EP4573371A2 - Diagnose und behandlung von akuter nierenläsion - Google Patents
Diagnose und behandlung von akuter nierenläsionInfo
- Publication number
- EP4573371A2 EP4573371A2 EP23855713.6A EP23855713A EP4573371A2 EP 4573371 A2 EP4573371 A2 EP 4573371A2 EP 23855713 A EP23855713 A EP 23855713A EP 4573371 A2 EP4573371 A2 EP 4573371A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- aki
- patient
- optionally
- enpp6
- col23a1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/34—Genitourinary disorders
- G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/50—Determining the risk of developing a disease
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/52—Predicting or monitoring the response to treatment, e.g. for selection of therapy based on assay results in personalised medicine; Prognosis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/60—Complex ways of combining multiple protein biomarkers for diagnosis
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5014—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing toxicity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
Definitions
- Acute kidney injury represents an acute decline in kidney function and is often caused by ischemia and toxic insults. It is common in hospitalized patients and is associated with significant morbidity and mortality.
- the AKI diagnosis and staging criteria across these definitions revolve around changes in serum creatinine (SCr), urine output, and requirement for kidney replacement therapy (KRT).
- SCr may increase in various clinical scenarios of AKI, such as pre-renal azotemia, acute tubular injury (ATI), hepatorenal syndrome (HRS), and cardiorenal syndrome, which have diverse pathophysiological processes and require different management strategies.
- ATI acute tubular injury
- HRS hepatorenal syndrome
- cardiorenal syndrome which have diverse pathophysiological processes and require different management strategies.
- This unspecific rise in SCr during AKI makes both the diagnosis and patient management challenging.
- SUMMARY OF THE INVENTION In mouse acute kidney injury (AKI), a subgroup of injured proximal tubule (PT) cells undergo maladaptive changes that prevent complete tissue recovery.
- AKI mouse acute kidney injury
- PT proximal tubule
- the present inventors aimed to elucidate the transcriptomic landscape of PT maladaptation in humans, identify plasma proteomic signatures linked to the maladaptive process, and determine their associations with adverse renal outcomes.
- the present inventors performed single-nucleus RNA sequencing of 120,985 nuclei in kidneys from 17 participants with AKI and 7 healthy controls from the Kidney Precision Medicine Project.
- the phenotype of maladaptive PT characterized by dedifferentiation and enrichment in ferroptotic, necroptotic, proinflammatory, and profibrotic pathways, was widely present in participants with AKI of diverse etiologies.
- the present inventors measured the plasma proteome (SOMAscan) in 2 independent cohorts of cardiac surgery patients and a cohort of marathon runners, linked it to the transcriptomic signatures associated with maladaptive PT, and identified 9 proteins whose genes were specifically up- or downregulated by maladaptive PT.
- both cohorts of patients had increases in TGFB2, COL23A1, and NLGN4X, and decreases in PLG, ENPP6, and PROC. Similar changes were observed in marathon runners with exercise-associated injury.
- the postoperative changes in these biomarkers were strongly associated with severe AKI in adults after cardiac surgery and progression to post-AKI kidney atrophy in mouse models of ischemia-reperfusion injury and toxic injury.
- the present inventors results demonstrate the feasibility of a multiomics approach to discovering novel, noninvasive markers and associate PT maladaptation with adverse clinical outcomes.
- the present invention utilizes eight plasma proteins for the diagnosis of proximal tubular injury. These proteins were identified via a multiomics approach, integrating plasma proteomics and kidney tissue transcriptomics from two large cohorts of patients. The present inventors show herein that the genes of these proteins were specifically upregulated by the injured proximal tubular cells in the kidney, and, in certain embodiments, the increase in the plasma levels of these proteins after cardiac surgery is associated with higher risk of developing severe AKI.
- the panel comprises seven plasma protein biomarkers: neuregulin-4 X linked (NLGN4X), collagen type XXIII ⁇ 1 chain (COL23A1) transforming growth factor ⁇ -2 (TGFB2)), ectonucleotide pyrophosphatase/phosphodiesterase 6 (ENPP6), plasminogen (PLG) and protein C (PROC).
- the panel further comprises CD200, prolyl 4-hydroxylase (P4HA2) and/or afamin (AFM).
- the present invention can be used for early detection of drug toxicity. Drug toxicity is a common cause of acute tubular injury and AKI.
- Drugs commonly associated with tubular injury includes antibiotics (vancomycin, piperacillin-tazobactam and aminoglycosides), antivirals (acyclovir, tenofovir), antifungal (colistin), lithium, nonsteroidal anti-inflammatory drugs and kidney injury drugs (methotrexate, cisplatin and ifosfamide).
- SCr is often unchanged until tubular injury is severe, resulting a delay in cessation of these nephrotoxic agents and worsening kidney function.
- the present invention can provide early detection of drug induced proximal tubular injury before SCr starts to increase and the clinical diagnosis of AKI is made.
- the present invention can be used to routinely monitor for toxicity, clinicians may promptly stop these nephrotoxic agents when proximal tubular injury occurs and prevent further injury.
- the present invention can be used in the management of cardiorenal syndrome and hepatorenal syndrome.
- the diagnosis and management of AKI in patients with decompensated cirrhosis largely depends on its etiologies and pathophysiological processes.
- Hepatorenal syndrome (HRS), pre-renal azotemia, and ATI are the most common etiologies in these patients. Each requires a completely different management strategy.
- HRS marked by splenic vasodilatation and decreased renal perfusion through neurohormonal activation, may be reversible after administration of vasoconstrictive therapy.
- Pre-renal azotemia requires volume expansion with either albumin or crystalloid.
- ATI could potentially progress and often warrants evaluation of simultaneous liver and kidney transplantation.
- the proposed biomarker panel may be used to evaluate ATI in patients with decompensated cirrhosis. Lack of change in these biomarkers may ensure the health of tubules, prompt the use of volume expansion and vasoconstrictive therapy, and may indicate recovery potentials after liver transplantation.
- AKI AKI in patients with decompensated heart failure
- SCr based AKI diagnosis criteria does not differentiate kidney function fluctuation from hemodynamic changes from true intrinsic kidney injury.
- aggressive diuresis is often necessary to relieve renal congestion and restore hemodynamics.
- diuresis was often held when SCr rises from hemoconcentration without evidence of true intrinsic renal injury, resulting in incomplete decongestion, higher risk of readmission and worse mortality outcome.
- the present invention can be used to rule out the presence of intrinsic tubular injury when SCr rises during decongestion and facilitate aggressive fluid removal.
- the present invention can be used for risk stratification for AKI transitioning to chronic kidney disease.
- much work has focused on the long-term morbidity and mortality of AKI.
- Patients with severe (KDIGO stage 2-3) AKI have two-fold higher risk of developing CKD comparing to those with mild AKI (Hsu et al JAMA Intern Med, 2020), and 5-8 fold higher risk of CKD comparing to those without AKI (Coca SG et al, Kidney Int.2012).
- the proposed panel of biomarkers are strongly associated with developing severe AKI, and thus may also be associated with developing incident CKD or experiencing CKD progression after severe AKI. These biomarkers could be used for risk stratification and for selection of patients that are at high risk of developing CKD after AKI.
- Timely initiation of nephroprotective medications such as angiotensin converting enzyme inhibitors, angiotensin receptor blockers and sodium glucose cotransporter inhibitors, may help prevent the development and progression of CKD after hospitalization with AKI.
- the present invention can be used for the detection of drug toxicity in preclinical rodent toxicity studies.
- urine biomarkers such as urine albumin, beta2-microglobulin, clusterin, cystatin-C, KIM-1 were previously approved by the FDA for preclinical use to indicate renal injury in rat.
- the proposed panel of biomarkers may be used for evaluation of nephrotoxicity as an addition to standard laboratory data used in rodent safety assessment studies. They will provide additional information to SCr and blood urea nitrogen, and correlates with histological renal tubular injury.
- the increase in COL23A1, TGFB2, and NLGN4X, and the decrease in ENPP6, PLG, P4HA2 and AFM may indicate early injury to the proximal tubule in rodents and indicate significant nephrotoxicity.
- the present invention provides methods for detecting acute tubular injury (ATI).
- the method comprises the steps of (a) detecting increased expression of neuregulin-4 X linked (NLGN4X), collagen type XXIII ⁇ 1 chain (COL23A1) and transforming growth factor ⁇ -2 (TGFB2) relative to a reference in a sample obtained from a patient; and (b) detecting decreased expression of ectonucleotide pyrophosphatase/phosphodiesterase 6 (ENPP6), plasminogen (PLG) and protein C (PROC) in the patient sample.
- step (a) further comprises detecting expression of CD200.
- the present invention also provides methods for identifying a patient as likely to develop acute kidney injury (AKI) comprising the steps of: (a) detecting increased expression levels of NLGN4X, COL23A1, and TFGB2 relative to a reference in a sample obtained from the patient; and (b) detecting decreased expression levels of ENPP6, PLG and PROC relative to a reference in the patient sample, thereby detecting ATI in the patient which is likely to develop into AKI.
- step (a) further comprises detecting expression of CD200.
- step (b) further comprising detecting expression of P4HA2 and/or AFM.
- ATI comprises PTI.
- the patient identified in step (b) is treated for AKI.
- the AKI treatment can comprise, but is not limited to, one or more of srenal replacement therapy, angiotensin-converting-enzyme inhibitors, Ang II type I (ATI) blockers, corticosteroids, immunosuppressants, artemsinin and derivatives thereof, drag-reducing polymers, endothelin subtype A receptor antagonists (pro)renin receptor antagonists and 5-HT 3 -tareting drugs.
- a method comprises the step of detecting the amount of NLGN4X, COL23A1, TGFB2, ENPP6, PLG, PROC and optionally one or more of CD200, P4HA2 and AFM in a biological sample obtained from a patient.
- a method for identifying a patient as having PTI comprises the step of measuring the level of NLGN4X, COL23A1, TGFB2, ENPP6, PLG, PROC and optionally one or more of CD200, P4HA2 and AFM in a biological sample obtained from the patient, wherein (a) an increase in the amount of NLGN4X, COL23A1, TGFB2 and optionally CD200 relative to a reference and (b) a decrease in the level of ENPP6, PLG, PROC and optionally P4HA2 and/or AFM relative to a reference identifies the patient as having PTI.
- the present invention provides a method of identifying a cardiac surgery patient as having a high risk of developing severe AKI comprising the step of measuring the level of NLGN4X, COL23A1, TGFB2, ENPP6, PLG, PROC and optionally one or more of CD200, P4HA2 and AFM in a biological sample obtained from the patient, wherein (a) an increase in the amount of NLGN4X, COL23A1, TGFB2 and optionally CD200 relative to a reference and (b) a decrease in the level of ENPP6, PLG, PROC and optionally P4HA2 and/or AFM relative to a reference identifies the patient as having a high risk of developing severe AKI.
- a patient identified as having PTI is administered diuresis to relieve renal congestion and restore hemodynamics.
- a patient identified in step (c) is treated for AKI, which can comprise one or more of renal replacement therapy, angiotensin-converting-enzyme inhibitors, Ang II type I (ATI) blockers, corticosteroids, immunosuppressants, artemsinin and derivatives thereof, drag-reducing polymers, endothelin subtype A receptor antagonists (pro)renin receptor antagonists and 5- HT 3 -tareting drugs.
- AKI can comprise one or more of renal replacement therapy, angiotensin-converting-enzyme inhibitors, Ang II type I (ATI) blockers, corticosteroids, immunosuppressants, artemsinin and derivatives thereof, drag-reducing polymers, endothelin subtype A receptor antagonists (pro)renin receptor antagonists and 5- HT 3 -tareting drugs.
- FIG.1F-1H Dot plot displaying enriched gene ontology pathways (FIG.1F), and genes involved in ferroptosis pathways (FIG.1G) and necroptosis pathways (FIG.1H) among PT subclusters.
- FIG.2A-2D Gene regulatory network analysis of PT subclusters in 17 participants with AKI demonstrated distinct regulatory networks in PT cells at different states of health.
- FIG.2A Heatmap depicting average regulon enrichment in each PT subcluster.
- FIG.2B Average expression of selected regulons enriched in each PT subcluster.
- FIG.2C Heatmap demonstrating unsupervised clustering of PT subclusters by the top 10 regulons from each subcluster, revealing significant differences in regulon activity in PT cells in healthy and diseased states.
- FIG.2D Louvain clustering of the top 10% of transcription factor-target gene pairs demonstrates clusters of transcription factors (nodes depicted by colors) forming coregulatory networks.
- Blood samples were collected at day 0, 3, 7, 10, 14, and 21 for blood urea nitrogen (BUN) measurements.
- Quantitative RT-PCR analysis was performed on whole kidney RNA harvested on days 0 (baseline), 7 (AKI phase) and 21 (CKD phase) after aristolochic acid injection, and day 21 (controls) after vehicle injection.
- AAN aristolochic acid nephropathy
- AFM afamin
- AKI acute kidney injury
- BUN blood urea nitrogen
- COL23A1 collagen type XXIII ⁇ 1 chain
- CD collecting duct
- CKD chronic kidney disease
- CNT connecting tubule
- DC dendritic cell
- DCT distal convoluted tubule
- EC endothelial cell
- ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6
- Fib fibroblast
- Glom glomerulus
- ICA intercalated cell of collecting duct type A
- ICB intercalated cell of collecting duct type B
- IRI ischemia- reperfusion injury
- Mac macrophage
- MD macula densa
- Mes mesangial cell
- Mono monocyte
- NLGN4X neuroligin-4 X linked
- P4HA2 prolyl 4-hydroxylase
- PC principal cell of
- FIG.5. Tissue gene expression of 39 candidate biomarkers of PT maladaptation identified from the integrated workflow in KPMP participants with AKI.
- FIG.6 Tissue gene expression of 38 candidate biomarkers of PT cells at healthy states identified from the integrated workflow in KPMP participants with AKI.
- FIG.7A-7C Tissue gene expression of biomarkers of PT maladaptation and PT cells at healthy states in kidney biopsy tissues from 3 recently enrolled KPMP participants with AKI.
- FIG.7A Marker gene expression of major kidney cell types in kidney biopsy tissues from 3 recently enrolled KPMP participants with AKI.
- FIG.7B Marker gene expression of predicted PT subclusters using PT cells from 17 KPMP participants with AKI in the biomarker discovery phase.
- FIG.7C Gene expression of biomarkers of PT maladaptation and PT cells at healthy states in predicted PT subclusters and other major kidney cell types.
- FIG.8A-8B Tissue gene expression of biomarkers of PT maladaptation and PT cells at healthy states in kidney autopsy tissues from an independent cohort of critically ill patients with AKI.
- FIG.8A Marker gene expression of PT subclusters classified using approaches described by Hinze et al (33).
- FIG.8B Gene expression of biomarkers of PT maladaptation and PT cells at healthy states in PT subclusters and other kidney cell types.
- FIG.10 Gene expression of biomarkers of PT maladaptation and PT cells at healthy states in a publicly available snRNA-seq dataset of an AAN model. SnRNA-seq data published by Lu et al (37) was downloaded from the ArrayExpress database (accession code No. E-MTAB-9390). Gene expression of biomarkers on day 0 and day 28 after aristolochic acid injection (4 doses of 2.5 mg/kg over 2 weeks) is visualized after converting snRNA-seq count data to counts per million.
- the present inventors developed a work-flow that identifies unique genes that are expressed by injured proximal tubule cells from single nuclei RNA sequencing analysis.
- the present inventors then integrated with blood proteomic profiles in patients who developed acute kidney injury (AKI), and identified eight protein biomarkers that can be measured in peripheral blood and reflected the severity of proximal tubular injury.
- These biomarkers include FSTL3, NLGN4X, COL23A1, TGFB2, P4HA2, ENPP6, PLG and AFM. These biomarkers of proximal tubular injury are associated with the development of moderate to severe acute kidney injury (AKI) after cardiac surgery.
- the present invention provides risk stratification in the post- operative setting in predicting the development of moderate to severe AKI after cardiac surgery. It also has potential to provide prognosis assessment for kidney function recovery, and long-term kidney outcome, such as developing chronic kidney disease and end stage kidney disease in future studies. Measurement platforms using standardized immunoassay can be developed based on this invention for future clinical application. I. Definitions As used herein, a “subject”, “patient” or “individual” is a human.
- a subject can be one who has been previously diagnosed with or identified as suffering from or having a condition, disease, or disorder in need of treatment (e.g., kidney injury) or one or more complications related to the condition, disease, or disorder, and optionally, have already undergone treatment for the condition, disease, disorder, or the one or more complications related to the condition, disease, or disorder.
- a subject can also be one who has not been previously diagnosed as having a condition, disease, or disorder or one or more complications related to the condition, disease, or disorder.
- a subject can be one who exhibits one or more risk factors for a condition, disease, or disorder, or one or more complications related to the condition, disease, or disorder, or a subject who does not exhibit risk factors.
- a “subject in need” of treatment for a particular condition, disease, or disorder can be a subject suspected of having that condition, disease, or disorder, diagnosed as having that condition, disease, or disorder, already treated or being treated for that condition, disease, or disorder, not treated for that condition, disease, or disorder, or at risk of developing that condition, disease, or disorder.
- the subject is selected from the group consisting of a subject suspected of having a disease, a subject that has a disease, a subject diagnosed with a disease, a subject that has been treated for a disease, a subject that is being treated for a disease, and a subject that is at risk of developing a disease.
- samples or biological samples include cheek swab; mucus; whole blood, blood, serum; plasma; urine; saliva, semen; lymph; fecal extract; sputum; other body fluid or biofluid; cell sample; and tissue sample etc.
- the term also includes a mixture of the above-mentioned samples or biological samples.
- sample also includes untreated or pretreated (or pre-processed) biological samples.
- a sample or biological sample can comprise one or more cells from the subject.
- Subject samples or biological samples usually comprise derivatives of blood products, including blood, plasma and serum.
- the sample is a biological sample.
- the sample is blood.
- the sample is peripheral blood.
- body fluid or “bodily fluids” are liquids originating from inside the bodies of organisms.
- Bodily fluids include amniotic fluid, aqueous humour, vitreous humour, bile, blood (e.g., serum), breast milk, cerebrospinal fluid, cerumen (earwax), chyle, chyme, endolymph and perilymph, exudates, feces, female ejaculate, gastric acid, gastric juice, lymph, mucus (e.g., nasal drainage and phlegm), pericardial fluid, peritoneal fluid, pleural fluid, pus, rheum, saliva, sebum (skin oil), serous fluid, semen, sputum, synovial fluid, sweat, tears, urine, vaginal secretion, and vomit.
- blood e.g., serum
- breast milk e.g., breast milk
- cerebrospinal fluid cerumen (earwax)
- Extracellular bodily fluids include intravascular fluid (blood plasma), interstitial fluids, lymphatic fluid and transcellular fluid.
- Biological sample also includes a mixture of the above-mentioned body fluids.
- Biological samples may be untreated or pretreated (or pre-processed) biological samples.
- body fluid means urine. Sample collection procedures and devices known in the art are suitable for use with various embodiment of the present invention.
- sample collection procedures and devices include but are not limited to: phlebotomy tubes (e.g., a vacutainer blood/specimen collection device for collection and/or storage of the blood/specimen), dried blood spots, Microvette CB300 Capillary Collection Device (Sarstedt), HemaXis blood collection devices (microfluidic technology, Hemaxis), Volumetric Absorptive Microsampling (such as CE-IVD Mitra microsampling device for accurate dried blood sampling (Neoteryx), HemaSpotTM-HF Blood Collection Device, a tissue sample collection device; standard collection/storage device (e.g., a collection/storage device for collection and/or storage of a sample (e.g., blood, plasma, serum, urine, etc.); a dried blood spot sampling device.
- phlebotomy tubes e.g., a vacutainer blood/specimen collection device for collection and/or storage of the blood/specimen
- dried blood spots e.g.
- the Volumetric Absorptive Microsampling (VAMS 1M ) samples can be stored and mailed, and an assay can be performed remotely.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, -carboxyglutamate, and O-phosphoserine.
- amino acid residues comprising the peptide are “L-form” amino acid residues, however, it is recognized that in various embodiments, “D” amino acids can be incorporated into the peptide.
- Peptides also include amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
- the term applies to amino acids joined by a peptide linkage or by other, “modified linkages” (e.g., where the peptide bond is replaced by an a-ester, a f3-ester, a thioamide, phosphonamide, carbamate, hydroxylate, and the like (see, e.g., Spatola, (1983) Chern. Biochem. Amino Acids and Proteins 7: 267-357), where the amide is replaced with a saturated amine (see, e.g., Skiles et al., U.S. Pat.
- a protein refers to any of a class of nitrogenous organic compounds that comprise large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms.
- a protein may contain various modifications to the amino acid structure such as disulfide bond formation, phosphorylations and glycosylations.
- a linear chain of amino acid residues may be called a “polypeptide,” A protein contains at least one polypeptide.
- Antibody refers to a polypeptide ligand substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, which specifically binds and recognizes an epitope (e.g., an antigen).
- the recognized immunoglobulin genes include the kappa and lambda light chain constant region genes, the alpha, gamma, delta, epsilon and mu heavy chain constant region genes, and the myriad immunoglobulin variable region genes.
- Antibodies exist, e.g., as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases.
- solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
- the term “threshold” as used herein refers to the magnitude or intensity that must be exceeded for a certain reaction, phenomenon, result, or condition to occur or be considered relevant. The relevance can depend on context, e.g., it may refer to a positive, reactive or statistically significant relevance.
- binding assay is meant a biochemical assay wherein the biomarkers are detected by binding to an agent, such as an antibody, through which the detection process is carried out.
- the detection process may involve fluorescent or radioactive labels, and the like.
- the assay may involve immobilization of the biomarker, or may take place in solution.
- Immunoassay is an assay that uses an antibody to specifically bind an antigen (e.g., a marker).
- the immunoassay is characterized by the use of specific binding properties of a particular antibody to isolate, target, and/or quantify the antigen.
- Non-limiting examples of immunoassays include ELISA (enzyme-linked immunosorbent assay), immunoprecipitation, SISCAPA (stable isotope standards and capture by anti-peptide antibodies), Western blot, etc.
- Diagnostic means identifying the presence or nature of a pathologic condition, disease, or disorder and includes identifying patients who are at risk of developing a specific condition, disease or disorder. Diagnostic methods differ in their sensitivity and specificity.
- the “sensitivity” of a diagnostic assay is the percentage of diseased individuals who test positive (percent of “true positives”). Diseased individuals not detected by the assay are “false negatives.” Subjects who are not diseased and who test negative in the assay, are termed “true negatives.”
- the “specificity” of a diagnostic assay is 1 minus the false positive rate, where the “false positive” rate is defined as the proportion of those without the disease who test positive.
- a particular diagnostic method may not provide a definitive diagnosis of a condition, a disease, or a disorder, it suffices if the method provides a positive indication that aids in diagnosis.
- the term “statistically significant” or “significantly” refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p- value.
- the term “sensitivity” refers to the ability of a method to detect or identify the presence of a disease or condition in a subject.
- a high sensitivity means that the method correctly identifies the presence of PTI in the subject a large percentage of the time.
- a method described herein that correctly detects PTI in a subject 95% of the time the method is performed is said to have a sensitivity of 95%.
- a method described herein that can detect PTI in a subject provides a sensitivity of at least 70% (e.g., about 70%, about 72%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, or about 100%).
- methods provided herein that include detecting the presence of one or more members of two or more classes of biomarkers e.g., nucleic acid biomarkers and/or protein biomarkers
- the term “specificity” refers to the ability of a method to detect the presence of a disease or condition in a subject (e.g., the specificity of a method can be described as the ability of the method to identify the true positive over true negative rate in a subject and/or to distinguish a truly occurring sequence variant from a sequencing artifact or other closely related sequences).
- a high specificity means that the method correctly identifies the absence of kidney injury in the subject a large percentage of the time (e.g., the method does not incorrectly identify the presence of kidney injury in the subject a large percentage of the time).
- a method described herein that can detect the absence of kidney injury (e.g., normal) in a subject provides a specificity of at least 80% (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, or higher).
- a method having high specificity results in minimal or no false positive results (e.g., as compared to other methods). False positive results can arise from any source.
- methods provided herein that include detecting the presence of one or more members of two or more classes of biomarkers provide a higher specificity than methods that include detecting the presence of one or more members of only one class of biomarkers.
- detection may be used in the context of detecting biomarkers, detecting peptides, detecting proteins, or of detecting a condition, detecting a disease or a disorder (e.g., when positive assay results are obtained). In the latter context, “detecting” and “diagnosing” are considered synonymous when mere detection indicates the diagnosis.
- the term is also used synonymously with the term “measuring.”
- the terms “marker” or “biomarker” are used interchangeably herein, and in the context of the present invention refer to a protein or peptide (for example, protein or peptide associated with kidney injury as described herein) is differentially present in a sample taken from patients having a specific disease or disorder as compared to a control value, the control value consisting of, for example average or mean values in comparable samples taken from control subjects (e.g., a person with a negative diagnosis, normal or healthy subject).
- Biomarkers may be determined as specific peptides or proteins which may be detected by, for example, antibodies or mass spectroscopy.
- a mass spectroscopy or other profile of multiple antibodies may be used to determine multiple biomarkers, and differences between individual biomarkers and/or the partial or complete profile may be used for diagnosis.
- the biomarkers may be detected by antibodies, mass spectrometry, or combinations thereof.
- a “test amount” of a marker refers to an amount of a marker present in a sample being tested.
- a test amount can be either in absolute amount (e.g., g/mL) or a relative amount (e.g., relative intensity of signals).
- a “diagnostic amount” of a marker refers to an amount of a marker in a subject’s sample that is consistent with a diagnosis of a particular disease or disorder.
- a diagnostic amount can be either in absolute amount (e.g., ⁇ g/ml) or a relative amount (e.g., relative intensity of signals).
- a “control amount” of a marker can be any amount or a range of amount which is to be compared against a test amount of a marker.
- a control amount of a marker can be the amount of a marker in a person who does not suffer from the disease or disorder sought to be diagnosed
- a control amount can be either in absolute amount (e.g., ⁇ g/ml) or a relative amount (e.g., relative intensity of signals).
- the term “differentially present” or “change in level” refers to differences in the quantity and/or the frequency of a marker present in a sample taken from patients having a specific disease or condition as compared to a control subject.
- a marker can be present at an elevated level or at a decreased level in samples of patients with the disease or condition compared to a control value (e.g., determined from samples of control subjects).
- a marker can be detected at a higher frequency or at a lower frequency in samples of patients compared to samples of control subjects.
- a marker can be differentially present in terms of quantity, frequency or both as well as a ratio of differences between two or more specific modified amino acid residues and/or the protein itself.
- a marker can be differentially present in patients having PTI as compared to a control subject including patients having no PTI.
- a marker, compound, composition or substance is differentially present in a sample if the amount of the marker, compound, composition or substance in the sample (e.g., a patient having acute kidney injury) is statistically significantly different from the amount of the marker, compound, composition or substance in another sample (e.g., a patient having acute kidney injury or no kidney injury), or from a control value (e.g., an index or value representative of acute kidney injury or no kidney injury).
- a biomarker is differentially present between the two sets of samples if it is detected at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100% more frequently or less frequently observed in one set of samples (e.g., a patient having PTI) than the other set of samples (e.g., a patient having PTI or no PTI).
- cut-off points, etc. that represent a statistically significant difference to determine whether the marker is differentially present.
- the term “one or more of” refers to combinations of various biomarkers. The term encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 15 ,16 ,17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40... N, where “N” is the total number of biomarker proteins in the particular embodiment.
- the term also encompasses, and is interchangeably used with, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 15 ,16 ,17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40... N.
- biomarkers herein includes the phrase “one or more of” the biomarkers and, in particular, includes the “at least 1, at least 2, at least 3” and so forth language in each recited embodiment of a biomarker panel.
- Detectable moiety or a “label” refers to a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means.
- the detectable moiety is a stable isotope.
- the stable isotope is selected from the group consisting of 15 N, 13 C, 18 O and 2 H.
- “Route of administration” may refer to any administration pathway known in the art, including but not limited to aerosol, nasal, via inhalation, oral, anal, intra-anal, peri-anal, transmucosal, transdermal, parenteral, enteral, topical or local.
- detection thereby determines the levels of expression of the biomarkers in the biological sample; and the method can further comprise (c) comparing the levels of expression of the one or more biomarker proteins in the biological sample with predetermined threshold values, wherein levels of expression of at least one of the biomarker proteins above or below the predetermined threshold values indicates, for example, the subject has kidney injury, the severity of kidney injury, and/or is/will be responsive to kidney injury therapy.
- predetermined threshold values levels of expression of at least one of the biomarker proteins above or below the predetermined threshold values indicates, for example, the subject has kidney injury, the severity of kidney injury, and/or is/will be responsive to kidney injury therapy.
- Such embodiments can assist in identifying whether a subject has, for example, AKI versus normal.
- binding agents that can be effectively employed in such methods include, but are not limited to, antibodies or antigen-binding fragments thereof, aptamers, lectins and the like.
- any other suitable agent e.g., a peptide, an aptamer, or a small organic molecule
- a biomarker of the present invention is optionally used in place of the antibody in the above- described immunoassays.
- an aptamer that specifically binds a biomarker and/or one or more of its breakdown products might be used.
- Aptamers are nucleic acid-based molecules that bind specific ligands. Methods for making aptamers with a particular binding specificity are known as detailed in U.S. Patents No.5,475,096; No.5,670,637; No.
- the assay performed on the biological sample can comprise contacting the biological sample with one or more capture agents (e.g., antibodies, lectins, peptides, aptamer, etc., combinations thereof) to form a biomarker:capture agent complex.
- capture agents e.g., antibodies, lectins, peptides, aptamer, etc., combinations thereof.
- the complexes can then be detected and/or quantified.
- a subject can then be identified as having PTI, AKI, etc.
- a first, or capture, binding agent such as an antibody that specifically binds the protein biomarker of interest
- a suitable solid phase substrate or carrier is immobilized on a suitable solid phase substrate or carrier.
- the test biological sample is then contacted with the capture antibody and incubated for a desired period of time.
- a second, detection, antibody that binds to a different, non-overlapping, epitope on the biomarker (or to the bound capture antibody) is then used to detect binding of the polypeptide biomarker to the capture antibody.
- the detection antibody is preferably conjugated, either directly or indirectly, to a detectable moiety.
- detectable moieties examples include, but are not limited to, cheminescent and luminescent agents; fluorophores such as fluorescein, rhodamine and eosin; radioisotopes; colorimetric agents; and enzyme-substrate labels, such as biotin.
- a biotinylated lectin that specifically binds a biomarker can be added to a patient sample and a streptavidin labeled fluorescent marker that binds the biotinylated lectin bound to the biomarker is then added, and the biomarker is detected.
- the assay is a competitive binding assay, wherein labeled protein biomarker is used in place of the labeled detection antibody, and the labeled biomarker and any unlabeled biomarker present in the test sample compete for binding to the capture antibody.
- the amount of biomarker bound to the capture antibody can be determined based on the proportion of labeled biomarker detected.
- Solid phase substrates, or carriers, that can be effectively employed in such assays are well known to those of skill in the art and include, for example, 96 well microtiter plates, glass, paper, and microporous membranes constructed, for example, of nitrocellulose, nylon, polyvinylidene difluoride, polyester, cellulose acetate, mixed cellulose esters and polycarbonate.
- Suitable microporous membranes include, for example, those described in US Patent Application Publication no. US 2010/0093557 A1.
- Methods for the automation of immunoassays are well known in the art and include, for example, those described in U.S. Patent Nos.5,885,530, 4,981,785, 6,159,750 and 5,358,691.
- the presence of several different protein biomarkers in a test sample can be detected simultaneously using a multiplex assay, such as a multiplex ELISA.
- Multiplex assays offer the advantages of high throughput, a small volume of sample being required, and the ability to detect different proteins across a board dynamic range of concentrations.
- such methods employ an array, wherein multiple binding agents (for example capture antibodies) specific for multiple biomarkers are immobilized on a substrate, such as a membrane, with each capture agent being positioned at a specific, pre- determined, location on the substrate.
- a substrate such as a membrane
- Methods for performing assays employing such arrays include those described, for example, in US Patent Application Publication nos. US2010/0093557A1 and US2010/0190656A1, the disclosures of which are hereby specifically incorporated by reference.
- Multiplex arrays in several different formats based on the utilization of, for example, flow cytometry, chemiluminescence or electron-chemiluminesence technology, can be used.
- Flow cytometric multiplex arrays also known as bead-based multiplex arrays, include the Cytometric Bead Array (CBA) system from BD Biosciences (Bedford, Mass.) and multi- analyte profiling (xMAP®) technology from Luminex Corp. (Austin, Tex.), both of which employ bead sets which are distinguishable by flow cytometry.
- CBA Cytometric Bead Array
- xMAP® multi- analyte profiling
- Luminex Corp. Austintin, Tex.
- a multiplex ELISA from Quansys Biosciences (Logan, Utah) coats multiple specific capture antibodies at multiple spots (one antibody at one spot) in the same well on a 96-well microtiter plate. Chemiluminescence technology is then used to detect multiple biomarkers at the corresponding spots on the plate.
- the biomarkers of the present invention may be detected by means of an electrochemiluminescent assay developed by Meso Scale Discovery (Gaithersburg, MD). Electrochemiluminescence detection uses labels that emit light when electrochemically stimulated. Background signals are minimal because the stimulation mechanism (electricity) is decoupled from the signal (light). Labels are stable, non- radioactive and offer a choice of convenient coupling chemistries.
- proteins of the present invention can be detected by other suitable methods. Detection paradigms that can be employed to this end include optical methods, electrochemical methods (voltametry and amperometry techniques), atomic force microscopy, and radio frequency methods, e.g., multipolar resonance spectroscopy.
- Illustrative of optical methods are detection of fluorescence, luminescence, chemiluminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or interferometry).
- the protein biomarker proteins of the present invention can be captured and concentrated using nano particles.
- the proteins can be captured and concentrated using Nanotrap® technology (Ceres Nanosciences, Inc. (Manassas, VA)).
- the Nanotrap platform reduces pre-analytical variability by enabling biomarker enrichment, removal of high-abundance analytes, and by preventing degradation to highly labile analytes in an innovative, one-step collection workflow.
- Multiple analytes sequestered from a single sample can be concentrated and eluted into small volumes to effectively amplify, up to 100-fold or greater depending on the starting sample volume (Shafagati, 2014; Shafagati, 2013; Longo, et al., 2009), resulting in substantial improvements to downstream analytical sensitivity.
- a sample may also be analyzed by means of a biochip.
- Biochips generally comprise solid substrates and have a generally planar surface, to which a capture reagent (also called an adsorbent or affinity reagent) is attached. Frequently, the surface of a biochip comprises a plurality of addressable locations, each of which has the capture reagent bound there.
- Protein biochips are biochips adapted for the capture of polypeptides. Many protein biochips are described in the art. These include, for example, protein biochips produced by Ciphergen Biosystems, Inc. (Fremont, CA.), Invitrogen Corp. (Carlsbad, CA), Affymetrix, Inc. (Fremong, CA), Zyomyx (Hayward, CA), R&D Systems, Inc.
- the chip comprises a small wafer that carries a collection of binding agents bound to its surface in an orderly pattern, each binding agent occupying a specific position on the chip.
- the set of binding agents specifically bind to each of the one or more one or more of the biomarkers described herein.
- a few micro-liters of, for example, blood, serum or plasma are dropped on the chip array.
- Protein biomarkers present in the tested specimen bind to the binding agents specifically recognized by them.
- Subtype and amount of bound mark is detected and quantified using, for example, a fluorescently- labeled secondary, subtype-specific antibody.
- an optical reader is used for bound biomarker detection and quantification.
- a system can comprise a chip array and an optical reader.
- a chip is provided. III. Detection/Measurement of Nucleic Acid Markers
- Nucleic acids may be sequenced using sequencing methods such as next-generation sequencing, high-throughput sequencing, massively parallel sequencing, sequencing-by- synthesis, paired-end sequencing, single-molecule sequencing, nanopore sequencing, pyrosequencing, semiconductor sequencing, sequencing-by-ligation, sequencing-by- hybridization, RNA-Seq, Digital Gene Expression, Single Molecule Sequencing by Synthesis (SMSS), Clonal Single Molecule Array (Solexa), shotgun sequencing, Maxim-Gilbert sequencing, primer walking, and Sanger sequencing.
- SMSS Single Moleculencing by Synthesis
- Solexa Clonal Single Molecule Array
- Sequencing methods may comprise targeted sequencing, whole-genome sequencing (WGS), lowpass sequencing, bisulfite sequencing, whole-genome bisulfite sequencing (WGBS), or a combination thereof. Sequencing methods may include preparation of suitable libraries. Sequencing methods may include amplification of nucleic acids ( e.g., by targeted or universal amplification, such as PCR).
- Sequencing reads can be obtained from various sources including, for example, whole genome sequencing, whole exome-sequencing, targeted sequencing, next-generation sequencing, pyrosequencing, sequencing-by-synthesis, ion semiconductor sequencing, tag- based next generation sequencing semiconductor sequencing, single-molecule sequencing, nanopore sequencing, sequencing-by-ligation, sequencing-by-hybridization, Digital Gene Expression (DGE), massively parallel sequencing, Clonal Single Molecule Array (Solexa/Illumina), sequencing using PacBio, and Sequencing by Oligonucleotide Ligation and Detection (SOLiD).
- DGE Digital Gene Expression
- DGE massively parallel sequencing
- Solexa/Illumina Solexa/Illumina
- sequencing using PacBio and Sequencing by Oligonucleotide Ligation and Detection (SOLiD).
- sequencing comprises modification of a nucleic acid molecule or fragment thereof, for example, by ligating a barcode, a unique molecular identifier (UMI), or another tag to the nucleic acid molecule or fragment thereof.
- a barcode is a unique barcode (i.e., a UMI).
- a barcode is non-unique, and barcode sequences can be used in connection with endogenous sequence information such as the start and stop sequences of a target nucleic acid (e.g., the target nucleic acid is flanked by the barcode and the barcode sequences, in connection with the sequences at the beginning and end of the target nucleic acid, creates a uniquely tagged molecule).
- Sequencing reads may be processed using methods such as de-multiplexing, de- deduplication (e.g., using unique molecular identifiers, UMIs), adapter-trimming, quality filtering, GC correction, amplification bias correction, correction of batch effects, depth normalization, removal of sex chromosomes, and removal of poor-quality genomic bins.)
- sequencing reads may be aligned to a reference nucleic acid sequence.
- the reference nucleic acid sequence is a human reference genome.
- the human reference genome can be hg19, hg38, GrCH38, GrCH37, NA12878, or GM12878. IV.
- Methods of Treatment Treatment for AKI can include, but are not limited to, renal replacement therapy, angiotensin-converting-enzyme inhibitors, Ang II type I (ATI) blockers, corticosteroids, immunosuppressants, artemsinin and derivatives thereof, drag-reducing polymers, endothelin subtype A receptor antagonists (pro)renin receptor antagonists and 5-HT 3 -tareting drugs.
- a treatment comprises renal replacement therapy and can include, but is not limited to, hemodialysis, peritoneal dialysis, hemofiltration and renal transplantation.
- a kidney treatment can also include angiotensin-converting-enzyme (ACE) inhibitor, an Ang II type I (ATI) blocker, corticosteroids, or an immunosuppressant.
- ACE angiotensin-converting-enzyme
- ATI Ang II type I
- a treatment comprises artemisinin and derivatives thereof. Examples includes claims 1-14 of WO2014/090306. Another examples is the derivative Artesunate. See also U.S. Patent Application Publication No.2008/0139642 and WO2010/110747.
- a treatment comprises a drag-reducing polymer (DRP).
- WO2013055702 describes methods for treating AKI using DRPs: DNA, RNA, PEO, polyacrylamide, hyaluronic acid, hyaluronate, rhamnogalactogalacturonan, aloe vera extract, polyethyleneimine (with hydrophilic pendant groups), glucosaminoglycans, other polyglycans, polyvinylformamide, polyphosphates, polyvinylamine, polyvinylalcohol, polyvinylpyrrolidone, polyacryhc acid, polyacrylamide, or combinations of the foregoing.
- WO2014138738 describes methods of treating AKI using endothelin subtype A receptor (ETA) receptor antagonist such as atrasentan.
- ETA endothelin subtype A receptor
- ABT-627 refers to (2R,3R,4S)-4-(l,3-benzodioxol-5-yl)-l-[2-(dibutylamino)-2-oxoethyl]-2- (4-methoxyphenyl)pyrrolidine-3-carboxylic acid salts thereof such as the HC1 salt of atrasentan.
- endothelin subtype A receptor antagonist or “ETA receptor antagonist” or “ETA receptor inhibitor” refers to any compound that inhibits the effect of ET- 1 signaling through the endothelin subtype A receptor.
- ETA receptor antagonists include, but are not limited to, ambrisentan, atrasentan, avosentan, BMS 193884, BQ-123, CI-1020, clazosentan, darusentan, edonentan, S-0139, SB-209670, sitaxsentan, TA- 0201, tarasentan, TBC 3711, tezosentan, YM-598, ZD-1611, ZD-4054, and salts, esters, prodrugs, metabolites, tautomers, racemates and enantiomers thereof.
- a treatment comprises a (pro) renin receptor (PRR) antagonist.
- PRR renin receptor
- PRR antagonists can be polypeptides or small molecules.
- Examples of functional PRR antagonist polypeptides include, but are not limited to, SEQ ID NOS:1-4 in WO2016/106080.
- WO2022099027 describes the use of 5-HT 3 -targeting drugs for treatment of acute kidney injury.
- Such drugs comprise one or more of ondansetron, granisetron, dolasetron, palonosetron, alosetron, cilansetron, tropisetron, ramosetron, or a pharmaceutically- acceptable salt or solvate of any of the preceding.
- Kidney treatments include, but are not limited to, renal replacement therapy, angiotensin-converting-enzyme inhibitors, Ang II type I (ATI) blockers, corticosteroids, immunosuppressants, artemsinin and derivatives thereof, drag-reducing polymers, endothelin subtype A receptor antagonists (pro)renin receptor antagonists and 5-HT 3 -tareting drugs.
- a treatment comprises renal replacement therapy and can include, but is not limited to, haemodialysis, peritoneal dialysis, hemofiltration and renal transplantation.
- a kidney treatment can also include angiotensin-converting-enzyme (ACE) inhibitor, an Ang II type I (ATI) blocker, corticosteroids, or an immunosuppressant.
- ACE angiotensin-converting-enzyme
- ATI Ang II type I
- a treatment comprises artemisinin and derivatives thereof. Examples includes claims 1-14 of WO2014/090306. Another examples is the derivative Artesunate. See also U.S. Patent Application Publication No.2008/0139642 and WO2010/110747.
- a treatment comprises a drag-reducing polymer (DRP).
- WO2013055702 describes methods for treating AKI using DRPs: DNA, RNA, PEO, polyacrylamide, hyaluronic acid, hyaluronate, rhamnogalactogalacturonan, aloe vera extract, polyethyleneimine (with hydrophilic pendant groups), glucosaminoglycans, other polyglycans, polyvinylformamide, polyphosphates, polyvinylamine, polyvinylalcohol, polyvinylpyrrolidone, polyacryhc acid, polyacrylamide, or combinations of the foregoing.
- WO2014138738 describes methods of treating AKI using endothelin subtype A receptor (ETA) receptor antagonist such as atrasentan.
- ETA endothelin subtype A receptor
- ABT-627 refers to (2R,3R,4S)-4-(l,3-benzodioxol-5-yl)-l-[2-(dibutylamino)-2-oxoethyl]-2- (4-methoxyphenyl)pyrrolidine-3-carboxylic acid salts thereof such as the HC1 salt of atrasentan.
- endothelin subtype A receptor antagonist or “ETA receptor antagonist” or “ETA receptor inhibitor” refers to any compound that inhibits the effect of ET- 1 signaling through the endothelin subtype A receptor.
- ETA receptor antagonists include, but are not limited to, ambrisentan, atrasentan, avosentan, BMS 193884, BQ-123, CI-1020, clazosentan, darusentan, edonentan, S-0139, SB-209670, sitaxsentan, TA- 0201, tarasentan, TBC 3711, tezosentan, YM-598, ZD-1611, ZD-4054, and salts, esters, prodrugs, metabolites, tautomers, racemates and enantiomers thereof.
- a treatment comprises a (pro) renin receptor (PRR) antagonist.
- PRR renin receptor
- PRR antagonists can be polypeptides or small molecules.
- Examples of functional PRR antagonist polypeptides include, but are not limited to, SEQ ID NOS:1-4 in WO2016/106080.
- WO2022099027 describes the use of 5-HT 3 -targeting drugs for treatment of acute kidney injury. Such drugs comprise one or more of ondansetron, granisetron, dolasetron, palonosetron, alosetron, cilansetron, tropisetron, ramosetron, or a pharmaceutically- acceptable salt or solvate of any of the preceding.
- Kits In another aspect, the present invention provides kits for detecting one or more biomarkers. The exact nature of the components configured in the inventive kit depends on its intended purpose.
- the kit is configured particularly for human subjects.
- the materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility.
- the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures.
- the components are typically contained in suitable packaging material(s).
- packaging material refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like.
- the packaging material is constructed by well-known methods, to provide a sterile, contaminant-free environment.
- the term “package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding the individual kit components.
- the packaging material generally has an external label which indicates the contents and/or purpose of the kit and/or its components.
- the present invention provides a kit comprising: (a) one or more internal standards suitable for measurement of one or more biomarkers including by any one or more of mass spectrometry, antibody method, antibodies, lectins, nucleic acid aptamer method, nucleic acid aptamers, immunoassay, ELISA, immunoprecipitation, SISCAPA, Western blot, PCR (qPCR, digital PCR, etc.) or combinations thereof; and (b) reagents and instructions for sample processing, preparation and biomarker measurement/detection.
- the kit can further comprise (c) instructions for using the kit to measure biomarkers in a sample obtained from the subject.
- the kit comprises reagents necessary for processing of samples and performance of an assay.
- the assay is an immunoassay such as an ELISA.
- the kit comprises a substrate for performing the assay (e.g., a 96-well polystyrene plate).
- the substrate can be coated with antibodies specific for a biomarker protein(s).
- the kit can comprise a detection antibody including, for example, a polyclonal antibody/ies specific for a biomarker protein(s) conjugated to a detectable moiety or label (e.g., horseradish peroxidase).
- the kit can also comprise a standard, e.g., a human protein standard.
- the kit can also comprise one or more of a buffer diluent, calibrator diluent, wash buffer concentrate, color reagent, stop solution and plate sealers (e.g., adhesive strip).
- the kit may comprise a solid support, such as a chip, microtiter plate (e.g., a 96-well plate), bead, or resin having protein biomarker capture reagents attached thereon.
- the kit may further comprise a means for detecting the protein biomarkers, such as antibodies, and a secondary antibody-signal complex such as horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG antibody and tetramethyl benzidine (TMB) as a substrate for HRP.
- HRP horseradish peroxidase
- TMB tetramethyl benzidine
- the kit can comprise magnetic beads conjugated to the antibodies (or separate containers thereof for later conjugation).
- the kit can further comprise detection antibodies, for example, biotinylated antibodies or lectins that can be detected using, for example, streptavidin labeled fluorescent markers such as phycoerythrin.
- the kit can be configured to perform the assay in a singleplex or multiplex format.
- the kit may be provided as an immuno-chromatography strip comprising a membrane on which the antibodies are immobilized, and a means for detecting, e.g., gold particle bound antibodies, where the membrane, includes NC membrane and PVDF membrane.
- kits may comprise a plastic plate on which a sample application pad, gold particle bound antibodies temporally immobilized on a glass fiber filter, a nitrocellulose membrane on which antibody bands and a secondary antibody band are immobilized and an absorbent pad are positioned in a serial manner, so as to keep continuous capillary flow of the sample.
- a kit comprises one or more of (a) magnetic beads for conjugating to antibodies that specifically bind biomarker proteins of interest; (b) monoclonal antibodies that specifically bind the biomarker proteins of interest; (c) biotinylated immunoglobulin G detection antibodies; (d) biotinylated lectins that specifically bind the biomarker proteins of interest; and (e) streptavidin labeled fluorescent marker.
- a subject can be diagnosed by adding a biological sample (e.g., peripheral blood) from the patient to the kit and detecting the relevant protein biomarkers conjugated with antibodies and/or lectins, specifically, by a method which comprises the steps of: (i) collecting serum from the patient; (ii) adding peripheral blood from patient to a diagnostic kit; and, (iii) detecting the protein biomarkers conjugated with antibodies/lectins. If the biomarkers are present in the sample, the antibodies/lectins will bind to the sample, or a portion thereof. In other kit and diagnostic embodiments, peripheral blood will not be collected from the patient (i.e., it is already collected).
- a biological sample e.g., peripheral blood
- the sample may comprise a urine, blood, plasma sweat, tissue, or a clinical sample.
- the kit can also comprise a washing solution or instructions for making a washing solution, in which the combination of the capture reagents and the washing solution allows capture of the protein biomarkers on the solid support for subsequent detection by, e.g., antibodies/lectins or mass spectrometry.
- a kit can comprise instructions for suitable operational parameters in the form of a label or separate insert. For example, the instructions may inform a consumer about how to collect the sample, etc.
- the kit can comprise one or more containers with protein biomarker samples, to be used as standard(s) for calibration or normalization.
- the kit comprises reagents and components necessary for performing an electrochemiluminescent ELISA.
- the kit comprises a reagent that permits quantification of one or more of the nucleic acid markers described herein.
- the kit comprises: (i) at least one reagent that allows quantification (e.g., determining the abundance, concentration or level) of an expression product of one or more of nucleic acid markers in a biological sample; and optionally (ii) instructions for using the at least one reagent.
- the kit can further comprise reagents for detection/measurement of other biomarkers.
- a nucleic acid-based detection kit may include a primer or probe that specifically hybridizes to a target polynucleotide.
- the kit can further include a target biomarker polynucleotide to be used as a positive control.
- enzymes suitable for amplifying nucleic acids including various polymerases (reverse transcriptase, Taq, SequenaseTM, DNA ligase etc., depending on the nucleic acid amplification technique employed), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.
- Such kits also generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each primer or probe.
- the kit is provided as a PCR kit comprising primers that specifically bind to one or more of the nucleic acid biomarkers described herein.
- the kit can further comprise substrates and other reagents necessary for conducting PCR (e.g., quantitative real-time PCR, digital PCR).
- the kit can be configured to conduct singleplex or multiplex PCR.
- the kit can further comprise instructions for carrying out the PCR reaction(s).
- the biological sample obtained from a subject may be manipulated to extract nucleic acid.
- the nucleic acids are contacted with primers that specifically bind the target biomarkers to form a primer:biomarker complex.
- the complexes can then be amplified and detected/quantified/measured to determine the levels of one or more biomarkers.
- the subject can then be identified as having myocardial injury based on a comparison of the measured levels of one or more biomarkers to one or more reference controls.
- the reagents described herein which may be optionally associated with detectable labels, can be presented in the format of a microfluidics card, a chip or chamber, a microarray or a kit adapted for use with the assays described in the examples or below, e.g., RT-PCR, Q PCR, digital PCR techniques described herein.
- reaction conditions e.g., component concentrations, desired solvents, solvent mixtures, temperatures, pressures and other reaction ranges and conditions that can be used to optimize the product purity and yield obtained from the described process. Only reasonable and routine experimentation will be required to optimize such process conditions.
- EXAMPLE 1 Analysis Of The Human Kidney Transcriptome And Plasma Proteome Identifies Novel Biomarkers Of Proximal Tubule Maladaptation To Injury
- Acute kidney injury (AKI) is a common complication during hospitalization and can affect 15%-20% of hospitalized patients (1). Patients with AKI have a twofold increase in the risk of in-hospital death and a fourfold increase in the risk of developing chronic kidney disease (CKD) or experiencing CKD progression (2, 3).
- CKD chronic kidney disease
- kidney ischemia-reperfusion injury (IRI) models of AKI suggests that kidney ischemia results in significant transcriptional changes in the proximal tubule (PT) (4). Although most PT cells under AKI stress can be fully repaired, a distinct subpopulation of PT cells enters a maladaptive, senescent phenotype that may fail to repair, leading to inflammation and fibrosis (4). This pathophysiological process suggests that PT maladaptation may mediate AKI progression, incomplete recovery, and subsequent development of CKD. Despite the increasingly detailed knowledge derived from mouse AKI models, there may be important distinctions between humans and mice in renal tubular responses to injury(5).
- the present inventors aimed to investigate transcriptional changes in PT cells in response to injury in hospitalized patients with AKI.
- the present inventors developed a multiomics approach that integrates the kidney transcriptome and plasma proteome to identify biomarkers of PT maladaptation and determine their associations with severe AKI in patients undergoing cardiac surgery.
- the present inventors hypothesized that maladaptive PT cells that are enriched in proinflammatory and profibrotic pathways would be observed in hospitalized patients with AKI caused by diverse etiologies.
- the present inventors also postulated that in patients undergoing cardiac surgery, plasma proteins linked to the transcriptomic signatures of maladaptive PT cells would be associated with the development of severe AKI, as well as post-AKI kidney atrophy in mouse models of AKI.
- KPMP is an NIDDK-sponsored, ongoing, prospective, observational cohort study of participants with AKI and CKD receiving kidney biopsies (11).
- Participants with AKI were recruited if they developed AKI during hospitalization, defined as an increase in serum creatinine by 50% from their baseline, defined as the nearest outpatient serum creatinine levels 7-365 days before hospitalization, and had baseline eGFR >45 mL/min/1.73 m 2 .
- Biopsies were obtained from 13 hospitalized participants with AKI who consented to research biopsies at 4 recruitment sites across the United States: Johns Hopkins Hospital, Yale–New Haven Hospital, University of Pittsburgh Medical Center, and Columbia University Medical Center. Additional biopsies were obtained from 4 hospitalized participants with COVID-19–associated AKI at Johns Hopkins Hospital. Healthy reference tissues were obtained from nontumor regions of kidney tissue after tumor nephrectomy in 3 participants and from intraoperative kidney biopsy in 4 participants undergoing urological procedures for nephrolithiasis removal in the HuBMAP consortium at Washington University at St. Louis. All samples were collected after informed consent and with the approval of the local ethics committees. Tissue processing and single- nucleus isolation were performed at Washington University at St.
- the TRIBE-AKI study was among the first few pioneering studies to explore the prognostic values of kidney disease biomarkers in AKI, the proteomic data is newly generated, and this is the first investigation of proteomic data with AKI in this cohort.
- the present inventors validated the proteomic findings in 2 independent cohorts.
- the first validation cohort was the pediatric cardiac surgery study cohort, a prospective cohort of children who underwent cardiac surgery for the repair of congenital heart disease at 3 academic centers in North America from 2007 to 2010. Children were excluded if they had a history of kidney transplantation or dialysis (55).
- the second validation cohort comprised marathon runners participating in the 2015 Hartford Marathon (Connecticut, US) (34).
- the present inventors further validated the gene expression of biomarkers of maladaptive PT and PT cells at healthy states in 2 mouse models with different repair capacities after IRI (repair and atrophy models), as the present inventors previously reported (35), and in a mouse model of AAN presenting as AKI-to-CKD transition. All human subject research studies were approved by each institution’s research ethics board, and all animal protocols were approved by the Yale University Animal Care and Use Committee. Human snRNA-seq data library preparation, preprocessing, and analysis. The present inventors used the Cell Ranger 7.0 pipeline to align snRNA-seq FASTQ files to the human hg38 reference genome.
- the present inventors then used CellBender to remove ambient RNA contamination and DoubletDetection to remove doublets (56, 57).
- the present inventors used Seurat v4 for data preprocessing and analyses, including log normalization, scaling, clustering, dimension reduction, and examination of differential gene expression (58).
- the present inventors excluded low-quality nuclei with less than 200 or more than 7,500 genes detected (12) (preprint) .
- the present inventors removed unique molecular identifiers mapped to mitochondrial RNA from analysis and combined all samples for further processing. To correct for batch effects, the present inventors performed data integration using reciprocal principal component analysis on 2,000 highly variable genes across each sample after log-normalization and scaling.
- the present inventors then performed principal component analysis in the integrated dataset, and chose the 15 principal components determined by using the ElbowPlot function in Seurat.
- the present inventors further performed dimension reduction to a uniform manifold approximation and projection (UMAP) plot and performed Louvain clustering using a resolution of 0.5 after k-nearest neighbor embedding.
- UMAP uniform manifold approximation and projection
- the canonical markers of major kidney cell types used are: PT: CUBN and SLC5A12; thin limb: SLC44A5; thick ascending limb: UMOD and SLC12A1; distal convoluted tubule: SLC12A3; connecting tubule: CALB1; principal cell: AQP2, SCNN1G; intercalated A cell, SLC4A1; intercalated B cell, SLC26A4; podocyte, NPHS2; endothelium, FLT1; fibroblast, ACTA2 and COL1A1; and immune cell, CD163, IL7R, NKG7, MS4A1, MZB1, HLA-DQA1, and MS4A2.
- the present inventors focused the present inventors’ further analysis on PT subclusters.
- the present inventors obtained lists of differentially-expressed genes for each PT subcluster by comparing gene expression in that subcluster to that of other subclusters using the Wilcoxon test (FindAllMarkers function in Seurat) and accounting for multiple comparisons using the false discovery rate.
- the present inventors included all differentially- expressed genes and performed GSEA using the FGSEA package (59) (preprint) .
- the present inventors defined PT maladaptation as PT cells with near-complete dedifferentiation and enrichment of proinflammatory and profibrotic genes and pathways. Gene regulatory network analysis.
- the present inventors used pySCENIC for gene regulatory network analysis (60).
- the present inventors focused on the analysis of PT nuclei data in participants with AKI and retained 4,247 highly variable genes (minimal dispersion 0.4 using Scanpy) for analysis (61).
- the present inventors generated coexpression networks via Epoch and cell regulatory networks of PT nuclei with the human hg38 reference genome for cis-regulatory analysis (32).
- the present inventors obtained the gene-motif ranking of 10 kb around the transcription start site (62).
- the present inventors further plotted the top 10% of transcription factor–target gene pairs using the igraph package and performed community detection using the Louvain clustering algorithm.
- Proteomic measurements were performed using the Slow Off- Rate Modified Aptamer (SOMA)-based capture array on preoperative and the first postoperative plasma or urine samples.
- Plasma and urine samples were shipped to SomaLogic (Boulder, CO) for identification and quantification of low-abundance plasma proteins by SOMAscan, which uses easily quantifiable, chemically-modified oligonucleotides as binding reagents for proteins and protein complexes (63).
- Protein analyte measurements underwent the SOMAscan data standardization and normalization process and were matched to their corresponding genes. Outcome definition for the primary analysis in TRIBE-AKI adult participants. The primary outcome of the present inventors’ analysis is severe (KDIGO stage 2 and 3) AKI.
- stage 2 AKI as a twofold increase in serum creatinine from baseline to the peak postoperative value.
- stage 3 AKI as a threefold increase in serum creatinine from baseline to the peak postoperative value or requiring kidney replacement therapy.
- the prospective KPMP cohort allowed us to internally validate the present inventors’ biomarker findings in 3 recently enrolled participants whose snRNA-seq data were not included in the biomarker discovery phase. In these 3 participants, snRNA-seq libraries were prepared using the approach described earlier.
- the present inventors used the metadata from 17 participants with AKI from the discovery phase as reference, and predicted PT cell subtypes using pySingleCellNet, a random forest–based classifier (64).
- the present inventors downloaded an snRNA-seq library of post-mortem kidney tissues from an independent cohort of 8 critically-ill patients with AKI published by Hinze et al (GSE210622) (33), and performed clustering of PT cells using the approach discussed by these investigators. Biomarker gene expression patterns were explored in the internal and external validation cohorts. Animal surgery and experimental protocol.
- the present inventors compared 2 mouse models of IRI (repair and atrophy) that the present inventors previously reported (35) and examined the gene expression of 4 biomarkers associated with (mal)adaptive kidney repair following IRI. Additionally, the present inventors determined the gene expression kinetics in a mouse model of AAN that presents as AKI-to-CKD transition. All animal protocols were approved by the Yale University Animal Care and Use Committee. Male C57BL/6 (Envigo, Indianapolis, IN) wild-type mice (aged 9-11 weeks) were used in this work.
- mice were treated with a single 5 mg/kg body weight dose of aristolochic acid (Sigma-Aldrich) intraperitonially, and 4 mice were treated with vehicle. Blood was collected on days 3, 7, 10, 14, and 21 after injection. Seven AAN-treated mice were sacrificed and kidneys were harvested on days 7 and 21 post- injection. Mice treated with the vehicle were used as experimental controls and were sacrificed on day 21 post-injection. Blood urea nitrogen (BUN) was measured using Stanbio Diagnostic Set (Fisher Scientific).
- BUN Blood urea nitrogen
- the present inventors downloaded a publicly available snRNA-seq dataset of mouse AAN kidneys published by Lu et al (37), and compared biomarker gene expression between the kidney fibrosis phase (day 28) and baseline. Quantitative PCR analysis.
- Whole-kidney RNA was extracted with an RNeasy Mini kit (Qiagen, Germantown, MD) and reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories).
- Gene expression analysis was determined by quantitative real-time PCR using an iCycler iQ (Bio-Rad Laboratories) and normalized to hypoxanthine-guanine phosphoribosyltransferase (Hprt).
- Primers used include mouse Col23a1 (forward: GGCATAAGTGATCCTCAGACATAA (SEQ ID NO:1)and reverse: AGTTGGCGCATCCCATAAA (SEQ ID NO:2)), Enpp6 (forward: GGAACACATGACCGTGTATGA (SEQ ID NO:3) and reverse: TCTCTCGACTCTCTGCTATGAA (SEQ ID NO:4)), Tgfb2 (forward: AGAGGGATCTTGGATGGAAATG (SEQ ID NO:5) and reverse: TGAGGACTTTGGTGTGTTGAG (SEQ ID NO:6)), Proc (forward: CCTCAAACGAGACACAGACAGACTTAG (SEQ ID NO:7) and reverse: GATCATACTCACCAAGCCTCAC (SEQ ID NO:8)), and Hprt (forward: CAGTACAGCCCCAAAATGGT (SEQ ID NO:9) and reverse: CAAGGGCATATCCAACAACAACA (SEQ ID NO:10)).
- the present inventors hypothesize that cardiac surgery will result in PT injury and subsequent maladaptation and that a postoperative increase in protein biomarkers from maladaptive PT cells will be associated with development of severe AKI in the hospital.
- the present inventors retained proteins if their median levels were higher postoperatively and the median postoperative levels were higher in patients with severe AKI than in patients without severe AKI by Wilcoxon tests.
- the present inventors then manually examined gene expression across all cells and selected those genes specific to the maladaptive PT subcluster. This process yielded 4 biomarkers of PT maladaptation for further analysis.
- the present inventors additionally determined correlations between preoperative maladaptation biomarkers and baseline eGFR using Spearman correlation.
- biomarkers of PT cells at healthy states that decreased in maladaptive states the present inventors applied a similar workflow. These biomarkers can be viewed as “inverse” biomarkers of PT maladaptation (i.e., lower levels indicate more severe PT maladaptation).
- the present inventors first identified upregulated genes with log2-fold changes >0.25 in healthy PT cells compared to diseased PT subclusters and extracted the corresponding proteins. The present inventors retained proteins if their median levels were lower postoperatively and if the median postoperative protein levels were lower in patients with severe AKI than in patients without severe AKI by Wilcoxon tests.
- Model 1 was the univariable model including postoperative biomarkers only.
- Model 2 adjusted for biomarkers, age, sex, and race.
- Model 3 adjusted for the variables in model 2 as well as baseline eGFR, hypertension, diabetes mellitus, myocardial infarction, and heart failure.
- Model 4 adjusted for the variables in model 3 as well as the baseline urine albumin to creatinine ratio.
- Model 5 was derived from model 4 with additional adjustment for preoperative biomarker values.
- the present inventors next determined if the addition of biomarkers of PT maladaptation and PT cells at healthy states can further improve the prediction of severe AKI beyond other kidney disease biomarkers (kidney injury molecule-1, neutrophil gelatinase- associated lipocalin, and soluble urokinase plasminogen activator receptor) and other clinical variables (age, sex, Black race, pre-operative eGFR, albuminuria, hypertension, diabetes, myocardial infarction, and heart failure).
- the present inventors compared the area under the curve of the logistic regression models using 1,000 bootstrap samples.
- the present inventors compared the protein levels in the first postoperative urine samples with the preoperative samples. For validation in pediatric cardiac surgery participants, the present inventors compared protein levels in the first postoperative samples versus preoperative samples. For validation in marathon runners, the present inventors compared protein levels in the immediate postrace samples versus the prerace samples. The present inventors performed these comparisons using pairwise Wilcoxon tests. For the present inventors’ mouse models of IRI followed by repair and atrophy, the present inventors used two-way ANOVA (GraphPad Prism 8) for model comparison to test whether there was a difference between the models and in the time course, followed by Sidak post-tests for subgroup comparison at each timepoint.
- ANOVA GraphPad Prism 8
- the present inventors determined the Pearson correlation of biomarker genes with fibrosis marker genes in the recovery phase of AKI (days 7, 14, and 30). For the mouse model of AAN, the present inventors used ANOVA followed by Tukey tests for comparisons across subgroups, and Student t tests to determine the difference between gene expression in the AKI (7 day) and CKD (21 day) phases compared with baseline. The present inventors conducted a complete case analysis and considered a two-sided P value ⁇ 0.05 as statistically significant. All statistical analyses were performed using R version 4.1.2. Data and materials availability.
- the snRNA-seq human AKI data have been deposited in the KPMP data repository (https://atlas.kpmp.org/repository/) and the code used for analysis is available at GitHub (https://github.com/ywen1407/snRNAseq_AKI_aptamer_PT_maladaptation).
- the proteomic data analyzed in this work is not publicly available because widespread sharing of TRIBE- AKI study data was not stipulated in the ethics approval for the study.
- the TRIBE-AKI principal investigator Chorag R. Parikh, chirag.parikh@jhmi.edu
- Single-nucleus RNA sequencing reveals diverse PT cell phenotypes in human AKI.
- the present inventors used single-nucleus RNA sequencing (snRNA-seq) to profile 120,985 nuclei from 17 participants with AKI and 7 healthy participants, including data from 13 participants (6 with AKI and 7 healthy references) that were published previously and 11 participants with AKI whose data were unpublished (Supplemental Data S1, not shown) (12) (preprint) .
- the median number of unique molecular identifiers per nucleus was 2,941 (IQR: 2,069-3,620) and the median number of genes detected per nucleus was 1,720 (IQR: 891- 2843) (Supplemental Data S2, not shown).
- the present inventors identified clusters of all major kidney, stromal, and immune cell types in participants with and without AKI (FIG.1A, 1B).
- the present inventors focused the present inventors’ analysis to PT cells, which included 6 subclusters, 2 of which (PT.S1S2 and PT.S3) were enriched in mature PT markers (SLC5A12, SLC22A6, SLC22A7, and SLC7A13) (FIG.1C-1E, Supplemental Data S3, not shown).
- GSEA Gene set enrichment analysis of these 2 subclusters demonstrated an enrichment in gene ontology terms involved in the physiological function of PT cells, such as organic anion transport and fatty acid metabolism (FIG.1F, Supplemental Data S4, not shown), consistent with their relatively healthy states.
- FIG.1D 4 subclusters of PT cells with decreased expression of mature PT markers
- the present inventors observed a subcluster of PT cells enriched in markers of proliferation (TOP2A and MKI-67).
- the other 3 subclusters exhibited 2 distinct phenotypes based on marker gene expression and pathway analysis.
- SPP1 markers of cellular stress
- FTH1 and FTL iron hemostasis
- FTH1 and FTL injury
- SOX4 and CD24 MHC class I
- HLA-A HLA-A
- HLA-C HLA-C
- HLA-E MHC class II
- CD74 and HLA-DRA MHC class II
- the present inventors refer to the terminally dedifferentiated subcluster hereafter as maladaptive PT because it exhibits similar marker gene expression (e.g., VCAM1, HAVCR1, and DCDC2) and pathway enrichment as the mouse “failed to repair” PT described in a previous study in mice (4).
- marker gene expression e.g., VCAM1, HAVCR1, and DCDC2
- pathway enrichment as the mouse “failed to repair” PT described in a previous study in mice (4).
- the present inventors observed upregulation of ACSL4 and downregulation of GCLC, GSS, and GPX4 (FIG.1G), indicating potential activation of the ferrotopsis pathway and loss of the capacity to remove toxic polyunsaturated fatty acid–phospholipid hydroperoxides (13).
- necroptosis markers such as death receptors (FAS, TNFRSF10A, and TNFRSF10B) and the necroptotic executioner MLKL (FIG.1H).
- FAS death receptors
- TNFRSF10A TNFRSF10A
- TNFRSF10B necroptotic executioner MLKL
- Gene regulatory network analysis identifies distinct regulators activated in PT cells in healthy and diseased states.
- the present inventors next used pySCENIC to explore whether the gene regulatory structure (i.e., regulons) in PT cells in diseased states was deranged compared to the healthy state in participants with AKI. Similar to several mouse AKI studies, the present inventors observed enrichment of regulons (HNF1A, HNF4A, NR1H3, MAF, RXRA, and MLXIPL) involved in promoting and maintaining PT cell differentiation, stabilizing mitochondrial structure, and maintaining mitochondrial lipid metabolism in PT cells at healthy states (FIG.2A, Supplemental Data S5-S6, not shown) (15–20).
- regulons HNF1A, HNF4A, NR1H3, MAF, RXRA, and MLXIPL
- RXRA is also known to protect tubules from oxidative stress and prevent the AKI-to-CKD transition (21). Regulon enrichment diminished significantly as PT cells progressed toward the maladaptive state. Specifically, maladaptive PT cells were enriched in SOX4, a key regulator promoting nephrogenesis, and in STAT5A, a regulator that drives abnormal tubular cell growth (22–24). Consistent with the profibrotic and proinflammatory signatures from GSEA, maladaptive PT upregulated TEAD2, a regulator governing the epithelial-to-mesenchymal transition, and IRF8, a transcription factor promoting inflammatory responses (25–27).
- the present inventors further examined the gene expression of these 39 proteins in KPMP participants and identified 4 proteins that were relatively specific to maladaptive PT cells as candidate biomarkers of PT maladaptation (FIG.4A, FIG.5).
- the present inventors also identified 320 genes that were downregulated as PT cells progressed from healthy to maladaptive states and measured the encoded proteins using SOMAscan. Among these, 192 proteins were lower postoperatively and 38 were significantly lower in patients who developed severe AKI.
- the present inventors further examined expression of the genes encoding these 38 proteins in KPMP participants and identified 5 that were specifically enriched in healthy PT cells and downregulated in maladaptive PT cells (FIG. 4A, FIG.6).
- Pre- and postoperative protein levels and their fold changes are shown in Table 4 and Table 5, respectively.
- Table 3 Using multivariable logistic regression with sequential adjustment of covariates, the present inventors observed strong and positive associations between postoperative maladaptation biomarkers and the development of severe AKI (Table 3).
- NLGN4X, COL23A1, and TGFB2 were significantly associated with increased odds of severe AKI in all models, including model 5, which adjusted for preoperative biomarker levels.
- the increase of plasma biomarkers in kidney disease may be caused by the decrease in GFR thus may lead to spurious associations (i.e., reverse causation).
- the preoperative levels of these proteins are not correlated with preoperative eGFR, suggesting a lack of reverse causation (Table 5).
- Three plasma biomarkers of PT cells at healthy states can also be measured in the urine by SOMAscan aptamer assays. Excretion of both PLG and AFM significantly increased after cardiac surgery, and excretion of PROC became significantly higher after being indexed to urine creatinine to account for urine dilution (Table 6), which may be due to shedding from healthy PT cells after injury.
- kidney diseases such as kidney injury molecule-1, neutrophil gelatinase-associated lipocalin, and soluble urokinase plasminogen activator receptor
- biomarkers of PT maladaptation and PT cells at healthy states can further enhance the predictive performance for AKI (Table 7).
- the present inventors validated these plasma proteins as indicators of PT maladaptation and PT cells at healthy states in 2 independent cohorts.
- the pediatric cardiac surgery cohort comprised 68 participants undergoing surgery for the repair of congenital heart disease, with a median age of 41 (IQR: 6-84) months, including 37 (54.4%) girls.
- the present inventors observed significant increases in plasma TGFB2, COL23A1, and NLGN4X (proteins of PT maladaptation), and significant decreases in plasma ENPP6, PLG, and PROC (proteins of PT cells at healthy states) after cardiac surgery, similar to the findings in their adult counterparts (Table 2, Table 4).
- the present inventors compared these proteins in 39 participants before and immediately after running a marathon.
- the present inventors previously demonstrated that after completion of a marathon, runners could develop significant tubular injury, with excretion of kidney injury and inflammation biomarkers increasing by 3- to 12-fold immediately after the race (34).
- the median age of the marathon runners was 42 (IQR: 33-51) years, 21 (53.8%) were women, 2 (5.1%) participants had hypertension, and 1 (2.6%) had diabetes.
- the present inventors observed significant increases in plasma TGFB2 and NLGN4X and significant decreases in plasma PLG and PROC after the marathon, consistent with the present inventors’ findings from the 2 cardiac surgery cohorts (Table 2, Table 4). Reverse translational investigation validates biomarkers of PT maladaptation in mouse models of ischemic and toxic AKI.
- Tgfb2 had strong, positive correlations with known fibrosis markers (Col1a1, Col3a1, Fn1, Pdgfb, and Acta2), and Enpp6 and Proc had moderate to strong negative correlations with fibrosis (FIG. 9, Table 8).
- the present inventors also observed a progressive increase in Tgfb2 expression, as well as continuing decreases in Enpp6 and Proc expression as mice progressed from AKI to CKD (FIG.4 G-L).
- the present inventors identified plasma NLGN4X, COL23A1, and TGFB2 as novel biomarkers that increased in the setting of PT maladaptation after cardiac surgery, whereas plasma ENPP6, PLG, and PROC serve as novel biomarkers of PT cells at healthy states that diminish in the setting of maladaptive repair after injury. Discussion In this study, the present inventors used snRNA-seq analysis of kidney tissue from hospitalized participants with AKI and identified PT cells in a distinctive maladaptive state, characterized by the loss of differentiated states and physiological function and the activation of aberrant kidney regeneration signatures associated with a proinflammatory and profibrotic milieu. This maladaptive repair at the transcriptional level represents a shared response to injury in participants with AKI of diverse etiologies.
- PT cells exhibit a maladaptive profile, lose their physiological function, enter a senescent cell-cycle arrest phase, activate programmed cell death pathways, and eventually form atrophic tubules (36, 38).
- maladaptive PT cells persistently produce and secrete profibrotic factors, such as TGF- ⁇ , and recruit and activate the transition of pericytes and fibroblasts into myofibroblasts, leading to production of matrix material and fibrosis (39).
- profibrotic factors such as TGF- ⁇
- the present inventors’ study demonstrated that PT maladaptation, characterized by enrichment in proinflammatory, profibrotic, ferroptotic and necroptotic pathways, is similarly present in human AKI.
- PT maladaptive PT cells In these maladaptive PT cells, the present inventors further identified that the activation of regulators involved in maladaptive tubular cell growth, such as SOX4 and STAT5A, was accompanied by a close coregulation network with proinflammatory and profibrotic mediators (40). Whether therapeutic intervention halting this maladaptive repair process can attenuate the risk of severe AKI and the AKI-to-CKD transition requires further investigation.
- PT maladaptation was widely present in participants with AKI of diverse etiologies, suggesting a shared response to injury at the tubular cell level. This is consistent with observations from mouse models of ischemic and toxic AKI, in which injured PT cells enter the senescent and maladaptive phenotype and mediate interstitial fibrosis (37, 41).
- kidney tissue interrogation allows the identification of PT maladaptation for in-depth mechanistic investigation.
- the invasive nature of the kidney biopsy procedure makes it challenging for this interrogation to be applied to large cohorts of patients. This highlights the importance of developing sensitive and noninvasive biomarkers to measure this maladaptive repair process at the tissue level.
- biomarkers may characterize the prevalence of PT maladaptation and establish its etiological associations with clinical complications of AKI in large cohorts of patients. They may also serve as potential pharmacodynamic endpoints for early investigation of targeted therapeutics in preventing complications of AKI. With this motivation, the present inventors developed a workflow to integrate findings from snRNA-seq with the plasma proteome in patients at high risk of AKI from cardiac surgery. The discovery of biomarkers by integrating these 2 different cohorts, instead of using only the kidney biopsy cohort, is largely due to the small sample size of patients with available transcriptomic data.
- the present inventors snRNA-seq analysis demonstrates that the PT maladaptation phenotype may be shared across different patient populations with diverse causes of AKI, further suggesting the feasibility of this integrative approach.
- the present inventors identified multiple biomarkers of PT maladaptation associated with AKI progression.
- Tubular epithelial expression of TGF- ⁇ plays a critical role in the development of interstitial fibrosis after AKI (43, 44).
- the TGF- ⁇ 2 isoform is not well described in AKI, it is implicated in the epithelial-to-mesenchymal transition in cancer cells, potentially by interacting with urokinase plasminogen activator (45).
- X-linked neuroligin-4 encoded by NLGN4X
- collagen XXIII ⁇ -1 collagen XXIII ⁇ -1
- NLGN4X NLGN4X
- XXIII ⁇ -1 collagen XXIII ⁇ -1
- the associations between AKI and these biomarkers of cell adhesion, migration, and extracellular matrix material are consistent with the profibrotic profile of PT maladaptation.
- the present inventors identified multiple novel biomarkers of the successful repair of injured PT cells. Plasminogen and protein C have been shown to ameliorate fibrosis and inflammation after renal IRI (48, 49).
- ENPP6 is involved in the extracellular degradation of glycerophosphocholine to provide choline intracellularly but has not yet been reported in kidney disease (50).
- the discrepancies in 2 biomarkers, COL23A1 and ENPP6, between marathon runners and patients undergoing cardiac surgery may be due to differences in the kidney’s response to these 2 distinct insults.
- cardiac surgery may additionally involve an enhanced inflammatory milieu from cardiopulmonary bypass (51, 52).
- cardiopulmonary bypass 51, 52.
- the present inventors found that 3 of the 4 markers were associated with maladaptive changes, interstitial fibrosis, and kidney atrophy.
- the consistency of the gene expression patterns in ischemic and toxic AKI models further support the stereotypical maladaptive response observed in human AKI of diverse etiologies.
- the low expression level of Col23a1 and its lack of correlation with fibrosis, as well as the lack of Nlgn4 and Plg expression in mouse kidneys could be due to transcriptomic differences between humans and mice and highlight the importance and benefit of direct interrogation of human kidney tissues.
- the present inventors’ study has many important implications.
- the present inventors’ snRNA-seq analysis demonstrated that maladaptive repair of PT cells may be a stereotypical response to injury in participants with diverse etiologies and severities of AKI.
- kidney tissue transcriptome and plasma proteome
- the present inventors discovered multiple proteins that reflect the maladaptive and healthy states of PT cells, which can be measured noninvasively to establish the etiological association between PT maladaptation and adverse outcomes of AKI in large cohorts of patients. Future studies can determine if these plasma proteins can serve as pharmacodynamic endpoints in early-stage clinical trials investigating drugs targeting PT maladaptation.
- the present inventors multiomics biomarker development pipeline may also be adopted in research aiming to establish associations between diseased cell states and clinical outcomes in other kidney diseases. The present inventors recognize several limitations of this study that are worth noting.
- the present inventors could not assess gene expression changes along the trajectory of PT maladaptation. This is due to the cross-sectional nature of kidney biopsy procedures following AKI diagnosis and interindividual variations of PT cells with diverse disease pathophysiology and clinical courses, which makes the use of trajectory analysis tools challenging. Proteomic and snRNA-seq analysis were performed in 2 different cohorts, making us unable to directly correlate plasma proteins with tissue gene expression. Proteomic profiling in the biomarker discovery cohort was performed using only the first postoperative plasma samples. Proteins that were released to the plasma later in the course of injury and maladaptation and proteins that were more likely to be excreted to the urine, such as kidney injury molecule-1, may not be adequately captured and may lead to false-negative results (53).
- the orphan nuclear receptor ROR ⁇ is a potential endogenous protector in renal ischemia/reperfusion injury.
- Xu, ⁇ -Amyrin ameliorates diabetic nephropathy in mice and regulates the miR-181b-5p/HMGB2 axis in high glucose-stimulated HK-2 cells.
- 31. R. Bechara, N. Amatya, R. D. Bailey, Y. Li, F. E. Y. Aggor, D.-D. Li, C. V. Jawale, B. M. Coleman, N. Dai, N. S. Gokhale, T. C. Taylor, S. M. Horner, A. C. Poholek, A. Bansal, P. S. Biswas, S. L.
- Venkatachalam, PTEN loss defines a TGF- ⁇ -induced tubule phenotype of failed differentiation and JNK signaling during renal fibrosis.
- AFM afamin
- COL23A1 collagen type XXIII ⁇ 1 chain
- ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6
- NLGN4X neuregulin-4 X linked
- P4HA2 prolyl 4- hydroxylase
- PROC protein C
- PLG plasminogen
- PT proximal tubule
- TGFB2 transforming growth factor ⁇ -2.
- ACR albumin-creatinine ratio
- AFM afamin
- COL23A1 collagen type XXIII ⁇ 1 chain
- eGFR estimated glomerular filtration rate
- ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6
- NLGN4X neuregulin-4 X linked
- OR odds ratio
- P4HA2 prolyl 4-hydroxylase
- PROC protein C
- PLG plasminogen
- PT proximal tubule
- TGFB2 transforming growth factor ⁇ -2.
- Model 1 comprised postoperative biomarkers alone; Model 2 additionally adjusted for age, sex, and race; Model 3 additionally adjusted for hypertension, diabetes mellitus, congestive heart failure, myocardial infarction, and baseline eGFR; Model 4 additionally adjusted for baseline ACR; Model 5 additionally adjusted for preoperative biomarker values. All proteins were presented by names of aptamers used in the SOMAscan assay, and measurements were log2-transformed so that the odds ratio represents an increase in the odds of doubling protein levels. Table 4. Protein concentrations in the TRIBE-AKI adult cohort and in 2 independent validation cohorts *Values are presented as median (IQR) of normalized aptamer measurements in relative fluorescence intensities.
- IQR median
- AFM afamin
- COL23A1 collagen type XXIII ⁇ 1 chain
- ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6
- NLGN4X neuregulin-4 X linked
- P4HA2 prolyl 4- hydroxylase
- PROC protein C
- PLG plasminogen
- PT proximal tubule
- TGFB2 transforming growth factor ⁇ -2.
- AFM afamin
- COL23A1 collagen type XXIII ⁇ 1 chain
- eGFR estimated glomerular filtration rate
- ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6
- NLGN4X neuregulin-4 X linked
- P4HA2 prolyl 4-hydroxylase
- PROC protein C
- PLG plasminogen
- PT proximal tubule
- TGFB2 transforming growth factor ⁇ -2.
- #Fold change is based on comparing postoperative versus preoperative protein levels
- Table 7 Performance of biomarkers of PT maladaptation and PT cells at healthy states in predicting severe AKI after cardiac surgery when added to known kidney disease biomarkers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263371894P | 2022-08-19 | 2022-08-19 | |
| PCT/US2023/072477 WO2024040225A2 (en) | 2022-08-19 | 2023-08-18 | Diagnosis and treatment of acute kidney injury |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4573371A2 true EP4573371A2 (de) | 2025-06-25 |
Family
ID=89942325
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23855713.6A Pending EP4573371A2 (de) | 2022-08-19 | 2023-08-18 | Diagnose und behandlung von akuter nierenläsion |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4573371A2 (de) |
| WO (1) | WO2024040225A2 (de) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN118899088B (zh) * | 2024-10-09 | 2025-01-21 | 山东中医药大学附属医院 | 一种脓毒症早期风险的预测系统和方法 |
| CN120829482B (zh) * | 2025-09-15 | 2026-02-10 | 吉林农业大学 | 一种抑制铁死亡的活性肽及其应用 |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2779905A1 (en) * | 2009-11-07 | 2011-05-12 | Astute Medical, Inc. | Methods and compositions for diagnosis and prognosis of renal injury and renal failure |
| US10557856B2 (en) * | 2010-09-24 | 2020-02-11 | University Of Pittsburgh-Of The Commonwealth System Of Higher Education | Biomarkers of renal injury |
| US20200124614A1 (en) * | 2018-10-03 | 2020-04-23 | Yale University | Compositions and Methods for Assessing Acute Kidney Injury (AKI) and Mortality Risk |
| EP3904883A1 (de) * | 2020-04-07 | 2021-11-03 | Sciomics GmbH | Vorhersage und frühdiagnose von akuten nierenverletzungen |
-
2023
- 2023-08-18 WO PCT/US2023/072477 patent/WO2024040225A2/en not_active Ceased
- 2023-08-18 EP EP23855713.6A patent/EP4573371A2/de active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024040225A2 (en) | 2024-02-22 |
| WO2024040225A9 (en) | 2024-05-02 |
| WO2024040225A3 (en) | 2024-03-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20150275301A1 (en) | URINE EXOSOME mRNAS AND METHODS OF USING SAME TO DETECT DIABETIC NEPHROPATHY | |
| JP2010525822A (ja) | 新規に進行中の心不全における個人のリスク評価のためのトランスクリプトームのバイオマーカー | |
| US10859573B2 (en) | Nourin molecular biomarkers diagnose angina patients with negative troponin | |
| WO2024040225A2 (en) | Diagnosis and treatment of acute kidney injury | |
| US20170088894A1 (en) | Methods of Predicting Acute Rejection Outcomes | |
| KR20140108718A (ko) | 가와사키 질환용 바이오마커 | |
| JP2019528733A (ja) | 遺伝性血管性浮腫のrnaバイオマーカー | |
| Guo et al. | Glomerular complement factor H–related protein 5 is associated with histologic injury in immunoglobulin A nephropathy | |
| EP2710143B1 (de) | Verfahren zur bestimmung des risikos eines subjekts zur entwicklung einer chronischen nierenerkrankung | |
| JP7162104B2 (ja) | 糖尿病性腎症の早期病態の特異的な診断を可能とする検査方法 | |
| US20160244835A1 (en) | Urinary neuropilin-1 (nrp-1) as a prognostic marker for nephritis and lupus nephritis | |
| JP2023548156A (ja) | 肝疾患の評価のためのキット、試薬、及び方法 | |
| Matboli et al. | Evaluation of urinary autophagy transcripts expression in diabetic kidney disease | |
| Pei et al. | Serum cystatin C, klotho, and neutrophil gelatinase-associated lipocalin in the risk prediction of acute kidney injury after acute myocardial infarction | |
| US8728984B2 (en) | Acute kidney injury risk testing | |
| US20160376657A1 (en) | Method of diagnosing renal disorders | |
| CN104737020B (zh) | 早期肾障碍的评价指标和其测定方法 | |
| WO2021024856A1 (ja) | 間質性肺炎のタンパク質診断バイオマーカー | |
| EP2882767A1 (de) | Bewertung von nierenläsionen mithilfe von hyaluronsäure | |
| CA3036256C (en) | Inspection method enabling specific diagnosis of pathological state of diabetic nephropathy at early stage | |
| CN116802500A (zh) | 用于治疗肾损伤和肾衰竭的方法和组合物 | |
| EP3781948A1 (de) | Bewertung des risikos der komplikation bei einem patienten mit einer vermuteten infektion mit einem sofa-wert unter zwei | |
| HK1212773B (en) | Methods and compositions for diagnosis and prognosis of renal injury and renal failure |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250318 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |