Polynucleotides also have associated counter ions, such as H + , NH 4 + , trialkylammonium, Mg 2+ , Na + and the like.
  • a polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof. Polynucleotides may be composed of internucleotide nucleobase and sugar analogs.
  • oligonucleotide is used to denote a polynucleotide that comprises between about 2 and about 150 nucleotides, e.g., between about 10 and about 100 nucleotides, between about 15 and about 75 nucleotides, or between about 15 and about 50 nucleotides.
  • oligonucleotide is represented by a sequence of letters, the nucleotides are presented in the 5' to 3' order from the left to the right.
  • a "polynucleotide sequence” refers to the sequence of nucleotide monomers along the polymer. Unless denoted otherwise, whenever a polynucleotide sequence is represented, it will be understood that the nucleotides are in 5' to 3' orientation from left to right.
  • 3 refers to a region or position in a polynucleotide or oligonucleotide 3' (i.e., downstream) from another region or position in the same polynucleotide or oligonucleotide.
  • 5 refers to a region or position in a polynucleotide or oligonucleotide 5' (i.e., upstream) from another region or position in the same polynucleotide or oligonucleotide.
  • oligonucleotide primers comprise tracts of poly-adenosine at their 5' termini.
  • RNA relates to the "half-life" of RNA.
  • “Half-life” relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules.
  • the half-life of a RNA is indicative for the stability of said RNA.
  • poxviruses means a member of a family of brickshaped or ovoid viruses that contains a double-stranded DNA genome.
  • poxviruses include vaccinia virus, variola virus, rabbitpox virus, monkeypox virus, ectromelia virus, camelpox virus, cowpox virus, muledeerpox virus, myxoma virus, rabbit fibroma virus, swinepox virus, lumpy skin disease virus, sheeppox virus, canarypox virus, fowl pox virus, orf virus, and bovine papular stomatitis virus, as well as relatives, descendents, variants, and derivatives of such poxviruses.
  • MS mass spectrometry
  • MS is mass spectrometry, an analytical chemistry technique that helps identify the amount and type of chemicals present in a sample by measuring the mass- to-charge ratio and abundance of gas-phase ions.
  • a mass spectrum (plural spectra) is a plot of the ion signal as a function of the mass-to-charge ratio.
  • MS techniques are known in the arts. For more information, see the MS Primer (2015) available from Waters Corporation, Milford MA USA. See also, Basiri et al, Bioanalysis 1525-1542 (2014).
  • LC liquid chromatography
  • mRNAs bear a "cap" structure at their 5'-termini, which plays an important role in translation and stability.
  • the 5’ cap plays a pivotal role in mRNA metabolism, and is required to varying degrees for processing and maturation of an RNA transcript in the nucleus, transport of mRNA from the nucleus to the cytoplasm, mRNA stability, and efficient translation of the mRNA to protein.
  • Cap 1 Messenger RNA Synthesis with Co-transcriptional CleanCap((R)) Analog by In Vitro Transcription. Curr. Protoc. 2021 ;1 :e39).
  • One example comprises a 7-methyl guanosine (m 7 G) that is linked via a 5’-5’-triphosphate bridge to the 5 '-end of the first transcribed nucleotide, resulting in a dinucleotide cap of m 7 GpppN, where N is any nucleoside (e.g. G, C, A or U) and is the first transcribed nucleotide. This is often referred to as capO.
  • mRNAs that are produced by in vitro transcription for use in vaccines and in other therapeutics must also capped in order for the mRNA to be translated.
  • capping mRNA produced from in vitro transcription Post-transcriptional capping involves treating the RNA formed by in vitro transcription with capping enzymes (usually from vaccinia virus) in the presence of GTP or other capping nucleotides.
  • Co-transcriptional capping involves adding a cap analogue to the in vitro transcription reaction that the RNA polymerase incorporates into the 5' terminal of the mRNA in place of GTP.
  • both types of capping reactions may not be 100% efficient and the resulting mixture may contain capped and uncapped mRNA.
  • the resulting reaction mixture may also contain unmethylated capped mRNA.
  • the methods described herein may be used to determine the amount of capped, uncapped and/or unmethylated capped mRNA in a sample.
  • the present application provides, among other things, an improved method for quantifying mRNA capping efficiency.
  • the methods described herein are particularly useful for quantifying the capping efficiency of mRNA synthesized using in vitro translation, for example, without the need for sequence specific oligonucleotides or radioisotopes.
  • the described methods may be used as part of a quality control process, for example, as part of a process assessing the safety, efficacy, and/or uniformity of mRNAs for therapeutic uses.
  • a method of quantifying mRNA capping efficiency comprising: treating an mRNA sample with capping enzyme in the presence of heavy labelled reagent to form a treated mRNA sample optionally comprising mRNA with a heavy labelled 5’cap; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • This may be expressed, for example, as a ratio or percentage of the total mRNA present in the sample.
  • the mRNA sample comprises mRNA with an unlabelled 5’cap.
  • the treated mRNA sample comprises mRNA with a heavy labelled 5’cap.
  • the treated mRNA sample comprises mRNA with an unlabelled 5’cap and a heavy labelled 5’cap.
  • the methods described herein comprise treating an mRNA sample with a capping enzyme and heavy labelled reagent (e.g. heavy GTP and/or heavy SAM).
  • a capping enzyme and heavy labelled reagent e.g. heavy GTP and/or heavy SAM.
  • the mRNA sample will comprise one or more of capped mRNA, uncapped mRNA and unmethylated capped mRNA.
  • the “capped mRNA” described herein comprises at least one 5' cap structure.
  • 5’cap structures are known to the person skilled in the art.
  • the 5’cap structure is as described herein.
  • the capped mRNA comprises m 7 GpppN (CapO).
  • the capped mRNA comprises m 7 GpppmN (Cap1)
  • uncapped mRNA includes any mRNA without a 5’ cap structure, including for example, mRNA having a 5’ terminal triphosphate, 5’ terminal diphosphate or 5’ terminal monophosphate group. In one example, “uncapped mRNA” is mRNA having a 5’ terminal triphosphate group and/or 5’ terminal diphosphate group. In one example, “uncapped mRNA” is mRNA having a 5’ terminal triphosphate group.
  • GpppN guanosine
  • RNA with a GpppN cap also referred to herein as Gcapped RNA
  • m7Gcapped RNA with a m 7 GpppN cap
  • unmethylated capped mRNA is an intermediate formed in the synthesis of mRNA having a capO.
  • unmethylated capped mRNA comprises mRNA with a GpppN cap, where N is the first transcribed nucleotide.
  • N is G.
  • N is A.
  • the 5’ guanine is not methylated on N 7 .
  • the methods described herein can also be used to determine the methylation efficiency, for example methylation of N 7 to form CapO or the 2’OH of the ribose to form, for example, Cap1 .
  • the methods described herein can be used to determine the amount of capped mRNA, uncapped mRNA and/or unmethylated capped mRNA in the sample, which can then be used to quantitatively determine the capping efficiency.
  • the treating step forms a treated mRNA sample.
  • the treating step is performed under conditions that allow the formation of mRNA comprising a heavy labelled 5’cap.
  • the capped mRNA in the mRNA sample does not react with the labelled GTP and remains unlabelled.
  • uncapped mRNA reacts with the labelled GTP in the presence of the capping system and forms labelled mRNA.
  • the treated mRNA sample therefore contains a mixture of labelled and unlabelled capped mRNA.
  • the amount of labelled capped mRNA depends on the amount on uncapped mRNA in the mRNA sample being tested. If the mRNA sample being tested is all capped, the treated mRNA sample should not include any labelled capped mRNA. This is illustrated in Figure 1 .
  • the method further comprises contacting the treated mRNA with a nuclease.
  • the contacting step comprises digesting the treated mRNA with a nuclease. Any nuclease that is suitable for digesting single stranded RNA may be used. Digestion of the mRNA with the nuclease releases the 5’cap. Depending on the nuclease used and sequence of the mRNA, the released 5’cap may form part of an oligonucleotide comprising the 5’cap (for example, m 7 GpppN(N) a -p, where each occurrence of N is independently any nucleotide, a is an integer and p is a phosphate).
  • nuclease treatment of the labelled mRNA sample would yield a mixture of free nucleotides and heavy labelled and unlabelled 5' cap which are detectable, for example by LC-MS.
  • RNAse T1 which is a nuclease which cleaves the phosphodiester bond between the 3'-guanylic residue and the 5'-OH residue of adjacent nucleotides, m 7 GpppGp is produced.
  • RNAse A which is a nuclease that degrades single-stranded RNA at C and U residues
  • the released 5’cap forms part of a oligonucleotide which has a 3’ Cp or Up, for example rn 7 GpppG(N) m (C/U)p, each occurrence of N is independently any nucleotide, and m is a positive integer, e.g. between 0 and 10.
  • N is G or A.
  • the amount of the labelled cap or oligonucleotide comprising the labelled cap produced is related to the amount of uncapped and/or unmethylated mRNA in the original sample.
  • the ratio of labelled and unlabelled capped mRNA in the sample may be determined by quantifying the amount of unlabelled cap and/or labelled cap present in the digested sample. This ratio may be used to quantify mRNA capping efficiency.
  • the percentage of labelled and/or unlabelled capped mRNA relative to total mRNA in the sample may be determined by quantifying the amount of unlabelled cap and/or labelled cap present in the digested sample.
  • the quantity of labelled and unlabelled capped mRNA in a sample may be determined using any method known to the person skilled in the art.
  • the quantity of capped and uncapped mRNA is determined by mass spectrometry, e.g. high resolution mass spectrometry (HRMS).
  • the mass spectrometric analysis quantifies labelled and unlabelled 5’caps through targeted multiple reaction monitoring (MRM).
  • MRM targeted multiple reaction monitoring
  • a triple-quadrupole mass spectrometer is used. .
  • Mass analysers with high mass accuracy, high sensitivity and high resolution include, but are not limited to, matrix-assisted laser desorption time-of-flight (MALDI-TOF) mass spectrometers, electrospray ionization time-of-flight (ESI-TOF) mass spectrometers, Fourier transform ion cyclotron mass analysers (FT-ICR-MS), and ORBITRAPTM analyser instruments.
  • MALDI-TOF matrix-assisted laser desorption time-of-flight
  • EI-TOF electrospray ionization time-of-flight
  • FT-ICR-MS Fourier transform ion cyclotron mass analysers
  • ORBITRAPTM analyser instruments include ion trap and triple quadrupole mass spectrometers.
  • ion trap MS In ion trap MS, analytes are ionized by electrospray ionization or MALDI and then moved into an ion trap. Trapped ions can then be separately analysed by MS upon selective release from the ion trap. Ion traps can also be combined with the other types of mass spectrometers described above.
  • liquid chromatography ESI-MS/MS or automated LC- MS/MS which utilizes capillary reverse phase chromatography as the separation method
  • Other separation systems known to the person skilled in the art may be employed to separate the product of interest prior to MS analysis.
  • Systems that can be linked to MS include, but are not limited to, capillary electrophoresis and gas chromatography.
  • Example techniques that may be applied to characterize RNAs include ion mobility separation, EXD (EAD/ECD/ETD) fragmentation, and MS/MS analysis.
  • Mass-spectrometric analysis of the biomolecules in a sample can be targeted, and can include SIM-scans (selected ion monitoring) to increase sensitivity, e.g., 10 to 100 fold or more.
  • SIM-scans selected ion monitoring
  • the SIM scan can scan a mass range which includes the predicted mass of the labelled and/or unlabelled 5’cap. With the SIM scan, it is then possible to achieve accurate quantification even for biomolecules that are very low in the sample.
  • Other fragmentation methods such as ETD, ECT and EAD may be utilized to analyse RNAs (e.g. RNAs with Cap1 or Cap2) with or without employing an ion mobility gas separation module.
  • SRM / MRM Selected /Multiple Reaction Monitoring
  • determining the ratio of labelled and unlabelled capped mRNA in the sample comprises determining the ratio of areas between a peak or the peaks of the labelled cap and a corresponding peak or corresponding peaks of the unlabelled cap.
  • the ratio may be obtained by first integrating the signal of the labelled cap prior to integrating the signal of the unlabelled cap, and then determining their ratio by dividing one signal by the other or vice versa.
  • the amount of unlabelled product on the LC-MS spectra can be expressed as a percent of total mRNA (labelled and unlabelled 5’cap) and would correspond to capping reaction efficiency.
  • the present inventors have also found that the amount of unmethylated capped mRNA present in a sample can be quantitated by use of heavy labelled methyl donor (e.g. heavy labelled SAM, e.g. CD 3 -SAM). Accordingly, there is provided a method of quantifying mRNA capping efficiency, the method comprising: treating an mRNA sample with capping enzyme in the presence of heavy labelled methyl donor to form a treated mRNA sample optionally comprising mRNA with a heavy labelled 5’cap; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • heavy labelled methyl donor e.g. heavy labelled SAM, e.g. CD 3 -SAM
  • quantifying mRNA capping efficiency comprises determining the amount of unmethylated capped mRNA in the sample. This may be expressed, for example, as a ratio or percentage of the total mRNA present in the sample or as a ratio or percentage of the capped mRNA present in the sample.
  • This method (which uses heavy labelled GTP and heavy labelled SAM) is illustrated in Figure 2.
  • the mRNA sample comprises mRNA with an unlabelled 5’cap. In one example, the treated mRNA sample comprises mRNA with a heavy labelled 5’cap. In one example, the treated mRNA sample comprises mRNA with an unlabelled 5’cap and a heavy labelled 5’cap.
  • the methyl group transferred includes a heavy atom, e.g. CD 3 .
  • the heavy labelled methyl donor is heavy labelled-SAM, for example, CD 3 -SAM.
  • the capping enzyme comprises a guanine-7-methyltransferase or an enzyme with guanine-7-methyltransferase activity.
  • the capping enzyme comprises mRNA Cap 2'-O-Methyltransferase or an enzyme with mRNA Cap 2'-O-Methyltransferase activity.
  • the method further comprises treating the mRNA sample with a capping enzyme and a heavy labelled nucleotide.
  • this reaction can be performed prior to treating with capping enzyme and the heavy methyl donor or in the same reaction mixture.
  • the present inventors have also found that the amount of uncapped mRNA and unmethylated capped mRNA present in a sample can be quantitated in a one pot assay by use of heavy labelled methyl donor (e.g. heavy labelled SAM, e.g. CD 3 -SAM) and heavy labelled substrate (e.g. heavy nucleotide, such as heavy labelled GTP).
  • heavy labelled methyl donor e.g. heavy labelled SAM, e.g. CD 3 -SAM
  • heavy labelled substrate e.g. heavy nucleotide, such as heavy labelled GTP
  • the methods described herein comprise treating an mRNA sample comprising capped RNA with a capping enzyme, a heavy labelled methyl donor and a heavy labelled nucleotide.
  • a method of quantifying mRNA capping efficiency comprising: treating an mRNA sample with capping enzymes in the presence of heavy labelled methyl donor and heavy labelled nucleotide to form a treated mRNA sample optionally comprising mRNA with a heavy labelled 5’cap; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • the heavy labelled methyl donor is as described herein (e.g. CD 3 -SAM).
  • the heavy labelled nucleotide is as described herein (e.g. 13 C, 15 N-GTP). This method may be used when the 5’ cap is CapO. This method is illustrated in Figure 2.
  • the capping enzyme comprises VCE and mRNA Cap 2'-O-Methyltransferase or an enzyme with mRNA Cap 2'-O- Methyltransferase activity.
  • This assay may be used when the 5’ cap is Cap1 .
  • Capping enzymes mRNA capping is a three-step process catalysed by capping enzymes (e.g. RNA triphosphatase, guanylyltransferase, and methyltransferase). Through a series of three steps, the cap is added to the first nucleotide's 5' hydroxyl group of the mRNA strand. This may occur co-transcriptionally (i.e. while the mRNA is still be synthesized) or after transcription of the mRNA is complete.
  • capping enzymes e.g. RNA triphosphatase, guanylyltransferase, and methyltransferase.
  • RNA prepared using in vitro transcription is more frequently the case for RNA prepared using in vitro transcription as the RNA is first synthesised from a DNA template using in vitro transcription and then the 5’cap can be added using a capping enzyme.
  • First for the addition of a 7-methylguanosine cap or CapO, RNA 5' triphosphatase hydrolyses the 5' triphosphate group to remove the terminal phosphate group producing 5’ diphosphate- RNA.
  • RNA methyltransferase transfers a methyl group from a methyl donor to the N7 position of the cap guanosine to yield a 7-methylguanosine cap that is attached to the 5' end of the transcript.
  • These reactions typically require GTP and a methyl donor, such as S-adenosylmethionine (SAM).
  • GTP is required for the addition of GMP by guanylyltransferase.
  • the methyl donor e.g. SAM
  • SAM SAM
  • RNA triphosphatase cleaves the 5'-triphosphate of mRNA to a diphosphate, pppN1 (p)Nx— OH(3') ⁇ ppN1 (pN)x— OH(3')+Pi;
  • RNA guanyltransferase catalyzes the addition of GMP (from GTP) to the 5'- diphosphate of the most 5' nucleotide (N1) of the mRNA, ppN1 (pN)x— OH(3')+GTP— >GpppN1 (pN)x— OH(3')+PPi; and finally,
  • guanine-7-methyltransferase using S-adenosylmethionine (AdoMet) as a cofactor, catalyzes methylation of the 7-nitrogen of guanine in the cap nucleotide forming the CapO structure,
  • mRNA Cap 2'-O-Methyltransferase using S-adenosylmethionine (AdoMet) as a co-factor, catalyses methylation of the 2’-hydroxy group on the first ribose sugar, m 7 GpppN1 (pN)x — OH(3') +AdoMet— > m 7 GpppNi*(pN)x — OH(3') +AdoHyc, where N/ is methylated on the 2’hydroxy group.
  • the methods described herein comprise treating an mRNA sample with a capping enzyme to form a treated mRNA sample.
  • a capping enzyme or CE is an enzyme that catalyzes one or more of the reactions involved in attachment of the 5' cap to messenger RNA molecules.
  • Capping enzymes include RNA triphosphatase, guanylyltransferase (or CE), and methyltransferase.
  • a capping enzyme or a capping enzyme system refers to the combination of one or more polypeptides having enzymatic activities that, in the presence of a cap nucleotide, including a modified cap nucleotide, and suitable reaction conditions, results in synthesis of capped RNA, including a modified- nucleotide-capped RNA, for example capped RNA having a capO structure.
  • a capping enzyme system or capping enzyme suitable for use in the methods described herein comprises RNA triphosphatase and RNA guanyltransferase enzymatic activities, and optionally, the capping enzyme system or capping enzyme can also comprise RNA guanine- 7-methyltransferase enzymatic activity.
  • capping enzyme system or capping enzyme suitable for use in the methods described herein comprises RNA triphosphatase, RNA guanyltransferase and RNA guanine-7-methyltransferase enzymatic activities.
  • Capping enzyme systems that can be used in the methods of the present disclosure are well known in the art (e.g., see Shuman, S, Prog. Nucleic Acid Res. Mol. Biol. 66: 1-40, 2001 ; Shuman, S, Prog. Nucleic Acid Res. Mol. Biol. 50: 101-129, 1995; Bisaillon, M and Lemay, G, Virology 236: 1-7, 1997; Banerjee, A K, Microbiol. Rev. 44: 175-205, 1980).
  • vaccinia virus capping enzymes include, but are not limited to, vaccinia virus capping enzymes, faustovirus capping enzymes and poxvirus capping enzymes, including both full-length and enzymatically active portions thereof, which capping enzymes have been identified, purified, characterized, cloned, and expressed recombinantly (e.g., see Martin S A et al., J Biol Chem 250: 9322-9329, 1975; Shuman, J Biol Chem 265: 11960-11966, 1990; Shuman and Morham, 265: 11967-11972, 1990; M A Higman, et al., J. Biol. Chem. 267: 16430, 1992; Myette, J R and Niles, E G, J.
  • vaccinia virus capping enzymes include, but are not limited to, vaccinia virus capping enzymes, faustovirus capping enzymes and poxvirus capping enzymes, including both full-length and
  • RNA triphosphatase RNA guanyltransferase and guanine-7- methyltransferase enzymatic activities
  • the active sites for the RNA triphosphatase, RNA guanyltransferase and guanine-7- methyltransferase enzymatic activities can be on single-component polypeptides, 2- component polypeptides (typically having RNA triphosphatase and RNA guanyltransferase activities), or on a 3-component polypeptide, from a cloned or a wild-type source.
  • the capping enzyme system can originate from one wild type source, or one or more of the RNA triphosphatase, RNA guanyltransferase, and/or guanine-7- methyltransferase activities can comprise a polypeptide from a different source, which polypeptides can each be encoded by a DNA sequence originating from the same biological source or by a DNA sequence originating from a different biological source.
  • the RNA triphosphatase component of the capping enzyme comprises a divalent cationdependent RNA triphosphatase encoded by a DNA virus or fungus having conserved motifs A, B, and C.
  • the RNA triphosphatase is encoded by a poxvirus gene.
  • the RNA triphosphatase is encoded by a vaccinia virus gene.
  • any suitable RNA triphosphatase may be used.
  • the RNA triphosphatase comprises a divalent cation-independent RNA triphosphatase encoded by a DNA derived from a nematode, mammalian or other metazoan source, so long as the RNA triphosphatase removes a gamma phosphate of a triphosphate-terminated RNA to form an RNA with a 5'- diphosphate terminus.
  • the capping enzyme system can lack RNA triphosphatase activity in some examples.
  • RNA guanyltransferases of capping enzyme systems are structurally and mechanistically conserved among fungi, metazoans, protozoa, and DNA viruses (Shuman, S, Prog. Nucleic Acid Res. Mol. Biol. 66: 1-40, 2001).
  • the capping enzyme has a conserved motif I consisting of the amino acid sequence KxDGxx (SEQ ID NO:1), wherein X is any amino acid.
  • the sixth (6th) position of said motif I is not arginine.
  • Motif I contains the active site of covalent attachment of GMP to the capping enzyme within the RNA guanyltransferase portion of capping enzyme.
  • motif I of the capping enzyme has the amino acid sequence KTDG(I/V)(P/G) (SEQ ID NO:2). In some examples, motif I of the capping enzyme has the amino acid sequence KTDG(I/V)X (SEQ ID NO:3), wherein the 6th amino acid (i.e. X) of said motif I is an amino acid selected from the group consisting of phenylalanine, serine, and leucine. Another conserved motif within the capping enzyme is motif III, which is also within the RNA guanyltransferase portion of the capping enzyme.
  • the first position of motif III is valine, isoleucine, or tyrosine
  • the sixth position of motif III is glutamic acid
  • the fourth position of motif III is phenylalanine, tyrosine or tryptophan.
  • motif III has the amino acid sequence VVVFGEAV (SEQ ID NO:4).
  • motif III has the amino acid sequence YRLWCEAV (SEQ ID NO:5).
  • motif III has the amino acid sequence VT(L/I)YGEA(I/V) (SEQ ID NO:6).
  • motif III has the amino acid sequence (VZI)YLYAEMR (SEQ ID NO:7).
  • motif III has the amino acid sequence (V/I)XL(Y/F)GEA(I/V) (SEQ ID NO:8), wherein X is any amino acid.
  • the RNA guanyltransferase is encoded by a poxvirus gene. In some examples, the RNA guanyltransferase is encoded by a vaccinia virus gene.
  • the “capping enzyme” or a “capping enzyme system” useful in the methods described herein, optionally comprises a guanine-7-methyltransferase.
  • a guanine-7-methyltransferase optionally comprises a guanine-7-methyltransferase.
  • the RNA guanyltransferase reaction step is reversible
  • the methylation step catalysed by the guanine- 7-methyltransferase activity of the capping enzyme is essentially irreversible. Therefore, 7- methylation of the guanine is useful because this step drives the reaction to completion in the direction of cap formation. Methylation of the cap is also useful for enhancing translation of the RNA.
  • guanine-7-methyltransferase enzymes of capping enzymes are highly conserved from DNA viruses to yeast to humans and other metazoans. This is shown by the fact that full-length and some truncated guanine-7- methyltransferase genes that encode S. pombe, C. albicans and human capping enzymes can complement deletions of the S. cerevisiae capping enzyme guanine-7- methyltransferase, by the fact that the guanine 7-methyltransferase domain of vaccinia virus capping enzyme can function in vivo in lieu of the yeast methyltransferase enzyme (Saha, N et al., J.
  • the guanine-7-methyltransferase portion of a capping enzyme of the invention can comprise a wild-type or recombinant enzyme from any of a wide variety of sources.
  • the guanine-7-methyltransferase is encoded by a poxvirus gene.
  • the guanine-7-methyltransferase is encoded by a vaccinia virus gene.
  • the guanine 7-methyltransferase has a conserved IHF amino acid motif. In some examples, the guanine 7-methyltransferase has a motif consisting of the amino acid sequence VL(D/E)XGXGXG (SEQ ID NO:9), wherein X is any amino acid.
  • the “capping enzyme” or a “capping enzyme system” useful in the methods described herein comprises mRNA Cap 2'-O-Methyltransferase (2’OMTase) or an enzyme with mRNA Cap 2'-O-Methyltransferase activity.
  • mRNA Cap 2'-O-Methyltransferase adds a methyl group at the 2'-O position of the first nucleotide adjacent to the cap structure at the 5' end of the RNA.
  • the enzyme utilizes S-adenosylmethionine (SAM) as a methyl donor to methylate capped RNA (cap-0) on the 2’OH group of the ribose to form a cap-1 structure.
  • SAM S-adenosylmethionine
  • the substrate for mRNA Cap 2'-O-Methyltransferase is RNA with an m 7 GpppN cap as substrate. It cannot utilize RNA with pN, ppN, pppN or GpppN at the 5' end.
  • RNA with an m 7 GpppN cap may be prepared using methods known to the person skilled in the art, for example, via in vitro transcription using a cap analog or through enzymatic capping using the Vaccinia Capping Enzyme or other capping enzyme.
  • mRNA Cap 2'-O-Methyltransferase may be produced recombinantly or is available from commercial suppliers (New England Biolabs).
  • the capping enzyme comprises a cap methyltransferase 1 and 2 for Cap1 and Cap2 formation at the 5’-end of the RNA, respectively.
  • the capping enzyme comprises Vaccinia virus Capping Enzyme (VCE).
  • VCE Vaccinia virus Capping Enzyme
  • the VCE is composed of two subunits (D1 and D12).
  • the D1 subunit comprises a RNA triphosphatase, guanylyltransferase and guanine methyltransferase.
  • the D12 subunit binds and stimulates the methyltransferase.
  • the VCE can be used to add the 7-methylguanylate cap structure (Cap 0) to the 5' end of RNA generated by in vitro transcription.
  • the capping enzyme is the Vaccinia virus Capping Enzyme (VCE), an enzyme with VCE like biochemical activity or an enzyme system based VCE.
  • the capping enzyme is the Vaccinia virus Capping Enzyme (VCE).
  • VCE Vaccinia virus Capping Enzyme
  • the capping enzyme is purified from vaccinia virus, whereas in other examples, the vaccinia capping enzyme is a purified recombinant vaccinia virus capping enzyme.
  • the vaccinia virus capping enzyme is a mutant or variant of the wild-type enzyme (e.g., that exhibits greater enzymatic activity compared to wild-type capping enzyme).
  • Variants, including allelic variants, muteins, analogs and fragments capable of functioning as the provided capping enzyme are known in the art and are also contemplated by this invention.
  • the capping enzyme comprises Faustovirus Capping Enzyme (FCE).
  • FCE catalyses the addition of N7-methylguanosine cap to the 5' end of triphosphorylated and diphosphorylated transcripts, producing Cap-0 RNA (Ramanathan, A. et al. (2016). Nucleic Acids Res . 44 (16), 7511-7526).
  • the FCE is a single-subunit enzyme that comprises triphosphatase, guanylyltransferase, and (guanine-N7)-methyltransferase activities.
  • FCE retains significant capping activity at low temperatures and tolerates reaction temperatures up to 55°C. In one example, the capping reaction is performed between 15 and 55 degC.
  • the capping reaction is performed between 25 and 55 degC.
  • the capping enzyme is recombinantly expressed, for example, in E. coli.
  • the FCE is a mutant or variant of the wild-type enzyme (e.g., that exhibits greater enzymatic activity compared to wild-type capping enzyme).
  • Variants including allelic variants, muteins, analogs and fragments capable of functioning as the provided capping enzyme are known in the art and are also contemplated by this disclosure. Suitable FCE and variants thereof variants are described in
  • FCE is compatible with mRNA Cap 2'-O-Methyltransferase enabling one-pot synthesis of mRNA having a Cap1 structure.
  • the capping enzyme comprises FCE and mRNA Cap 2'-O-Methyltransferase. Use of FCE and mRNA Cap 2'-O- Methyltransferase allows for quantification of Cap1 capping efficiency in a single pot reaction.
  • the capping enzyme comprises a RNA triphosphatase, RNA guanyltransferase, and/or guanine-7-methyltransferase.
  • the capping enzyme comprises a RNA guanyltransferase.
  • the capping enzyme comprises a RNA triphosphatase and RNA guanyltransferase.
  • the capping enzyme comprises a RNA triphosphatase, RNA guanyltransferase, and guanine-7- methyltransferase.
  • the capping enzyme comprises a guanine-7- methyltransferase.
  • the methods described herein comprise treating an mRNA sample with capping enzyme and one or more labelled reagents (e.g. heavy GTP and/or heavy SAM).
  • labelled refers to attachment of a detectable signal, agent or moiety to a compound.
  • detectable signal refers to a signal that can be detected or measured by a human being or a machine. In one example, a detectable signal can be quantified such that the intensity of the signal is related to (e.g., proportional to) the amount of the compound associated with the signal.
  • a detectable signal may be detected, measured or quantified by a spectroscopic, photochemical, biochemical, immunochemical, electrical, optical, or chemical means.
  • a “detectable signal” may also be referred to as “detectable agent” or “detectable moiety” in this application.
  • the “detectable signal” is detectable by mass spectrometry.
  • the labelled reagents are labelled with label that is detectable by mass spectrometry.
  • the labelled reagents are labelled with a stable isotope.
  • the labelled reagents are labelled with a heavy isotope.
  • a “heavy” isotope is the stable isotope or stable isotopes of an element, which are heavier than the most abundant isotope.
  • a “heavy isotope” is a stable atom in which there are more neutrons than in the normal isotope of the element, giving it a greater mass. For instance, 18 O is considered as heavy oxygen, compared to the most abundant 16 O.
  • Heavy isotopes of nitrogen includes 15 N (c.f. 14 N).
  • Heavy isotopes of Carbon include 13 C and heavy isotopes of hydrogen include 2 D, also referred to as deuterium.
  • the labelled reagent may comprise one or more 15 N, 13 C and/or D ( 2 H) atoms. These reagents are often referred to as “heavy” reagents, e.g. heavy GTP and heavy SAM. Heavy reagents can also be referred to as “isotopically labelled” reagents, e.g. isotopically labelled GTP, isotopically labelled SAM and the like.
  • the labelled reagent is a heavy labelled reagent (also referred to as a heavy reagent or isotopically labelled reagent).
  • the heavy labelled reagent is a heavy labelled substrate and/or co-factor of the capping enzyme. Any heavy labelled substrate and/or co-factor that is suitable for use with the capping enzyme may be used.
  • the heavy reagent comprises a heavy nucleotide, for example heavy ATP, heavy GTP, heavy CTP or heavy UTP.
  • the reagent is heavy GTP.
  • heavy GTP comprises 15 N-GTP, 13 C-GTP, D-GTP, 15 N, 13 C-GTP, 15 N, D-GTP, 13 C, D-GTP or 15 N, 13 C, D-GTP.
  • heavy GTP is 15 N, 13 C-GTP.
  • heavy GTP is 13 CI 0 , 15 N 5 -GTP.
  • the mass of 13 CI 0 , 15 N 5 -GTP is 15 daltons greater than regular/light GTP.
  • heavy GTP is a compound of formula I shown below and is available from commercial suppliers such as CortecNet (Paris-Saclay, France):
  • the labelled reagent comprises a heavy labelled methyl donor. Any suitable methyl donor may be used provided the methyl group being transferred includes one or more heavy atoms, e.g. CD 3 .
  • the regent is heavy SAM. SAM is also referred to as S-Adenosyl methionine or AdoMet.
  • heavy SAM comprises D- SAM, 13 C-SAM, or D, 13 C-SAM.
  • heavy SAM is D-SAM.
  • heavy SAM is D 3 -SAM.
  • heavy SAM is a compound of formula (II) shown below:
  • the labelled reagent comprises a heavy labelled nucleotide and a heavy labelled methyl donor. In one example, the labelled reagent comprises a nucleotide and a heavy labelled methyl donor. In one example, the labelled reagent comprises a heavy labelled nucleotide and a methyl donor. In one example, the labelled reagent comprises 13 C, 15 N-GTP and/or D 3 -SAM.
  • the labelled reagents are not labelled with a radioisotope (e.g. 32 P). In one example, the labelled reagents are not labelled with a fluorescent label. In one example, the labelled reagents are not labelled with biotin.
  • a radioisotope e.g. 32 P
  • the labelled reagents are not labelled with a fluorescent label. In one example, the labelled reagents are not labelled with biotin.
  • the methods described herein provides a person skilled in the art with a way of quantifying the amount of uncapped mRNA in a sample without the need for radiolabels.
  • LC-MS electrospray mass spectrometry
  • detecting their differences in mass the amount of uncapped mRNA in a sample can be measured accurately and with high-resolution.
  • the methods described herein comprise the step of digesting the treated mRNA sample with an nuclease (e.g. RNase) to release the 5’ cap.
  • an nuclease e.g. RNase
  • the released 5’cap may be a dinucleotide (e.g. m 7 GpppG) or form part of a oligonucleotide.
  • the oligonucleotide comprising the 5’cap may comprise 2, 3, 4, 5 or more nucleotides including the first nucleotide. It is to be appreciated that examples of the method are not limited by the identity of the nuclease, although certain nuclease may provide one or more advantages.
  • nuclease capable of cleaving or digesting the mRNA, and particularly single stranded mRNA, to release the 5’cap may be used. It would also be appreciated by the person of skill in the art that the identity of the cap and/or the sequence at the 5’end of the mRNA may influence the choice of nuclease. In addition, the specificity of the nuclease may also influence the choice of nuclease. For example, Nuclease NP1 may be preferred when the mRNA is capped with CapO, Cap1 or Cap2.
  • RNase A may be used when the first nucleotide following the triphosphate linkage is a cytosine (or uracil) in analysing mRNAs with CapO.
  • RNase T1 may be used when the first nucleotide following the triphosphate linkage is a guanosine respectively in analysing mRNAs with CapO.
  • the cleavage site can be further moved down to the third, fourth etc nucleotide depending on the nature of the mRNA, nuclease and/or testing requirement(s).
  • the nuclease is an RNase. Suitable nucleases include, but are not limited to, RNase A, RNase T1 , NP1 , barnase, colicin E5, and mazF and the like.
  • a suitable nuclease is RNase T1 or an enzyme with RNAse T1 like biochemical activity.
  • RNase T1 is an endonuclease that cleaves single-stranded RNA after guanine residues, i.e., on the 3' side of the G.
  • one advantage of RNase T1 is that it does not require metal ions for activity.
  • the inventors also found that digestion with RNase T1 produced m 7 GpppGp which could be more readily distinguished from background m 7 GpppG using LC-MS.
  • the reaction products include oligonucleotides with a terminal 3'-Gp.
  • the reaction products include m 7 *G*pppGp.
  • the G* may be heavy labelled and the ratio of heavy labelled cap to unlabelled cap in the digested sample can be determined as described herein to determine the percentage capped mRNA in the original sample.
  • the m* may also be heavy labelled and the ratio of heavy labelled methylated cap to unlabelled methylated cap in the digested sample can be determined as described herein to determine the percentage unmethylated capped mRNA in the original sample.
  • the RNase T1 is from the mould Aspergillus oryzae.
  • RNase T1 and variants thereof may be manufactured using recombinant techniques or are available commercially from suppliers, such as Thermo Fisher Scientific and SigmaAldrich. In some embodiments, it may be desired to heat the sample (e.g., to about 37 °C)to promote RNA digestion.
  • the pH of the nuclease reaction mixture is between about 5 and 8, e.g. pH 7.5. In some examples, the reaction is performed in accordance with the manufacturer’s instructions.
  • a suitable nuclease is Nuclease P1 (NP1) or an enzyme with NP1 like biochemical activity.
  • NP1 is a zinc dependent endonuclease that cleaves single-stranded RNA or DNA with no base specificity and is capable of converting single-stranded DNA or RNA to 5'-mononucleotides.
  • the reaction products include oligonucleotides with a terminal 3'-Gp and a terminal 3’-G. In the case of CapO capped mRNA, the reaction products include m 7 *G*pppG. Depending on whether heavy GTP or heavy-SAM are used, the G* and/or m* may be heavy labelled.
  • NP1 is from the mould Penicillium citrinum. NP1 and variants thereof may be manufactured using recombinant techniques or are available commercially from suppliers, such as Thermo Fisher Scientific and New England Biolabs. In some embodiments, it may be desired to heat the sample (e.g., to about 37 °C or to about 60 °C) to promote RNA digestion.
  • the pH of the nuclease reaction mixture is between about 5 and 8, e.g. pH 5.5. In some examples, the reaction is performed in accordance with the manufacturer’s instructions.
  • a suitable nuclease is RNase A or an enzyme with RNase A like biochemical activity.
  • RNase A is a endoribonuclease that specifically degrades singlestranded RNA at C and U (pyrimidine) residues. It cleaves the phosphodiester bond between the 5'-ribose of a nucleotide and the phosphate group attached to the 3'-ribose of an adjacent C or U (pyrimidine) nucleotide. The resulting 2', 3'-cyclic phosphate is hydrolysed to the corresponding 3'-nucleoside phosphate.
  • the reaction products include oligonucleotides with a terminal 3'-(C/U)p.
  • the reaction products include oligonucleotides comprising the 5’cap, for example m 7 *G*pppG(N) x (C/U)p, wherein N is A or U and x is an integer starting at 0.
  • the G* and/or m* may be heavy labelled and the ratio of heavy labelled cap to unlabelled cap in the digested sample can be determined to determine the percentage capped mRNA in the original sample.
  • RNase A is from Bovine pancreas.
  • RNase A and variants thereof may be isolated from Bovine pancreas, manufactured using recombinant techniques or are available commercially from suppliers, such as Thermo Fisher Scientific and SigmaAldrich.
  • the sample e.g., to about 37 °C, to about 50 °C or to about 60 °C
  • the nuclease reaction mixture contains NaCI at a concentration of 0.3M or higher.
  • the reaction is performed in accordance with the manufacturer’s instructions.
  • two or more nucleases may be used in combination, for example RNase T 1 and NP1 , RNase T 1 and RNase A, NP1 and RNase A or RNase T 1 , NP1 and RNase A.
  • nucleases can be categorised into groups based on the intermediate formed during hydrolysis of an RNA.
  • hydrolysis of an RNA by a nuclease proceeds via a 2',3'-cyclic phosphate intermediate (see Figure 4).
  • RNA cleavage by these nucleases includes a transesterification (transphosphorylation) step, forming a cyclic phosphate intermediate followed by hydrolysis of the cyclic phosphate intermediate to generate a 3'-phosphate.
  • Nucleases that form a 2', 3'- cyclic phosphate intermediate include, but are not limited to RNaseA, RNase T1 and RNAse T2.
  • hydrolysis of an RNA by a nuclease does not proceed via a 2', 3'- cyclic phosphate intermediate.
  • Nucleases that do not form a 2',3'-cyclic phosphate intermediate include, but are not limited to NP1 .
  • the nuclease used in the methods described herein is a nuclease that forms an 2',3'-cyclic phosphate intermediate, for example, RNaseA, RNase T1 or RNAse T2. It is thought that due to their mechanism of hydrolysis, these nucleases will only be suitable for quantifying capping efficiency of RNA with a hydroxyl (-OH) group at the 2’ position of the ribose, e.g. RNA with capO not Cap1 .
  • the nuclease is RNaseA, RNase T1 and/or RNAse T2 and the 5’cap is CapO.
  • the nuclease is RNaseA and/or RNase T1 and the 5’cap is CapO. In one example, the nuclease is RNaseA and the 5’cap is CapO. In one example, the nuclease is RNase T1 and the 5’cap is CapO.
  • the cleaved product from such nucleases will be m7GTPGp or m7GTPAp.
  • the nuclease used in the methods described herein is a nuclease that does not form an 2',3'-cyclic phosphate intermediate, for example, NP1 .
  • nucleases will be suitable for quantifying capping efficiency of RNA with a hydroxyl (-OH) or -OR where R is a C1-C4 alkyl (e.g. -OCH 3 ) at the 2’ position of the ribose, e.g. RNA with capO or Cap1 .
  • the nuclease is NP1 and the 5’cap is CapO or Cap1 .
  • the cleaved product from such nucleases will be m7GTPG (or m7GTPA) and m7GTPGm (or m7GTPAm) for capO and cap1 RNA, respectively.
  • the methods described herein comprise treating an mRNA sample with a capping enzyme and heavy labelled reagent (e.g. heavy GTP and/or heavy SAM).
  • a capping enzyme and heavy labelled reagent e.g. heavy GTP and/or heavy SAM
  • the mRNA sample will comprise one or more of capped mRNA, uncapped mRNA and unmethylated capped mRNA.
  • the capped mRNA referred to has a 5’ cap structure or 5’cap.
  • the term “5’cap structure” or “5’ cap” refers to a structure at the 5’ terminal end of a mRNA.
  • the 5’cap structure is known to stabilise mRNA through association of CBP with poly(A) binding protein to form a mature mRNA.
  • the presence of a 5’cap structure in the mRNA of the present disclosure can further increase the stability of the mRNA compared to a mRNA without the 5’cap.
  • the 5' cap structure provides resistance to 5'-exonuclease activity and its absence results in rapid degradation of the mRNA
  • an endogenous mRNA is 5’capped with a guanosine through a (5)’-ppp- (5)’-triphosphate linkage attached to the 5’terminal nucleotide of the mRNA.
  • the guanosine cap can then be methylated to a 7-methylguanosine (m 7 G) generating a m 7 GpppNip-, wherein Ni represents the first 5’terminal nucleotide of the mRNA (e.g. CapO).
  • This structure can be further 2’-O-methylated to produce m 7 GpppNimp- (e.g. Cap1), and/or m 7 G- pppNimpN 2 mp (e.g. Cap2).
  • Exemplary 5’cap structures include, but are not limited to, CapO, Cap1 , Cap2, Cap4, anti-reverse cap analogue (ARCA), inosine, N7,2'-0-dimethyl-guanosine (mCAP), N1- methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, 2-azido-guanosine, N6,2'-0-dimethyladenosine, 7- methylguanosine (m 7 G) and CAP-003-CAP-225.
  • the capped mRNA of the present disclosure comprises an endogenous cap.
  • the term “endogenous cap” refers to a 5’cap capable of being synthesised in a cell.
  • an endogenous cap is a natural 5’cap or a wildtype 5’cap.
  • the endogenous cap is a CapO, Cap1 , or Cap2 structure.
  • the 5’ cap is CapO.
  • the 5’cap is Cap1 .
  • the 5’cap is cap2.
  • the 5’cap is CapO or Cap1 .
  • the 5’cap is m 7 GpppNip-, wherein Ni represents the first 5’terminal nucleotide of the mRNA.
  • Ni can be any nucleotide.
  • Ni comprises A, m 6 A, G, C or U.
  • Ni is A or m 6 A.
  • Ni is G.
  • the Ni nucleotide may be methylated on the 2’OH.
  • the 5’ cap can be further 2’-O- methylated to produce m 7 GpppNimp-, and/or m 7 G-pppNimpN 2 mp.
  • the capped mRNA of the present disclosure comprises an analog of an endogenous cap (also referred to as cap analog).
  • an analog in the context of an endogenous cap or “cap analog” refers to a synthetic 5’cap.
  • the cap analog can be used to produce 5’capped mRNA in in vitro transcription reactions.
  • Cap analogs may be chemically (i.e. non-enzymatically) or enzymatically synthesized and/or linked to a nucleotide (e.g. 5’terminal nucleotide of an mRNA).
  • Suitable cap analogs include, but are not limited to, m 7 GpppG, m 7 GpppA, m 7 GpppC, 3’-O-Me-m 7 GpppG, unmethylated cap analogs (e.g. GpppG); dimethylated cap analogs (e.g.
  • m 2 7 GpppG trimethylated cap analog (e.g., m 2 ’ 2 ’ 7 GpppG), dimethylated symmetrical cap analogs (e.g., m 7 Gpppm 7 G), or anti reverse cap analogs (e.g., ARCA; rn 7 ’ 2 Ome GpppG, m 72 d GpppG, m 7 ’ 3 Ome GpppG, m 7 ’ 3 d GpppG and their tetraphosphate derivatives) (see, e.g., Jemielity, J. et al, “Novel ‘anti-reverse’ cap analogs with superior translational properties'”, RNA, 9: 1 108-1122 (2003)).
  • ARCA rn 7 ’ 2 Ome GpppG, m 72 d GpppG, m 7 ’ 3 Ome GpppG, m 7 ’ 3 d GpppG and their tetraphosphate derivatives
  • the cap analog is N7,3'-0-dimethyl-guanosine-5'-triphosphate-5'-guanosine (i.e. anti-reverse cap analogue (ARCA)).
  • ARCA can only insert in the proper orientation, which, for example, results in capped mRNAs that are translated twice as efficiently as those initiated with m 7 GpppG.
  • the 5’ cap has a structure of formula (III):
  • B is a nucleobase
  • R 1 is selected from a H, halogen, OH, and OCH 3
  • R 2 is selected from H, OH and OCH 3
  • R 3 is CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or is absent
  • R 4 is NH 2
  • R 5 is selected from OH, OCH 3 or a halogen
  • n is 1 , 2, or 3
  • M is a nucleotide of the mRNA.
  • R 1 is selected from halogen, OH, and OCH 3 .
  • R 1 is selected from H, OH, and OCH 3 .
  • R 1 is selected from OH, and OCH 3 .
  • R 1 is OH.
  • R 5 is OCH 3 or OH. In one example, R 5 is OH. In one example, R 5 is OCH 3 . In one example, R 1 is OH, R 2 is OH, R 3 is CH 3 , R 4 is NH 2 , R 5 is OH or OCH 3 and n is 1 . In one example, R 1 is OH, R 2 is OH, R 3 is CH 3 , R 4 is NH 2 , R 5 is OH and n is 1 .
  • the nucleobase B is guanine, cytosine, uracil or adenine. In one example, the nucleobase B is adenine. In one example, the nucleobase B is guanine.
  • the cap is m 7 GpppmG wherein the 2' OH group of the ribose ring of base 1 is methylated (i.e., R 5 is OCH 3 ). In one example, the cap is m 7 GpppG wherein the R 5 group of the ribose ring of base 1 is -OH. In one example, the cap has a structure of formula (IV): wherein, R 2 is H, OH or OCH 3 ; R 4 is NH 2 ; R 5 is OH or OCH 3 R 6 is H or CH 3 ; M is a nucleotide of the mRNA.
  • R 2 is OH, R 4 is NH 2 , R 5 is OH or OCH 3 and R 6 is H.
  • R 2 is OH
  • R 4 is NH 2
  • R 5 is OH and R 6 is H.
  • R 5 is OH.
  • R 5 is OCH 3 .
  • R 5 is OCH 3 or OH.
  • the 5’cap is an unmethylated cap with a structure for formula (IVa): wherein M is a nucleotide of the mRNA.
  • the 5’cap is an unmethylated cap with a structure for formula (IVb): wherein M is a nucleotide of the mRNA.
  • the cap has a structure of formula (V):
  • R 2 is H, OH or OCH 3 ;
  • R 4 is NH 2 ;
  • R 5 is OH or OCH 3 ,
  • M is a nucleotide of the mRNA.
  • R 2 is OH, R 4 is NH2 and R 5 is OH or OCH3.
  • R 2 is
  • R 4 is NH 2 and R 5 is OH.
  • R 5 is OH.
  • R 5 is OCH 3 .
  • R 5 is OCH 3 or OH.
  • the 5’ cap has a structure of Formula (VI): wherein R 7 is an OH or OP(O) 2 O-M, wherein M is a nucleotide of the mRNA.
  • 5’cap is also referred to as CleanCap AG (N-71 13) (TriLink Biotechnologies, Inc.) and has a 5' N 7 -methylguanosine structure.
  • the 5’ cap has a structure of Formula (VII):
  • R 7 is an OH or OP(O) 2 O-M, wherein M is a nucleotide of the mRNA.
  • the 5’ cap has a structure of Formula (Villa): wherein R 7 is an OH or OP(O)2O-M, wherein M is a nucleotide of the mRNA.
  • the above 5’cap is also referred to as CleanCap AG (3’OMe) - (N-7413) (TriLink Biotechnologies, Inc.) and includes the 5' N7-Methyl-3'-0-Methylguanosine commonly found in mRNA capped using ARCA.
  • the 5’ cap has a structure of Formula (VII I b) :
  • R 7 is an OH or OP(O) 2 O-M, wherein M is a nucleotide of the mRNA.
  • the 5’ cap has a structure of Formula (IXa): wherein R 7 is an OH or OP(O) 2 O-M, wherein M is a nucleotide of the mRNA.
  • R 7 is an OH or OP(O) 2 O-M
  • M is a nucleotide of the mRNA.
  • CleanCap AG - N-7114
  • TriLink Biotechnologies, Inc. TriLink Biotechnologies, Inc.
  • m 7 Gppp(2'OMeA)pll m 7 Gppp(2'OMeA)pll.
  • the 5’ cap has a structure of Formula (IXb): wherein R 7 is an OH 0r OP(O) 2 O-M, wherein M is a nucleotide of the mRNA.
  • 5’ caps are commercially available, for example from TriLink Biotechnologies, Inc., San Diego CA USA.
  • the 5’ cap can be synthesised using techniques known to the person skilled in the art.
  • the 5’cap structure is a non-hydrolysable cap structure.
  • the non- hydrolysable cap structure can prevent decapping of the mRNA and increase the half-life of the mRNA.
  • modified nucleotides may be used during the capping reaction.
  • one or more of the oxygen atoms in the phosphorodiester linkage may be replaced, for example with a sulphur atom.
  • the cap structure may comprise a phosphorothioate linkage.
  • a 5'-Phosphorothiolate dinucleotide cap analog is used to form the cap (e.g.
  • Vaccinia Capping Enzyme New England Biolabs
  • a-thio- guanosine nucleotides may be used with a-thio- guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap.
  • the non-hydrolysable cap structure comprises a modified nucleotide selected from a group consisting or a a-thio- guanosine nucleotide, a-methyl-phosphonate, seleno-phosphate, and a combination thereof.
  • the modified nucleotide is linked to the 5’end of the mRNA through an a- phosphorothiate linkage. Methods of linking the modified nucleotide to the 5’end of the mRNA will be apparent to the skilled person. For example, using a Vaccinia Capping enzyme (New England Biolabs) or poxvirus capping enzyme.
  • Additional modifications include, but are not limited to, 2'-0-methylation of the ribose sugars of 5'-terminal and/or 5'- anteterminal nucleotides of the mRNA on the 2'-hydroxyl group of the sugar ring.
  • Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a nucleic acid molecule, such as an mRNA molecule.
  • the present disclosure provides a method for quantifying mRNA capping efficiency.
  • messenger RNA also referred to as mRNA
  • mRNA refers to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated (e.g. directly or indirectly translated) to produce the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.
  • the mRNA may or may not be chemically modified.
  • the mRNA of the present disclosure encompasses a non-self-replicating mRNA (also referred to as conventional mRNA (cRNA)), a self-replicating RNA (sa-mRNA), and any RNA that requires a 5’cap.
  • the mRNA is sa-mRNA.
  • the mRNA is cRNA.
  • cRNA comprises, in order from 5’ to 3’: a 5’cap structure, a 5’-UTR, a nucleotide sequence encoding a polypeptide of interest, a 3’-UTR and a tailing sequence (e.g. a polyadenylation signal or poly-A tail).
  • the cRNA of the present disclosure may further comprise an translation internal ribosome entry site (e.g. Kozak consensus sequence or IRES).
  • the cRNA may also comprise a chain terminating nucleotide and/or a stem loop.
  • self-replicating RNA refers to a construct based on an RNA virus that has been engineered to allow expression of heterologous RNA and proteins.
  • Self-replicating RNA can also be referred to as a replicon.
  • Self-replicating RNA can amplify in host cells leading to expression of the desired gene product in the host cell.
  • the present disclosure provides a monocistronic self-replicating RNA.
  • the present disclosure provides a bicistronic self-replicating RNA.
  • the present disclosure provides a multi-cistronic self-replicating RNA.
  • the sa-mRNA of the present disclosure comprises one or more features of a cRNA, however, sa-mRNA further comprises nucleotide sequences encoding non-structural proteins (NSPs) which enables the sa-mRNA to direct its self-replication.
  • NSPs non-structural proteins
  • Non-structural proteins include at least one or more genes selected from the group consisting of a viral replicase (or viral polymerase), a viral protease, a viral helicase and other non-structural viral proteins.
  • self-replicating RNA can be based on the genomic RNA of RNA viruses.
  • the RNA should be positive (+)-stranded so that it can be directly translated after delivery to a cell without the need for intervening replication steps (e.g., reverse transcription). Translation of the RNA results in the production of non-structural proteins (NSPs) which combine to form a replicase complex (i.e., an RNA-dependent RNA polymerase).
  • the replicase complex is the component of the sa-mRNA which amplifies the original RNA producing both antisense and sense transcripts, resulting in production of multiple daughter RNAs, and subsequently the encoded polypeptide of interest.
  • the self-replicating RNA comprises a viral replicase (or viral polymerase).
  • the sa-mRNA comprises NSPs derived from (or based on) an alphavirus.
  • alphaviruses include, but are not limited to, Venezuelan equine encephalitis virus (VEEV; e.g., Trinidad donkey, TC83CR), Semliki Forest virus (SFV), Sindbis virus (SIN), Ross River virus, Western equine encephalitis virus, Eastern equine encephalitis virus, Chikungunya virus, S.A.
  • alphavirus may also include chimeric alphaviruses (e.g., as described by Perri et al, (2003) J. Virol. 77(19): 10394-403) that contain genome sequences from more than one alphavirus.
  • the self-replicating RNA is derived from or based on a virus other than an alphavirus, for example, a positive-stranded RNA virus.
  • a positive-stranded RNA virus suitable for use in the present disclosure will be apparent to the skilled person and include, for example, a picornavirus, a flavivirus, a rubivirus, a pestivirus, a hepacivirus, a calicivirus, or a coronavirus.
  • the sa-mRNA also includes a subgenomic (SG) promoter which, when linked to a nucleotide sequence encoding NSPs and/or an polypeptide of interest, drives the expression of the NSPs and/or polypeptide of interest.
  • SG subgenomic
  • the present disclosure provides a self-replicating RNA comprising a nucleotide sequence encoding an antigen operably linked to a SG promoter.
  • SG promoters also known as ‘junction region’ promoters
  • suitable for use in the present disclosure will be apparent to the skilled person and/or are described herein.
  • the SG promoter is derived from or based on an alphavirus SG promoter.
  • the SG promoter is a native alphavirus SG promoter.
  • the native SG promoter is a minimal SG promoter.
  • the minimal SG promoter is the minimal sequence required for initiation of transcription.
  • the self-replicating RNA comprises the non-structural proteins of the RNA virus, the 5’ and 3’ untranslated regions (UTRs) and the native subgenomic promoter.
  • the self-replicating RNA comprises a 5'- and a 3'-end UTR of the RNA virus.
  • the mRNA of the present disclosure typically comprises a nucleotide sequence encoding a polypeptide of interest.
  • the nucleotide sequence may encode any polypeptide known to the person skilled in the art, including any naturally or non-naturally occurring or otherwise modified polypeptide.
  • a polypeptide encoded by an mRNA may be of any size and may have any secondary structure or activity.
  • a polypeptide encoded by an mRNA may have a therapeutic effect when expressed in a cell.
  • the nucleotide sequence encodes an antigen e.g., a pathogenic antigen).
  • the antigen can induce an immune response in the subject.
  • the mRNA of the present disclosure comprises a nucleotide sequence that encodes an antigen from a virus.
  • Viruses include but are not limited to influenza virus, coronavirus, respiratory syncytial virus, human metapneumovirus, human parainfluenza vims, Epstein-Ban virus, human papillomavirus, measles virus, varicella-zoster virus and the like.
  • the mRNA of the present disclosure comprises a nucleotide sequence that encodes an antigen from a respiratory virus, for example, influenza virus, coronavirus, respiratory syncytial virus, human metapneumovirus, human paraintluenza virus.
  • the antigen is from SARS- CoV-2. In one example, the antigen is from influenza. In one example, the antigen is from respiratory syncytial virus. In one example, the antigen is from human metapneumovirus. In one example, the antigen is from human parainfluenza virus.
  • the mRNA may have a coding region encoding at least one antigenic peptide or protein derived from hemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (Ml), matrix protein 2 (M2), non- structural protein 1 (NS1), non-structural protein 2 (NS2), nuclear export protein (NEP), polymerase acidic protein (PA), polymerase basic protein PB1 , PB1-F2, or polymerase basic protein 2 (PB2) of an influenza virus or a fragment or variant thereof.
  • HA hemagglutinin
  • NA nucleoprotein
  • Ml matrix protein 1
  • M2 matrix protein 2
  • NEP nuclear export protein
  • PA polymerase acidic protein
  • PB1 polymerase basic protein
  • PB1-F2 polymerase basic protein 2
  • the coding region encodes at least one antigenic peptide or protein derived from hemagglutinin (HA) and/or neuraminidase (NA) of an influenza virus or a fragment or variant thereof.
  • HA hemagglutinin
  • NA neuraminidase
  • the HA and/or NA may, independently, be derived from an influenza A virus or an influenza B virus or a fragment of either.
  • the mRNA molecule may have a coding region encoding at least one antigenic peptide or protein derived from Spike (S) protein and/or nucleocapsid (N) protein.
  • S and/or N may, independently, be derived from an variant of SARS-CoV-2 (e.g. the original strain, alpha, delta, omicron) or a fragment of either.
  • the mRNA may contain one or more intronic sequences capable of being excised from the mRNA.
  • the mRNA of the present disclosure comprises one or more modification(s).
  • modifications are introduced into a polynucleotide (e.g. mRNA) to increase the translation efficiency and/or stability of the polynucleotide.
  • a polynucleotide e.g. mRNA
  • Suitable modifications to the polynucleotide will be apparent to the skilled person and/or described herein.
  • RNA can be modified in many ways including chemically, structurally, and functionally, by methods known to those of skill in the biotechnological arts. Such RNA modifications can include, e.g., modifications normally introduced post-transcriptionally to mammalian cell mRNA.
  • mRNA molecules can be modified by the introduction during transcription of alternative nucleotides nucleosides or nucleotides, as described in U.S. Pat. No. 10 8,278,036 (Kariko et al.); U.S. Pat. Appl. No. 2013/0102034 (Schrum); U.S. Pat. Appl. No. 2013/0115272 (deFougerolles et al) and U.S. Pat. Appl. No. 2013/0123481 (deFougerolles et al.).
  • the first nucleotide sequence comprising the 5’-UTR and/or the fragment thereof is modified. Modification of the first nucleotide sequences comprising the 5’-UTR and/or the fragment thereof results in a variant of the 5’-UTR and/or the fragment thereof.
  • one or more nucleotide sequence(s) of the polynucleotide are codon optimized.
  • Method of codon optimization will be apparent to the skilled person and/or described herein.
  • tools for codon optimization of polynucleotide include, for example, GeneArt GeneOptimizer (Thermofisher®) or GenSmart® (GeneScript®).
  • the polynucleotide is modified to increase the amount of Guanine (G) and/or Cytosine (C) in the polynucleotide.
  • the amount of G/C in the polynucleotide i.e. G/C content
  • G/C content can influence the stability of the polynucleotide. Accordingly, polynucleotide comprising an increased amount of G/C nucleotides can be functionally more stable than polynucleotides contain a large amount of Adenine (A) and Thymine (T) or Uracil (U) nucleotides.
  • the G/C content is increased by substituting A or T nucleotides with G or C nucleotides.
  • the G/C content is increased in the nucleotide sequence encoding the polypeptide of interest.
  • the modification(s) in the second nucleotide sequence takes advantage of the ability of substituting codons that contain less favourable combinations of nucleotides (in terms of mRNA stability) with alternative codons encoding the same amino acid, or encoding amino acid(s) of similar chemistry (e.g. conserved amino acid substitution).
  • the G/C content is increased by substituting codons containing A or T nucleotides with codons containing G or C nucleotides that encode for the same amino acid.
  • the G/C content is increased by substituting codons containing A or T nucleotides with codons containing G or C nucleotides that encode for an amino acid of similar chemistry.
  • the G/C content is increased in one or more nucleotide sequence of the polynucleotide which do not encode the polypeptide of interest.
  • the G/C content is increased in the portion of the mRNA comprising the 5’-UTR.
  • the G/C content is increased in the portion of the mRNA comprising the 3’-UTR.
  • the mRNA comprises one or more alternative nucleotides.
  • the alternative nucleotides can include an alternative nucleobase.
  • a nucleobase of a polynucleotide is an organic base such as a purine or pyrimidine or a derivative thereof.
  • a nucleobase may be a canonical base (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties, e.g., increased stability such as resistance to nucleases.
  • Non- canonical or modified bases may include, for example, one or more substitutions or modifications including but not limited to alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and/or thio substitutions; one or more fused or open rings; oxidation; and/or reduction.
  • Alternative nucleotides can be naturally or non-naturally occurring.
  • Alternative nucleotide base pairing encompasses not only the standard adeninethymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.
  • the nucleobase is an alternative uracil.
  • Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (qi), pyridin-
  • 5-methoxy-uracil (mo5U), uracil 5-oxyacetic acid (cmo5U), uracil 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uracil (cm5U), 1-carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uracil (chm5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm5U), 5-methoxycarbonylmethyl-uracil (mcm5U), 5-methoxycarbonylmethyl-2-thio- uracil (mcm5s2U), 5-aminomethyl-2-thio-uracil (nm5s2U), 5-methylaminomethyl-uracil (mnm5U), 5-methylaminomethyl-2-thio-uracil (mnm5s2U), 5-methylaminomethyl-uracil (mnm5U), 5-methylaminomethyl-2-thio-uracil (
  • the nucleobase is an alternative cytosine.
  • Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytosine, 6-aza- cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl- cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5- iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo- cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio- pseudoisocy tidine, 4-thio-1-methyl-pseudoi
  • the nucleobase is an alternative adenine.
  • Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2,6- diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6- chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza- adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6
  • the nucleobase is an alternative guanine.
  • Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1 -methylinosine (mil), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (o2yW), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyW*), 7-deaza-guanine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano- 7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQ1), archa
  • the alternative nucleobase of a nucleotide can be independently a purine, a pyrimidine, a purine or pyrimidine analog.
  • the nucleobase can be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine.
  • the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4-d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8- thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines
  • At least one naturally occurring nucleotide of the polynucleotide is replaced with a chemically modified nucleotide. In one example, at least 10%, or 20%, or 30%, or 40%, or 50%, or 60%, or 70%, or 80%, or 90%, or 100% of naturally occurring nucleotides of the polynucleotide is replaced with a chemically modified nucleotide.
  • the mRNA may or may not be uniformly altered along the entire length of the molecule.
  • one or more or all types of nucleotide e.g., purine or pyrimidine, or any one or more or all of A, G, U, C
  • nucleotide analogs or other alteration(s) may be located at any position(s) of a mRNA such that the function of the mRNA is not substantially decreased.
  • An alteration may also be a 5'- or 3 '-terminal alteration.
  • the mRNA includes an alteration at the 3'-terminus.
  • the mRNA includes an alteration at the 5'- terminus.
  • the mRNA may include one or more naturally occurring components, including any of the canonical nucleotides A (adenosine), G (guanosine), C (cytosine) or U (uridine).
  • all or substantially all of the nucleotides comprising (a) the 5'- UTR, (b) the open reading frame (ORF), (c) the 3'-UTR, (d) the poly A tail, and any combination of (a, b, c, or d above) comprise naturally occurring canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).
  • the mRNA may include one or more alternative components, as described herein, which impart useful properties including increased stability and/or the lack of a substantial induction of the innate immune response of a cell into which the polynucleotide is introduced.
  • an alternative polynucleotide exhibits reduced degradation in a cell into which the polynucleotide is introduced, relative to a corresponding unaltered polynucleotide.
  • These alternative species may enhance the efficiency of protein production, intracellular retention of the polynucleotides, and/or viability of contacted cells, as well as possess reduced immunogenicity.
  • capped mRNA mRNAs suitable for use in the methods described may be prepared using any method known in the art, including synthetic methods such as e.g. solid phase synthesis, as well as in vitro methods, such as in vitro transcription reactions .
  • the RNA is produced using in vitro transcription (IVT) from a corresponding DNA molecule.
  • IVT in vitro transcription
  • This method was originally developed by Krieg and Melton (Methods Enzymol., 1987, 155: 397-415) for the synthesis of RNA using an RNA phage polymerase. Transcription of RNA usually starts with a nucleoside triphosphate (usually a purine, A or G).
  • In vitro transcription typically comprises a phage RNA polymerase such as T7, T3 or SP6, a DNA template containing a phage polymerase promoter, nucleotides (ATP, GTP, CTP and UTP) and a buffer containing magnesium salt under conditions that support polymerase activity.
  • RNA synthesis yields may be optimized by increasing nucleotide concentrations, adjusting magnesium concentrations and by including inorganic pyrophosphatase (U.S. Pat. No. 5,256,555; Gurevich, et ah, Anal. Biochem. 195: 207-213 (1991); Sampson, J.R. and Uhlenbeck, O.C., Proc. Natl. Acad. Sci. USA. 85, 1033-1037 (1988); Wyatt, J.R., et al, Biotechniques, 11 : 764-769 (1991)). Many in vitro transcription techniques are known in the biotechnological arts.
  • In vitro transcription can be performed using a variety of commercially available kits including, but not limited to RiboMax Large Scale RNA Production System (Promega), MegaScript Transcription kits (Life Technologies) as well as with commercially available reagents including RNA polymerases and rNTPs.
  • the methodology for in vitro transcription of mRNA is well-known in the art. (see, e.g. Losick, R., 1972, In vitro transcription, Ann Rev Biochem v.41 409-46; Kamakaka, R. T. and Kraus, W. L. 2001. In Vitro Transcription.
  • Template DNA can be prepared for in vitro transcription from a number of sources with appropriate techniques which are well-known in the art including, but not limited to, plasmid DNA and polymerase chain reaction amplification (see Linpinsel, J.L and Conn, G.L., General protocols for preparation of plasmid DNA template and Bowman, J.C., Azizi, B., Lenz, T.K., Ray, P., and Williams, L.D. in RNA in vitro transcription and RNA purification by denaturing PAGE in Recombinant and in vitro RNA syntheses Methods v. 941 Conn G.L. (ed), New York, N.Y. Humana Press, 2012).
  • plasmid DNA and polymerase chain reaction amplification see Linpinsel, J.L and Conn, G.L., General protocols for preparation of plasmid DNA template and Bowman, J.C., Azizi, B., Lenz, T.K., Ray, P., and Williams, L.D
  • the DNA molecule may be plasmid DNA, a PCR product, doggybone DNA or the like.
  • the DNA molecule comprises a suitable promoter, e.g. a T7, T3 or SP6 promoter, for in vitro transcription, which is followed by the desired nucleotide sequence, e.g. mRNA, to be prepared and a termination signal for in vitro transcription.
  • the DNA molecule comprises a T7 promoter.
  • the desired nucleotide sequence includes, in a 5’ to 3’ direction, a 5’UTR, ORF and a 3’ UTR.
  • the desired nucleotide sequence or part thereof may be codon optimized.
  • the DNA molecule may be linearized prior to use in the in vitro transcription reaction.
  • the DNA molecule includes a restriction cleavage and/or recognition sequence. Any suitable restriction enzyme (and corresponding restriction cleavage and/or recognition sequence) may be used for linearization.
  • the restriction enzyme is a Type II restriction enzyme (e.g. a Type IIS restriction enzyme).
  • the recognition sequence for the type IIS restriction endonuclease is located 5-26 base pairs, e.g. 24-26 base pairs, downstream of the 3' end of the nucleic acid sequence (e.g. downstream of the polyadenyl cassette).
  • the DNA template is cleaved within the polyadenyl cassette and results in a transcript ending in an unmasked poly (A) sequence. It has been found that RNA having an open-ended poly (A) sequence is translated more efficiently than RNA having a poly (A) sequence with a masked terminus (i.e. nucleotides other than A at the 3’end) (see, e.g. W02017/059902A1).
  • restriction endonuclease or " restriction enzyme” refers to a class of enzymes that cleave phosphodiester bonds in both strands of a DNA molecule within specific base sequences. They recognize specific binding sites, referred to as recognition sequences, on a double- stranded DNA molecule. The sites at which said phosphodiester bonds in the DNA are cleaved by said enzymes are referred to as cleavage sites. In the case of type IIS enzymes, the cleavage site is located at a defined distance from the DNA binding site.
  • the term "restriction endonuclease” comprises, for example, the enzymes Sapl, Ecil, Bpil, Aarl, Alol, Bael, BbvCI, Ppil and Psrl, BsrDI , Btsl, Earl, Bmrl, Bsal, BsmBI, Faul, Bbsl, BciVI, BfuAI, Bsp I, BseRI, Ecil, BtgZI, BpuEl Bsgl, Mmel, CspCI, Bael, BsaMI, Mval269l, Pctl, Bse3DI, BseMI, Bst6l, Eamll04l, sp632l, Bfil, Bso31 l, BspTNI, Eco31 l, Esp3l, Bful, Acc36l, Aarl, Eco57l, Eco57MI, Gsul, Alol, Hin4l, P
  • the synthesis of capped RNA includes the incorporation of a cap analog (e.g., m 7 GpppG) in the transcription reaction.
  • the cap analog is incorporated only as the first or 5' terminal G of the transcript because its structure precludes its incorporation at any other position in the RNA molecule.
  • the RNA polymerase will incorporate the cap analog as readily as any of the other nucleotides; that is, there is no bias for the cap analog.
  • the cap analog will be incorporated at the 5' terminus by the enzyme guanylyl transferase.
  • the cap analog will be incorporated only at the 5' terminus because it does not have a 5' triphosphate.
  • the +1 nucleotide of their respective promoters is usually a G residue and if both GTP and cap analog (e.g. m 7 GpppG) are present in equal concentrations in the transcription reaction, then they each have an equal chance of being incorporated at the +1 position.
  • the cap analog e.g. m 7 GpppG
  • excess cap analog for example, 4:1 ratio of cap analog to GTP is added. It is though that excess cap analog increases the opportunity that each transcript will include the 5’ cap analog.
  • RNA yield is dependent on GTP concentration, which is necessary for the elongation of the transcript.
  • the other nucleotides ATP, CTP, UTP
  • Kits for capping of in vitro transcribed mRNAs are commercially available, including the mMESSAGE mMACHINE® kit (Ambion, Inc., Austin, Tex.).
  • kits will yield 80% capped RNA to 20% uncapped RNA.
  • the mMESSAGE mMACHINE® kit (Cat. #1344, Ambion, Inc.) is used according to manufacturer’s instructions, where it is recommended that the cap to GTP ratio be 4:1 (6 mM: 1 .5 mM).
  • the DNA template may include the sequence 5’-TAATACGACTCACTATAAGG-3’(SEQ ID NO: 10) downstream of the promoter sequence for inclusion of a cap-analogue.
  • the synthesis of capped RNA includes in vitro transcription from a DNA template followed by addition of a cap using a capping enzyme or capping system.
  • Some examples utilize commercial kits for the large scale synthesis of in vitro transcripts (e.g., MEGAscript®, Ambion).
  • the RNA synthesized in these reactions is usually characterized by a 5' terminal nucleotide that has a triphosphate at the 5' position of the ribose.
  • this nucleotide is a guanosine, although it can be an adenosine (see e.g., Coleman, T. M., et ah, Nucleic Acids Res., 32: el4 (2004)).
  • all four nucleotides are typically included at equimolar concentrations and none of them is limiting.
  • the reaction is a batch reaction, that is, all components are combined and then incubated at about 37 °C to promote the polymerization of the RNA until the reaction terminates.
  • a batch reaction is used for convenience and to obtain as much RNA as needed from such reactions for their experiments.
  • a "fedbatch" system (see, e.g., Jeffrey A. Kern, Batch and Fed-batch Strategies for Largescale Production of RNA by in Vitro Transaction (University of Colorado) (1997)) is used to increase the efficiency of the in vitro transcription reaction. All components are combined, but then additional amounts of some of the reagents are added over time, such as the nucleotides and magnesium, to try to maintain constant reaction conditions.
  • the pH of the reaction may be held at 7.4 by monitoring it overtime and adding a base, such as KOH, as needed.
  • the in vitro transcribed RNA may be further processed, for example by the addition of a polyA tail.
  • a poly(A) tail is added using methods known to the person skilled in the art.
  • the poly(A) tail may be included in the plasmid, added via PCR, or added post-transcriptionally by enzymatic polyadenylation. In the latter case, the DNA template may include a polyadenylation signal sequence.
  • the poly(A) tail is introduced by including a poly(dT) stretch at the end of the transcription template. In one example, this is accomplished by a PCR step that utilizes a primer containing the poly(dT) stretch.
  • the pol(A) tail is added following in vitro transcription.
  • a 3’ poly(A) tail of approximately 200 nucleotides in length is added following in vitro transcription through the addition of ATP in conjunction with Poly(A)polymerase.
  • a “poly(A) polymerase” (“PAP”) refers to a template-independent RNA polymerase, for example, as found in most eukaryotes, prokaryotes, and eukaryotic viruses that selectively uses ATP to incorporate AMP residues to 3'-hydroxylated ends of RNA.
  • the poly(A) tail is approximately 100-250 nucleotides in length. In some embodiments, the poly(A) tail is about 50-300 nucleotides in length.
  • the in vitro transcription products include 5' and 3' untranslated regions. Any suitable 5' and 3' untranslated region known to the person skilled in the art may be used. Suitable 5' and 3' untranslated region include those described in W02017059902A1 (Biontech Rna Pharmaceuticals Gmbh, Tron - Translationale Onkologie An Der Universitatstechnik Der Johannes Gutenberg-Universitat Mainz Ggmbh) which is incorporated herein by reference in its entirety.
  • the DNA molecule which forms the template of the at least one RNA of interest, may be prepared by fermentative proliferation and subsequent isolation as part of a plasmid which can be replicated in bacteria.
  • competent bacterial cells e.g., Escherichia coli
  • competent bacterial cells are transformed with a DNA plasmid encoding a the RNA of interest.
  • Individual bacterial colonies are isolated and the resultant plasmid DNA amplified in E. coli cultures.
  • the plasmid DNA amplified in E. coli cultures may be isolated using techniques known to the person skilled in the art.
  • the plasmid DNA is isolated following fermentation.
  • the plasmid DNA is isolated using a commercially available kit (e.g., Maxiprep DNA kit), or other routine methods known to the skilled person.
  • plasmid DNA may be linearized by restriction digest (i.e., using a restricting enzyme). Restriction enzymes are removed using methods known in the art, including for example phenol/chloroform extraction, ethanol precipitation, chromatography, and the like.
  • Plasmids which may be mentioned as suitable for use as templates are e.g. the plasmids pT7Ts (GenBank accession number U26404; Lai et al., Development 1 995, 121 : 2349 to 2360), pGEM® series, e.g. pGEM®-1 (GenBank accession number X65300; from Promega) and pSP64 (GenBank accession number X65327).
  • the DNA molecule is amplified from a template nucleic acid using PCR.
  • at least one of the primers used for PCR may include a promoter sequence (e.g. T7, T3 or SP6 promoter sequence).
  • at least one of the primers used for PCR may include a polyadenylation cassette.
  • at least one of the primers used for PCR may include a cleavage site for a restriction enzyme.
  • the DNA template may be purified to remove enzymes and reaction components.
  • Commercially available column purification such as QIAGEN'S Plasmid Plus kits, or phenol/chloroform extraction followed by ethanol precipitation may be used.
  • the DNA template may be removed using any technique known to the person skilled in the art.
  • the DNA template is removed by treatment with DNase (e.g. DNAse I).
  • the mRNA is purified. This helps separate the mRNA from the undesired components of the transcription and associated reactions.
  • Various methods for purifying mRNA will be apparent to the skilled person.
  • the mRNA is purified LiCI precipitation, phenol:chloroform extraction followed by ethanol precipitation, precipitation with ether alcohol in the presence of monovalent cations or by using a spin column based method.
  • the mRNA is purified using tangential flow filtration (TFF), e.g. diafiltration.
  • the purification step comprises diafiltration into a suitable buffer.
  • the purification step comprises a spin column based method or column chromatography.
  • Spin columns may be used to remove unincorporated nucleotides, proteins and salts.
  • the spin column based method may be performed using a commercially available kit (e.g. Monarch RNA Cleanup Kit (New England Biolabs)) in accordance with the manufacturer’s instructions.
  • the purification step comprises phenol- choroform extraction and ethanol precipitation.
  • the mRNA is resuspended in e.g., nuclease-free water or a suitable buffer.
  • the mRNA product is analysed to assess reaction yield and quality. Various methods for analysing mRNA will be apparent to the skilled person.
  • mRNA product is analysed by the methods disclosed herein.
  • the methods and uses described herein are useful for quality control during manufacture of mRNA and for characterisation of mRNA as an active pharmaceutical ingredient (API) in final therapeutic products, including vaccines.
  • API active pharmaceutical ingredient
  • the use of the heavy labelled reagents, such as heavy GTP and/or heavy-SAM allows capping efficiency to be determined without using a oligonucleotide that is complementary to the 5’region of the mRNA being analysed.
  • the methods of the present disclosure are not limited with respect to the sequence of the RNA molecule to be analysed.
  • the methods used herein do not require that the RNA contain a cleavage site for a catalytic nucleic acid molecule or require the synthesis of a tagged probe that is complementary to the 5’ end of the target RNA.
  • the methods described herein may also be used to quantitate capping efficiency without using a radio-isotope such as 32 P.
  • the method described herein is conducted before releasing an mRNA lot.
  • mRNA may be formulation in a lipid nanoparticle for administration.
  • Methods of forming lipid nanoparticles are known to the person skilled in the art.
  • suitable LNPs can be formed using mixing processes such as microfluidics, including herringbone micromixing, and T-junction mixing of two fluid streams, one of which contains the polynucleotide, typically in an aqueous solution, and the other of which has the various required lipid components, typically in ethanol.
  • kits comprising various reagents and materials useful for carrying out the methods described herein.
  • the quantitative procedures described herein may be performed by diagnostic laboratories, experimental laboratories, or commercial laboratories.
  • the disclosed kits can be used in these different settings.
  • the term “kit” refers to any delivery system for delivering materials.
  • Such delivery systems may include systems that allow for the storage, transport, or delivery of various diagnostic or therapeutic reagents (e.g., oligonucleotides, antibodies, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another.
  • kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials.
  • fragmented kit refers to delivery systems comprising two or more separate containers that each contains a subportion of the total kit components.
  • the containers may be delivered to the intended recipient together or separately.
  • a first container may contain an enzyme (for example, a capping enzyme) for use in the methods described herein, while a second container may contain one or more labelled reagents (such as, heavy GTP and/or heavy SAM).
  • labelled reagents such as, heavy GTP and/or heavy SAM.
  • any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term “fragmented kit.”
  • a “combined kit” refers to a delivery system containing all of the components in a single container (e.g., in a single box housing each of the desired components).
  • kit includes both fragmented and combined kits.
  • kits for quantifying mRNA capping efficiency in an mRNA sample by enzymatic manipulation may be assembled together in a kit.
  • a kit comprises labelled reagents (heavy reagents) and instructions for using the kit according to the methods described herein.
  • the kits may further comprise capping enzymes or systems and instructions for using the same.
  • the kits may also comprise nucleases for degrading single stranded RNA; e.g., RNase T1 , RNase A and/or NP1 , and instructions to use to same.
  • the kit comprises a capping enzyme or capping system, and heavy GTP.
  • the kit comprises a capping enzyme or capping system, heavy GTP and heavy SAM. In one example, the kit comprises a capping enzyme or capping system, a nuclease and heavy GTP. In one example, the kit comprises a capping enzyme or capping system, a nuclease, heavy GTP and heavy SAM.
  • Kits or other articles of manufacture as described herein may include one or more containers to hold various reagents.
  • Suitable containers include, for example, bottles, vials, syringes (e.g., pre-filled syringes), ampules.
  • the container may be formed from a variety of materials such as glass or plastic.
  • kits as described herein may include suitable control levels or control samples for determining control levels as described herein.
  • kits of the invention may include instructions for using the kit according to one or more methods of the invention and may comprise instructions for 5’ capping and/or nuclease treatment.
  • a method of quantifying mRNA capping efficiency comprising: treating an mRNA sample with capping enzymes in the presence of heavy labelled reagent to form a treated mRNA sample optionally comprising mRNA with a heavy labelled 5’cap; digesting the treated mRNA sample with a nuclease to release 5’ cap; and quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample to quantify the mRNA capping efficiency.
  • heavy labelled substrate and/or cofactor comprises heavy GTP or heavy SAM or a combination thereof.
  • the heavy labelled substrate and/or cofactor comprises heavy GTP and heavy SAM, for example, wherein the heavy labelled substrate and/or cofactor comprises 13 C, 15 N - GTP and CD 3 -SAM.
  • step of quantitatively determining the amount of heavy labelled and unlabelled 5’ cap in the sample comprises analysing the released 5’ cap by liquid chromatography/mass spectrometry (LC-MS) and determining the relative amount of heavy labelled and unlabelled 5’cap fragments.
  • the capping enzyme comprises a vaccinia capping system or poxvirus capping enzymes.
  • capping enzymes comprise a triphosphatase, a guanylyltransferase or a guanine methyltransferase, or a combination thereof.
  • mRNA sample comprises capped mRNA that is produced by a post-transcriptional capping reaction or a co- transcriptional capping reaction.
  • the mRNA sample comprises capped mRNA having a 5’ cap selected from the group consisting of CapO, Cap1 , Cap2, Cap4, anti-reverse cap analogue (ARCA), inosine, N7,2'-0-dimethyl-guanosine (mCAP), N1- methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino- guanosine, LNA-guanosine, 2-azido-guanosine, N6,2'-0-dimethyladenosine, 7- methylguanosine (m 7 G) and CAP-003-CAP-225.
  • a 5’ cap selected from the group consisting of CapO, Cap1 , Cap2, Cap4, anti-reverse cap analogue (ARCA), inosine, N7,2'-0-dimethyl-guanosine (mCAP), N1- methyl-guanosine
  • nuclease comprises
  • RNAse T 1 Nuclease NP1 or RNAse A or combinations thereof
  • nuclease is RNAse T 1 .
  • nuclease is Nuclease NP1.
  • the mRNA sample comprises capped mRNA having a 5’ cap having a structure of formula (III): wherein B is a nucleobase; R 1 is selected from a H, halogen, OH, and OCH 3 ; R 2 is selected from H, OH and OCH 3 ; R 3 is CH 3 , CH 2 CH 3 , CH 2 CH 2 CH 3 or is absent; R 4 is NH 2; R 5 is OH; n is 1 , 2, or 3; and M is a nucleotide of the mRNA; and wherein the nuclease is RNAse T1 .
  • the mRNA sample comprises capped mRNA having a 5’ cap which is CapO and wherein the nuclease is RNAse T 1 .
  • the mRNA sample comprises capped mRNA having a 5’ cap which is CapO or Cap1 and wherein the nuclease is Nuclease NP1 .
  • quantifying mRNA capping efficiency comprises quantifying the absolute amount of capped mRNA in the mRNA sample.
  • quantifying mRNA capping efficiency comprises quantifying the percentage of unlabelled 5’cap relative to total 5’cap in the digested mRNA sample.
  • quantifying mRNA capping efficiency comprises quantifying the ratio of unlabelled 5’cap relative to total 5’cap in the digested mRNA sample.
  • kits for quantifying mRNA capping efficiency comprising: heavy labelled substrate and/or cofactor; capping enzymes; and optionally nuclease.
  • the present disclosure includes the following non-limiting Examples.
  • RNAse-free synthesis of RNA was conducted under RNAse-free conditions. All tubes, vials, pipette tips, pipettes, buffers, etc. were required to be nuclease-free.
  • DNA templates encoding the self-replicating RNAs were produced in competent Escherichia coli cells that were transformed with a DNA plasmid. Individual bacterial colonies were isolated and the resultant plasmid DNA amplified in E. coli cultures. Following fermentation, the plasmid DNA was isolated and linearized by restriction digest. Restriction enzymes were then removed using phenol/chloroform extraction and ethanol precipitation. mRNA was made by in vitro transcription from the linearized DNA template using a T7 RNA polymerase. Subsequently, the DNA template was removed by DNase digestion.
  • the 7-methylguanylate cap structure (Cap 0) was added to the 5' end of RNA using the Vaccinia Capping System in accordance with the manufacturer’s instructions (NEB). Briefly, the purified mRNA product from the in vitro transcription reaction was denatured at 65 °C for 5 minutes and then incubated on ice for 5 minutes. The following were added in order with mixing to the RNA (10X capping buffer, 10 mM GTP, 2 mM S-adenosyl methionine, VCE). The reaction mixture was incubated at 37 °C for 30 minutes. Upon completion, the final reaction mixture was purified. The purified mRNA was resuspended in nuclease-free water.
  • F602 expressing H5 and N1 antigen and NSP1-4 (SEQ ID NO:11).
  • the sequence of the 5’ end of the F602 construct comprises 5’- GAUAGGCGGCGCAUGAGAGAAGCCCAGACCAAUUACCUACCCAAA (SEQ ID NO:12).
  • SEQ ID NO:12 The sequence of the 5’ end of the F602 construct comprises 5’- GAUAGGCGGCGCAUGAGAGAAGCCCAGACCAAUUACCUACCCAAA (SEQ ID NO:12).
  • SEQ ID NO:12 Quantification of capping efficiency for a known sample
  • This example demonstrates the quantification of capping efficiency through conversion of uncapped mRNA to heavy labelled capO mRNA.
  • a schematic illustrating the assay used in this Example is shown in Figure 1 .
  • RNA sample comprising uncapped mRNA was analysed using the method described herein. Briefly, Vaccinia Capping System was used in accordance with the manufacturer’s instructions (New England Biolabs) to add a heavy labelled cap to the mRNA sample. More specifically, in vitro synthesized RNA product was denatured at 65 °C for 5 minutes and then incubated on ice for 5 minutes. The following were added in order with mixing to the mRNA (10X capping buffer, 10 mM GTP- 13 Cw, 15 N 5 (Sigma Aldrich, catalogue number 645680), 2 mM S-adenosyl methionine, VCE). The reaction mixture was incubated at 37 °C for 30 minutes.
  • RNAse T1 ThermoFisher Scientific
  • Nuclease P1 New England Biolabs
  • RNase T1 the labelled mRNA product was denatured at 95 °C for 5 minutes and then ramped down to 25 °C for 5 minutes.
  • RNAse T1 was added to the sample and the mixture incubated at 37 °C for 3 hours.
  • Nuclease P1 the enzyme was added to the sample and the mixture incubated at 37 °C for 1 hour. Upon completion, the final reaction mixture was optionally quenched by the addition of methanol.
  • LC-MS was used for quantitative analysis of capped versus uncapped mRNA. Briefly, analysis of the nuclease treated mRNA sample was conducted with an Vanquish UPLC (Thermo Scientific, Grand Island NY USA) connected to a TSQ Altis triple quadrupole mass spectrometer (Thermo Scientific, Grand Island NY USA). Mobile phase A consisted of 200 mM hexafluoroisopropanol, 5 mM /V,/V-dimethyhexylamine, pH 7.4 and mobile phase B was 100% methanol.
  • Mass spectra were obtained in the negative ion mode, using MS/MS multiple reaction monitoring.
  • the mass spectrometer running parameters used are provided in Table 4.
  • multiple reaction monitoring (MRM) parameters for each molecule including Retention Time (min), RT Window (min), Polarity, Precursor (m/z), Product (m/z), Collision Energy (V), Min Dwell Time (ms), and RF Lens (V) are shown in Table 5.
  • Spectra were analysed using Skyline software (available online at https://skyline.ms/project/home/software/Skyline/begin.view).
  • the LCMS results for T1 digested mRNA are shown in Figure 5A.
  • the LCMS results for NP1 digested mRNA are shown in Figure 5B. Both show only labelled cap product is observed, corresponding with a capping efficiency of 0%,. This is aligned with the uncapped nature of the original mRNA sample. There is no background or interference signal for capO in this uncapped sample.
  • the abundance of capped species may be determined by the total ion chromatograms (TIC) from the corresponding transitions.
  • the analysis can be done using a TSQ MS or through HRMS on a Q-TOF or Orbitrap MS instrument and data can be processed using the vendor provided software or a third party software such as Skyline. Data may be presented in the form of peak area or ratio of unlabelled to labelled peak area. Peak area here refers to the total peak area from all transitions for a particular precursor compound. Peak area can also refer to a specific transition chosen for quantification.
  • Capping efficiency (%) can be calculated using the following formula: Area(m7 GpppGp peak)
  • an mRNA sample with unknown capping efficiency was treated in the same manner as described in Example 2.
  • the LCMS results for T1 digested mRNA are shown in Figure 5C.
  • the LCMS results for NP1 digested mRNA are shown in Figure 5D. Both show mostly unlabelled cap product, corresponding to the capped mRNA present in the original sample, while the small amount of labelled cap product observed corresponds to the uncapped mRNA present in the sample. Based on these peak areas, the capping efficiency is 94.4% for the T1 digest and 98.0% for the NP1 digest.
  • capping species of interest are capO (m7Gcapped), unmethylated capped (Gcapped), and uncapped mRNA.
  • a schematic illustrating the assay used in this Example is shown in Figure 2.
  • the mRNA samples were denatured at 65 °C for 5 minutes and then incubated on ice for 5 minutes. The following were added in order with mixing to the mRNA (10X capping buffer, 10 mM heavy GTP- 13 Cw, 15 N 5 (Sigma Aldrich, catalogue number 645680), 2 mM heavy S-adenosyl methionine-D 3 (ChemCruz, Cat#sc-481746) and VCE). The reaction mixtures were incubated at 37 °C for 30 minutes.
  • RNAse T1 RNAse T1
  • Nuclease P1 the enzyme was added to the sample and the mixture incubated at 37 °C for 1 hour.
  • the digested mRNA samples were analysed by LC-MS as described in Example 2 with the MRM transition settings shown in Table 6. The results are shown in Figure 6.
  • the percentage of each capping species present in the sample being analysed is related to the relative peak areas of unlabelled and labelled peaks.
  • the +3 Da heavy label results from methylation with heavy SAM and so represents the amount of unmethylated (Gcapped) mRNA present in the original sample.
  • the +18 Da heavy label results from incorporation of heavy SAM and heavy GTP and represents uncapped mRNA present in the original sample.
  • the Gcapped sample i.e. sample 1 was determined to contain 84.2% of Gcapped mRNA and 15.8% uncapped mRNA (using RNAse T1) or 86.5% Gcapped and 13.5% of uncapped mRNA (using NP1).
  • the +3 Da heavy methylation is clearly shown to be incorporated into both the Gcapped and uncapped mRNA.
  • the capped sample i.e. sample 2 was determined to contain 87.4% capO, 1 .7% Gcapped and 10.9% uncapped mRNA (using RNAse T1).
  • the capped sample i.e. sample 2 was determined to contain 90.9% capO, 1.4% Gcapped and 7.8% uncapped mRNA (using NP1). This illustrates that the assay may be used to quantify the capping efficiency of a sample with unknown capping efficiency.
  • the blended sample i.e. sample 3 was determined to contain 45.9% capO, 20% Gcapped and 34.1 % uncapped mRNA (using RNAse T1). As shown in Figure 6C (right panel), the blended sample (i.e. sample 3) was determined to contain 47.9% capO, 20.6% Gcapped and 31.5% uncapped mRNA (using NP1).
  • the expected percentage of the capping species in the blended sample can also be calculated based on the total mRNA concentration of each component sample, and the measured percentage of capping species in each component sample (i.e. Figures 6A and 6B for the Gcapped and capped sample, respectively).
  • the blended sample was expected to contain 42.5% of capO mRNA, 21 .7% Gcapped mRNA and 35.8% uncapped mRNA (using RNAse T1) or 43.2% of capO mRNA, 23.9% Gcapped mRNA and 32.9% uncapped mRNA (using NP1).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP24749812.4A 2023-01-31 2024-01-31 Kappungstest Pending EP4658809A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363482343P 2023-01-31 2023-01-31
PCT/IB2024/050863 WO2024161314A1 (en) 2023-01-31 2024-01-31 Capping assay

Publications (1)

Publication Number Publication Date
EP4658809A1 true EP4658809A1 (de) 2025-12-10

Family

ID=92145900

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24749812.4A Pending EP4658809A1 (de) 2023-01-31 2024-01-31 Kappungstest

Country Status (3)

Country Link
EP (1) EP4658809A1 (de)
AU (1) AU2024213258A1 (de)
WO (1) WO2024161314A1 (de)

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5256555A (en) 1991-12-20 1993-10-26 Ambion, Inc. Compositions and methods for increasing the yields of in vitro RNA transcription and other polynucleotide synthetic reactions
AU4966997A (en) 1996-11-18 1998-06-10 Takeshi Imanishi Novel nucleotide analogues
JP3756313B2 (ja) 1997-03-07 2006-03-15 武 今西 新規ビシクロヌクレオシド及びオリゴヌクレオチド類縁体
DE69829760T3 (de) 1997-09-12 2016-04-14 Exiqon A/S Bi- und tri-zyklische - nukleosid, nukleotid und oligonukleotid-analoga
EP4332227B1 (de) 2005-08-23 2026-02-11 The Trustees of the University of Pennsylvania Rna-haltige modifizierte nukleoside und verfahren zur verwendung davon
MX2013003681A (es) 2010-10-01 2013-11-20 Moderna Therapeutics Inc Ácidos nucleicos manipulados y métodos de uso de los mismos.
SI3682905T1 (sl) 2011-10-03 2022-04-29 Modernatx, Inc. Modificirani nukleozidi, nukleotidi in nukleinske kisline ter njihove uporabe
MX2015011945A (es) * 2013-03-14 2015-12-01 Shire Human Genetic Therapies Evaluacion cuantitativa para la eficacia de los casquetes de arn mensajero.
WO2017059902A1 (en) 2015-10-07 2017-04-13 Biontech Rna Pharmaceuticals Gmbh 3' utr sequences for stabilization of rna
WO2017098468A1 (en) * 2015-12-09 2017-06-15 Novartis Ag Label-free analysis of rna capping efficiency using rnase h, probes and liquid chromatography/mass spectrometry
BR112020026125A8 (pt) * 2018-03-15 2022-10-18 Biontech Rna Pharmaceuticals Gmbh Compostos oligonucleotídeos superiores ou 5'-cap- trinucleotídeo e seus usos na estabilização de rna, expressão de proteínas e em terapia
EP4017995A1 (de) 2019-08-23 2022-06-29 New England Biolabs, Inc. Verfahren zur enzymatischen rna-kappung
AU2021424650A1 (en) 2021-01-27 2023-08-17 New England Biolabs, Inc. Faustovirus capping enzyme, mrna capping enzyme compositions, methods and kits

Also Published As

Publication number Publication date
AU2024213258A1 (en) 2025-06-26
WO2024161314A1 (en) 2024-08-08

Similar Documents

Publication Publication Date Title
ES2763822T3 (es) Análisis exento de marcas de la eficacia de la adición de caperuzas al arn utilizando rnasa h, sondas y cromatografía líquida/espectrometría de masas
US11920174B2 (en) RNA analysis by total hydrolysis and quantification of released nucleosides
EP3414340B1 (de) Verfahren zur analyse von rna
AU2014375404C1 (en) Methods for RNA analysis
US20160024492A1 (en) Removal of dna fragments in mrna production process
US20200325532A1 (en) Polya tail length analysis of rna by mass spectrometry
KR20240004662A (ko) 폴리 a 테일 길이를 측정하는 방법
Potužník et al. It’s the little things (in viral RNA)
CN115667509A (zh) 用于rna合成的组合物和方法
EP4658809A1 (de) Kappungstest
WO2024256674A1 (en) Methods of simultaneously identifying or quantifying capping and tailing modifications of messenger rna
JP2026505178A (ja) キャップ形成アッセイ
Klumpp et al. Variation in ATP requirement during influenza virus transcription.
CN118786215A (zh) 使用催化性核酸分析rna分子
WO2024231285A1 (en) Method of analysing contaminants in rna products by ion-pair chromatography
WO2025102115A1 (en) Method for detecting capped rna molecules
US10829798B2 (en) DNA-linked enzyme-coupled assays
Bahena-Ceron et al. in Staphylococcus aureus
JP2026503216A (ja) メッセンジャーrnaの最適化されたテーリング
Slama Engineering of modified linear and circular messenger RNA and study of the influence on protein expression tuning
JP2024053406A (ja) mRNA医薬品の特性評価方法並びに同評価に用いられる標準試料組成物及びキット
Rakotondrafara et al. APPENDIX B. IN VITRO ANALYSIS OF TRANSLATION ENHANCERS

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250630

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR