EP4396338A1 - Aktivierbare dna-polymerase - Google Patents

Aktivierbare dna-polymerase

Info

Publication number
EP4396338A1
EP4396338A1 EP22772844.1A EP22772844A EP4396338A1 EP 4396338 A1 EP4396338 A1 EP 4396338A1 EP 22772844 A EP22772844 A EP 22772844A EP 4396338 A1 EP4396338 A1 EP 4396338A1
Authority
EP
European Patent Office
Prior art keywords
dna polymerase
nucleic acid
unit
activatable
activity
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP22772844.1A
Other languages
English (en)
French (fr)
Inventor
Philip Tinnefeld
Andrés Manuel VERA GÓMEZ
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Maximilians Universitaet Muenchen LMU
Original Assignee
Ludwig Maximilians Universitaet Muenchen LMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Maximilians Universitaet Muenchen LMU filed Critical Ludwig Maximilians Universitaet Muenchen LMU
Publication of EP4396338A1 publication Critical patent/EP4396338A1/de
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/96—Stabilising an enzyme by forming an adduct or a composition; Forming enzyme conjugates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase

Definitions

  • the present invention provides an activatable DNA polymerase comprising a DNA polymerase protein unit coupled to a nucleic acid unit, preferably wherein the nucleic acid unit has a length which is sufficient to block activity of the DNA polymerase protein unit, optionally further comprising at least one linker unit between the polymerase protein unit and the nucleic acid unit, wherein the nucleic acid unit is coupled (a) by a covalent chemical bond or by streptavidin-biotin; and/or (b) by its terminal nucleotide.
  • the present invention provides a method of synthesizing a nucleic acid comprising: a) providing a sample comprising at least one nucleic acid template, components for nucleic acid synthesis and the activatable DNA polymerase of the invention, b) activating the activatable DNA polymerase in the sample of step a), thereby generating an activated DNA polymerase, and c) subjecting the sample comprising the activated DNA polymerase of step b) to reaction conditions that allow synthesis of a nucleic acid complementary to the at least one nucleic acid template.
  • the present invention provides a method of determining the presence or absence of a single stranded nucleic acid of interest comprising: a) providing a sample to be tested for comprising a single stranded nucleic acid of interest, b) adding the activatable DNA polymerase according to the invention to the sample of step a), wherein at least a part of the nucleic acid unit is single stranded and complementary to the single stranded nucleic acid of interest, c) subjecting the sample with the activatable DNA polymerase of step b) to reaction conditions which allow hybridization, preferably hybridization between the single stranded part of the nucleic acid unit of the activatable DNA polymerase unit and the single stranded nucleic acid of interest, thereby activating the activatable DNA polymerase of the invention, and d) determining activity of the activatable DNA polymerase of step c), wherein activity of the activatable DNA polymerase indicates the presence of the nucleic acid of
  • the invention provides the use of a nucleic acid for reversibly inhibiting a DNA polymerase wherein the nucleic acid is coupled to the DNA polymerase (a) by a covalent chemical bond or by streptavidin-biotin; and/or (b) by its terminal nucleotide.
  • the nucleic acid has a length which is sufficient to block the activity of the DNA polymerase, more preferably wherein the nucleic acid is at least partially single stranded as described herein.
  • the cleavage of the photocleavable site is by irradiation with light, preferably wherein the photocleavable site is an o-nitrobenzyl based photocleavable site and/or the light has a wavelength between 300 nm to 400 nm, preferably between 310 nm to 370 nm, more preferably between 315 nm to 365 nm, most preferably at about 315 or at about 365 nm.
  • the invention provides the use of the activatable DNA polymerase of the invention for in vitro diagnosis, such as diagnosis of a disease, a medical condition and/or detection of pathogens in a sample, such as from a human or an animal (e.g., mammal or bird), food, drink, soil or water (e.g., a drinking water, a waste water or a hydrologic sample).
  • a sample such as from a human or an animal (e.g., mammal or bird), food, drink, soil or water (e.g., a drinking water, a waste water or a hydrologic sample).
  • Figure 1 Scheme showing the mechanism of Light-Start DNA polymerases.
  • the sequence at the bottom of the Figure represents an example of the nucleic acid unit (SEQ ID NO: 1 ).
  • the asterisk (*) denotes a photocleavable unit.
  • Figure 2 Light-activation of Phi29 DNA pol.
  • Phi29 pol-PC_oligoScr left gel
  • Phi29 pol_oligo2 constructs right gel
  • a light pulse of 365 nm 120 s was applied (lane 2). All activities assays were performed with 20 nM enzyme for 2 h at 30 °C.
  • Figure Caption. Phi29 pol is represented in dark and Phi29 pol-PC_Oligo in light grey.
  • Figure 3 Polymerase and nuclease activity of different polymerases can be blocked, a) 3' to 5' exo activity of Phi29 pol-PC_oligo. Exonuclease activity of the unmodified Phi29 pol (lane 2). b) PCR with Taq pol-PC_oligo (left gel) and Pfu pol- PC_oligo (right gel) samples. In both cases, PCR product was not detected in nonilluminated samples (lane 2). Only irradiated samples (lane 3) showed the PCR product present in the unmodified enzyme samples (lane 1 ).
  • Figure 4 Light-start applications, a), b) and c) failure-by-design experiments for Phi29 pol-PC_oligo, Pfu pol-PC_oligo, and Taq pol-PC_oligo, respectively, a) Whole genome amplification of human DNA by Phi29 pol-PC_oligo, and b) PCR amplification of E. coli Bir A gene by Pfu pol-PC_oligo.
  • Figure 5 Tight-blockage of DNA polymerases and further failure-by-design assays, a) Tight blockage of the activity of Phi pol-PC_oligo. No amplification product was observed when 120 nM of Phi29 polPC_oligo was used (lane 1 ). Activity was recovered after a 10 s light pulse with 315 nm UV (lane 2). b), c), and d) Independent failure-by-design experiments were performed to corroborate the results shown in Figure 4. b) Whole genome amplification by Phi pol-PC_oligo. The hexamers concentration in reactions in lane 1 and 2 was 6.25 pM, and 3.12 pM in lane 3 and 4.
  • Phi29 pol-Oligo as a specific nucleic acid sensor
  • a) Amplification of T7 blue plasmid by Multiply-Primed RCA shows selective activation of Phi29 pol-Oligo only by the target sequence (complementary to the sensing oligo, GTGATGTAGGTGGTAGAGGAA, SEQ ID NO: 17). Reaction was performed for 2h with 150 nM polymerase at 30 °C.
  • Mocking oligo is an oligo with a sequence not complementary to the blocking oligo (AGGGTCCACCAAACGTAATGC, SEQ ID NO: 18).
  • Similar recovery of the activity was observed by a complementary RNA (right gel, lain 1 vs 2).
  • Figure 7 Fidelity of Pfu pol-PC_oligo a) and Taq pol-PC_oligo b) enzymes.
  • the Bir A gene from E. coli (GenBank: M15820.1 , SEQ ID NO: 11 ) was PCR amplified, gel-purified and sent to sequencing (Eurofins Genomics, Germany).
  • the gene was amplified using unmodified Pfu pol, and Pfu pol-PC_oligo in a), unmodified Taq pol and Taq pol- PC_oligo in b), and the sequences obtained by the unmodified and oligo-modified versions compared (a pulse of 120 s 365 nm UV light was used for the activated enzymes).
  • the first 50 and last 100-200 nucleotides of the sequencing reaction were omitted due to limitations of the sequencing reaction. In none of both cases, differences between the sequences retrieved by the unmodified enzymes and the oligo-modified ones were detected (see sequence alignment).
  • Figure 8 miRNA and DNA detection. Schematics of a point of care (POC) assay.
  • POC point of care
  • the nucleic acid unit is coupled by a covalent chemical bond or by streptavidin-biotin, more preferably by a covalent chemical bond.
  • the term coupling is used in the context of connecting or tightly binding and the person skilled in the art will understand that the nucleic acid is coupled at a site of the DNA polymerase that is distinct and distant of the blocking site at the active center of the DNA polymerase.
  • the coupling (direct or indirect) of the nucleic acid unit is to an amino acid of the DNA polymerase protein unit, i.e.
  • the nucleic acid unit blocks the activity of the DNA polymerase in a nonsequence specific manner.
  • the coupling allows a high local nucleic acid concentration resulting in competitive binding of the nucleic acid to the active center of the DNA polymerase (at a site distinct from the coupling site of the DNA polymerase).
  • the blocking mechanism by the nucleic acid unit is sequence unspecific.
  • the nucleic acid unit does not inhibit the DNA polymerase unit when free in solution, i.e., not coupled to the DNA polymerase.
  • the coupling according to the invention does not encompass binding of an aptamer to a DNA polymerase.
  • Aptamers bind to specific DNA polymerases in a sequence specific manner, binding is dependent on the 3D-structure of the aptamer via multiple non- covalent interactions and is neither by the terminal nucleotide nor by covalent bonds.
  • sequence unspecific or “non-sequence specific” as used herein in the context of the present invention means that nucleic acid units with different sequences block or inhibit the activity of a specific DNA polymerase protein unit and the same nucleic acid unit blocks or inhibits the activity of different DNA polymerase protein units, including DNA polymerases of different classes.
  • the sequence of the nucleic acid unit may be a random sequence or may be a specific sequence, e.g., specific for a single stranded nucleic acid of interest in a method of diagnosing a disease, a medical condition or determining the presence of a pathogen in a sample and/or in a method of determining the presence or absence of a single stranded nucleic acid of interest according to the invention.
  • the sequence of the nucleic acid unit is independent of or unspecific for the DNA polymerase protein unit of the activatable DNA polymerase according to the invention.
  • the DNA polymerase protein unit is blocked via unspecific competition-based blockage by the nucleic acid unit coupled (e.g., covalently bound) to the DNA polymerase protein unit at its opposite end. This is also confirmed by the observation that the inhibition is released at low temperature (about 30°C) when the nucleic acid is cut from its attachment point to the enzyme, since a specific binder would remain bound thus blocking the enzyme at this low temperature.
  • the inventors unexpectedly observed that binding of a nucleic acid to a DNA polymerase blocked the activity of the DNA polymerase in a non-sequence-specific manner thereby allowing for universal applicability of the blocking mechanism without specific adaptation to a particular DNA polymerase. Without being bound by theory, it is believed that the nucleic acid blocks the activity of the DNA polymerase protein by an unspecific competition-based mechanism.
  • the term “reversible” as used herein means that the activity of the DNA polymerase can be fully recovered. Specifically, in an inactive state of the activatable DNA polymerase, the nucleic acid unit blocks the activity of the DNA polymerase protein unit while in an active state of the activatable DNA polymerase the nucleic acid unit does not block the activity of the DNA polymerase protein unit, resulting in unblocking the DNA polymerase protein unit.
  • unblocking is performed by cleavage of at least a part of the nucleic acid unit at a cleavable site of the activatable DNA polymerase.
  • the cleavable site is a photocleavable site.
  • introduction of a photocleavable site near the terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit, optionally via a linker unit allows for unblocking of DNA polymerase protein unit by a light pulse. Prior to the light pulse, the DNA polymerase activity is tightly blocked while after the UV pulse the DNA polymerase activity is fully recovered ( Figure 1 ).
  • the present invention provides a technically simple reversible blocking system which is independent of activation by temperature and/or the design of polymerase- tailored blocking means or mechanisms, and which is particularly useful for temperature-sensitive DNA polymerases, i.e. , mesophilic DNA polymerases, thereby enabling the application of the invention in a broad field of DNA synthesis processes such as PCR, isothermal amplification, and sequencing.
  • a “nucleic acid unit” as used herein is a nucleic acid which is a part of the activatable DNA polymerase of the invention.
  • a “nucleic acid unit” as used herein is a macromolecule (e.g., a single or one nucleic acid strand) which is composed of monomers called nucleotides.
  • a “nucleotide” as used herein is built of a nucleobase, a deoxyribose or ribose sugar and a phosphate group.
  • a nucleic acid can be a single stranded or a double stranded macromolecule.
  • the nucleic acid unit of the invention might be partially single stranded, i.e., it comprises at least a single stranded part.
  • the term “partially single stranded” or “single stranded part” as used herein refers to at least 12, preferably at least 15, more preferably at least 20 consecutive nucleotides which are single stranded.
  • Consecutive nucleotides as used herein means that the nucleotides are not separated by one or more double stranded nucleotides.
  • the single stranded part of the nucleic acid unit is localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit or a linker unit if present.
  • the partially single stranded nucleic acid unit may comprise a terminal or an internal double stranded part, preferably wherein at least 12, preferably at least 15, more preferably at least 20 consecutive single stranded nucleotides are present which are preferably localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit or a linker unit if present.
  • the internal or terminal double stranded part might preferably be generated by a self- complementary part, e.g., a hairpin, of a single stranded nucleic acid unit.
  • the sequence of the nucleic acid unit does not have any predicted secondary structure.
  • the nucleic acid unit is not an aptamer.
  • nucleotide sequence of the nucleic acid unit might vary and is not crucial for blocking the DNA polymerase protein unit.
  • the blocking mechanism is sequence unspecific, i.e., the sequence of the nucleic acid unit is independent of or unspecific for the DNA polymerase protein unit of the activatable DNA polymerase according to the invention.
  • the nucleic acid unit comprises or consists of a random nucleotide sequence.
  • the inhibition is maintained at high temperature (up to 95°C). In contrast blocking aptamers are inactivated at high temperature and would no longer inhibit a DNA polymerase.
  • the activatable DNA polymerase of the invention is activated by cleavage of at least a part of the nucleic acid unit as described herein.
  • essentially the entire nucleic acid unit is cleaved off, wherein essentially means all or all but one, two or three nucleotides.
  • the nucleotide sequence of the nucleic acid unit may be an artificial sequence, i.e., it is non-natural and cannot be isolated from an organism and/or does not hybridize to a genomic sequence.
  • the nucleic acid unit preferably has a length which is sufficient to block activity of the DNA polymerase protein unit.
  • the skilled person is aware that the exact length of the nucleic acid unit might vary. The exact length depends on various factors, e.g., the attachment site of the nucleic acid unit at the DNA polymerase protein unit relative to the active center of the DNA polymerase activity or the length and/or nature of additional units such as a linker unit. Further factors might be the length of a cleavable site as described herein which might be optionally present between the DNA polymerase protein unit and the nucleic acid unit and/or the length of the double stranded part of the nucleic acid unit which might be optionally present.
  • the nucleic acid unit has a length of at least about 5 nucleotides. In a further embodiment, the nucleic acid unit has a length of about 10 to about 60 nucleotides, preferably about 12 to about 45 nucleotides, more preferably about 16 to about 40 nucleotides, most preferably about 18 to about 35 nucleotides. In a specific embodiment, the nucleic acid unit is an oligonucleotide, e.g., an oligonucleotide having about 15 to about 30 nucleotides.
  • the nucleic acid unit comprises a nucleotide sequence selected from the group consisting of: ttcctctaccacctacatcac (SEQ ID NO: 1 ), cttcatcacactccatctcca (SEQ ID NO: 2), gcattacgtttggtggaccct (SEQ ID NO: 3), ttcctctaccacctacatcactcttct (SEQ ID NO: 4) and ttcctctaccacctacatcactcttctcattac (SEQ ID NO: 5).
  • a linker unit may serve as a spacer and reduce steric hinderance and/or increase flexibility of the coupled nucleic acid unit.
  • the nucleic acid unit might be sterically hindered, and the blocking of the DNA polymerase protein activity might be hampered.
  • the need for a linker may also depend on the attachment site of the nucleic acid unit to the DNA polymerase protein unit.
  • a linker particularly a peptide linker expressed together with the DNA polymerase protein unit, may be used for coupling the nucleic acid unit to the DNA polymerase protein unit, e.g., for the introduction and use of a click chemistry unit.
  • nucleic acid unit might be coupled to the DNA polymerase protein unit (optionally to the DNA polymerase protein unit expressed together with the linker unit) by any suitable chemical coupling reaction known in the art.
  • Chemical reactions for coupling are generally known to the skilled person and may comprise, e.g., click chemistry using a first click chemistry unit and a second click chemistry unit (see, e.g., [9-10] which are incorporated herein by reference).
  • click chemistry units are known to the skilled person and are commercially available, often directly coupled to the nucleotide, the amino acid or to the functional groups of the linkers which allows for a simple reaction between the different units of the activatable DNA polymerase.
  • the nucleic acid unit can be coupled to the DNA polymerase protein unit, or optionally the linker unit, if present.
  • the nucleic acid unit is coupled by its terminal nucleotide.
  • the nucleic acid unit is single stranded, comprises a DBCO click chemistry unit in the terminal nucleotide and a photocleavable site at position 1 of a single stranded nucleic acid unit from the terminus coupled to the DNA polymerase protein unit.
  • the nucleic acid unit is one as depicted in the Examples (see Material and Methods, Table 1 ).
  • “Protection” or “protected “as used herein refers to a modification of a nucleotide and/or to the linkage between nucleotides, e.g., the phosphodiester bond.
  • a “modification of a nucleotide” or a “modified nucleotide” as used herein might be any modification which protects a nucleic acid from degradation. Such modifications are known to the skilled person, e.g., a modification of the sugar of a nucleotide.
  • a “modification of the sugar of a nucleotide” as used herein refers, e.g., to a replacement of the hydroxy group at the 2’- carbon atom of the ribose by another functional group, such as an amine group or a fluorine group; or to a replacement of the hydrogen of the hydroxyl group of the 2’ carbon atom of the ribose.
  • the replacement of the hydrogen of the hydroxyl group may be by an alkyl group to generate a 2’-O-Methyl, 2’-O-Ethyl, or 2’-O-Propyl, preferably 2’-O-Methyl; an ether group, such as 2’-O-Methoxymethyl, 2’-O-Methoxyethyl, 2’-O- Methoxypropyl, preferably 2’-O-Methoxyethyl; an amine group to generate 2’-0-Amine, 2’-O-Methylamine, 2’-O-Ethylamine, 2’-O-Propylamine, preferably 2’-O-Propylamine; or an 2’-O-Proparagyl group (see also [30] and [31 ], which are incorporated herein by reference).
  • the terminal nucleotide of the free terminus of the nucleic acid unit is protected, preferably by a modification of a nucleotide as described herein.
  • a modification of a nucleotide as described herein Preferably, at least a few of the nucleotides at the free terminus (two or more of the nucleotides at the free terminus, such as 2, 3 or 4) are protected.
  • the free terminus is protected by a modification of a nucleotide and/or a modification of the linkage between nucleotides as described herein.
  • the nucleic acid unit orientation for coupling and/or the protection of the free terminus of the nucleic acid unit as described herein may have the advantage that the nucleic acid unit is protected from the nuclease activity of the DNA polymerase protein unit.
  • the direct or indirect coupling of the nucleic acid unit is to an amino acid of the DNA polymerase protein unit which does not interfere with the active center, preferably an amino acid which is outside of and/or distant to the active center of the DNA polymerase protein unit, preferably outside of and/or distant to the active center mediating the polymerase activity and/or nuclease activity of the DNA polymerase protein unit.
  • the (direct or indirect) coupling of the nucleic acid unit is to a terminal amino acid of the DNA polymerase protein unit, such as the N-terminal or the C-terminal amino acid, preferably to the C-terminal amino acid.
  • the activatable DNA polymerase of the invention can be used or applied in any method using DNA polymerases.
  • the embodiments described herein for the activatable DNA polymerase of the invention likewise apply to the methods, processes, and uses as described herein.
  • the present invention provides a new reversible blocking mechanism for DNA polymerases.
  • the activatable DNA polymerase of the present invention as described herein provides a blocking mechanism which is universally applicable to basically any DNA polymerase.
  • the invention relates to a method of synthesizing a nucleic acid comprising: a) providing a sample comprising at least one nucleic acid template, components for nucleic acid synthesis and the activatable DNA polymerase of the invention, b) activating the activatable DNA polymerase in the sample of step a), thereby generating an activated DNA polymerase, and c) subjecting the sample comprising the activated DNA polymerase of step b) to reaction conditions that allow synthesis of a nucleic acid complementary to the at least one nucleic acid template.
  • the nucleic acid template might be any nucleic acid, e.g., a linear and/or a circular nucleic acid.
  • the nucleic acid template might further be a single or double stranded nucleic acid.
  • the DNA amplification might comprise polymerase-chain reaction (PCR), e.g., RT- PCR, qPCR, rolling circle amplification, whole genome amplification, or isothermal amplification, e.g., loop-mediated isothermal amplification (LAMP).
  • PCR polymerase-chain reaction
  • RT- PCR RT- PCR
  • qPCR rolling circle amplification
  • whole genome amplification e.g., qPCR
  • isothermal amplification e.g., loop-mediated isothermal amplification (LAMP).
  • LAMP loop-mediated isothermal amplification
  • the nature and the amount of the components for nucleic acid synthesis and the reaction conditions might vary and depend on the type of the method of synthesizing a nucleic acid which are known to the skilled person.
  • the DNA polymerase may be Bst as described herein, preferably Bst comprising the amino acid sequence of SEQ ID NO: 10.
  • the DNA polymerases may be Taq or Pfu as described herein, preferably Taq or Pfu comprising the amino acid sequences of SEQ ID NOs: 7 or 8.
  • the DNA polymerase might by Phi29, preferably Phi29 comprising the sequence of SEQ ID NO: 6 or SEQ ID NO: 34.
  • the invention provides a method of DNA amplification, such as polymerase-chain reaction (PCR), comprising: a) providing a sample comprising at least one nucleic acid template, components for nucleic acid amplification and the activatable DNA polymerase of the invention as described herein, preferably wherein the DNA polymerase protein unit is selected from the group consisting of Taq and Pfu, more preferably of Taq comprising the amino acid sequence of SEQ ID NO: 7, and Pfu comprising the amino acid sequence of SEQ ID NO: 8, b) activating the activatable DNA polymerase in the sample of step a), thereby generating an activated DNA polymerase, and c) subjecting the sample with the activated DNA polymerase of step b) to reaction conditions that allow amplification of the at least one nucleic acid template.
  • PCR polymerase-chain reaction
  • the nucleic acid template might be any nucleic acid, e.g., a linear nucleic acid.
  • the nucleic acid template might be a double stranded or single stranded nucleic acid, preferably a double stranded nucleic acid.
  • the nucleic acid template is a circular nucleic acid which might by single stranded or double stranded.
  • components for nucleic acid amplification might comprise a mixture of deoxyribonucleotides (dNTPs), a buffer which is suitable for carrying out nucleic acid synthesis, cofactors for the polymerase such as Mg 2+ , and primers.
  • dNTPs deoxyribonucleotides
  • the criteria for the choice of primers are known to the skilled person and might comprise degree of complementary to the nucleic acid template particularly at the 3’ end of the primer, annealing temperature (which is based on the length of the primers and the guanosine and cytidine content) and length of amplicon and location and orientation of the primers on the opposite nucleic acid strands.
  • the reaction conditions that allow amplification of the at least one nucleic acid template are known to the skilled person and comprise for example a denaturation step at high temperatures, such as about 90 °C to about 95 °C for about 1 to about 5 minutes, followed by about 30 to about 50 cycles comprising a denaturation step at high temperatures, such as about 95 °C for about 15 seconds to about 1 minute, an annealing step at the primer-specific annealing temperature for about 30 seconds to about 1 minute, and an extension step or elongation step at about 72 °C for about 30 seconds to about 2 minutes depending on the length of the amplicon.
  • the cycles are followed by a terminal elongation step at a temperature of about 72 °C for about 10 minutes and optionally subsequent cooling at about 8 °C until removal of the sample.
  • the activatable DNA polymerase is preferably an activatable DNA polymerase which comprises a cleavable site as described herein.
  • the activatable DNA polymerase comprises a photocleavable site as described herein.
  • the DNA polymerase protein unit is directly coupled or indirectly coupled, e.g., by a linker; to the nucleic acid unit and the cleavable site, preferably the photocleavable site, is localized in the nucleic acid unit as described herein.
  • the DNA polymerase protein unit is indirectly coupled to the nucleic acid unit by the cleavable site, preferably the photocleavable site, optionally wherein the cleavable site is flanked by at least one linker unit on one or both sites of the cleavable site as described herein.
  • the photocleavable site is activated by irradiation with light, such as light of a wavelength which cleaves conventional photocleavable sites.
  • Such a wavelength is known to the skilled person, e.g., a wavelength which is between about 300 nm to about 400 nm, preferably between about 310 nm to about 370 nm, more preferably between about 315 nm to about 365 nm, most preferably at about 315 or at about 365 nm may be used for a o- nitrobenzyl-based photocleavable site, e.g., 1-(2-Nitrophenyl)-1 ,3-propanediol or 1 -(2- Nitrophenyl)-1 ,3-butanediol.
  • This activation (i.e., cleavage) of the photocleavable site results in cleavage of at least a part of the nucleic acid unit of the activatable DNA polymerase.
  • the wavelength does not essentially interfere with the integrity of the nucleic acid template, the activity of the activatable DNA polymerase protein unit and/or is compatible with the assay method.
  • the invention provides a method of rolling circle amplification comprising: a) providing a sample comprising at least one circular nucleic acid template, components for nucleic acid synthesis and the activatable DNA polymerase of the invention, preferably wherein the DNA polymerase protein unit is Phi29, more preferably comprising the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 34, b) activating the activatable DNA polymerase in the sample of step a), thereby generating an activated DNA polymerase, and c) subjecting the sample with the activated DNA polymerase of step b) to reaction conditions that allow amplification of the circular nucleic acid template.
  • the conditions in step c) comprise incubation at an about constant temperature, preferably at temperature in a range between 28°C to 40°C, preferably between 30°C to 37°C.
  • a “constant temperature” as used herein means a temperature of fixed value which might deviate from the fixed value within a range of 1 °C to 3 °C, preferably 1 °C to 2 °C.
  • Buffers which might be used in step b) are known to the skilled person and might, e.g., comprise buffers which are suitable for DNA polymerase, e.g. a buffer which is suitable for carrying out nucleic acid synthesis comprising a salt and cofactors for the polymerase such as Mg 2+ .
  • the activatable DNA polymerase is preferably an activatable DNA polymerase which comprises a cleavable site as described herein.
  • the activatable DNA polymerase comprises a photocleavable site as described herein.
  • the DNA polymerase protein unit is directly coupled or indirectly coupled, e.g., by a linker; to the nucleic acid unit and the cleavable site, preferably the photocleavable site, is localized in the nucleic acid unit as described herein.
  • the DNA polymerase protein unit is indirectly coupled to the nucleic acid unit by the cleavable site, preferably the photocleavable site, wherein optionally the cleavable site is flanked by at least one linker unit on one or both sites of the cleavable site as described herein.
  • the photocleavable site is activated (resulting in cleavage of at least a part of the nucleic acid unit of the activatable DNA polymerase) by irradiation with light, such as light of a wavelength which cleaves conventional photocleavable sites.
  • Such a wavelength is known to the skilled person, e.g., a wavelength which is between about 300 nm to about 400 nm, preferably between about 310 nm to about 370 nm, more preferably between about 315 nm to about 365 nm, most preferably at about 315 or at about 365 nm may be used for a o-nitrobenzyl-based photocleavable site, e.g., 1 -(2-Nitrophenyl)-1 ,3- propanediol or 1 -(2-Nitrophenyl)-1 ,3-butanediol.
  • the activatable DNA polymerase of this embodiment does not comprise a cleavable site as described herein.
  • the nucleic acid of the activatable DNA polymerase is directly coupled to the DNA polymerase protein unit.
  • the nucleic acid unit is indirectly coupled to the DNA polymerase protein unit by a linker unit as described herein.
  • the DNA polymerase of this embodiment is activated by exposing the DNA polymerase to a single stranded nucleic acid which is sufficiently complementary for hybridizing to the nucleic acid unit, preferably wherein the nucleic acid unit is at least partially single stranded.
  • the nucleic acid unit of the activatable DNA polymerase is at least partially single stranded or comprises at least a single stranded part as described herein.
  • the nucleic acid unit comprises at least 12, preferably at least 15, more preferably at least 20 consecutive nucleotides which are single stranded.
  • the single stranded part of the nucleic acid unit is localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit.
  • the partially single stranded nucleic acid unit may comprise a terminal or an internal double stranded part, preferably wherein at least 12, preferably at least 15, more preferably at least 20 consecutive single stranded nucleotides are present which are preferably localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit.
  • the internal or terminal double stranded part might preferably be generated by a self-complementary part, e.g., a hairpin, of a single stranded nucleic acid unit.
  • the nucleic acid unit is a single stranded nucleic acid unit, i.e. , it comprises single stranded nucleotides only.
  • the sequence of the nucleic acid unit does not have any predicted secondary structure.
  • the nucleic acid unit is not an aptamer.
  • the complementary sequence of the single stranded part of the nucleic acid unit has a sequence identity of at least about 80%, at least about 90%, at least about 95%, at least about 98% or at least about 100% to the complete sequence of the single stranded nucleic acid.
  • the invention provides a method of nucleic acid sequencing comprising: a) providing a sample comprising a nucleic acid to be sequenced, components for nucleic acid sequencing and the activatable DNA polymerase of the invention as described herein, preferably wherein the DNA polymerase protein unit is Phi29, more preferably comprising the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 34, or Klenow fragment, more preferably comprising the amino acid sequence of SEQ ID NO: 9, b) activating the activatable DNA polymerase in the sample of step a), thereby generating an activated DNA polymerase, and c) subjecting the sample with the activated DNA polymerase of step b) to reaction conditions that allow sequencing of the nucleic acid to be sequenced.
  • the DNA polymerase protein unit is Phi29, more preferably comprising the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 34, or Klenow fragment, more preferably comprising the amino acid sequence of SEQ ID NO: 9, b) activ
  • the nucleic acid to be sequenced might be any nucleic acid, e.g., a linear nucleic acid and/or a circular nucleic acid.
  • the nucleic acid template might be a single stranded or double stranded nucleic acid.
  • the nucleic acid to be sequenced might be a genomic nucleic acid of an organism or a pathogen (e.g. a bacterial or viral pathogen).
  • the components and amounts of the components for nucleic acid sequencing are known to the skilled person and are similar to the components described above for the DNA amplification method.
  • the components might comprise a mixture deoxyribonucleotides (dNTPs), buffers which are suitable for carrying out synthesizing processes of nucleic acids, cofactors for the polymerase such as Mg 2+ , and primers.
  • dNTPs mixture deoxyribonucleotides
  • buffers which are suitable for carrying out synthesizing processes of nucleic acids
  • cofactors for the polymerase such as Mg 2+
  • primers primers.
  • the basic principle of nucleic acid sequencing is the chain-termination method which comprises elongation of the primer with a dNTP mixture comprises nucleotides of each base which lead to a termination of the DNA polymerase activity, such as a 2’, 3’- dideoxynucleotide (ddNTP) and is described, e.g., in Sanger et al., 1977 [22] and 1975 [23], which are incorporated herein by reference.
  • ddNTP dideoxynucleotide
  • further sequencing methods which might be applicable in the present invention such as 454 pyrosequencing, Illumina (Solexa) sequencing or singlemolecule real-time (SMRT) sequencing (Pacific Biosciences) [24-28] which are incorporated herein by reference.
  • the DNA polymerase protein unit is indirectly coupled to the nucleic acid unit by the cleavable site, preferably the photocleavable site, wherein optionally the cleavable site is flanked by at least one linker unit on one or both sites of the cleavable site as described herein.
  • the photocleavable site is activated by cleavage of the entire or at least a part of the nucleic acid unit by irradiation with light.
  • the activatable DNA polymerase of this embodiment does not necessarily comprise a cleavable site as described herein.
  • the nucleic acid of the activatable DNA polymerase is directly coupled to the DNA polymerase protein unit.
  • the nucleic acid unit is indirectly coupled to the DNA polymerase protein unit by a linker unit as described herein.
  • the activatable DNA polymerase may or may not comprise a cleavable site as this is not required for the method of determining the presence or absence of a single stranded nucleic acid of interest.
  • the activatable DNA polymerase of the invention does not comprise a cleavable site.
  • the single stranded part of the nucleic acid unit of the activatable DNA polymerase comprises a sequence which is sufficient complementary to hybridize to the nucleic acid of interest.
  • the complementary sequence of the single stranded part of the nucleic acid unit has a sequence identity of at least about 80%, at least about 90%, at least about 95%, at least about 98% or at least about 100% to the complete sequence of the single stranded nucleic acid of interest.
  • the single stranded nucleic acid may be at least a part of a nucleic acid encoding a polypeptide or protein, such as a secreted, cytoplasmic, nuclear, membrane bound or cell surface polypeptide or might be a non-coding nucleic acid.
  • the circular primed template is single stranded and/or comprises a sequence which is identical to the single stranded nucleic acid unit of the activatable DNA polymerase.
  • the DNA polymerase generates an amplification product of the circular template thereby generating a multitude of copies of the single stranded nucleic acid of interest. These copies may in turn activate further activatable DNA polymerases thereby rapidly amplifying the initial signal.
  • Subsequent hybridizing of a labeled probe, e.g., fluorescence-labeled, to the amplification product, and measuring a signal generated by the label indicates the presence of the nucleic acid of interest.
  • determination of activity of the activatable DNA polymerase activity may comprise determination of nuclease activity of the activatable DNA polymerase, such as degradation of a single stranded nucleic acid added to the activatable DNA polymerase wherein degradation creates a measurable signal, such as a fluorescence signal.
  • nuclease activity of the activatable DNA polymerase such as degradation of a single stranded nucleic acid added to the activatable DNA polymerase wherein degradation creates a measurable signal, such as a fluorescence signal.
  • the invention relates to methods of determining the presence or absence of a DNA repair enzyme of interest, the method comprising: a) providing a sample to be tested for comprising a DNA repair enzyme, b) contacting the sample of step a) with an activatable DNA polymerase of the invention as described herein wherein the nucleic acid unit comprises a damaged nucleotide, c) incubating the sample of step b) comprising the activatable DNA polymerase under conditions which allow nucleotide excision repair, preferably of cleavage of a at least a part of the nucleic acid unit, d) determining activity of the activatable DNA polymerase DNA polymer wherein the DNA polymerase activity indicates the presence of a DNA repair enzyme of interest.
  • the sample might be a sample derived from an organism.
  • the sample is a tissue or cell sample or sample from a body fluid.
  • the sample might be a biopsy, a smear, a blood sample, e.g., serum or plasma, a urine sample, a feces sample, a liquor sample, a mucus sample or a pus sample.
  • Conditions which allow nucleotide excision repair comprise incubation at a temperature of about 30 °C to about 39 °C, preferably about 37 °C.
  • the skilled person would know that the incubation buffer needs to be adopted to be optimal for the activity of the specific repair enzyme to be tested.
  • the activatable DNA polymerase of this embodiment does not necessarily comprise a cleavable site as described herein.
  • the nucleic acid of the activatable DNA polymerase is directly coupled to the DNA polymerase protein unit.
  • the nucleic acid unit is indirectly coupled to the DNA polymerase protein unit by a linker unit as described herein.
  • the activatable DNA polymerase of the invention does not comprise a cleavable site.
  • the activatable DNA polymerase comprises a mesophilic DNA polymerase protein unit as described herein, most preferably Phi 29 as described herein, e.g., Phi29 comprising the amino acid sequence of SEQ ID NO: 6 or SEQ ID NO: 34.
  • the nucleic acid unit of the activatable DNA polymerase is at least partially single stranded or comprises at least a single stranded part as described herein.
  • the nucleic acid unit comprises at least 12, preferably at least 15, more preferably at least 20 consecutive nucleotides which are single stranded.
  • the single stranded part of the nucleic acid unit is localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit.
  • the partially single stranded nucleic acid unit may comprise a terminal or an internal double stranded part, preferably wherein at least 12, preferably at least 15, more preferably at least 20 consecutive single stranded nucleotides are present which are preferably localized at a terminus of the nucleic acid unit which is coupled to the DNA polymerase protein unit.
  • the internal or terminal double stranded part might preferably be generated by a self-complementary part, e.g., a hairpin, of a single stranded nucleic acid unit.
  • the nucleic acid unit is a single stranded nucleic acid unit, i.e. , it comprises single stranded nucleotides only.
  • the sequence of the nucleic acid unit does not have any predicted secondary structure. According to the invention the nucleic acid unit is not an aptamer.
  • the invention provides the use of a nucleic acid for reversibly inhibiting a DNA polymerase wherein the nucleic acid is coupled to the DNA polymerase (a) by a covalent chemical bond or by streptavidin-biotin; and/or (b) by its terminal nucleotide, preferably wherein the nucleic acid has a length which is sufficient to block activity of the DNA polymerase more preferably wherein the nucleic acid is at least partially single stranded as described herein.
  • the invention provides the use of the activatable DNA polymerase of the invention in a nucleic acid synthesis process, preferably wherein the activatable DNA polymerase comprises a cleavable site wherein upon cleavage at least a part of the nucleic acid unit is removed and wherein the cleavable site is a photocleavable site.
  • DBCO dibenzocyclooctyne
  • the inventors used the E. coli BI21 star (DE3) strain transformed with the plasmid pEVOL-pAzF (a gift from Prof. Peter Schultz, Addgene plasmid #31186) for incorporation of the unnatural amino acid 4-Azido-L-phenylalanine in the recombinant proteins.
  • pEVOL-pAzF E. coli cells co-transformed with the expression plasmids were grown with vigorous shaking at 37 °C in LB medium with the adequate antibiotics until they reached an QD600 of « 1 .
  • the cells were pelleted, washed with M9 minimal medium, and resuspended in M9 minimal medium supplemented with 0.2 mg/mL 4-azido-L-phenylalanine (Hycultec GmbH, Germany), 0.02% arabinose and antibiotics.
  • the culture was incubated at 37 °C degree for one hour and finally induced with 1 mM IPTG overnight at 16°C.
  • UV pulses were applied using either a 45-watt 315 nm UV-Pad (Vilber, France) or a handheld 6-watt 365 nm lamp (Analytikjena GmbH, Germany). The samples were illuminated with UV light just before the polymerization or digestion reaction were started. 1.7 Multiply-primed amplification experiments
  • the cells were resuspended in 200 pl of molecular biology grade water and boiled at 99 °C for 5 min, afterwards the sample was centrifuged for 2 min at 15.000 g and the supernatant with the chromosomic DNA transferred to a fresh tube. This chromosomic sample was diluted 10 times and 0.5 pl was used for the PCRs.
  • the inventors used 0.25 ng of the plasmid as template.
  • an o-nitrobenzyl-based photocleavable (PC) linker (see Material and Methods section for details) between the first and the second nucleotide proximal to the anchoring point of the enzyme (see Figure 1 ).
  • a short UV pulse will release the oligonucleotide from the enzyme and reactivate it.
  • an SDS-PAGE gel shows the effect of UV pulses of different duration on the light-sensitive enzyme-oligo complex.
  • a band corresponding to unmodified enzyme appeared in the irradiated samples (see lanes 3- 5 in Figure 2a), and as expected the proportion of this population correlated positively with duration of the light pulse.
  • the Phi29 pol-PC_oligo samples that were irradiated recovered the enzymatic activity, and this reactivation was correlated with the intensity and duration of the light pulse ( Figure 2b, lanes 5-9). This reactivation was not observed in irradiated Phi29 pol_oligo (lane 3), confirming that the reactivation is specific to oligonucleotide cleavage.
  • the inventors achieved a tight blockage of the enzymatic activity.
  • the inventors did not detect residual activity in the non-illuminated samples, as there was no statistical difference (p ⁇ 0.01 ) with samples that are not able to polymerize (samples without dNTPs, see Figure 2e).
  • Even experiments performed at high concentration of the enzyme (150 nM) did not show activity in the nonilluminated samples (see figure 5a), further confirming a severe inactivation of the enzyme.
  • the inventors blocked the enzyme with a third oligonucleotide (having the sequence of SEQ ID NO: 3) with a completely different sequence (Phi29 pol_oligo2, Table 1 for details).
  • This third type of modified Phi29 pol still displayed the same light-activated behavior ( Figure 2f, right). Similar results were also obtained with longer sequences, e.g., ttcctctaccacctacatcactcttct (SEQ ID NO: 4) and ttcctctaccacctacatcactcttctcattac (SEQ ID NO: 5) (data not shown).
  • the proposed inhibition mechanism would also provide blockage of the 3’ to 5’ exonuclease (3'-5' exo) activity of the Phi29 pol, as the oligonucleotide bound to the enzyme might also successfully compete with other exonuclease substrates provided it still hampers the access to the active site.
  • the inventors devised a test to characterize the 3'-5' exo activity of the Phi29 pol constructs using a 5’ fluorophore- labeled (6-Carboxyfluorescein, 6-FAM) single stranded DNA probe (FAM-labeled ssDNA).
  • the position of the modification was not rationally designed, the inventors hypothesized that the same effect might be observed for other DNA polymerases as long as the oligonucleotide has enough flexibility to reach the active sites. Therefore, the inventors implemented the same strategy in two other DNA polymerases widely used in biotechnology, the Taq and the Pfu DNA polymerases (for a discussion on how exonuclease degradation of the blocking oligo was avoided see Material and Methods, section 1.4 Protein-oligo coupling).
  • the Taq pol is the workhorse for PCR applications in all laboratories around the world and Pfu pol is a classical low error rate polymerase for application where high fidelity is desired [2b, 2c, 4b],
  • Taq DNA pol possesses 5’ nuclease activity, including 5’ to 3’ exonuclease and 5’ flap nuclease activity [2c, 12],
  • the nuclease activity of the Taq pol-PC_oligo was inhibited until the samples were photo-activated ( Figure 3d, see lanes 3 and 4 and comparison with the wild type enzyme in lane 1 ). Altogether, the results show that not only the polymerase activity was blocked in the enzymes, but also the nuclease activity.
  • the data presented herein suggest that the inactivation of the enzymes is caused by obstructed access to the active site (or direct competition for it) by the oligonucleotide attached to the enzyme. It was hypothesized that a similar re-activation effect would be observed upon hybridization of a complementary oligonucleotide with the blocking ssDNA, as the rigidification derived from the transition from single to double stranded DNA could lead to hampered accessibility of the blocking DNA to the enzymatic active center. Indeed, the inventors observed such an effect when incubating the Phi29 pol-oligo with the complementary oligo, an effect that is dependent on the concentration of the latter (Fig 6a).
  • RNA sequences can also trigger the reactivation of the enzyme (see Figure 6b, left gel), showing therefore applications in the detection of, e.g., microRNA (small regulatory RNAs, related to ageing, neurodegeneration, and cancer and potentially useful as non- invasive biomarkers [16] ).
  • microRNA small regulatory RNAs, related to ageing, neurodegeneration, and cancer and potentially useful as non- invasive biomarkers [16] ).
  • the inventors also included base modifications in the blocking oligonucleotide bound to the enzyme and the activity of the enzyme remained reversibly blocked (see Figure 6b, right gel). Specifically, they substituted one of the bases for an abasic site.
  • Example 3 the inventors showed that a DNA polymerase whose activity is blocked by a nucleic acid can be re-activated upon hybridization of a complementary oligonucleotide with the blocking nucleic acid. Based on this finding, the inventors propose a novel strategy for molecular detection (point of care, POC) of single stranded nucleic acids of interest such as miRNAs using, e.g., an activatable Phi29 DNA polymerase (Phi29 pol) in accordance with the invention, which is inactive and recovers activity only after the recognition of a single stranded nucleic acid of interest, e.g., a specific small nucleic acid (RNA or DNA, Fig 6a) and 6b), left gel).
  • POC point of care
  • Phi29 pol Due to its strand displacement activity, the Phi29 pol does not require thermal cycling to achieve amplification reactions, besides, it performs optimally at about 30 °C and when combined with rolling-circle amplification (RCA) can produce excellent signal amplifications in short times. Phi29 pol is therefore ideal to develop POC applications.
  • the strategy proposed here is not limited to Phi29 polymerase. Unlike previous RCA-Phi29 pol assays, in the inventive approach the enzyme itself is the sensor. Phi29 pol is covalently modified with an at least partially single stranded DNA nucleic acid unit as described herein.
  • the single stranded part of the DNA nucleic acid unit is complementary to the single stranded nucleic acid of interest, e.g., a target RNA sequence of interest, and after binding the enzyme recovers the activity due the rigidification associated with the transition from single to double strand (which hampers its accessibility to the active site).
  • This initial activation (step 1 , Fig 8) is coupled to an RCA assay, producing thousands of DNA copies of the single stranded nucleic acid of interest, e.g., a target activator sequence (Step 2, Fig 8), and triggering a second wave of enzymatic activation (Step 3, Fig 8).
  • the newly activated enzymes can repeat the process and an exponential activation of polymerases occurs (Step 4, Fig 8).
  • the signal is further amplified by a nicking enzyme digesting of a fluorophore-quencher oligonucleotide complementary to the copied RCA template. Owing to the nicking enzyme, every copy of the template can participate in several rounds of fluorophore- quencher activation, producing a fluorescence signal.
  • the assay can be implemented in a lateral flow strip format and read-out using commercially available fluorescence lateral flow readers [34], A restriction enzyme site is also included in the RCA template. Using an oligo complementary to the restriction enzyme site in the copied template, the enzymatic digestion would result in multiple smaller fragments of the latter, thus increasing diffusivity and speeding up the exponential activation of the polymerases.
  • Phi DNA polymerase with N59D (SEQ ID NO: 6)
  • Bir A gene (SEQ ID NO: 11 )

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP22772844.1A 2021-09-01 2022-08-31 Aktivierbare dna-polymerase Pending EP4396338A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP21194389 2021-09-01
PCT/EP2022/074156 WO2023031247A1 (en) 2021-09-01 2022-08-31 Activatable dna polymerase

Publications (1)

Publication Number Publication Date
EP4396338A1 true EP4396338A1 (de) 2024-07-10

Family

ID=77595457

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22772844.1A Pending EP4396338A1 (de) 2021-09-01 2022-08-31 Aktivierbare dna-polymerase

Country Status (2)

Country Link
EP (1) EP4396338A1 (de)
WO (1) WO2023031247A1 (de)

Family Cites Families (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1386666B1 (de) 1997-03-28 2012-11-14 Life Technologies Corporation Thermo-Zyklus-Vorrichtung zur Ausführung der Polymerase-Kettenreaktion
CA2328609A1 (en) 1998-05-16 1999-11-25 Pe Corporation (Ny) Instrument for monitoring polymerase chain reaction of dna
CN1313394A (zh) * 2000-03-10 2001-09-19 上海博德基因开发有限公司 一种新的多肽——dna聚合酶10和编码这种多肽的多核苷酸
CN1363658A (zh) * 2001-01-05 2002-08-14 上海博德基因开发有限公司 一种新的多肽——dna聚合酶14.78和编码这种多肽的多核苷酸
CN1364876A (zh) * 2001-01-10 2002-08-21 上海博德基因开发有限公司 一种新的多肽——dna聚合酶9.68和编码这种多肽的多核苷酸
US20020172972A1 (en) * 2001-05-15 2002-11-21 President And Fellows Of Harvard College Use of a selectively inactivatable enzyme to digest contaminating nucleic acid
EP2813581B1 (de) * 2005-01-06 2018-06-27 Applied Biosystems, LLC Verwendung von Polypeptiden mit Nukleinsäurebindungsaktivität in Verfahren schneller Nukleinsäurenamplifikation
WO2007008728A2 (en) * 2005-07-07 2007-01-18 Quanta Biosciences, Inc. Compositions and methods for increasing amplification efficiency
US10724017B1 (en) * 2017-12-06 2020-07-28 Cepheid Inhibition of DNA polymerases by uracil-DNA glycosylase-cleavable oligonucleotide ligands
US10689629B1 (en) * 2017-12-06 2020-06-23 Cepheid Inhibition of nucleic acid polymerases by endonuclease V-cleavable circular oligonucleotide ligands
EP3818176A4 (de) * 2018-07-03 2022-04-27 National University of Singapore Visuelle und modulare detektion von nukleinsäuren mit enzymassistierter nanotechnologie

Also Published As

Publication number Publication date
WO2023031247A1 (en) 2023-03-09

Similar Documents

Publication Publication Date Title
US20220127667A1 (en) Method of dna synthesis
CN109641026B (zh) 用于检测靶rna的方法和组合物
JP6068365B2 (ja) Ｄｎａ合成のためのテンプレートスイッチの使用
KR101467969B1 (ko) 핵산분자의 제조방법
ES2331112T3 (es) Nueva composicion y metodo para la amplificacion de acidos nucleicos de inicio en caliente.
US11773425B2 (en) Multiplexed profiling of RNA and DNA modifications
JP2016047049A (ja) 閉鎖型直鎖状ｄｎａの製造
KR102278495B1 (ko) Dna 생산 방법 및 dna 단편 연결용 키트
KR20090037118A (ko) 리가제 및 엔도뉴클레아제의 존재하에서 롤링서클 증폭에의하여 표적 핵산을 증폭하는 방법
EP4017995A1 (de) Verfahren zur enzymatischen rna-kappung
ES2776427T3 (es) Método de amplificación de ADN basado en invasión de cadena
JP2008029333A (ja) 新規遺伝子増幅法に用いられるプライマー
WO2021147910A1 (en) Methods and kits for amplification and detection of nucleic acids
AU2020336278A1 (en) Enzymatic RNA capping method
EP4396338A1 (de) Aktivierbare dna-polymerase
JP2021533751A (ja) 不連続な複数の鋳型から相補的ＤＮＡ（ｃＤＮＡ）を順序だてて連続的に合成するための組成物およびその方法
CA3238871A1 (en) Rna and dna analysis using engineered surfaces
JP2008029335A (ja) 新規遺伝子増幅法に用いられるプライマーセットおよびキット
Kesici et al. A simple and general approach to control the activity of DNA processing enzymes
KR100812259B1 (ko) 기지의 서열에 인접한 미지의 ｄｎａ 서열을 증폭하는 방법
WO2024006552A1 (en) Ambient temperature nucleic acid amplification and detection
CA3222937A1 (en) Methods of nucleic acid sequencing using surface-bound primers
JP2004135628A (ja) Ｄｎａの変異導入法

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20240226

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR