Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
  • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7088—Compounds having three or more nucleosides or nucleotides
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P9/00—Drugs for disorders of the cardiovascular system
  • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/30—Special therapeutic applications

Definitions

• the present disclosure relates to therapeutic RNA, variants thereof, and treatment of muscle disorders and/or heart conditions and/or inflammatory conditions and/or fibrosis using same.
• An isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) is provided. Also provided are nucleic acids having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to that of SEQ ID NO: 1. Also provided are therapeutic uses of nucleic acids of the present disclosure to treat a muscle disorder, heart condition, or conditions associated inflammation and/or fibrosis.
• a method of treating a condition associated with inflammation and/or fibrosis comprising administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nucleotides (nt) long.
• a method of immunomodulation comprising contacting an effective amount of an isolated nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with a population of macrophages, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long.
• kits containing any of the isolated nucleic acid(s) of the present disclosure and a transfection reagent are also provided.
• FIGs. 1A-1D show the proposed mechanism of action of the immunomodulatory effect of the non-coding RNA, tREX-1, and initial characterization of tREX-1 in vitro bioactivity according to some non-limiting embodiments of the present disclosure, according to some non-limiting embodiments of the present disclosure.
• FIG. 1 A is a schematic diagram showing a 5’ tRNA half and known bioactivity.
• FIG. IB is a collection of schematic diagrams showing a proposed mechanism of action of tREX-1, according to some non-limiting embodiments of the present disclosure.
• FIG. 1C is a heat map diagram showing transcriptome-wide changes in cultured macrophage gene expression.
• FIG. ID is a plot showing cultured macrophage gene expression changes grouped by gene ontology.
• FIGs. 2A-2D show the disease-modifying bioactivity of tREX-1 in the heart in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 2A is a schematic diagram showing an experimental design.
• FIG. 2B is a plot showing change over time in ejection fraction as a measure of heart function.
• FIG. 2C is a collection of images showing Masson’s trichrome staining in the heart.
• FIG. 2D is a graph showing fibrosis in the heart.
• FIGs. 3A-3E show the disease-modifying bioactivity of tREX-1 in skeletal muscle, in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 3A is a schematic diagram showing an experimental design.
• FIG. 3B is a plot showing change over time in tetanic torque from baseline as a measure of skeletal muscle function.
• FIG. 3C is a collection of images showing Masson’s trichrome staining in skeletal muscle (tibialis anterior).
• FIG. 3D is a graph showing fibrosis in in skeletal muscle.
• FIG. 3E is a graph showing the number of myofibers in the tibialis anterior.
• FIG. 4 shows the effect of tREX-1 administration on serum inflammatory cytokine levels in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 5 shows the effect of oral tREX- 1 administration in a model of acute myocardial infarction (MI), according to some non-limiting embodiments of the present disclosure.
• FIG. 6 shows nucleotide sequences of tREX-1, tRNAs and a scrambled RNA for tREX-1, according to some non-limiting embodiments of the present disclosure.
• FIGs. 7A-7F show the discovery of tREX-1 from extracellular vesicles (EVs) secreted by cardio sphere-derived cells and initial characterization of tREX-1 in vitro bioactivity according to some non-limiting embodiments of the present disclosure.
• FIG 7A is a heat map diagram showing transcriptomic changes.
• FIG. 7B is a graph showing mapping of sequences to different RNA.
• FIG. 7C is a graph showing mapping of sequences to different tRNA.
• FIG. 7D is a sequence and a collection of graphs showing changes in gene expression levels in cultured macrophages.
• FIG. 7E is a plot showing cultured macrophage gene expression changes grouped by gene ontology.
• FIG. 7F is a plot showing cultured macrophage gene expression changes grouped by Kyoto Encyclopedia of Genes and Genomes.
• FIGs. 8A-8F show the disease-modifying bioactivity of tREX-1 in the heart and in skeletal muscle in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 8A is a schematic diagram showing an experimental design.
• FIG. 8B is a collection of graphs showing change over time in ejection fraction as a measure of heart function.
• FIG. 8C is a collection of graphs showing change over time in tetanic torque as a measure of skeletal muscle function.
• FIG. 8D is a collection of images and a graph showing myocardial fibrosis.
• FIG. 8E is a collection of images and a graph showing muscle fibrosis.
• FIG. 8F is a graph showing the number of myofibers in the tibialis anterior.
• FIG. 9 shows uptake of tREX-1 by cultured macrophages, according to some non-limiting embodiments of the present disclosure.
• FIG. 10 shows identified tREX-1 protein binding partners, according to some non-limiting embodiments of the present disclosure.
• FIG. 11 shows the effects of tREX-1 on cardiac macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 12 shows the effects of tREX-1 on skeletal muscle macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• FIG. 13 shows that tREX-1 bioactivity is dependent on macrophages in a model of muscular dystrophy, according to some non-limiting embodiments of the present disclosure.
• nucleic acids that include the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), and methods of using the same for treatment of a condition associated with inflammation and/or fibrosis.
• the nucleic acids of the present disclosure are generally no more than 60 nucleotides (nt) long.
• nucleic acid or “oligonucleotide” refers to multiple nucleotides (e.g., molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)).
• a substituted pyrimidine e.g. cytosine (C), thymidine (T) or uracil (U)
• a substituted purine e.g. adenine (A) or guanine (G)
• the term includes polynuclcosidcs (i.c.
• nucleic acid can include any other suitable modifications.
• nucleic acid also encompasses nucleic acids with substitutions or modifications, such as in the bases and/or sugars.
• Polypeptide or nucleic acid molecules of the present disclosure may share a certain degree of sequence similarity or identity with the reference molecules (e.g., reference polypeptides or reference polynucleotides), for example, with art-described molecules (e.g., engineered or designed molecules or wild-type molecules).
• identity refers to a relationship between the sequences of two or more polypeptides or polynucleotides, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between them as determined by the number of matches between strings of two or more amino acid residues or nucleic acid residues.
• Identity measures the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related peptides can be readily calculated by known methods. “% identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid residues or nucleic acid residues) in the candidate amino acid or nucleic acid sequence that are identical with the residues in the amino acid sequence or nucleic acid sequence of a second sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Any suitable methods and computer programs for the alignment can be used.
• variants of a particular polynucleotide or polypeptide have at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular reference polynucleotide or polypeptide as determined by sequence alignment programs and parameters described herein and known to those skilled in the art.
• tools for alignment include those of the BLAST suite (Stephen F.
• FGSAA Fast Optimal Global Sequence Alignment Algorithm
• identity refers to the overall relatedness between polymeric molecules, for example, between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of the percent identity of two polynucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
• the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
• the nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
• the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
• the comparison of sequences and determination of percent identity between two sequences can be accomplished using a suitable mathematical algorithm.
• the percent identity between two nucleic acid sequences can be determined using methods such as those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects. Smith. D. W., cd., Academic Press. New York, 1993; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; and Sequence Analysis Primer, Gribskov, M.
• the percent identity between two nucleic acid sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4:11-17), which has been incorporated into the ALIGN program (version 2.0) using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
• the percent identity between two nucleic acid sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.
• Methods commonly employed to determine percent identity between sequences include, but are not limited to those disclosed in Carillo, H., and Lipman, D., SIAM J Applied Math., 48: 1073 (1988); incorporated herein by reference. Techniques for determining identity are codified in publicly available computer programs. Exemplary computer software to determine homology between two sequences include, but are not limited to, GCG program package, Devereux, J., et al., Nucleic Acids Research, 12(1), 387 (1984)), BLASTP, BLASTN, and FASTA Altschul, S. F. et al., J. Molec. Biol., 215, 403 (1990)).
• base-pairing refers to the formation of hydrogen bonds between specific pairs of nucleotide bases (“complementary base pairs”). For example, two hydrogen bonds form between adenine (A) and uracil (U), and three hydrogen bonds form between guanine (G) and cytosine (C).
• A adenine
• U uracil
• C guanine
• One method of assessing the strength of bonding between two polynucleotides is by quantifying the percentage of bonds formed between the guanine and cytosine bases of the two polynucleotides (“GC content”).
• the GC content of bonding between two nucleic acids of a multimeric molecule is at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%. In some embodiments, the GC content of bonding between two nucleic acids of a multimeric molecule (e.g., a multimeric mRNA molecule) is between 10% and 70%, about 20% to about 60%, or about 30% to about 60%.
• hybridization The formation of a nucleic acid duplex via bonding of complementary base pairs can also be referred to as “hybridization”.
• a region of complementarity can vary in size. In some embodiments, a region of complementarity ranges in length from about 2 base pairs to about 100 base pairs. In some embodiments, a region of complementarity ranges in length from about 5 base pairs to about 75 base pairs. In some embodiments, a region of complementarity ranges in length from about 10 base pairs to about 50 base pairs. In some embodiments, a region of complementarity ranges in length from about 20 base pairs to about 30 base pairs.
• isolated as used herein with reference to an isolated biomolecule, e.g., a nucleic acid, has the ordinary and customary meaning to one of ordinary skill in the art in view of the present disclosure.
• An isolated biomolecule e.g., an isolated nucleic acid, is generally in a non-natural environment, or in an environment that the biomolecule would otherwise not have been without human intervention of the biomolecule or its environment.
• an isolated biomolecule is not inside a cell or an organism.
• Extracellular vesicle or “EV” as used herein have their ordinary and customary meaning as understood by one of ordinary skill in the art, in view of the present disclosure.
• EVs include lipid bilayer structures generated by cells, and include exosomes, microvesicles, epididimosomes, argosomes, exosome-like vesicles, microparticles, promininosomes, prostasomes, dexosomes, texosomes, dex, tex, archeosomes and oncosomes.
• Casein micelles are colloidal particles that can include aggregates of one or more casein phosphoproteins (e.g., one or more, two or more, three or more, or all four of alpha si casein, alpha s2 casein, beta casein, and kappa casein).
• casein phosphoproteins e.g., one or more, two or more, three or more, or all four of alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• “Micelle” as used herein with reference to lipid micelles has its customary and ordinary meaning as understood by one of ordinary skill in the art, in view of the present disclosure.
• Subject refers to any vertebrate animal, including mammals and non-mammals.
• a subject can include primates, including humans, and nonprimate mammals, such as rodents, domestic animals or game animals.
• Non-primate mammals can include mouse, rat, hamster, rabbit, dog, fox, wolf, cat, horse, cow, pig, sheep, goat, camel, deer, buffalo, bison, etc.
• Non-mammals can include bird (e.g., chicken, ostrich, emu, pigeon), reptile (e.g., snake, lizard, turtle), amphibian (e.g., frog, salamander), fish (e.g., salmon, cod, pufferfish, tuna), etc.
• bird e.g., chicken, ostrich, emu, pigeon
• reptile e.g., snake, lizard, turtle
• amphibian e.g., frog, salamander
• fish e.g., salmon, cod, pufferfish, tuna
• the terms, “individual,” “patient,” and “subject” are used interchangeably herein.
• administering can include any suitable routes of administering a therapeutic agent or composition as disclosed herein. Suitable routes of administration include, without limitation, oral, parenteral, intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, cutaneous, injection or topical administration. Administration can be local or systemic.
• treat and “treatment” includes curing, improving, ameliorating, reducing the severity of, preventing, slowing the progression of, and/or delaying the appearance of a disease, condition and/or symptoms thereof.
• a treatment can be considered “effective,” or “therapeutically effective” as used herein, if one or more of the signs or symptoms of a condition described herein are altered in a beneficial manner, other clinically accepted symptoms are improved, or even ameliorated, or a desired response or outcome is induced e.g., by at least 2%, 3%. 4%, 5%, 10%, or more, following treatment according to the methods described herein. Efficacy can be assessed, for example, by measuring a marker, indicator, symptom, and/or the incidence of a condition treated according to the methods described herein or any other measurable parameter appropriate, e.g. exercise endurance.
• Efficacy can also be measured by a failure of an individual to worsen as assessed by hospitalization, or need for medical interventions (e.g., progression of the disease is halted).
• Treatment includes any treatment of a disease or condition in an individual or an animal (some non-limiting examples include a human or an animal) and includes: (1) inhibiting the disease or condition, e.g., preventing a worsening of symptoms (e.g. pain or inflammation); or (2) relieving the severity of the disease or condition, e.g.. causing regression of symptoms.
• An effective amount for the treatment of a disease or condition means that amount which, when administered to a subject in need thereof, is sufficient to result in effective treatment as that term is defined herein, for that disease or condition.
• Efficacy of an agent can be determined by assessing physical indicators of a condition or desired response or outcome, (e.g. muscle function, mass, or volume, such as heart function, mass, or volume). One skilled in the art can monitor efficacy of administration and/or treatment by measuring any one of such parameters, or any combination of parameters.
• the term “effective amount” or “therapeutically effective amount” as used herein refers to the amount of a composition or an agent needed to alleviate at least one or more symptom of the disease or condition, and relates to a sufficient amount of therapeutic composition to provide the desired effect.
• an effective amount can refer to an amount of a composition or therapeutic agent that is sufficient to provide a particular anti-inflammatory, anti-fibrotic, immunomodulatory, myoprotective and/or cardioprotective effect when administered to a typical subject.
• An effective amount as used herein, in various contexts, can include an amount sufficient to delay the development of a symptom of the disease or condition, alter the course of a symptom disease or condition (for example but not limited to, slowing the progression of a symptom of the disease or condition), or reverse a symptom of the disease or condition.
• the therapeutically effective amount is administered in one or more doses of the therapeutic agent.
• the therapeutically effective amount is administered in a single administration, or over a period of time in a plurality of doses.
• physiologically compatible and “pharmaceutically acceptable” are employed interchangeably herein to refer to those compounds, materials, compositions, and/or dosage forms which arc. within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
• nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a variant thereof.
• the nucleic acid is RNA.
• nucleic acid includes a nucleotide sequence at least 80%, 85%, 90%, 92%, 93%, 94%, 95%, 96%, 98%. 99% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
• the nucleic acid includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1) with a sequence variation at up to 1, 2, 3, 4, or 5 positions in the nucleotide sequence.
• a “position” within a nucleotide sequence or nucleic acid is defined relative to the 5’ end of the nucleotide sequence or nucleic acid.
• the nucleotide sequence of the nucleic acid is UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), or a sequence variant thereof.
• the nucleic acid has the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
• tREX-1 refers to an RNA having the sequence UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
• the nucleic acid can be any suitable length. In some embodiments, the nucleic acid is or is about 32 nucleotides (nt) long. In some embodiments, the nucleic acid is 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38. 39, 40. 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52. 53, 54.
• the nucleic acid is at most 60 nt long. In some embodiments, the nucleic acid is at most 40 nt long. In some embodiments, the nucleic acid is 20-35 nt long, or 30-35 nt long. In some embodiments, the nucleic acid consists of, or consists essentially of the nucleotide sequence: UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
• the nucleic acid is derived from a human tRNA.
• the nucleic acid is a 5’ fragment of a human tRNA.
• a “5’ fragment” of a reference nucleic acid refers to a polynucleotide that includes at least the 5’ end of the reference nucleic acid, and may be truncated relative to the reference nucleic acid at the 3’ end.
• a 5’ fragment of a human tRNA includes a 5’ half of the (full length) human tRNA.
• the human tRNA is selected from TRE-CTC1- 7, TRE-CTC1-1, and TRE-CTC2-1.
• TRE-CTC1-7 (corresponding to Gene ID: 100189269)
• TRE-CTC1-1 (corresponding to Gene ID: 100189384)
• TRE-CTC2-1 (corresponding to Gene ID: 100189409) each has a sequence as shown in FIG. 6.
• a nucleic acid of the present disclosure can be single stranded or double stranded (e.g., RNA/DNA hybrid). In some embodiments, the nucleic acid is single stranded.
• An isolated nucleic acid of the present disclosure in some embodiments includes one or more chemically-modified nucleotides, e.g., nucleotides with a modified backbone.
• the chemical modification(s) is one that substantially preserves or enhances the therapeutic potency of the nucleic acid. Any suitable number of nucleotides of the nucleic acid can be chemically modified.
• the nucleic acid includes 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more, 18 or more, 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 26 or more, 27 or more, 28 or more, 29 or more, 30 or more chemically-modified nucleotides.
• the nucleic acid includes 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1- 15, 1-20, 1-25, or 1-30 chemically-modified nucleotides.
• the nucleic acid includes 1-10 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 8 chemically-modified nucleotides. In some embodiments, the nucleic acid includes 6 chemically-modified nucleotides.
• the chemically modified nucleotides can be distributed along the isolated nucleic acid in any suitable manner.
• the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid.
• the nucleic acid includes at least one chemically- modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid.
• the nucleic acid includes at least one chemically-modified nucleotide within the first half of the nucleic acid, e.g., the 5’ half of the nucleic acid, and at least one chemically-modified nucleotide within the second half of the nucleic acid, e.g., the 3’ half of the nucleic acid.
• the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 5’ end of the nucleic acid.
• the nucleic acid includes one or more chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides from the 3’ end of the nucleic acid. In some embodiments, no two chemically-modified nucleotides are adjacent each other in the nucleic acid. In some embodiments, the nucleic acid includes 1 , 1, 2, 2, 3, 3, 4, 4, 5, 5 chcmically-modificd nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 5’ end of the nucleic acid.
• the nucleic acid includes 1, 1, 2, 2, 3, 3, 4, 4, 5, 5 chemically-modified nucleotides within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 nucleotides, respectively, from the 3’ end of the nucleic acid.
• the nucleic acid includes the same number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleic acid.
• the nucleic acid includes a different number of chemically-modified nucleotides in the 5’ half and 3 ’half of the nucleic acid.
• the nucleic acid includes a greater number of chemically-modified nucleotides in the 3’ half than in the 5 ’half of the nucleic acid.
• the nucleic acid includes a greater number of chemically-modified nucleotides in the 5’ half than in the 3 ’half of the nucleic acid. In some embodiments, the nucleic acid includes 3 chemically- modified nucleotides within 5 nucleotides from the 5’ end of the nucleic acid and/or 3 chemically-modified nucleotides within 5 nucleotides from the 3’ end of the nucleic acid.
• the chemically-modified nucleotide(s) increases in vitro and/or in vivo stability of the nucleic acid. In some embodiments, the chemically- modified nucleotide(s) increases therapeutic potency of the nucleic acid, e.g., for treating an inflammatory condition, cardiac injury, or muscular dystrophy.
• the isolated nucleic acid in some embodiments includes one type, or two or more different types of chemically-modified nucleotides.
• the chemically-modified nucleotide has a methylene bridge connecting the 2’-0 atom and the 4’- C atom of the nucleotide sugar ring to lock the conformation (Locked Nucleic Acid (LNA)).
• LNA Locked Nucleic Acid
• the isolated nucleic acid in some embodiments, can include any suitable chemical modification.
• the chemical modification is a backbone modification, e.g., modification of the sugar/phosphate backbone.
• the chemical modification is a backbone sugar modification.
• the chemically modified nucleotide includes a LNA.
• the chemical modification includes the introduction of a phosphorothioate group as linker between nucleotides.
• Suitable backbone modifications of the chemically-modified nucleotides include, without limitation, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages.
• the chemical modification is a base modification.
• the nucleic acids of the present disclosure can be prepared using any suitable option. Suitable options include, without limitation, chemical synthesis, enzymatic production and/or biological production. In some embodiments, the nucleic acids are prepared using chemical synthesis. Any suitable option for chemical synthesis of nucleic acids can be used. Suitable options include, without limitation, phosphodiester, phosphotriester, phosphoramidite, phosphite-triester, and solid phase synthesis approaches. In some embodiments, preparing the nucleic acids includes in vitro transcription. In some embodiments, the nucleic acids are prepared using recombinant DNA technology. In some embodiments, the nucleic acids are prepared by chemically modifying an unmodified nucleic acid having a nucleotide sequence of interest.
• compositions that include the nucleic acid of the present disclosure.
• the composition is a pharmaceutical or therapeutic composition.
• the composition includes a therapeutically effective amount of the nucleic acid.
• the therapeutically effective amount of the nucleic acid is an amount that, when administered to a subject, can bring about a desired outcome in the subject in need of treatment of a condition or disease (e.g., a condition associated with inflammation and/or fibrosis, a muscle disorder or symptom thereof, etc.) as described herein.
• the therapeutically effective amount of the nucleic acid is sufficient on its own to bring about the desired outcome (e.g., without administering another therapeutic agent for the same condition or disease).
• the composition contains a nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA, where the tRNA is selected from the group consisting of: TRE- CTC1-7, TRE-CTC1-1, and TRE-CTC2-1.
• the composition does not include another nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA (e.g., does not include a nucleotide sequence of a 5’ fragment of a tRNA other than TRE-CTC1-7).
• the composition does not include another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is derived from at least one of: TRG-GCC1 -2 (corresponding to Gene ID: 100189252), TRG-GCC4-1 (corresponding to Gene ID: 100189274).
• the composition docs not include another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is the 5’ fragment of TRG-GCC1-2 or TRG-GCC4-1.
• the composition includes a pharmaceutically acceptable excipient.
• the composition consists of, or consists essentially of the therapeutically effective amount of the isolated nucleic acid and the pharmaceutically acceptable excipient.
• the composition is a cell-free composition, e.g., the composition is substantially free of cells such as CDC.
• the composition is an extracellular vesicle-free composition, e.g., the composition is substantially free of extracellular vesicles, such as exosomes.
• Some non-limiting examples of materials which can serve as pharmaceutically-acceptable excipients include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as
• the composition includes a transfection reagent, e.g., to promote delivery of the nucleic acid to a target cellular target (in vitro or in vivo).
• a transfection reagent e.g., to promote delivery of the nucleic acid to a target cellular target (in vitro or in vivo).
• Any suitable transfection reagent can be included in the composition.
• Suitable transfection reagents include, without limitation, a liposome, extracellular vesicle (EV), and a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
• the transfection reagent includes a lipid (e.g., a liposome-forming lipid), or a PEGylatcd lipid.
• the lipid is a cationic lipid, as provided herein.
• the transfection reagent includes DharmaFECT® or Lipofectamine®.
• the nucleic acid of the present disclosure is formulated with the transfection reagent in the composition so as to promote cellular uptake and/or pharmacokinetics of the nucleic acid.
• Liposomes are artificially-prepared vesicles which may primarily be composed of a lipid bilayer and may be used as a delivery vehicle for the administration of pharmaceutical formulations.
• Liposomes can be of different sizes such as, but not limited to, a multilamellar vesicle (MLV), which may be hundreds of nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments, a small unicellular vesicle (SUV), which may be smaller than 50 nm in diameter, and a large unilamellar vesicle (LUV), which may be between 50 and 500 nm in diameter.
• MLV multilamellar vesicle
• SUV small unicellular vesicle
• LUV large unilamellar vesicle
• Liposome design may include, without limitation, opsonins or ligands in order to improve the attachment of liposomes to target tissue/cells, or to activate events such as, but not limited to, endocytosis.
• Liposomes may contain a low or a high pH in order to improve the delivery of the cargo, e.g., a nucleic acid of the present disclosure.
• the composition includes, without limitation, liposomes such as those formed from l,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Wash.), l,2-dilinoleyloxy-3- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]- dioxolane (DLin-KC2-DMA), and MC3 and liposomes such as, but not limited to, DOXIL® from Janssen Biotech, Inc. (Horsham, Pa.).
• DOXIL® from Janssen Biotech, Inc.
• the composition includes a cationic lipid.
• Any suitable cationic lipid may be used in the present compositions. Suitable cationic lipids include, without limitation, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA and amino alcohol lipids.
• the composition includes a cationic lipid complex, e.g., a polyethylene glycol (PEG)-cationic lipid complex (PCLC).
• the cationic lipid is PEGylated, e.g., 2 kDa PEG (“PEG2000”). Any suitable option can be used to PEGylate the cationic lipid.
• PCLC is formed by exposing a mixture of PEG and the cationic lipid to one or more freeze/thaw cycles, e.g., 1, 2, 3, 4, 5 or more freeze/thaw cycles.
• a freeze/thaw cycle includes freezing the mixture with liquid nitrogen (e.g., around -190 °C) for about 5 minutes, and thawing at about 60 °C for about 5 minutes.
• a nucleic acid of the present disclosure can be mixed with the PCLC to generate a complex of the nucleic acid and the PCLC.
• the composition includes extracellular vesicles (EV), e.g., exosomes.
• the extracellular vesicles (EV) can be those from any suitable source, e.g., EV derived from cardiosphere-derived cells (CDC), or from fibroblasts.
• Suitable EV, such as CDC-derived EV are provided in, e.g., U.S. Application Publication Nos. 20080267921, 20160158291 and 20160160181; Smith et al., Circulation. 2007. 115:896-908; Aminzadeh, M. A. et al. Stem Cell Reports 10, 942-955 (2016); and (2004) et al., Stem Cell Reports.
• the EVs are those isolated from serum-free media conditioned by human CDCs in culture.
• the composition includes EV and liposomes and/or PCLC as transfection reagents.
• the composition is substantially free of CDC-derived EV.
• EVs e.g., exosomes, disclosed herein can vary in size, depending on the embodiment. Depending on the embodiment, the size of the EVs ranges in diameter from about 15 nm to about 95 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 95 nm, and overlapping ranges thereof.
• EVs are larger (e.g., those ranging from about 140 to about 210 nm, including about 140 nm to about 150 nm, about 150 nm to about 160 run, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, 190 nm to about 200 nm, about 200 nm to about 210 nm, and overlapping ranges thereof).
• the EV diameter is in a range of about 15 nm to about 200 nm in diameter, including about 15 nm to about 20 nm, about 20 nm to about 30 nm, about 30 nm to about 40 nm, about 40 nm to about 50 nm, about 50 nm to about 60 nm, about 60 nm to about 70 nm, about 70 nm to about 80 nm, about 80 nm to about 90 nm, about 90 nm to about 100 nm, about 100 nm to about 110 nm, about 110 nm to about 120 nm, about 120 nm to about 130 nm, about 130 nm to about 140 nm, about 140 nm to about 150 nm, about 150 nm to about 160 nm, about 160 nm to about 170 nm, about 170 nm to about 180 nm, about 180 nm to about 190 nm, about 190 nm, about 190
• the EVs that arc generated from the original cellular body are 100, 200, 300. 400, 500, 600, 700. 800, 900, 1,000, 2,000. 5,000, or 10,000 times smaller in at least one dimension (e.g., diameter) than the original cellular body.
• the composition containing the EV and nucleic acid of the present disclosure can be prepared using any suitable option.
• loading the nucleic acid into the EV includes: formulating the nucleic acid with liposomes and/or PCLC, e.g.. as provided above, to generate a nucleic acid-liposome mixture; combining the nucleic acid-liposome mixture with the EV; and enriching for EV associated with exosome markers to generate a population of EV enriched for the nucleic acid.
• Combining the nucleic acidliposome mixture with the EV can be done using any suitable option.
• the nucleic acid-liposome mixture is combined with the EV at 37 °C with shaking for about 30 minutes or more.
• Enriching to generate a population of EV enriched for the nucleic acid can be done using any suitable option.
• enriching for EV associated with exosome markers includes immunoprecipitating EV associated with exosome markers using antibodies specific to an exosome marker.
• the exosome marker is one or more of CD9, CD63 and CD81.
• enriching for EV associated with exosome markers includes immunoprecipitating EV associated with all the exosome markers, CD9, CD63 and CD81.
• the size distribution of the population of EV enriched for the nucleic acid is substantially unimodal.
• the population of EV enriched for the nucleic acid has an average diameter of about 50-180 nm, e.g., 60-170 nm, 70-160 nm, 80-150 nm, 90-140 nm, 100-130 nm, or about 110-130 nm.
• the composition includes casein, e.g., a casein micelle. In some embodiments, the composition includes chitosan. In some embodiments, the composition includes casein and chitosan, e.g., a casein-chitosan micelle. In some embodiments, the composition includes a casein-chitosan complex. In some embodiments, the isolated nucleic acid in the composition is encapsulated in a casein-chitosan complex. In some embodiments, the composition includes one or more of phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• the composition includes two or more, three or more, or all four phosphoproteins: alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• the phosphoprotcins may be present in the composition at any suitable concentration (relative to each other, and relative to the total volume of the composition), and in some embodiments, is present in an amount suitable for forming casein micelles.
• the casein phosphoproteins are collectively present in the composition at about 5-10 % (weight by volume). In some embodiments, the casein phosphoproteins are collectively present in the composition at about 8 % (weight by volume).
• the casein phosphoproteins are collectively present in the composition at about 5 % (weight by volume).
• the casein phosphoproteins can be those from any suitable animal, e.g., mammal such as, but not limited to, human, non-human primate, cow, pig, horse, camel, goat, and sheep.
• the casein phosphoproteins are bovine alpha si casein, alpha s2 casein, beta casein, and kappa casein.
• Suitable casein formulations with EV are provided in, e.g., Aminzadeh et al., J Extracell Vesicles. 2021 Jan;10(3):el2045, the entirety of which is incorporated herein by reference.
• a composition e.g., pharmaceutical composition, of the present disclosure formulated with casein, as provided herein, is suitable for oral administration to the subject.
• suitable oral formulations for the nucleic acids of the present disclosure are provided in, e.g., International Application Nos. PCT/US2022/035866 (filed June 30, 2022) and PCT/US2022/035870 (filed June 30, 2022), each of which is incorporated herein by reference in its entirety.
• an oral formulation of the present disclosure includes any one or more nucleic acids described herein; a cationic lipid; at least one casein protein; and a chitosan.
• the oral formulation includes an isolated nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1); a cationic lipid; at least one casein protein; and a chitosan.
• an oral formulation includes an artificial lipid micelle or a liposome; any one or more nucleic acids described herein, wherein the one or more nucleic acids is encapsulated within the artificial lipid micelle or the liposome; and a coating on the artificial lipid micelle or the liposome, wherein the coating comprises a mixture of casein proteins and chitosan polymers.
• an oral formulation includes an artificial lipid micelle or a liposome; an isolated nucleic acid that includes a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is encapsulated within the artificial lipid micelle or the liposome; and a coating on the artificial lipid micelle or the liposome, wherein the coating comprises a mixture of casein proteins and chitosan polymers.
• the artificial lipid micelle includes a cationic lipid micelle.
• the liposome includes cationic lipids.
• the liposome includes DharmaFECT® or Lipofectamine® .
• the composition is in a parenteral dosage form.
• the parenteral dosage form is sterile or capable of being sterilized before administering to a patient.
• parenteral dosage forms include, but are not limited to, solutions ready for injection, dry products ready to be dissolved or suspended in a pharmaceutically acceptable vehicle for injection, suspensions ready for injection, and emulsions.
• controlled-release parenteral dosage forms can be prepared for administration to a subject.
• Suitable excipients that can be used to provide parenteral dosage forms of the nucleic acid include, without limitation: sterile water; water for injection USP; saline solution; glucose solution; aqueous vehicles such as but not limited to, sodium chloride injection, Ringer's injection, dextrose Injection, dextrose and sodium chloride injection, and lactated Ringer's injection; water-miscible vehicles such as, but not limited to, ethyl alcohol, polyethylene glycol, and propylene glycol; and non-aqueous vehicles such as, but not limited to, corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.
• the composition includes an antisense oligonucleotide, such as those targeting one or more exons of a dystrophin transcript.
• the composition includes an antisense oligonucleotide that includes an exonskipping agent that targets a dystrophin transcript.
• Conditions that may be treated by the treatment methods include, without limitation, muscle disorders, heart conditions, fibrotic conditions, and inflammatory conditions.
• the conditions include, without limitation, muscular- disorders, myocardial infarction, cardiac disorders, myocardial alterations, muscular dystrophy, fibrotic disease, inflammatory disease, viral infection, sepsis or wound healing.
• the conditions include acute myocardial infarction.
• conditions treated by the treatment methods include, without limitation, conditions associated with inflammation and/or fibrosis.
• a subject treated by administering the nucleic acids of the present disclosure, according to the treatment methods herein are in need of treatment for conditions associated with inflammation and/or fibrosis.
• the conditions associated with inflammation and/or fibrosis can include, without limitation, inflammation and/or fibrosis of the heart or skeletal muscle.
• the conditions treated by the present treatment methods are a symptom and/or sequelae of an infection.
• the infection is a viral infection, e.g., a respiratory virus infection, such as COVID-19, infections due to other coronaviruses, or other viral pathogens (e.g., flu, H1N1. Hepatitis C. HIV, etc.).
• the method includes identifying a subject having or diagnosed with a muscle disorder, heart condition, or inflammatory condition, as described herein, and administering a therapeutically effective amount of the nucleic acids of the present disclosure to the subject.
• a treatment method of the present disclosure can include administering to a subject in need of treatment a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein) to thereby treat the subject.
• a method of treating a muscle disorder or symptom thereof includes administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), thereby treating the muscle disorder or symptom thereof.
• the muscle disorder comprises a skeletal muscle disorder and/or a heart condition.
• the muscle disorder comprises muscular dystrophy (e.g., Duchenne muscular dystrophy).
• a method of treating muscular dystrophy further includes administering a second therapy (e.g., an exon-skipping agent and/or gene therapy) for the muscle disorder.
• a second therapy e.g., an exon-skipping agent and/or gene therapy
• an exon-skipping agent includes an antisense oligonucleotide that targets a dystrophin transcript.
• the heart condition includes myocardial infarction, heart failure, or a symptom or sequelae thereof (e.g., reduced heart function, cardiac tissue fibrosis, etc.).
• the heart condition includes acute myocardial infarction.
• heart function includes left ventricle function, which can be represented by any suitable option such as, without limitation, ejection fraction.
• the method includes identifying a subject having or diagnosed with a muscle disorder or symptom thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• the method includes identifying a subject having or diagnosed with muscular dystrophy (e.g., Duchenne muscular dystrophy) or a symptom thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• muscular dystrophy e.g., Duchenne muscular dystrophy
• the method includes identifying a subject having or diagnosed with heart failure, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject. In some embodiments, the method includes identifying a subject who is at risk of, or has suffered myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• the method includes identifying a subject who is at risk of, or has suffered acute myocardial infarction, or a symptom or sequelae thereof, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• a method of treating a condition associated with inflammation and/or fibrosis includes administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), thereby treating the condition associated with inflammation and/or fibrosis.
• the condition associated with inflammation and/or fibrosis comprises inflammation and/or fibrosis of the heart or skeletal muscle, or a symptom and/or sequelae of myocardial infarction, heart failure or muscular dystrophy, or a symptom or sequelae of an infectious disease (e.g., a viral infection) or is associated with immunotherapy, or a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.
• the condition associated with inflammation and/or fibrosis comprises inflammation and/or fibrosis of the heart.
• the condition associated with inflammation and/or fibrosis comprises inflammation and/or fibrosis of skeletal muscle.
• the condition associated with inflammation and/or fibrosis comprises a symptom and/or sequelae of myocardial infarction or heart failure (c.g., reduced heart function, cardiac tissue fibrosis, etc.).
• the condition associated with inflammation and/or fibrosis comprises a symptom and/or sequelae of muscular dystrophy (e.g., reduced muscle function, tissue fibrosis, etc.).
• the method includes identifying a subject having or diagnosed with inflammation and/or fibrosis of the heart, as described herein, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• the subject is a subject who has or has suffered heart failure. In some embodiments, the subject is a subject who has or has suffered myocardial infarction. In some embodiments, the subject is a subject who has or has suffered acute myocardial infarction. In some embodiments, the subject is at risk of having heart failure and/or myocardial infarction (e.g., acute myocardial infarction). In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject prevents reduction in ejection fraction due to heart failure.
• administering the therapeutically effective amount of the nucleic acid to the subject prevents reduction in ejection fraction after myocardial infarction (e.g., acute myocardial infarction).
• myocardial infarction e.g., acute myocardial infarction
• the subject’s ejection fraction does not substantively decrease due to heart failure or myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject.
• the subject’s ejection fraction does not substantively decrease due to acute myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject.
• the subject’s ejection fraction does not decrease, or decreases by, by about, or by at most 1, 2, 3, 4, 5%, or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to heart failure or myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject.
• the subject’s ejection fraction does not decrease, or decreases by, by about, or by at most 1, 2, 3, 4, 5%, or by a percentage in a range defined by any two of the preceding values (e.g., 0-5%, 0-3%, 1-4%, etc.) due to acute myocardial infarction after administering the therapeutically effective amount of the nucleic acid to the subject.
• the subject’s ejection fraction increases after administering the therapeutically effective amount of the nucleic acid to the subject, where the subject has suffered heart failure and/or myocardial infarction.
• the subject’s ejection fraction increases after administering the therapeutically effective amount of the nucleic acid to the subject, where the subject has suffered acute myocardial infarction. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces myocardial fibrosis due to heart failure and/or myocardial infarction. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject reduces myocardial fibrosis due to acute myocardial infarction.
• the subject has or is predisposed to having muscular dystrophy, e.g., Duchenne muscular dystrophy.
• the subject is genetically predisposed to having muscular dystrophy, e.g., Duchenne muscular dystrophy.
• the method includes identifying a subject who is predisposed to having muscular dystrophy, and administering a therapeutically effective amount of the nucleic acid of the present disclosure to the subject.
• the subject has one or more mutations in a dystrophin gene that predisposes the subject to developing muscular dystrophy, e.g., Duchenne muscular dystrophy.
• administering the therapeutically effective amount of the nucleic acid to the subject prevents or attenuates the reduction in skeletal muscle function e.g., the force or torque exerted by a skeletal muscle group, due to muscular dystrophy. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject suffering from muscular dystrophy increases or restores skeletal muscle function e.g., the force or torque exerted by an affected skeletal muscle group.
• administering the therapeutically effective amount of the nucleic acid to the subject suffering from muscular dystrophy increases the force or torque exerted by an affected skeletal muscle group by, by about, or by at least 5, 7, 10, 12, 15, 17, 20%, or by a percentage defined by any two of the preceding values (e.g., 5-20%, 5-15%, 7- 17%, etc.), compared to before administering.
• administering the therapeutically effective amount of the nucleic acid to the subject reduces skeletal muscle fibrosis due to muscular dystrophy.
• administering the therapeutically effective amount of the nucleic acid to the subject reduces the percentage of skeletal muscle fibrosis due to muscular dystrophy by, by about, or by at least 2, 5, 7, 10, 12, or 15 percentage points, or by a percentage point in a range defined by any two of the preceding values (e.g., 2- 15%, 5-15%, 10-12%, 7-15%, etc.) compared to a suitable reference (e.g., an average percentage of skeletal muscle fibrosis due to muscular dystrophy in a subject who does not receive the therapeutically effective amount of the nucleic acid).
• administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases myofiber number in skeletal muscle.
• administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases myofiber number in skeletal muscle by, by about, or by at least 5, 10, 12, 15, 18, 20, 25%, or by a percentage in a range defined by any two of the preceding values (e.g., 5-25%, 10-20%, 12018%, 10-15%, etc.) compared to before the administering.
• administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases skeletal muscle mass or volume.
• administering the therapeutically effective amount of the nucleic acid to the subject having muscular dystrophy increases skeletal muscle mass or volume by, by about, or by at least 5, 10, 12, 15, 18, 20, 25%, or by a percentage in a range defined by any two of the preceding values (e.g.. 5-25%, 10-20%. 12018%, 10-15%, etc.) compared to before the administering.
• administering the therapeutically effective amount of the nucleic acid to the subject alters the composition of macrophage subtypes in a muscle tissue, e.g., in skeletal muscle or cardiac muscle.
• administering the therapeutically effective amount of the nucleic acid to the subject increases the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., skeletal muscle, compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.).
• administering the therapeutically effective amount of the nucleic acid to the subject increases the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., skeletal muscle, by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4. 4.5, 5 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 1.1-5 fold, 1.5-4.5 fold, 2-4 fold, 1.2-5 fold, etc.), compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.).
• a suitable reference e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.
• administering the therapeutically effective amount of the nucleic acid to the subject increases the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., skeletal muscle, compared to a suitable control.
• the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., in skeletal muscle or cardiac muscle is determined relative to the number and/or abundance of CD68+/CD206- cells in the same tissue.
• administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., cardiac muscle, compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide, etc.).
• administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., cardiac muscle, by, by about, or by at least 0.1, 0.2, 0.3, 0.4 or 0.5 fold, or by a fold amount in a range defined by any two of the preceding values (e.g., 0.1-0.5 fold, 0.1-0.4 fold, 0.2-0.4 fold, 0.1-0.3 fold, etc.), compared to a suitable reference (e.g., before the administering, other subjects treated with a scramble oligonucleotide).
• a suitable reference e.g., before the administering, other subjects treated with a scramble oligonucleotide.
• administering the therapeutically effective amount of the nucleic acid to the subject reduces the number and/or abundance of CD68+/CD206+ cells in a muscle tissue, e.g., cardiac muscle, compared to a suitable control. In some embodiments, administering the therapeutically effective amount of the nucleic acid to the subject does not alter the number and/or abundance of CD68+/C8O+ cells in a muscle tissue, e.g., in skeletal muscle or cardiac muscle. In some embodiments, the number and/or abundance of CD68+/CD80+ cells in a muscle tissue, e.g., in skeletal muscle or cardiac muscle, is determined relative to the number and/or abundance of CD68+/CD8O- cells in the same tissue.
• the nucleic acid can be administered to the subject at any suitable amount.
• the therapeutically effective amount of the nucleic acid includes about 0.01 pg, 0.02 pg, 0.05 pg, 0.1 pg, 0.2 pg. 0.5 pg, 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg.
• the therapeutically effective amount of the nucleic acid includes about 0.001 pg/g, 0.002 pg/g, 0.005 pg/g, 0.01 pg/g, 0.02 pg/g, 0.05 pg/g, 0.1 pg/g, 0.15 pg/g, 0.2 pg/g, 0.5 pg/g, 1 pg/g, 2 pg/g, 3 pg/g. 4 pg/g, 5 pg/g, 6 pg/g, 7 pg/g, 8 pg/g.
• the therapeutically effective amount of the nucleic acid is about 0.001 pg/g, 0.002 pg/g, 0.005 pg/g, 0.01 pg/g, 0.02 pg/g, 0.05 pg/g, 0.1 pg/g, 0.2 pg/g, 0.5 pg/g, or about 1 pg/g of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 pg/g-0.01 pg/g, 0.01 pg/g-0.05 pg/g, 0.05 pg/g-0.1 pg/g, 0.1 pg/g-0.2 pg/g, 0.2 pg/g-0.5 pg/g, or 0.5 pg/g-1 pg/g).
• the therapeutically effective amount of the nucleic acid includes about 0.001 mg/kg, 0.002 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.05 mg/kg, 0.1 mg/kg, 0.15 mg/kg, 0.2 mg/kg, 0.5 mg/kg, 1 mg/kg, 2 mg/kg, 3 mg/kg, 4 mg/kg, 5 mg/kg, 6 mg/kg, 7 mg/kg, 8 mg/kg, 9 mg/kg, 10 mg/kg, 15 mg/kg, 20 mg/kg, 25 mg/kg, 30 mg/kg, 35 mg/kg, 40 mg/kg, 45 mg/kg, 50 mg/kg, 60 mg/kg, 70 mg/kg, 80 mg/kg, 90 mg/kg, 100 mg/kg of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 mg/kg- 0.01 mg/kg, 0.01 mg/kg-0.1 mg/kg, 0.1 mg/kg-1 mg
• the therapeutically effective amount of the nucleic acid is about 0.001 mg/kg, 0.002 mg/kg, 0.005 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.05 mg/kg, 0.1 mg/kg, 0.2 mg/kg, 0.5 mg/kg, or about 1 mg/kg of body weight, or more, or an amount in a range defined by any two of the preceding values (e.g., 0.001 mg/kg-0.01 mg/kg, 0.01 mg/kg- 0.05 mg/kg, 0.05 mg/kg-0.1 mg/kg, 0.1 mg/kg-0.2 mg/kg, 0.2 mg/kg-0.5 mg/kg, or 0.5 mg/kg- 1 mg/kg).
• the therapeutically effective amount of the nucleic acid is sufficient on its own to bring about the desired outcome (e.g., without administering another therapeutic agent for the same condition or disease).
• the method does not include administering another nucleic acid that includes a nucleotide sequence about 25 to about 35 nt long that is part of a tRNA (e.g., does not include a nucleotide sequence that is the 5’ fragment of TRE-CTC1-7).
• the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is derived from at least one of: TRE-GCC1-2, TRE-GCC4- 1. In any method of the present disclosure, in some embodiments, the method does not include administering another nucleic acid that includes a nucleotide sequence about 30-32 nt long that is the 5’ fragment of TRE-GCC1 -2 or TRE-GCC4-1 . In any method of the present disclosure, in some embodiments, the method includes administering a therapeutically effective amount of a composition that consists of, or consists essentially of the isolated nucleic acid and a pharmaceutically acceptable excipient.
• the method includes administering a therapeutically effective amount of a cell-free composition (e.g., a composition substantially free of cells such as CDC) that includes the isolated nucleic acid.
• a therapeutically effective amount of an extracellular' vesicle-free composition e.g., a composition substantially free of extracellular vesicles such as exosomes
• an extracellular' vesicle-free composition e.g., a composition substantially free of extracellular vesicles such as exosomes
• the nucleic acid or composition can be administered to the subject at any suitable dosing schedule.
• the therapeutically effective amount of the nucleic acid or the composition is administered to the subject no more frequently than three time a week, twice a week, once a week (QW), once every two weeks (Q2W), once every month (QM), once every two months (Q2M), once every three months (Q3M), once every four months (Q4M) or longer, or at a frequency in a range defined by any two of the preceding values (e.g., three times a week to once every four months (Q4M), twice a week to once every two months (Q2M), or twice a week to once a month (QM)).
• the nucleic acid is administered to the subject 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more times, or a number of times in a range defined by any two of the preceding values (e.g., 1-30 times, 2-20 times, 5-15 times, 1-20 times, etc.). In some embodiments, the nucleic acid is administered to the subject at regular intervals. In some embodiments, the nucleic acid is administered to the subject chronically.
• the nucleic acid or composition can be administered using any suitable route. Administration can be local or systemic. In some embodiments, administration is parenteral. Suitable option for administration include, without limitation, intravenous, intramuscular, subcutaneous, intra-arterial, intraperitoneal, or oral administration. In some embodiments, the nucleic acid or composition is administered orally. In some embodiments, the nucleic acid or composition is administered by oral gavage. In some embodiments, the nucleic acid or composition is administered intravenously. In some embodiments, the nucleic acid or composition is administered by infusion. [0070] Also provided herein is a method of immunomodulation (“immunomodulation method”).
• the immunomodulation method can include contacting an effective amount of the nucleic acid of the present disclosure (or a composition containing the same, as described herein), with a population of macrophages, e.g., human macrophages.
• the contacting comprises administering to a subject in need of treating a condition characterized by inflammation and/or fibrosis an effective amount of the nucleic acid or the composition.
• contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of one or more anti-inflammatory cytokines.
• contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of IL-10, IL-la, and/or ARG-1 in the population of macrophages. In some embodiments, contacting the effective amount of the nucleic acid of the present disclosure with a population of macrophages increases expression of IL- 10, IL-la, and/or ARG-1 in the population of macrophages by, by about, or by at least 1.1, 1.2, 1.3, 1.4, 1.5, 2, 2.2, 2.5, 3, 3.5, 4, 4.5, 5.
• expression of IL-10, IL-la, and/or ARG-1 is mRNA expression of IL-10, IL-la, and/or ARG- 1.
• the contacting is done in vitro, e.g., in culture.
• the method includes administering the macrophages to a subject in need of treating a muscle disorder, a heart condition, fibrosis, an inflammatory condition, as described herein.
• kits that include the nucleic acid or a composition of the present disclosure.
• the present kit in some embodiments finds use in treating a muscle disorder, a heart condition, fibrosis, an inflammatory condition (e.g., associated with a muscle disorder, or a viral infection), as provided herein.
• a kit can include the nucleic acid of the present disclosure and a transfection reagent.
• the transfections reagent can be any suitable transfection reagent, as provided herein.
• the transfection reagent includes one or more of a lipid (e.g., a liposome-forming lipid), a PEGylated lipid, and an extracellular vesicle.
• the kit includes a pharmaceutically acceptable excipient, as provided herein.
• the kit includes casein and/or chitosan.
• the kit includes an antisense oligonucleotide, such as, without limitation, an exon-skipping agent that targets a dystrophin transcript.
• Kits can include one or more containers (e.g., vials, ampoules, test tubes, flasks or bottles) for holding one or more components of the kits.
• the kits may further include instructions for using the kit to treat a condition (e.g., muscular dystrophy, heart failure, myocardial infarction, or an inflammatory condition associated therewith, or an inflammatory condition associated with a viral infection).
• the information and instructions may be in the form of words, pictures, or both, and the like.
• Cardiosphere-derived cells are cardiac progenitor/stromal cells with immunomodulatory, anti-fibrotic, and pro-regenerative properties. These therapeutic actions antagonize crucial pathways central to the pathology of Duchenne muscular dystrophy (DMD).
• DMD Duchenne muscular dystrophy
• CDC-EVs extracellular vesicles
• tRNA transfer RNA
• tREX-1 a species comprising the 5’ half of one specific tRNA is particularly plentiful. This entity, tREX-1, was tested in mdx mice (see Examples below). When created synthetically and packaged in a transfection reagent, tREX-1 has disease-modifying bioactivity: key disease manifestations of DMD, including structural and functional abnormalities in the heart and skeletal muscle, are partially and significantly reversed by tREX-1 intravenous infusion twice weekly for 4 weeks. Thus, tREX-1 represents a new class of defined ncRNAs mined from CDC-EVs. [0075] Non-limiting embodiments of the present disclosure are further provided in the following numbered arrangements.
• nucleic acid comprising a nucleotide sequence of UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.
• nucleic acid comprising a nucleotide sequence at least 95% identical to UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1), wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.
• An isolated nucleic acid comprising a nucleotide sequence of a 5’ fragment of a human tRNA, wherein the human tRNA is selected from: TRE-CTC1-7, TRE-CTC1-1, and TRE-CTC2-1, wherein the nucleic acid is RNA, wherein the nucleic acid is at most 60 nt long, or is at most 40 nt long.
• nucleic acid of any one of the preceding arrangements, wherein the nucleic acid comprises at least one chemically-modified nucleotide.
• nucleic acid of arrangement 4 wherein the nucleic acid comprises 1-10 chemically-modified nucleotides.
• nucleic acid of any one of the preceding arrangements, wherein the nucleotide sequence is at the 5’ end of the nucleic acid.
• nucleic acid of any one of the preceding arrangements wherein the nucleic acid is or is about 32 nt long.
• the nucleic acid consists of or consists essentially of the nucleotide sequence: UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC (SEQ ID NO: 1).
• a therapeutic composition comprising: a therapeutically effective amount of the isolated nucleic acid of any one of the preceding arrangements; and a pharmaceutically acceptable excipient.
• composition of arrangement 14 further comprising a transfection reagent.
• transfection reagent comprises one or more of a liposome, an extracellular vesicle (EV), and a polyethylene glycol (PEG)- cationic lipid complex (PCLC).
• EV extracellular vesicle
• PCLC polyethylene glycol
• composition of arrangement 15 or 16 wherein the transfection reagent comprises EV derived from cardiosphere-derived cells (CDC).
• composition of arrangement 18 comprising casein micelles.
• composition of arrangement 18 or 19, comprising chitosan.
• composition of claim 20 wherein the isolated nucleic acid is encapsulated in a casein-chitosan complex.
• composition of arrangement 20 or 21, comprising casein-chitosan micelles.
• composition of arrangement 23, wherein the antisense oligonucleotide comprises an exon-skipping agent that targets a dystrophin transcript.
• a kit comprising: the nucleic acid of any one of any one of arrangements 1-13; and a transfection reagent.
• the transfection reagent comprises one or more of a lipid, PEGylated lipid, and an extracellular vesicle (EV).
• kits of arrangement 30, wherein the antisense oligonucleotide comprises an exon-skipping agent that targets a dystrophin transcript.
• a method of treating a muscle disorder or symptom thereof comprising administering to a subject in need of treating a muscle disorder or symptom thereof a therapeutically effective amount of the nucleic acid of any one of arrangements 1-13, or of the composition of any one of arrangements 14-24, thereby treating the muscle disorder or symptom thereof.
• the method of arrangement 32, wherein the muscle disorder comprises a skeletal muscle disorder and/or a heart condition.
• a method of treating a heart condition or symptom thereof comprising administering to a subject in need of treating a heart condition or symptom thereof a therapeutically effective amount of the nucleic acid of any one of arrangements 1-13, or of the composition of any one of arrangements 14-24, thereby treating the heart condition or symptom thereof.
• heart condition comprises a symptom and/or sequelae of heart failure or myocardial infarction.
• a method of treating a condition associated with inflammation and/or fibrosis comprising administering to a subject in need of treating a condition associated with inflammation and/or fibrosis a therapeutically effective amount of the nucleic acid of any one of arrangements 1-1 , or of the composition of any one of arrangements 14-24, thereby treating the condition associated with inflammation and/or fibrosis.
• condition associated with inflammation and/or fibrosis comprises inflammation and/or fibrosis of the heart or skeletal muscle.
• condition associated with inflammation and/or fibrosis comprises a symptom and/or sequelae of heart failure, myocardial infarction, or muscular dystrophy.
• condition associated with inflammation and/or fibrosis comprises a symptom or sequelae of an infectious disease or is associated with immunotherapy .
• condition associated with inflammation and/or fibrosis comprises a cytokine storm or an autoimmune disorder.
• condition associated with inflammation and/or fibrosis comprises a symptom or sequelae of an infectious disease, idiopathic pulmonary fibrosis or cirrhosis of the liver.
• the method of arrangement 48 comprising intravenously, intramuscularly, or intracardially administering the therapeutically effective amount of the nucleic acid or of the composition to the subject.
• the therapeutically effective amount comprises from about 0.001 pg/g to about 100 pg/g of the nucleic acid.
• a method of immunomodulation comprising contacting an effective amount of the nucleic acid of any one of arrangements 1- 13, or of the composition of any one of arrangements 14-24 with a population of macrophages.
• the method of arrangement 52, wherein the contacting comprises administering to a subject in need of treating a condition characterized by inflammation and/or fibrosis an effective amount of the nucleic acid or the composition.
• nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for treatment of a muscle disorder or symptom thereof in a subject in need thereof.
• nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for preparation of a medicament for treatment of a muscle disorder or symptom thereof in a subject in need thereof.
• nucleic acid or the composition of arrangements 59 or 60, wherein the muscle disorder comprises a skeletal muscle disorder and/or a heart condition.
• nucleic acid or the composition of arrangement 61 wherein the heart condition comprises a symptom and/or sequelae of heart failure or myocardial infarction.
• nucleic acid of any one of arrangements 1-13 or the composition of any one of arrangements 14-24 for preparation of a medicament for treatment of a condition associated with inflammation and/or fibrosis a subject in need thereof.
• ncRNA non-coding RNA
• tREX-1 tREX-1
• CDC-EV CDC-derived extracellular vesicles
• ncRNA species particularly abundant in CDC-EV was identified as having the sequence 5’-UCCCUGGUGGUCUAGUGGUUAGGAUUCGGCGC-3’ (SEQ ID NO: 1) (FIG. 7D).
• Extracellular vesicles (EVs) secreted by cardio sphere-derived cells induced transcriptomic changes in cultured macrophages, sharing characteristics with alternatively - activated (M2) and classically-activated (Ml) macrophages (FIG. 7A).
• M2 alternatively - activated
• Ml classically-activated macrophages
• Sequencing of EV small RNAs revealed that tRNAs represented the largest percentage of mapped reads (FIG. 7B). The greatest tRNA reads mapped to tREX-1 (FIG. 7C).
• BMDM bone marrow-derived macrophages
• RNA-seq analysis revealed broad (or major transcriptome-wide) changes in gene expression in cultured BMDM exposed to tREX-1, compared to control cells exposed to vehicle (Veh) or scrambled (Scr) RNA (FIG. 1C).
• the scrambled RNA had the sequence of SEQ ID NO: 5 shown in FIG. 6.
• FIG. 1C shows a transcriptomic heatmap of mdx mouse bone marrow-derived macrophages exposed to tREX-1 (20 nM), scrambled RNA, or vehicle.
• mice that received tREX- 1 had a greater left ventricular ejection fraction (EF) (or greater preservation of heart function) relative to mice that received scrambled control.
• FIG. 8B shows the EF data, including data in FIG. 2B, in a different format.
• mice that had received tREX-1 showed preserved heart function, whereas heart function decreased in control mice.
• FIG. 2C shows representative Masson’s trichrome micrographs of cardiac tissue sections. The results of quantification of myocardial fibrosis of tissue sections, such as those shown in FIG 2C, are shown in FIG. 2D.
• FIG. 8D shows the cardiac tissue section staining data and quantification of myocardial fibrosis, including data in FIGs. 2C and 2D, in a different format. Animals treated with tREX-1 exhibited a significant reduction in myocardial fibrosis compared to animals treated with scrambled RNA (FIGs. 2D, 8D right panel). *P ⁇ 0.05.
• This non-limiting example shows disease-modifying bioactivity of tREX-1 in a model of muscular dystrophy.
• FIG. 3A shows a schematic of the experimental protocol (see also FIG. 8 A). 14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 pg/g BW) twice-weekly by retro-orbital injection (i.e., intravenous) for 4 weeks.
• FIG. 3B shows that mice that received tREX-1 produced more muscle torque relative to mice that received scrambled control.
• FIG. 8C shows tetanic torque data, including data in FIG. 3B, in a different format. Thus, mice that had received tREX-1 had improved muscle function, whereas no change was observed in control mice (FIG. 8C).
• FIG. 3C shows representative Masson’s trichrome micrographs of cardiac tissue sections. Quantification of fibrosis and muscle fiber count of skeletal muscle tissue sections was carried out. Animals treated with tREX- 1 exhibited a significant reduction in myocardial fibrosis (FIG. 3D), and a significant increase in myofiber count (FIG. 3E) compared to animals treated with scrambled RNA.
• FIG. 8E shows the skeletal muscle tissue section staining data and quantification of myocardial fibrosis, including data in FIGs. 3C and 3D, in a different format, and FIG.
• 8F shows the myofiber count data, including data in FIG. 3E, in a different format.
• Data are represented as mean ⁇ SEM.
• This non-limiting example shows the effect of tREX-1 administration on serum inflammatory cytokine levels.
• FIG. 4 shows the changes in serum inflammatory cytokines from mdx mice.
• mice that received tREX-1 showed robust changes in pro-inflammatory cytokines relative to scrambled control, demonstrating immunomodulatory properties in vivo.
• Example 5
• This non-limiting example shows the effect of oral tREX-1 administration in a model of acute myocardial infarction (MI).
• This non-limiting example shows uptake of tREX-1 by cultured macrophages.
• a fluorescent version of tREX-1 was created by substituting adenosine residues with 2-aminopurine (2-AP), a fluorescent adenosine analog maintaining Watson- Crick base pairing.
• Cultured macrophages were exposed to fluorescent (tREX-l 2 AP ) and non- fluorescent tREX-1 (25 nM) for 90 minutes. Cells were then processed for analysis by flow cytometry. As shown by FIG. 9, cultured macrophages demonstrated uptake of labeled tREX- 1.
• This non-limiting example shows identification of tREX-1 protein binding partners.
• Biotinylated tREX-1 or scrambled RNA (20 pM) was spiked into cultured macrophage lysates, and RNA pulldown was performed using streptavidin-coated beads.
• RNA binding proteins (RBP) eluted by pulldown were then identified by mass spectrometry (FIG. 10).
• RBP mass binding proteins
• FIG. 10 In total, 5 predicted RBPs (based on sequence complementarity) were validated by mass spectrometry. Each of the RBPs identified have well-established roles in regulating gene expression at the transcriptional, post-transcriptional, and translational levels.
• Mass spectrometry was unable to detect any RBPs in samples spiked with biotinylated scrambled RNA, further supporting the notion that the specificity of tREX-1 is unique to its sequence. These data suggest tREX-1 interacts with RBPs to regulate macrophage gene expression; and thus, altering their biological function.
• tREX-1 12-14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15
• Hearts were processed for immunohistochemistry and CD68+/CD8O- and CD68+/CD8O+ cells (FIG. 11, top panels), and CD68+/CD206- and CD68+/CD206+ cells (FIG. 11, bottom panels) were quantified.
• This non-limiting example shows the effects of tREX-1 on skeletal muscle macrophages.
• tREX-1 12-14-month-old mdx mice were administered tREX-1 or scrambled RNA (0.15 ptg/g body weight) twice-weekly by intravenous injection for 4 weeks.
• Hearts were processed for immunohistochemistry and CD68+/CD8O- and CD68+/CD8O+ cells (FIG. 12, top panels), and CD68+/CD206- and CD68+/CD206+ cells (FIG. 12, bottom panels) were quantified.
• tREX-1 had no effect on CD68+/CD8O+ (classically-activated) skeletal muscle macrophages, but dramatically increased the numbers of CD68+/CD206+ (alternatively - activated) macrophages (FIG. 12, top right and bottom right panels, respectively).
• tREX-1 alters the composition of skeletal muscle macrophage subtypes.
• Macrophages were depleted (Mcp-) by clodronate liposomes or present (M ⁇ p+) in 12-14-month-old mdx mice prior to administration of tREX-1 or scrambled RNA (0.15 J-ig/g body weight) twice-weekly by intravenous injection for 4 weeks.
• Heart function was measured by echocardiography at baseline (after macrophage depletion, but prior to tREX- 1 administration) and at the 4-week study endpoint. When macrophages were present, tREX- 1 improved heart function (FIG. 13). In contrast, when macrophages were absent, tREX-1 was ineffective (FIG. 13).
• These data demonstrate macrophages are targets of tREX-1.
• ***P ⁇ 0.001, ns: not significant. Data are represented as mean ⁇ SEM. A two-way ANOVA was used to determine statistical significance (a 0.05).

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Genetics & Genomics (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Molecular Biology (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Medicinal Chemistry (AREA)
• Biotechnology (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• General Engineering & Computer Science (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Cardiology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Biochemistry (AREA)
• Heart & Thoracic Surgery (AREA)
• Endocrinology (AREA)
• Microbiology (AREA)
• Epidemiology (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Neurology (AREA)
• Urology & Nephrology (AREA)
• Orthopedic Medicine & Surgery (AREA)
• Physical Education & Sports Medicine (AREA)
• Hospice & Palliative Care (AREA)
• Vascular Medicine (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=90479292

Family Applications (1)

Country Status (5)

Families Citing this family (4)

Family Cites Families (4)

• 2023
  • 2023-09-28 JP JP2025518434A patent/JP2025534332A/ja active Pending
  • 2023-09-28 AU AU2023354018A patent/AU2023354018A1/en active Pending
  • 2023-09-28 KR KR1020257014211A patent/KR20250078993A/ko active Pending
  • 2023-09-28 EP EP23873948.6A patent/EP4594489A2/de active Pending
  • 2023-09-28 WO PCT/US2023/075437 patent/WO2024073612A2/en not_active Ceased

Also Published As

Similar Documents

Legal Events