EP4637811A1 - Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier - Google Patents

Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier

Info

Publication number
EP4637811A1
EP4637811A1 EP23836813.8A EP23836813A EP4637811A1 EP 4637811 A1 EP4637811 A1 EP 4637811A1 EP 23836813 A EP23836813 A EP 23836813A EP 4637811 A1 EP4637811 A1 EP 4637811A1
Authority
EP
European Patent Office
Prior art keywords
skin
bacterial strain
composition
chosen
composition according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23836813.8A
Other languages
German (de)
French (fr)
Inventor
Luc Aguilar
Leslie LANDEMAINE
Cécile CLAVAUD
Mathias RICHARD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
LOreal SA
Original Assignee
LOreal SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by LOreal SA filed Critical LOreal SA
Publication of EP4637811A1 publication Critical patent/EP4637811A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66Microorganisms or materials therefrom
    • A61K35/74Bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/99Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from microorganisms other than algae or fungi, e.g. protozoa or bacteria
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/007Preparations for dry skin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/44Staphylococcus
    • C12R2001/45Staphylococcus epidermidis

Definitions

  • the present invention relates to bacterial strains of Staphylococcus epidermidis and the use thereof for improving the barrier function and moisturizing the skin. More particularly, the present invention aims to provide live bacterial strains of the species Staphylococcus epidermidis, in isolated form, or included in compositions, notably cosmetic compositions, in particular for caring for keratin materials, further comprising a physiologically acceptable medium.
  • the invention furthermore relates to a composition, notably a cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole-3-carboxaldehyde and/or a salt thereof, and indole-3-acetic acid and/or a salt thereof; and at least one adjuvant chosen from the group constituted of fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as diprop
  • the invention also relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or composition for preventing a reduction in and/or reinforcing the skin barrier function in an individual.
  • the invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of such a composition for improving skin moisturization.
  • the invention also relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for: - improving skin quality, in particular the quality of dry skin, and/or - preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
  • the invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis.
  • the invention also relates to the cosmetic use, particularly topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis.
  • the invention relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of a live bacterial strain according to the invention or of a composition according to the invention.
  • the skin is a tissue, the cells of which are joined together and integrally attached to each other.
  • the skin tissue forms an outer covering comprising sebaceous or sweat glands, and hair follicles.
  • the skin is an epithelium which undergoes continual renewal.
  • the renewal, or desquamation, is a coordinated and finely regulated process resulting in the imperceptible and invisible removal of the superficial cells.
  • Human skin is constituted of two compartments, namely an upper compartment, the epidermis, and a deep compartment, the dermis.
  • the epidermis is conventionally divided into a basal layer of keratinocytes that constitutes the germinal layer of the epidermis, a spinous layer constituted of several layers of polyhedral cells positioned on the germinal layers, one to three "granular" layers constituted of flattened cells containing distinct cytoplasmic inclusions, keratohyalin granules, and finally a set of upper layers referred to as the cornified layers (or stratum corneum), constituted of keratinocytes at the terminal stage in their differentiation, referred to as corneocytes.
  • cornified layers or stratum corneum
  • Desmosomes are composed of transmembrane proteins from the cadherin family, such as desmoglein. These junctions have an essential role in the structure, maintenance and architectural cohesion of the epidermis and enable transmission and damping of mechanical forces acting on the keratinocytes. These adherens junctions are predominantly found in the intermediate layers of the epidermis up to the uppermost layers, namely the cornified layer composed of corneocytes.
  • Corneocytes are anucleated cells mainly constituted of a fibrous material containing cytokeratins, surrounded by a cornified envelope, constituted particularly of the protein filaggrin. Filaggrin aggregates the keratin filaments into macrofibrils in the lower part of the cornified layer. When it comes close to the skin’s surface, filaggrin is mainly broken down into free amino acids which form a major portion of a highly hygroscopic complex, natural moisturizing factor (NMF). NMF is important for maintaining the moisturization of the cornified layer and the suppleness of the skin. New keratinocytes are constantly being produced to compensate for the continuous loss of epidermal cells at the cornified layer by a mechanism referred to as desquamation.
  • desquamation a mechanism referred to as desquamation.
  • an imbalance between the production of cells at the basal layer and the rate of desquamation may particularly lead to the formation of scales on the surface of the skin.
  • a lack of terminal differentiation of the cells of the stratum corneum can result in the formation of large, thick cell clusters which are visible to the naked eye and are referred to as "squamae", or in other situations, in a thinning of the stratum corneum.
  • squamae a reduction in the whole of the junction system which is responsible for cell- cell cohesion directly results in a reduction in the efficacy of the skin’s barrier function.
  • one or more of these internal factors may lead to a weakness in the barrier properties of the epidermis, to chronic dehydration of the stratum corneum, to a loss of mechanical elasticity, to tautness, and also to a loss of radiance and transparency of the skin.
  • weakening of the skin barrier can also occur in the presence of external attacking factors, notably chosen from irritants (detergents, acids, bases, oxidizing agents, reducing agents, concentrated solvents, gases or noxious fumes), thermal or climatic imbalances (cold, drought, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants) or internal attacking factors such as psychological stress.
  • the cornified envelope is an essential component of corneocytes.
  • active ingredients may lead to mechanical softening of the stratum corneum, to an increase in the state of moisturization thereof and/or an improvement in the skin’s microrelief by the formation of a film at the surface of the skin.
  • these effects are not necessarily particularly persistent over time and disappear after cleansing the skin.
  • active ingredients can be eliminated by cleansing actions.
  • the tryptophan metabolic pathway namely the aryl hydrocarbon receptor (AhR) pathway, is of particular interest.
  • active ingredients for preventing a reduction in, and/or reinforcing, the skin barrier function in an individual There is also a need for active ingredients for improving skin moisturization.
  • active ingredients for improving skin quality in particular the quality of dry skin; and/or preventing and/or treating cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
  • the invention also relates to the cosmetic use, particularly topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis. Disclosure of the invention
  • the aim of the present invention is to solve the abovementioned technical problems. Indeed, the inventors have now discovered that certain bacterial strains of the species Staphylococcus epidermidis according to the present invention make it possible to overexpress a gene for activating the AhR pathway (notably the OVOL1 gene described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and optionally genes for stimulating differentiation (FLG – Filaggrin and/or DSG1 – Desmoglein 1), and thereby to prevent a reduction in, and/or to reinforce, the skin barrier function in an individual.
  • a gene for activating the AhR pathway notably the OVOL1 gene described by Furue et al. Int. J. Mol. Sci. 20, (2019)
  • genes for stimulating differentiation FLG – Filaggrin and/or D
  • the present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695.
  • the present invention also relates to a composition, notably cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5692, I-5693, I-5694 and I-5695.
  • a composition notably cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5692
  • the invention additionally relates to a composition, notably cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole- 3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as di
  • a “polyol” that is suitable for use in the invention is intended to be a compound of linear, branched or cyclic, saturated or unsaturated alkyl type, bearing on the alkyl chain at least two –OH functions, in particular at least three –OH functions and more particularly at least four –OH functions.
  • the polyols that are suitable for formulating a composition according to the present invention are in particular those containing especially from 2 to 32 carbon atoms and preferably 3 to 16 carbon atoms.
  • fill it must be understood colorless or white solid particles of all shapes, which are in an insoluble form and dispersed in the medium of the composition. Mineral or organic in nature, they give body or rigidity to the composition and/or softness.
  • the fillers used in the compositions according to the present invention can be of lamellar, globular, spherical, fiber shapes or any other intermediate shape between these defined shapes.
  • the fillers in the context of the invention may or may not be superficially coated, and, in particular, they may be surface treated with silicones, amino acids, fluorinated derivatives or any other substance promoting dispersion and compatibility of filler in the composition.
  • the filler can be inorganic or organic.
  • the mineral fillers can be chosen from synthetic or natural mica; silica powder; talc; kaolin; boron nitride or mixtures thereof.
  • the organic fillers can be chosen from: • organopolysiloxane powders coated with silicone resin, such as those sold under the trade names "KSP-100", “KSP-101", “KSP-102", “KSP-103", KSP-104", “KSP-105" by Shin Etsu, • polymethylsilsesquioxane powders, such as those sold under the trade name TOSPEARL by Momentive Performance Materials; • polyamide powders also known as Nylon such as Nylon-1 (Polyamide 1), Nylon- 12 ( Polyamide 12), such as those sold under the trade names ORGASOL by Arkema Nylon-66 (Polyamide 66); Nylon-6 (Polyamide 6); • polyethylene powders; • microspheres based on acrylic copolymers, such as those made of ethylene glycol dimethacrylate/lauryl methacrylate copolymer sold by Dow Corning under the trade name POLYTRAP; • expanded powders such as hollow microspheres and in particular, microspheres sold under the trade name
  • the propellants can be chosen from compressed gases or liquefied gases.
  • compressed gases air, nitrogen, carbon dioxide (or carbon dioxide), and their mixtures can be mentioned.
  • liquefied gases dimethyl ether, chlorinated and/or fluorinated hydrocarbons, such as trichlorofluoromethane, dichlorodifluoromethane, chlorodifluoromethane, 1,1,1,2-tetrafluoroethane, chloropentafluoroethane, 1-chloro-1,1- difluoroethane, 1,1-difluoroethane; volatile hydrocarbons, such as especially C3-C5 alkanes, like propane, isopropane, n-butane, isobutane, pentane, alone or in a mixture.
  • hydrocarbons are chosen from propane, isopropane, n-butane, isobutane, alone or in a mixture can be mentioned.
  • the live bacterial strain of the species Staphylococcus epidermidis may in particular be capable of producing a mixture of indoles comprising (i) indole-3-lactic acid (ILA) and/or a salt thereof, (ii) indole-3-carboxaldehyde (IAld) and/or a salt thereof, (iii) indole-3-acetic acid (IAA) and/or a salt thereof and (iv) tryptamine and/or a salt thereof.
  • IVA indole-3-lactic acid
  • IAld indole-3-carboxaldehyde
  • IAA indole-3-acetic acid
  • tryptamine tryptamine and/or a salt thereof.
  • a “live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole- 3-lactic acid (ILA) and/or a salt thereof, indole-3-carboxaldehyde (IAld) and/or a salt thereof, and indole-3-acetic acid (IAA) and/or a salt thereof and optionally tryptamine and/or a salt thereof” is understood to mean a live bacterial strain which, when it is brought into contact with human keratinocytes in a [bacteria/keratinocyte] ratio of 10:1 in a culture medium suitable for culturing human keratinocytes, in particular the KSFM medium, makes it possible to produce after at least 10 h of culture, preferably between 10 h and 24 h of culture, even better still 14 h of culture, a concentration of total indoles (indole-3-lactic acid (ILA) and/or
  • the bacterial strain of the species Staphylococcus epidermidis of a composition according to the invention may in particular be capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and (iv) tryptamine and/or a salt thereof.
  • the bacterial strain of the species Staphylococcus epidermidis of a composition according to the invention may more particularly be chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695.
  • bacterial strains according to the invention make it possible to overexpress a gene for activating the AhR pathway (notably the OVOL1 gene) and optionally the genes for stimulating differentiation (FLG – Filaggrin and/or DSG1 – Desmoglein 1), and thus to prevent a reduction in and/or reinforce the barrier function of the skin.
  • This discovery forms the basis of the present invention (see for example Hoober JK, Eggink LL. Int. J. Mol. Sci., 2022 Jan 27; 23(3): 1455).
  • filaggrin FLG is a major structural protein involved in the surface barrier of the skin. Mutations in the gene encoding filaggrin are the most significant risk factors for skin diseases.
  • DSG1 encodes desmoglein 1, a major constituent of desmosomes, which connect the cell surface to the keratin cytoskeleton and have a crucial role in maintaining the integrity of the epidermis and of the barrier function.
  • SAM syndrome severe dermatitis, multiple allergies and metabolic wasting syndrome
  • a psoriasiform dermatitis are reflected in an absence of membrane expression of DSG1, leading to a loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59–64 (2014)).
  • a lack of desmoglein 1 leads to severe dermatitis, multiple allergies and a loss of metabolism (Samuelov L et al. Nat Genet.
  • a composition according to the invention may notably be suitable for topical administration.
  • the invention also relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing a reduction in and/or reinforcing the skin barrier function in an individual.
  • an individual is preferentially a human being.
  • the invention additionally relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for improving skin moisturization.
  • the invention relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for improving the quality of the skin, in particular of dry skin.
  • the invention additionally relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
  • Dry skin also known as "xerosis” may appear at any age, and may be unrelated to a pathological condition.
  • the invention further relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis.
  • the invention also relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating atopic dermatitis.
  • a composition used according to the invention, or a bacterial strain used according to the invention can in particular be administered to an individual topically.
  • the invention also relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of at least one live bacterial strain according to the invention or of a composition according to the invention.
  • a non-therapeutic cosmetic method for caring for keratin materials in particular the skin, notably dry skin
  • Bacterial strain according to the invention Staphylococcus epidermidis, or white staphylococcus is a human commensal bacterium and part of the mucocutaneous flora of virtually the whole human population.
  • the inventors have identified new strains of Staphylococcus epidermidis that have the abovementioned specific abilities.
  • the present invention relates to an isolated bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.
  • an isolated bacterial strain of the species Staphylococcus epidermidis according to the invention is chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I- 5695.
  • One strain according to the invention is preferably the bacterial strain deposited at the CNCM under the accession number I-5691.
  • the abovementioned specific abilities of the bacterial strains according to the invention mainly result from their ability to produce a particular mixture of indoles, as presented in the examples.
  • a bacterial strain according to the invention should preferably be administered live.
  • live is understood to mean, according to the invention, a bacterium, the metabolism of which is active or reactivatable. For example, it is a bacterium in fresh or freeze-dried form, also referred to as dry form.
  • the term “live” is also understood to cover bacteria which are inactivated but can be reactivated.
  • a live bacterial strain according to the invention may be in an encapsulated or microencapsulated form.
  • the process for encapsulating bacteria and the various types of capsules are well known to those skilled in the art.
  • Antunes et al., 2013 Food Science and Technology 54: 125-131 describes a microencapsulation process in which a bacterial suspension is immobilized in cellulose acetate with glycerol, maltodextrin and Tween.
  • the bacterial suspension is nebulized using a single nozzle in a heated zone (100°C-200°C).
  • the water contained in the suspension evaporates and a dry bacterial powder is obtained.
  • the powder obtained resembles a matrix containing said microorganisms instead of microcapsules comprising a water-insoluble and water- impermeable shell, and microorganisms contained in a non-aqueous composition in the core of said microcapsules.
  • microencapsulated or "microcapsules” denote products obtained by a microencapsulation process.
  • microcapsule is a small sphere surrounded by a uniform wall.
  • the material inside the microcapsule is referred to as the core, inner phase or filling, while the wall is referred to as the shell, coating or membrane.
  • microencapsulation methods that are appropriate in the context of the present invention include, without being limited thereto, pan coating, air suspension coating, centrifugal extrusion, vibrating nozzle, spray drying, ionotropic gelation, coacervation and phase separation, interfacial polycondensation, interfacial crosslinking, in situ polymerization and matrix polymerization.
  • a strain according to the invention is preferably administered by topical application to the keratin materials in question, in particular to the skin, and notably to the dry skin in question.
  • composition according to the invention also relates to a composition
  • a composition comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.
  • the live bacterial strain is chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I- 5693, I-5694 and I-5695, and is in particular the bacterial strain deposited at the CNCM under the accession number I-5691.
  • a composition according to the invention may comprise a single type of bacterial strain as indicated above or a mixture of at least two or more bacterial strains as listed above.
  • a composition according to the invention is preferably devoid of any strain different from a strain as listed above.
  • the present invention also relates to a composition
  • a composition comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole- 3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether;
  • a composition according to the invention is preferably a cosmetic composition, in particular for caring for keratin materials.
  • a composition according to the invention comprises at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and (iv) tryptamine and/or a salt thereof.
  • Such a strain may in particular be chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and more particularly chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695.
  • composition according to the invention is preferentially suitable for topical application on keratin materials, in particular on the skin, and therefore comprises a physiologically acceptable medium, that is to say a medium compatible with application on keratin materials, in particular the skin, notably having a pleasant colour, a pleasant odour and a pleasant feel, and which does not cause any unacceptable discomfort, i.e. stinging or tautness, liable to dissuade the user from applying this composition.
  • Cosmetic means a composition that is compatible with keratin materials, in particular the skin, mucous membranes and the integuments.
  • the composition according to the invention is non-therapeutic.
  • keratin materials is intended to denote in particular the skin, mucous membranes, fibres, eyelashes and skin appendages.
  • skin is intended to mean all of the skin of the body, and preferably the skin of the face, scalp, neckline, neck, arms and forearms, or more preferably still the skin of the face, the skin of the face (in particular of the forehead, nose, cheeks and chin), of the neckline and of the neck.
  • the terms “treat” and “treatment” mean the alleviation of the symptoms associated with a specific disorder or condition and/or the elimination of said symptoms and also the complete disappearance of the disorder or condition in question.
  • the terms “prevent” and “prevention” denote the reduction, to a lesser degree, of the risk or probability of occurrence of a given phenomenon.
  • the present invention thus makes it possible to confer beneficial properties on the skin, notably in a long-lasting manner, in particular: effective barrier function; moisturizing effect; elasticity and smooth texture of the skin; surface morphology, with low roughness, good tissue cohesion and an improvement in the visual appearance of the skin.
  • effective barrier function notably in a long-lasting manner, in particular: effective barrier function; moisturizing effect; elasticity and smooth texture of the skin; surface morphology, with low roughness, good tissue cohesion and an improvement in the visual appearance of the skin.
  • dry skin is often associated with a decrease in the degree of skin moisturization and with an adverse effect on the barrier function, measured by the transepidermal water loss.
  • it is particularly characterized by a feeling of tautness, itching, feelings of discomfort and/or tension of the skin.
  • a composition according to the invention may be suitable for topical application representing from 10 7 to 10 12 colony-forming units (cfu) of bacteria according to the invention, preferably by application equivalent to 10 9 or 10 10 cfu.
  • a live bacterial strain of the species Staphylococcus epidermidis according to the invention or a composition according to the invention thus proves very particularly effective for treating skin-dryness conditions, for treating dry skin, for treating itching and/or tautness associated with dry skin, for physiologically restoring a suitable moisturization status of the stratum corneum, for treating hypo-seborrhoeic dry skin, for improving the comfort of dry skin, or else for combating the dull and/or lifeless appearance of the skin as a consequence of its drying-out.
  • a strain according to the invention is notably capable of producing (i) indole-3-lactic acid (ILA) and/or a salt thereof; (ii) indole- 3-carboxaldehyde (IAld) and/or a salt thereof; and (iii) indole-3-acetic acid (IAA) and/or a salt thereof.
  • IAA indole-3-acetic acid
  • a “salt” of an indole according to the invention is understood to mean a salt formed by an inorganic or organic acid or else an inorganic or organic base.
  • acid salts mention may be made of the sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and aspartate salts.
  • base salts examples include hydroxides of alkali metals such as sodium, potassium and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals such as aluminium and zinc; aqueous ammonia and organic amines such as unsubstituted or hydroxy-substituted mono-, di- or trialkylamines; dicyclohexylamines; tributylamines; pyridine; N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, bis- or tris(2-hydroxyalkylamines) such as mono-, bis- or tris(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine or tris(hydroxymethyl)methylamine, N,N-di-alkyl-N-(hydroxyalkyl)amines, such as N,N- dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-gluc
  • An indole salt according to the invention is preferably a base salt and in particular a sodium or potassium salt.
  • the indole-3-lactic acid (ILA) is of formula (I) below: [Chem 1] is of formula (II) below: [Chem 2] is of formula (III) below: [Chem 3] may in particular be, completely or partially, in the form of a sodium salt, in a composition according to the invention.
  • a bacterial strain according to the invention may also be capable of producing tryptamine.
  • the tryptamine is of formula (IV) below:
  • [Chem 4] to the invention may comprise at least one adjuvant chosen from the group constituted of fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.
  • a composition according to the invention may comprise water.
  • a composition according to the invention may comprise from 20% to 90% by weight and preferably from 30% to 60% by weight of water, relative to the total weight of the composition.
  • a composition according to the invention may also comprise at least one additional cosmetic active agent.
  • This may in particular be at least one active agent for caring for dry skin, such as glycerol or urea.
  • additional active agent means a compound which acts by itself, that is to say which does not require the intervention of an external agent in order to activate it.
  • the additional active agent which can be used in the compositions of the invention may in particular be chosen from desquamating agents, soothing agents, anti-irritant agents, anti- ageing agents, wound-healing agents, vitamins, and mixtures thereof in any proportions.
  • the additional active agent used in a composition according to the invention may represent from 0.0001% to 20%, preferably from 0.01% to 10% and better still from 0.1% to 5% by weight relative to the total weight of the composition.
  • a composition according to the invention may be in any presentation form normally used in the cosmetics field.
  • aqueous or aqueous-alcoholic solution which may be gelled
  • a dispersion of the lotion type which may be a two-phase dispersion, an oil-in- water or water-in-oil emulsion or a multiple emulsion, an aqueous gel, or else a dispersion of oils in an aqueous phase, notably using spherules, it being possible for these spherules to be polymeric particles or, better still, lipid vesicles of ionic and/or nonionic type.
  • the composition may be of more or less fluid liquid consistency.
  • compositions according to the invention differs from compositions having an essentially detergent purpose with regard to the skin, hair and/or mucous membranes, such as soaps, shampoos and shower gels for washing and/or cleansing.
  • a composition according to the invention is preferentially suitable for topical administration.
  • a composition according to the invention may comprise all the constituents usually employed in the envisaged topical application and administration.
  • a composition according to the invention may advantageously be in the form of an emulsion, notably obtained by dispersion of an aqueous phase in a fatty phase (W/O) or of a fatty phase in an aqueous phase (O/W), of liquid or semi-liquid consistency of the milk type, or of soft consistency, or even of multiple emulsion (W/O/W or O/W/O).
  • W/O fatty phase
  • O/W aqueous phase
  • These compositions are prepared according to the usual known methods.
  • a composition according to the invention may be intended for topical application and may preferably be in the form of an emulsion, preferably an oil-in-water emulsion. Preferably, such an emulsion is not intended to be rinsed off after application.
  • a composition according to the invention is preferentially intended to be applied to a skin.
  • the skin is the skin of the face, scalp, neckline, neck, arms or forearms, or even more preferably the skin of the face (in particular of the forehead, nose, cheeks, chin), neckline and neck.
  • the pH of said composition is advantageously less than or equal to 8, preferably ranging from 4 to 7, better still ranging from 4.5 to 6.5.
  • a composition may alternatively be in the form of a face and/or body care or makeup product, and may be packaged, for example, in the form of a cream in a jar or a fluid in a tube or a pump bottle or a dropper bottle.
  • a composition according to the invention can be manufactured by any known process generally used in the cosmetics field.
  • the present invention relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing a reduction in and/or reinforcing the skin barrier function in an individual.
  • the present invention relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for improving skin moisturization.
  • the present invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for: - improving skin quality, in particular the quality of dry skin, and/or - preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
  • One subject of the present invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis.
  • the invention also relates to the cosmetic use, notably topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis.
  • the present invention relates to a non- therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of a live bacterial strain according to the invention or of a composition according to the invention.
  • the cosmetic uses and methods considered according to the invention are non-therapeutic.
  • the cosmetic uses and methods of the invention are preferentially performed by topically administering a live bacterial strain according to the invention or a composition according to the invention.
  • the cosmetic use or method according to the invention may be implemented by topical, for example daily, application of at least one composition according to the invention, which may be formulated, for example, in the form of a cream, gel, serum, lotion, emulsion, or makeup-removing milk, preferably in the form of an emulsion.
  • the application can be repeated, for example, once to twice daily for one or more days and generally over an extended period of at least 4 weeks, or even 4 to 15 weeks, with, where appropriate, one or more periods of stoppage.
  • the application is daily (once a day) and generally over an extended period of at least 4 weeks, or even 4 to 15 weeks, with, where appropriate, one or more periods of stoppage.
  • the cosmetic treatment method according to the invention may comprise a single application.
  • the terms “between ... and ...”, and “ranging from ... to ...” should be understood as meaning limits included, unless otherwise specified.
  • the examples that follow illustrate the present invention without limiting the scope thereof.
  • the temperature is room temperature (20°C) and is expressed in degrees Celsius
  • the pressure is atmospheric pressure.
  • MATERIALS AND METHODS Origin of the strains, CNCM names and culture methods The Staphylococcus epidermidis strains selected, numbering 8, were collected from subjects with normal healthy skin. The samples were obtained using the swabbing method, as described previously, for example, in Leung, M. H. Y.
  • the ATCC 12228 strain is sold under the name ATCC12228 by LGC STANDARD.
  • the bacterial strains were cultured either in TSB (tryptic soy broth) or in KSFM (keratinocyte serum-free medium) using conventional microbiology methods.
  • Culture and treatments of keratinocytes Normal neonatal human primary epidermal keratinocytes (NHEKs) (CellnTec) were cultured in a medium supplemented with CnT-57 (CellnTec) containing a bovine pituitary extract (BPE) at 37°C and 5% CO 2 .
  • the NHEKs were cultured to approximately 90% confluence in keratinocyte-SFM medium (Gibco, Life Tech.
  • the NHEKs were treated with S. epidermidis using an MOI (mode of infection) of 10:1 (10 bacteria per keratinocyte) in KSFM medium for 14 hours.
  • MOI mode of infection
  • the media were collected for the quantification of the indole metabolites and the cytotoxicity assay (CyQuantTM LDH cytotoxicity assay, Thermo Fisher), and the cells were harvested for the real-time quantitative PCR assay.
  • RNA concentration was determined using a NanodropTM (Nanodrop 1000, Thermo Scientific). iScript cDNA Synthesis (Biorad) was used to synthesize the cDNA. The mRNA levels were measured using the StepOnePlusTM Real-Time PCR system (Applied BiosystemsTM) and SYBR Green Master Mix (Biorad).
  • the data from the quantitative PCR were analysed using the 2- ⁇ Ct quantification method, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for the eukaryotic cells and GyrB (DNA gyrase subunit B) for the staphylococcus as endogenous control.
  • GAPDH glycosylase dehydrogenase
  • GyrB DNA gyrase subunit B
  • Target gene GyrB Se sense primer (5'-3') of sequence SEQ ID NO: 1: GTTGTAATTGAGAAAGACAATTG (SEQ ID NO: 1) and antisense primer (3'-5') of sequence SEQ ID NO: 1: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 2).
  • the stock solutions of the labelled analytes were prepared in water with 0.1% formic acid and the end concentrations were chosen to correspond to the estimated concentrations of endogenous metabolites.
  • Extraction of metabolites The metabolites were extracted from 50 ⁇ l of coculture medium obtained as described above. After adding the preparations indicated above (100 ⁇ l) and 300 ⁇ l of MeOH, the samples were mixed for 15 s and homogenized at -20°C, for 30 min. After centrifugation for 10 min at 5000 rpm and -4°C, 350 ⁇ l of supernatant were collected and concentrated under a stream of N2.
  • Example 1 Selection of 8 live strains of Staphylococcus epidermidis + the reference strain ATCC12228, which are isolated from human skin For this selection, single strains are co-cultured with NHEK for 14 hours, then the supernatant is collected to quantify the indole metabolites and the keratinocytes are used for RT-qPCR as explained above. Quantification of the specific AhR ligands revealed the presence of indole-3- carboxaldehyde (IAld) and indole-3-lactic acid (ILA), indole-3-acetic acid (IAA) and tryptamine. The total indole produced was also quantified.
  • IAld indole-3- carboxaldehyde
  • IAA indole-3-lactic acid
  • IAA indole-3-acetic acid
  • OVOL1 is in fact known to be linked to the differentiation of keratinocytes (Tsuji, G. et al. Cell Death Dis. 8, e2931–e2931 (2017)) and filaggrin (FLG), as indicated above, is involved in skin differentiation and in the skin barrier function.
  • DSG1 is one of the tight junction proteins involved in the cohesion of skin cells. Strains ATCC12228, I-5692, I-5688, I-5694, I-5695, I-5693, I-5691 and I-5904 induced a strong expression of OVOL1 compared with the untreated control.
  • GAPDH a reference gene which is a constituent of NHEKs Conditions Average Control (untreated) NHEKs without bacteria 1 after 14 h of culture ATCC 12228 4.74 CNCM I-5688 3.567 CNCM I-5692 3.508 CNCM I-5694 4.194 CNCM I-5695 13.83 CNCM I-5693 8.017 CNCM I-5691 12.38 CNCM I-5904 2.53 Table 2 Strains I-5688 and I-5689 induced an FLG expression greater than the untreated control. [Table 3] Average mRNA expression level of the FLG gene vs.
  • GAPDH a reference gene which is a constituent of NHEKs Conditions Average Control (untreated) 1 CNCM I-5688 1.541 CNCM I-5689 1.243 Table 3 Strains I-5688 and I-5693 induced a DSG1 expression greater than the untreated control. [Table 4] Average mRNA expression level of the DSG1 gene vs.
  • GAPDH a reference gene which is a constituent of NHEKs Conditions Mean Control (untreated) 1 CNCM I-5688 1.395 CNCM I-5693 1.049 Table 4 Overall, strains ATCC12228, I-5688, I-5689, I-5691, I-5692, I-5693, I-5694 and I-5695 enhance the markers of the barrier function by AhR activation and indole secretion.
  • Isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I- 5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695. 2.
  • Composition particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I- 5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I- 5691, I-5904, I-5692, I-5693, I-5694 and I-5695. 3.
  • Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I- 5691, I-5904, I-5692, I-5693, I-5694 and I-5695.
  • Composition particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole-3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether
  • composition according to Claim 3 wherein the bacterial strain of the species Staphylococcus epidermidis is capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and in addition (iv) tryptamine and/or a salt thereof. 5.
  • composition according to Claim 3 or 4 wherein the bacterial strain of the species Staphylococcus epidermidis is chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under accession numbers I- 5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695. 6. Composition according to any one of Claims 2 to 5, the composition being suitable for topical administration. 7.
  • Non-therapeutic cosmetic use particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing a reduction in and/or reinforcing the skin barrier function in an individual.
  • Non-therapeutic cosmetic use particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for improving skin moisturization.
  • Non-therapeutic cosmetic use particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
  • the present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695 and a composition comprising same.
  • the invention also relates to the use of such a strain for preventing a reduction in and/or reinforcing the skin barrier function in an individual, for improving skin moisturization, for improving the quality of the skin, in particular the quality of dry skin, for preventing and/or treating cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin, and/or for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis and/or for preventing and/or treating atopic dermatitis and a non-therapeutic cosmetic method for caring for keratin materials comprising at least one step of topical application on said keratin materials of such a strain or composition.
  • a dermatological disorder such as atopic dermatitis and/or for preventing and/or treating atopic dermatitis and a non-therapeutic cosmetic method for caring for keratin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Dermatology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Birds (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Cosmetics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695 and a composition comprising same. The invention also relates to the use of such a strain for preventing a reduction in and/or reinforcing the skin barrier function in an individual, for improving skin moisturization, for improving the quality of the skin, in particular the quality of dry skin, for preventing and/or treating cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin, and/or for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis and/or for preventing and/or treating atopic dermatitis and a non-therapeutic cosmetic method for caring for keratin materials comprising at least one step of topical application on said keratin materials of such a strain or composition.

Description

Description Title: Use of strains of Staphylococcus epidermidis producing indole metabolites for improving the skin barrier Technical field The present invention relates to bacterial strains of Staphylococcus epidermidis and the use thereof for improving the barrier function and moisturizing the skin. More particularly, the present invention aims to provide live bacterial strains of the species Staphylococcus epidermidis, in isolated form, or included in compositions, notably cosmetic compositions, in particular for caring for keratin materials, further comprising a physiologically acceptable medium. The invention furthermore relates to a composition, notably a cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole-3-carboxaldehyde and/or a salt thereof, and indole-3-acetic acid and/or a salt thereof; and at least one adjuvant chosen from the group constituted of fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof. The invention also relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or composition for preventing a reduction in and/or reinforcing the skin barrier function in an individual. The invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of such a composition for improving skin moisturization. The invention also relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for: - improving skin quality, in particular the quality of dry skin, and/or - preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin. The invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis. The invention also relates to the cosmetic use, particularly topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis. Finally, the invention relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of a live bacterial strain according to the invention or of a composition according to the invention. Prior art The skin is a tissue, the cells of which are joined together and integrally attached to each other. The skin tissue forms an outer covering comprising sebaceous or sweat glands, and hair follicles. The skin is an epithelium which undergoes continual renewal. The renewal, or desquamation, is a coordinated and finely regulated process resulting in the imperceptible and invisible removal of the superficial cells. Human skin is constituted of two compartments, namely an upper compartment, the epidermis, and a deep compartment, the dermis. The epidermis is conventionally divided into a basal layer of keratinocytes that constitutes the germinal layer of the epidermis, a spinous layer constituted of several layers of polyhedral cells positioned on the germinal layers, one to three "granular" layers constituted of flattened cells containing distinct cytoplasmic inclusions, keratohyalin granules, and finally a set of upper layers referred to as the cornified layers (or stratum corneum), constituted of keratinocytes at the terminal stage in their differentiation, referred to as corneocytes. The organization, and above all the cohesion, between these various cell layers is made possible by a set of intercellular junctions including adherens junctions which contribute to maintaining homeostasis in the epithelial tissue. These adherens junctions are particularly referred to as desmosomes. Desmosomes are composed of transmembrane proteins from the cadherin family, such as desmoglein. These junctions have an essential role in the structure, maintenance and architectural cohesion of the epidermis and enable transmission and damping of mechanical forces acting on the keratinocytes. These adherens junctions are predominantly found in the intermediate layers of the epidermis up to the uppermost layers, namely the cornified layer composed of corneocytes. Corneocytes are anucleated cells mainly constituted of a fibrous material containing cytokeratins, surrounded by a cornified envelope, constituted particularly of the protein filaggrin. Filaggrin aggregates the keratin filaments into macrofibrils in the lower part of the cornified layer. When it comes close to the skin’s surface, filaggrin is mainly broken down into free amino acids which form a major portion of a highly hygroscopic complex, natural moisturizing factor (NMF). NMF is important for maintaining the moisturization of the cornified layer and the suppleness of the skin. New keratinocytes are constantly being produced to compensate for the continuous loss of epidermal cells at the cornified layer by a mechanism referred to as desquamation. Nevertheless, an imbalance between the production of cells at the basal layer and the rate of desquamation may particularly lead to the formation of scales on the surface of the skin. Similarly, a lack of terminal differentiation of the cells of the stratum corneum, for various reasons, can result in the formation of large, thick cell clusters which are visible to the naked eye and are referred to as "squamae", or in other situations, in a thinning of the stratum corneum. In addition, a reduction in the whole of the junction system which is responsible for cell- cell cohesion directly results in a reduction in the efficacy of the skin’s barrier function. Thus, one or more of these internal factors may lead to a weakness in the barrier properties of the epidermis, to chronic dehydration of the stratum corneum, to a loss of mechanical elasticity, to tautness, and also to a loss of radiance and transparency of the skin. In parallel, weakening of the skin barrier can also occur in the presence of external attacking factors, notably chosen from irritants (detergents, acids, bases, oxidizing agents, reducing agents, concentrated solvents, gases or noxious fumes), thermal or climatic imbalances (cold, drought, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants) or internal attacking factors such as psychological stress. One of the critical steps in the process of terminal differentiation of the stratum corneum is the crosslinking of the precursor proteins of the cornified envelope (CE). This phenomenon has an essential role in the development and maintenance of skin cohesion, of the physical properties of the skin such as the barrier function, and is a crucial step in the process of terminal differentiation. The cornified envelope is an essential component of corneocytes. The moisturizing active ingredients conventionally used, such as humectants, moisturizing polymers or occlusive fatty substances such as liquid petroleum jelly, temporarily modify the surface properties of the skin. These active ingredients may lead to mechanical softening of the stratum corneum, to an increase in the state of moisturization thereof and/or an improvement in the skin’s microrelief by the formation of a film at the surface of the skin. However, these effects are not necessarily particularly persistent over time and disappear after cleansing the skin. Moreover, these active ingredients can be eliminated by cleansing actions. In order to overcome these disadvantages, it may be advantageous to opt for active ingredients that have a beneficial effect on biological pathways and biomarkers involved in the skin barrier function. Aside from the abovementioned key factors involved in the skin barrier function which are notably filaggrin and adherens junctions (desmoglein), the tryptophan metabolic pathway, namely the aryl hydrocarbon receptor (AhR) pathway, is of particular interest. This is because this pathway is known to be involved in various skin disorders such as accelerated ageing and inflammation (Parrado, C. et al. Front. Pharmacol. 10, (2019); Krutmann, J. Dermatol. Sci.85, 152–161 (2017); Vogeley, C., Int. J. Mol. Sci. 20, (2019). Hidaka, T., Front. Med.6, (2019); Stockinger, B Annu. Rev. Immunol.32, 403–432 (2014)). It is also known to be essential for the integrity of the skin barrier (Haas, K. et al. J. Invest. Dermatol.136, 2260–2269 (2016)) and the activation thereof, notably by the OVOL1 gene, makes it possible to improve the skin barrier in the context of atopic dermatitis (Furue, M., Hashimoto-Hachiya, A. & Tsuji, G. Int. J. Mol. Sci.20, (2019)). Thus, there is a need to identify new active ingredients which make it possible to stimulate not only the tryptophan metabolic pathway, namely the aryl hydrocarbon receptor (AhR) pathway, and optionally to stimulate expression of filaggrin and/or of adherens junctions such as desmoglein. There is a need for active ingredients that enable the skin, in particular dry skin, to maintain its barrier function. There is a need for active ingredients for preventing a reduction in, and/or reinforcing, the skin barrier function in an individual. There is also a need for active ingredients for improving skin moisturization. There is furthermore a need for active ingredients for improving skin quality, in particular the quality of dry skin; and/or preventing and/or treating cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin. There is also a need for active ingredients for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis. The invention also relates to the cosmetic use, particularly topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis. Disclosure of the invention The aim of the present invention is to solve the abovementioned technical problems. Indeed, the inventors have now discovered that certain bacterial strains of the species Staphylococcus epidermidis according to the present invention make it possible to overexpress a gene for activating the AhR pathway (notably the OVOL1 gene described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and optionally genes for stimulating differentiation (FLG – Filaggrin and/or DSG1 – Desmoglein 1), and thereby to prevent a reduction in, and/or to reinforce, the skin barrier function in an individual. They are therefore advantageous in improving the barrier function and moisturization of the skin. Summary of the invention Thus, according to a first aspect, the present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695. The present invention also relates to a composition, notably cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5692, I-5693, I-5694 and I-5695. The invention additionally relates to a composition, notably cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole- 3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof. A “polyol” that is suitable for use in the invention is intended to be a compound of linear, branched or cyclic, saturated or unsaturated alkyl type, bearing on the alkyl chain at least two –OH functions, in particular at least three –OH functions and more particularly at least four –OH functions. The polyols that are suitable for formulating a composition according to the present invention are in particular those containing especially from 2 to 32 carbon atoms and preferably 3 to 16 carbon atoms. By “filler”, it must be understood colorless or white solid particles of all shapes, which are in an insoluble form and dispersed in the medium of the composition. Mineral or organic in nature, they give body or rigidity to the composition and/or softness. The fillers used in the compositions according to the present invention can be of lamellar, globular, spherical, fiber shapes or any other intermediate shape between these defined shapes. The fillers in the context of the invention may or may not be superficially coated, and, in particular, they may be surface treated with silicones, amino acids, fluorinated derivatives or any other substance promoting dispersion and compatibility of filler in the composition. The filler can be inorganic or organic. The mineral fillers can be chosen from synthetic or natural mica; silica powder; talc; kaolin; boron nitride or mixtures thereof. The organic fillers can be chosen from: • organopolysiloxane powders coated with silicone resin, such as those sold under the trade names "KSP-100", "KSP-101", "KSP-102", "KSP-103", KSP-104", "KSP-105" by Shin Etsu, • polymethylsilsesquioxane powders, such as those sold under the trade name TOSPEARL by Momentive Performance Materials; • polyamide powders also known as Nylon such as Nylon-1 (Polyamide 1), Nylon- 12 ( Polyamide 12), such as those sold under the trade names ORGASOL by Arkema Nylon-66 (Polyamide 66); Nylon-6 (Polyamide 6); • polyethylene powders; • microspheres based on acrylic copolymers, such as those made of ethylene glycol dimethacrylate/lauryl methacrylate copolymer sold by Dow Corning under the trade name POLYTRAP; • expanded powders such as hollow microspheres and in particular, microspheres sold under the trade name EXPANCEL by Nouryon; • methyl polymethacrylarte microspheres, such as those sold under the trade name MICROSPHERE M-100 by Matsumoto or under the trade name COVABEAD LH85 by Sensient; • ethylene-acrylate copolymer powders, such as those sold under the trade name FLOBEADS by Sumitomo Seika Chemicals; • natural organic material powders such as starch powders particularly corn, wheat or rice starches, optionally crosslinked, such as starch powders crosslinked with octenylsuccinate anhydride, such as those marketed under the trade name DRY-FLO by Nouryon; • poly-p-phenylene terephtamide powders; • and mixtures thereof. The propellants can be chosen from compressed gases or liquefied gases. As examples of compressed gases, air, nitrogen, carbon dioxide (or carbon dioxide), and their mixtures can be mentioned. As an example of liquefied gases, dimethyl ether, chlorinated and/or fluorinated hydrocarbons, such as trichlorofluoromethane, dichlorodifluoromethane, chlorodifluoromethane, 1,1,1,2-tetrafluoroethane, chloropentafluoroethane, 1-chloro-1,1- difluoroethane, 1,1-difluoroethane; volatile hydrocarbons, such as especially C3-C5 alkanes, like propane, isopropane, n-butane, isobutane, pentane, alone or in a mixture. Preferably, hydrocarbons are chosen from propane, isopropane, n-butane, isobutane, alone or in a mixture can be mentioned. In a composition according to the invention, the live bacterial strain of the species Staphylococcus epidermidis may in particular be capable of producing a mixture of indoles comprising (i) indole-3-lactic acid (ILA) and/or a salt thereof, (ii) indole-3-carboxaldehyde (IAld) and/or a salt thereof, (iii) indole-3-acetic acid (IAA) and/or a salt thereof and (iv) tryptamine and/or a salt thereof. For the purposes of the present invention a “live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole- 3-lactic acid (ILA) and/or a salt thereof, indole-3-carboxaldehyde (IAld) and/or a salt thereof, and indole-3-acetic acid (IAA) and/or a salt thereof and optionally tryptamine and/or a salt thereof” is understood to mean a live bacterial strain which, when it is brought into contact with human keratinocytes in a [bacteria/keratinocyte] ratio of 10:1 in a culture medium suitable for culturing human keratinocytes, in particular the KSFM medium, makes it possible to produce after at least 10 h of culture, preferably between 10 h and 24 h of culture, even better still 14 h of culture, a concentration of total indoles (indole-3-lactic acid (ILA) and/or a salt thereof, and indole-3-carboxaldehyde (IAld) and/or a salt thereof and indole-3-acetic acid (IAA) and/or a salt thereof, and optionally tryptamine and/or a salt thereof) of at least 890 pmol/ml, in particular of at least 1000 pmol/ml, and more particularly a concentration of: - indole-3-lactic acid (ILA) and/or a salt thereof, of at least 770 pmol/ml, in particular of at least 860 pmol/ml and - indole-3-carboxaldehyde (IAld) and/or a salt thereof, of at least 40 pmol/ml, in particular of at least 50 pmol/ml and - indole-3-acetic acid (IAA) and/or a salt thereof, of at least 80 pmol/ml, in particular of at least 90 pmol/ml and optionally - tryptamine and/or a salt thereof, of at least 0.5 pmol/ml, in particular of at least 1 pmol/ml. The bacterial strain of the species Staphylococcus epidermidis of a composition according to the invention may in particular be capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and (iv) tryptamine and/or a salt thereof. The bacterial strain of the species Staphylococcus epidermidis of a composition according to the invention may more particularly be chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695. As illustrated in the examples below, the applicant has discovered, surprisingly, that bacterial strains according to the invention make it possible to overexpress a gene for activating the AhR pathway (notably the OVOL1 gene) and optionally the genes for stimulating differentiation (FLG – Filaggrin and/or DSG1 – Desmoglein 1), and thus to prevent a reduction in and/or reinforce the barrier function of the skin. This discovery forms the basis of the present invention (see for example Hoober JK, Eggink LL. Int. J. Mol. Sci., 2022 Jan 27; 23(3): 1455). Indeed, filaggrin (FLG) is a major structural protein involved in the surface barrier of the skin. Mutations in the gene encoding filaggrin are the most significant risk factors for skin diseases. Approximately 50% of patients suffering from atopic dermatitis carry loss-of- function mutations in filaggrin. Esparza-Gordillo et al. (Curr Opin Allergy Clin Immunol. 2010 Oct; 10(5): 418-26) indicated that 10% to 20% of people in industrialized countries suffer from atopic dermatitis, with a strong predisposition in children when the mother carries an FLG mutation. The mutation in the FLG gene is also associated with ichthyosis vulgaris, which is a common skin disease characterized by dry and squamous skin with a prevalence of at least one case per 250 people. Moreover, DSG1 encodes desmoglein 1, a major constituent of desmosomes, which connect the cell surface to the keratin cytoskeleton and have a crucial role in maintaining the integrity of the epidermis and of the barrier function. The mutations which cause SAM syndrome (severe dermatitis, multiple allergies and metabolic wasting syndrome), a psoriasiform dermatitis, are reflected in an absence of membrane expression of DSG1, leading to a loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59–64 (2014)). A lack of desmoglein 1 leads to severe dermatitis, multiple allergies and a loss of metabolism (Samuelov L et al. Nat Genet. 2013 Oct;45(10):1244-1248; Lisa M Godsel et al. J Clin Invest.2022 Feb 1;132(3):e144363.). These two proteins are therefore key to the barrier role played by the skin. A composition according to the invention may notably be suitable for topical administration. The invention also relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing a reduction in and/or reinforcing the skin barrier function in an individual. For the purposes of the present invention, an individual is preferentially a human being. The invention additionally relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for improving skin moisturization. The invention relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for improving the quality of the skin, in particular of dry skin. The invention additionally relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin. Dry skin, also known as "xerosis", may appear at any age, and may be unrelated to a pathological condition. The invention further relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis. The invention also relates to the cosmetic use, notably topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention, for preventing and/or treating atopic dermatitis. A composition used according to the invention, or a bacterial strain used according to the invention, can in particular be administered to an individual topically. Finally, the invention also relates to a non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of at least one live bacterial strain according to the invention or of a composition according to the invention. Other characteristics, aspects and advantages of the invention will become apparent on reading the detailed description that follows. Detailed description Bacterial strain according to the invention Staphylococcus epidermidis, or white staphylococcus, is a human commensal bacterium and part of the mucocutaneous flora of virtually the whole human population. The inventors have identified new strains of Staphylococcus epidermidis that have the abovementioned specific abilities. Consequently, the present invention relates to an isolated bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695. In particular, an isolated bacterial strain of the species Staphylococcus epidermidis according to the invention is chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I- 5695. One strain according to the invention is preferably the bacterial strain deposited at the CNCM under the accession number I-5691. The abovementioned specific abilities of the bacterial strains according to the invention mainly result from their ability to produce a particular mixture of indoles, as presented in the examples. Thus, a bacterial strain according to the invention should preferably be administered live. The term "live" is understood to mean, according to the invention, a bacterium, the metabolism of which is active or reactivatable. For example, it is a bacterium in fresh or freeze-dried form, also referred to as dry form. Thus, within the meaning of the invention, the term "live" is also understood to cover bacteria which are inactivated but can be reactivated. Consequently, dead bacteria, that is to say bacteria for which the metabolism has been inactivated but can no longer be reactivated, such as lysed forms of bacteria, are not covered by the invention. A live bacterial strain according to the invention may be in an encapsulated or microencapsulated form. The process for encapsulating bacteria and the various types of capsules are well known to those skilled in the art. For example, Antunes et al., 2013 (Food Science and Technology 54: 125-131) describes a microencapsulation process in which a bacterial suspension is immobilized in cellulose acetate with glycerol, maltodextrin and Tween. During spray drying, the bacterial suspension is nebulized using a single nozzle in a heated zone (100°C-200°C). Thus, the water contained in the suspension evaporates and a dry bacterial powder is obtained. The powder obtained resembles a matrix containing said microorganisms instead of microcapsules comprising a water-insoluble and water- impermeable shell, and microorganisms contained in a non-aqueous composition in the core of said microcapsules. The terms "microencapsulated" or "microcapsules" denote products obtained by a microencapsulation process. It is a process in which particles or droplets of microscopic size (of the order of a micrometre) are surrounded by a coating to give small capsules, having many useful properties. In the context of the present invention, it is used to incorporate bacteria according to the invention. In a relatively simple form, a microcapsule is a small sphere surrounded by a uniform wall. The material inside the microcapsule is referred to as the core, inner phase or filling, while the wall is referred to as the shell, coating or membrane. A person skilled in the art knows that there are numerous methods for manufacturing microcapsules and that the present invention is not limited to any of these methods. The microencapsulation methods that are appropriate in the context of the present invention include, without being limited thereto, pan coating, air suspension coating, centrifugal extrusion, vibrating nozzle, spray drying, ionotropic gelation, coacervation and phase separation, interfacial polycondensation, interfacial crosslinking, in situ polymerization and matrix polymerization. A strain according to the invention is preferably administered by topical application to the keratin materials in question, in particular to the skin, and notably to the dry skin in question. Composition according to the invention The present invention also relates to a composition comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695. In particular, the live bacterial strain is chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I- 5693, I-5694 and I-5695, and is in particular the bacterial strain deposited at the CNCM under the accession number I-5691. Of course, a composition according to the invention may comprise a single type of bacterial strain as indicated above or a mixture of at least two or more bacterial strains as listed above. A composition according to the invention is preferably devoid of any strain different from a strain as listed above. The present invention also relates to a composition comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole- 3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof. A composition according to the invention is preferably a cosmetic composition, in particular for caring for keratin materials. In particular, a composition according to the invention comprises at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and (iv) tryptamine and/or a salt thereof. Such a strain may in particular be chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and more particularly chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695. The composition according to the invention is preferentially suitable for topical application on keratin materials, in particular on the skin, and therefore comprises a physiologically acceptable medium, that is to say a medium compatible with application on keratin materials, in particular the skin, notably having a pleasant colour, a pleasant odour and a pleasant feel, and which does not cause any unacceptable discomfort, i.e. stinging or tautness, liable to dissuade the user from applying this composition. The term “cosmetic” means a composition that is compatible with keratin materials, in particular the skin, mucous membranes and the integuments. The composition according to the invention is non-therapeutic. The term “keratin materials” is intended to denote in particular the skin, mucous membranes, fibres, eyelashes and skin appendages. The term "skin" is intended to mean all of the skin of the body, and preferably the skin of the face, scalp, neckline, neck, arms and forearms, or more preferably still the skin of the face, the skin of the face (in particular of the forehead, nose, cheeks and chin), of the neckline and of the neck. As used herein, the terms “treat” and “treatment” mean the alleviation of the symptoms associated with a specific disorder or condition and/or the elimination of said symptoms and also the complete disappearance of the disorder or condition in question. In the context of the present invention, the terms “prevent” and “prevention” denote the reduction, to a lesser degree, of the risk or probability of occurrence of a given phenomenon. The present invention thus makes it possible to confer beneficial properties on the skin, notably in a long-lasting manner, in particular: effective barrier function; moisturizing effect; elasticity and smooth texture of the skin; surface morphology, with low roughness, good tissue cohesion and an improvement in the visual appearance of the skin. In physiological terms, dry skin is often associated with a decrease in the degree of skin moisturization and with an adverse effect on the barrier function, measured by the transepidermal water loss. In sensory terms, it is particularly characterized by a feeling of tautness, itching, feelings of discomfort and/or tension of the skin. For obvious reasons, these manifestations cause discomfort. A composition according to the invention may be suitable for topical application representing from 107 to 1012 colony-forming units (cfu) of bacteria according to the invention, preferably by application equivalent to 109 or 1010 cfu. A live bacterial strain of the species Staphylococcus epidermidis according to the invention or a composition according to the invention thus proves very particularly effective for treating skin-dryness conditions, for treating dry skin, for treating itching and/or tautness associated with dry skin, for physiologically restoring a suitable moisturization status of the stratum corneum, for treating hypo-seborrhoeic dry skin, for improving the comfort of dry skin, or else for combating the dull and/or lifeless appearance of the skin as a consequence of its drying-out. As indicated above and illustrated in the examples, a strain according to the invention is notably capable of producing (i) indole-3-lactic acid (ILA) and/or a salt thereof; (ii) indole- 3-carboxaldehyde (IAld) and/or a salt thereof; and (iii) indole-3-acetic acid (IAA) and/or a salt thereof. A “salt” of an indole according to the invention is understood to mean a salt formed by an inorganic or organic acid or else an inorganic or organic base. As examples of acid salts, mention may be made of the sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and aspartate salts. As examples of base salts, mention may be made of hydroxides of alkali metals such as sodium, potassium and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals such as aluminium and zinc; aqueous ammonia and organic amines such as unsubstituted or hydroxy-substituted mono-, di- or trialkylamines; dicyclohexylamines; tributylamines; pyridine; N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, bis- or tris(2-hydroxyalkylamines) such as mono-, bis- or tris(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine or tris(hydroxymethyl)methylamine, N,N-di-alkyl-N-(hydroxyalkyl)amines, such as N,N- dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine and lysine. An indole salt according to the invention is preferably a base salt and in particular a sodium or potassium salt. The indole-3-lactic acid (ILA) is of formula (I) below: [Chem 1] is of formula (II) below: [Chem 2] is of formula (III) below: [Chem 3] may in particular be, completely or partially, in the form of a sodium salt, in a composition according to the invention. A bacterial strain according to the invention may also be capable of producing tryptamine. The tryptamine is of formula (IV) below: [Chem 4] to the invention may comprise at least one adjuvant chosen from the group constituted of fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof. Such an adjuvant may represent from 0.0001% to 20%, preferably from 0.01% to 10% and better still from 0.1% to 5% by weight relative to the total weight of the composition. Of course, a person skilled in the art will take care to select this or these adjuvant(s), and/or the amount thereof, such that the advantageous properties of the strains according to the invention are not, or are not substantially, adversely affected by the envisioned addition. According to one embodiment, a composition according to the invention may comprise water. In particular, a composition according to the invention may comprise from 20% to 90% by weight and preferably from 30% to 60% by weight of water, relative to the total weight of the composition. A composition according to the invention may also comprise at least one additional cosmetic active agent. This may in particular be at least one active agent for caring for dry skin, such as glycerol or urea. In the context of the present invention, the term “additional active agent” means a compound which acts by itself, that is to say which does not require the intervention of an external agent in order to activate it. The additional active agent which can be used in the compositions of the invention may in particular be chosen from desquamating agents, soothing agents, anti-irritant agents, anti- ageing agents, wound-healing agents, vitamins, and mixtures thereof in any proportions. The additional active agent used in a composition according to the invention may represent from 0.0001% to 20%, preferably from 0.01% to 10% and better still from 0.1% to 5% by weight relative to the total weight of the composition. Of course, a person skilled in the art will take care to select this or these optional additional compound(s), and/or the amount thereof, such that the advantageous properties of a bacterial strain according to the invention or of a composition according to the invention are not, or are not substantially, adversely affected by the envisioned addition. A composition according to the invention may be in any presentation form normally used in the cosmetics field. It may notably be in the form of an aqueous or aqueous-alcoholic solution, which may be gelled, a dispersion of the lotion type, which may be a two-phase dispersion, an oil-in- water or water-in-oil emulsion or a multiple emulsion, an aqueous gel, or else a dispersion of oils in an aqueous phase, notably using spherules, it being possible for these spherules to be polymeric particles or, better still, lipid vesicles of ionic and/or nonionic type. The composition may be of more or less fluid liquid consistency. Preferentially, a composition according to the invention differs from compositions having an essentially detergent purpose with regard to the skin, hair and/or mucous membranes, such as soaps, shampoos and shower gels for washing and/or cleansing. A composition according to the invention is preferentially suitable for topical administration. Thus, a composition according to the invention may comprise all the constituents usually employed in the envisaged topical application and administration. A composition according to the invention may advantageously be in the form of an emulsion, notably obtained by dispersion of an aqueous phase in a fatty phase (W/O) or of a fatty phase in an aqueous phase (O/W), of liquid or semi-liquid consistency of the milk type, or of soft consistency, or even of multiple emulsion (W/O/W or O/W/O). These compositions are prepared according to the usual known methods. More particularly, a composition according to the invention may be intended for topical application and may preferably be in the form of an emulsion, preferably an oil-in-water emulsion. Preferably, such an emulsion is not intended to be rinsed off after application. A composition according to the invention is preferentially intended to be applied to a skin. Preferably, the skin is the skin of the face, scalp, neckline, neck, arms or forearms, or even more preferably the skin of the face (in particular of the forehead, nose, cheeks, chin), neckline and neck. The pH of said composition is advantageously less than or equal to 8, preferably ranging from 4 to 7, better still ranging from 4.5 to 6.5. A composition may alternatively be in the form of a face and/or body care or makeup product, and may be packaged, for example, in the form of a cream in a jar or a fluid in a tube or a pump bottle or a dropper bottle. A composition according to the invention can be manufactured by any known process generally used in the cosmetics field. The ingredients are mixed before forming, in the order and under conditions readily determined by a person skilled in the art. According to a particular mode of the invention, other agents intended to embellish the appearance and/or texture of the skin may also be added to a composition according to the invention. Uses and methods According to one of its aspects, the present invention relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing a reduction in and/or reinforcing the skin barrier function in an individual. According to yet another one of its aspects, the present invention relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for improving skin moisturization. The present invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for: - improving skin quality, in particular the quality of dry skin, and/or - preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin. One subject of the present invention additionally relates to the cosmetic use, notably topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis. The invention also relates to the cosmetic use, notably topical cosmetic use, of such a composition for preventing and/or treating atopic dermatitis. According to yet another one of its aspects, the present invention relates to a non- therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of a live bacterial strain according to the invention or of a composition according to the invention. The cosmetic uses and methods considered according to the invention are non-therapeutic. The cosmetic uses and methods of the invention are preferentially performed by topically administering a live bacterial strain according to the invention or a composition according to the invention. By way of illustration, the cosmetic use or method according to the invention may be implemented by topical, for example daily, application of at least one composition according to the invention, which may be formulated, for example, in the form of a cream, gel, serum, lotion, emulsion, or makeup-removing milk, preferably in the form of an emulsion. The application can be repeated, for example, once to twice daily for one or more days and generally over an extended period of at least 4 weeks, or even 4 to 15 weeks, with, where appropriate, one or more periods of stoppage. According to one embodiment, the application is daily (once a day) and generally over an extended period of at least 4 weeks, or even 4 to 15 weeks, with, where appropriate, one or more periods of stoppage. According to one embodiment, the cosmetic treatment method according to the invention may comprise a single application. Throughout the description, including the claims, the terms “between ... and ...”, and “ranging from ... to ...” should be understood as meaning limits included, unless otherwise specified. The examples that follow illustrate the present invention without limiting the scope thereof. In the examples, unless otherwise specified, the temperature is room temperature (20°C) and is expressed in degrees Celsius, and the pressure is atmospheric pressure. Examples MATERIALS AND METHODS Origin of the strains, CNCM names and culture methods The Staphylococcus epidermidis strains selected, numbering 8, were collected from subjects with normal healthy skin. The samples were obtained using the swabbing method, as described previously, for example, in Leung, M. H. Y. et al. Changes of the human skin microbiota upon chronic exposure to polycyclic aromatic hydrocarbon pollutants. Microbiome 8, 100 (2020). The bacteria collected were isolated on tryptone soya agar (TSA) and preserved in the form of frozen stock. These eight strains are as follows: the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 3 June 2021 under accession number CNCM I-5688 (I-5688), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 3 June 2021 under accession number CNCM I-5689 (I-5689), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 21 September 2022 under accession number CNCM I-5904 (I-5904), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 3 June 2021 under accession number CNCM I-5691 (I-5691), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 3 June 2021 under accession number CNCM I-5692 (I-5692), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 3 June 2021 under accession number CNCM I-5693 (I-5693), the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 7 June 2021 under accession number CNCM I-5694 (I-5694) and the Staphylococcus epidermidis (S. epidermidis) strain deposited by L'Oréal at the CNCM on 7 June 2021 under accession number CNCM I-5695 (I-5695). The ATCC 12228 strain is sold under the name ATCC12228 by LGC STANDARD. The bacterial strains were cultured either in TSB (tryptic soy broth) or in KSFM (keratinocyte serum-free medium) using conventional microbiology methods. Culture and treatments of keratinocytes Normal neonatal human primary epidermal keratinocytes (NHEKs) (CellnTec) were cultured in a medium supplemented with CnT-57 (CellnTec) containing a bovine pituitary extract (BPE) at 37°C and 5% CO2. The NHEKs were cultured to approximately 90% confluence in keratinocyte-SFM medium (Gibco, Life Tech. Corp., Grand Island, USA) supplemented with 0.035 µg/µl EGF and 12.4 mg/ml BPE (Gibco) 24 hours before the treatments. For the treatments with the live bacterial strains, the NHEKs were treated with S. epidermidis using an MOI (mode of infection) of 10:1 (10 bacteria per keratinocyte) in KSFM medium for 14 hours. At the end of the treatment, the media were collected for the quantification of the indole metabolites and the cytotoxicity assay (CyQuantTM LDH cytotoxicity assay, Thermo Fisher), and the cells were harvested for the real-time quantitative PCR assay. Quantitative RT-PCR from the keratinocytes using the RNeasy Micro kit (Qiagen, Hilden, Germany) following the manufacturer’s protocol, with an additional treatment with DNase (Rnase-Free Dnase Set, Qiagen). The RNA concentration was determined using a NanodropTM (Nanodrop 1000, Thermo Scientific). iScript cDNA Synthesis (Biorad) was used to synthesize the cDNA. The mRNA levels were measured using the StepOnePlusTM Real-Time PCR system (Applied Biosystems™) and SYBR Green Master Mix (Biorad). The data from the quantitative PCR (qPCR) were analysed using the 2-ΔΔCt quantification method, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for the eukaryotic cells and GyrB (DNA gyrase subunit B) for the staphylococcus as endogenous control. Primers for FLG, IVL, KLK7, DSG1, CDSN, Ki67, DEFB4, STAT6, OVOL1, OVOL2 were provided by Biorad, the other primer sequences are presented below: Target gene GyrB Se: sense primer (5'-3') of sequence SEQ ID NO: 1: GTTGTAATTGAGAAAGACAATTG (SEQ ID NO: 1) and antisense primer (3'-5') of sequence SEQ ID NO: 1: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 2). Quantification of AhR metabolites/ligands Preparation: 5-Hydroxyindole-acetic acid-d5, serotonin-d4, indole-3-acetic acid-d4, kynurenic acid-d5, melatonin-d4, piconilic acid-d3, tryptamine-d4 and xanthurenic acid- d4 were purchased from Santa Cruz Biotechnology. 3-Hydroxyantrhanilic acid-d4, 3- hydroxykynurenin-13C2-15N, 5-hydroxytryptophan-d4, indole-3-acetamide-d5, kynurenin-d4 and tryptophan-d5 were purchased from Toronto Research Chemicals. The stock solutions of the labelled analytes were prepared in water with 0.1% formic acid and the end concentrations were chosen to correspond to the estimated concentrations of endogenous metabolites. Extraction of metabolites: The metabolites were extracted from 50 μl of coculture medium obtained as described above. After adding the preparations indicated above (100 μl) and 300 μl of MeOH, the samples were mixed for 15 s and homogenized at -20°C, for 30 min. After centrifugation for 10 min at 5000 rpm and -4°C, 350 μl of supernatant were collected and concentrated under a stream of N2. The residues were reconstituted in 100 μl of MeOH/H2O (1:9) and transferred to a 96-well plate for LC-HRMS. Instrumentation: The analyses were carried out as described previously in Lefèvre, A. et al.. Talanta 195, 593–598 (2019). In brief, 2 μl were injected into the LC-MS (XEVO-TQ- XS, Waters®). A Kinetex C18 xb column (1.7 μm x 150 mm x 2.1 mm, temperature 55°C) associated with a gradient of two mobile phases (Phase A: water + 0.5% formic acid; Phase B: MeOH + 0.5% formic acid) at a flow rate of 0.4 ml/min were used. For each metabolite, calibration curves were used to determine the concentrations of each metabolite in the samples. Statistical analysis All experiments were performed with at least three biological replicates. The data is presented in the form of mean ± SEM. GraphPad Prism (version 7.0; GraphPad Software, La Jolla, California). The data was analysed using the Kruskal-Wallis test followed by Dunn’s test. The results are considered to be statistically significant when p < 0.05. Example 1: Selection of 8 live strains of Staphylococcus epidermidis + the reference strain ATCC12228, which are isolated from human skin For this selection, single strains are co-cultured with NHEK for 14 hours, then the supernatant is collected to quantify the indole metabolites and the keratinocytes are used for RT-qPCR as explained above. Quantification of the specific AhR ligands revealed the presence of indole-3- carboxaldehyde (IAld) and indole-3-lactic acid (ILA), indole-3-acetic acid (IAA) and tryptamine. The total indole produced was also quantified. Results Quantification of the concentrations of indoles in the culture supernatants indicated a concentration greater than 890 pmol/ml of total indoles – i.e. the sum of the concentration of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and tryptamine – for 9 of the strains tested, namely the strains previously indicated having the references I-5689, I-5688, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695 and for the reference strain ATCC12228. [Table 1] ILA IAld IAA Tryptamine Conditions (average in (average in (average in (average in Total pmol/ml) pmol/ml) pmol/ml) pmol/ml) indoles Culture medium only control 6.00 11.54 13.71 4.30 35.55 (KSFM) Untreated controls (KSFM after 14 h of culture 112.80 20.31 84.63 668.80 886.55 of the NHEKs) ATCC 12228 1130.71 70.96 438.59 6670.44 8310.70 CNCM I-5692 1795.89 50.43 99.30 1073.90 3019.52 CNCM I-5688 1486.31 97.90 686.47 9572.35 11843.04 CNCM I-5694 1231.30 106.72 180.69 8420.37 9939.08 CNCM I-5695 1434.51 102.78 195.86 3.74 1736.89 CNCM I-5693 925.56 129.85 386.30 9260.80 10702.51 CNCM I-5691 2736.41 52.62 252.07 1.91 3043.00 CNCM I-5904 2571.32 248.26 678.94 9277.92 12776.45 CNCM I-5689 1299.07 53.81 347.63 10333.14 12033.65 Table 1 Example 2: Measurement of the ability of the bacteria to maintain the skin barrier function Next, the ability of the strains to activate the AhR pathway was measured by following the expression of the OVOL1 gene and of the FLG and DSG1 barrier function markers. OVOL1 is in fact known to be linked to the differentiation of keratinocytes (Tsuji, G. et al. Cell Death Dis. 8, e2931–e2931 (2017)) and filaggrin (FLG), as indicated above, is involved in skin differentiation and in the skin barrier function. DSG1 is one of the tight junction proteins involved in the cohesion of skin cells. Strains ATCC12228, I-5692, I-5688, I-5694, I-5695, I-5693, I-5691 and I-5904 induced a strong expression of OVOL1 compared with the untreated control. Strains ATCC12228, I- 5692, I-5688, I-5694, I-5695, I-5693, I-5691 and I-5904 are also the strains which secrete the greatest amount of indoles as defined above, which confirms the action of these indoles on the activation of the AhR pathway. [Table 2] Average mRNA expression level of the OVOL1 gene vs. GAPDH, a reference gene which is a constituent of NHEKs Conditions Average Control (untreated) NHEKs without bacteria 1 after 14 h of culture ATCC 12228 4.74 CNCM I-5688 3.567 CNCM I-5692 3.508 CNCM I-5694 4.194 CNCM I-5695 13.83 CNCM I-5693 8.017 CNCM I-5691 12.38 CNCM I-5904 2.53 Table 2 Strains I-5688 and I-5689 induced an FLG expression greater than the untreated control. [Table 3] Average mRNA expression level of the FLG gene vs. GAPDH, a reference gene which is a constituent of NHEKs Conditions Average Control (untreated) 1 CNCM I-5688 1.541 CNCM I-5689 1.243 Table 3 Strains I-5688 and I-5693 induced a DSG1 expression greater than the untreated control. [Table 4] Average mRNA expression level of the DSG1 gene vs. GAPDH, a reference gene which is a constituent of NHEKs Conditions Mean Control (untreated) 1 CNCM I-5688 1.395 CNCM I-5693 1.049 Table 4 Overall, strains ATCC12228, I-5688, I-5689, I-5691, I-5692, I-5693, I-5694 and I-5695 enhance the markers of the barrier function by AhR activation and indole secretion.
Claims 1. Isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I- 5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695. 2. Composition, particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I- 5691, I-5692, I-5693, I-5694 and I-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I- 5691, I-5904, I-5692, I-5693, I-5694 and I-5695. 3. Composition, particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium: - at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and/or a salt thereof, indole-3-carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and - at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof. 4. Composition according to Claim 3, wherein the bacterial strain of the species Staphylococcus epidermidis is capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and/or a salt thereof, (ii) indole-3-carboxaldehyde and/or a salt thereof, (iii) indole-3-acetic acid and/or a salt thereof and in addition (iv) tryptamine and/or a salt thereof. 5. Composition according to Claim 3 or 4, wherein the bacterial strain of the species Staphylococcus epidermidis is chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under accession numbers I- 5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers I-5688, I-5904, I-5691, I-5692, I- 5693, I-5694 and I-5695. 6. Composition according to any one of Claims 2 to 5, the composition being suitable for topical administration. 7. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing a reduction in and/or reinforcing the skin barrier function in an individual. 8. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for improving skin moisturization. 9. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for improving skin quality, in particular the quality of dry skin. 10. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin. 11. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing and/or treating pruritus, in particular pruritus of a skin affected by a dermatological disorder such as atopic dermatitis. 12. Composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for use thereof in the prevention and/or treatment of atopic dermatitis. 13. Cosmetic use according to any one of Claims 7 to 11, or composition for use thereof or bacterial strain for use thereof according to Claim 12, said composition, or said at least one bacterial strain, being suitable for topical administration. 14. Non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of at least one bacterial strain according to Claim 1 or of a composition according to any one of Claims 2 to 6.
Abstract Use of strains of Staphylococcus epidermidis producing indole metabolites for improving the skin barrier The present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695 and a composition comprising same. The invention also relates to the use of such a strain for preventing a reduction in and/or reinforcing the skin barrier function in an individual, for improving skin moisturization, for improving the quality of the skin, in particular the quality of dry skin, for preventing and/or treating cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin, and/or for preventing and/or treating pruritus, in particular pruritus of skin affected by a dermatological disorder such as atopic dermatitis and/or for preventing and/or treating atopic dermatitis and a non-therapeutic cosmetic method for caring for keratin materials comprising at least one step of topical application on said keratin materials of such a strain or composition. Figure for the abstract: None

Claims

Claims
1. Isolated live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers I-
5688. 1-5689, 1-5904, 1-5691, 1-5692, 1-5693, 1-5694 and 1-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers 1-5688, 1-5691, 1-5904, 1-5692, 1-5693, 1-5694 and 1-5695.
2. Composition, particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers 1-5688, 1-5689, 1-5904, 1-
5691. 1-5692, 1-5693, 1-5694 and 1-5695, and in particular chosen from the group constituted of bacteria deposited at the CNCM under the accession numbers 1-5688, 1-
5691. 1-5904, 1-5692, 1-5693, 1-5694 and 1-5695.
3. Composition, particularly cosmetic composition, in particular for caring for keratin materials, comprising, in a physiologically acceptable medium:
- at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole- 3 -lactic acid and/or a salt thereof, indole-3 -carboxaldehyde and/or a salt thereof and indole-3-acetic acid and/or a salt thereof; and
- at least one adjuvant chosen from the group constituted by fatty substances; organic solvents chosen from lower monoalcohols containing from 1 to 5 carbon atoms such as ethanol, isopropanol, tert-butanol; polyols such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (or 2-methyl-2,4-pentanediol) and polyethylene glycols; polyol ethers such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic, thickeners; softeners; opacifiers; stabilizers; silicones; antifoams; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and mixtures thereof.
4. Composition according to Claim 3, wherein the bacterial strain of the species Staphylococcus epidermidis is capable of producing a mixture of indoles comprising (i) indole-3 -lactic acid and/or a salt thereof, (ii) indole-3 -carboxaldehyde and/or a salt thereof, (iii) indole- 3 -acetic acid and/or a salt thereof and in addition (iv) tryptamine and/or a salt thereof. 5. Composition according to Claim 3 or 4, wherein the bacterial strain of the species Staphylococcus epidermidis is chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under accession numbers I-
5688. 1-5689, 1-5904, 1-5691, 1-5692, 1-5693, 1-5694 and 1-5695, in particular chosen from the group constituted of the reference bacterium ATCC 12228 and bacteria deposited at the CNCM under the accession numbers 1-5688, 1-5904, 1-5691, 1-5692, 1-
5693. 1-5694 and 1-5695.
6. Composition according to any one of Claims 2 to 5, the composition being suitable for topical administration.
7. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing a reduction in and/or reinforcing the skin barrier function in an individual.
8. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for improving skin moisturization.
9. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for improving skin quality, in particular the quality of dry skin.
10. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing and/or treating the cosmetic signs associated with dry skin, in particular chosen from tautness, itching, feelings of discomfort, a dull complexion, skin roughness and a marked microrelief of the skin.
11. Non-therapeutic cosmetic use, particularly topical non-therapeutic cosmetic use, of a composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for preventing and/or treating pruritus, in particular pruritus of a skin affected by a dermatological disorder such as atopic dermatitis.
12. Composition according to any one of Claims 2 to 6, or of at least one bacterial strain according to Claim 1, for use thereof in the prevention and/or treatment of atopic dermatitis.
13. Cosmetic use according to any one of Claims 7 to 11, or composition for use thereof or bacterial strain for use thereof according to Claim 12, said composition, or said at least one bacterial strain, being suitable for topical administration.
14. Non-therapeutic cosmetic method for caring for keratin materials, in particular the skin, notably dry skin, comprising the topical application to these keratin materials of at least one bacterial strain according to Claim 1 or of a composition according to any one of Claims 2 to 6.
EP23836813.8A 2022-12-21 2023-12-20 Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier Pending EP4637811A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2214152A FR3144162A1 (en) 2022-12-21 2022-12-21 Use of Staphylococcus epidermidis strains producing indole metabolites to improve the skin barrier
PCT/EP2023/087026 WO2024133506A1 (en) 2022-12-21 2023-12-20 Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier

Publications (1)

Publication Number Publication Date
EP4637811A1 true EP4637811A1 (en) 2025-10-29

Family

ID=86329184

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23836813.8A Pending EP4637811A1 (en) 2022-12-21 2023-12-20 Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier

Country Status (6)

Country Link
EP (1) EP4637811A1 (en)
JP (1) JP2026501198A (en)
KR (1) KR20250109230A (en)
CN (1) CN120435312A (en)
FR (1) FR3144162A1 (en)
WO (1) WO2024133506A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR3162988A1 (en) * 2024-06-05 2025-12-12 L'oreal Cosmetic use of an extract of at least one bacterium of the species Staphylococcus epidermidis as a healing agent
FR3163077A1 (en) * 2024-06-05 2025-12-12 L'oreal Method for preparing an extract of at least one bacterium of the species Staphylococcus epidermidis, and cosmetic applications of said extract to prevent and/or treat the signs of aging of keratinous materials
FR3162987A1 (en) * 2024-06-05 2025-12-12 L'oreal Cosmetic use of an extract of at least one bacterium of the species Staphylococcus epidermidis to prevent the reduction of and/or strengthen the skin barrier function

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112236153B (en) * 2018-04-05 2025-04-29 阿兹特拉公司 Methods and compositions for treating skin diseases using recombinant microorganisms
CN114350563A (en) * 2022-01-17 2022-04-15 廖梅香 Staphylococcus epidermidis for repairing skin barrier

Also Published As

Publication number Publication date
KR20250109230A (en) 2025-07-16
WO2024133506A1 (en) 2024-06-27
CN120435312A (en) 2025-08-05
JP2026501198A (en) 2026-01-14
FR3144162A1 (en) 2024-06-28

Similar Documents

Publication Publication Date Title
WO2024133506A1 (en) Use of strains of staphylococcus epidermidis producing indole metabolites for improving the skin barrier
JP5601765B2 (en) Method for cosmetic use of Bifidobacterium species lysate for treatment of drying
JP2008013564A (en) Use of at least one C-glycoside derivative as a sedative
BRPI0802524B1 (en) uses of at least one extract of bacteria vitreoscilla filiformis, composition and cosmetic process for treating sensitive skin, mucous membranes and / or scalp
HU218944B (en) Topical use of anorganic salts of stroncium (ii) for producing pharmaceutical compositions for treating neurogen skin rubefaction
WO2024133512A1 (en) Composition for caring for keratin materials, comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and an adjuvant, uses and process implementing the composition
JP2016074656A (en) External preparation for skin, and anti-wrinkle agent
TWM676928U (en) The structure of exosome-containing rejuvenating serum skincare products
KR20080003918A (en) Silicone Elastomer Peeling Composition
JP2002255827A (en) Skin care preparation
CN114746077A (en) Personal care compositions and methods for using the same
KR102713551B1 (en) Lipid nanoparticles loaded hyaluronic acid and composition comprising thereof
RU2299725C1 (en) Cosmetic agent for skin care
KR20220082832A (en) Novel cosmetic use of N-methylglycine to increase the diversity of skin microflora
CN111035582A (en) Jelly bath mud and preparation method thereof
EP4633627A1 (en) Cosmetic use of a composition for caring for keratin materials comprising at least indole-3-pyruvic acid
JP2000264832A (en) Skin cosmetics
KR102038366B1 (en) Cosmetic composition for improving acne skin
TW202610612A (en) Composition for relieving skin irritation caused by external irritants and/or retinol
CN120359028A (en) Cosmetic use of a composition for caring for keratin materials, comprising at least indole-3-acetamide
KR20240165966A (en) Hyperbranched dextrin for topical use in the prevention or treatment of at least one symptom of skin inflammation
FR3152983A1 (en) CITRUS EXTRACT and ITS USE AS A COSMETIC AGENT
EP4240320A1 (en) Association of a vichy thermal water and an extract of at least one bacterium from the species vitreoscilla filiformis cultured on a medium comprising at least one vichy thermal water
JP2002053463A (en) External preparation for skin
FR2989896A1 (en) ACTIVE ACHILLA ESSENTIAL OIL FOR THE PREVENTION AND / OR TREATMENT OF SKIN DISORDERS AND / OR CUTANEOUS IMPERFECTIONS

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250613

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)