EP4305168A1 - Antisense oligonucleotides for inhibiting alpha-synuclein expression - Google Patents
Antisense oligonucleotides for inhibiting alpha-synuclein expressionInfo
- Publication number
- EP4305168A1 EP4305168A1 EP22710115.1A EP22710115A EP4305168A1 EP 4305168 A1 EP4305168 A1 EP 4305168A1 EP 22710115 A EP22710115 A EP 22710115A EP 4305168 A1 EP4305168 A1 EP 4305168A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- mcds
- ads
- tds
- oligonucleotide
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/321—2'-O-R Modification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/32—Chemical structure of the sugar
- C12N2310/323—Chemical structure of the sugar modified ring structure
- C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/341—Gapmers, i.e. of the type ===---===
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/34—Spatial arrangement of the modifications
- C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/352—Nature of the modification linked to the nucleic acid via a carbon atom
- C12N2310/3525—MOE, methoxyethoxy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
- C12N2320/53—Methods for regulating/modulating their activity reducing unwanted side-effects
Definitions
- Alpha-synuclein is a protein encoded by the SNCA gene that is predominantly expressed in the central nervous system, including the neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. In neurons, the expression of alpha-synuclein is localized at presynaptic terminals, and the protein is thought to be a chaperone involved in the assembly and function of the SNARE complex. At least three different isoforms of alpha-synuclein are known, which result from alternative splicing of the SNCA gene transcript. Alpha-synuclein may be involved in modulating many different neuronal functions and properties, including synaptic transmission, synaptic vesicle density, and neuronal plasticity.
- alpha-synuclein aggregates and forms insoluble fibrils.
- Alpha- synuclein aggregates are thought to be involved in the pathology of many different neurological diseases, including Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, and multiple system atrophy.
- the pathogenic role of alpha-synuclein in the progression of disease has been genetically validated. For example, missense mutations in the SNCA gene lead to rare familial Parkinson’s disease. Duplication or triplication of the wildtype gene can also cause rare cases of Parkinson’s disease, and the overexpression of wildtype alpha-synuclein protein alone has been demonstrated to be sufficient to cause disease.
- MSA Multiple system atrophy
- GCIs glial cytoplasmic inclusions
- the alpha-synuclein protein can be found in tissues in several different forms, including as a monomer, oligomer, or fibrillary complex, and may be phosphorylated. It is currently unknown which of these protein species is causative in synucleinopathies. It is therefore challenging to know which form of the protein to target in order to develop drugs that treat synucleinopathies at the protein level.
- the present disclosure provides antisense oligonucleotides (ASOs) that reduce the abundance or activity of RNA transcribed from the SNCA gene.
- ASOs antisense oligonucleotides
- the compounds of the present disclosure decrease the abundance of alpha-synuclein protein in the cell.
- the ASOs described herein therefore reduce alpha-synuclein proteins, their accumulation and aggregates which might alleviate the symptoms and/or delay disease progression.
- the present disclosure provides an oligonucleotide comprising a nucleotide sequence of 15 to 30 (e.g., 16 to 20) contiguous nucleotides, wherein the nucleotide sequence is complementary to a region of the same length found in nucleotides a) 16350-16450, b) 18926-19030, c) 22250-22471, d) 22933-23079, e) 23408-23700, f) 29753-29819, g) 38128-38158, h) 39852-39906, i) 53762-53799, or j) 59754-59865 of SEQ ID NO: 1.
- the nucleotide sequence comprises no more than 3 mismatches to said region.
- the nucleotide sequence may comprise 0, 1, or 2 mismatches to said region.
- the nucleotide sequence is single- stranded.
- the nucleotide sequence may be selected from, e.g., SEQ ID NOs: 18-40.
- an oligonucleotide described herein may comprise one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
- an oligonucleotide described herein may comprise one or more modified nucleotides.
- modified nucleotides may comprise, e.g., a 2’-0- methoxy ethyl (2’ -MOE) nucleotide, a locked nucleic acid (LNA) nucleotide, a bridged nucleic acid (BNA) nucleotide, or any combination thereof.
- all cytosines in an oligonucleotide described herein are 5- methyl cytosines.
- an oligonucleotide described herein may comprise phosphodiester internucleoside linkages and/or phosphorothioate internucleoside linkages.
- the oligonucleotide may comprise at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages.
- at least 1, 2, 3, 4, or 5, or all intemucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.
- an oligonucleotide described herein comprises: i) a 5-10-5 MOE gapmer; ii) a 4-10-4 MOE gapmer; iii) a 3-10-3 LNA gapmer; iv) a 3 - 11 -3 LNA gapmer; v) a 3-2-10-2-3 LNA/MOE gapmer; vi) a 2-3-10-3-2 BNA/MOE gapmer; vii) a 3-2-10-2-3 BNA/MOE gapmer; or viii) a 2-3-10-3-2 LNA/MOE gapmer.
- the oligonucleotide comprises: i) a 3-2-10-2-3 LNA/MOE gapmer; ii) a 2-3-10-3-2 BNA/MOE gapmer; iii) a 3-2-10-2-3 BNA/MOE gapmer; or iv) a 2-3-10-3-2 LNA/MOE gapmer; wherein the intemucleoside linkages between nucleosides v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19; vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate intemucleoside linkages.
- an oligonucleotide described herein comprises the following formula: i) Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 34), ii) Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 20), iii) Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mC
- A is adenine
- mC is a 5 -methyl cytosine
- G is guanine
- T is thymine
- e is a 2’-MOE modified ribose
- d is a 2’-deoxyribose
- b is a BNA
- 1 is an LNA
- o is a phosphodiester internucleoside linkage
- s is a phosphorothioate internucleoside linkage.
- the present disclosure provides an oligonucleotide comprising the structural formula: [0017] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
- the present disclosure provides an oligonucleotide comprising the structural formula:
- the present disclosure provides an oligonucleotide comprising the structural formula:
- the present disclosure also provides an oligonucleotide conjugate comprising an oligonucleotide described herein.
- the present disclosure provides a pharmaceutical composition
- a pharmaceutical composition comprising an oligonucleotide described herein or an oligonucleotide conjugate as described herein, and a pharmaceutically acceptable excipient.
- a method of reducing alpha-synuclein expression in a mammalian cell comprising contacting the cell with an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein, thereby reducing alpha-synuclein expression in the cell.
- the cell is a central nervous system cell, such as a cell in the human brain.
- the present disclosure provides a method for treating a synucleinopathy in a subject in need thereof, comprising administering a therapeutically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein to the subject.
- the synucleinopathy is Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, or multiple system atrophy.
- the oligonucleotide may be, e.g., injected intrathecally or intracranially to the subject.
- the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in murine primary cortical neurons engineered to express human alpha-synuclein.
- any of the oligonucleotides, oligonucleotide conjugates, and pharmaceutical compositions described herein may be used in any method of treatment as described herein, may be for use in any treatment as described herein, and/or may be for use in the manufacture of a medicament for any treatment as described herein.
- FIG. l is a diagram illustrating the knock-in of the human SNCA gene at the endogenous mouse SNCA locus in an hSNCA mouse model ⁇ hSNCA +!+ ).
- the level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
- the level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
- FIG. 3 is a table showing the tolerability scoring system for mice utilized in the in vivo assays described herein.
- FIG. 4 is a bar graph showing the efficacy and tolerability of the given ASO in mice.
- the left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo two weeks after treatment with the given ASO relative to PBS treated samples.
- the right Y axis and black circles depict the functional observational battery (FOB) absolute score observed in mice one hour after treatment with the given ASO.
- FOB functional observational battery
- FIG. 5 is a bar graph showing the efficacy and tolerability of the given 3LNA- 2MOE-10DNA-2MOE-3LNA gapmer ASO. Axes are as described in FIG. 4.
- FIG. 6 is a bar graph showing the efficacy and tolerability of the given 2BNA- 3MOE-10DNA-3MOE-2BNA gapmer ASO. Axes are as described in FIG. 4.
- FIG. 7 is a bar graph showing the efficacy of SNCA_ASO_1613
- SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol.
- the left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
- FIG. 8 is a bar graph showing the efficacy of SNCA_ASO_1613
- SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol.
- the left Y axis and solid bars depict the expression level of alpha synuclein protein expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
- FIG. 9 is a dot graph showing the concentration of SNCA AS0 1613
- FIG. 10 is a table showing the tolerability scoring system for rats utilized in the in vivo assays described herein.
- FIG. 11 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR.
- FIG. 12 is a dot graph a dots graph comparing SNCA ASO 01617 and SNCA ASO 01613 at doses of 10 nmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR.
- FIG. 13 is a dot graph that compares the SNCA ASO 01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
- FIG. 14 is a diagram illustrating the experimental protocol for the measurement of alpha-synuclein pathology in neuronal culture treated with ASO.
- FIG. 15 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613,
- FIG.16 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613 before, during and after PFF treatment and measured by using a TR-FRET based immunoassay (mean ⁇ SEM).
- PFFs human alpha-synuclein preformed fibrils.
- the present disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting RNAs transcribed from the SNCA gene can effectively reduce the abundance of target SNCA gene transcripts and/or translation of the alpha-synuclein polypeptide from the transcripts.
- ASOs of the present disclosure comprise sequences that are complementary to SNCA transcripts and bind to defined nucleotide sequences within the transcripts.
- the ASO mediates a decrease in the expression and accumulation of the alpha-synuclein protein in the cell, alleviating the severity or progression of neurodegenerative diseases.
- the ASOs of the present disclosure are expected to be particularly useful in the treatment of synucleinopathies, which are caused by the accumulation or aggregation of the alpha- synuclein protein.
- This protein can be expressed in cells as, e.g., a monomer or an oligomer, and may be phosphorylated or unphosphorylated.
- the ASOs of the present disclosure are highly advantageous in that they target alpha-synuclein expression at the SNCA transcript level and thus have the ability to decrease expression of all of the above forms of the alpha-synuclein protein.
- the ASOs of the present disclosure bind to transcripts of the SNCA gene, which encodes the alpha-synuclein protein also named SNCA protein.
- the SNCA gene is also known as alpha-synuclein, NACP, nonA-beta component of AD amyloid, PARK1, PARK4 , or PDI gene.
- an ASO described herein targets a transcript of a mammalian SNCA gene (e.g., a murine or human SNCA gene).
- the sequence for the human SNCA gene is publicly available under GenBank Accession Number NC_000004.12. The gene is 137,980 bps in length and located at chromosome 4:89700345..89838324 (SEQ ID NO: 2). A portion of the human genomic SNCA sequence is shown in SEQ ID NO: 1, and a partial sequence for the pre-mRNA transcript can be found at GenBank AccessionNumberNG_011851.1 (residues 6001-8400). A mature mRNA transcript is shown in SEQ ID NO: 3.
- an ASO of the present disclosure binds to an SNCA sequence, or a transcript thereof, selected from Chromosome 4: 89,700,345-89,838,315 (reverse strand) and those under GenBank Accession Numbers NM_000345.3, NT_016354.20 TRUNC 30800000-30919000, JN709863.1, BC013293.2, NM 001146055.1, HQ830269.1, and NC_000004.12 (89724099..89838324, complement).
- an ASO of the present disclosure binds to an SNCA transcript that encodes an alpha-synuclein protein, e.g., as found under UniProt Accession Number P37840, A8K2A4, Q13701, Q4JHI3, or Q6IAU6.
- an ASO of the present disclosure comprises a sequence that may be at least 60, 70, 80, 85, 90, or 95%, or 100% complementary to a same-length sequence in the target SNCA transcript.
- an ASO of the present disclosure can bind to a transcript of a wildtype SNCA gene (e.g., a wildtype human, non-human primate, or murine gene).
- a wildtype SNCA gene e.g., a wildtype human, non-human primate, or murine gene.
- an ASO of the present disclosure binds to a variant, such as a known variant, of the wildtype SNCA gene.
- Known variants include, for example, a version of the human SNCA gene in which a G209A substitution results in an A53T mutation in the alpha- synuclein protein encoded from that gene. Additional known variants have nucleotide mutations giving rise to mutant alpha-synuclein proteins comprising A30P, E46K, H50Q, and G51D amino acid substitutions.
- an ASO described herein may reduce or inhibit expression of an SNCA transcript encoding an alpha-synuclein protein with one or more mutations selected from A30P, E46K, H50Q, G51D, and A53T.
- the present ASOs comprise sequences that are complementary to a same-length sequence in a target transcript encoded by the SNCA gene (wherein the genomic SNCA sequence may comprise, e.g., SEQ ID NO: 1).
- an ASO described herein comprises a sequence that is complementary to a sequence in a hotspot region within the target SNCA nucleic acid.
- the term “hotspot region” refers to a region of the target nucleotide sequence wherein binding of a sequence within the region by a complementary ASO tends to result in a reduction in the abundance or translational activity of the target RNA transcript.
- a hotspot region may be entirely within an intron, entirely within an exon, or may span an intron/exon junction; or be located in whole or in part in the 5’ or 3’ untranslated region (UTR) of an RNA transcript.
- an ASO described herein may comprise a sequence that binds to a target sequence within or overlapping with any of several different hotspot regions of the SNCA gene transcript.
- Table A lists exemplary hotspots in the human SNCA gene and identifies ASOs of the present disclosure that are designed to be complementary to them.
- the table also shows the minimum reduction in the SNCA gene transcript observed in vitro when neurons from a humanized SNCA knock-in mouse are treated with the selected ASOs targeting this hotspot (see, e.g., the section titled “Materials and Methods of in vitro Assays” below).
- compounds are referred to interchangeably as SNCA_ASO_[compound number] and as [compound number].
- compound number SNCA AS0 01608 and compound number 01608 represent the same antisense oligonucleotide compound.
- binding of a sequence in a hotspot region by an ASO described herein reduces SNCA RNA levels by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100% in a cell (e.g., in an in vitro assay such as the one described below in the section titled “Materials and Methods of in vitro Assays”).
- an ASO of the present disclosure may be an ASO listed in Table A, or an ASO with a sequence at least 80%, 85%, 90%, 95%, 96%, 97%,
- ASO antisense oligonucleotide
- ASO refers to an oligonucleotide capable of hybridizing to a sequence in a target transcript. It is understood by a person skilled in the art that the ASOs described herein do not occur in nature (i.e., they are “isolated” ASOs).
- RNA transcript refers to any RNA transcribed from a gene (e.g., an SNCA gene).
- the gene may be wildtype or may be a mutated or variant (e.g., polymorphic) form.
- An RNA transcript may be a primary RNA transcript or precursor messenger RNA (pre- mRNA), or a messenger RNA (mRNA), and may include exons, introns, 5’ UTRs and 3’ UTRs. Unless otherwise indicated, the sequences of transcripts and ASOs provided herein denote the nucleotide sequence from 5’ end (left) to 3’ end (right).
- oligonucleotide refers to a compound comprising a strand of about 5 to 100 nucleosides, e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides, connected via internucleoside linkages.
- Each nucleoside and internucleoside linkage of an oligonucleotide of the present disclosure may be modified or unmodified from naturally occurring nucleotides and linkages.
- a modified oligonucleotide may comprise one or more modified sugar moieties, one or more modified nucleobases, and/or one or more modified intemucleoside linkages.
- An ASO described herein may comprise a sequence that is substantially or fully complementary to a same-length sequence in the target transcript. Full complementarity occurs when a first strand of contiguous nucleotides (modified or unmodified) and a second strand of contiguous nucleotides (modified or unmodified) are completely complementary to each other over the entire length of the shorter strand (or both strands, if they are of the same length).
- the two strands are considered substantially complementary to each other when they base-pair with each other over 80% or more (e.g., 90% or more) over the length of the shorter strand (or both strands, if they are of the same length), with no more than 20% (e.g., no more than 10%) of mismatching base-pairs (e.g., for a duplex of 20 nucleotides, no more than 4 or no more than 2 mismatched base-pairs).
- a sequence in an ASO of the present disclosure is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target RNA transcript.
- the present ASO comprises no more than 1, 2, or 3 mismatches to its target sequence.
- nucleobases refers to identical nucleobases.
- percent identity in this context refers to the percentage of nucleobases that are the same when the two comparing sequences are aligned (introducing gaps, if necessary) for maximum correspondence, over the length of the shorter comparing sequence (or both sequences, if the comparing sequences are of the same length).
- reduced, inhibited, or abrogated expression or activity of the target transcript is observed compared to a control sample not treated with the ASO.
- an ASO of the present disclosure reduces the abundance and/or translational activity of the target SNCA transcript in a treated sample, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control sample not exposed to the ASO.
- the ASO reduces the level of the target transcript in vivo by said percentage, and administration of the ASO optionally results in a tolerability score (Functional Observational Battery or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, e.g., 0.
- the terms “reduce” and “inhibit” do not necessarily mean a total elimination of the entire amount and/or activity of the transcript.
- ASOs are considered to be active when they reduce the amount or activity of the target RNA by 25% or more in an in vitro assay.
- the present ASO may cause a detectable or measurable change in the level or activity of the alpha-synuclein protein encoded by the target RNA.
- ASOs may inhibit expression of alpha-synuclein by recruiting an RNase HI enzyme to the duplex formed between an ASO and the target SNCA transcript.
- Enzymes of the RNase HI family are endonucleases that typically target RNA:DNA duplexes and catalyze the hydrolytic cleavage of the RNA in the duplex.
- the ASO has minimal off-target effects, and does not hybridize to any non -SNCA transcript in a way that results in significant reduction in the abundance or activity of the non -SNCA transcript.
- the present ASOs are between 8 and 30 nucleotides in length (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).
- an ASO described herein can comprise a sequence, complementary to a same-length SNCA transcript sequence, that is any of a range of nucleotide lengths having an upper limit of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
- the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In particular embodiments, the complementary sequence in the ASO is 16, 17, 18, or 20 nucleobases in length.
- the ASOs of the present disclosure may comprise one or more modifications, e.g., to increase binding affinity to the target transcript, increase ASO stability (e.g., increase resistance to degradation, e.g., by nucleases), and/or increase ease of ASO transport into the cell.
- Modifications may include any modification known in the art, including, for example, end modifications, nucleobase modifications, sugar modifications or replacements, and backbone modifications. End modifications may include, for example, 5’ and/or 3’ end modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and inverted linkages).
- Base modifications may include, e.g., replacement with stabilizing bases, removal of bases, or conjugated bases.
- Sugar modifications or replacements may include, e.g., modifications at the T and/or 4’ position of the ribose moiety, or replacement of the ribose moiety.
- Backbone modifications or internucleoside linkage modifications may include, for example, modification or replacement of phosphodiester linkages, e.g., with one or more phosphorothioates, phosphorodithioates, phosphotriesters, methyl and other alkyl phosphonates, phosphinates, and phosphoramidates.
- the present ASOs may have one or more modified nucleosides.
- nucleoside refers to a compound comprising a nucleobase and a sugar moiety.
- Naturally occurring nucleosides include DNA and RNA nucleosides.
- a non-naturally occurring nucleoside also referred to as a “modified nucleoside” or a “nucleoside analog”
- the base and/or the sugar have been modified.
- the modification of the nucleoside may be “silent,” in which case the modified nucleoside has the same or equivalent function in the context of the oligonucleotide compared to a naturally occurring nucleoside.
- a modified nucleoside may increase the efficacy of the ASO in decreasing the abundance or activity of a target transcript.
- efficacy encompasses the target engagement on SNCA mRNA.
- nucleotide refers to a nucleoside covalently bonded to one or more modified or unmodified internucleoside linkages.
- exemplary nucleotides include monophosphates, diphosphates, triphosphates, and thiophosphates.
- nucleotide encompasses unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs).
- nucleoside encompasses unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside analogs); and the term “nucleobases” encompasses unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs).
- a modified nucleoside comprises a modified nucleobase.
- the modified nucleobase is a 5-methyl cytosine (5mC) nucleobase, as shown in the structure (I) below, wherein R represents the sugar moiety.
- 5mC 5-methyl cytosine
- a sugar moiety can be a modified or an unmodified sugar moiety.
- an unmodified sugar moiety refers to a 2’-OH(H) ribosyl moiety as found in naturally occurring RNA, also referred to as an unmodified RNA sugar moiety.
- a modified sugar moiety may be a 2’-H(H) deoxyribose sugar moiety. This moiety is found naturally in deoxyribonucleic acids, and may be referred to as an unmodified DNA sugar moiety or simply a DNA sugar moiety.
- a modified sugar moiety may comprise an O-methoxyethyl (MOE) moiety.
- MOE O-methoxyethyl
- the O-methoxyethyl moiety is at the T position of the sugar, as shown in the structure below (III).
- R in the structure below represents a nucleobase.
- Each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages.
- a T -MOE modified sugar or T -MOE modified nucleoside, or simply an MOE sugar or nucleoside, is a ribose or nucleoside in which the T hydroxyl group that naturally occurs in the ribose is replaced with a 2OCH 2 CH 2 OCH 3 group.
- a modified sugar moiety may comprise a bridged nucleic acid (BNA) moiety.
- a bridged nucleic acid comprises a bicyclic sugar moiety.
- the sugar moiety comprises a 4’-CH 2 -NH-0-2’ linkage.
- the nitrogen of the bridged nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with a phenyl group).
- the structure of a BNA moiety is shown below (IV), wherein R is a nucleobase, R’ is, for example, an H, Me, or Phenyl group, and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages. In the present ASOs, R’ is an Me group, unless otherwise specified.
- a BNA modified nucleoside, or simply a BNA nucleoside is a nucleoside comprising a BNA sugar moiety.
- a modified sugar moiety may comprise a locked nucleic acid (LNA) moiety.
- a locked nucleic acid comprises a bicyclic sugar moiety.
- the sugar moiety comprises a 4’-CH 2 -0-2’ linkage.
- An LNA moiety, as described herein, may be in the alpha-L configuration or the beta-D configuration.
- LNA moieties in the ASOs described herein are in the beta-D configuration.
- the structure of an LNA moiety is shown below (V), wherein R is a nucleobase and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in intemucleoside linkages.
- An LNA modified nucleoside, or simply an LNA nucleoside is a nucleoside comprising an LNA sugar moiety.
- an ASO described herein may include one or more modified nucleotides known in the art, including, e.g., 2’-0-methyl modified nucleotides, T - fluoro modified nucleotides, 2’-deoxy modified nucleotides, T -O-m ethoxy ethyl modified nucleotides, modified nucleotides allowing for alternative intemucleoside linkages (e.g., nucleotides comprising thiophosphates, phosphorothioates, and phosphotriesters), modified nucleotides terminally linked to a cholesterol derivative or lipophilic moiety, peptide nucleic acids, inverted deoxy or dideoxy modified nucleotides, abasic modifications of nucleotides, T -amino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides comprising modifications at other sites of the sugar or base of an oligonucle
- nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% of the nucleosides in the ASO (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) are modified nucleosides.
- the ASOs of the present disclosure may comprise naturally-occurring and/or non- naturally-occurring internucleoside linkages.
- the term “internucleoside linkage,” as used in the present disclosure, refers to a covalent linkage between adjacent nucleosides in an oligonucleotide.
- an ASO described herein may include one or more modified nucleoside linkages known in the art, including, e.g., a phosphonoacetate (PACE, P(CR’R”) n COOR) or thiophosphonoacetate (thioPACE, (S)-P(CR’R”) n COOR) internucleoside linkage, wherein n is an integer from 0 to 6 and each of R’ and R” is independently selected from the group consisting of H, an alkyl and substituted alkyl.
- PACE phosphonoacetate
- S thiophosphonoacetate
- the intemucleoside linkage of a nucleotide may be a phosphate group or a thiophosphate group. Methods of preparation of phosphorous- containing intemucleoside linkages are well known to those skilled in the art.
- the ASOs described herein may have phosphodiester intemucleoside linkages, phosphorothioate intemucleoside linkages, or a combination thereof.
- phosphodiester intemucleoside linkage refers to an intemucleoside linkage between two nucleosides formed by a phosphodiester group.
- phosphorothioate internucleoside linkage refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom.
- internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or can be prepared as separate enantiomers.
- Representative intemucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates.
- ASOs of the present disclosure comprising intemucleoside linkages having one or more chiral center(s) can be prepared as populations of ASOs comprising stereorandom intemucleoside linkages, or as populations of ASOs comprising stereodefmed intemucleoside linkages.
- stereodefmed intemucleoside linkage refers to an intemucleoside linkage in which the stereochemical designation of the phosphorus atom is controlled such that a specific amount of R p or S p of the intemucleoside linkage is present within an ASO strand.
- the stereochemical designation of a chiral linkage can be defined by, for example, asymmetric synthesis.
- An ASO having at least one stereodefmed intemucleoside linkage can be referred to as a stereodefmed ASO.
- the present ASOs are fully stereodefmed.
- the term “fully stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (R p or S p ) in each intemucleoside linkage in the ASO.
- the term “partially stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (R p or S p ) in at least one intemucleoside linkage, but not in all of the intemucleoside linkages of the ASO. Therefore, a partially stereodefmed ASO can include linkages that are achiral or non-stereodefmed in addition to at least one stereodefmed linkage.
- populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular stereochemical configuration.
- the particular configuration of the particular phosphorothioate linkage is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population.
- Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art such as, for example, the methods described in Oka et ah, JACS (2003) 125:8307, Wan et ah, Nuc. Acid. Res.
- chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
- ASO conjugates antisense oligonucleotide conjugates comprising one or more ASOs described herein.
- ASO conjugate refers to an oligomeric compound comprising an antisense oligonucleotide that is covalently linked to one or more non-nucleotide moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacology or pharmacokinetic properties of the ASO.
- the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cellular distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and/or or stability of the ASO.
- the conjugate moiety may help target the ASO to a specific region in the central nervous system.
- the conjugate moiety may be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and/or a lipid (e.g., phospholipid).
- PCT Patent Publications WO 1993/07883 and WO 2013/033230 provide suitable conjugate moieties for use with the ASOs of the present disclosure.
- Certain conjugate groups and conjugate moieties have been described previously, for example, in the following references: thioether moiety, e.g., hexyl-S-tritylthiol (Manoharan et ah, Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et ah, Bioorg. Med. Chem. Lett.
- phospholipid e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et ah, Tetrahedron Lett. (1995) 36:3651-4; Shea et ah, Nucl. Acids Res.
- conjugation of an ASO of the present disclosure to a lipophilic moiety may increase the delivery of the ASO to cells of the central nervous system.
- lipophilic moiety broadly refers to any compound or chemical moiety having an affinity for lipids.
- the lipophilic moiety may generally comprise a saturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic.
- the hydrocarbon chain may comprise various substituents and/or one or more heteroatoms, such as an oxygen or a nitrogen atom.
- the lipophilic moiety is a(n) aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound.
- the lipophilic moiety is a steroid (e.g., sterol).
- Steroids include, without limitation, bile acids (e.g., cholic acid, deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone.
- cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA (1989) 86:6553-6), cholic acid moiety (Manoharan et al., Bioorg. Med. Chem. Lett. (1994) 4:1053-60), thiochole sterol moiety (Oberhauser et al., Nucl. Acids Res. (1992) 20:533-8), aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison- Behmoaras et al., EMBO J.
- A is an adenine nucleobase
- G is a guanine nucleobase
- T is a thymine nucleobase
- mC is a 5-methyl cytosine nucleobase
- e is a 2’-MOE modified sugar
- d is a 2’-deoxyribose sugar
- 1 is a locked nucleic acid
- b is a bridged nucleic acid
- o is a phosphodiester intemucleoside linkage
- s is a phosphorothioate intemucleoside linkage.
- the ASOs of the present disclosure are gapmers.
- the term “gapmer,” as used in the present disclosure, refers to an oligonucleotide comprising or consisting of an internal region positioned between two external regions, wherein the sugar moieties of the nucleosides comprising the internal region are chemically distinct from the sugar moieties of the nucleosides comprising the external region.
- the term “gap” refers to the internal region of the oligonucleotide, while the term “wing” refers to the external regions.
- a gapmer has a 5’ -wing, a gap, and a 3’ -wing. The three regions form a contiguous sequence.
- each of the wing nucleosides differ from at least some of the sugar moieties of the gap nucleosides.
- the nucleosides of the gap region of the ASOs of the present disclosure comprise entirely 2’-deoxyriboxyl nucleosides.
- a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases that do not necessarily follow the gapmer pattern of sugar modifications.
- the oligonucleotides of the present disclosure are gapmers that comprise MOE, BNA, LNA, or DNA modifications, or any combination thereof.
- the gapmers comprise MOE, DNA, and BNA, MOE, DNA, and LNA, or BNA, DNA, and LNA modified sugar moieties.
- the intemucleoside linkages between the oligonucleosides are phosphodiester or phosphorothioate intemucleoside linkages, or a combination thereof.
- the lengths of the three gapmer regions may be notated using the notation [# of nucleosides in the 5’ wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3’ wing].
- a 4-10-4 gapmer comprises 4 linked nucleosides in each wing and 10 linked nucleosides in the gap.
- an ASO of the present disclosure is a 3-10-3 LNA gapmer.
- 3-10-3 LNA gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides.
- all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methyl cytosines.
- all intemucleoside linkages are phosphorothioate intemucleoside linkages.
- an ASO of the present disclosure is a 3-11-3 LNA gapmer.
- 3-11-3 LNA gapmers are 17 nucleobases in length, wherein the central gap segment comprises 11 2’- deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides.
- all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methyl cytosines.
- all intemucleoside linkages are phosphorothioate intemucleoside linkages.
- an ASO of the present disclosure is a 4-10-4 MOE gapmer.
- 4-10-4 gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T- deoxynucleosides and each of the 5’ and 3’ wing segments comprises four T -MOE nucleosides.
- all cytosine nucleobases throughout the 4-10-4 MOE gapmer are 5-methyl cytosines.
- all intemucleoside linkages are phosphorothioate intemucleoside linkages.
- an ASO of the present disclosure is a 5-10-5 MOE gapmer.
- 5-10-5 gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T -deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides.
- all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methyl cytosines.
- all internucleoside linkages are phosphorothioate internucleoside linkages.
- an ASO of the present disclosure is a 3LNA-2MOE- 10DNA-2MOE-3LNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise an LNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a T -MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides.
- all internucleoside linkages are phosphodiester intemucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
- an ASO of the present disclosure is a 2BNA-3MOE- 10DNA-3MOE-2BNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise a BNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides.
- the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages.
- each cytosine nucleobase is a 5-methyl cytosine.
- an ASO of the present disclosure is a 3BNA-2MOE- 10DNA-2MOE-3BNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise a BNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides.
- the all internucleoside linkages are phosphodiester internucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
- an ASO of the present disclosure is a 2LNA-3MOE- 10DNA-3MOE-2LNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise an LNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides.
- the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages.
- the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
- the present disclosure provides the ASOs listed in the following table and described in more detail below.
- Table B Representative ASOs
- an ASO of the present disclosure is a BNA/MOE gapmer compound, e.g., a compound described below.
- Compound SNCA_ASO_01608 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phospho
- Compound SNCA AS0 01608 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (modified oligonucleotide SEQ ID NO: 18), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA AS0 01608 is characterized by the following chemical structure (VI):
- Compound SNCA_ASO_01613 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01613 is characterized by the following chemical notation: Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (modified oligonucleotide SEQ ID NO: 19), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01613 is characterized by the following chemical structure (VII):
- Compound SNCA_ASO_01615 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01615 is characterized by the following chemical notation: Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 20), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA_ASO_01609 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA AS0 01609 is characterized by the following chemical notation: mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (modified oligonucleotide SEQ ID NO: 21), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA AS0 01609 is characterized by the following chemical structure (IX):
- Compound SNCA_ASO_01611 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- TTGCAGATAAACCATCCCAC unmodified oligonucleotide SEQ ID NO
- Compound SNCA ASO 01611 is characterized by the following chemical notation: Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (modified oligonucleotide SEQ ID NO: 22), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01611 is characterized by the following chemical structure (X):
- Compound SNCA_ASO_01614 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
- AGTGCCAGACCCTTTCATTA unmodified oligonucleotide SEQ ID NO: 9
- Compound SNCA ASO 01614 is characterized by the following chemical notation: Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds mCeo Aeo Tes Tbs Ab (modified oligonucleotide SEQ ID NO: 23), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0113] Compound SNCA ASO 016
- Compound SNCA_ASO_01610 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01610 is characterized by the following chemical notation: mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (modified oligonucleotide SEQ ID NO: 24), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01610 is characterized by the following chemical structure (XII): [0117] Compound SNCA_ASO_01612 is characterized as a 2BNA-3MOE-10DNA-
- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01612 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Aes Tds Ads Ads mCds mCds Ads Tds mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 25), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01612 is characterized by the following chemical structure (XIII):
- Compound SNCA_ASO_01616 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01616 is characterized by the following chemical notation: mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 26), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01616 is characterized by the following chemical structure (XIV): [0123] Compound SNCA_ASO_01790 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine
- Compound SNCA AS0 01790 is characterized by the following chemical notation: Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (modified oligonucleotide SEQ ID NO: 27), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA AS0 01790 is characterized by the following chemical structure (XV): [0126] Compound SNCA_ASO_01791 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 23), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine
- Compound SNCA ASO 01791 is characterized by the following chemical notation: Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (modified oligonucleotide SEQ ID NO: 28), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01791 is characterized by the following chemical structure (XVI): [0129] Compound SNCA_ASO_01792 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
- TACATGGCCAGAAACCACTT unmodified oligonucleotide SEQ ID NO: 14
- each of nucleosides 1-2 and 19-20 comprise a BNA modification
- each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
- each of nucleosides 6-15 are T - deoxynucleosides
- the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
- the other intemucleoside linkages are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01792 is characterized by the following chemical notation: Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 29), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01792 is characterized by the following chemical structure (XVII):
- Compound SNCA_ASO_01793 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
- AAGCCAAGCCCAAACACTAA unmodified oligonucleotide SEQ ID NO: 15
- each of nucleosides 1-2 and 19-20 comprise a BNA modification
- each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
- each of nucleosides 6-15 are T - deoxynucleosides
- the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
- the other intemucleoside linkages are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01793 is characterized by the following chemical notation: Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (modified oligonucleotide SEQ ID NO: 30), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01793 is characterized by the following chemical structure (XVIII): [0135] Compound SNCA_ASO_01789 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
- each of nucleosides 1-2 and 19-20 comprise aBNA modification
- each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification
- each of nucleosides 6-15 are T - deoxynucleosides
- the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages
- the other intemucleoside linkages are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01789 is characterized by the following chemical notation: Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (modified oligonucleotide SEQ ID NO: 31), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- an ASO of the present disclosure is an LNA/MOE gapmer compound, e.g., a compound described below.
- Compound SNCA_ASO_01618 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- GCAGTTCTATCCCACTCATC unmodified oligonucleotide SEQ ID NO: 4
- Compound SNCA ASO 01618 is characterized by the following chemical notation: Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (modified oligonucleotide SEQ ID NO: 32), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01618 is characterized by the following chemical structure (XX):
- Compound SNCA_ASO_01623 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01623 is characterized by the following chemical notation: Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls A1 (modified oligonucleotide SEQ ID NO: 33), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0144] Compound SN
- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01625 is characterized by the following chemical notation: Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 34), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01625 is characterized by the following chemical structure (XXII):
- Compound SNCA_ASO_01619 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01619 is characterized by the following chemical notation: mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls T1 (modified oligonucleotide SEQ ID NO: 35), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01619 is characterized by the following chemical structure (XXIII):
- Compound SNCA_ASO_01621 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
- TTGCAGATAAACCATCCCAC unmodified oligonucleotide SEQ ID NO: 8
- Compound SNCA ASO 01621 is characterized by the following chemical notation: Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (modified oligonucleotide SEQ ID NO: 36), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01621 is characterized by the following chemical structure (XXIV):
- Compound SNCA_ASO_01624 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’ of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- AGTGCCAGACCCTTTCATTA unmodified oligonucleotide SEQ ID NO: 9
- Compound SNCA ASO 01624 is characterized by the following chemical notation: Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds Tds Tds Tds mCeo Aes Tlo Tls A1 (modified oligonucleotide SEQ ID NO: 37), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01624 is characterized by the following chemical structure (XXV): [0157] Compound SNCA_ASO_01620 is characterized as a 3LNA-2MOE-10DNA-
- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA AS0 01620 is characterized by the following chemical notation: mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls A1 (modified oligonucleotide SEQ ID NO: 38), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA AS0 01620 is characterized by the following chemical structure (XXVI):
- Compound SNCA_ASO_01622 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01622 is characterized by the following chemical notation: Gls mClo Als Geo Aes Tds Ads Ads mCds mCds Ads Tds mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 39), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01622 is characterized by the following chemical structure (XXVII): [0163] Compound SNCA_ASO_01626 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytos
- Compound SNCA ASO 01626 is characterized by the following chemical notation: mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 40), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
- Compound SNCA ASO 01626 is characterized by the following chemical structure (XXVIII):
- Compound SNCA_ASO_01823 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01823 is characterized by the following chemical notation: Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (modified oligonucleotide SEQ ID NO: 41), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0168] Compound SNCA
- Compound SNCA_ASO_01824 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 13), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01824 is characterized by the following chemical notation: Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (modified oligonucleotide SEQ ID NO: 42), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01824 is characterized by the following chemical structure (XXX):
- Compound SNCA_ASO_01825 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01825 is characterized by the following chemical notation: Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 43), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA ASO 01825 is characterized by the following chemical structure (XXXI):
- Compound SNCA_ASO_01826 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of
- AAGCCAAGCCCAAACACTAA unmodified oligonucleotide SEQ ID NO: 15
- each of nucleosides 1-3 and 18-20 comprise a LNA modification
- each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification
- each of nucleosides 6-15 are T - deoxynucleosides
- the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages
- the other intemucleoside linkages are phosphorothioate intemucleoside linkages
- each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01826 is characterized by the following chemical notation: Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als A1 (modified oligonucleotide SEQ ID NO: 44), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
- Compound SNCA_ASO_01822 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- Compound SNCA ASO 01822 is characterized by the chemical notation Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als A1 (modified oligonucleotide SEQ ID NO: 45), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. [0180] Compound SNCA ASO 01822
- An antisense oligonucleotide of the present disclosure may be synthesized by any method known in the art.
- an ASO may be synthesized by in vitro transcription and purification (e.g., using commercially available in vitro RNA synthesis kits), by transcription and purification from cells (e.g., cells comprising an expression cassette/vector encoding the ASO), by use of an automated solid-phase synthesizer, and the like.
- solid- phase oligonucleotide synthesis monomeric nucleoside units are added iteratively to a growing oligonucleotide chain covalently bound to a solid support.
- electrophilic 3’ phosphoramidite monomeric units may be used.
- any suitable electrophilic group can be used to covalently link two nucleosides.
- the present ASOs may be purified following solid-phase synthesis through any method known in the art. For example, oligonucleotides may be precipitated from solution through treatment of the solution with ethanol and divalent cations.
- the present ASOs may also be purified using, e.g., sizing columns, reverse-phase chromatography, high-performance liquid chromatography, and polyacrylamide gel electrophoresis.
- compositions comprising an ASO described herein.
- the composition is useful for treating a disease or disorder associated with expression or overexpression of alpha-synuclein, e.g., a synucleinopathy.
- Compositions of the present disclosure may be formulated based upon the mode of delivery.
- a pharmaceutical composition described herein may comprise a pharmaceutically acceptable excipient.
- a pharmaceutically acceptable excipient can be liquid or solid, and may be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline solution, buffering agents, preservatives, and the like.
- the ASOs of the present disclosure may be administered to a patient as a formulation in phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- Example of pharmaceutically acceptable excipients include water, saline, buffer solution, or artificial cerebrospinal fluid.
- the pharmaceutically acceptable excipient is preferably sterile.
- the ASOs of the present disclosure may be administered as pharmaceutically acceptable salts.
- a pharmaceutically acceptable salt is a salt of the ASOs of the present disclosure that is physiologically acceptable, and retains the desired biological activity of the ASO without having undesired toxicological effects.
- the term ASO encompasses both the free acid form and salt forms (e.g., sodium salt form) of the oligonucleotides.
- the ASOs of the present disclosure may be admixed, encapsulated (e.g., in a lipid nanoparticles), conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of nucleic acids.
- U.S. Patent Publication Number 2020/0385723 provides suitable pharmaceutical compositions for use with the ASOs of the present disclosure.
- the ASOs of the present disclosure typically inhibit the activity of transcripts encoded by the SNCA gene in a mammalian cell, such as a human cell.
- the cell is a neuronal cell.
- the cell is a cell of the central nervous system (CNS), including cells of the motor cortex, frontal cortex, caudate, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, dorsal cochlear nucleus (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forebrain nuclei.
- CNS central nervous system
- the present disclosure provides methods of down-regulating the abundance or activity of SNCA gene transcripts in cells or in tissues comprising contacting the cells or tissues with an effective amount of one or more of the ASOs or compositions of the disclosure.
- the methods may be carried out in vitro or in vivo.
- the ASOs of the present disclosure can be utilized for treatment or prophylaxis.
- the ASOs of the present disclosure can be used as therapeutics in animals suspected of having a disease or disorder that can be treated by modulating the expression of the SNCA gene transcript and/or alpha-synuclein protein.
- the animal may also be prone to having the disease or disorder associated with the expression of the SNCA gene, and is not necessarily suspected of having the disease or disorder.
- the animal is treated by administering a therapeutically or prophylactically effective amount of one or more of the ASO compounds or pharmaceutical compositions of the present disclosure.
- the animal is a mammal.
- the animal is a human.
- the ASOs described herein may be used to treat a neurodegenerative disease, such as Parkinson’s disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher’s disease, and Alzheimer’s disease. In general, a neurodegenerative disease results in the death of neurons.
- a neurodegenerative disease results in the death of neurons.
- the ASOs of the present disclosure ameliorate the symptoms of a disease or disorder associated with the expression of the SNCA gene. Amelioration may refer to a reduction in the severity or the frequency of occurrence of a symptom. Amelioration may also refer to a delay in the onset or progression of a symptom.
- a symptom alleviated by treatment with the ASO is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, or dementia. Amelioration of these symptoms may result in improved motor function, reduction of alpha-synuclein aggregations, reduced neurodegeneration, reduced or reversed cognitive decline, and/or reduced or reversed dementia.
- a “therapeutically effective amount” of an ASO as disclosed herein is an amount sufficient to carry out a specifically stated purpose. Such an amount can be determined empirically and in a routine manner, in relation to the stated purpose. Certain factors may influence the dosage and timing required to effectively treat a subject, including, but not limited to, severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and one or more other diseases being present. Moreover, treatment of a subject with a therapeutically effective amount of a pharmaceutical composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the ASOs of the present disclosure may be made using conventional methodologies or on the basis of in vivo testing using appropriate animal models. A therapeutically effective amount may alleviate the symptoms of a disease.
- the ASOs or pharmaceutical compositions of the present disclosure are prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracranial, and the like).
- the pharmaceutical composition is injected intrathecally or intracranially to the subject.
- the ASOs of the present disclosure can be used for research purposes.
- an ASO may be used to specifically inhibit the synthesis of the alpha-synuclein protein in cells and experimental animals.
- ASO-mediated inhibition of alpha-synuclein synthesis can be used to perform functional analyses of alpha-synuclein protein.
- kits and articles of manufacture comprising an ASO described herein.
- Kits or articles of manufacture comprising an ASO of the present disclosure can be used to perform the methods described herein.
- a kit or article of manufacture comprises at least one ASO in one or more containers.
- kits or an article of manufacture described herein may be used for the treatment and/or prevention of a disease associated with the expression of the SNCA gene (e.g., a synucleinopathy).
- the kit or article of manufacture may further comprise a container and a label or package insert on or associated with the container.
- Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc.
- the containers may be formed from a variety of materials such as glass or plastic, and may hold a composition which is by itself or combined with another composition effective for treating or preventing the disease and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
- the kit or article of manufacture may further comprise a package insert indicating that the compositions can be used to treat a particular disease.
- the article of manufacture or kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer’s solution and dextrose solution. It may further include other materials desirable from a commercial and/or user standpoint, including other buffers, diluents, filters, needles, and syringes.
- kits contain all of the components necessary and/or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results.
- ASO can be readily incorporated into one of the established kit formats which are well known in the art.
- the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.
- the term “approximately” or “about” as applied to one or more values of interest refers to a value that is similar to a stated reference value.
- the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context.
- the ASOs were constructed to be complementary to the sense strand of the genomic SNCA sequence (SEQ ID NO: 1) as well as the sequence of the mRNA transcribed from the SNCA gene (NC_000004.12: :89724099..89838324, SEQ ID NO: 2).
- Sk-Mel-2 cells were cultured in Eagle’s minimum essential medium (EMEM) supplemented with 10% Fetal Bovine Serum (FBS).
- EMEM Eagle’s minimum essential medium
- FBS Fetal Bovine Serum
- C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire wildtype human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter.
- C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) mutated in position A53T into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter.
- cortical neurons were collected from embryos removed from pregnant homozygous human SNCA knock-in mice at embryonic day 17.5. Cortical tissue of each embryo was dissected on ice-cold Hank’s Balanced Salt Solution. Pooled tissue was minced and digested with papain at 37 °C for 12 minutes. Digestion then was halted by the addition of 10% FBS/DMEM. The cells were triturated and resuspended in NeurobasalTM Plus media supplemented with GlutaMAXTM, 2% penicillin/streptomycin, and B-27TM Plus supplement.
- Cells were seeded at a density of 15000 cells/well onto 384-well poly-L-lysine + boric acid coated plates in 40 pL supplemented NeurobasalTM media (containing B-27TM supplement and GlutaMAX). The neurons were then incubated for four days at 37°C under a 5% CO2 atmosphere.
- neurons were treated with 300 nM of the given ASO.
- neurons were treated with serial dilutions of the given ASO starting at 3 pM (1 ⁇ 2 log dilutions, 11 concentrations total).
- the culture media was replaced with new NeurobasalTM media.
- RNA was extracted from the cells using the TaqManTM Fast Advanced Cells-to- CT Kit (ThermoFisher). Cells were then washed in PBS and lysed in solution for five minutes at room temperature, with simultaneous DNase treatment. Lysis was terminated by treatment of the mixture with Stop Solution, followed by a two-minute incubation at room temperature.
- Reverse transcription was conducted immediately after cell lysis using Fast Advanced RT Enzyme Mix (ThermoFisher).
- the cDNA samples were then used for quantitative real-time PCR measurement using TaqManTM genotyping assays.
- Specific probes and primers were used for SNCA mRNA quantification (Hs00240906_ml SNCA; ThermoFisher).
- SNCA mRNA levels were adjusted to the measured levels of the housekeeping gen ePPIA (probe/primer PPIA_Mm02342430_gl; ThermoFisher).
- the quantification cycle value (Ct) is defined as the number of cycles required for the fluorescent signal to exceed the background fluorescence.
- the QuantStudioTM Real-Time PCR software program (Applied Biosystems, Foster City, CA) sets this threshold at ten standard deviations above the mean baseline fluorescence.
- the comparative Ct method normalized the Ct value of a target gene to housekeeping genes before comparisons were made between samples. First, the difference between Ct values (ACt) of the target gene and the housekeeping gene was calculated for each sample, and then the difference in the ACt (AACt) was calculated between two samples (e.g., control and treatment). The fold-change in expression of the two samples was calculated as 2 DDa . The percentage of reduction was calculated by subtracting the value 1 to the 2 DDa of the ASO group mean of interest and by multiplying by 100, % reduction (1- 2-AACtASO group mean) x 100.
- hSNCA mice received a single unilateral bolus injection of oligonucleotide at a dose of 30 nmol. Mice were anesthetized with isoflurane at a concentration of 4.5-5% and maintained during surgery with a concentration of 1.5-2% isoflurane. For pain management, buprenorphine at a dosage of 0.04 mg/kg was administered subcutaneously at least 30 minutes before injection. The scalps of the mice were shaved and, following loss of the pedal reflex, mice were placed in a stereotaxic frame (David Kopf Instruments, CA). The scalp was sterilized using three alternating wipes of Betadine and 70% ethanol.
- mice were subcutaneously injected with 1 mL of warm sterile saline solution to aid rehydration and placed in their warm home cage.
- a control group of mice was similarly dosed with saline vehicle control. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects.
- Drug tolerability was scored one hour following dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
- ASO SNCA 00033 as previously described in PCT Patent Publication WO 2012/068405 was also tested as a comparator. In all instances, ASO SNCA 00033 has a 5-10-5 MOE gapmer pattern in which all of the internucleoside linkages are phosphorothioate internucleoside linkages and all cytosine residues are 5-methyl cytosines.
- ASO solution was administered in 30m1 of artificial CSF over ⁇ 30 seconds.
- the catheter was left in place and sealed to avoid diffusion of the CSF fluid.
- Muscle and skin were sutured, and the rats were subcutaneously injected with 1 mL warm sterile saline to aid rehydration and placed in their warm home cage.
- a control group of rats were similarly dosed with artificial CSF. Rats were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects.
- Drug tolerability was scored at one, three, and 24 hours post dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
- mice were weighed on the injection day and three times per week until completion of the experiment. Any mice displaying intolerable health, behavioral observations, or weight loss of more than 20% of their initial body weight were immediately euthanized.
- mice All mice were euthanized by anesthetic overdose. Animals were transcardially perfused in the left ventricle with 0.9 % saline. The thoracic aorta between the lungs and the liver was clamped with hemostatic forceps to block blood flow from the heart to the abdomen, but to allow blood to flow to the brain. The right ventricle was opened with scissors. A constant pressure of 100 to 120 mm Hg was maintained on the perfusion solution by connecting the solution bottle to a manometer-controlled air compressor. Perfusion was continued until the skull surface turned pale and perfusion solution exited the right ventricle. Following perfusion, brain tissues (cortex) and peripherical tissues (kidney and liver) were collected. Samples were cut into small pieces, mixed and aliquoted into three equal parts.
- RNA extraction and mRNA quantification by qPCR were performed. From right cortex biopsies, RNA was extracted using RNeasy Mini Kit (Qiagen) with DNase treatment. Total RNA samples were quantified using a NanodropTM spectrophotometer and analyzed using TapeStation to determine the quality of the RNA (RIN). In qPCR quantification experiments, the RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied BiosystemsTM).
- the reaction was performed in a 100 pL final reaction volume, starting from 1000 ng of total RNA (to a final RNA concentration of 10 ng/pL)
- Quantification of the human SNCA gene and the mouse PPIA housekeeping gene were performed from 40ng of total cDNA using QuantStudio 7 Flex (Applied BiosystemsTM), TaqManTM Universal PCR Master Mix (Applied BiosystemsTM, Ref. 4324020), and TaqManTM Gene Expression Assays in duplex (Hs00240906_ml in FAM fluorochrome and Mm02342430_gl in VIC fluorochrome).
- qPCR analysis was performed in triplicate using the fast run mode. The Ct values of each qPCR plate were analyzed using Excel software.
- hSNCA Protein Expression by Mass Spectrometry Analysis Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. Brain samples were diluted in a denaturing buffer (ammonium bicarbonate 50mM, deoxycholate 1%) and then heated at 95°C for five minutes.
- lysis buffer PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate
- trypsin (lOpg) was added into each sample.
- the tryptic digestion was performed in an ultrasonic bath (Branson 1200) for one minute followed by an incubation at 52 °C for 30 minutes.
- the reaction was stopped by the addition of lpL of TCEP (0.5 M) and 1 pL of 100% formic acid followed by incubation at 95°C for five minutes.
- the samples were then centrifuged at 30,000 g for 15 minutes.
- Peptide digests were analyzed by a reversed-phase liquid chromatography tandem mass spectrometry (LC-MS/MS) using a Shimadzu LC system (Shimadzu) coupled online to a triple quadrupole mass spectrometer (Shimadzu 8060) operated in the MRM mode.
- the specific peptides used to measure alpha-synuclein protein abundance were TVEGAGSIAAATGFVK (SEQ ID NO: 46) and TVEGAGNI AAAT GF VK (SEQ ID NO: 47).
- the specific peptide used to measure GAPDH protein abundance was VGVNGFGR (SEQ ID NO: 48).
- hSNCA Protein or alpha-sy nuclein Protein Expression by ELISA Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. The quantification of a-synuclein in brain lysates were performed by using the U-PLEX Human a-Synuclein Kit (K151WKK) following manufacturer instruction.
- the quantification of total a-synuclein in brain lysates were performed using the ELISA commercial kit from MSD®, U-PLEX Human a-Synuclein Kit (K151WKK).
- the provided plate was pre-coated with capture antibody for a-synuclein.
- the sample (brain lysates) was added to a solution containing the detection antibody (anti-a-synuclein) conjugated to an electroluminescent compound label (MSD SULFO-TAG).
- MSD SULFO-TAG electroluminescent compound label
- MSD® read buffer was added providing the appropriate chemical environment for electroluminescence and the plate was loaded into an MSD SECTOR® Imager for analysis. Inside the SECTOR Imager, a voltage applied to the plate electrodes caused the probes bound to the electrode surface to emit light. The instrument measured the intensity of emitted light to provide a quantitative measurement of a-synuclein present in the sample.
- HPLC High Performance Liquid Chromatography
- Plasma samples were weighed and grinded into MasterpureTM/Proteinase K 97/3 (V/V) buffer for 2x30 seconds at 6500rpm using a Precellys device.
- Plasma samples (5pL) were diluted into MasterpureTM/ptoteinase K 97/3 (70pL). Plasma and tissue homogenates were incubated during 30 minutes at 55°C under soft agitation. Then, 10pL of KC1 3M solution was added into 50pL of tissue homogenates or plasma dilution, rapidly vortexed and sonicated for five minutes.
- CSF samples (1 OpL) were diluted into hybridation buffer (Tris HC1 50 mM pH 8.5 / ACN 90/10) (45pL) and proteinase K (lpL) and were incubated during 15 minutes at 55°C. Prior to analysis, a hybridization step was undertaken with a fluorescently labelled peptide nucleic acid oligomer complementary to the quantified oligonucleotide. For calibration standards and tissue homogenates, 40 pL hybridation buffer was mixed with 10pL of fluorescent complementary probe and 10pL of calibration standards, quality control sample and study sample supernatants.
- Example 1 mRNA Reduction in vitro following a Single Dose of ASO
- Modified oligonucleotides complementary to the human SNCA nucleotide sequence were designed and tested in cultured Sk-Mel-2 cells for their selective efficacy in reducing SNCA mRNA levels.
- Cultured Sk-Mel-2 cells at a density of 15000 cells per well were transfected using Lipofectamine 2000 (Invitrogen) with 20 nM or 2 nM concentrations of modified antisense oligonucleotides (ASOs).
- This method relies on the signal amplification of a branched DNA (bDNA) probe that binds to a specific nucleotide sequence.
- the probe-sets used were XM_005555421 (reactive to dog and human SNCA ) and NM_002046 (reactive to human GapDH ), which were designed by Affymetrix Inc./ThermoScientific and synthesized by Metabion International.
- SVCN-RLUs were normalized to GapDH relative light units (RLUs) of respective wells. Values were normalized against wells treated with unspecific (Ahsal) ASOs.
- the modified oligonucleotides tested in the above experiment are shown in Table C below.
- Each modified oligonucleotide listed in Table C is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 5-10-5 MOE gapmer.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each of the wing segments comprises five 2’MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate internucleoside linkages.
- the identified position in Table C corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
- Each modified oligonucleotide listed in Table D is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 4-10-4 MOE gapmer.
- the gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides, and the wing segments on both the 5’ and 3’ ends comprise four T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
- Table D corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human SNCA nucleic acid sequence (SEQ ID NO: 1).
- Each modified oligonucleotide listed in Table E is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-10-3 LNA gapmer.
- the gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segments on the 5’ and 3’ ends comprise three LNA nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
- the identified position in Table E corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the modified human nucleic acid sequence (SEQ ID NO: 1).
- Each modified oligonucleotide listed in Table F is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-11-3 LNA gapmer.
- the gapmers are 17 nucleobases in length, wherein the central gap segment comprises eleven T - deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising three LNA nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
- the identified position in Table F corresponds to the “Start Site” i.e. the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
- Example 2 mRNA Reduction in vitro following a Single Dose of MOE-Modified ASO
- Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were designed and tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with 300 nM of each antisense oligonucleotide. mRNA levels were quantified using qRT-PCR (TaqManTM) with the following probes:
- PPIA_Mm02342430_g 1 Therm oF i sher (control) .
- Each modified oligonucleotide listed in Table G and Table H is complementary to the human SNCA DNA (SEQ ID NO: 1) or mRNA (SEQ ID NO: 3) sequence.
- the sequences in Table G are complementary to exons of the mRNA sequence, whereas the sequences in Table H are complementary to the introns of the mRNA sequence.
- Each ASO is a 5-10-5 MOE gapmer that is 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and the wing segments on both 5’ and 3’ ends comprise five T -MOE nucleosides.
- MOE-Modified ASOs Complementary to SNCA RNA Introns
- Example 3 mRNA Reduction in vitro following Multiple Doses of MOE-modified ASOs
- Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with multiple doses (3 mM; 1 ⁇ 2 log dilution; 11 concentrations) of the given antisense oligonucleotide.
- the Hill coefficient which is the slope of the line in a Hill plot, was measured in order to observe the shape of the dose response curve for each ASO.
- Each modified oligonucleotide listed in Table I, Table J, and Table K is complementary to human SNCA nucleic acid sequence SEQ ID NO: 1 and/or SEQ ID NO: 3.
- the ASOs in Table J are designed to be complementary to introns in the SNCA mRNA sequence, whereas the ASOs in Tables I and K are designed to be complementary to exons in the SNCA mRNA sequence.
- Each of the ASOs in Tables I, J, and K is a 5-10-5 MOE gapmer.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the flanking wing segments comprises five T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
- the SNCA_ASO_01617 in Table J is a 5-10-5 MOE gapmer.
- the gapmer is 20 nucleobases in length, wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five T -MOE nucleosides.
- All cytosines residues throughout each gapmer are 5-methyl cytosines.
- All internucleoside linkages are phosphorothioates linkages except between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
- Each of the ASOs in Table L is a 3-2-10-2-3 LNA/MOE mixed gapmer.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides.
- the ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 T -deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides.
- cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages.
- PS phosphorothioate
- Each ASO listed in Table M is a 2-3-10-3-2 BNA/MOE gapmer.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T- deoxynucleosides and each wing segment comprises two BNA nucleosides and three T- MOE nucleosides.
- Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three T -MOE nucleosides, 10 T -deoxynucleosides, three T -MOE nucleosides, and two BNA nucleosides.
- cytosines throughout each gapmer are 5-methyl cytosines, and all 5 internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester (PO) linkages.
- Example 4 Tolerability and Efficacy of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice
- Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed in the indicated table at a dose of 30 nmol.
- Each modified oligonucleotide is complementary to the human SNCA genomic nucleic acid sequence (SEQ ID NO: 1).
- the positions in the tables indicate the 5’ nucleoside to which the oligonucleotide is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
- the tolerability score is represented as the Functional
- Each ASO in Table N is a 5-10-5 MOE gapmer as described above, in which all cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate (PS) linkages.
- FIG. 4 is a bar graph that compares the tolerability of select 5-10-5 MOE gapmers. Compounds having an FOB of greater than ten were excluded from further assays. The structure of SNCA ASO 01617 is as described above. Table N. Tolerability of 5-10-5 MOE Gapmers in hSNCA Mice
- Each ASO listed in Table O is a 5-10-5 MOE gapmer as described above, in which all cytosine residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate linkages.
- FIG. 4 is a bar graph that compares the efficacy of select 5-10-5 MOE gapmers.
- the structure of SNCA_ASO_01617 is as described above.
- Each ASO listed in Table P is a 3-2-10-2-3 LNA/MOE mixed gapmer, except for SNCA_ASO_00033, which is a 5-10-5 MOE gapmer as described above, used as a comparator.
- the LNA/MOE mixed gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides.
- the ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 2’-deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides. All cytosines residues throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages. [0249] Further experimentation to determine the level of mRNA reduction was not performed for compounds 00937, 00938, 00941 and 00942 because they did not exhibit promising FOB results. The mice treated with these compounds were sacrificed.
- FIG. 5 is a bar graph that compares the tolerability of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages. Table Q. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
- Each ASO listed in Table R is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines. All internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages. Table R. Tolerability of 3-2-10-2-3- LNA/MOE Mixed Gapmers in hSNCA Mice
- Each ASO listed in Table S is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
- Each ASO listed in Table T (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 LNA/MOE mixed gapmer.
- FIG. 5 is a bar graph that compares the efficacy of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester linkages.
- Each ASO in Table U is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages, except the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages. [0256] As shown below, the ASOs reduced the amount of human SNCA mRNA in mice two weeks post injection.
- Each ASO in Table V is a 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
- Each ASO listed in Table W (aside from comparator SNCA_ASO_00033) is a 2- 3-10-3-2 BNA/MOE gapmer.
- FIG. 6 is a bar graph that compares the tolerability of select 2- 3-10-3-2 BNA/MOE gapmers.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises two BNA nucleosides and three 2’-MOE nucleosides.
- Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three 2’-MOE nucleosides, 102’-deoxynucleosides, three T - MOE nucleosides, and two BNA nucleosides.
- All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
- Each ASO listed in Table X (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 BNA/MOE gapmer.
- FIG. 6 is a bar graph that compares the efficacy of select 2-3- 10-3-2 BNA/MOE gapmers.
- the gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three BNA nucleosides and two 2’-MOE nucleosides.
- Each ASO therefore comprises, from 5’ to 3’, three BNA nucleosides, two 2’-MOE nucleosides, 102’-deoxynucleosides, two 2’-MOE nucleosides, and three BNA nucleosides.
- All cytosines throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
- Example 5 Tolerability, Efficacy and Biodistribution of Multiple Doses of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice
- Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed at doses described in the indicated tables.
- hSNCA mice were divided into groups of six mice. A group of six mice received PBS as negative control for each experiment.
- the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour post-injection.
- FOB Functional Observational Battery
- mice were sacrificed four weeks post-injection, except figures followed by an asterisk wherein analyzes were two weeks post-injection.
- Cortical brain tissue was collected and the level of hSNCA mRNA was measured as described above and the level of alpha-synuclein protein was measured by ELISA kit as described above. Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha-synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
- PBS vehicle
- SNC A_ASO_01613 in Table Y is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17-18 are phosphodiester internucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- SNCA_ASO_01625 in Table Z is a 3-2-10-2-3 LNA/MOE gapmer as described above, in which the intemucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester intemucleoside linkages, the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
- SNC A_ASO_01617 (SEQ ID NO: 1264) in Table AA is a 5-10-5 MOE gapmer wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’MOE nucleosides.
- all cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioates linkages except between 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 positions which are phosphodiester linkages.
- FIG. 7 is a bar graph that compares the efficacy of SNCA_ASO_1613,
- FIG. 8 is a bar graph that compares the efficacy of SNCA_ASO_1613, SNCA_ASO_1617 and SNCA_ASO_1625 based on the expression of alpha synuclein protein at different doses of 1, 5, 10, 30 or 100 nmol. Reductions in mRNA and protein levels were analyzed two weeks post injection.
- SNCA_ASO_01613 is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine;
- FIG. 9 is a dot graph that represents the amount of ASO quantified per mg of cortex by HPLC fluorescence after a single ICY injection of multiple doses.
- Table AB Dose effect of ASO Concentration in the Cortex of hSNCA mice
- Example 6 Tolerability of of Modified Oligonucleotides in Rat [0269] Male Winstar rats received a single intrathecal bolus injection of oligonucleotide at a dose of 2.5 mg. Sterile saline syringes and nuclease free centrifuge tubes were used to prepare dosing solutions. The tubes containing ASO powder were briefly centrifuged before adding aCSF solution, then re-centrifuged for 10 minutes to fully dissolve the ASO powder. The solution was vortexed for ⁇ 1 min, stored at 4°C and filtered with a 0.22pm filter until use.
- the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour, three-hour and twenty-four hours post injection.
- FOB Functional Observational Battery
- mice Three-month-old hSNCA mice, divided into groups of five to six mice each, received a single unilateral bolus injection of oligonucleotide SNCA AS0 1613 or SNCA_ASO_1617 at two doses of 10 and 50 nmol described in Table AD below. A group of three mice received PBS as a negative control for each experiment.
- mice were sacrificed at different timepoint (2-6-12-20 weeks) post-injection.
- Cortical, cerebellum and striatum brain tissue were collected and the level of hSNCA mRNA was measured by qRT-PCR as described above and the level of alpha synuclein protein was measured by ELISA kit as described above.
- Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
- FIG. 11 is a dot graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR as described above.
- FIG. 12 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA ASO 01613 at the dose of lOnmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR as described above.
- FIG. 13 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
- Table AD PK/PD analysis at different timepoint in hSNCA mice
- alpha-synuclein pathology was analyzed by measuring the level of the phosphorylated form (pS129) of alpha-synuclein with a commercial immunoassay kit (Cisbio, #6FSYNPEG) according to the manufacturer’s instructions.
- This assay is based on a sandwich assay with two different specific antibodies, one binding the pS129 motif of alpha- synuclein and the other recognizing the alpha-synuclein protein, labelled with a donor or an acceptor dye.
- FIG. 15 is a bar graph that represents the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture measuring by a TR-FRET based immunoassay.
- the level of phosphorylated alpha-synuclein was normalized by the level of alpha-tubulin and values were related to wells treated with vehicle (PBS). Seeded neurons were treated at DIV7 with a high dose (330nM) of specific ASOs (SNCA) or an unspecific ASO (Malatl) as described in Table AE below.
- FIG. 16 is a bar graph that represents the level of alpha-synuclein pathology
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The present disclosure provides antisense oligonucleotides for regulating expression of alpha-synuclein and use thereof to treat synucleinopathies.
Description
ANTISENSE OLIGONUCLEOTIDES FOR INHIBITING ALPHA-SYNUCLEIN EXPRESSION
SEQUENCE LISTING
[0001] The instant application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on March 6, 2021, is named 027628_W0002_SLfmal.txt and is 718,553 bytes in size.
BACKGROUND OF THE INVENTION
[0002] Alpha-synuclein is a protein encoded by the SNCA gene that is predominantly expressed in the central nervous system, including the neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. In neurons, the expression of alpha-synuclein is localized at presynaptic terminals, and the protein is thought to be a chaperone involved in the assembly and function of the SNARE complex. At least three different isoforms of alpha-synuclein are known, which result from alternative splicing of the SNCA gene transcript. Alpha-synuclein may be involved in modulating many different neuronal functions and properties, including synaptic transmission, synaptic vesicle density, and neuronal plasticity.
[0003] In some cases, alpha-synuclein aggregates and forms insoluble fibrils. Alpha- synuclein aggregates are thought to be involved in the pathology of many different neurological diseases, including Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, and multiple system atrophy. The pathogenic role of alpha-synuclein in the progression of disease has been genetically validated. For example, missense mutations in the SNCA gene lead to rare familial Parkinson’s disease. Duplication or triplication of the wildtype gene can also cause rare cases of Parkinson’s disease, and the overexpression of wildtype alpha-synuclein protein alone has been demonstrated to be sufficient to cause disease.
[0004] Disorders caused by misfolding or aggregation of alpha-synuclein are collectively termed synucleinopathies. Multiple system atrophy (MSA), a synucleinopathy with a rapid clinical progression, arises from the misfolding and accumulation of alpha-synuclein, resulting in the formation of glial cytoplasmic inclusions (GCIs) in oligodendrocytes. GCIs
are widely distributed in the nervous system of MSA patients, but some regions, including the basal ganglia, cerebellum, pons, and spinal cord, are more affected than others. At the microscopic level, the neuropathological features of MSA include moderate gliosis, myelin deficiency, and neuronal loss and axonal degeneration within the striatonigral and olivopontocerebellar systems.
[0005] The alpha-synuclein protein can be found in tissues in several different forms, including as a monomer, oligomer, or fibrillary complex, and may be phosphorylated. It is currently unknown which of these protein species is causative in synucleinopathies. It is therefore challenging to know which form of the protein to target in order to develop drugs that treat synucleinopathies at the protein level.
[0006] Currently there is a lack of acceptable options for treating synucleinopathies.
Thus, there remains a need for compounds, methods and pharmaceutical compositions for the treatment of these disorders.
SUMMARY OF THE INVENTION
[0007] The present disclosure provides antisense oligonucleotides (ASOs) that reduce the abundance or activity of RNA transcribed from the SNCA gene. By reducing levels of SNCA RNA, the compounds of the present disclosure decrease the abundance of alpha-synuclein protein in the cell. The ASOs described herein therefore reduce alpha-synuclein proteins, their accumulation and aggregates which might alleviate the symptoms and/or delay disease progression.
[0008] In some aspects, the present disclosure provides an oligonucleotide comprising a nucleotide sequence of 15 to 30 (e.g., 16 to 20) contiguous nucleotides, wherein the nucleotide sequence is complementary to a region of the same length found in nucleotides a) 16350-16450, b) 18926-19030, c) 22250-22471, d) 22933-23079, e) 23408-23700, f) 29753-29819, g) 38128-38158, h) 39852-39906, i) 53762-53799, or j) 59754-59865
of SEQ ID NO: 1. In certain embodiments, the nucleotide sequence comprises no more than 3 mismatches to said region. For example, the nucleotide sequence may comprise 0, 1, or 2 mismatches to said region. In particular embodiments, the nucleotide sequence is single- stranded. The nucleotide sequence may be selected from, e.g., SEQ ID NOs: 18-40.
[0009] In some embodiments, an oligonucleotide described herein may comprise one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
[0010] In some embodiments, an oligonucleotide described herein may comprise one or more modified nucleotides. Such modified nucleotides may comprise, e.g., a 2’-0- methoxy ethyl (2’ -MOE) nucleotide, a locked nucleic acid (LNA) nucleotide, a bridged nucleic acid (BNA) nucleotide, or any combination thereof.
[0011] In some embodiments, all cytosines in an oligonucleotide described herein are 5- methyl cytosines.
[0012] In some embodiments, an oligonucleotide described herein may comprise phosphodiester internucleoside linkages and/or phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide may comprise at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages. In certain embodiments, at least 1, 2, 3, 4, or 5, or all intemucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.
[0013] In some embodiments, an oligonucleotide described herein comprises: i) a 5-10-5 MOE gapmer; ii) a 4-10-4 MOE gapmer; iii) a 3-10-3 LNA gapmer; iv) a 3 - 11 -3 LNA gapmer; v) a 3-2-10-2-3 LNA/MOE gapmer; vi) a 2-3-10-3-2 BNA/MOE gapmer; vii) a 3-2-10-2-3 BNA/MOE gapmer; or viii) a 2-3-10-3-2 LNA/MOE gapmer.
[0014] In certain embodiments, the oligonucleotide comprises: i) a 3-2-10-2-3 LNA/MOE gapmer; ii) a 2-3-10-3-2 BNA/MOE gapmer; iii) a 3-2-10-2-3 BNA/MOE gapmer; or iv) a 2-3-10-3-2 LNA/MOE gapmer; wherein the intemucleoside linkages between nucleosides v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19;
vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate intemucleoside linkages.
[0015] In certain embodiments, an oligonucleotide described herein comprises the following formula: i) Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 34), ii) Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 20), iii) Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls A1 (SEQ ID NO: 33), iv) Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (SEQ ID NO: 19), v) Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (SEQ ID NO: 18), vi) mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (SEQ ID NO: 21), vii) Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (SEQ ID NO: 22), viii) Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab (SEQ ID NO: 23), ix) mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (SEQ ID NO: 24), x) Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 25), xi) mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 26), xii) Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (SEQ ID NO: 27), xiii) Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (SEQ ID NO: 28),
xiv) Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 29), xv) Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (SEQ ID NO: 30), xvi) Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (SEQ ID NO: 31), xvii) Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (SEQ ID NO: 32), xviii) mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls T1 (SEQ ID NO: 35), xix) Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (SEQ ID NO: 36), xx) Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls A1 (SEQ ID NO: 37), xxi) mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls A1 (SEQ ID NO: 38), xxii) Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls T1 (SEQ ID NO: 39), xxiii) mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 40), xxiv) Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (SEQ ID NO: 41), xxv) Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (SEQ ID NO: 42), xxvi) Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls T1 (SEQ ID NO: 43), xxvii) Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als A1 (SEQ ID NO: 44), xxviii) Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als A1 (SEQ ID NO: 45), wherein
A is adenine, mC is a 5 -methyl cytosine,
G is guanine,
T is thymine, e is a 2’-MOE modified ribose, d is a 2’-deoxyribose, b is a BNA, 1 is an LNA, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0016] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
[0017] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
[0018] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
[0019] In some embodiments, the present disclosure provides an oligonucleotide comprising the structural formula:
[0020] The present disclosure also provides an oligonucleotide conjugate comprising an oligonucleotide described herein.
[0021] In some aspects, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide described herein or an oligonucleotide conjugate as described herein, and a pharmaceutically acceptable excipient.
[0022] Also provided is a method of reducing alpha-synuclein expression in a mammalian cell, comprising contacting the cell with an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein, thereby reducing alpha-synuclein expression in the cell. In some embodiments, the cell is a central nervous system cell, such as a cell in the human brain. In some embodiments, the present disclosure provides a method for treating a synucleinopathy in a subject in need thereof, comprising administering a
therapeutically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein to the subject. In certain embodiments, the synucleinopathy is Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, or multiple system atrophy. The oligonucleotide may be, e.g., injected intrathecally or intracranially to the subject. In certain embodiments, the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in murine primary cortical neurons engineered to express human alpha-synuclein.
[0023] It is understood that any of the oligonucleotides, oligonucleotide conjugates, and pharmaceutical compositions described herein may be used in any method of treatment as described herein, may be for use in any treatment as described herein, and/or may be for use in the manufacture of a medicament for any treatment as described herein.
[0024] Other features, objectives, and advantages of the invention are apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments and aspects of the invention, is given by way of illustration only, not limitation. Various changes and modification within the scope of the invention will become apparent to those skilled in the art from the detailed description.
BRIEF DESCRIPTION OF THE FIGURES [0025] FIG. l is a diagram illustrating the knock-in of the human SNCA gene at the endogenous mouse SNCA locus in an hSNCA mouse model {hSNCA+!+).
[0026] FIG. 2A is a bar graph showing the quantification of human alpha-synuclein protein ( hSNCA protein) in cortical tissue from hSNCA+l+ (n=5), hSNCA+l~ (n=5), and hSNCA (n=2) three-month-old mice. The level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
[0027] FIG. 2B is a bar graph showing the quantification of murine alpha-synuclein protein ( mSNCA protein) in the cortex of hSNCA+l+ (n=5), hSNCA+l~ (n=5), and hSNCA 1 (n=2) three-month-old mice. The level of alpha-synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
[0028] FIG. 2C is a bar graph showing the level of human alpha-synuclein protein {hSNCA protein) in different brain areas (cortex, cerebellum, hippocampus, striatum, spinal cord) and peripheral organs (liver, spleen, kidney) in three-month-old hSNCA+!+ mice (n=5). The level of alpha synuclein protein was assessed by mass spectrometry and normalized against the level of GADPH protein.
[0029] FIG. 3 is a table showing the tolerability scoring system for mice utilized in the in vivo assays described herein.
[0030] FIG. 4 is a bar graph showing the efficacy and tolerability of the given ASO in mice. The left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo two weeks after treatment with the given ASO relative to PBS treated samples. The right Y axis and black circles depict the functional observational battery (FOB) absolute score observed in mice one hour after treatment with the given ASO.
[0031] FIG. 5 is a bar graph showing the efficacy and tolerability of the given 3LNA- 2MOE-10DNA-2MOE-3LNA gapmer ASO. Axes are as described in FIG. 4.
[0032] FIG. 6 is a bar graph showing the efficacy and tolerability of the given 2BNA- 3MOE-10DNA-3MOE-2BNA gapmer ASO. Axes are as described in FIG. 4.
[0033] FIG. 7 is a bar graph showing the efficacy of SNCA_ASO_1613,
SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol. The left Y axis and solid bars depict the expression level of SNCA mRNA expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
[0034] FIG. 8 is a bar graph showing the efficacy of SNCA_ASO_1613,
SNC A_ASO_l 617 and SNCA_ASO_1625 at doses of 1, 5, 10, 30 and 100 nmol. The left Y axis and solid bars depict the expression level of alpha synuclein protein expressed in mouse neurons in vivo four weeks after treatment with the given ASO relative to PBS treated samples.
[0035] FIG. 9 is a dot graph showing the concentration of SNCA AS0 1613,
SNCA AS0 1617 and SNCA AS0 1625 quantified by HPLC fluorescence in cortical tissue homogenate four weeks after a single injection at 1, 5, 10, 30 and lOOnmol on ASO. [0036] FIG. 10 is a table showing the tolerability scoring system for rats utilized in the in vivo assays described herein.
[0037] FIG. 11 is a dot graph comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR.
[0038] FIG. 12 is a dot graph a dots graph comparing SNCA ASO 01617 and SNCA ASO 01613 at doses of 10 nmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR.
[0039] FIG. 13 is a dot graph that compares the SNCA ASO 01617 and SNCA_ASO_01613 at doses of 10 nmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
[0040] FIG. 14 is a diagram illustrating the experimental protocol for the measurement of alpha-synuclein pathology in neuronal culture treated with ASO.
[0041] FIG. 15 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613,
SNCA ASO 01617 and non-targeting control Malatl ASO and measured using a TR-FRET based immunoassay.
[0042] FIG.16 is a bar graph that shows the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture treated with SNCA ASO 01613 before, during and after PFF treatment and measured by using a TR-FRET based immunoassay (mean±SEM). PFFs: human alpha-synuclein preformed fibrils.
DETAILED DESCRIPTION OF THE INVENTION [0043] The present disclosure is based on the discovery that antisense oligonucleotides (ASOs) targeting RNAs transcribed from the SNCA gene can effectively reduce the abundance of target SNCA gene transcripts and/or translation of the alpha-synuclein polypeptide from the transcripts. The ASOs of the present disclosure comprise sequences that are complementary to SNCA transcripts and bind to defined nucleotide sequences within the transcripts.
[0044] By decreasing the level or translational activity of SNCA target transcripts in a cell, the ASO mediates a decrease in the expression and accumulation of the alpha-synuclein protein in the cell, alleviating the severity or progression of neurodegenerative diseases. The ASOs of the present disclosure are expected to be particularly useful in the treatment of synucleinopathies, which are caused by the accumulation or aggregation of the alpha- synuclein protein. This protein can be expressed in cells as, e.g., a monomer or an oligomer, and may be phosphorylated or unphosphorylated. Because it is unclear which of these alpha- synuclein species is causative in disease, it has thus far been challenging to develop effective therapeutics that target alpha-synuclein expression or activity at the protein level. The ASOs of the present disclosure are highly advantageous in that they target alpha-synuclein expression at the SNCA transcript level and thus have the ability to decrease expression of all of the above forms of the alpha-synuclein protein.
I. The SNCA gene and Alpha-Svnuclein Protein
[0045] The ASOs of the present disclosure bind to transcripts of the SNCA gene, which encodes the alpha-synuclein protein also named SNCA protein. The SNCA gene is also known
as alpha-synuclein, NACP, nonA-beta component of AD amyloid, PARK1, PARK4 , or PDI gene. In some embodiments, an ASO described herein targets a transcript of a mammalian SNCA gene (e.g., a murine or human SNCA gene).
[0046] The sequence for the human SNCA gene is publicly available under GenBank Accession Number NC_000004.12. The gene is 137,980 bps in length and located at chromosome 4:89700345..89838324 (SEQ ID NO: 2). A portion of the human genomic SNCA sequence is shown in SEQ ID NO: 1, and a partial sequence for the pre-mRNA transcript can be found at GenBank AccessionNumberNG_011851.1 (residues 6001-8400). A mature mRNA transcript is shown in SEQ ID NO: 3. In some embodiments, an ASO of the present disclosure binds to an SNCA sequence, or a transcript thereof, selected from Chromosome 4: 89,700,345-89,838,315 (reverse strand) and those under GenBank Accession Numbers NM_000345.3, NT_016354.20 TRUNC 30800000-30919000, JN709863.1, BC013293.2, NM 001146055.1, HQ830269.1, and NC_000004.12 (89724099..89838324, complement). In some embodiments, an ASO of the present disclosure binds to an SNCA transcript that encodes an alpha-synuclein protein, e.g., as found under UniProt Accession Number P37840, A8K2A4, Q13701, Q4JHI3, or Q6IAU6. In certain embodiments, an ASO of the present disclosure comprises a sequence that may be at least 60, 70, 80, 85, 90, or 95%, or 100% complementary to a same-length sequence in the target SNCA transcript.
[0047] In some embodiments, an ASO of the present disclosure can bind to a transcript of a wildtype SNCA gene (e.g., a wildtype human, non-human primate, or murine gene). In some embodiments, an ASO of the present disclosure binds to a variant, such as a known variant, of the wildtype SNCA gene. Known variants include, for example, a version of the human SNCA gene in which a G209A substitution results in an A53T mutation in the alpha- synuclein protein encoded from that gene. Additional known variants have nucleotide mutations giving rise to mutant alpha-synuclein proteins comprising A30P, E46K, H50Q, and G51D amino acid substitutions. These substitutions may be found alone or in combination with other mutations. The present ASOs can be designed to reduce or inhibit expression of wildtype or variant SNCA transcripts. In certain embodiments, an ASO described herein may reduce or inhibit expression of an SNCA transcript encoding an alpha-synuclein protein with one or more mutations selected from A30P, E46K, H50Q, G51D, and A53T.
[0048] The present ASOs comprise sequences that are complementary to a same-length sequence in a target transcript encoded by the SNCA gene (wherein the genomic SNCA sequence may comprise, e.g., SEQ ID NO: 1). In certain embodiments, an ASO described herein comprises a sequence that is complementary to a sequence in a hotspot region within
the target SNCA nucleic acid. The term “hotspot region” refers to a region of the target nucleotide sequence wherein binding of a sequence within the region by a complementary ASO tends to result in a reduction in the abundance or translational activity of the target RNA transcript. A hotspot region may be entirely within an intron, entirely within an exon, or may span an intron/exon junction; or be located in whole or in part in the 5’ or 3’ untranslated region (UTR) of an RNA transcript.
[0049] In some embodiments, an ASO described herein may comprise a sequence that binds to a target sequence within or overlapping with any of several different hotspot regions of the SNCA gene transcript. Table A lists exemplary hotspots in the human SNCA gene and identifies ASOs of the present disclosure that are designed to be complementary to them.
The table also shows the minimum reduction in the SNCA gene transcript observed in vitro when neurons from a humanized SNCA knock-in mouse are treated with the selected ASOs targeting this hotspot (see, e.g., the section titled “Materials and Methods of in vitro Assays” below). Throughout this disclosure, compounds are referred to interchangeably as SNCA_ASO_[compound number] and as [compound number]. For example, compound number SNCA AS0 01608 and compound number 01608 represent the same antisense oligonucleotide compound. In certain embodiments, binding of a sequence in a hotspot region by an ASO described herein reduces SNCA RNA levels by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or 100% in a cell (e.g., in an in vitro assay such as the one described below in the section titled “Materials and Methods of in vitro Assays”). In particular embodiments, an ASO of the present disclosure may be an ASO listed in Table A, or an ASO with a sequence at least 80%, 85%, 90%, 95%, 96%, 97%,
98%, or 99% identical thereto.
Table A. Human SNCA Gene Hotspots Targeted by Antisense Oligonucleotides
II. Antisense Oligonucleotides
[0050] The term “antisense oligonucleotide” or “ASO” refers to an oligonucleotide capable of hybridizing to a sequence in a target transcript. It is understood by a person skilled in the art that the ASOs described herein do not occur in nature (i.e., they are “isolated” ASOs).
[0051] The term “transcript” refers to any RNA transcribed from a gene (e.g., an SNCA gene). The gene may be wildtype or may be a mutated or variant (e.g., polymorphic) form. An RNA transcript may be a primary RNA transcript or precursor messenger RNA (pre- mRNA), or a messenger RNA (mRNA), and may include exons, introns, 5’ UTRs and 3’ UTRs. Unless otherwise indicated, the sequences of transcripts and ASOs provided herein denote the nucleotide sequence from 5’ end (left) to 3’ end (right).
[0052] The term “oligonucleotide,” as used in the present disclosure, refers to a compound comprising a strand of about 5 to 100 nucleosides, e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides, connected via internucleoside linkages. Each nucleoside and internucleoside linkage of an oligonucleotide of the present disclosure may be modified or unmodified from naturally occurring nucleotides and linkages. A modified oligonucleotide may comprise one or more modified sugar moieties, one or more modified nucleobases, and/or one or more modified intemucleoside linkages.
[0053] An ASO described herein may comprise a sequence that is substantially or fully complementary to a same-length sequence in the target transcript. Full complementarity occurs when a first strand of contiguous nucleotides (modified or unmodified) and a second strand of contiguous nucleotides (modified or unmodified) are completely complementary to each other over the entire length of the shorter strand (or both strands, if they are of the same length). The two strands are considered substantially complementary to each other when they base-pair with each other over 80% or more (e.g., 90% or more) over the length of the shorter strand (or both strands, if they are of the same length), with no more than 20% (e.g., no more than 10%) of mismatching base-pairs (e.g., for a duplex of 20 nucleotides, no more than 4 or no more than 2 mismatched base-pairs). In some embodiments, a sequence in an ASO of the present disclosure is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target RNA transcript. In some embodiments, the present ASO comprises no more than 1, 2, or 3 mismatches to its target sequence.
[0054] The term “identical” or “identity” in the context of comparing two nucleotide sequences refers to identical nucleobases. The term “percent identity” in this context refers to the percentage of nucleobases that are the same when the two comparing sequences are aligned (introducing gaps, if necessary) for maximum correspondence, over the length of the shorter comparing sequence (or both sequences, if the comparing sequences are of the same length).
[0055] In certain embodiments, reduced, inhibited, or abrogated expression or activity of the target transcript is observed compared to a control sample not treated with the ASO. In some embodiments, an ASO of the present disclosure reduces the abundance and/or translational activity of the target SNCA transcript in a treated sample, e.g., by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to a control sample not exposed to the ASO. In some cases, the ASO reduces the level of the target transcript in vivo by said percentage, and administration of the ASO optionally results in a tolerability score (Functional Observational Battery or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1, e.g., 0. The terms “reduce” and “inhibit” do not necessarily mean a total elimination of the entire amount and/or activity of the transcript. In some embodiments, ASOs are considered to be active when they reduce the amount or activity of the target RNA by 25% or more in an in vitro assay. The present ASO may cause a detectable or measurable change in the level or activity of the alpha-synuclein protein encoded by the target RNA.
[0056] Without wishing to be bound by theory, it is believed that ASOs may inhibit expression of alpha-synuclein by recruiting an RNase HI enzyme to the duplex formed
between an ASO and the target SNCA transcript. Enzymes of the RNase HI family are endonucleases that typically target RNA:DNA duplexes and catalyze the hydrolytic cleavage of the RNA in the duplex.
[0057] In some embodiments, the ASO has minimal off-target effects, and does not hybridize to any non -SNCA transcript in a way that results in significant reduction in the abundance or activity of the non -SNCA transcript.
A. Lengths of Antisense Oligonucleotides
[0058] In some embodiments, the present ASOs are between 8 and 30 nucleotides in length (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length). In some embodiments, an ASO described herein can comprise a sequence, complementary to a same-length SNCA transcript sequence, that is any of a range of nucleotide lengths having an upper limit of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20
[0059] In certain embodiments, the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In particular embodiments, the complementary sequence in the ASO is 16, 17, 18, or 20 nucleobases in length.
B. Modifications of Antisense Oligonucleotides
[0060] In some embodiments, the ASOs of the present disclosure may comprise one or more modifications, e.g., to increase binding affinity to the target transcript, increase ASO stability (e.g., increase resistance to degradation, e.g., by nucleases), and/or increase ease of ASO transport into the cell. Modifications may include any modification known in the art, including, for example, end modifications, nucleobase modifications, sugar modifications or replacements, and backbone modifications. End modifications may include, for example, 5’ and/or 3’ end modifications (e.g., phosphorylation, conjugation, DNA nucleotides, and inverted linkages). Base modifications may include, e.g., replacement with stabilizing bases, removal of bases, or conjugated bases. Sugar modifications or replacements may include, e.g., modifications at the T and/or 4’ position of the ribose moiety, or replacement of the ribose moiety. Backbone modifications or internucleoside linkage modifications may include, for example, modification or replacement of phosphodiester linkages, e.g., with one or more phosphorothioates, phosphorodithioates, phosphotriesters, methyl and other alkyl phosphonates, phosphinates, and phosphoramidates.
[0061] In some embodiments, the present ASOs may have one or more modified nucleosides. The term “nucleoside” refers to a compound comprising a nucleobase and a
sugar moiety. Naturally occurring nucleosides include DNA and RNA nucleosides. In a non-naturally occurring nucleoside (also referred to as a “modified nucleoside” or a “nucleoside analog”), the base and/or the sugar have been modified. The modification of the nucleoside may be “silent,” in which case the modified nucleoside has the same or equivalent function in the context of the oligonucleotide compared to a naturally occurring nucleoside.
In other cases, a modified nucleoside may increase the efficacy of the ASO in decreasing the abundance or activity of a target transcript. The term efficacy encompasses the target engagement on SNCA mRNA.
[0062] The term “nucleotide,” as used herein, refers to a nucleoside covalently bonded to one or more modified or unmodified internucleoside linkages. Exemplary nucleotides include monophosphates, diphosphates, triphosphates, and thiophosphates. As used herein, the term “nucleotide” encompasses unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs). The term “nucleoside” encompasses unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside analogs); and the term “nucleobases” encompasses unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs).
[0063] In some embodiments, a modified nucleoside comprises a modified nucleobase.
In certain embodiments, the modified nucleobase is a 5-methyl cytosine (5mC) nucleobase, as shown in the structure (I) below, wherein R represents the sugar moiety.
[0064] In some embodiments, a sugar moiety can be a modified or an unmodified sugar moiety. As used herein, an unmodified sugar moiety refers to a 2’-OH(H) ribosyl moiety as found in naturally occurring RNA, also referred to as an unmodified RNA sugar moiety. In some embodiments, a modified sugar moiety may be a 2’-H(H) deoxyribose sugar moiety. This moiety is found naturally in deoxyribonucleic acids, and may be referred to as an unmodified DNA sugar moiety or simply a DNA sugar moiety. The structure of a 2’- deoxynucleoside sugar moiety is shown in the structure (II) below, wherein R represents a
nucleobase, and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages.
[0065] In some embodiments, a modified sugar moiety may comprise an O-methoxyethyl (MOE) moiety. In some embodiments, the O-methoxyethyl moiety is at the T position of the sugar, as shown in the structure below (III). R in the structure below represents a nucleobase. Each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages. A T -MOE modified sugar or T -MOE modified nucleoside, or simply an MOE sugar or nucleoside, is a ribose or nucleoside in which the T hydroxyl group that naturally occurs in the ribose is replaced with a 2OCH2CH2OCH3 group.
[0066] In some embodiments, a modified sugar moiety may comprise a bridged nucleic acid (BNA) moiety. A bridged nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4’-CH2-NH-0-2’ linkage. The nitrogen of the bridged nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with a phenyl group). The structure of a BNA moiety is shown below (IV), wherein R is a nucleobase, R’ is, for example, an H, Me, or Phenyl group, and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in internucleoside linkages. In the present ASOs, R’ is an Me group, unless otherwise specified. A BNA modified nucleoside, or simply a BNA nucleoside, is a nucleoside comprising a BNA sugar moiety.
[0067] In some embodiments, a modified sugar moiety may comprise a locked nucleic acid (LNA) moiety. A locked nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises a 4’-CH2-0-2’ linkage. An LNA moiety, as described herein, may be in the alpha-L configuration or the beta-D configuration. In particular embodiments, LNA moieties in the ASOs described herein are in the beta-D configuration. The structure of an LNA moiety is shown below (V), wherein R is a nucleobase and each of the 5’ -hydroxyl and 3’ -hydroxyl groups of the sugar is optionally involved in intemucleoside linkages. An LNA modified nucleoside, or simply an LNA nucleoside, is a nucleoside comprising an LNA sugar moiety.
[0068] In certain embodiments, an ASO described herein may include one or more modified nucleotides known in the art, including, e.g., 2’-0-methyl modified nucleotides, T - fluoro modified nucleotides, 2’-deoxy modified nucleotides, T -O-m ethoxy ethyl modified nucleotides, modified nucleotides allowing for alternative intemucleoside linkages (e.g., nucleotides comprising thiophosphates, phosphorothioates, and phosphotriesters), modified nucleotides terminally linked to a cholesterol derivative or lipophilic moiety, peptide nucleic acids, inverted deoxy or dideoxy modified nucleotides, abasic modifications of nucleotides, T -amino modified nucleotides, phosphoramidate modified nucleotides, modified nucleotides comprising modifications at other sites of the sugar or base of an oligonucleotide, and non natural base-containing modified nucleotides.
[0069] In some embodiments, the ASO may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7,
8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modified nucleosides. In certain embodiments, all of the nucleosides in the ASO are modified nucleosides. In other embodiments, less than 100% of the nucleosides in the ASO (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) are modified nucleosides.
[0070] The ASOs of the present disclosure may comprise naturally-occurring and/or non- naturally-occurring internucleoside linkages. The term “internucleoside linkage,” as used in the present disclosure, refers to a covalent linkage between adjacent nucleosides in an oligonucleotide. In certain embodiments, an ASO described herein may include one or more modified nucleoside linkages known in the art, including, e.g., phosphate, phosphotriester, boranophosphate, methylphosphonate, phosphoramidate, phosphorothioate, phosphorodithioate linkage, methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester, thionocarbamate (-0-C(=0)(NH)-S-), siloxane (-O-SiEE-O-), dialkylsiloxane, N,N'- dimethylhydrazine (-CH2-N(CH3)-N(CH3)-), MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3’-CH2- C(=0)-N(H)-5'), amide-4 (3’-CH2-N(H)-C(=0)-5'), amide-5 (3,-N(H)-C(=0)-CH2-5’), amide-6 (3’-C(=0)-N(H)-CH2-5’), formacetal (3’-0-CH2-0-5'), methoxypropyl, thioformacetal (3'-S-CH2-0-5'), carboxylate ester, carboxamide, sulfide, sulfonate ester, or amide linker. See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65.
[0071] In certain embodiments, an ASO described herein may include one or more modified nucleoside linkages known in the art, including, e.g., a phosphonoacetate (PACE, P(CR’R”)nCOOR) or thiophosphonoacetate (thioPACE, (S)-P(CR’R”)nCOOR) internucleoside linkage, wherein n is an integer from 0 to 6 and each of R’ and R” is independently selected from the group consisting of H, an alkyl and substituted alkyl. Examples of these internucleoside linkages include phosphonocarboxylate, phosphonocarboxylate, thiophosphonocarboxylate, and thiophosphonocarboxylate ester linkages, and in some embodiments are described in Yamada et ah, J Am. Chem. Soc. (2006) 128(15):5251-61, the contents of which are hereby incorporated by reference in its entirety. [0072] In certain embodiments, the intemucleoside linkage of a nucleotide may be a phosphate group or a thiophosphate group. Methods of preparation of phosphorous- containing intemucleoside linkages are well known to those skilled in the art. In particular embodiments, the ASOs described herein may have phosphodiester intemucleoside linkages, phosphorothioate intemucleoside linkages, or a combination thereof. The term “phosphodiester intemucleoside linkage” refers to an intemucleoside linkage between two
nucleosides formed by a phosphodiester group. The term “phosphorothioate internucleoside linkage” refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced with a sulfur atom. [0073] In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or can be prepared as separate enantiomers. Representative intemucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. ASOs of the present disclosure comprising intemucleoside linkages having one or more chiral center(s) can be prepared as populations of ASOs comprising stereorandom intemucleoside linkages, or as populations of ASOs comprising stereodefmed intemucleoside linkages.
[0074] The term “stereodefmed intemucleoside linkage,” in the present disclosure, refers to an intemucleoside linkage in which the stereochemical designation of the phosphorus atom is controlled such that a specific amount of Rp or Sp of the intemucleoside linkage is present within an ASO strand. The stereochemical designation of a chiral linkage can be defined by, for example, asymmetric synthesis. An ASO having at least one stereodefmed intemucleoside linkage can be referred to as a stereodefmed ASO.
[0075] In some embodiments, the present ASOs are fully stereodefmed. The term “fully stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (Rp or Sp) in each intemucleoside linkage in the ASO. The term “partially stereodefmed ASO,” as used in the present disclosure, refers to an ASO sequence having a defined chiral center (Rp or Sp) in at least one intemucleoside linkage, but not in all of the intemucleoside linkages of the ASO. Therefore, a partially stereodefmed ASO can include linkages that are achiral or non-stereodefmed in addition to at least one stereodefmed linkage.
[0076] In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate intemucleoside linkages in a particular stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art such as, for example, the methods described in Oka et ah, JACS (2003) 125:8307, Wan et ah, Nuc. Acid. Res. (2014) 42:13456, and PCT Patent Publication WO 2017/015555.
[0077] Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
C. Antisense Oligonucleotide Conjugates
[0078] The present disclosure also provides antisense oligonucleotide conjugates (ASO conjugates) comprising one or more ASOs described herein. The term “ASO conjugate,” in the present disclosure, refers to an oligomeric compound comprising an antisense oligonucleotide that is covalently linked to one or more non-nucleotide moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacology or pharmacokinetic properties of the ASO. For example, the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, absorption, tissue distribution, cellular distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and/or or stability of the ASO. In particular, the conjugate moiety may help target the ASO to a specific region in the central nervous system. In some embodiments of an ASO described herein, the conjugate moiety may be a carbohydrate, a peptide (e.g., a cell surface receptor ligand), and/or a lipid (e.g., phospholipid).
[0079] PCT Patent Publications WO 1993/07883 and WO 2013/033230 provide suitable conjugate moieties for use with the ASOs of the present disclosure. Certain conjugate groups and conjugate moieties have been described previously, for example, in the following references: thioether moiety, e.g., hexyl-S-tritylthiol (Manoharan et ah, Ann. NY. Acad. Sci. (1992) 660:306-309; Manoharan et ah, Bioorg. Med. Chem. Lett. (1993) 3:2765-70), phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et ah, Tetrahedron Lett. (1995) 36:3651-4; Shea et ah, Nucl. Acids Res. (1990) 18:3777-83), a polyamine or a polyethylene glycol chain (Manoharan et ah, Nucleosides & Nucleotides (1995) 14:969-73), or adamantane acetic acid, a tocopherol group (Nishina et ah, Molecular Therapy Nucleic Acids (2015) 4:e220; and Nishina et ah, Molecular Therapy (2008) 16:734-40), or a GalNAc moiety (e.g., PCT Patent Publications WO 2014/076196, WO 2014/207232, and WO 2014/179620).
[0080] In certain embodiments, conjugation of an ASO of the present disclosure to a lipophilic moiety may increase the delivery of the ASO to cells of the central nervous system. The term “lipophilic moiety,” in the present disclosure, broadly refers to any compound or chemical moiety having an affinity for lipids. The lipophilic moiety may generally comprise a saturated or unsaturated hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may comprise various substituents and/or one or more heteroatoms, such
as an oxygen or a nitrogen atom. In certain embodiments, the lipophilic moiety is a(n) aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyalicyclic compound. In certain embodiments, the lipophilic moiety is a steroid (e.g., sterol). Steroids include, without limitation, bile acids (e.g., cholic acid, deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone.
[0081] Certain lipophilic conjugate groups and conjugate moieties have been described previously, for example, in the following references: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA (1989) 86:6553-6), cholic acid moiety (Manoharan et al., Bioorg. Med. Chem. Lett. (1994) 4:1053-60), thiochole sterol moiety (Oberhauser et al., Nucl. Acids Res. (1992) 20:533-8), aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison- Behmoaras et al., EMBO J. (1991) 10:1111-8; Kabanov et al., FEBS Lett. (1990) 259:327-30; Svinarchuk et al., Biochimie (1993) 75:49-54), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta (1995) 1264:229-37), or an octadecylamine or hexylamino-5 carbonyl- oxycholesterol moiety (Crooke et al., J Pharmacol. Exp. Ther. (1996) 277:923-37)
D. Exemplary Antisense Oligonucleotide Compounds [0082] Certain abbreviations are used in the present disclosure to describe the modifications of each of the nucleotides and intemucleoside linkages of ASOs described herein that are modified oligonucleotides. Abbreviations are as follows: A is an adenine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; mC is a 5-methyl cytosine nucleobase; e is a 2’-MOE modified sugar; d is a 2’-deoxyribose sugar; 1 is a locked nucleic acid; b is a bridged nucleic acid; o is a phosphodiester intemucleoside linkage; and s is a phosphorothioate intemucleoside linkage.
[0083] In certain embodiments, the ASOs of the present disclosure are gapmers. The term “gapmer,” as used in the present disclosure, refers to an oligonucleotide comprising or consisting of an internal region positioned between two external regions, wherein the sugar moieties of the nucleosides comprising the internal region are chemically distinct from the sugar moieties of the nucleosides comprising the external region. The term “gap” refers to the internal region of the oligonucleotide, while the term “wing” refers to the external regions. A gapmer has a 5’ -wing, a gap, and a 3’ -wing. The three regions form a contiguous sequence. The sugar moieties of each of the wing nucleosides differ from at least some of the sugar moieties of the gap nucleosides. Unless otherwise noted, the nucleosides of the gap region of the ASOs of the present disclosure comprise entirely 2’-deoxyriboxyl nucleosides. In some embodiments, a gapmer may comprise one or more modified intemucleoside
linkages and/or modified nucleobases that do not necessarily follow the gapmer pattern of sugar modifications.
[0084] In some embodiments, the oligonucleotides of the present disclosure are gapmers that comprise MOE, BNA, LNA, or DNA modifications, or any combination thereof. In some embodiments, the gapmers comprise MOE, DNA, and BNA, MOE, DNA, and LNA, or BNA, DNA, and LNA modified sugar moieties. In certain embodiments, the intemucleoside linkages between the oligonucleosides are phosphodiester or phosphorothioate intemucleoside linkages, or a combination thereof.
[0085] The lengths of the three gapmer regions may be notated using the notation [# of nucleosides in the 5’ wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3’ wing]. Thus, a 4-10-4 gapmer comprises 4 linked nucleosides in each wing and 10 linked nucleosides in the gap.
[0086] In some embodiments, an ASO of the present disclosure is a 3-10-3 LNA gapmer.
3-10-3 LNA gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methyl cytosines. In some embodiments, all intemucleoside linkages are phosphorothioate intemucleoside linkages.
[0087] In some embodiments, an ASO of the present disclosure is a 3-11-3 LNA gapmer.
3-11-3 LNA gapmers are 17 nucleobases in length, wherein the central gap segment comprises 11 2’- deoxynucleosides and each of the 5’ and 3’ wing segments comprises three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methyl cytosines. In some embodiments, all intemucleoside linkages are phosphorothioate intemucleoside linkages.
[0088] In some embodiments, an ASO of the present disclosure is a 4-10-4 MOE gapmer.
4-10-4 gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T- deoxynucleosides and each of the 5’ and 3’ wing segments comprises four T -MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 4-10-4 MOE gapmer are 5-methyl cytosines. In some embodiments, all intemucleoside linkages are phosphorothioate intemucleoside linkages.
[0089] In some embodiments, an ASO of the present disclosure is a 5-10-5 MOE gapmer.
5-10-5 gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T -deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’-MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 5-10-5
MOE gapmer are 5-methyl cytosines. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.
[0090] In certain embodiments, an ASO of the present disclosure is a 3LNA-2MOE- 10DNA-2MOE-3LNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise an LNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a T -MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides. In some embodiments, all internucleoside linkages are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
[0091] In certain embodiments, an ASO of the present disclosure is a 2BNA-3MOE- 10DNA-3MOE-2BNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise a BNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
[0092] In certain embodiments, an ASO of the present disclosure is a 3BNA-2MOE- 10DNA-2MOE-3BNA gapmer, wherein each of the nucleosides at positions 1, 2, 3, 18, 19, and 20 of the oligonucleotide comprise a BNA modification, each of nucleosides at positions 4, 5, 16, and 17 of the oligonucleotide comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are 2’-deoxynucleosides. In some embodiments, the all internucleoside linkages are phosphodiester internucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the intemucleoside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
[0093] In certain embodiments, an ASO of the present disclosure is a 2LNA-3MOE- 10DNA-3MOE-2LNA gapmer, wherein each of nucleosides at positions 1, 2, 19, and 20 comprise an LNA modification, each of the nucleosides at positions 3, 4, 5, 16, 17, and 18 comprise a 2’-MOE modification, and each of the nucleosides at positions 6-15 are T - deoxynucleosides. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the intemucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester intemucleoside linkages. In some embodiments, the remainder of the interncueloside linkages are phosphorothioate intemucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methyl cytosine.
[0094] In a particular embodiment, the present disclosure provides the ASOs listed in the following table and described in more detail below.
Table B. Representative ASOs
D.l. Representative BNA/MOE Gapmer Compounds [0095] In some embodiments, an ASO of the present disclosure is a BNA/MOE gapmer compound, e.g., a compound described below.
[0096] Compound SNCA_ASO_01608 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0097] Compound SNCA AS0 01608 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (modified oligonucleotide SEQ ID NO: 18), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0098] Compound SNCA AS0 01608 is characterized by the following chemical structure (VI):
[0099] Compound SNCA_ASO_01613 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine. [0100] Compound SNCA ASO 01613 is characterized by the following chemical notation: Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (modified oligonucleotide SEQ ID NO: 19), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic
acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0101] Compound SNCA ASO 01613 is characterized by the following chemical structure (VII):
[0102] Compound SNCA_ASO_01615 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0103] Compound SNCA ASO 01615 is characterized by the following chemical notation: Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 20), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a
thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0104] Compound SNCA ASO 01615 is characterized by the following chemical structure (VIII):
[0105] Compound SNCA_ASO_01609 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine. [0106] Compound SNCA AS0 01609 is characterized by the following chemical notation: mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds
mCeo mCeo Tes Tbs Tb (modified oligonucleotide SEQ ID NO: 21), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0107] Compound SNCA AS0 01609 is characterized by the following chemical structure (IX):
[0108] Compound SNCA_ASO_01611 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0109] Compound SNCA ASO 01611 is characterized by the following chemical notation: Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (modified oligonucleotide SEQ ID NO: 22), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0110] Compound SNCA ASO 01611 is characterized by the following chemical structure (X):
[0111] Compound SNCA_ASO_01614 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages,
the other intemucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0112] Compound SNCA ASO 01614 is characterized by the following chemical notation: Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab (modified oligonucleotide SEQ ID NO: 23), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage. [0113] Compound SNCA ASO 01614 is characterized by the following chemical structure (XI):
[0114] Compound SNCA_ASO_01610 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE
modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine. [0115] Compound SNCA ASO 01610 is characterized by the following chemical notation: mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (modified oligonucleotide SEQ ID NO: 24), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0116] Compound SNCA ASO 01610 is characterized by the following chemical structure (XII):
[0117] Compound SNCA_ASO_01612 is characterized as a 2BNA-3MOE-10DNA-
3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-2 and 19-20
comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0118] Compound SNCA ASO 01612 is characterized by the following chemical notation: Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 25), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0119] Compound SNCA ASO 01612 is characterized by the following chemical structure (XIII):
[0120] Compound SNCA_ASO_01616 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC
(unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0121] Compound SNCA ASO 01616 is characterized by the following chemical notation: mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 26), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0122] Compound SNCA ASO 01616 is characterized by the following chemical structure (XIV):
[0123] Compound SNCA_ASO_01790 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0124] Compound SNCA AS0 01790 is characterized by the following chemical notation: Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (modified oligonucleotide SEQ ID NO: 27), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0125] Compound SNCA AS0 01790 is characterized by the following chemical structure (XV):
[0126] Compound SNCA_ASO_01791 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 23), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0127] Compound SNCA ASO 01791 is characterized by the following chemical notation: Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (modified oligonucleotide SEQ ID NO: 28), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0128] Compound SNCA ASO 01791 is characterized by the following chemical structure (XVI):
[0129] Compound SNCA_ASO_01792 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0130] Compound SNCA ASO 01792 is characterized by the following chemical notation: Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 29), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0131] Compound SNCA ASO 01792 is characterized by the following chemical structure (XVII):
[0132] Compound SNCA_ASO_01793 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15), wherein each of nucleosides 1-2 and 19-20 comprise a BNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0133] Compound SNCA ASO 01793 is characterized by the following chemical notation: Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (modified oligonucleotide SEQ ID NO: 30), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0134] Compound SNCA ASO 01793 is characterized by the following chemical structure (XVIII):
[0135] Compound SNCA_ASO_01789 is characterized as a 2BNA-3MOE-10DNA- 3MOE-2BNA gapmer having a sequence, from 5’ to 3’, of
TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), wherein each of nucleosides 1-2 and 19-20 comprise aBNA modification, each of nucleosides 3-5 and 16-18 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17- 18 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0136] Compound SNCA ASO 01789 is characterized by the following chemical notation: Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (modified oligonucleotide SEQ ID NO: 31), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, b is a bridged nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0137] Compound SNCA ASO 01789 is characterized by the following chemical structure (XIX):
D.2. Representative LNA/MOE Gapmer Compounds [0138] In some embodiments, an ASO of the present disclosure is an LNA/MOE gapmer compound, e.g., a compound described below.
[0139] Compound SNCA_ASO_01618 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0140] Compound SNCA ASO 01618 is characterized by the following chemical notation: Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (modified oligonucleotide SEQ ID NO: 32), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0141] Compound SNCA ASO 01618 is characterized by the following chemical structure (XX):
[0142] Compound SNCA_ASO_01623 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0143] Compound SNCA ASO 01623 is characterized by the following chemical notation: Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls A1 (modified oligonucleotide SEQ ID NO: 33), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0144] Compound SNCA ASO 01623 is characterized by the following chemical structure (XXI):
[0145] Compound SNCA_ASO_01625 is characterized as a 3LNA-2MOE-10DNA-
2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0146] Compound SNCA ASO 01625 is characterized by the following chemical notation: Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 34), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic
acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0147] Compound SNCA ASO 01625 is characterized by the following chemical structure (XXII):
[0148] Compound SNCA_ASO_01619 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0149] Compound SNCA ASO 01619 is characterized by the following chemical notation: mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls T1 (modified oligonucleotide SEQ ID NO: 35), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0150] Compound SNCA ASO 01619 is characterized by the following chemical structure (XXIII):
[0151] Compound SNCA_ASO_01621 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages,
the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0152] Compound SNCA ASO 01621 is characterized by the following chemical notation: Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (modified oligonucleotide SEQ ID NO: 36), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0153] Compound SNCA ASO 01621 is characterized by the following chemical structure (XXIV):
[0154] Compound SNCA_ASO_01624 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’ of AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE
modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0155] Compound SNCA ASO 01624 is characterized by the following chemical notation: Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls A1 (modified oligonucleotide SEQ ID NO: 37), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0156] Compound SNCA ASO 01624 is characterized by the following chemical structure (XXV):
[0157] Compound SNCA_ASO_01620 is characterized as a 3LNA-2MOE-10DNA-
2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CCAAGTGCCAGACCCTTTCA
(unmodified oligonucleotide SEQ ID NO: 10), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0158] Compound SNCA AS0 01620 is characterized by the following chemical notation: mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls A1 (modified oligonucleotide SEQ ID NO: 38), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0159] Compound SNCA AS0 01620 is characterized by the following chemical structure (XXVI):
[0160] Compound SNCA_ASO_01622 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GCAGATAAACCATCCCACTT
(unmodified oligonucleotide SEQ ID NO: 11), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0161] Compound SNCA ASO 01622 is characterized by the following chemical notation: Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 39), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0162] Compound SNCA ASO 01622 is characterized by the following chemical structure (XXVII):
[0163] Compound SNCA_ASO_01626 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0164] Compound SNCA ASO 01626 is characterized by the following chemical notation: mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 40), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0165] Compound SNCA ASO 01626 is characterized by the following chemical structure (XXVIII):
[0166] Compound SNCA_ASO_01823 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0167] Compound SNCA ASO 01823 is characterized by the following chemical notation: Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (modified oligonucleotide SEQ ID NO: 41), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate intemucleoside linkage.
[0168] Compound SNCA ASO 01823 is characterized by the following chemical structure (XXIX):
[0169] Compound SNCA_ASO_01824 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 13), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0170] Compound SNCA ASO 01824 is characterized by the following chemical notation: Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (modified oligonucleotide SEQ ID NO: 42), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic
acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0171] Compound SNCA ASO 01824 is characterized by the following chemical structure (XXX):
[0172] Compound SNCA_ASO_01825 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are 2’-deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0173] Compound SNCA ASO 01825 is characterized by the following chemical notation: Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls T1 (modified oligonucleotide SEQ ID NO: 43), wherein A is an adenine nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine
nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0174] Compound SNCA ASO 01825 is characterized by the following chemical structure (XXXI):
[0175] Compound SNCA_ASO_01826 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of
AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine. [0176] Compound SNCA ASO 01826 is characterized by the following chemical notation: Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als A1 (modified oligonucleotide SEQ ID NO: 44), wherein A is an adenine
nucleobase, mC is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester intemucleoside linkage, and s is a phosphorothioate internucleoside linkage.
[0177] Compound SNCA ASO 01826 is characterized by the following chemical structure (XXXII):
[0178] Compound SNCA_ASO_01822 is characterized as a 3LNA-2MOE-10DNA- 2MOE-3LNA gapmer having a sequence, from 5’ to 3’, of TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16), wherein each of nucleosides 1-3 and 18-20 comprise a LNA modification, each of nucleosides 4-5 and 16-17 comprise a 2’-MOE modification, each of nucleosides 6-15 are T - deoxynucleosides, the intemucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18- 19 are phosphodiester intemucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
[0179] Compound SNCA ASO 01822 is characterized by the chemical notation Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als A1 (modified oligonucleotide SEQ ID NO: 45), wherein A is an adenine nucleobase, mC
is a 5-methyl cytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2’-MOE modified sugar, d is a 2’-deoxyribose sugar, 1 is a locked nucleic acid, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage. [0180] Compound SNCA ASO 01822 is characterized by the following chemical structure (XXXIII):
III. Methods of Making Antisense Oligonucleotides
[0181] An antisense oligonucleotide of the present disclosure may be synthesized by any method known in the art. For example, an ASO may be synthesized by in vitro transcription and purification (e.g., using commercially available in vitro RNA synthesis kits), by transcription and purification from cells (e.g., cells comprising an expression cassette/vector encoding the ASO), by use of an automated solid-phase synthesizer, and the like. In solid- phase oligonucleotide synthesis, monomeric nucleoside units are added iteratively to a growing oligonucleotide chain covalently bound to a solid support. In the case of phosphodiester linkages, electrophilic 3’ phosphoramidite monomeric units may be used. However, any suitable electrophilic group can be used to covalently link two nucleosides.
[0182] The present ASOs may be purified following solid-phase synthesis through any method known in the art. For example, oligonucleotides may be precipitated from solution through treatment of the solution with ethanol and divalent cations. The present ASOs may also be purified using, e.g., sizing columns, reverse-phase chromatography, high-performance liquid chromatography, and polyacrylamide gel electrophoresis.
[0183] Exemplary methods of synthesizing antisense oligonucleotides using solid-phase supports and purifying said oligonucleotides are described in, for example, Ellington et al., Introduction to the synthesis and purification of oligonucleotides. Curr. Protoc. Nucleic Acid Chem. (2001) Appendix 3C.
IV. Compositions of Antisense Oligonucleotides
[0184] In some embodiments, the present disclosure relates to compositions (e.g., pharmaceutical compositions) comprising an ASO described herein. In some embodiments, the composition is useful for treating a disease or disorder associated with expression or overexpression of alpha-synuclein, e.g., a synucleinopathy. Compositions of the present disclosure may be formulated based upon the mode of delivery.
[0185] A pharmaceutical composition described herein may comprise a pharmaceutically acceptable excipient. A pharmaceutically acceptable excipient can be liquid or solid, and may be selected with the planned manner of administration in mind so as to provide for the desired bulk, consistency, and other pertinent transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline solution, buffering agents, preservatives, and the like. For example, the ASOs of the present disclosure may be administered to a patient as a formulation in phosphate buffered saline (PBS). Example of pharmaceutically acceptable excipients include water, saline, buffer solution, or artificial cerebrospinal fluid. The pharmaceutically acceptable excipient is preferably sterile.
[0186] The ASOs of the present disclosure may be administered as pharmaceutically acceptable salts. A pharmaceutically acceptable salt is a salt of the ASOs of the present disclosure that is physiologically acceptable, and retains the desired biological activity of the ASO without having undesired toxicological effects. As used herein, the term ASO encompasses both the free acid form and salt forms (e.g., sodium salt form) of the oligonucleotides.
[0187] The ASOs of the present disclosure may be admixed, encapsulated (e.g., in a lipid nanoparticles), conjugated, or otherwise associated with other molecules, molecular structures, or mixtures of nucleic acids.
[0188] U.S. Patent Publication Number 2020/0385723 provides suitable pharmaceutical compositions for use with the ASOs of the present disclosure.
V. Methods of Using Antisense Oligonucleotides
[0189] The ASOs of the present disclosure typically inhibit the activity of transcripts encoded by the SNCA gene in a mammalian cell, such as a human cell. In some embodiments, the cell is a neuronal cell. In certain embodiments, the cell is a cell of the central nervous system (CNS), including cells of the motor cortex, frontal cortex, caudate, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, dorsal cochlear nucleus (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forebrain nuclei.
[0190] The present disclosure provides methods of down-regulating the abundance or activity of SNCA gene transcripts in cells or in tissues comprising contacting the cells or tissues with an effective amount of one or more of the ASOs or compositions of the disclosure. The methods may be carried out in vitro or in vivo.
[0191] In some embodiments, the ASOs of the present disclosure can be utilized for treatment or prophylaxis. The ASOs of the present disclosure can be used as therapeutics in animals suspected of having a disease or disorder that can be treated by modulating the expression of the SNCA gene transcript and/or alpha-synuclein protein. The animal may also be prone to having the disease or disorder associated with the expression of the SNCA gene, and is not necessarily suspected of having the disease or disorder. The animal is treated by administering a therapeutically or prophylactically effective amount of one or more of the ASO compounds or pharmaceutical compositions of the present disclosure. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human.
[0192] In some embodiments, the ASOs described herein may be used to treat a neurodegenerative disease, such as Parkinson’s disease, Lewy body dementia, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher’s disease, and Alzheimer’s disease. In general, a neurodegenerative disease results in the death of neurons.
[0193] In some embodiments, the ASOs of the present disclosure ameliorate the symptoms of a disease or disorder associated with the expression of the SNCA gene. Amelioration may refer to a reduction in the severity or the frequency of occurrence of a symptom. Amelioration may also refer to a delay in the onset or progression of a symptom.
In some embodiments, a symptom alleviated by treatment with the ASO is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, or dementia. Amelioration of these symptoms may result in improved motor function, reduction of alpha-synuclein aggregations, reduced neurodegeneration, reduced or reversed cognitive decline, and/or reduced or reversed dementia.
[0194] A “therapeutically effective amount” of an ASO as disclosed herein is an amount sufficient to carry out a specifically stated purpose. Such an amount can be determined empirically and in a routine manner, in relation to the stated purpose. Certain factors may influence the dosage and timing required to effectively treat a subject, including, but not limited to, severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and one or more other diseases being present. Moreover, treatment of a subject with a therapeutically effective amount of a pharmaceutical composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the ASOs of the present disclosure may be made using conventional methodologies or on the basis of in vivo testing using appropriate animal models. A therapeutically effective amount may alleviate the symptoms of a disease.
[0195] In certain embodiments, the ASOs or pharmaceutical compositions of the present disclosure are prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intracranial, and the like). In preferred embodiments, the pharmaceutical composition is injected intrathecally or intracranially to the subject.
[0196] In some embodiments, the ASOs of the present disclosure can be used for research purposes. For example, an ASO may be used to specifically inhibit the synthesis of the alpha-synuclein protein in cells and experimental animals. ASO-mediated inhibition of alpha-synuclein synthesis can be used to perform functional analyses of alpha-synuclein protein.
VI. Kits and Articles of Manufacture
[0197] The present disclosure also provides kits and articles of manufacture comprising an ASO described herein. Kits or articles of manufacture comprising an ASO of the present
disclosure can be used to perform the methods described herein. A kit or article of manufacture comprises at least one ASO in one or more containers.
[0198] In some embodiments, a kit or an article of manufacture described herein may be used for the treatment and/or prevention of a disease associated with the expression of the SNCA gene (e.g., a synucleinopathy). The kit or article of manufacture may further comprise a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, IV solution bags, etc. The containers may be formed from a variety of materials such as glass or plastic, and may hold a composition which is by itself or combined with another composition effective for treating or preventing the disease and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The kit or article of manufacture may further comprise a package insert indicating that the compositions can be used to treat a particular disease. Alternatively, or additionally, the article of manufacture or kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer’s solution and dextrose solution. It may further include other materials desirable from a commercial and/or user standpoint, including other buffers, diluents, filters, needles, and syringes.
[0199] In some embodiments, the kits contain all of the components necessary and/or sufficient to perform a detection assay, including all controls, directions for performing assays, and any necessary software for analysis and presentation of results. One skilled in the art will readily recognize that the disclosed ASO can be readily incorporated into one of the established kit formats which are well known in the art.
[0200] Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of neurology, medicine, medicinal and pharmaceutical chemistry, and cell biology described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
Throughout this specification and embodiments, the words “have” and “comprise,” or variations such as “has,” “having,” “comprises,” or “comprising,” will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. As used herein, the term “approximately” or “about” as applied to one or more values of interest refers to a value that is similar to a stated reference value. In certain embodiments, the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context.
[0201] All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0202] In order that this invention may be better understood, the following examples are set forth. These examples are for purposes of illustration only and are not to be construed as limiting the scope of the invention in any manner.
EXAMPLES
[0203] The materials and methods used in the experiments described below are as follows.
Construction of ASOs
[0204] The ASOs were constructed to be complementary to the sense strand of the genomic SNCA sequence (SEQ ID NO: 1) as well as the sequence of the mRNA transcribed from the SNCA gene (NC_000004.12: :89724099..89838324, SEQ ID NO: 2).
Sk-Mel-2 Cell Culture
[0205] Sk-Mel-2 cells were cultured in Eagle’s minimum essential medium (EMEM) supplemented with 10% Fetal Bovine Serum (FBS).
Transgenic Human SNCA Mice and Collection of Neurons [0206] C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire wildtype human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter. C57BL/6Tac mice (Taconic) were genetically engineered to introduce the entire human SNCA gene starting from its 5’UTR (SEQ ID NO: 1) mutated in position A53T into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter. Primary cortical neurons were collected from embryos removed from pregnant
homozygous human SNCA knock-in mice at embryonic day 17.5. Cortical tissue of each embryo was dissected on ice-cold Hank’s Balanced Salt Solution. Pooled tissue was minced and digested with papain at 37 °C for 12 minutes. Digestion then was halted by the addition of 10% FBS/DMEM. The cells were triturated and resuspended in Neurobasal™ Plus media supplemented with GlutaMAX™, 2% penicillin/streptomycin, and B-27™ Plus supplement. Cells were seeded at a density of 15000 cells/well onto 384-well poly-L-lysine + boric acid coated plates in 40 pL supplemented Neurobasal™ media (containing B-27™ supplement and GlutaMAX). The neurons were then incubated for four days at 37°C under a 5% CO2 atmosphere.
Male Winstar Rats
[0207] Male Wistar Rats weighed 200-225g at their arrival and were housed in groups of two animals per cage at room temperature with food and water available ad libitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide to the Care and Use of Experimental Animals.
ASO Screenings in Neurons in vitro
[0208] For single dose screenings, neurons were treated with 300 nM of the given ASO. For multiple dose screenings, neurons were treated with serial dilutions of the given ASO starting at 3 pM (½ log dilutions, 11 concentrations total). Seven days after treatment with the ASO, the culture media was replaced with new Neurobasal™ media. 15 days after the treatment, RNA was extracted from the cells using the TaqMan™ Fast Advanced Cells-to- CT Kit (ThermoFisher). Cells were then washed in PBS and lysed in solution for five minutes at room temperature, with simultaneous DNase treatment. Lysis was terminated by treatment of the mixture with Stop Solution, followed by a two-minute incubation at room temperature. Reverse transcription was conducted immediately after cell lysis using Fast Advanced RT Enzyme Mix (ThermoFisher). The cDNA samples were then used for quantitative real-time PCR measurement using TaqMan™ genotyping assays. Specific probes and primers were used for SNCA mRNA quantification (Hs00240906_ml SNCA; ThermoFisher). SNCA mRNA levels were adjusted to the measured levels of the housekeeping gen ePPIA (probe/primer PPIA_Mm02342430_gl; ThermoFisher).
[0209] In a qPCR reaction, the quantification cycle value (Ct) is defined as the number of cycles required for the fluorescent signal to exceed the background fluorescence. The QuantStudio™ Real-Time PCR software program (Applied Biosystems, Foster City, CA) sets this threshold at ten standard deviations above the mean baseline fluorescence. The comparative Ct method normalized the Ct value of a target gene to housekeeping genes
before comparisons were made between samples. First, the difference between Ct values (ACt) of the target gene and the housekeeping gene was calculated for each sample, and then the difference in the ACt (AACt) was calculated between two samples (e.g., control and treatment). The fold-change in expression of the two samples was calculated as 2 DDa. The percentage of reduction was calculated by subtracting the value 1 to the 2 DDa of the ASO group mean of interest and by multiplying by 100, % reduction (1- 2-AACtASO group mean) x 100.
Mouse Model
[0210] The entire wildtype (WT) human SNCA gene (SEQ ID NO: 1) was introduced into the mouse genome in place of the mouse SNCA gene locus in C57BL/6Tac mice (Taconic) as shown in FIG. 1. The expression of human and murine SNCA proteins in different brain areas and peripherical organs was analyzed by mass spectrometry analysis (FIG. 2A-2C). Three- to four-month-old homozygous male mice expressing the WT human SNCA gene (referred to as “hSNCA+/+Kl mice” or “ hSNCA mice”) were housed in groups of three animals maximum per cage at room temperature with food and water available ad libitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide to the Care and Use of Experimental Animals hSNCA A53T neurons
[0211] The entire human A53T SNCA gene was introduced into the mouse genome in place of the mouse SNCA gene locus of C57BL/6Tac mice (Taconic) as described in FIG.l. Homozygous female mice expressing human A53EWC4 gene (referred to as hA53TSNCA+/+KI) were housed isolated with one animal per cage at room temperature with food and water available ad libitum. All procedures were approved by the Institut de Recherches SERVIER ethical committee in accordance with the principles of the Guide to the Care and Use of Experimental Animals.
Intracerebroventricular (ICV) Injection
[0212] Sterile saline syringes and nuclease-free centrifuge tubes were used to prepare dosing solutions. The tubes containing ASO powder were briefly centrifuged before adding saline solution, then re-centrifuged for 10 minutes to fully dissolve the ASO powder. The solution was vortexed for approximately one minute and stored at 4°C until use.
[0213] hSNCA mice received a single unilateral bolus injection of oligonucleotide at a dose of 30 nmol. Mice were anesthetized with isoflurane at a concentration of 4.5-5% and maintained during surgery with a concentration of 1.5-2% isoflurane. For pain management, buprenorphine at a dosage of 0.04 mg/kg was administered subcutaneously at least 30
minutes before injection. The scalps of the mice were shaved and, following loss of the pedal reflex, mice were placed in a stereotaxic frame (David Kopf Instruments, CA). The scalp was sterilized using three alternating wipes of Betadine and 70% ethanol. An incision was made in the scalp and the skull surface exposed and bregma positively identified. A hole was drilled in the skull at 0.5 mm AP, 1.1 mm ML, relative to bregma. The ASO was injected through a canula (3 lg) connected to a microsyringe pump controller. The dorsoventral DV coordinate was measured at 1 mm below the skull surface. Once the canula was positioned, the ASO solution was administered in 5 pL of saline vehicle over 30 seconds. The canula was left in place for an additional three minutes after injection to allow diffusion of the solution in the brain. After a slow withdrawing of the canula, the scalp was sutured and mice were subcutaneously injected with 1 mL of warm sterile saline solution to aid rehydration and placed in their warm home cage. A control group of mice was similarly dosed with saline vehicle control. Mice were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerability was scored one hour following dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
[0214] The antisense oligonucleotides described above were tested in hSNCA+!+ KI (Knock In) mice as described above to assess their tolerability profile. ASO SNCA 00033 as previously described in PCT Patent Publication WO 2012/068405 was also tested as a comparator. In all instances, ASO SNCA 00033 has a 5-10-5 MOE gapmer pattern in which all of the internucleoside linkages are phosphorothioate internucleoside linkages and all cytosine residues are 5-methyl cytosines.
Intrathecal (IT) Injection
[0215] Male Wistar rats received a single intrathecal bolus injection of oligonucleotide at a dose of 2.5mg. Rat were anesthetized with isoflurane at a concentration of 4 % and maintained during surgery with a concentration of 2-2.5 % isoflurane. For pain management, Carprofene 5mg/kg and Buprenorphine 0.05 mg/kg was administered subcutaneously at least 20 minutes before injection. Rat were shaved and, following loss of the pedal reflex, an incision was made between the 5th and the 6th lumbar vertebra. Muscle around this area was dissected allowing to access of the spinal canal to insert the catheter used for ASO injection. Once the catheter was positioned, ASO solution was administered in 30m1 of artificial CSF over ~30 seconds. The catheter was left in place and sealed to avoid diffusion of the CSF fluid. Muscle and skin were sutured, and the rats were subcutaneously injected with 1 mL warm sterile saline to aid rehydration and placed in their warm home cage. A control group
of rats were similarly dosed with artificial CSF. Rats were observed until they regained consciousness and mobility to prevent potential adverse behavioral effects. Drug tolerability was scored at one, three, and 24 hours post dosing. Animals dosed with non-tolerated compounds (tolerability score >8) were euthanized immediately following the one-hour evaluation.
ASO Acute Tolerability Assessment
[0216] At one and three hours post injection, adverse effects were monitored and scored in dosed mice according to the criteria shown in FIG. 3. At one, three, and twenty -four hours post injection, adverse effects were monitored and scored in dosed rats according to the criteria shown in FIG. 10. A normal tolerability score is 0 and a highly toxic score corresponds to 16. The final tolerability score was calculated based on the sum of all criteria. For some oligonucleotides, an intolerable acute toxicity was observed without reaching the first observational time point. In these cases, the ASO was scored with an acute toxicity score of 14, and the mice were immediately euthanized. If a score of higher than 6 was measured at the one-hour time point, mice were more closely monitored over the course of the experiment.
ASO Long Term Tolerability Assessment [0217] Mice were weighed on the injection day and three times per week until completion of the experiment. Any mice displaying intolerable health, behavioral observations, or weight loss of more than 20% of their initial body weight were immediately euthanized.
Tissue Sampling
[0218] All mice were euthanized by anesthetic overdose. Animals were transcardially perfused in the left ventricle with 0.9 % saline. The thoracic aorta between the lungs and the liver was clamped with hemostatic forceps to block blood flow from the heart to the abdomen, but to allow blood to flow to the brain. The right ventricle was opened with scissors. A constant pressure of 100 to 120 mm Hg was maintained on the perfusion solution by connecting the solution bottle to a manometer-controlled air compressor. Perfusion was continued until the skull surface turned pale and perfusion solution exited the right ventricle. Following perfusion, brain tissues (cortex) and peripherical tissues (kidney and liver) were collected. Samples were cut into small pieces, mixed and aliquoted into three equal parts.
All samples were frozen with liquid nitrogen and stored at -80°C until use for RNA, protein, and ASO measurements. For some studies, blood and cerebrospinal fluid (CSF) were also collected.
mRNA Measurements by qRT-PCR
[0219] RNA extraction and mRNA quantification by qPCR were performed. From right cortex biopsies, RNA was extracted using RNeasy Mini Kit (Qiagen) with DNase treatment. Total RNA samples were quantified using a Nanodrop™ spectrophotometer and analyzed using TapeStation to determine the quality of the RNA (RIN). In qPCR quantification experiments, the RNA was first reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™). The reaction was performed in a 100 pL final reaction volume, starting from 1000 ng of total RNA (to a final RNA concentration of 10 ng/pL) Quantification of the human SNCA gene and the mouse PPIA housekeeping gene were performed from 40ng of total cDNA using QuantStudio 7 Flex (Applied Biosystems™), TaqMan™ Universal PCR Master Mix (Applied Biosystems™, Ref. 4324020), and TaqMan™ Gene Expression Assays in duplex (Hs00240906_ml in FAM fluorochrome and Mm02342430_gl in VIC fluorochrome). qPCR analysis was performed in triplicate using the fast run mode. The Ct values of each qPCR plate were analyzed using Excel software. Technical replicates (n = 3) were combined and averaged to the geometric mean. Relative expression was generated for each ASO group using the mouse control PBS condition. hSNCA Protein Expression by Mass Spectrometry Analysis [0220] Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. Brain samples were diluted in a denaturing buffer (ammonium bicarbonate 50mM, deoxycholate 1%) and then heated at 95°C for five minutes. Next, trypsin (lOpg) was added into each sample. The tryptic digestion was performed in an ultrasonic bath (Branson 1200) for one minute followed by an incubation at 52 °C for 30 minutes. The reaction was stopped by the addition of lpL of TCEP (0.5 M) and 1 pL of 100% formic acid followed by incubation at 95°C for five minutes. The samples were then centrifuged at 30,000 g for 15 minutes. Peptide digests were analyzed by a reversed-phase liquid chromatography tandem mass spectrometry (LC-MS/MS) using a Shimadzu LC system (Shimadzu) coupled online to a triple quadrupole mass spectrometer (Shimadzu 8060) operated in the MRM mode. The specific peptides used to measure alpha-synuclein protein abundance were TVEGAGSIAAATGFVK (SEQ ID NO: 46) and TVEGAGNI AAAT GF VK (SEQ ID NO: 47). The specific peptide used to measure GAPDH protein abundance was VGVNGFGR (SEQ ID NO: 48). A single 10 pL injection of each brain sample digest was injected on a Waters™ XBridge Peptide BEH C18 column (130 A; 3.5 pm; 150 mm x 2.1
mm). Peptides were eluted using a linear gradient of acetonitrile (2-40%) in 0.1% formic acid over 30 min. Chromatograms were analyzed using the Shimadzu Lab Solutions software. The signal intensity obtained for each peptide was normalized by GAPDH signal obtained in each sample and is expressed in arbitrary units (AU). hSNCA Protein or alpha-sy nuclein Protein Expression by ELISA [0221] Mouse brain tissues were homogenized with Pecellys® (2x20s, 5000tr) in lysis buffer (PBS, Sigma Protease and Phosphatase Inhibitor Cocktail, 1% deoxycholate) at 150 mg/mL. Brain homogenates were then centrifuged (27000g, 4°C, 20 minutes) and supernatants collected. The quantification of a-synuclein in brain lysates were performed by using the U-PLEX Human a-Synuclein Kit (K151WKK) following manufacturer instruction. The quantification of total a-synuclein in brain lysates were performed using the ELISA commercial kit from MSD®, U-PLEX Human a-Synuclein Kit (K151WKK). The provided plate was pre-coated with capture antibody for a-synuclein. The sample (brain lysates) was added to a solution containing the detection antibody (anti-a-synuclein) conjugated to an electroluminescent compound label (MSD SULFO-TAG). Analytes in the sample bound to the capture antibodies immobilized on the working electrode surface. Recruitment of the conjugated detection antibody by bound analytes completed the sandwich. An MSD® read buffer was added providing the appropriate chemical environment for electroluminescence and the plate was loaded into an MSD SECTOR® Imager for analysis. Inside the SECTOR Imager, a voltage applied to the plate electrodes caused the probes bound to the electrode surface to emit light. The instrument measured the intensity of emitted light to provide a quantitative measurement of a-synuclein present in the sample.
High Performance Liquid Chromatography (HPLC) Fluorescence [0222] Samples were analyzed against a set of calibration standards prepared in water.
As no matrix effect was noticed, quantification of all samples (plasma, CSF and tissues) were performed using a water set of standards. Frozen tissues were weighed and grinded into Masterpure™/Proteinase K 97/3 (V/V) buffer for 2x30 seconds at 6500rpm using a Precellys device. Plasma samples (5pL) were diluted into Masterpure™/ptoteinase K 97/3 (70pL). Plasma and tissue homogenates were incubated during 30 minutes at 55°C under soft agitation. Then, 10pL of KC1 3M solution was added into 50pL of tissue homogenates or plasma dilution, rapidly vortexed and sonicated for five minutes. The tubes were centrifuged for ten minutes (20000 g) at +4 °C. CSF samples (1 OpL) were diluted into hybridation buffer (Tris HC1 50 mM pH 8.5 / ACN 90/10) (45pL) and proteinase K (lpL) and were incubated during 15 minutes at 55°C. Prior to analysis, a hybridization step was undertaken with a
fluorescently labelled peptide nucleic acid oligomer complementary to the quantified oligonucleotide. For calibration standards and tissue homogenates, 40 pL hybridation buffer was mixed with 10pL of fluorescent complementary probe and 10pL of calibration standards, quality control sample and study sample supernatants. For plasma samples, 30pL hybridation buffer were mixed with 10pL of fluorescent complementary probe and 60 pL of quality control sample and study sample supernatants. For CSF analysis, lOpl of fluorescent complementary probe was directly added into the previous dilution. The mixtures were first incubated 15 minutes at 95°C then 15 minutes at 55°C. Finally, samples were centrifuged for 5 minutes (20000 g) at 4°C. The samples were analyzed under an RP-HPLC system with fluorescence detection. The injected volume was 50pL excepted for plasma (90pL). The amount of fluorescence due to hybridized oligonucleotide to fluorescent probe was measured and compared to the calibration curve. The oligonucleotide concentration in the sample was calculated considering the different dilutions used during sample preparation.
Example 1: mRNA Reduction in vitro Following a Single Dose of ASO [0223] Modified oligonucleotides complementary to the human SNCA nucleotide sequence were designed and tested in cultured Sk-Mel-2 cells for their selective efficacy in reducing SNCA mRNA levels. Cultured Sk-Mel-2 cells at a density of 15000 cells per well were transfected using Lipofectamine 2000 (Invitrogen) with 20 nM or 2 nM concentrations of modified antisense oligonucleotides (ASOs). After 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by a branched DNA assay (QuantiGene Singleplex Assay Kit, ThermoFisher). This method relies on the signal amplification of a branched DNA (bDNA) probe that binds to a specific nucleotide sequence. The probe-sets used were XM_005555421 (reactive to dog and human SNCA ) and NM_002046 (reactive to human GapDH ), which were designed by Affymetrix Inc./ThermoScientific and synthesized by Metabion International. SVCN-RLUs were normalized to GapDH relative light units (RLUs) of respective wells. Values were normalized against wells treated with unspecific (Ahsal) ASOs.
[0224] The modified oligonucleotides tested in the above experiment are shown in Table C below. Each modified oligonucleotide listed in Table C is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each of the wing segments comprises five 2’MOE nucleosides. All cytosines throughout
each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate internucleoside linkages.
[0225] The identified position in Table C corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
Table C. 5-10-5 MOE Gapmers
[0226] Each modified oligonucleotide listed in Table D is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 4-10-4 MOE gapmer. The gapmers are 18 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides, and the wing segments on both the 5’ and 3’ ends comprise four T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
[0227] The identified position in Table D corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human SNCA nucleic acid sequence (SEQ ID NO: 1). Table D. 4-10-4 MOE Gapmers
[0228] Each modified oligonucleotide listed in Table E is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-10-3 LNA gapmer. The gapmers are 16 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segments on the 5’ and 3’ ends comprise three LNA nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
[0229] The identified position in Table E corresponds to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the modified human nucleic acid sequence (SEQ ID NO: 1).
Table E. 3-10-3 LNA Gapmers
[0230] Each modified oligonucleotide listed in Table F is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-11-3 LNA gapmer. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises eleven T - deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising three LNA nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
[0231] The identified position in Table F corresponds to the “Start Site” i.e. the 5’ nucleoside to which the gapmer is complementary in the human nucleic acid sequence (SEQ ID NO: 1).
Table F. 3-11-3 LNA Gapmers
Example 2: mRNA Reduction in vitro Following a Single Dose of MOE-Modified ASO [0232] Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were designed and tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with 300 nM of each antisense oligonucleotide. mRNA levels were quantified using qRT-PCR (TaqMan™) with the following probes:
T GGC A AC AGT GGCTGAGA AGAC C A A (SEQ ID NO: 248) with the primers Hs00240906_ml SNCA (Therm oFisher), and CC AAGACTGAAT GGCTGGATGGC AA (SEQ ID NO: 249) with the primers
PPIA_Mm02342430_g 1 (Therm oF i sher) (control) .
[0233] Each modified oligonucleotide listed in Table G and Table H is complementary to the human SNCA DNA (SEQ ID NO: 1) or mRNA (SEQ ID NO: 3) sequence. The sequences in Table G are complementary to exons of the mRNA sequence, whereas the sequences in Table H are complementary to the introns of the mRNA sequence. Each ASO
is a 5-10-5 MOE gapmer that is 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and the wing segments on both 5’ and 3’ ends comprise five T -MOE nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages. [0234] The identified position in Table G and Table H corresponds to the “start site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the modified human nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 3. “#N/A” signifies that the sequence does not align to SEQ ID NO: 1 (e.g., where the sequence bridges an exon-exon junction only present in the mature mRNA). Table G. MOE-Modified ASOs Complementary to SNCA RNA Exons
Table H. MOE-Modified ASOs Complementary to SNCA RNA Introns
Example 3: mRNA Reduction in vitro Following Multiple Doses of MOE-modified ASOs [0235] Modified oligonucleotides complementary to the human SNCA nucleic acid sequence were tested in vitro in primary cortical neurons for their selective efficacy in reducing SNCA mRNA levels. Neurons were treated with multiple doses (3 mM; ½ log dilution; 11 concentrations) of the given antisense oligonucleotide. This assay provided the in vitro cellular potency (pIC5o= -Log(IC50)) and efficacy (Delta Inhib Obs (%)) of the given ASO in neurons. In addition, the Hill coefficient, which is the slope of the line in a Hill plot, was measured in order to observe the shape of the dose response curve for each ASO.
[0236] Each modified oligonucleotide listed in Table I, Table J, and Table K is complementary to human SNCA nucleic acid sequence SEQ ID NO: 1 and/or SEQ ID NO: 3. The ASOs in Table J are designed to be complementary to introns in the SNCA mRNA sequence, whereas the ASOs in Tables I and K are designed to be complementary to exons in the SNCA mRNA sequence.
[0237] Each of the ASOs in Tables I, J, and K is a 5-10-5 MOE gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each of the flanking wing segments comprises five T -MOE nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages.
[0238] The SNCA_ASO_01617 in Table J is a 5-10-5 MOE gapmer. The gapmer is 20 nucleobases in length, wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five T -MOE nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines. All internucleoside linkages are phosphorothioates linkages except between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
[0239] Each of the ASOs in Table L is a 3-2-10-2-3 LNA/MOE mixed gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T - deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides. The ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 T -deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides. All cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages.
[0240] Each ASO listed in Table M is a 2-3-10-3-2 BNA/MOE gapmer. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten T-
deoxynucleosides and each wing segment comprises two BNA nucleosides and three T- MOE nucleosides. Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three T -MOE nucleosides, 10 T -deoxynucleosides, three T -MOE nucleosides, and two BNA nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all 5 internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester (PO) linkages.
[0241] The identified positions in Tables I, J, K, L, and M correspond to the “Start Site,” i.e., the 5’ nucleoside to which the gapmer is complementary in the human SNCA 0 nucleic acid sequence SEQ ID NO: 1 and/or SEQ ID NO: 3.
Table I. 5-10-5 MOE Gapmers Complementary to SNCA RNA Exons
S
S
S
S
S
S
S
S
S
S
S
S
S
S
S
Table J. 5-10-5 MOE Gapmers Complementary to SNCA RNA Introns
Table K. 5-10-5 MOE Gapmers Complementary to SNCA RNA Exons
Table L. 3-2-10-2-3 LNA/MOE mixed gapmer
Table M. 2-3-10-3-2 BNA/MOE mixed gapmer
Example 4: Tolerability and Efficacy of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice [0242] Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed in the indicated table at a dose of 30 nmol. Each modified oligonucleotide is complementary to the human SNCA genomic nucleic acid sequence (SEQ ID NO: 1). The positions in the tables indicate the 5’ nucleoside to which the oligonucleotide is complementary in the human nucleic acid sequence (SEQ ID NO: 1). [0243] For tolerability studies, the tolerability score is represented as the Functional
Observational Battery (FOB) score at one hour post-injection.
[0244] For efficacy studies, most treatment groups consisted of three animals. Mice were sacrificed two weeks or six weeks post-injection, as indicated. Brain tissue was collected and the level of hSNCA mRNA was measured as described above. Results are presented in the tables as percent reduction of the amount of SNCA mRNA relative to vehicle control groups. A value of 0% reduction indicates that the compound had no effect.
I. Tolerability of 5-10-5 MOE Gapmers (PS)
[0245] Each ASO in Table N is a 5-10-5 MOE gapmer as described above, in which all cytosines residues throughout each gapmer are 5-methyl cytosines and all internucleoside
linkages are phosphorothioate (PS) linkages. FIG. 4 is a bar graph that compares the tolerability of select 5-10-5 MOE gapmers. Compounds having an FOB of greater than ten were excluded from further assays. The structure of SNCA ASO 01617 is as described above. Table N. Tolerability of 5-10-5 MOE Gapmers in hSNCA Mice
II. Efficacy of 5-10-5 MOE Gapmers (PS)
[0246] Each ASO listed in Table O is a 5-10-5 MOE gapmer as described above, in which all cytosine residues throughout each gapmer are 5-methyl cytosines and all internucleoside linkages are phosphorothioate linkages. FIG. 4 is a bar graph that compares the efficacy of select 5-10-5 MOE gapmers. The structure of SNCA_ASO_01617 is as described above.
[0247] As shown below, several of the ASOs reduced the amount of human SNCA mRNA in mice two weeks post-injection.
Table O. Effect of 5-10-5 MOE Gapmers in hSNCA Mice
III. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers (PS)
[0248] Each ASO listed in Table P is a 3-2-10-2-3 LNA/MOE mixed gapmer, except for SNCA_ASO_00033, which is a 5-10-5 MOE gapmer as described above, used as a comparator. The LNA/MOE mixed gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three LNA nucleosides and two T -MOE nucleosides. The ASO therefore comprises, from 5’ to 3’, 3 LNA nucleosides, two T -MOE nucleosides, 10 2’-deoxynucleosides, two T -MOE nucleosides, and 3 LNA nucleosides. All cytosines residues throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages. [0249] Further experimentation to determine the level of mRNA reduction was not performed for compounds 00937, 00938, 00941 and 00942 because they did not exhibit promising FOB results. The mice treated with these compounds were sacrificed.
Table P. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
IV. Tolerability of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0250] Each ASO listed in Table Q (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 LNA/MOE mixed gapmer. FIG. 5 is a bar graph that compares the tolerability of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all intemucleoside linkages are phosphorothioate (PS) linkages except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester (PO) linkages.
Table Q. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
V. Tolerability of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0251] Each ASO listed in Table R is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines. All internucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages.
Table R. Tolerability of 3-2-10-2-3- LNA/MOE Mixed Gapmers in hSNCA Mice
VI. Tolerability of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0252] Each ASO listed in Table S is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
Table S. Tolerability of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
VII. Efficacy of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0253] Each ASO listed in Table T (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 LNA/MOE mixed gapmer. FIG. 5 is a bar graph that compares the efficacy of select 3-2-10-2-3 LNA/MOE mixed gapmers. All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19, which are phosphodiester linkages.
[0254] As shown below, several of the ASOs reduced the amount of human SNCA mRNA in mice two weeks post injection.
Table T. Effect of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
VIII. Efficacy of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0255] Each ASO in Table U is a 3-2-10-2-3 LNA/MOE gapmer. All cytosines throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages, except the linkages between nucleosides 2 and 3, 4 and 5, and 16 and 17, which are phosphodiester linkages.
[0256] As shown below, the ASOs reduced the amount of human SNCA mRNA in mice two weeks post injection.
Table U. Effect of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
IX. Efficacy of 3-2-10-2-3 LNA/MOE Gapmers (PS/PO)
[0257] Each ASO in Table V is a 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
[0258] As shown below, the ASOs reduced the amount of human SNCA mRNA in mice two weeks post injection.
Table V. Effect of 3-2-10-2-3 LNA/MOE Mixed Gapmers in hSNCA Mice
X. Tolerability of 2-3-10-3-2 BNA/MOE Gapmers (PS/PO)
[0259] Each ASO listed in Table W (aside from comparator SNCA_ASO_00033) is a 2- 3-10-3-2 BNA/MOE gapmer. FIG. 6 is a bar graph that compares the tolerability of select 2- 3-10-3-2 BNA/MOE gapmers. The gapmers are 20 nucleobases in length, wherein the
central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises two BNA nucleosides and three 2’-MOE nucleosides. Each ASO therefore comprises, from 5’ to 3’, two BNA nucleosides, three 2’-MOE nucleosides, 102’-deoxynucleosides, three T - MOE nucleosides, and two BNA nucleosides. All cytosines throughout each gapmer are 5- methyl cytosines, and all internucleoside linkages are phosphorothioate linkages except the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
Table W. Tolerability of 2-3-10-3-2 BNA/MOE Mixed Gapmers in hSNCA Mice
XI. Efficacy of 3-2-10-2-3 BNA/MOE Gapmers (PS/PO)
[0260] Each ASO listed in Table X (aside from comparator SNCA AS0 00033) is a 3- 2-10-2-3 BNA/MOE gapmer. FIG. 6 is a bar graph that compares the efficacy of select 2-3- 10-3-2 BNA/MOE gapmers. The gapmers are 20 nucleobases in length, wherein the central gap segment comprises ten 2’-deoxynucleosides and each wing segment comprises three BNA nucleosides and two 2’-MOE nucleosides. Each ASO therefore comprises, from 5’ to 3’, three BNA nucleosides, two 2’-MOE nucleosides, 102’-deoxynucleosides, two 2’-MOE nucleosides, and three BNA nucleosides. All cytosines throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioate linkages except for the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18, which are phosphodiester linkages.
[0261] As shown below, the ASOs significantly reduced the amount of human SNCA mRNA in mice as quickly as two weeks post injection. Table X. Effect of 2-3-10-3-2 BNA/MOE Mixed Gapmers in hSNCA Mice
Example 5: Tolerability, Efficacy and Biodistribution of Multiple Doses of Modified Oligonucleotides Complementary to Human SNCA in hSNCA Mice [0262] Three-month-old hSNCA mice received a single bolus ICV injection of a modified oligonucleotide listed at doses described in the indicated tables. hSNCA mice were divided into groups of six mice. A group of six mice received PBS as negative control for each experiment. For tolerability studies, the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour post-injection. [0263] For efficacy studies, mice were sacrificed four weeks post-injection, except figures followed by an asterisk wherein analyzes were two weeks post-injection. Cortical brain tissue was collected and the level of hSNCA mRNA was measured as described above and the level of alpha-synuclein protein was measured by ELISA kit as described above. Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha-synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
[0264] For biodistribution studies, the concentration of SNCA ASO in the cortex of hSNCA mice is quantified by High Performance Liquid Chromatography (HPLC) Fluorescence.
I. Tolerability and Efficacy of multiple dose of 2-3-10-3-2 BNA/MOE, 3-2-10- 2-3 LNA/MOE, and 5-10-5 MOE Gapmers (PS/PO)
[0265] SNC A_ASO_01613 in Table Y is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17-18 are phosphodiester internucleoside linkages, the other intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine. SNCA_ASO_01625 in Table Z is a 3-2-10-2-3 LNA/MOE gapmer as described above, in which the intemucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester intemucleoside linkages, the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages, and each cytosine is a 5-methyl cytosine.
SNC A_ASO_01617 (SEQ ID NO: 1264) in Table AA is a 5-10-5 MOE gapmer wherein the central gap segment comprises ten T deoxynucleosides and is flanked by wing segments on both 5’ and 3’ end comprising five 2’MOE nucleosides. In SNCA_ASO_01617, all cytosines residues throughout each gapmer are 5-methyl cytosines, and all intemucleoside linkages are phosphorothioates linkages except between 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 positions which are phosphodiester linkages. [0266] FIG. 7 is a bar graph that compares the efficacy of SNCA_ASO_1613,
SNCA_ASO_1617 and SNCA_ASO_1625 based on the expression of SNCA mRNA at different doses of 1, 5, 10, 30 or 100 nmol. FIG. 8 is a bar graph that compares the efficacy of SNCA_ASO_1613, SNCA_ASO_1617 and SNCA_ASO_1625 based on the expression of alpha synuclein protein at different doses of 1, 5, 10, 30 or 100 nmol. Reductions in mRNA and protein levels were analyzed two weeks post injection.
Table Y. Tolerability and Efficacy of multiple dose of 2-3-10-3-2 BNA/MOE Mixed
Gapmers in hSNCA Mice
Table Z. Tolerability and Efficacy of multiple dose of 3-2-10-2-3 LNA/MOE Mixed
Gapmers in hSNCA Mice
Table AA. Tolerability and Efficacy of multiple dose of 5-10-5 MOE Gapmers in hSNCA Mice
II. Dose effect of ASO Concentration in the Cortex by ELISA analysis [0267] In Table AB, SNCA_ASO_01613 is a 2-3-10-3-2 BNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine; SNCA_ASO_01625 is a 3-2-10-2-3 LNA/MOE gapmer as described above, in which the internucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methyl cytosine; and SNCA ASO 01617 is a 5-10-5 MOE gapmer in which all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methyl cytosines as described above.
[0268] FIG. 9 is a dot graph that represents the amount of ASO quantified per mg of cortex by HPLC fluorescence after a single ICY injection of multiple doses.
Table AB. Dose effect of ASO Concentration in the Cortex of hSNCA mice
Example 6 : Tolerability of of Modified Oligonucleotides in Rat [0269] Male Winstar rats received a single intrathecal bolus injection of oligonucleotide at a dose of 2.5 mg. Sterile saline syringes and nuclease free centrifuge tubes were used to prepare dosing solutions. The tubes containing ASO powder were briefly centrifuged before adding aCSF solution, then re-centrifuged for 10 minutes to fully dissolve the ASO powder. The solution was vortexed for ~1 min, stored at 4°C and filtered with a 0.22pm filter until use.
[0270] For tolerability studies, the tolerability score is represented as the Functional Observational Battery (FOB) score at one-hour, three-hour and twenty-four hours post injection.
[0271] In Table AC, the tolerability profile of SNCA_ASO_01617 and SNCA ASO 01613 is compared in rat at a dosage of 2.5 mg as a function of time.
Table AC. Tolerability Scoring Analysis in Rats
Example 7 : Duration of Action on Multiple Doses of Modified Oligonucleotides in hSNCA Mice
[0272] Three-month-old hSNCA mice, divided into groups of five to six mice each, received a single unilateral bolus injection of oligonucleotide SNCA AS0 1613 or SNCA_ASO_1617 at two doses of 10 and 50 nmol described in Table AD below. A group of three mice received PBS as a negative control for each experiment.
[0273] For efficacy studies, mice were sacrificed at different timepoint (2-6-12-20 weeks) post-injection. Cortical, cerebellum and striatum brain tissue were collected and the level of hSNCA mRNA was measured by qRT-PCR as described above and the level of alpha synuclein protein was measured by ELISA kit as described above. Results are presented in the tables as percent reduction of the amount of SNCA mRNA and alpha synuclein protein relative to vehicle (PBS) control groups. A value of 0% reduction indicates that the compound had no effect.
[0274] FIG. 11 is a dot graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the cortex based on SNCA mRNA expression quantified by qRT-PCR as described above.
[0275] FIG. 12 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA ASO 01613 at the dose of lOnmol and 50 nmol in the cerebellum based on SNCA mRNA expression quantified by qRT-PCR as described above.
[0276] FIG. 13 is a dot graph a dots graph that compares the SNCA-ASO-01617 and SNCA_ASO_01613 at the dose of lOnmol and 50 nmol in the striatum based on SNCA mRNA expression quantified by qRT-PCR as described above.
Table AD. PK/PD analysis at different timepoint in hSNCA mice
Example 8: In vitro Alpha-synuclein Pathology Reduction
[0277] At DIVO, primary neuronal culture (35000 cells per well) from hSNCA A53T mice as described above were cultured and then were transfected with 200 nM of human alpha-synuclein preformed fibrils (PFFs, from StressMarq Bioscience SPR-316) at seven days post primary neuronal culture (DIV7) and were treated with 6, 20, 60, 200 or 170 nM of SNC A_ASO_01613 or SNCA_ASO_01617 at four (DIV4), seven (DIV7) or ten (DIVIO) days post primary neuronal culture as illustrated in the diagram FIG.14. A control with an unspecific (Malatl) ASOs was used. After 19 days post primary neuronal culture (DIV19), cells were lysed and the alpha-synuclein pathology was analyzed by measuring the level of the phosphorylated form (pS129) of alpha-synuclein with a commercial immunoassay kit (Cisbio, #6FSYNPEG) according to the manufacturer’s instructions. This assay is based on a sandwich assay with two different specific antibodies, one binding the pS129 motif of alpha- synuclein and the other recognizing the alpha-synuclein protein, labelled with a donor or an acceptor dye. Their specific binding and close proximity on the phosphorylated alpha- synuclein produces a FRET (Fluorescence Resonance Energy Transfer) signal proportional to the protein level.
[0278] FIG. 15 is a bar graph that represents the level of alpha-synuclein pathology (phosphorylated form) in primary neuronal culture measuring by a TR-FRET based immunoassay. The level of phosphorylated alpha-synuclein was normalized by the level of alpha-tubulin and values were related to wells treated with vehicle (PBS). Seeded neurons were treated at DIV7 with a high dose (330nM) of specific ASOs (SNCA) or an unspecific ASO (Malatl) as described in Table AE below.
Table AE. Levels of Phosphorylated Alpha-Synuclein in Primary Neurons
[0279] FIG. 16 is a bar graph that represents the level of alpha-synuclein pathology
(phosphorylated form) in primary neuronal culture measuring by a TR-FRET based immunoassay, the mean±SEM. The level of phosphorylated alpha-synuclein was normalized by the level of alpha-tubulin and values were related to wells treated with vehicle (PBS). Dose-response effect were evaluated in seeded neurons treated with specific ASO at four, seven or ten days as described in Table AF.
Table AF. Levels of Phosphorylated Alpha-Synuclein in Primary Neurons
Claims
1. An oligonucleotide comprising a nucleotide sequence of 15 to 30 contiguous nucleotides, wherein the nucleotide sequence is complementary to a region of the same length found in nucleotides a) 16350-16450, b) 18926-19030, c) 22250-22471, d) 22933-23079, e) 23408-23700, f) 29753-29819, g) 38128-38158, h) 39852-39906, i) 53762-53799, or j) 59754-59865 of SEQ ID NO: 1, optionally wherein the nucleotide sequence comprises no more than 3 mismatches to said region.
2. The oligonucleotide of claim 1, wherein the nucleotide sequence is 16 to 20 contiguous nucleotides in length.
3. The oligonucleotide of claim 1 or 2, wherein the nucleotide sequence comprises 0, 1, or 2 mismatches to said region.
4. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is single-stranded.
5. The oligonucleotide of any one of the preceding claims, wherein the nucleotide sequence is selected from SEQ ID NOs: 18-40.
6. The oligonucleotide of any one of the preceding claims, comprising one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
7. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises one or more modified nucleotides.
8. The oligonucleotide of any one of the preceding claims, wherein the one or more modified nucleotides comprise a T -O-m ethoxy ethyl (2’ -MOE) nucleotide, a locked nucleic acid (LNA) nucleotide, a bridged nucleic acid (BNA) nucleotide, or any combination thereof.
9. The oligonucleotide of any one of the preceding claims, wherein all cytosines in the oligonucleotide are 5-methyl cytosines.
10. The oligonucleotide of any one of the preceding claims, comprising at least 1, 2, 3, 4, or 5 phosphodiester intemucleoside linkages.
11. The oligonucleotide of any one of the preceding claims, wherein at least 1, 2, 3, 4, or 5, or all intemucleoside linkages are phosphorothioate intemucleoside linkages.
12. The oligonucleotide of any one of claims 7-11, wherein the oligonucleotide comprises: i) a 5-10-5 MOE gapmer; ii) a 4-10-4 MOE gapmer; iii) a 3-10-3 LNA gapmer; iv) a 3 - 11 -3 LNA gapmer; v) a 3-2-10-2-3 LNA/MOE gapmer; vi) a 2-3 -10-3-2 BNA/MOE gapmer; vii) a 3-2-10-2-3 BNA/MOE gapmer; or viii) a 2-3-10-3-2 LNA/MOE gapmer.
13. The oligonucleotide of claim 12, wherein the oligonucleotide comprises: i) a 3-2-10-2-3 LNA/MOE gapmer; ii) a 2-3 -10-3-2 BNA/MOE gapmer; iii) a 3-2-10-2-3 BNA/MOE gapmer; or iv) a 2-3-10-3-2 LNA/MOE gapmer; and wherein the intemucleoside linkages between nucleosides v) 2 and 3, 4 and 5, 16 and 17, and 18 and 19;
vi) 2 and 3, 4 and 5, and 16 and 17; vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 17 and 18; or viii) 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages; and the remainder of the internucleoside linkages are phosphorothioate internucleoside linkages.
14. An oligonucleotide comprising the following formula: i) Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 34), ii) Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 20), iii) Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls A1 (SEQ ID NO: 33), iv) Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (SEQ ID NO: 19), v) Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (SEQ ID NO: 18), vi) mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (SEQ ID NO: 21), vii) Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (SEQ ID NO: 22), viii) Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab (SEQ ID NO: 23), ix) mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (SEQ ID NO: 24), x) Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 25), xi) mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb (SEQ ID NO: 26), xii) Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (SEQ ID NO: 27), xiii) Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (SEQ ID NO: 28),
xiv) Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (SEQ ID NO: 29), xv) Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (SEQ ID NO: 30), xvi) Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (SEQ ID NO: 31), xvii) Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (SEQ ID NO: 32), xviii) mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls T1 (SEQ ID NO: 35), xix) Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (SEQ ID NO: 36), xx) Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls A1 (SEQ ID NO: 37), xxi) mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls A1 (SEQ ID NO: 38), xxii) Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls T1 (SEQ ID NO: 39), xxiii) mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl (SEQ ID NO: 40), xxiv) Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (SEQ ID NO: 41), xxv) Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (SEQ ID NO: 42), xxvi) Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls T1 (SEQ ID NO: 43), xxvii) Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als A1 (SEQ ID NO: 44), xxviii) Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als A1 (SEQ ID NO: 45), wherein
A is adenine, mC is a 5 -methyl cytosine,
G is guanine,
T is thymine, e is a 2’-MOE modified ribose, d is a 2’-deoxyribose, b is a BNA,
1 is an LNA, o is a phosphodiester internucleoside linkage, and s is a phosphorothioate internucleoside linkage.
15. An oligonucleotide comprising the structural formula:
16. An oligonucleotide comprising the structural formula:
17. An oligonucleotide comprising the structural formula:
18. An oligonucleotide comprising the structural formula:
19. An oligonucleotide conjugate comprising the oligonucleotide of any one of the preceding claims.
20. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1- 18 or the oligonucleotide conjugate of claim 19, and a pharmaceutically acceptable excipient.
21. A method of reducing alpha-synuclein expression in a mammalian cell, comprising contacting the cell with the oligonucleotide of any one of claims 1-18, the oligonucleotide conjugate of claim 19, or the pharmaceutical composition of claim 20, thereby reducing alpha-synuclein expression in the cell.
22. The method of claim 21, wherein the cell is a cell in the central nervous system, optionally a cell in the human brain.
23. A method for treating a synucleinopathy in a subject in need thereof, comprising administering a therapeutically effective amount of the oligonucleotide of any one of claims 1-18, the oligonucleotide conjugate of claim 19, or the pharmaceutical composition of claim 20 to the subject.
24. The method of any one of claims 21-23, wherein the oligonucleotide reduces SNCA mRNA levels by at least 25, 50, 75, or 80% in murine primary cortical neurons engineered to express human alpha-synuclein.
25. The method of claim 23 or 24, wherein the oligonucleotide is injected intrathecally or intracranially to the subject.
26. Use of the oligonucleotide of any one of claims 1-18 or the oligonucleotide conjugate of claim 19 for the manufacture of a medicament in treating a synucleinopathy in a subject in need thereof in the method of any one of claims 23-25.
27. The oligonucleotide of any one of claims 1-18, the oligonucleotide conjugate of claim 19, or the pharmaceutical composition of claim 20 for use in treating a synucleinopathy in a subject in need thereof in the method of any one of claims 23-25.
28. The method, use, oligonucleotide for use, oligonucleotide conjugate for use, or pharmaceutical composition for use of any one of claims 23-27, wherein the synucleinopathy is Parkinson’s disease, Lewy body dementia, Alzheimer’s disease, or multiple system atrophy.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21315033 | 2021-03-08 | ||
| EP21306123 | 2021-08-17 | ||
| PCT/EP2022/055770 WO2022189363A1 (en) | 2021-03-08 | 2022-03-07 | Antisense oligonucleotides for inhibiting alpha-synuclein expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4305168A1 true EP4305168A1 (en) | 2024-01-17 |
Family
ID=80738805
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22710115.1A Pending EP4305168A1 (en) | 2021-03-08 | 2022-03-07 | Antisense oligonucleotides for inhibiting alpha-synuclein expression |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP4305168A1 (en) |
| JP (1) | JP2024508956A (en) |
| AU (1) | AU2022234522A1 (en) |
| CA (1) | CA3212650A1 (en) |
| CL (1) | CL2023002644A1 (en) |
| IL (1) | IL305668A (en) |
| MX (1) | MX2023010535A (en) |
| PE (1) | PE20240696A1 (en) |
| TW (1) | TW202305132A (en) |
| WO (1) | WO2022189363A1 (en) |
Family Cites Families (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0724447B1 (en) | 1991-10-24 | 2003-05-07 | Isis Pharmaceuticals, Inc. | Derivatized oligonucleotides having improved uptake |
| EP3561060A1 (en) * | 2010-02-08 | 2019-10-30 | Ionis Pharmaceuticals, Inc. | Selective reduction of allelic variants |
| WO2012068405A2 (en) * | 2010-11-17 | 2012-05-24 | Isis Pharmaceuticals, Inc. | Modulation of alpha synuclein expression |
| EP3067421B1 (en) * | 2011-02-08 | 2018-10-10 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| EP3640332A1 (en) | 2011-08-29 | 2020-04-22 | Ionis Pharmaceuticals, Inc. | Oligomer-conjugate complexes and their use |
| EP2839006B1 (en) * | 2012-04-20 | 2018-01-03 | Ionis Pharmaceuticals, Inc. | Oligomeric compounds comprising bicyclic nucleotides and uses thereof |
| SG10201804331TA (en) | 2012-11-15 | 2018-07-30 | Roche Innovation Ct Copenhagen As | Oligonucleotide conjugates |
| CA2921162A1 (en) | 2013-05-01 | 2014-11-06 | Ionis Pharmaceuticals, Inc. | Conjugated antisense compounds and their use |
| AU2014300981B2 (en) | 2013-06-27 | 2017-08-10 | Ricc A/S | Antisense oligomers and conjugates targeting PCSK9 |
| WO2017015575A1 (en) | 2015-07-22 | 2017-01-26 | Wave Life Sciences Ltd. | Oligonucleotide compositions and methods thereof |
| EP3585807A1 (en) * | 2017-02-22 | 2020-01-01 | CRISPR Therapeutics AG | Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders |
| TWI809004B (en) * | 2017-11-09 | 2023-07-21 | 美商Ionis製藥公司 | Compounds and methods for reducing snca expression |
| US12241065B2 (en) * | 2018-01-12 | 2025-03-04 | Bristol-Myers Squibb Company | Antisense oligonucleotides targeting alpha-synuclein and uses thereof |
| MA51634A (en) * | 2018-01-12 | 2020-11-18 | Roche Innovation Ct Copenhagen As | ALPHA-SYNUCLEIN ANTISENS OLIGONUCLEOTIDES AND THEIR USES |
| WO2020227395A2 (en) | 2019-05-06 | 2020-11-12 | University Of Massachusetts | Anti-c9orf72 oligonucleotides and related methods |
-
2022
- 2022-03-07 PE PE2023002509A patent/PE20240696A1/en unknown
- 2022-03-07 TW TW111108274A patent/TW202305132A/en unknown
- 2022-03-07 CA CA3212650A patent/CA3212650A1/en active Pending
- 2022-03-07 MX MX2023010535A patent/MX2023010535A/en unknown
- 2022-03-07 WO PCT/EP2022/055770 patent/WO2022189363A1/en not_active Ceased
- 2022-03-07 IL IL305668A patent/IL305668A/en unknown
- 2022-03-07 JP JP2023554365A patent/JP2024508956A/en active Pending
- 2022-03-07 AU AU2022234522A patent/AU2022234522A1/en not_active Abandoned
- 2022-03-07 EP EP22710115.1A patent/EP4305168A1/en active Pending
-
2023
- 2023-09-05 CL CL2023002644A patent/CL2023002644A1/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| AU2022234522A1 (en) | 2023-10-26 |
| PE20240696A1 (en) | 2024-04-10 |
| IL305668A (en) | 2023-11-01 |
| WO2022189363A1 (en) | 2022-09-15 |
| TW202305132A (en) | 2023-02-01 |
| CL2023002644A1 (en) | 2024-04-01 |
| CA3212650A1 (en) | 2022-09-15 |
| JP2024508956A (en) | 2024-02-28 |
| MX2023010535A (en) | 2023-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7354342B2 (en) | Compositions for modulating tau expression | |
| US20220411796A1 (en) | Compositions and methods for decreasing tau expression | |
| JP6983343B2 (en) | Antisense-oligonucleotide as a TGF-R signaling inhibitor | |
| AU2012305053B2 (en) | Antisense oligonucleotides for the treatment of Leber congenital amaurosis | |
| CA3234887A1 (en) | Extra-hepatic delivery irna compositions and methods of use thereof | |
| WO2012138487A2 (en) | Oligonucleotide modulation of splicing | |
| TW202012624A (en) | Oligonucleotides used to regulate ATXN2 expression | |
| JP6987041B2 (en) | Modified antisense oligomers for exon inclusion in spinal muscular atrophy | |
| US11655472B2 (en) | Antisense nucleic acid that induces skipping of exon 50 | |
| AU2022234522A1 (en) | Antisense oligonucleotides for inhibiting alpha-synuclein expression | |
| HK40107645A (en) | Antisense oligonucleotides for inhibiting alpha-synuclein expression | |
| CN117280032A (en) | Antisense oligonucleotides that inhibit alpha-synuclein expression | |
| TWI923029B (en) | Oligonucleotides for modulating kcnt1 expression | |
| TW202515583A (en) | Oligonucleotides for modulating kcnt1 expression | |
| WO2024187102A2 (en) | Compositions and methods for modulating c3 | |
| JP2026508023A (en) | Compositions and methods for modulating SPTLC1 | |
| JPWO2005074988A1 (en) | Neuronal differentiation inducer | |
| WO2025151407A1 (en) | Compositions and methods for modulating alpha-synuclein expression | |
| WO2025077916A1 (en) | Transthyretin-targeting oligonucleotide and use thereof | |
| HK40112391A (en) | Antisense oligonucleotides for modulating tmem106b expression | |
| CN120648679A (en) | Polynucleotide molecules inhibiting DMPK expression and uses thereof | |
| EA052416B1 (en) | mRNA Compositions for Extrahepatic Delivery and Methods of Their Use | |
| KR20220139366A (en) | Antisense oligonucleotides and their use for the treatment of Pendrid's syndrome | |
| US20140275207A1 (en) | Antisense compounds and methods of use thereof | |
| CN121285632A (en) | Formulations for oligonucleotide delivery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20231004 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |