CN117280032A - Antisense oligonucleotides for inhibiting expression of alpha-synuclein - Google Patents

Antisense oligonucleotides for inhibiting expression of alpha-synuclein Download PDF

Info

Publication number
CN117280032A
CN117280032A CN202280033253.1A CN202280033253A CN117280032A CN 117280032 A CN117280032 A CN 117280032A CN 202280033253 A CN202280033253 A CN 202280033253A CN 117280032 A CN117280032 A CN 117280032A
Authority
CN
China
Prior art keywords
mcds
ads
tds
oligonucleotide
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202280033253.1A
Other languages
Chinese (zh)
Inventor
H·特兰
B·尚里翁
S·洛菲
G·达斯多雷斯
T·多瓦尔
R·吉格纳德
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Laboratoires Servier SAS
Original Assignee
Laboratoires Servier SAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Laboratoires Servier SAS filed Critical Laboratoires Servier SAS
Priority claimed from PCT/EP2022/055770 external-priority patent/WO2022189363A1/en
Publication of CN117280032A publication Critical patent/CN117280032A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/50—Methods for regulating/modulating their activity
    • C12N2320/53—Methods for regulating/modulating their activity reducing unwanted side-effects

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present disclosure provides antisense oligonucleotides for modulating α -synuclein expression and their use in treating synucleinopathies.

Description

Antisense oligonucleotides for inhibiting expression of alpha-synuclein
Sequence listing
The present application contains a sequence listing that has been electronically submitted in ASCII format and is incorporated by reference herein in its entirety. The ASCII copy created at 3 and 6 of 2021 is named 027628_wo002_slfinal. Txt and is 718553 bits in size.
Background
Alpha-synuclein is a protein encoded by the SNCA gene that is expressed predominantly in the central nervous system, including neocortex, hippocampus, substantia nigra, thalamus, and cerebellum. In neurons, α -synuclein expression is localized at the presynaptic terminal, and this protein is thought to be a chaperone protein involved in SNARE complex assembly and function. At least three different isoforms of alpha-synuclein are known, which result from alternative splicing of SNCA gene transcripts. Alpha-synuclein may be involved in regulating many different neuronal functions and properties, including synaptic transmission, synaptic vesicle density and neuronal plasticity.
In some cases, the α -synuclein aggregates and forms insoluble fibrils. The α -synuclein aggregates are thought to be involved in the pathology of many different neurological diseases including parkinson's disease, lewy body dementia, alzheimer's disease and multiple system atrophy. Pathogenic roles of alpha-synuclein in disease progression have been genetically verified. For example, missense mutations in the SNCA gene lead to rare familial parkinson's disease. Wild-type gene repeats or three repeats may also cause rare cases of parkinson's disease, and it has been shown that wild-type α -synuclein overexpression alone is sufficient to cause disease.
Diseases caused by misfolding or aggregation of alpha-synuclein are collectively referred to as synucleinopathies. Multiple System Atrophy (MSA) is a rapidly progressing clinical synucleinopathy that arises from misfolding and accumulation of α -synuclein, resulting in the formation of glial cytoplasmic inclusion bodies (GCIs) in oligodendrocytes. GCI is widely distributed in the nervous system of MSA patients, but some areas, including basal ganglia, cerebellum, brain bridge, and spinal cord, are more affected than others. At the microscopic level, neuropathological features of MSA include moderate gliosis, myelin deficiency, and neuronal loss and axonal degeneration within the striatal substantia nigra system and the olivary pontine cerebellum system.
The α -synuclein can exist in several different forms in tissues, including as a monomer, oligomer, or fibril complex (fibrillary complex), and can be phosphorylated. It is currently unknown which of these protein classes are causative in synucleinopathies. It is therefore difficult to know which form of the protein to target to develop a drug for treating synucleinopathies at the protein level.
There is currently a lack of acceptable treatment options for synucleinopathy. Thus, there remains a need for compounds, methods, and pharmaceutical compositions for treating these diseases.
Summary of The Invention
The present disclosure provides antisense oligonucleotides (ASOs) that reduce the abundance or activity of RNA transcribed from the SNCA gene. By reducing SNCA RNA levels, compounds of the present disclosure reduce the abundance of α -synuclein in cells. The ASOs described herein thus reduce α -synuclein, its accumulation and aggregation, which may alleviate symptoms and/or delay disease progression.
In some aspects, the disclosure provides an oligonucleotide comprising a nucleotide sequence of 15 to 30 (e.g., 16 to 20) consecutive nucleotides, wherein the nucleotide sequence is complementary to a region of equal length present in the following nucleotides of SEQ ID NO: 1:
a)16350-16450，
b)18926-19030，
c)22250-22471，
d)22933-23079，
e)23408-23700，
f)29753-29819，
g)38128-38158，
h)39852-39906，
i) 53762-53799, or
j) 59754-59865. In certain embodiments, the nucleotide sequence comprises no more than 3 mismatches to the region. For example, the nucleotide sequence may contain 0, 1 or 2 mismatches with respect to the region. In a specific embodiment, the nucleotide sequence is single stranded. The nucleotide sequence may be selected from, for example, SEQ ID NOS.18-40.
In some embodiments, the oligonucleotides described herein may comprise one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
In some embodiments, an oligonucleotide described herein may comprise one or more modified nucleotides. Such modified nucleotides may comprise, for example, 2 '-O-methoxyethyl (2' -MOE) nucleotides, locked Nucleic Acid (LNA) nucleotides, bridged Nucleic Acid (BNA) nucleotides, or any combination thereof.
In some embodiments, all cytosines in an oligonucleotide described herein are 5-methylcytosines.
In some embodiments, the oligonucleotides described herein may comprise phosphodiester internucleoside linkages and/or phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide may comprise at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages. In certain embodiments, at least 1, 2, 3, 4, or 5 or all of the internucleoside linkages in the oligonucleotide are phosphorothioate internucleoside linkages.
In some embodiments, an oligonucleotide described herein comprises:
i)5-10-5 MOE gapmer；
ii)4-10-4 MOE gapmer；
iii)3-10-3 LNA gapmer；
iv)3-11-3 LNA gapmer；
v)3-2-10-2-3 LNA/MOE gapmer；
vi)2-3-10-3-2 BNA/MOE gapmer；
vii) 3-2-10-2-3 BNA/MOE gapmer; or (b)
viii)2-3-10-3-2 LNA/MOE gapmer。
In certain embodiments, the oligonucleotide comprises:
i)3-2-10-2-3 LNA/MOE gapmer；
ii)2-3-10-3-2 BNA/MOE gapmer；
iii) 3-2-10-2-3 BNA/MOE gapmer; or (b)
iv)2-3-10-3-2 LNA/MOE gapmer；
Wherein the internucleoside linkage between the following nucleosides is a phosphodiester internucleoside linkage;
v) 2 and 3, 4 and 5, 16 and 17 and 18 and 19;
vi) 2 and 3, 4 and 5, and 16 and 17;
vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 18; or (b)
viii) 3 and 4, 4 and 5, 16 and 17 and 18
And the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
In certain embodiments, the oligonucleotides described herein comprise the following formula:
i)Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl(SEQ ID NO:34)，
ii)Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb(SEQ ID NO:20)，
iii)Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls Al(SEQ ID NO:33)，
iv)Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab(SEQ ID NO:19)，
v)Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb(SEQ ID NO:18)，
vi)mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb(SEQ ID NO:21)，
vii)Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb(SEQ ID NO:22)，
viii)Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab(SEQ ID NO:23)，
ix)mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab(SEQ ID NO:24)，
x)Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb(SEQ ID NO:25)，
xi)mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb(SEQ ID NO:26)，
xii)Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb(SEQ ID NO:27)，
xiii)Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb(SEQ ID NO:28)，
xiv)Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb(SEQ ID NO:29)，
xv)Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab(SEQ ID NO:30)，
xvi)Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab(SEQ ID NO:31)，
xvii)Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl(SEQ ID NO:32)，
xviii)mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls Tl(SEQ ID NO:35)，
xix)Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl(SEQ ID NO:36)，
xx)Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls Al(SEQ ID NO:37)，
xxi)mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls Al(SEQ ID NO:38)，
xxii)Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls Tl(SEQ ID NO:39)，
xxiii)mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl(SEQ ID NO:40)，
xxiv)Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl(SEQ ID NO:41)，
xxv)Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl(SEQ ID NO:42)，
xxvi)Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls Tl(SEQ ID NO:43)，
xxvii)Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als Al(SEQ ID NO:44)，
xxviii)Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als Al(SEQ ID NO:45)，
wherein A is adenine,
mC is 5-methylcytosine and,
g is a guanine group and the group is a guanine,
t is thymine and the T is thymine,
e is a ribose modified with a 2' -MOE,
d is 2 '-deoxyribose, and the amino acid is a 2' -deoxyribose,
b is a BNA and is preferably selected from the group consisting of BNA,
l is the number of the LNA,
o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
In some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula:
in some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula:
in some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula:
in some embodiments, the disclosure provides an oligonucleotide comprising the following structural formula:
the present disclosure also provides oligonucleotide conjugates comprising the oligonucleotides described herein.
In some aspects, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide as described herein or an oligonucleotide conjugate as described herein and a pharmaceutically acceptable excipient.
Also provided is a method of reducing alpha-synuclein expression in a mammalian cell, the method comprising contacting the cell with an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein, thereby reducing alpha-synuclein expression in the cell. In some embodiments, the cell is a central nervous system cell, such as a cell in the human brain. In some embodiments, the present disclosure provides a method of treating a synucleinopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an oligonucleotide, oligonucleotide conjugate, or pharmaceutical composition described herein. In certain embodiments, the synucleinopathy is parkinson's disease, dementia with lewy bodies, alzheimer's disease, or multiple system atrophy. The oligonucleotides may be injected into the subject, for example intrathecally or intracranially. In certain embodiments, the oligonucleotide reduces SNCA mRNA levels in murine primary cortical neurons engineered to express human α -synuclein by at least 25, 50, 75, or 80%.
It will be appreciated that any of the oligonucleotides, oligonucleotide conjugates and pharmaceutical compositions described herein may be used in any method of treatment as described herein, in any treatment as described herein, and/or in the manufacture of a medicament for use in any treatment as described herein.
Other features, objects, and advantages of the invention will be apparent from the detailed description of the invention that follows. It should be understood, however, that the detailed description, while indicating embodiments and aspects of the invention, is given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.
Brief Description of Drawings
FIG. 1 is a graph illustrating the results in a hSNCA mouse model (hSNCA +/+ ) Schematic of the knock-in of the human SNCA gene at the endogenous mouse SNCA locus.
FIG. 2A is a graph showing that the sequence is derived from hSNCA +/+ (n＝5)、hSNCA +/- (n=5) and hsneca -/- (n=2) histogram of quantification of human α -synuclein (hsneca protein) in cortical tissue of march-old mice. The levels of alpha-synuclein were assessed by mass spectrometry and normalized to the levels of GADPH protein.
FIG. 2B is a graph showing the results in hSNCA +/+ (n＝5)、hSNCA +/- (n=5) and hsneca -/- (n=2) histogram of quantitative murine α -synuclein (msneca protein) in cortex of march-old mice. The levels of alpha-synuclein were assessed by mass spectrometry and normalized to the levels of GADPH protein.
FIG. 2C is a graph showing the age of three months hSNCA +/+ Histogram of human α -synuclein (hsnoca protein) levels in different brain regions (cortex, cerebellum, hippocampus, striatum, spinal cord) and peripheral organs (liver, spleen, kidney) of mice (n=5). The level of alpha synuclein was assessed by mass spectrometry and normalized to the level of GADPH protein.
FIG. 3 is a table showing the tolerability assessment system of mice used in the in vivo assays described herein.
Fig. 4 is a bar graph showing the efficacy and tolerability of a given ASO in mice. The left Y-axis and filled bars describe the expression levels of SNCA mRNA expressed in vivo in mouse neurons two weeks after treatment with a given ASO relative to PBS-treated samples. The right Y-axis and black circles describe the absolute scores of the functional observations set (Functional Observational Battery, FOB) observed in mice one hour after treatment with a given ASO.
FIG. 5 is a bar graph showing the efficacy and tolerability of the 3LNA-2MOE-10DNA-2MOE-3LNA gapmers ASO given. The axes are as described in fig. 4.
FIG. 6 is a bar graph showing the efficacy and tolerability of the 2BNA-3MOE-10DNA-3MOE-2BNA gapmers ASO given. The axes are as described in fig. 4.
Fig. 7 is a bar graph showing the efficacy of snca_aso_1613, snca_aso_1617 and snca_aso_1625 at doses 1, 5, 10, 30 and 100 nmol. The left Y-axis and solid line depict the expression levels of SNCA mRNA expressed in mouse neurons in vivo four weeks after treatment with a given ASO relative to PBS-treated samples.
Fig. 8 is a bar graph showing the efficacy of snca_aso_1613, snca_aso_1617 and snca_aso_1625 at doses 1, 5, 10, 30 and 100 nmol. The left Y-axis and filled bars depict the expression levels of alpha synuclein expressed in mouse neurons four weeks after treatment with a given ASO relative to PBS-treated samples.
Fig. 9 is a plot showing the concentration of snca_aso_1613, snca_aso_1617 and snca_aso_1625 quantified according to HPLC fluorescence in cortical homogenates four weeks after a single injection of 1, 5, 10, 30 and 100nmol ASO.
FIG. 10 is a table showing the tolerability assessment system for rats used in the in vivo assays described herein.
FIG. 11 is a plot of SNCA mRNA expression quantified based on qRT-PCR comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the cortex.
FIG. 12 is a plot of SNCA mRNA expression quantified based on qRT-PCR comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the cerebellum.
FIG. 13 is a plot of SNCA mRNA expression quantified based on qRT-PCR as described above comparing SNCA_ASO_01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the striatum.
Fig. 14 is a diagram showing an experimental protocol for measuring alpha-synuclein lesions in ASO-treated neuronal cultures.
Fig. 15 is a bar graph showing the levels of α -synucleinopathy (phosphorylated form) in primary neuronal cultures treated with snca_aso_01613, snca_aso_01617 and non-targeted control Malat1_aso and measured using a TR-FRET based immunoassay.
Fig. 16 is a bar graph (mean ± SEM) showing the levels of α -synucleinopathy (phosphorylated form) in primary neuronal cultures measured with snca_aso_01613 treatment and using TR-FRET based immunoassays before, during and after PFF treatment. PFF: human alpha-synuclein preformed fibrils.
Detailed Description
The present disclosure is based on the discovery that: antisense oligonucleotides (ASOs) targeting RNA transcribed from the SNCA gene can be effective to reduce the abundance of a target SNCA gene transcript and/or the translation of an a-synuclein polypeptide from the transcript. ASOs of the present disclosure comprise sequences that are complementary to SNCA transcripts and bind to nucleotide sequences defined internally to these transcripts.
By reducing the level or translational activity of SNCA target transcripts in cells, ASOs mediate reduced expression and accumulation of α -synuclein in cells, thereby alleviating the severity or progression of neurodegenerative disease. ASOs of the present disclosure are expected to be particularly useful for treating synucleinopathies caused by accumulation or aggregation of α -synuclein. Such proteins may be expressed in cells, for example, as monomers or oligomers, and may be phosphorylated or non-phosphorylated. Because it is unclear which of these α -synuclein species are causative in the disease, it has heretofore been difficult to develop effective therapeutic agents targeting α -synuclein expression or activity at the protein level. ASOs of the present disclosure are highly advantageous because they target α -synuclein expression at the SNCA transcript level and thus have the ability to reduce α -synuclein expression in all forms above.
I.SNCA gene and alpha-synuclein
ASOs of the present disclosure bind to transcripts of the SNCA gene encoding α -synuclein, also known as SNCA proteins. The SNCA gene is also known as the alpha-synuclein, NACP, non-aβ component of AD amyloid, PARK1, PARK4 or PDI gene. In some embodiments, an ASO described herein targets a transcript of a mammalian SNCA gene (e.g., a murine or human SNCA gene).
The sequence of the human SNCA gene is publicly available under GenBank accession No. nc_ 000004.12. The gene was 137980bps long and located at chromosome 4: 89700345..89838324 (SEQ ID NO: 2). A portion of the human genomic SNCA sequence is shown in SEQ ID NO. 1; and partial sequences of pre-mRNA transcripts can be found in GenBank accession number ng_011851.1 (residues 6001-8400). Mature mRNA transcripts are shown in SEQ ID NO. 3. In some embodiments, the ASO of the present disclosure is associated with a gene selected from chromosome 4: 89,700,345-89,838,315 (reverse strand) and those SNCA sequences according to GenBank accession nos. nm_000345.3, nt_016354.20TRUNC 30800000-30919000, JN709863.1, BC013293.2, nm_001146055.1, HQ830269.1 and nc_000004.12 (89724099.. 89838324, complementary) or transcripts thereof. In some embodiments, an ASO of the disclosure binds to an SNCA transcript encoding an α -synuclein as found according to Uniprot accession No. P37840, A8K2A4, Q13701, Q4JHI3, or Q6IAU6, for example. In certain embodiments, the ASOs of the present disclosure comprise sequences that may be at least 60, 70, 80, 85, 90, or 95% or 100% complementary to the equivalent length sequences in the target SNCA transcript.
In some embodiments, an ASO of the present disclosure can bind to a transcript of a wild-type SNCA gene (e.g., a human, non-human primate, or murine wild-type gene). In some embodiments, the ASOs of the present disclosure bind to variants (e.g., known variants) of the wild-type SNCA gene. Known variants include, for example, the human SNCA gene in a form in which a G209A substitution results in an a53T mutation in the alpha-synuclein encoded by the gene. Additional known variants have nucleotide mutations that produce mutant α -synuclein, wherein the mutant α -synuclein comprises a30P, E46K, H50Q and G51D amino acid substitutions. These substitutions may be present alone or in combination with other mutations. ASOs of the present disclosure may be designed to reduce or inhibit wild-type or variant SNCA transcript expression. In certain embodiments, an ASO described herein can reduce or inhibit expression of an SNCA transcript encoding an α -synuclein having one or more mutations selected from the group consisting of a30P, E46K, H50Q, G51D and a 53T.
The ASOs of the present disclosure comprise sequences complementary to equivalent length sequences in a target transcript encoded by the SNCA gene (wherein the genomic SNCA sequence may comprise, for example, SEQ ID NO: 1). In certain embodiments, an ASO described herein comprises a sequence complementary to a sequence in a hotspot region in a target SNCA nucleic acid. The term "hot spot region" refers to a region of a target nucleotide sequence in which complementary ASOs bind to sequences within the region often resulting in reduced abundance or translational activity of the target RNA transcript. The hot spot region may be entirely within an intron, entirely within an exon, or may span an intron/exon junction; or wholly or partially in the 5 'or 3' untranslated region (UTR) of RNA transcripts.
In some embodiments, an ASO described herein may comprise a sequence that binds to a target sequence within or overlapping any of several different hot spot regions of an SNCA gene transcript. Table a lists exemplary hot spots in human SNCA genes and identifies ASOs of the present disclosure designed to be complementary to these hot spots. The table also shows that minimal reduction of SNCA gene transcripts is observed in vitro when neurons from humanized SNCA knock-in mice are treated with selected ASOs targeting this hotspot (see, e.g., the section entitled "materials and methods for in vitro assays" below). Throughout this disclosure, compounds are interchangeably referred to as snca_aso_ [ compound number ] and as [ compound number ]. For example, compound number snca_aso_01608 and compound number 01608 represent the same antisense oligonucleotide compound. In certain embodiments, the binding of ASOs to sequences in the hotspot region described herein reduces SNCA RNA levels in the cell by at least 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or 100% (e.g., in an in vitro assay, as described below in the section entitled "materials and methods for in vitro assays"). In particular embodiments, an ASO of the present disclosure may be an ASO listed in table a, or an ASO having a sequence at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical thereto.
Table A antisense oligonucleotide targeted human SNCA Gene Hot spots
/>
II.Antisense oligonucleotides
The term "antisense oligonucleotide" or "ASO" refers to an oligonucleotide capable of hybridizing to a sequence in a target transcript. Those skilled in the art will appreciate that the ASOs described herein do not exist in nature (i.e., they are "isolated" ASOs).
The term "transcript" refers to any RNA transcribed from a gene (e.g., SNCA gene). The gene may be wild-type or may be in the form of a mutation or a variant (e.g., polymorphic) form. The RNA transcript may be a primary RNA transcript or a precursor messenger RNA (pre-mRNA) or a messenger RNA (mRNA), and may comprise exons, introns, 5 'utrs and 3' utrs. Unless otherwise indicated, the sequences of transcripts and ASOs provided herein refer to nucleotide sequences from the 5 'end (left) to the 3' end (right).
As used in this disclosure, the term "oligonucleotide" refers to a compound comprising a chain of about 5 to 100 nucleosides (e.g., 5 to 50 nucleosides, e.g., 8 to 30 nucleosides) linked by internucleoside linkages. Each nucleoside and internucleoside linkage of the oligonucleotides of the disclosure may be modified or unmodified from naturally occurring nucleotides and linkages. The modified oligonucleotide may comprise one or more modified sugar moieties, one or more modified nucleobases and/or one or more modified internucleoside linkages.
The ASOs described herein may comprise sequences that are substantially or completely complementary to sequences of equal length in the target transcript. Complete complementarity occurs when a first (modified or unmodified) continuous nucleotide strand and a second (modified or unmodified) continuous nucleotide strand are fully complementary to each other throughout the entire length of the shorter strand (or both strands if they are the same length). It is believed that the bases of the two strands pair more than 80% or more (e.g., 90% or more) with each other over the length of the shorter strand (or both strands if they are the same length), while the two strands are substantially complementary to each other when the base pairing mismatch is no more than 20% (e.g., no more than 10%) (e.g., no more than 4 or no more than 2 mismatched base pairing for a 20 nucleotide duplex). In some embodiments, the sequence in an ASO of the disclosure is 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% complementary to the target RNA transcript. In some embodiments, an ASO of the disclosure comprises no more than 1, 2, or 3 mismatches to its target sequence.
In the context of comparing two nucleotide sequences, the term "identical" or "identity" refers to the same nucleobase. The term "percent identity" in this case refers to the percentage of nucleobases that are identical when the correspondence is maximized, with the two comparison sequences (with gaps introduced as needed) being aligned over the length of the shorter comparison sequence (or the two sequences if the comparison sequences are identical in length).
In certain embodiments, reduced, inhibited, or eliminated expression or activity of the target transcript is observed as compared to a control sample not treated with ASO. In some embodiments, an ASO of the disclosure reduces the abundance and/or translational activity of a target SNCA transcript, e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%, in a treated sample compared to a control sample not exposed to the ASO. In some cases, ASO reduces the level of the percentage of target transcript in vivo, and administration of ASO optionally results in a tolerability score (functional observation set or FOB score) of less than 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 (e.g., 0). The terms "reduce" and "inhibit" do not necessarily mean to completely eliminate the total amount and/or activity of transcripts. In some embodiments, ASOs are considered active when they reduce the amount or activity of the target RNA by 25% or more in an in vitro assay. ASOs of the present disclosure can cause a detectable or quantifiable change in the level or activity of the α -synuclein encoded by the target RNA.
Without wishing to be bound by theory, it is believed that ASO can inhibit α -synuclein expression by recruiting the rnase H1 enzyme to the duplex formed between the ASO and the target SNCA transcript. The enzymes of the RNase H1 family are endonucleases that generally target RNA, DNA duplex and catalyze hydrolytic cleavage of RNA in the duplex.
In some embodiments, ASO has minimal off-target effects and does not hybridize to any non-SNCA transcript in a manner that results in a significant decrease in abundance or activity of the non-SNCA transcript.
A. Length of antisense oligonucleotide
In some embodiments, an ASO of the disclosure is between 8 and 30 nucleotides in length (e.g., 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length). In some embodiments, an ASO described herein can comprise a sequence complementary to an equal length SNCA transcript sequence, the sequence being any one of a series of nucleotide lengths having an upper limit of 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 and an independently selected lower limit of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
In certain embodiments, the complementary sequence in the ASO is between 16 and 20 nucleotides in length. In specific embodiments, the complementary sequences in an ASO are 16, 17, 18, or 20 nucleobases in length.
B. Modification of antisense oligonucleotides
In some embodiments, an ASO of the present disclosure may comprise one or more modifications, e.g., to increase binding affinity to a target transcript, to increase ASO stability (e.g., to increase resistance to, e.g., nuclease degradation), and/or to increase ease of ASO transport to a cell. Modifications may include any modifications known in the art, including, for example, terminal modifications, nucleobase modifications, sugar modifications or substitutions, and backbone modifications. Terminal modifications can include, for example, 5 'and/or 3' terminal modifications (e.g., phosphorylation, conjugation, DNA nucleotide and reverse linkage). The base modification may, for example, include substitution with a stable base, removal of a base, or conjugation of a base. Sugar modifications or substitutions may, for example, include modifications at the 2 'and/or 4' positions of the ribose moiety, or substitutions of ribose moieties. Backbone modifications or internucleoside linkage modifications may, for example, include modifications or substitutions of phosphodiester linkages, for example, with one or more phosphorothioates, phosphorodithioates, phosphotriesters (phosphonates), methyl and other alkylphosphonates, phosphinates (phosphonates) and phosphoramidates (phosphonamides).
In some embodiments, an ASO of the present disclosure may have one or more modified nucleosides. The term "nucleoside" refers to a compound comprising a nucleobase and a sugar moiety. Naturally occurring nucleosides include DNA nucleosides and RNA nucleosides. In non-naturally occurring nucleosides (also referred to as "modified nucleosides" or "nucleoside analogs"), the bases and/or sugars have been modified. The modification of a nucleoside may be "silent", in which case the modified nucleoside has the same or equivalent function in the context of an oligonucleotide as compared to a naturally occurring nucleoside. In other cases, the modified nucleoside may increase the efficacy of the ASO in reducing the abundance or activity of the target transcript. The term "efficacy" encompasses target binding to SNCA mRNA.
As used herein, the term "nucleotide" refers to a nucleoside covalently bound to one or more modified or unmodified internucleoside linkages. Exemplary nucleotides include monophosphates, diphosphate, triphosphate and phosphorothioate. As used herein, the term "nucleotide" encompasses both unmodified nucleotides (i.e., naturally occurring nucleotides) and modified nucleotides (i.e., nucleotide analogs). The term "nucleoside" encompasses both unmodified nucleosides (i.e., naturally occurring nucleosides) and modified nucleosides (i.e., nucleoside analogs); and the term "nucleobase" encompasses both unmodified nucleobases (i.e., naturally occurring nucleobases) and modified nucleobases (i.e., nucleobase analogs).
In some embodiments, the modified nucleoside comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine (5 mC) nucleobase, as shown in structure (I) below, wherein R represents a sugar moiety.
In some embodiments, the sugar moiety may be a modified or unmodified sugar moiety. As used herein, an unmodified sugar moiety refers to a 2' -OH (H) ribosyl moiety as found in naturally occurring RNAs, also referred to as an unmodified RNA sugar moiety. In some embodiments, the modified sugar moiety may be a 2' -H (H) deoxyribose sugar moiety. This moiety is naturally present in deoxyribonucleic acid and may be referred to as an unmodified DNA sugar moiety, or simply as a DNA sugar moiety. The structure of the 2' -deoxynucleoside sugar moiety is shown below in structure (II), wherein R represents a nucleobase, and each 5' -hydroxyl and 3' -hydroxyl of the sugar optionally participates in an internucleoside linkage.
In some embodiments, the modified sugar moiety may comprise an O-Methoxyethyl (MOE) moiety. In some embodiments, the O-methoxyethyl moiety is at the 2' position of the sugar, as shown in structure (III) below. R in the following structure represents a nucleobase. Each 5 '-hydroxyl and 3' -hydroxyl of the sugar optionally participates in an internucleoside linkage. 2'-MOE modified sugar or 2' -MOE modified nucleoside, or simply MOE sugar or nucleoside, is wherein ribose naturally occurring 2 'hydroxy with 2' OCH 2 CH 2 OCH 3 Ribose or nucleoside replaced by a base.
In some embodiments, the modified sugar moiety may comprise a Bridging Nucleic Acid (BNA) moiety. The bridging nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises 4' -CH 2 -NH-O-2' bond. The nitrogen of the bridging nucleic acid is optionally substituted (e.g., methylated, alkylated, or modified with phenyl). The structure (IV) of the BNA moiety is shown below, wherein R is a nucleobase, R ' is for example H, me or phenyl, and each 5' -hydroxy and 3' -hydroxy group of the sugar optionally participates in an internucleoside linkage. In the ASO of the present disclosure, R' is a Me group unless otherwise indicated. BNA-modified nucleosides, or simply BNA nucleosides, are nucleosides that comprise a BNA sugar moiety。
In some embodiments, the modified sugar moiety may comprise a Locked Nucleic Acid (LNA) moiety. The locked nucleic acid comprises a bicyclic sugar moiety. The sugar moiety comprises 4' -CH 2 -O-2' bond. The LNA section as described herein may be in the α -L configuration or the β -D configuration. In particular embodiments, the LNA portion of an ASO described herein is in the β -D configuration. The structure (V) of the LNA moiety is shown below, wherein R is a nucleobase and each 5 '-hydroxyl and 3' -hydroxyl of the sugar optionally participates in an internucleoside linkage. LNA modified nucleosides, or simply LNA nucleosides, are nucleosides that comprise an LNA sugar moiety.
In certain embodiments, the ASOs described herein can comprise one or more modified nucleotides known in the art, including, for example, 2' -O-methyl modified nucleotides, 2' -fluoro modified nucleotides, 2' -deoxy modified nucleotides, 2' -O-methoxyethyl modified nucleotides, modified nucleotides that allow for alternative internucleoside linkages (e.g., nucleotides comprising phosphorothioates, and phosphotriesters), modified nucleotides linked terminally to cholesterol derivatives or lipophilic moieties, peptide nucleic acids, deoxy or dideoxy modified inverted nucleotides, nucleotide abasic modifications, 2' -amino modified nucleotides, phosphoramidate (phosphoramidate) modified nucleotides, modified nucleotides comprising a modified nucleotide at a sugar or other position of the oligonucleotide, and modified nucleotides comprising a non-natural base.
In some embodiments, an ASO may include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) modified nucleosides. In certain embodiments, all nucleosides in an ASO are modified nucleosides. In other embodiments, less than 100% (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10%) of the nucleosides in the ASO are modified nucleosides.
ASOs of the present disclosure may comprise naturally occurring and/or non-naturally occurring internucleoside linkages. As used in this disclosure, the term "internucleoside linkage" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. The ASOs described herein may, in certain embodiments, comprise one or more modified nucleoside linkages known in the art, including, for example, phosphate esters, phosphotriesters, borophosphate esters (borophosphate), methylphosphonate esters, phosphoramidate esters, phosphorothioate esters, phosphorodithioate linkages, methylenemethylimino (-CH) 2 -N(CH 3 )-O-CH 2 (-), thiodiester, thiocarbamate (thiodicarbamate) (-O-C (=o) (NH) -S-), siloxane (-O-SiH) 2 -O-), dialkyl siloxane, N' -dimethylhydrazine (-CH) 2 -N(CH 3 )-N(CH 3 )-)、MMI(3'-CH 2 -N(CH 3 ) -O-5 '), amide-3 (3' -CH) 2 -C (=o) -N (H) -5 '), amide-4 (3' -CH) 2 -N (H) -C (=o) -5 '), amide-5 (3' -N (H) -C (=o) -CH 2 -5 '), amide-6 (3' -C (=o) -N (H) -CH 2 -5 '), methylal (3' -O-CH) 2 -O-5 '), methoxypropyl, thiomethylal (3' -S-CH) 2 -O-5'), carboxylic esters, carboxamides, sulfides, sulfonic esters or amide linkers. See, for example, carbohydrate Modifications in Antisense Research; y.s. sanghvi and p.d. cook, monograph ACS Symposium Series, 580; chapter 3 and 4, 40-65.
In certain embodiments, the ASOs described herein may comprise one or more modified nucleoside linkages known in the art, including, for example, phosphonoacetate (PACE, P (CR 'R') n COOR) or thiophosphonoacetate (thioppace, (S) -P (CR 'R') n COOR) internucleoside linkage, wherein n is an integer from 0 to 6 and R' and R "are each independently selected from H, alkyl and substituted alkyl. Examples of such internucleoside linkages include phosphonate, phosphonyl carboxylate, thiophosphonyl carboxylate, and thiophosphonyl carboxylate ester linkages, and are described in some embodiments in Yamada et al, j.am.chem.Soc.(2006)
128 (15) 5251-61, the contents of which are hereby incorporated by reference in their entirety.
In certain embodiments, the internucleoside linkage of the nucleotide may be a phosphate group or a phosphorothioate group. Methods for preparing phosphorus-containing internucleoside linkages are well known to those skilled in the art. In particular embodiments, the ASOs described herein may have phosphodiester internucleoside linkages, phosphorothioate internucleoside linkages, or combinations thereof. The term "phosphodiester internucleoside linkage" refers to an internucleoside linkage between two nucleosides formed from a phosphodiester group. The term "phosphorothioate internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of the phosphodiester internucleoside linkage is replaced by a sulfur atom.
In certain embodiments, the internucleoside linkages having chiral atoms can be prepared as a racemic mixture, or can be prepared as separate enantiomers. Representative internucleoside linkages having chiral centers include, but are not limited to, alkyl phosphonates and phosphorothioates. The disclosed ASOs comprising internucleoside linkages having one or more chiral centers may be prepared as a population of ASOs comprising stereorandom internucleoside linkages or as a population of ASOs comprising stereochemically deterministic internucleoside linkages.
In the present disclosure, the term "stereochemically deterministic internucleoside linkage" refers to an internucleoside linkage in which the stereochemical naming of the phosphorus atoms is controlled such that a specific amount of R p Or S p Internucleoside linkages are present in the ASO chain. Stereochemical naming of chiral bonds may be defined in terms of, for example, asymmetric synthesis. ASOs having at least one stereochemically deterministic internucleoside linkage may be referred to as stereochemically deterministic ASOs.
In some embodiments, the ASOs of the present disclosure are stereochemically fully defined. As used in this disclosure, the term "stereochemically complete deterministic ASO" refers to a compound having a defined chiral center (R p Or S p ) Is a sequence of ASO of (A). As used in this disclosure, the term "partially stereochemically deterministic ASO" refers to an ASO having a defined hand in at least one, but not all, internucleoside linkages Sex center (R) p Or S p ) Is a sequence of ASO of (A). Thus, in addition to at least one stereochemically deterministic bond, a stereochemically locally deterministic ASO may also contain bonds that are achiral or non-stereochemically deterministic.
In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides comprising one or more specific phosphorothioate internucleoside linkages in a specific stereochemical configuration. In certain embodiments, a particular configuration of a particular phosphorothioate linkage is present in at least 65%, 70%, 80%, 90%, or 99% of the molecules of the population. Such chiral enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, for example, in Oka et al, JACS (2003) 125:8307; wan et al, nuc.acid.Res. (2014) 42:13456, and PCT patent publication WO 2017/015555.
Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereorandom or in a particular stereochemical configuration.
C. Antisense oligonucleotide conjugates
The present disclosure also provides antisense oligonucleotide conjugates (ASO conjugates) comprising one or more ASOs described herein. The term "ASO conjugate" in this disclosure refers to an oligomeric compound comprising an antisense oligonucleotide covalently linked to one or more non-nucleotide moieties (conjugate moieties). Conjugation of an oligonucleotide to one or more conjugate moieties may improve the pharmacological or pharmacokinetic properties of ASO. For example, the conjugate moiety may affect the activity, cellular distribution, cellular uptake, binding, uptake, tissue distribution, cellular distribution, charge, clearance, bioavailability, metabolism, excretion, permeability, and/or stability of the ASO. In particular, the conjugate moiety may help direct ASO targeting to specific areas of the central nervous system. In some embodiments of the ASOs described herein, the conjugate moiety may be a sugar, a peptide (e.g., a cell surface receptor ligand), and/or a lipid (e.g., a phospholipid).
PCT patent publications WO 1993/07883 and WO 2013/033230 provide conjugate moieties suitable for use with the disclosed ASOs. Certain conjugate groups and conjugate moieties have been previously described, for example, in the following references: thioether moieties, such as hexyl-S-tritylthiol (Manoharan et al, ann.N.Acad.Sci. (1992) 660:306-309; manoharan et al, bioorg.Med.chem.Lett. (1993) 3:2795-70), phospholipids, such as, for example, dicetyl-rac-glycerol or triethylammonium 1, 2-di-O-cetyl-rac-glycerol-3H-phosphonate (Manoharan et al, tetrahedron Lett. (1995) 36:3651-4; shea et al, nucl.acids Res. (1990) 18:3777-83), polyamine or polyethylene glycol chains (Manoharan et al, nucleoside & Nucleotetides (1995) 14:969-73), or adamantaneacetic acid, phenolic groups (shina et al, molecular Therapy Nucleic Acids) 220; and PCT patent No. 35: molecular Therapy/WO 35, such as, for example, WO patent No. 35:370716, WO 35/37734-3740, etc. A-3H-phosphonate (Manoharan.Y.) (1992) may be used in the form of the invention)
2014/207232 and WO 2014/179620).
In certain embodiments, conjugation of an ASO of the present disclosure to a lipophilic moiety can increase cellular delivery of the ASO to the central nervous system. In the present disclosure, the term "lipophilic moiety" refers broadly to any compound or chemical moiety that has an affinity for lipids. The lipophilic moiety may generally comprise saturated or unsaturated hydrocarbon chains, which may be cyclic or acyclic. The hydrocarbon chain may contain various substituents and/or one or more heteroatoms, such as oxygen or nitrogen atoms. In certain embodiments, the lipophilic moiety is an aliphatic, cyclic, alicyclic, polycyclic, aromatic, or polyheterocyclic compound. In certain embodiments, the lipophilic moiety is a steroid (e.g., a sterol). Steroids include, but are not limited to, bile acids (e.g., cholic acid, deoxycholic acid, and dehydrocholic acid), cortisone, digitonin, testosterone, cholesterol, and cationic steroids, such as cortisone.
Certain lipophilic conjugate groups and conjugate moieties have been previously described, for example, in the following references: cholesterol moiety (Letsinger et al, proc. Natl. Acad. Sci. USA (1989) 86:6553-6), cholic acid moiety (Manoharan et al, bioorg. Med. Chem. Lett. (1994) 4:1053-60), mercaptocholesterol moiety (Oberhauser et al, nucl. Acids Res. (1992) 20:533-8), aliphatic chains, for example, dodecanediol or undecyl residues (Saison-Behmoaras et al, EMBO J. (1991) 10:1111-8; kabanov et al, FEBS Lett. (1990) 259:327-30; svinarchuk et al, biochie (1993) 75:49-54), palmitoyl moiety (Mira et al, biochim. Acta (1995) 4:229-37) or octadecylamine-carbonyl oxygen-5:12637) (Phacol et al, phacol. 1993).
D. Exemplary antisense oligonucleotide Compounds
Certain abbreviations are used in the present disclosure to describe modifications to each nucleotide and internucleoside linkage of the ASOs described herein, which are modified oligonucleotides. Abbreviations are as follows: a is an adenine nucleobase; g is a guanine nucleobase; t is thymine nucleobase; mC is a 5-methylcytosine nucleobase; e is a 2' -MOE modified sugar; d is 2' -deoxyribose sugar; l is a locked nucleic acid; b is a bridging nucleic acid; o is a phosphodiester internucleoside linkage; and s is a phosphorothioate internucleoside linkage.
In certain embodiments, the ASO of the present disclosure is gapmer. As used in this disclosure, the term "gapmer" refers to an oligonucleotide comprising or consisting of an inner region located between two outer regions, wherein the sugar portion of the nucleoside that comprises the inner region is chemically distinct from the sugar portion of the nucleoside that comprises the outer region. The term "gap" refers to the interior region of an oligonucleotide, while the term "wing" refers to the exterior region. gapmer has 5 '-wings, spacers, and 3' -wings. These three regions form a continuous sequence. The sugar moiety of each wing nucleoside differs from at least some of the sugar moieties of the spacer nucleoside. Unless otherwise indicated, nucleosides of the spacer region of the ASO of the present disclosure fully comprise 2' -deoxyribonucleosides. In some embodiments, the gapmer may comprise one or more modified internucleoside linkages and/or modified nucleobases that do not necessarily follow the sugar modified gapmer pattern.
In some embodiments, the oligonucleotides of the disclosure are gapmers comprising MOEs, BNA, LNA, or DNA modifications, or any combination thereof. In some embodiments, the gapmer comprises a MOE, a DNA and BNA modified, a MOE, a DNA and LNA modified, or a BNA, DNA and LNA modified sugar moiety. In certain embodiments, the internucleoside linkages between the oligonucleotides are phosphodiester or phosphorothioate internucleoside linkages, or a combination thereof.
The length of the three gapmer regions can be symbolized using the notation [ number of nucleosides in 5 'wing ] - [ number of nucleosides in interval ] - [ number of nucleosides in 3' wing ]. Thus, one 4-10-4gapmer contains 4 linked nucleosides per wing and 10 linked nucleosides in the interval.
In some embodiments, the ASO of the present disclosure is a 3-10-3 LNA gapmer.3-10-3 LNA gapmer is 16 nucleobases long, with the central spacer segment comprising ten 2' -deoxynucleosides and the 5' and 3' wing segments each comprising three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-10-3 LNA gapmer are 5-methylcytosine.
In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.
In some embodiments, the ASO of the present disclosure is a 3-11-3 LNA gapmer.3-11-3 LNA gapmer is 17 nucleobases long, with the central spacer segment comprising 11 2' -deoxynucleosides and the 5' and 3' wing segments each comprising three LNA nucleosides. In some embodiments, all cytosine nucleobases throughout the 3-11-3 LNA gapmer are 5-methylcytosine. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.
In some embodiments, the ASO of the present disclosure is a 4-10-4 MOE gapmer.4-10-4gapmer 18 nucleobases long, wherein the central spacer segment comprises ten 2 '-deoxynucleosides and the 5' and 3 'wing segments each comprise four 2' -MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 4-10-4 MOE gapmer are 5-methylcytosine. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.
In some embodiments, the ASO of the present disclosure is a 5-10-5 MOE gapmer.5-10-5 gapmer 20 nucleobases long, wherein the central spacer segment comprises ten 2 '-deoxynucleosides and flanked at the 5' and 3 'ends by wing segments comprising five 2' -MOE nucleosides. In some embodiments, all cytosine nucleobases throughout the 5-10-5 MOE gapmer are 5-methylcytosine. In some embodiments, all internucleoside linkages are phosphorothioate internucleoside linkages.
In certain embodiments, the ASO of the present disclosure is a 3LNA-2MOE-10DNA-2MOE-3LNA gapmer, wherein each nucleoside at oligonucleotide positions 1, 2, 3, 18, 19 and 20 comprises an LNA modification, each nucleoside at oligonucleotide positions 4, 5, 16 and 17 comprises a 2'-MOE modification, and each nucleoside at positions 6-15 is a 2' -deoxynucleoside. In some embodiments, all internucleoside linkages are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.
In certain embodiments, the ASO of the present disclosure is a 2BNA-3MOE-10DNA-3MOE-2BNA gapmer, wherein each nucleoside at positions 1, 2, 19, and 20 comprises a BNA modification, each nucleoside at positions 3, 4, 5, 16, 17, and 18 comprises a 2'-MOE modification, and each nucleoside at positions 6-15 is a 2' -deoxynucleoside. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.
In certain embodiments, the ASO of the present disclosure is a 3BNA-2MOE-10DNA-2MOE-3BNA gapmer, wherein each nucleoside at oligonucleotide positions 1, 2, 3, 18, 19 and 20 comprises a BNA modification, each nucleoside at oligonucleotide positions 4, 5, 16 and 17 comprises a 2'-MOE modification, and each nucleoside at positions 6-15 is a 2' -deoxynucleoside. In some embodiments, all internucleoside linkages are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, 16 and 17, and 18 and 19 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.
In certain embodiments, the ASO of the present disclosure is a 2LNA-3MOE-10DNA-3MOE-2LNA gapmer, wherein each nucleoside at positions 1, 2, 19 and 20 comprises an LNA modification, each nucleoside at positions 3, 4, 5, 16, 17 and 18 comprises a 2'-MOE modification, and each nucleoside at positions 6-15 is a 2' -deoxynucleoside. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 4 and 5, and 16 and 17 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the internucleoside linkages between the nucleosides at positions 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester internucleoside linkages. In some embodiments, the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In some embodiments, each cytosine nucleobase is a 5-methylcytosine.
In a specific embodiment, the present disclosure provides an ASO as listed in the following table and described in more detail below.
TABLE B representative ASO
/>
D.1. Representative BNA/MOE gapmer Compounds
In some embodiments, the ASO of the present disclosure is a BNA/MOE gapmer compound, e.g., a compound described below.
The compound SNCA_ASO_01608 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01608 is characterized by the following chemical notations: gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb (modified oligonucleotide SEQ ID NO: 18), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01608 is characterized by the following chemical structure (VI):
the compound SNCA_ASO_01613 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01613 is characterized by the following chemical notations: abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab (modified oligonucleotide SEQ ID NO: 19), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01613 is characterized by the following chemical structure (VII):
The compound SNCA_ASO_01615 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01615 is characterized by the following chemical notations: abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 20), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01615 is characterized by the following chemical structure (VIII):
the compound SNCA_ASO_01609 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01609 is characterized by the following chemical notations: mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb (modified oligonucleotide SEQ ID NO: 21), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01609 is characterized by the following chemical structure (IX):
the compound SNCA_ASO_01611 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01611 is characterized by the following chemical symbols: tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb (modified oligonucleotide SEQ ID NO: 22), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01611 is characterized by the following chemical structure (X):
the compound SNCA_ASO_01614 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01614 is characterized by the following chemical notations: abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab (modified oligonucleotide SEQ ID NO: 23), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01614 is characterized by the following chemical structure (XI):
the compound SNCA_ASO_01610 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01610 is characterized by the following chemical symbols: mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab (modified oligonucleotide SEQ ID NO: 24), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01610 is characterized by the following chemical structure (XII):
the compound SNCA_ASO_01612 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01612 is characterized by the following chemical notations: gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 25), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01612 is characterized by the following chemical structure (XIII):
the compound SNCA_ASO_01616 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01616 is characterized by the following chemical symbols: mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb (modified oligonucleotide SEQ ID NO: 26), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01616 is characterized by the following chemical structure (XIV):
The compound SNCA_ASO_01790 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01790 is characterized by the following chemical notations: gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb (modified oligonucleotide SEQ ID NO: 27), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01790 is characterized by the following chemical structure (XV):
the compound SNCA_ASO_01791 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 23) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modifications, nucleosides 3-5 and 16-18 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01791 is characterized by the following chemical notations: abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb (modified oligonucleotide SEQ ID NO: 28), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01791 is characterized by the following chemical structure (XVI):
the compound SNCA_ASO_01792 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01792 is characterized by the following chemical notations: tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb (modified oligonucleotide SEQ ID NO: 29), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01792 is characterized by the following chemical structure (XVII):
the compound SNCA_ASO_01793 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modifications, nucleosides 3-5 and 16-18 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01793 is characterized by the following chemical notations: abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab (modified oligonucleotide SEQ ID NO: 30), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01793 is characterized by the following chemical structure (XVIII):
The compound SNCA_ASO_01789 is characterized as 2BNA-3MOE-10DNA-3MOE-2BNA gapmer having the sequence TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16) from 5 'to 3', wherein nucleosides 1-2 and 19-20 each comprise BNA modification, nucleosides 3-5 and 16-18 each comprise 2'-MOE modification, nucleosides 6-15 each are 2' -deoxynucleosides, internucleoside linkages between nucleosides 3-4, 4-5, 16-17 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01789 is characterized by the following chemical notations: tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab (modified oligonucleotide SEQ ID NO: 31), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, b is a bridging nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01789 is characterized by the following chemical structure (XIX):
D.2. representative LNA/MOE gapmer compounds
In some embodiments, the ASO of the present disclosure is an LNA/MOE gapmer compound, e.g., a compound described below.
The compound SNCA_ASO_01618 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence GCAGTTCTATCCCACTCATC (unmodified oligonucleotide SEQ ID NO: 4) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01618 is characterized by the following chemical notations: gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl (modified oligonucleotide SEQ ID NO: 32), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01618 is characterized by the following chemical structure (XX):
the compound SNCA_ASO_01623 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence AATAGCATCCTTCCACACCA (unmodified oligonucleotide SEQ ID NO: 5) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01623 is characterized by the following chemical symbols: als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls Al (modified oligonucleotide SEQ ID NO: 33), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01623 is characterized by the following chemical structure (XXI):
the compound SNCA_ASO_01625 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence ATCACCTTCAAACCCCTTTC (unmodified oligonucleotide SEQ ID NO: 6) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01625 is characterized by the following chemical notations: als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 34), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01625 is characterized by the following chemical structure (XXII):
the compound SNCA_ASO_01619 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence CCGGTGCCATTACTCCCTTT (unmodified oligonucleotide SEQ ID NO: 7) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01619 is characterized by the following chemical notations: mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls Tl (modified oligonucleotide SEQ ID NO: 35), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01619 is characterized by the following chemical structure (XXIII):
The compound SNCA_ASO_01621 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence TTGCAGATAAACCATCCCAC (unmodified oligonucleotide SEQ ID NO: 8) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01621 is characterized by the following chemical notations: tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl (modified oligonucleotide SEQ ID NO: 36), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01621 is characterized by the following chemical structure (XXIV):
the compound SNCA_ASO_01624 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence AGTGCCAGACCCTTTCATTA (unmodified oligonucleotide SEQ ID NO: 9) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01624 is characterized by the following chemical notations: als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls Al (modified oligonucleotide SEQ ID NO: 37), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01624 is characterized by the following chemical structure (XXV):
the compound SNCA_ASO_01620 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence CCAAGTGCCAGACCCTTTCA (unmodified oligonucleotide SEQ ID NO: 10) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01620 is characterized by the following chemical notations: mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls Al (modified oligonucleotide SEQ ID NO: 38), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01620 is characterized by the following chemical structure (XXVI):
the compound SNCA_ASO_01622 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence GCAGATAAACCATCCCACTT (unmodified oligonucleotide SEQ ID NO: 11) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01622 is characterized by the following chemical symbols: gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls Tl (modified oligonucleotide SEQ ID NO: 39), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01622 is characterized by the following chemical structure (XXVII):
The compound SNCA_ASO_01626 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence CGGTGCCATTACTCCCTTTC (unmodified oligonucleotide SEQ ID NO: 17) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01626 is characterized by the following chemical notations: mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl (modified oligonucleotide SEQ ID NO: 40), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01626 is characterized by the following chemical structure (XXVIII):
the compound SNCA_ASO_01823 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence GAACTGATGCCTCTACCTCC (unmodified oligonucleotide SEQ ID NO: 12) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01823 is characterized by the following chemical notation: gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl (modified oligonucleotide SEQ ID NO: 41), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01823 is characterized by the following chemical structure (XXIX):
the compound SNCA_ASO_01824 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence ACTGAACTGATGCCTCTACC (unmodified oligonucleotide SEQ ID NO: 13) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01824 is characterized by the following chemical notation: als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl (modified oligonucleotide SEQ ID NO: 42), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01824 is characterized by the following chemical structure (XXX):
the compound SNCA_ASO_01825 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence TACATGGCCAGAAACCACTT (unmodified oligonucleotide SEQ ID NO: 14) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01825 is characterized by the following chemical notations: tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls Tl (modified oligonucleotide SEQ ID NO: 43), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01825 is characterized by the following chemical structure (XXXI):
The compound SNCA_ASO_01826 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence AAGCCAAGCCCAAACACTAA (unmodified oligonucleotide SEQ ID NO: 15) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 are each 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01826 is characterized by the following chemical notation: als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als Al (modified oligonucleotide SEQ ID NO: 44), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01826 is characterized by the following chemical structure (XXXII):
the compound SNCA_ASO_01822 is characterized as 3LNA-2MOE-10DNA-2MOE-3LNA gapmer having the sequence TCCAAAGGAGCACCAACCAA (unmodified oligonucleotide SEQ ID NO: 16) from 5 'to 3', wherein nucleosides 1-3 and 18-20 each comprise LNA modifications, nucleosides 4-5 and 16-17 each comprise 2'-MOE modifications, nucleosides 6-15 each are 2' -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 4-5, 16-17 and 18-19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.
Compound snca_aso_01822 is characterized by the following chemical notation: tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als Al (modified oligonucleotide SEQ ID NO: 45), wherein A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE modified sugar, d is a 2' -deoxyribose sugar, l is a locked nucleic acid, o is a phosphodiester internucleoside linkage and s is a phosphorothioate internucleoside linkage.
Compound snca_aso_01822 is characterized by the following chemical structure (XXXIII):
III.method for producing antisense oligonucleotide
The antisense oligonucleotides of the present disclosure can be synthesized by any method known in the art. For example, ASO can be synthesized by in vitro transcription and purification (e.g., using a commercially available in vitro RNA synthesis kit), by transcription and purification from cells (e.g., cells comprising an expression cassette/vector encoding ASO), by use of an automated solid phase synthesizer, etc. In solid phase oligonucleotide synthesis, a single polynucleotide unit is repeatedly added to a growing oligonucleotide chain covalently bound to a solid support. In the case of phosphodiester bonds, electrophilic 3' phosphorus imide monomer units may be used. However, any suitable electrophilic group may be used to covalently link two nucleosides.
The ASO of the present disclosure may be purified after solid phase synthesis by any method known in the art. For example, the oligonucleotides may be precipitated from the solution by treating the solution with ethanol and a divalent cation. ASOs of the present disclosure can also be purified, for example, using a fractionation column, reverse phase chromatography, high performance liquid chromatography, and polyacrylamide gel electrophoresis.
Exemplary methods for synthesizing antisense oligonucleotides and purifying the oligonucleotides using solid supports are described, for example, in Ellington et al, introduction to the synthesis and purification of oligonucleotides (entry into oligonucleotide synthesis and purification). Curr.protoc.nucleic Acid chem. (2001) appdix 3C.
IV.Compositions of antisense oligonucleotides
In some embodiments, the disclosure relates to compositions (e.g., pharmaceutical compositions) comprising the ASOs described herein. In some embodiments, the compositions are useful for treating diseases or disorders associated with α -synuclein expression or overexpression, e.g., synucleinopathies. The compositions of the present disclosure may be formulated based on the mode of delivery.
The pharmaceutical compositions described herein may comprise pharmaceutically acceptable excipients. Pharmaceutically acceptable excipients may be liquid or solid and may be selected with consideration of the intended mode of administration to provide the desired volume, consistency and other relevant transport and chemical properties. Any known pharmaceutically acceptable carrier or diluent may be used, including, for example, water, saline solutions, buffers, preservatives and the like. For example, the ASO of the present disclosure may be administered to a patient as a formulation in Phosphate Buffered Saline (PBS). Examples of pharmaceutically acceptable excipients include water, saline, buffered solutions or artificial cerebrospinal fluid. The pharmaceutically acceptable excipient is preferably sterile.
The ASOs of the present disclosure may be administered as pharmaceutically acceptable salts. Pharmaceutically acceptable salts are salts of the disclosed ASOs that are physiologically acceptable and retain the desired biological activity of the ASO without unwanted toxicological effects. As used herein, the term ASO encompasses both the free acid form and the salt form (e.g., sodium salt form) of an oligonucleotide.
ASOs of the present disclosure may be mixed, encapsulated (e.g., in lipid nanoparticles), conjugated, or otherwise conjugated with other molecules, molecular structures, or nucleic acid mixtures.
U.S. patent publication 2020/0385723 provides pharmaceutical compositions suitable for use with the disclosed ASOs.
V.Methods of using antisense oligonucleotides
ASOs of the present disclosure generally inhibit the activity of transcripts encoded by SNCA genes in mammalian cells, such as human cells. In some embodiments, the cell is a neuronal cell. In certain embodiments, the cell is a cell of the Central Nervous System (CNS), including cells of: motor cortex, frontal cortex, caudate nucleus, amygdala, pontine, substantia nigra, putamen, cerebellar foot, corpus callosum, dorsal Cochlear Nucleus (DCN), entorhinal cortex (Ent cortex), hippocampus, island leaf cortex, medulla oblongata, central gray color, occipital core, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, upper colliculus and basal forebrain nucleus.
The present disclosure provides methods of down-regulating the abundance or activity of SNCA gene transcripts in a cell or tissue, the methods comprising contacting the cell or tissue with an effective amount of one or more ASOs or compositions of the disclosure. These methods may be performed in vitro or in vivo.
In some embodiments, ASOs of the present disclosure may be used for treatment or prevention. ASOs of the present disclosure may be used as therapeutic agents in animals suspected of having a disease or disorder that may be treated by modulating expression of SNCA gene transcripts and/or alpha-synuclein. Animals may also be susceptible to, and not necessarily suspected of having, a disease or disorder associated with SNCA gene expression. Animals are treated by administering a therapeutically effective amount or a prophylactically effective amount of one or more ASO compounds or pharmaceutical compositions of the present disclosure. In some embodiments, the animal is a mammal. In some embodiments, the animal is a human.
In some embodiments, the ASOs described herein can be used to treat neurodegenerative diseases, such as parkinson's disease, lewy body dementia, diffuse Lewy body disease, simple autonomic failure, multiple system atrophy, neuronal disorders Gaucher's disease, and alzheimer's disease. Overall, neurodegenerative diseases lead to neuronal death.
In some embodiments, the ASOs of the present disclosure alleviate symptoms of a disease or disorder associated with SNCA gene expression. Alleviation may refer to a decrease in severity or frequency of symptoms. Improvement may also refer to a delay in onset or progression of symptoms. In some embodiments, the symptom alleviated by ASO treatment is motor dysfunction, alpha-synuclein aggregation, neurodegeneration, reduced cognitive ability, or dementia. Alleviation of these symptoms may lead to improved motor function, reduced alpha-synuclein aggregation, reduced neurodegeneration, reduced or reversed cognitive decline, and/or reduced or reversed dementia.
A "therapeutically effective amount" of an ASO as disclosed herein is an amount sufficient to carry out a specifically described purpose. Such amounts may be determined empirically and in a routine manner relative to the purpose. Certain factors may affect the dosage and schedule required to effectively treat a subject, including, but not limited to, the severity of the disease or condition, previous treatments, the overall health and/or age of the subject, and the presence of one or more other diseases. In addition, treating a subject with a therapeutically effective amount of a pharmaceutical composition may include a single treatment or a series of treatments. The effective dose and in vivo half-life of the disclosed ASO can be estimated using conventional methods or based on in vivo testing using a suitable animal model. The therapeutically effective amount may alleviate symptoms of the disease.
In certain embodiments, an ASO or pharmaceutical composition of the disclosure is prepared for injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intraventricular (ICV), intracranial, etc.). In a preferred embodiment, the pharmaceutical composition is injected intrathecally or intracranially into the subject.
In some embodiments, the ASOs of the present disclosure may be used for research purposes. For example, ASO can be used to specifically inhibit the synthesis of α -synuclein in cells and experimental animals. ASO-mediated inhibition of α -synuclein synthesis can be used to perform functional analysis of α -synuclein.
VI.Kit and article of manufacture
The disclosure also includes kits and articles of manufacture for the ASOs described herein. Kits or articles of manufacture comprising the ASOs of the present disclosure may be used to perform the methods described herein. The kit or article of manufacture comprises at least one ASO in one or more containers.
In some embodiments, the kits or articles of manufacture described herein can be used to treat and/or prevent a disease associated with SNCA gene expression (e.g., synucleinopathies). The kit or article of manufacture may further comprise a container and a label or package insert on or associated with the container. Suitable containers include, for example, bottles, vials, syringes, intravenous infusion bags, and the like. The container may be formed from a variety of materials such as glass or plastic and may contain a composition that is effective in itself to treat or prevent a disease or in combination with another composition and may have a sterile access port (e.g., the container may be an intravenous infusion bag or a vial having a stopper penetrable by a hypodermic needle). The kit or article of manufacture may also comprise a package insert indicating that the composition may be used to treat a particular disease. Alternatively or additionally, the article of manufacture or kit may further comprise a second (or third) container comprising a pharmaceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate buffered saline, ringer's solution, and dextrose solution. It may also include other materials that are popular from a commercial and/or user standpoint, including other buffers, diluents, filters, needles and syringes.
In some embodiments, the kit contains all components necessary and/or sufficient to perform a detection assay, including all control measures, instructions to perform the assay, and any software necessary to analyze and present the results. Those skilled in the art will readily recognize that the disclosed ASOs can be readily incorporated into one of the well-known set kit formats in the art.
Unless defined otherwise herein, scientific and technical terms used in connection with the present disclosure should have meanings commonly understood by one of ordinary skill in the art. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice and testing of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, the nomenclature used in connection with and the techniques of neurology, medicine, medical chemistry, and pharmaceutical chemistry and cell biology described herein are those well known and commonly employed in the art. Enzymatic reactions and purification techniques are performed according to manufacturer's instructions, as is commonly done in the art or as described herein. In addition, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise" or variations thereof such as "comprises" or "comprising," "including," or "comprises" are to be interpreted as referring to the inclusion of a stated integer or group of integers but not to the exclusion of any other integer or group of integers. As used herein, the term "about" or "approximately" as applied to one or more target values refers to values similar to the reference value. In certain embodiments, unless stated otherwise or apparent from the context, the term refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the recited reference value in either direction (greater than or less).
All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, such citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
In order that the invention may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any way.
Examples
The materials and methods used in the experiments described below are as follows.
ASO construction
ASO was constructed to be complementary to the sense strand of the genomic SNCA sequence (SEQ ID NO: 1) and the sequence of mRNA transcribed from the SNCA gene (NC_ 000004.12::89724099..89838324,SEQ ID NO:2).
Sk-Mel-2 cell culture
Sk-Mel-2 cells were cultured in Eagle Minimal Essential Medium (EMEM) supplemented with 10% Fetal Bovine Serum (FBS). Transgenic human SNCA mice and acquisition neurons
C57BL/6Tac mice (Taconic) were genetically engineered to introduce the human intact wild-type SNCA gene (SEQ ID NO: 1) starting at their 5' UTR into the mouse genome, replacing the mouse SNCA gene and under the control of the mouse SNCA promoter. C57BL/6Tac mice (Taconic) were genetically engineered to introduce a human complete SNCA gene (SEQ ID NO: 1) mutated at position A53T starting from its 5' UTR into the mouse genome in place of the mouse SNCA gene and under the control of the mouse SNCA promoter. Primary cortical neurons were collected from embryos taken from pregnant mice knocked in by homozygous human SNCA at day 17.5 of embryo day. Cortical tissue was dissected from each embryo in ice-cold Hank balanced salt solution. Pooled tissues were minced and digested with papain for 12 minutes at 37 ℃. The digestion was then discontinued by addition of 10% FBS/DMEM. Cells were digested and resuspended in GlutataMAX supplementation TM 2% penicillin/streptomycin and B-27 TM Neurobasal of Plus supplement TM Plus medium. Cells were seeded at a density of 15000 cells/well into 40 μl of supplemented Neurobasal in poly-L-lysine + boric acid coated 384 well plates TM Culture medium (containing B-27) TM Supplement and GlutaMAX). The neurons were then incubated at 37℃with 5% CO 2 Incubate under atmosphere for four days.
Male Winstar rats
Male Wistar rats weighed 200-225g at their arrival and were housed in two animal groups per cage at room temperature, with free access to food and water. All procedures were approved by the Institut de Recherches SERVIER ethics committee according to guidelines of the laboratory animal care and use guidelines.
Screening for ASO in vitro neurons
For single dose screening, neurons were treated with 300nM of a given ASO. For multiple dose screening, neurons were treated with serial dilutions of the given ASO, starting with 3 μm (1/2 log dilution, 11 total concentrations). Seven days after ASO treatment, the medium was replaced with new Neurobasal TM A culture medium. 15 days after treatment, taqMan was used TM Fast Advanced Cells-to-CT kit (ThermoFisher) extracts RNA from cells. The cells were then washed in PBS and lysed in solution for five minutes at room temperature while dnase treatment was performed. Cleavage was terminated by treating the mixture with a termination solution followed by incubation for two minutes at room temperature. Reverse transcription was performed immediately after cell lysis using Fast Advanced RT enzyme mix (ThermoFisher). Subsequent use of TaqMan TM Genotyping assays cDNA samples were used for quantitative real-time PCR measurements. Specific probes and primers were used for SNCA mRNA quantification (Hs 00240906_m1SNCA; thermoFisher). SNCA mRNA levels were adjusted to the measured levels of housekeeping gene PPIA (probe/primer PPIA_Mm02342430_g1; thermoFisher).
In qPCR reactions, the quantitative cycle value (Ct) is defined as the number of cycles required for the fluorescent signal to exceed the background fluorescence. Quantum studio TM The real-time PCR software program (Applied Biosystems, foster City, CA) sets this threshold at ten standard deviations above the mean baseline fluorescence. The comparative Ct method normalizes Ct values of target genes against housekeeping genes, after which comparisons are made between samples. First, a difference (Δct) between Ct values of a target gene and a housekeeping gene is calculated for each sample, and then a Δct difference (ΔΔct) is calculated between two samples (e.g., a control and a treated sample). The fold change in expression of the two samples was calculated to be 2 -ΔΔCt . The percent reduction is calculated by: value 1 minus 2 of the average of the ASO group of interest -ΔΔCt And multiplied by 100, decrease% = (1-2 -ΔΔCt ASO group mean) x 100.
Mouse model
As shown in FIG. 1, the human whole wild-type (WT) SNCA gene (SEQ ID NO: 1) was introduced into the mouse genome in place of the mouse SNCA gene locus in the C57BL/6Tac mouse (Taconic). Analysis of human and murine SNCA proteins in different brain regions by Mass Spectrometry Domain and expression in peripheral organs (fig. 2A-2C). Male mice homozygous for the age of March to April expressing the human WT SNCA gene (referred to as "hSNCA +/+ KI mice "or" hsneca mice ") were housed in groups of up to three animals per cage at room temperature with free access to food and water. All procedures were approved by the Institut de Recherches SERVIER ethics committee according to guidelines of the laboratory animal care and use guidelines.
hSNCA A53T neuron
As depicted in FIG. 1, the human intact A53T SNCA gene was introduced into the mouse genome in place of the mouse SNCA gene locus of the C57BL/6Tac mouse (Taconic). Homozygous female mice expressing the human A53T SNCA gene (designated hA53TSNCA +/+ KI) one animal per cage was fed separately at room temperature, food and water were freely available. All procedures were approved by the Institut de Recherches SERVIER ethics committee according to guidelines of the laboratory animal care and use guidelines.
Intra-cerebral (ICV) injection
Sterile saline syringes and no nuclease centrifuge tubes were used to prepare the dosing solutions. The tubes containing the ASO powder were centrifuged briefly before adding the brine solution, followed by centrifugation for another 10 minutes to completely dissolve the ASO powder. The solution was vortexed for approximately one minute and stored at 4 ℃ until use.
hsneca mice received a single bolus injection (bolus injection) of the oligonucleotide at a dose of 30 nmol. Mice were anesthetized with isoflurane at a concentration of 4.5-5% and maintained at isoflurane at a concentration of 1.5-2% during surgery. For pain management, buprenorphine was subcutaneously administered at a dose of 0.04mg/kg for at least 30 minutes prior to injection. The scalp of the mice was shaved and after loss of plantar reflex, the mice were placed in brain stereotactic racks (David Kopf Instruments, CA). The scalpel was sterilized by alternating three wipes with iodophor and 70% ethanol. An incision was made in the scalp and the skull surface was exposed and the coronal points were clearly identified. A hole was drilled in the skull at 0.5mm AP, 1.1mm ML relative to the coronal point. ASO was injected through a cannula (31 g) connected to the microinjector pump controller. The dorsoabdominal DV coordinates were measured 1mm below the skull surface. Once the cannula was in place, the ASO solution was administered in 5 μl saline vehicle for 30 seconds. The cannula was left in place for an additional three minutes after injection to allow the solution to diffuse in the brain. After slow withdrawal of the cannula, the scalp was sutured and mice were subcutaneously injected with 1mL of warm sterile saline solution to aid in fluid replacement and placed in their warm living cages. Control mice were similarly dosed with saline vehicle control. Mice were observed until they regained consciousness and locomotion to prevent potentially adverse behavioral effects. Drug tolerance was assessed one hour after dosing. Animals dosed with non-tolerogenic compounds (tolerogenic score > 8) were euthanized immediately after this one hour evaluation.
The antisense oligonucleotide is used in hSNCA +/+ KI (knock-in) mice were tested as described above to evaluate their tolerability profile. ASO snca—00033 as in PCT patent publication WO 2012/068405, described previously, was also tested as a control. In all cases ASO SNCA_00033 has a 5-10-5 MOE gapmer pattern, where all internucleoside linkages are phosphorothioate internucleoside linkages and all cytosine residues are 5-methylcytosine.
Intrathecal (IT) injection
Male Wistar rats received a single intrathecal bolus of oligonucleotide at a dose of 2.5 mg. Rats were anesthetized with isoflurane at a concentration of 4% and maintained at isoflurane at a concentration of 2-2.5% during surgery. For pain management, carprofen 5mg/kg and buprenorphine 0.05mg/kg were administered subcutaneously at least 20 minutes prior to injection. Rats were shaved and after loss of plantar reflex, an incision was made between the 5 th and 6 th lumbar vertebrae. Dissecting the muscles around this region allows access to the spinal canal for insertion of a catheter for ASO injection. Once the catheter is in place, ASO solution is administered in 30 μl of artificial CSF for about 30 seconds. The catheter is left in place and sealed to avoid CSF fluid diffusion. After slow withdrawal of the cannula, the muscles and skin were sutured and 1mL of warm sterile saline was injected subcutaneously into the large to aid in fluid replacement and placed in their warm living cages. Rats in the control group were similarly dosed with artificial CSF. Rats were observed until they regained consciousness and locomotion to prevent potentially adverse behavioral effects. Drug tolerance was assessed one, three and 24 hours after dosing. Animals dosed with non-tolerogenic compounds (tolerogenic score > 8) were euthanized immediately after this one hour evaluation.
ASO acute tolerance assessment
Adverse effects were monitored and scored in the dosed mice one and three hours after injection according to the criteria shown in fig. 3. Adverse effects were monitored and scored in the dosed rats one hour, three hours, and twenty four hours after injection according to the criteria shown in fig. 10. The normal tolerance score is 0 and the highly toxic score corresponds to 16. The final tolerability score was calculated based on the sum of all criteria. For some oligonucleotides, intolerable acute toxicity was observed without reaching the first observation time point. In these cases, ASO was scored at an acute toxicity score of 14 and mice were immediately euthanized. Mice were monitored more closely during the experiment if scores above 6 were measured at this one hour time point.
ASO long-term tolerance assessment
Mice were weighed on the day of injection and three times a week until the experiment was completed. Any mice exhibiting intolerable health, behavioral observations, or weight loss of 20% over their initial body weight were immediately euthanized.
Tissue sampling
All mice were euthanized by overdosing with narcotics. Animals were perfused with 0.9% saline transheart in the left ventricle. The thoracic aorta between the lungs and liver is clamped with hemostatic forceps to block blood flow from the heart to the abdomen, but to allow blood flow to the brain. The right ventricle was opened with scissors. The constant pressure of 100 to 120 mmhg was maintained on the perfusion fluid by connecting the solution bottle to an air compressor controlled by a pressure gauge. Perfusion continues until the skull surface turns white and the perfusate exits the right ventricle. After perfusion, brain tissue (cortex) and surrounding tissue (kidney and liver) were collected. The sample was cut into small pieces, mixed and aliquoted into three equal portions. All samples were frozen with liquid nitrogen and stored at-80 ℃ until used to measure RNA, protein and ASO. For some studies, blood and cerebrospinal fluid (CSF) were also collected.
Measurement of mRNA by qRT-PCR
RNA was extracted and mRNA was quantified by qPCR. Make the following stepsRNA was extracted from right cortical biopsy samples using RNeasy mini kit (Qiagen) along with dnase treatment. Using Nanodrop TM A spectrophotometer, total RNA samples were quantified and analyzed using a tape station to determine the quality (RIN) of RNA. In qPCR quantification experiments, RNA was first reverse transcribed using the High-Capacity cDNA reverse transcription kit (Applied Biosystems). The reaction was performed in a final volume of 100. Mu.L of reaction starting from 1000ng total RNA (to a final concentration of RNA of 10 ng/. Mu.L). Using Quantum studio 7 Flex (Applied Biosystems) TM )、TaqMan TM Universal PCR Master mix (Applied Biosystems) TM Catalog number 4324020) and TaqMan TM Gene expression assay in duplex (Hs 00240906_m1 in FAM fluorescent and Mm02342430_g1 in VIC fluorescent), human SNCA gene and mouse PPIA housekeeping gene were quantified from 40ng total cDNA. qPCR analysis was performed in triplicate using the fast run mode. Ct values for each qPCR plate were analyzed using Excel software. The technical replicates were combined (n=3) and averaged into a geometric mean. Relative expression was generated for each ASO group using mouse control PBS conditions.
hSNCA protein expression by mass spectrometry
Mouse brain tissue was treated with 150mg/mL in lysis buffer (PBS, sigma protease and phosphatase inhibitor cocktail, 1% deoxycholate)(2X 20s,5000 tr) homogenization. The brain homogenate was then centrifuged (27000 g,4 ℃,20 min) and the supernatant collected. Brain samples were diluted in denaturing buffer (ammonium bicarbonate 50mM, deoxycholate 1%) and subsequently heated at 95 ℃ for five minutes. Next, trypsin (10. Mu.g) was added to each sample. One minute trypsin digestion was performed in an ultrasonic bath (Branson 1200) followed by incubation at 52 ℃ for 30 minutes. The reaction was stopped by adding 1. Mu.L of TCEP (0.5M) and 1. Mu.L of 100% formic acid, followed by incubation at 95℃for five minutes. The sample was then centrifuged at 30,000g for 15 minutes. Peptide analysis by reverse phase liquid chromatography tandem mass spectrometry (LC-MS/MS) using Shimadzu LC system (Shimadzu) connected online to triple quadrupole mass spectrometer (Shimadzu 8060) operating in MRM modeDigests. Specific peptides used to measure the abundance of alpha-synuclein are TVEGAGSIAAATGFVK (SEQ ID NO: 46) and TVEGAGNIAAATGFVK (SEQ ID NO: 47). A specific peptide used to measure the abundance of GAPDH protein is VGVGFGR (SEQ ID NO: 48). A single 10. Mu.L injection of each brain sample digest was loaded onto Waters TM XBridge Peptide BEH C18 column (+)>3.5 μm;150mm x 2.1 mm). The peptides were eluted over 30 minutes using a linear gradient of acetonitrile in 0.1% formic acid (2-40%). The chromatograms were analyzed using Shimadzu LabSolutions software. The signal intensity obtained for each peptide was normalized to the GAPDH signal obtained in each sample and expressed in Arbitrary Units (AU). hSNCA protein or alpha-synuclein expression as determined by ELISA
Mouse brain tissue was treated with 150mg/mL in lysis buffer (PBS, sigma protease and phosphatase inhibitor cocktail, 1% deoxycholate)(2X 20s,5000 tr) homogenization. The brain homogenate was then centrifuged (27000 g,4 ℃,20 min) and the supernatant collected. Following the manufacturer's instructions, alpha-synuclein in brain lysates was quantified by using the U-PLEX human alpha-synuclein kit (K151 WKK). Use from->The total alpha-synuclein was quantified in brain lysates using the ELISA commercial kit U-PLEX human alpha-synuclein kit (K151 WKK). Plates were provided that were pre-coated with capture antibodies to alpha-synuclein. The sample (brain lysate) is added to a solution containing a detection antibody (anti-alpha-synuclein) conjugated to an electroluminescent compound TAG (MSD sulphur-TAG). The analyte in the sample that binds to the capture antibody is immobilized on the working electrode surface. The bound analyte recruits conjugated detection antibodies to complete the sandwich. Add- >Reading the buffer, providing an appropriate chemical environment for electroluminescence, and loading the plate into MSD +.>Imagers were available for analysis. Within the SECTOR Imager, a voltage applied to the plate electrode causes the probes bound to the electrode surface to emit light. The instrument measures the intensity of the emitted light to quantitatively measure the alpha-synuclein present in the sample.
High Performance Liquid Chromatography (HPLC) fluorescence
The samples were analyzed against a set of calibration standards formulated in water. Since no matrix effect was observed, a set of standards in water was used to quantify all samples (plasma, CSF and tissue). Frozen tissue was weighed and ground to Masterpure at 6500rpm using a precell lys apparatus TM 2X30 seconds in a buffer of/Proteinase K97/3 (V/V). Plasma samples (5. Mu.L) were diluted in Masterpure TM In/ptoteinase K97/3 (70. Mu.L). Plasma and tissue homogenates were incubated at 55 ℃ with gentle agitation during 30 minutes. Subsequently, 10 μl of KCl 3M solution was added to 50 μl of tissue homogenate or plasma dilution, mixed rapidly by vortexing and sonicated for five minutes. The tube was centrifuged at +4℃forten minutes (20000 g). CSF samples (10 μl) were diluted in hybridization buffer (Tris HCl 50mm pH 8.5/ACN 90/10) (45 μl) and proteinase K (1 μl) and incubated at 55 ℃ during 15 minutes. Prior to analysis, a hybridization step is performed with fluorescent labeled peptide nucleic acid oligomers complementary to the quantified oligonucleotides. For calibration standards and tissue homogenates, 40 μl of hybridization buffer and 10 μl of fluorescent complementary probe were mixed with 10 μl of calibration standards, quality control samples, and study sample supernatants. For plasma samples, 30 μl of hybridization buffer and 10 μl of fluorescent complementary probe were mixed with 60 μl of quality control sample and study sample supernatant. For CSF analysis, 10 μl of fluorescent complementary probe was added directly to the previous dilution. The mixture was first incubated at 95℃for 15 minutes, followed by 15 minutes at 55 ℃. Finally, the sample was centrifuged at 4℃for 5 min (20000 g). Samples were analyzed under an RP-HPLC system with fluorescence detection. The volume of the sample was 50. Mu.L, with the exception of plasma (90. Mu.L). Measuring hybridization to The amount of fluorescence due to the oligonucleotides of the fluorescent probe is compared to a standard curve. The concentration of the oligonucleotides in the sample was calculated taking into account the different dilutions used during the sample preparation period.
Example 1: in vitro mRNA reduction after single dose ASO
Modified oligonucleotides complementary to the human SNCA nucleotide sequence were designed and tested for their selective efficacy in reducing SNCA mRNA levels in cultured Sk-Mel-2 cells. Cultured Sk-Mel-2 cells were transfected at a density of 15000 cells/well using Lipofectamine 2000 (Invitrogen) together with modified antisense oligonucleotides (ASO) at a concentration of 20nM or 2 nM. After 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by a branched DNA assay (QuantiGene Singleplex assay kit, thermosfisher). This method relies on the amplification of signals by branched DNA (bDNA) probes that bind to specific nucleotide sequences. The probe sets used were xm_005555421 (reactive to canine and human SNCA) and nm_002046 (reactive to human GapDH), designed by affymetrix inc./ThermoScientific and synthesized by Metabion International. The SNCA-RLU was normalized to the GapDH Relative Luminescence Units (RLU) of the corresponding wells. Values were normalized to non-specific (Ahsa 1) ASO treated wells.
Modified oligonucleotides tested in the above experiments are shown in table C below. Each of the modified oligonucleotides listed in Table C is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 5-10-5 MOE gapmer. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising five 2' moe nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate internucleoside linkages.
The positions identified in Table C correspond to the "start site", i.e., the gapmer is complementary to the 5' nucleoside in the human nucleic acid sequence (SEQ ID NO: 1).
TABLE C5-10-5 MOE gapmer
/>
/>
/>
Each of the modified oligonucleotides listed in Table D is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 4-10-4 MOE gapmer. These gapmers are 18 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and wing segments at both the 5' and 3 'ends comprising four 2' -MOE nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.
The positions identified in Table D correspond to the "start site", i.e., the gapmer is complementary to the 5' nucleoside in the human SNCA nucleic acid sequence (SEQ ID NO: 1).
TABLE D.4-10-4 MOE gapmer
/>
Each of the modified oligonucleotides listed in Table E is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-10-3 LNA gapmer. These gapmers are 16 nucleobases long, with a central spacer segment comprising ten 2' -deoxynucleosides and each wing segment at the 5' and 3' ends comprising three LNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.
The positions identified in Table E correspond to the "start site", i.e., the gapmer is complementary to the 5' nucleoside in the modified human nucleic acid sequence (SEQ ID NO: 1).
TABLE E.3-10-3 LNA gapmer
/>
Each of the modified oligonucleotides listed in Table F is complementary to the human SNCA nucleic acid sequence (SEQ ID NO: 1) and is a 3-11-3 LNA gapmer. These gapmers are 17 nucleobases long, with a centrally spaced segment comprising eleven 2' -deoxynucleosides and flanking both the 5' and 3' ends a wing segment comprising three LNA nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages.
The positions identified in Table F correspond to the "start site", i.e., the gapmer is complementary to the 5' nucleoside in the human nucleic acid sequence (SEQ ID NO: 1).
TABLE F.3-11-3 LNA gapmer
/>
/>
Example 2: single dose MOE modified ASO in vitro mRNA reduction
Modified oligonucleotides complementary to human SNCA nucleic acid sequences were designed and tested in vitro for their selective efficacy in reducing SNCA mRNA levels in primary cortical neurons. Using neurons300nM of each antisense oligonucleotide treatment. qRT-PCR (TaqMan) TM ) mRNA levels were quantified using the following probes:
TGGCAACAGTGGCTGAGAAGACCAA (SEQ ID NO: 248) partner primer
Hs00240906_m1SNCA (ThermoFisher); and
CCAAGACTGAATGGCTGGATGGCAA (SEQ ID NO: 249) partner primer
PPIA_Mm02342430_g1 (ThermoFisher) (control).
Each of the modified oligonucleotides listed in tables G and H is complementary to either the human SNCA DNA sequence (SEQ ID NO: 1) or the mRNA sequence (SEQ ID NO: 3). The sequences in Table G are complementary to exons of the mRNA sequence, while the sequences in Table H are complementary to introns of the mRNA sequence. Each ASO is a 5-10-5 MOE gapmer of 20 nucleobases in length, with a central spacer segment comprising ten 2 '-deoxynucleosides and wing segments at both the 5' and 3 'ends comprising five 2' -MOE nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages.
The positions identified in tables G and H correspond to the "start sites", i.e.the gapmers are complementary to the 5' nucleosides in the modified human nucleic acid sequences SEQ ID NO. 1 and SEQ ID NO. 3. "#N/A" indicates that the sequence is not aligned to SEQ ID NO. 1 (e.g., where the sequence bridging the exon-exon junction is only present in mature mRNA).
TABLE G MOE modified ASO complementary to SNCA RNA exons
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
TABLE H MOE modified ASO complementary to SNCA RNA introns
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
/>
Example 3: in vitro mRNA reduction after multiple MOE modified ASO
Modified oligonucleotides complementary to human SNCA nucleic acid sequences were tested in vitro for their selective efficacy in reducing SNCA mRNA levels in primary cortical neurons. Neurons were treated with various doses (3. Mu.M; 1/2log dilution; 11 concentrations) of a given antisense oligonucleotide. This assay provides in vitro cell titers (pIC) of a given ASO in neurons 50 ＝-Log(IC 50 ) And efficacy (observed inhibition delta (%)). In addition, hill coefficients, which are slopes of lines in Hill plots, were measured to observe the shape of the dose response curve for each ASO.
Each of the modified oligonucleotides listed in Table I, table J and Table K is complementary to human SNCA nucleic acid sequence SEQ ID NO. 1 and/or SEQ ID NO. 3. The ASOs in table J were designed to be complementary to introns in the SNCA mRNA sequence, while the ASOs in tables I and K were designed to be complementary to exons in the SNCA mRNA sequence.
Each ASO in tables I, J and K is a 5-10-5 MOE gapmer. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each flanking wing segment comprising five 2' -MOE nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages.
SNCA_ASO_01617 in Table J is 5-10-5 MOE gapmer. The gapmer is 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and flanking both the 5' and 3 'ends a wing segment comprising five 2' -MOE nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosine. All internucleoside linkages are phosphorothioate linkages, except for phosphodiester linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18.
Each ASO in Table L is a 3-2-10-2-3 LNA/MOE hybrid gapmer. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising three LNA nucleosides and two 2' -MOE nucleosides. The ASO thus comprises 3 LNA nucleosides, 2' -MOE nucleosides, 10 2' -deoxynucleosides, 2' -MOE nucleosides and 3 LNA nucleosides from 5' to 3 '. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are Phosphorothioate (PS) linkages, except for the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17 and 18 and 19 which are Phosphodiester (PO) linkages.
Each ASO listed in Table M is 2-3-10-3-2 BNA/MOE gapmer. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising two BNA nucleosides and three 2' -MOE nucleosides. The ASO thus comprises, from 5' to 3', two BNA nucleosides, three 2' -MOE nucleosides, 10 2' -deoxynucleosides, three 2' -MOE nucleosides and two BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, with the exception that the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are Phosphodiester (PO) linkages.
The positions identified in Table I, table J, table K, table L and Table M correspond to the "start site", i.e., the gapmer is complementary to the 5' nucleoside in human SNCA nucleic acid sequences SEQ ID NO:1 and/or SEQ ID NO: 3.
TABLE I5-10-5 MOE gapmer complementary to SNCA RNA exons
/>
/>
TABLE J5-10-5 MOE gapmer complementary to SNCA RNA introns
/>
/>
/>
/>
TABLE K5-10-5 MOE gapmer complementary to SNCA RNA exons
Table L.3-2-10-2-3 LNA/MOE hybrid gapmer
Table M.2-3-10-3-2 BNA/MOE Mixed gapmer
Example 4: tolerance and efficacy of modified oligonucleotides complementary to human SNCA in hsneca mice
Three month old hsneca mice received a single ICV bolus of modified oligonucleotides listed in the table shown at a dose of 30 nmol. Each modified oligonucleotide is complementary to a human SNCA genomic nucleic acid sequence (SEQ ID NO: 1). The positions in the table indicate the 5' nucleoside of the oligonucleotide that is complementary to the human nucleic acid sequence (SEQ ID NO: 1).
For tolerability studies, tolerability scores were expressed as a functional observations collection (FOB) score at one hour post injection.
For efficacy studies, most of the treatment groups consisted of three animals. As shown, mice were sacrificed two or six weeks after injection. Brain tissue was collected and hsneca mRNA levels were measured as described above. The results are presented in the table as percent reduction in the amount of SNCA mRNA relative to vehicle control. A value of 0% reduction indicates that the compound was not effective.
I.5-10-5 MOE gapmer (PS) tolerance
Each ASO in Table N is a 5-10-5 MOE gapmer as described above, wherein all cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are Phosphorothioate (PS) linkages. FIG. 4 is a bar graph comparing the tolerability of selected 5-10-5 MOE gapmers. Compounds with FOB greater than ten were excluded from further assays. The structure of snca_aso_01617 is as described above.
TABLE N5-10-5 MOE gapmer tolerance in hSNCA mice
/>
/>
/>
/>
II.5-10-5 MOE gapmer (PS) efficacy
Each ASO listed in Table O is a 5-10-5 MOE gapmer as described above, wherein all cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages. FIG. 4 is a bar graph comparing the efficacy of selected 5-10-5 MOE gapmers. The structure of snca_aso_01617 is as described above.
Two weeks after injection, several ASOs reduced the amount of human SNCA mRNA in mice, as shown below.
TABLE O.5-10-5 MOE gapmer effect in hSNCA mice
/>
III.tolerance of 3-2-10-2-3 LNA/MOE Mixed gapmer (PS)
Each ASO listed in Table P is a 3-2-10-2-3 LNA/MOE hybrid gapmer, except SNCA_ASO_00033, which is a 5-10-5 MOE gapmer as described above, was used as a control. LNA/MOE hybrid gapmer is 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising three LNA nucleosides and two 2' -MOE nucleosides. The ASO thus comprises, from 5' to 3', 3 LNA nucleosides, two 2' -MOE nucleosides, 10 2' -deoxynucleosides, two 2' -MOE nucleosides and 3 LNA nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages.
No further experiments were performed on compounds 00937, 00938, 00941 and 00942 to determine mRNA reduction levels, as they did not show promising FOB results. Mice treated with these compounds were sacrificed.
Tolerance of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
Tolerance of IV.3-2-10-2-3 LNA/MOE gapmer (PS/PO)
Each ASO listed in Table Q (except for the control SNCA_ASO_00033) is a 3-2-10-2-3 LNA/MOE hybrid gapmer. FIG. 5 is a bar graph comparing the tolerability of selected 3-2-10-2-3 LNA/MOE hybrid gapmers. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are Phosphorothioate (PS) linkages, with the exception of linkages between nucleosides 2 and 3, 4 and 5, 16 and 17 and 18 and 19, which are Phosphodiester (PO) linkages.
TABLE Q tolerance of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
/>
Tolerance of 3-2-10-2-3 LNA/MOE gapmer (PS/PO)
Each ASO listed in Table R is 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine. All internucleoside linkages are phosphorothioate linkages, except that the linkages between nucleosides 2 and 3, 4 and 5 and 16 and 17 are phosphodiester linkages.
TABLE R tolerance of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
Tolerance of VI.3-2-10-2-3 LNA/MOE gapmer (PS/PO)
Each ASO listed in Table S is 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages, except that the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 18 are phosphodiester linkages.
TABLE S tolerance of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
VII.efficacy of 3-2-10-2-3 LNA/MOE gapmer (PS/PO)
Each ASO listed in Table T (except for the control SNCA_ASO_00033) is a 3-2-10-2-3 LNA/MOE hybrid gapmer. FIG. 5 is a bar graph comparing the efficacy of selected 3-2-10-2-3 LNA/MOE hybrid gapmers. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, with the exception that the linkages between nucleosides 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester linkages.
Two weeks after injection, several ASOs reduced the amount of human SNCA mRNA in mice, as shown below.
TABLE T Effect of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
/>
VIII.3-2-10-2-3 LNA/MOE gapmer (PS/PO) efficacy
Each ASO in Table U is 3-2-10-2-3 LNA/MOE gapmer. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, with the exception that the linkages between nucleosides 2 and 3, 4 and 5 and 16 and 17 are phosphodiester linkages.
As shown below, these ASOs reduced the amount of human SNCA mRNA in mice two weeks after injection.
TABLE U effect of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
IX.3-2-10-2-3 LNA/MOE gapmer (PS/PO) efficacy
Each ASO in Table V is 3-2-10-2-3 LNA/MOE gapmer. All cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages, except that the linkages between nucleosides 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 18 are phosphodiester linkages.
As shown below, these ASOs reduced the amount of human SNCA mRNA in mice two weeks after injection.
TABLE V Effect of 3-2-10-2-3 LNA/MOE Mixed gapmer in hSNCA mice
Tolerance to X.2-3-10-3-2 BNA/MOE gapmer (PS/PO)
Each ASO listed in Table W (except for the comparison SNCA_ASO_00033) is 2-3-10-3-2 BNA/MOE gapmer. FIG. 6 is a bar graph comparing the tolerability of selected 2-3-10-3-2 BNA/MOE gapmers. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising two BNA nucleosides and three 2' -MOE nucleosides. Each ASO thus comprises, from 5' to 3', two BNA nucleosides, three 2' -MOE nucleosides, 10 2' -deoxynucleosides, three 2' -MOE nucleosides, and two BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, with the exception that the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester linkages.
TABLE W tolerance of 2-3-10-3-2 BNA/MOE cocktail gapmer in hSNCA mice
/>
XI.efficacy of 3-2-10-2-3 BNA/MOE gapmer (PS/PO)
Each ASO listed in Table X (except for the control SNCA_ASO_00033) is a 3-2-10-2-3 BNA/MOE hybrid gapmer. FIG. 6 is a bar graph comparing the efficacy of selected 2-3-10-3-2 BNA/MOE gapmers. These gapmers are 20 nucleobases long, with a central spacer segment comprising ten 2 '-deoxynucleosides and each wing segment comprising three BNA nucleosides and two 2' -MOE nucleosides. Each ASO thus comprises, from 5' to 3', three BNA nucleosides, two 2' -MOE nucleosides, 10 2' -deoxynucleosides, two 2' -MOE nucleosides, and three BNA nucleosides. All cytosines throughout each gapmer are 5-methylcytosines and all internucleoside linkages are phosphorothioate linkages, with the exception that the linkages between nucleosides 3 and 4, 4 and 5, 16 and 17, and 17 and 18 are phosphodiester linkages.
As shown below, these ASOs significantly reduced the amount of human SNCA mRNA in mice as fast as two weeks after injection. TABLE X Effect of 2-3-10-3-2 BNA/MOE Mixed gapmer in hSNCA mice
Example 5: tolerance, efficacy and biodistribution of multiple doses of modified oligonucleotides complementary to human SNCA in hsneca mice
Three month old hsneca mice received a single ICV bolus of the modified oligonucleotides listed at the doses described in the table shown. hsneca mice were divided into groups of six mice. One group of six mice received PBS as a negative control for each experiment. For tolerability studies, tolerability scores were expressed as a functional observations collection (FOB) score at one hour post injection.
For efficacy studies, mice were sacrificed four weeks after injection, with the exception of the asterisk plot, where analysis was performed two weeks after injection. Cortical brain tissue was collected and hsnoca mRNA levels were measured as described above, and α -synuclein levels were measured with ELISA kits as described above. The results are presented in the table as percent reduction in the amounts of SNCA mRNA and α -synuclein relative to vehicle (PBS) control. A value of 0% reduction indicates that the compound was not effective.
For biodistribution studies, the concentration of snca_aso in hsneca mouse cortex was quantified by High Performance Liquid Chromatography (HPLC) fluorescence.
I. Tolerability and efficacy of multiple doses of 2-3-10-3-2 BNA/MOE,3-2-10-2-3 LNA/MOE and 5-10-5 MOE gapmer (PS/PO)
Snca_aso_01613 in table Y is a 2-3-10-3-2 BNA/MOE gapmer as described above, wherein the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17-18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages and each cytosine is a 5-methylcytosine. Snca_aso_01625 in table Z is 3-2-10-2-3 LNA/MOE gapmer as described above, wherein the internucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester internucleoside linkages, the remaining internucleoside linkages are phosphorothioate internucleoside linkages and each cytosine is a 5-methylcytosine. SNCA_ASO_01617 (SEQ ID NO: 1264) in Table AA is a 5-10-5 MOE gapmer, in which the central spacer segment contains ten 2 'deoxynucleosides and is flanked by wing segments containing the 5' and 3 'ends of each of the five 2' MOE nucleosides. In SNCA-ASO 01617, all cytosine residues throughout each gapmer are 5-methylcytosine and all internucleoside linkages are phosphorothioate linkages, except phosphodiester linkages between the 2 and 3, 3 and 4, 4 and 5, 16 and 17, and 17 and 18 positions.
Fig. 7 is a bar graph comparing the efficacy of snca_aso_1613, snca_aso_1617 and snca_aso_1625 at different doses 1, 5, 10, 30 or 100nmol based on expression of SNCA mRNA. Fig. 8 is a bar graph comparing the efficacy of snca_aso_1613, snca_aso_1617 and snca_aso_1625 at different doses 1, 5, 10, 30 or 100nmol based on the expression of alpha synuclein. mRNA levels and protein levels were analyzed for decreases two weeks after injection.
Table Y. tolerance and efficacy of multiple doses of 2-3-10-3-2 BNA/MOE cocktail gapmer in hSNCA mice
Tolerance and efficacy of multiple doses of 3-2-10-2-3 LNA/MOE cocktail gapmer in hSNCA mice
Tolerance and efficacy of 5-10-5 MOE gapmer at multiple doses in hSNCA mice
Dose-response of ASO concentration in cortex analyzed by ELISA
In Table AB, SNCA_ASO_01613 is 2-3-10-3-2 BNA/MOE gapmer as described above, where the internucleoside linkages between nucleosides 3 and 4, 4 and 5, 16 and 17 and 18 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine; snca_aso_01625 is a 3-2-10-2-3 LNA/MOE gapmer as described above, wherein the internucleoside linkages between nucleosides 2 and 3, 4 and 5, 16 and 17 and 18 and 19 are phosphodiester internucleoside linkages, the other internucleoside linkages are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine; and SNCA_ASO_01617 is 5-10-5 MOE gapmer, wherein all cytosine nucleobases of the entire 5-10-5 MOE gapmer are 5-methylcytosine as described above.
FIG. 9 is a plot showing the amount of ASO per mg of cortex quantified by HPLC fluorescence after a single ICV injection of multiple doses.
Dose effect of ASO concentration in cortex of hsneca mice
Example 6: tolerance of modified oligonucleotides in rats
Male Winstar rats received a single intrathecal bolus of oligonucleotide at a dose of 2.5 mg. The dosing solution was prepared using a sterile saline syringe and a nuclease-free centrifuge tube. The tubes containing the ASO powder were centrifuged briefly before the aCSF solution was added, followed by centrifugation for an additional 10 minutes to completely dissolve the ASO powder. The solution was vortexed for approximately 1 minute, stored at 4 ℃ and filtered with a 0.22 μm filter prior to use.
For tolerability studies, tolerability scores were expressed as the functional observations set (FOB) scores at one hour, three hours, and twenty four hours post injection.
In table AC, tolerance characteristics of snca_aso_01617 and snca_aso_01613 were compared in rats at a dose of 2.5mg over time.
Table ac evaluation of tolerance in rats
Example 7: duration of action of multiple doses of modified oligonucleotides in hsneca mice
Three month old hsneca mice, divided into groups of five to six mice each, received a single bolus of either oligonucleotide snca_aso_1613 or snca_aso_1617 at two doses of 10 and 50nmol as described in table AD below. One group of three mice received PBS as a negative control for each experiment.
For efficacy studies, mice were sacrificed at different time points (weeks 2-6-12-20) after injection. Cortical, cerebellum and striatal brain tissue were collected and the level of hsneca mRNA was measured by qRT-PCR as described above, and the level of alpha synuclein was measured with ELISA kit as described above. The results are presented in the table as percent reduction in the amounts of SNCA mRNA and alpha synuclein relative to vehicle (PBS) control. A value of 0% reduction indicates that the compound was not effective.
FIG. 11 is a plot of SNCA mRNA expression quantified based on qRT-PCR as described above comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the cortex.
FIG. 12 is a plot of SNCA mRNA expression quantified based on qRT-PCR as described above comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the cerebellum.
FIG. 13 is a plot of SNCA mRNA expression quantified based on qRT-PCR as described above comparing SNCA-ASO-01617 and SNCA_ASO_01613 at doses of 10nmol and 50nmol in the striatum.
Table ad. PK/PD analysis at different time points in hsneca mice
Example 8: in vitro alpha-synuclein pathology reduction
At DIV0, primary neuronal cultures (35000 cells/well) from hsneca a53T mice as described above were cultured and subsequently transfected with 200nM human α -synuclein preformed fibrils (PFFs, from StressMarq Bioscience SPR-316) on the seventh day (DIV 7) after primary neuronal culture and treated with 6, 20, 60, 200 or 170nM SNCA_ASO_01613 or snca_aso_01617 on the fourth day (DIV 4), seventh day (DIV 7) or tenth day (DIV 10) after primary neuronal culture, as shown in fig. 14. Controls with non-specific (Malat 1) ASO were used. After day 19 (DIV 19) following primary neuronal culture, cells were lysed and alpha-synuclein pathology was analyzed by measuring the level of phosphorylated form of alpha-synuclein (pS 129) using a commercial immunoassay kit (Cisbio, #6 FSYNPEG) according to the manufacturer's instructions. This assay is based on a sandwich assay employing two different specific antibodies labeled with donor or acceptor dyes, one antibody binding to the pS129 motif of the α -synuclein and the other antibody recognizing the α -synuclein. Their specific binding and proximity to phosphorylated α -synuclein produces a FRET (fluorescence resonance energy transfer) signal proportional to protein level.
FIG. 15 is a bar graph showing the levels of alpha-synucleinopathy (phosphorylated form) in primary neuronal cultures as measured by TR-FRET based immunoassays. The level of phosphorylated α -synuclein was normalized to α -tubulin levels and the values correlated with vehicle (PBS) -treated wells. At DIV7, the vaccinated neurons were treated with either a large dose (330 nM) of specific ASO (SNCA) or non-specific ASO (Malat 1) as described in table AE below.
Table AE. levels of phosphorylated α -synuclein in primary neurons
FIG. 16 is a bar graph showing the levels of alpha-synucleinopathy (phosphorylated form) in primary neuronal cultures as measured by TR-FRET based immunoassays, mean ± SEM. The level of phosphorylated α -synuclein was normalized to α -tubulin levels and the values correlated with vehicle (PBS) -treated wells. Dose-response effects were evaluated on vaccinated neurons treated with specific ASOs on the fourth, seventh or tenth day as described in table AF.
TABLE AF levels of phosphorylated alpha-synuclein in primary neurons
/>

Claims (28)

1. An oligonucleotide comprising a nucleotide sequence of 15 to 30 consecutive nucleotides, wherein the nucleotide sequence is complementary to a region of equal length present in the following nucleotides of SEQ ID No. 1:
a)16350-16450，
b)18926-19030，
c)22250-22471，
d)22933-23079，
e)23408-23700，
f)29753-29819，
g)38128-38158，
h)39852-39906，
i) 53762-53799, or
j) 59754-59865, optionally wherein said nucleotide sequence comprises no more than 3 mismatches with said region.
2. The oligonucleotide of claim 1, wherein the nucleotide sequence is 16 to 20 consecutive nucleotides in length.
3. The oligonucleotide of claim 1 or 2, wherein the nucleotide sequence comprises 0, 1 or 2 mismatches with the region.
4. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is single stranded.
5. The oligonucleotide according to any of the previous claims, wherein said nucleotide sequence is selected from the group consisting of SEQ ID NOs 18-40.
6. The oligonucleotide of any one of the preceding claims, comprising one or more ribonucleotides, one or more deoxyribonucleotides, or a combination of both.
7. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises one or more modified nucleotides.
8. The oligonucleotide of any one of the preceding claims, wherein the one or more modified nucleotides comprise a 2 '-O-methoxyethyl (2' -MOE) nucleotide, a Locked Nucleic Acid (LNA) nucleotide, a Bridged Nucleic Acid (BNA) nucleotide, or any combination thereof.
9. The oligonucleotide of any one of the preceding claims, wherein all cytosines in the oligonucleotide are 5-methylcytosines.
10. The oligonucleotide of any one of the preceding claims, comprising at least 1, 2, 3, 4, or 5 phosphodiester internucleoside linkages.
11. The oligonucleotide of any one of the preceding claims, wherein at least 1, 2, 3, 4, or 5 or all of the internucleoside linkages are phosphorothioate internucleoside linkages.
12. The oligonucleotide of any one of claims 7-11, wherein the oligonucleotide comprises:
i)5-10-5MOE gapmer；
ii)4-10-4MOE gapmer；
iii)3-10-3LNA gapmer；
iv)3-11-3LNA gapmer；
v)3-2-10-2-3LNA/MOE gapmer；
vi)2-3-10-3-2BNA/MOE gapmer；
vii) 3-2-10-2-3BNA/MOE gapmer; or (b)
viii)2-3-10-3-2LNA/MOE gapmer。
13. The oligonucleotide of claim 12, wherein the oligonucleotide comprises:
i)3-2-10-2-3LNA/MOE gapmer；
ii)2-3-10-3-2BNA/MOE gapmer；
iii) 3-2-10-2-3BNA/MOE gapmer; or (b)
iv)2-3-10-3-2LNA/MOE gapmer；
And wherein the internucleoside linkages between
v) 2 and 3, 4 and 5, 16 and 17 and 18 and 19;
vi) 2 and 3, 4 and 5, and 16 and 17;
vii) 2 and 3, 3 and 4, 4 and 5, 16 and 17 and 18; or (b)
viii) 3 and 4, 4 and 5, 16 and 17 and 18
Is a phosphodiester internucleoside linkage; and the remaining internucleoside linkages are phosphorothioate internucleoside linkages.
14. An oligonucleotide comprising the formula:
i)Als Tlo mCls Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Tes Tlo Tls mCl(SEQ ID NO:34)，
ii)Abs Tbs mCeo Aeo mCes mCds Tds Tds mCds Ads Ads Ads mCds mCds mCds mCeo Teo Tes Tbs mCb(SEQ ID NO:20)，
iii)Als Alo Tls Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aes mClo mCls Al(SEQ ID NO:33)，
iv)Abs Abs Teo Aeo Ges mCds Ads Tds mCds mCds Tds Tds mCds mCds Ads mCeo Aeo mCes mCbs Ab(SEQ ID NO:19)，
v)Gbs mCbs Aeo Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCeo Aes Tbs mCb(SEQ ID NO:18)，
vi)mCbs mCbs Geo Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCeo Tes Tbs Tb(SEQ ID NO:21)，
vii)Tbs Tbs Geo mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCeo mCes Abs mCb(SEQ ID NO:22)，
viii)Abs Gbs Teo Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aeo Tes Tbs Ab(SEQ ID NO:23)，
ix)mCbs mCbs Aeo Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Teo Tes mCbs Ab(SEQ ID NO:24)，
x)Gbs mCbs Aeo Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aeo mCes Tbs Tb(SEQ ID NO:25)，
xi)mCbs Gbs Geo Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Teo Tes Tbs mCb(SEQ ID NO:26)，
xii)Gbs Abs Aeo mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCeo Tes mCbs mCb(SEQ ID NO:27)，
xiii)Abs mCbs Teo Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Teo Aes mCbs mCb(SEQ ID NO:28)，
xiv)Tbs Abs mCeo Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aeo mCes Tbs Tb(SEQ ID NO:29)，
xv)Abs Abs Geo mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCeo Tes Abs Ab(SEQ ID NO:30)，
xvi)Tbs mCbs mCeo Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCeo mCes Abs Ab(SEQ ID NO:31)，
xvii)Gls mClo Als Geo Tes Tds mCds Tds Ads Tds mCds mCds mCds Ads mCds Teo mCes Alo Tls mCl(SEQ ID NO:32)，
xviii)mCls mClo Gls Geo Tes Gds mCds mCds Ads Tds Tds Ads mCds Tds mCds mCeo mCes Tlo Tls Tl(SEQ ID NO:35)，
xix)Tls Tlo Gls mCeo Aes Gds Ads Tds Ads Ads Ads mCds mCds Ads Tds mCeo mCes mClo Als mCl(SEQ ID NO:36)，
xx)Als Glo Tls Geo mCes mCds Ads Gds Ads mCds mCds mCds Tds Tds Tds mCeo Aes Tlo Tls Al(SEQ ID NO:37)，
xxi)mCls mClo Als Aeo Ges Tds Gds mCds mCds Ads Gds Ads mCds mCds mCds Teo Tes Tlo mCls Al(SEQ ID NO:38)，
xxii)Gls mClo Als Geo Aes Tds Ads Ads Ads mCds mCds Ads Tds mCds mCds mCeo Aes mClo Tls Tl(SEQ ID NO:39)，
xxiii)mCls Glo Gls Teo Ges mCds mCds Ads Tds Tds Ads mCds Tds mCds mCds mCeo Tes Tlo Tls mCl(SEQ ID NO:40)，
xxiv)Gls Alo Als mCeo Tes Gds Ads Tds Gds mCds mCds Tds mCds Tds Ads mCeo mCes Tlo mCls mCl(SEQ ID NO:41)，
xxv)Als mClo Tls Geo Aes Ads mCds Tds Gds Ads Tds Gds mCds mCds Tds mCeo Tes Alo mCls mCl(SEQ ID NO:42)，
xxvi)Tls Alo mCls Aeo Tes Gds Gds mCds mCds Ads Gds Ads Ads Ads mCds mCeo Aes mClo Tls Tl(SEQ ID NO:43)，
xxvii)Als Alo Gls mCeo mCes Ads Ads Gds mCds mCds mCds Ads Ads Ads mCds Aeo mCes Tlo Als Al(SEQ ID NO:44)，
xxviii)Tls mClo mCls Aeo Aes Ads Gds Gds Ads Gds mCds Ads mCds mCds Ads Aeo mCes mClo Als Al(SEQ ID NO:45)，
wherein the method comprises the steps of
A is adenine and the amino acid is a compound,
mC is 5-methylcytosine and,
G is a guanine group and the group is a guanine,
t is thymine and the T is thymine,
e is a ribose modified with a 2' -MOE,
d is 2 '-deoxyribose, and the amino acid is a 2' -deoxyribose,
b is a BNA and is preferably selected from the group consisting of BNA,
l is the number of the LNA,
o is a phosphodiester internucleoside linkage, and
s is a phosphorothioate internucleoside linkage.
15. An oligonucleotide comprising the structural formula:
16. an oligonucleotide comprising the structural formula:
17. an oligonucleotide comprising the structural formula:
18. an oligonucleotide comprising the structural formula:
19. an oligonucleotide conjugate comprising an oligonucleotide according to any of the preceding claims.
20. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-18 or the oligonucleotide conjugate of claim 19, and a pharmaceutically acceptable excipient.
21. A method of reducing alpha-synuclein expression in a mammalian cell comprising contacting the cell with an oligonucleotide according to any of claims 1-18, an oligonucleotide conjugate according to claim 19 or a pharmaceutical composition according to claim 20, thereby reducing alpha-synuclein expression in the cell.
22. The method of claim 21, wherein the cell is a cell in the central nervous system, optionally a cell in the human brain.
23. A method of treating a synucleinopathy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of an oligonucleotide according to any of claims 1-18, an oligonucleotide conjugate according to claim 19, or a pharmaceutical composition according to claim 20.
24. The method of any one of claims 21-23, wherein the oligonucleotide reduces SNCA mRNA levels in murine primary cortical neurons engineered to express human a-synuclein by at least 25, 50, 75, or 80%.
25. The method of claim 23 or 24, wherein the oligonucleotide is injected intrathecally or intracranially into the subject.
26. Use of the oligonucleotide of any one of claims 1-18 or the oligonucleotide conjugate of claim 19 for the preparation of a medicament for treating synucleinopathy in a subject in need thereof in a method according to any one of claims 23-25.
27. Use of the oligonucleotide of any one of claims 1-18, the oligonucleotide conjugate of claim 19 or the pharmaceutical composition of claim 20 for treating a synucleinopathy in a subject in need thereof in a method of any one of claims 23-25.
28. The method, use, oligonucleotide for use, oligonucleotide conjugate for use or pharmaceutical composition for use according to any one of claims 23-27, wherein the synucleinopathy is parkinson's disease, dementia with lewy bodies, alzheimer's disease or multiple system atrophy.
CN202280033253.1A 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting expression of alpha-synuclein Pending CN117280032A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP21315033.7 2021-03-08
EP21306123 2021-08-17
EP21306123.7 2021-08-17
PCT/EP2022/055770 WO2022189363A1 (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting alpha-synuclein expression

Publications (1)

Publication Number Publication Date
CN117280032A true CN117280032A (en) 2023-12-22

Family

ID=77666438

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202280033253.1A Pending CN117280032A (en) 2021-03-08 2022-03-07 Antisense oligonucleotides for inhibiting expression of alpha-synuclein

Country Status (1)

Country Link
CN (1) CN117280032A (en)

Similar Documents

Publication Publication Date Title
AU2017268534B2 (en) Method for efficient exon (44) skipping in Duchenne Muscular Dystrophy and associated means
JP6265940B2 (en) Selective inhibition of polyglutamine protein expression
CN109715801A (en) For treating the material and method of α1 antitrypsin deficiency
US20140128449A1 (en) Oligonucleotide modulation of splicing
US20220411796A1 (en) Compositions and methods for decreasing tau expression
CA3020487A1 (en) Treatment of idiopathic pulmonary fibrosis using rna complexes that target connective tissue growth factor
KR20240036132A (en) Composition and methods for modulating of smn2 splicing in a subject
WO2010050801A1 (en) Methods and means for efficient skipping of exon 45 in duchenne muscular dystrophy pre-mrna
TW202012624A (en) Oligonucleotides for modulating atxn2 expression
JP2023536974A (en) Compositions and methods for inhibiting LPA expression
CN115397436A (en) RNAi agents for inhibiting PNPLA3 expression, pharmaceutical compositions and methods of use thereof
CN116234585A (en) Microtubule-associated protein TAU (MAPT) iRNA agent compositions and methods of use thereof
US10933081B2 (en) Myostatin iRNA compositions and methods of use thereof
KR20230018377A (en) Apolipoprotein E (APOE) IRNA preparation composition and method of use thereof
CN117280032A (en) Antisense oligonucleotides for inhibiting expression of alpha-synuclein
US20230139166A1 (en) RNAi Agents for Inhibiting Expression of Xanthine Dehydrogenase (XDH), Pharmaceutical Compositions Thereof, and Methods of Use
JP6987041B2 (en) Modified antisense oligomers for exon inclusion in spinal muscular atrophy
JP2024508956A (en) Antisense oligonucleotides for inhibiting alpha-synuclein expression.
WO2021053581A1 (en) A microrna dyslipidemia inhibitor
JPWO2005074988A1 (en) Neuronal differentiation inducer
CN117210468B (en) SiRNA for targeted regulation and control of PCSK9 gene expression and application thereof
US11058710B1 (en) MicroRNA ANGPTL3 inhibitor
WO2024005158A1 (en) Oligonucleotide
TW202345873A (en) Compositions and methods for modulatingscapactivity
TW202305134A (en) Huntingtin (htt) irna agent compositions and methods of use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination