EP3649235A1 - Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectieuses - Google Patents
Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectieusesInfo
- Publication number
- EP3649235A1 EP3649235A1 EP18753445.8A EP18753445A EP3649235A1 EP 3649235 A1 EP3649235 A1 EP 3649235A1 EP 18753445 A EP18753445 A EP 18753445A EP 3649235 A1 EP3649235 A1 EP 3649235A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- site
- seq
- deleted
- gene
- locus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/36—Adaptation or attenuation of cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/002—Protozoa antigens
- A61K39/012—Coccidia antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/44—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from protozoa
- C07K14/45—Toxoplasma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/64—General methods for preparing the vector, for introducing it into the cell or for selecting the vector-containing host
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
Definitions
- the present invention relates to novel attenuated strains of apicomplexes and their use as an antigen vector for the prevention of infectious diseases.
- Apicomplexes are obligate, mostly intracellular parasites that have a life cycle that can involve multiple hosts.
- the phylum of these parasites is subdivided into several families.
- Toxoplasma gondii belongs to the family Sarcocystidae.
- the cat the definitive host, excretes the parasite into the environment as oocysts.
- Intermediate hosts i.e. all homeotherms
- definitive may become infected by ingesting oocysts present on the food.
- the parasite is then transformed into tachyzoites which spread in the body and which, under the pressure of the immune system, encyst with a preferential tropism for the central nervous system, retina or muscles. Ingestion of encysted tissue is the second leading cause of contamination of final and intermediate hosts.
- Toxoplasma gondii the parasite responsible for toxoplasmosis
- This strain called Toxo tgmicl-3 KO, generates a strong and specific immune response against Toxoplasma gondii and makes it possible to prevent the effects of a subsequent infection in mice (Ismael et al., 2006, J. Infect Dis., 194 ( 8): 1176-83) and in ewes (Mévelec et al., 2010, Vet Res., 41 (4): 49).
- Neospora caninum (N. caninum) is an intracellular parasite responsible for neosporosis. It belongs also to the Sarcocystidae family. The life cycle of Neospora caninum is very close to that of T. gondii with two distinct phases: a sexual phase in the final host (ie canids and the dog in particular) which leads to the production of oocysts eliminated in the feces and an asexual phase in an intermediate host (ie sheep, goats, cattle, equines, etc.) which leads to the production of tachyzoites and cysts containing the bradyzoites.
- a sexual phase in the final host ie canids and the dog in particular
- oocysts eliminated in the feces and an asexual phase in an intermediate host (ie sheep, goats, cattle, equines, etc.) which leads to the production of tachyzoites and cysts containing the bra
- Neospora caninum Neo strain ncmicl-3 KO
- Neo strain ncmicl-3 KO a live attenuated strain of Neospora caninum
- This mutant strain has been shown to possess infectious and immunogenic properties conferring on mammals vaccine protection against the deleterious effects of neosporosis.
- Parasites of the Sarcocystidae family such as Toxoplasma gondii and Neospora caninum can be used to express heterologous proteins from other parasites such as Plasmodium spp, Cryptosporidium parvum or Leishmania spp.
- the wild strain RH of Toxoplasma gondii was used as a vector of the CSP (Plasmodium knowlesi protein Circum Sporozoite) antigen (Di Carlos et al., 1999, Infect Immun., 67 (4): 1677-82). .
- the recombinant strain was inoculated into Rhesus monkeys and induced in the animal a humoral immune response specific for the CSP protein.
- the thermosensitive strain ts-4 HXGPR " of Toxoplasma gondii was used as vector of Plasmodium yoelii CSP antigen (Charest et al., 2000, J. Immunol, 165 (4): 2084-92).
- the recombinant parasites were inoculated into the mouse inducing a humoral immune response specific for the CSP antigen but insufficient to induce protection against infection with Plasmodium yoelii.
- a strain of Toxoplasma gondii has also been used to express the gp40, gp15 and gp40 / gp15 precursor genes of Cryptosporidium parvum, the parasite responsible for cryptosporidiosis (O'Connor et al., Infect Immun., 2003 71 (10): 6027-35, O'Connor et al., 2007, Mol Biochem Parasitol, 152 (2): 148-58).
- the gp40 / gp15, gp40 and gp15 genes were cloned, placed under the control of a T. gondii promoter and randomly integrated into the parasite genome.
- Another team was also interested in the use of Toxoplasma gondii as a vector for Cryptosporidium parvum antigen and in particular for the immunodominant surface protein P23 (Shirafuji et al, 2005, J. Parasitol, 91 (2): 476- 9). The molecular weight and antigenic properties of recombinant P23 are similar to those of Native protein and mice immunized with lysed tachyzoites expressing P23 protein produced neutralizing antibodies directed against C. parvum.
- T. gondii was used as an expression vector for Leishmania Kmpl I antigen.
- the recombinant strain obtained allows a significant protection of the animals during a challenge with L. major (Ramirez et al., 2001, Vaccine, 20: 455-61).
- Neospora caninum was also used as a heterologous antigen vector and a recombinant N. caninum strain stably expressing T. gondii S AGI antigen was constructed (Zhang et al, 2010, Vaccine, 60 (1): 105-7).
- the expression level, the molecular weight and the antigenic properties of the AGI S protein expressed in N. caninum are similar to those of the native S AGI protein and the immunized mice produce a Th1 type S1-specific immune response of T gondii and are protected against a lethal challenge with T. gondii.
- the Cre / loxP system has been used in mammalian cell gene activation or inactivation strategies (Fukushige and Sauer, 1992, PNAS, 89 (17): 7905-9) or transgenic mice (Tsien et al. , 1996, Cell, 87 (7): 1317-26.).
- Cre Recombinase is an enzyme derived from the bacteriophage PI (Sternberg and Hamilton, 1981, J. Mol Biol, 150 (4): 487-507) of the family of integrases which recognize very specific sites and allow recombination between two identical sites.
- the Cre Recombinase restriction site is the loxP site, a 34 base pair nucleotide sequence (SEQ ID NO: 12) that includes two small 13-base pair repeated and inverted sequences and a spacer region (in bold) of 8 base pairs.
- SEQ ID NO: 12 a 34 base pair nucleotide sequence
- spacer region in bold
- Cre / LoxP In Toxoplasma gondii, the Cre / Lox system was first used in 1999 (Brecht et al., 1999, Gene, 234 (2): 239-47). Following the random insertion of a reporter gene flanked by LoxP sites oriented in an identical direction, the action of Cre Recombinase allowed the deletion of the reporter gene and the formation of a LoxP scar. Cre Recombinase was then used to integrate a new heterologous transgene at this LoxP scar. More recently ; the Cre / LoxP system has been used for the production of a Toxoplasma gondii strain deleted for the morn1 gene (Heaslip et al., 2010, PloS Pathog, 6 (2): el000754).
- T. gondii KO (knockout) strains have been created using a dimerizable form of inducible Cre Recombinase only after addition of a ligand: rapamycin (Andenmatten et al., 2013, Nat. 2): 125-7, Rugarabamu et al., 2015, Mol Microbiol, 97 (2): 244-62).
- the present invention relates to novel attenuated strains of Sarcocystidae (Toxoplasma gondii and Neospora caninum).
- the present invention also relates to the use of novel attenuated strains of Sarcocystidae (Toxoplasma gondii and Neospora caninum) as an antigen vector for the prevention of infectious diseases.
- Sarcocystidae Toxoplasma gondii and Neospora caninum
- the present invention relates to a mutant strain of Sarcocystidae in which at least one of the honey or mic3 genes is deleted, containing a specific recombination site of an enzyme allowing specific recombination, at the locus of said at least one deleted gene, and in in the case where the two genes honey and mic3 are deleted, the site of specific recombination of the enzyme allowing a specific recombination at the locus of the deleted honey gene is potentially different from that at the locus of the mic3 deleted gene.
- enzyme allowing specific recombination is meant enzyme catalyzing the recombination of DNA in a defined direction, between specific sites determined by sequences specific to each enzyme. They allow in particular the excision, insertion, inversion or translocation of a nucleotide sequence flanked by specific sites.
- an enzyme allowing specific recombination mention may be made, for example, of Cre recombinase, FLP recombinase, Tre recombinase, RecA and Hin recombinase proteins (bacteria).
- the genes honey and mic3 make it possible to code the proteins MIC1 and MIC3. These are micronemal proteins, secretory organelles of apicomplexes that play a central role in recognition and adhesion to host cells.
- the enzyme allowing specific recombination is the cre-recombinase.
- the mutant strain of Sarcocystidae in which at least one of the honey or mic3 genes is deleted contains a recombination site specific for the cre-recombinase, at the locus of said at least one deleted gene. and in the case where the two genes honey and mic3 are deleted, the specific recombination site of the cre-recombinase at the locus of the deleted honey gene is different from that at the locus of the deleted mic3 gene.
- deletion of the gene is understood to mean the deletion of the entire coding sequence (introns and exons), the deletion of the promoter region and the deletion of the 5 'and 3' untranslated transcribed regions, called 5 'and 3' UTR, the term “gene” designates the promoter region (also called promoter), the coding sequence and the 5 'and 3' UTR regions.
- Cre recombinase is a topoisomerase derived from bacteriophage PI, this enzyme is functional in parasites.
- the possible use of several lox sites that do not interact with one another makes it possible to envisage several deletions.
- recombination sites specific for Cre-recombinase the sites ⁇ , ⁇ , 1 ⁇ 2272, 1 ⁇ 71, 1 ⁇ 6, lox511, lox5171 and loxM2 can be cited in a non-exhaustive manner.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes honey and mic3 are deleted containing two specific recombination sites of an enzyme allowing a specific recombination including Cre-recombinase, said specific recombination sites being at the respective locus of each of the aforementioned deleted genes, the specific recombination site of the enzyme allowing a specific recombination, in particular of Cre-recombinase, at the locus of the deleted honey gene, being different from that at the locus of the deleted mic3 gene.
- the present invention relates to a mutant strain of Sarcocystidae in which said enzyme allowing a specific recombination is Cre-recombinase and in which in the case where the two genes honey and mic3 are deleted, the Specific recombination site of the enzyme allowing specific recombination at the locus of the deleted honey gene is different from that at the locus of the deleted mic3 gene.
- said mutant strain of Sarcocystidae is a strain of the genus Toxoplasma spp.
- This genus includes the species Toxoplasma gondii.
- said mutant strain of Sarcocystidae is a strain of the species Toxoplasma gondii.
- said mutant strain of Sarcocystidae is a strain of the genus Toxoplasma spp., In particular a strain of the species Toxoplasma gondii.
- said mutant strain of Sarcocystidae is a strain of the genus Neospora spp.
- Neospora caninum Neospora hughesi.
- said mutant strain of Sarcocystidae is a strain of the species Neospora caninum.
- said mutant strain of Sarcocystidae is a strain of the genus Neospora spp., In particular a strain of the species Neospora caninum.
- the present invention relates to a mutant strain of Sarcocystidae in which the two mic 1 and mic 3 genes are deleted, and which contains an enzyme-specific recombination site allowing specific recombination, in particular Cre-recombinase. at the locus of the deleted mic 1 gene, and a specific recombination site of the enzyme allowing a specific recombination, in particular of Cre recombinase, at the locus of the deleted mic3 gene, the site of recombination specific to the locus of the deleted honey gene being different of the recombination site specific to the locus of the deleted mic3 gene.
- an enzyme-specific recombination site allowing specific recombination, in particular Cre-recombinase. at the locus of the deleted mic 1 gene, and a specific recombination site of the enzyme allowing a specific recombination, in particular of Cre recombinase, at the locus of the deleted mic3 gene, the
- said mutant strain Sarcocystidae in which the two genes mic 1 and mic 3 are deleted contains a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, the Cre-recombinase specific recombination site at the locus of the deleted honey gene being different from that at the mic3 gene locus deleted.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes mic 1 and mic 3 are deleted, and containing two sites of recombination specific for an enzyme allowing specific recombination, in particular the Cre- recombinase, each of the two sites being respectively at the locus of each of the aforementioned deleted genes, the specific recombination site of the enzyme allowing a specific recombination including Cre-recombinase at the locus of the deleted honey gene being different from that at the locus of the mic3 gene deleted.
- the present invention relates to a mutant strain of Sarcocystidae in which the two mic 1 and mic 3 genes are deleted, and which contains an enzyme-specific recombination site allowing specific recombination, in particular Cre-recombinase.
- a specific recombination site of the enzyme allowing a specific recombination, in particular of Cre recombinase, at the locus of the deleted mic3 gene, the site of recombination specific to the locus of the deleted honey gene being different of the recombination site specific to the locus of the deleted mic3 gene, and said strain containing no heterologous DNA, other than those corresponding to the specific recombination sites of the enzyme allowing a specific recombination including Cre-recombinase, at the respective locus of each of the aforementioned genes deleted.
- the strain may contain as single heterologous DNA (s), one or several sequences corresponding to a specific recombination site of an enzyme allowing specific recombination.
- said mutant strain Sarcocystidae in which the two genes mic 1 and mic 3 are deleted contains a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, the Cre-recombinase specific recombination site at the locus of the deleted honey gene being different from that at the mic3 gene locus deleted, said strain containing no heterologous DNA, other than those corresponding to Cre-recombinase specific recombination sites, at the respective locus of each of the aforementioned deleted genes.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes honey and mic3 are deleted, and containing two sites of recombination specific for an enzyme allowing a specific recombination including Cre-recombinase, each of two sites being respectively at the locus of each of the above-mentioned deleted genes, the specific recombination site of the enzyme allowing a specific recombination, in particular Cre-recombinase, at the locus of the deleted honey gene being different from that at the locus of the deleted mic3 gene, and not containing heterologous DNA, other than those corresponding to enzyme-specific recombination sites allowing a specific recombination including Cre-recombinase at the respective locus of each of the aforementioned deleted genes.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes mic 1 and mic 3 are deleted, and containing a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, the Cre-recombinase specific recombination site, at the locus of the deleted honey gene being different from that at the locus of the deleted mic3 gene.
- said strain not containing heterologous DNA, other than those corresponding to the Cre-recombinase specific recombination sites, at the respective locus of each of the aforementioned deleted genes,
- each of the Cre-recombinase specific recombination sites, at the respective locus of the deleted honey and mic3 genes are selected from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68, the Cre-recombinase recombination site, at the deleted honey gene locus being different from that at the deleted mic3 gene locus.
- the present invention relates to a mutant strain according to the invention, in which the two genes honey and mic3 are deleted, containing two sites of specific recombination of an enzyme allowing a specific recombination, at the respective locus of each one.
- the site of specific recombination of the enzyme allowing a specific recombination, at the locus of the deleted honey gene being different from that at the locus of the deleted mic3 gene, and not containing heterologous DNA, other than heterologous DNAs corresponding to the specific recombination sites of the enzyme allowing specific recombination, in particular Cre-recombinase, at the respective locus of each of the aforementioned deleted genes, in particular said enzyme allowing a specific recombination being Cre-recombinase, and the recombination-specific recombination sites.
- the present invention relates to a mutant strain of Sarcocystidae in which the two honey and mic3 genes are deleted, and not containing heterologous DNA, other than those corresponding to the specific recombination sites of an enzyme allowing a specific recombination, in particular of Cre-recombinase, at the respective locus of each of the above-mentioned deleted genes and containing two specific recombination sites of the enzyme allowing a specific recombination, said enzyme being Cre-recombinase, each of the two sites being respectively at locus of each of the aforementioned deleted genes, said specific recombination sites being cre-recombinase specific recombination sites chosen from: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68, the Cre-recombinase recombination site at the deleted honey gene locus being different from that at the gene locus m
- the present invention relates to a mutant strain of Sarcocystidae in which the two mic 1 and mic 3 genes are deleted, and containing an enzyme-specific recombination site allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted mic 1 gene, and a specific recombination site of the enzyme allowing a specific recombination including Cre recombinase, at the locus of the deleted mic3 gene, the site of recombination specific to the deleted honey gene locus being different from the recombination site specific to the locus of the deleted mic3 gene, and said strain containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the specific recombination sites of the enzyme allowing a specific recombination including Cre-recombinase, at the respective locus of each of the genes honey and mi c3 deleted
- a first recombination site specific for the enzyme allowing specific recombination, in particular Cre-recombinase, corresponding to the specific recombination site of the enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted honey gene, and
- a first recombination site specific for the enzyme allowing specific recombination, in particular Cre-recombinase, corresponding to the specific recombination site of the enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted mic3 gene, and
- This embodiment targets the production of a heterologous RNA from said heterologous DNA in a mutant strain as described above.
- telomere By “telomeres necessary for the transcription of said heterologous DNA” is meant a promoter, a transcription initiation site, TATA box, a transcription terminator.
- the RNA thus transcribed may be a messenger RNA, an interfering RNA, a long non-coding RNA, a stem-loop RNA (in English "Hairpin RNA”),
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes honey and mic3 are deleted, and containing two sites of recombination specific for an enzyme allowing a specific recombination including Cre-recombinase, each of two sites being respectively at the locus of each of the above-mentioned deleted genes, the specific recombination site of the enzyme allowing a specific recombination, in particular Cre-recombinase, at the locus of the deleted honey gene being different from that at the locus of the deleted mic3 gene, and containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the specific recombination sites of the enzyme allowing a specific recombination, in particular the Cre-recombinase, at the respective locus of each of the aforementioned genes deleted, said heterologous DNA being flanked: a
- the present invention relates to a strain according to the invention, containing a heterologous DNA at the location of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the sites of specific recombination of the enzyme. allowing a specific recombination at the respective locus of each of the aforementioned deleted genes,
- heterologous DNA being flanked:
- said enzyme allowing specific recombination being Cre-recombinase and the specific Cre-recombinase recombination sites being chosen from: lox N of SEQ ID NO: 5, lox P of SEQ ID NO : 12 and lox 2272 of SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which the two mic 1 and mic 3 genes are deleted, and containing an enzyme-specific recombination site allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted mic 1 gene, and a recombination site specific to the enzyme allowing a specific recombination including Cre-recombinase at the locus of the mic3 gene deleted, the recombination site specific to the locus of the deleted gene honey being different from the locus of recombination specific to the locus of the mic3 gene deleted, said strain containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, other than those corresponding to the specific recombination sites of the enzyme allowing a specific recombination including Cre-recombinase, at the respective locus of each of the genes honey and mic3 deleted, such that: when said
- a first recombination site specific for the enzyme allowing specific recombination, in particular Cre-recombinase, corresponding to the specific recombination site of the enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted honey gene, and
- a first recombination site specific for the enzyme allowing specific recombination, in particular Cre-recombinase, corresponding to the specific recombination site of the enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted mic3 gene, and
- said mutant strain also comprises the means necessary for the expression of the aforementioned heterologous DNA .
- the present invention targets the protein expression of said heterologous DNA in a mutant as previously described.
- the present invention relates to a strain according to the invention containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the specific recombination sites of the enzyme allowing a specific recombination at the respective locus of each of the aforementioned honey and mic3 genes deleted, said heterologous DNA coding for a protein and being flanked:
- said enzyme allowing a specific recombination being Cre-recombinase and, the specific Cre-recombinase recombination sites being chosen from: lox N of SEQ ID NO: 5 , lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes honey and mic3 are deleted, containing two sites of recombination specific for an enzyme allowing a specific recombination including Cre-recombinase, each of them sites being respectively at the locus of each of the above-mentioned deleted genes, the site of specific recombination of the enzyme allowing a specific recombination including Cre-recombinase, at the locus of the deleted honey gene being different from that at the locus of the mic3 gene deleted, and containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the specific recombination sites of the enzyme allowing a specific recombination, in particular Cre-recombinase, at the respective locus of each of the aforementioned deleted genes; , said heterologous DNA encoding at least one protein and
- a first recombination site specific for the enzyme allowing specific recombination, in particular Cre-recombinase, corresponding to the specific recombination site of the enzyme allowing a specific recombination, in particular Cre-recombinase at the locus of the deleted honey gene, or that at the locus of the mic3 gene deleted, and
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes mic 1 and mic 3 are deleted, and containing a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, the Cre-recombinase specific recombination site, at the deleted honey gene locus (called site A) being different from that at the locus of the mic3 gene deleted (called site B), and said heterologous DNA-containing strain at the deleted honey gene locus or the deleted mic3 gene locus, different from those corresponding to Cre-recombinase specific recombination sites, at the respective locus of each of the genes honey and mic3 deleted, such that: when said heterologous DNA is inserted at the locus of the deleted gene honey, it is flanked:
- site C a second specific recombination site identical to the first specific recombination site located at the locus of the deleted honey gene (site A),
- heterologous DNA when said heterologous DNA is inserted at the locus of the deleted mic3 gene, it is flanked:
- a first recombination site specific for the enzyme allowing a specific recombination, in particular Cre-recombinase, corresponding to the site of specific recombination of the enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of the deleted mic3 gene (site B), and
- site C a second specific recombination site identical to the first specific recombination site located at the locus of the deleted mic3 gene (site B),
- said three specific recombination sites A, B and C being chosen from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68, such as
- said site A and said site B are different, and
- said site C is identical to said site A or B, it being understood that said strain comprises the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA encodes at least one protein.
- the present invention relates to a mutant strain of Sarcocystidae containing a heterologous DNA at the location of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the recombination sites specific for an enzyme allowing recombination.
- said enzyme is Cre-recombinase, at the respective locus of each of the aforementioned honey and mic3 deleted genes, and containing three specific recombination sites which are respectively:
- said site A and said site B are different, and
- said site C is identical to said site A or said site B.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes mic 1 and mic 3 are deleted, and containing a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, such as the Cre-recombinase specific recombination site at the deleted honey gene locus (designated site A) corresponds to a loxN site SEQ ID NO : 5 and that at the locus of the deleted mic3 gene (called site B) corresponds to a loxP site SEQ ID NO: 12,
- a first Cre-recombinase specific recombination site corresponding to the Cre-recombinase specific recombination site, at the deleted honey gene locus (site A) corresponding to a loxN site SEQ ID NO: 5, and
- site C a second specific recombination site corresponding to a loxN site SEQ ID NO: 5, identical to the first specific recombination site located at the location of the deleted honey gene (site A), when said heterologous DNA is inserted at locus gene mic3 deleted, it is flanked:
- a first Cre-recombinase specific recombination site corresponding to a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene (site B) corresponding to a loxP site SEQ ID NO: 12, and
- a second specific recombination site (site C) corresponding to a loxP site SEQ ID NO: 12, identical to the first specific recombination site located at the locus of the deleted mic3 gene (site B), it being understood that said strain comprises the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA codes for at least one protein.
- the present invention relates to a mutant strain of Sarcocystidae in which the two genes mic 1 and mic 3 are deleted, and containing a recombination site specific for Cre-recombinase, at the locus of the mic 1 gene deleted, and a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene, such as the Cre-recombinase specific recombination site at the deleted honey gene locus (designated site A) corresponds to a loxP site SEQ ID NO : 12 and that at the locus of the deleted mic3 gene (called site B) corresponds to a loxN site SEQ ID NO: 5, and said strain containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, different from the DNAs heterologous corresponding to Cre-recombinase specific recombination sites, at the respective locus of each of the honey and mic3 genes deleted,
- a first Cre-recombinase specific recombination site corresponding to the Cre-recombinase specific recombination site, at the locus of the deleted honey gene (site A) corresponding to a loxP site SEQ ID NO: 12, and
- site C a second specific recombination site corresponding to a loxP site SEQ ID NO: 12, identical to the first specific recombination site located at the locus of the deleted honey gene (site A), when said heterologous DNA is inserted at locus gene mic3 deleted, it is flanked:
- a first Cre-recombinase specific recombination site corresponding to a Cre-recombinase specific recombination site, at the locus of the deleted mic3 gene (site B) corresponding to a loxN site SEQ ID NO: 5, and
- a second specific recombination site (site C) corresponding to a loxN site SEQ ID NO: 5, identical to the first specific recombination site located at the locus of the mic3 gene (site B) deleted, it being understood that said strain comprises the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA codes for at least one protein.
- the present invention relates to a mutant strain of Sarcocystidae containing a heterologous DNA at the location of the deleted honey gene or at the locus of the deleted mic3 gene, different from the heterologous DNAs corresponding to the recombination sites specific for an enzyme allowing recombination.
- said enzyme is Cre-recombinase, at the respective locus of each of the aforementioned honey and mic3 deleted genes, and containing three specific recombination sites which are respectively:
- said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12, and
- said C site is the lox N SEQ ID NO: 5 site, said first Cre-recombinase specific recombination site being site A; or such
- said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12, and
- said C site is the lox P SEQ ID NO: 12 site, said first Cre-recombinase specific recombination site being the B site; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said C site is the lox site SEQ ID NO: 12, said first Cre-recombinase specific recombination site being site A; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said site C is the lox site N SEQ ID NO: 5, said first Cre-recombinase specific recombination site being site B.
- the present invention relates to a mutant strain of Toxoplasma spp., In which both the mic 1 and mic 3 genes, and the roplol gene are deleted, and which contains at the locus of each of these deleted genes a site of specific recombination of an enzyme allowing a specific recombination, in particular Cre-recombinase, such as the site of recombination specific to the locus of the deleted honey gene, is different from the site of recombination specific to the locus of the deleted mic3 gene, and the site of recombination specific to the
- the locus of the roplol gene deleted is different from the specific recombination site located at the locus of the deleted honey gene and the specific recombination site located at the locus of the deleted mic3 gene.
- the ropl6 gene is used to code the Ropl6 protein, which is a protein of rophiae. This protein is a serine threonine kinase.
- ROPs proteins are secreted to allow invagination of the plasma membrane of the host cell and formation of the parasitophorous vacuole.
- the ROPs released into the cytosol of the host cell can migrate to the surface of the parasitophorous vacuole (ROP5, ROP18, ROP2) or in the nucleus (ROP16, protein phosphatase 2C or PP2C-hn), allowing a modulation of the expression of genes involved in the immune response of the host.
- the present invention relates to a mutant strain of Sarcocystidae in which said mutant strain is a mutant strain of Toxoplasma spp., And in which the roplol gene is deleted, and which contains an enzyme-specific recombination site. allowing a specific recombination including Cre-recombinase, at the locus of said deleted roplol gene, said site being different from said specific recombination site located at the deleted honey gene locus and said specific recombination site located at the locus of the deleted mic3 gene.
- the present invention relates to a mutant strain of Toxoplasma spp., In which both the mic 1 and mic 3 genes, and the roplol gene are deleted, and which contains at the locus of each of these deleted genes a site of specific recombination of an enzyme allowing a specific recombination, in particular Cre-recombinase, such as the site of recombination specific to the locus of the deleted honey gene, is different from the site of recombination specific to the locus of the deleted mic3 gene, and the site of recombination specific to the
- the locus of the roplol gene deleted is different from the specific recombination site located at the locus of the deleted honey gene and the specific recombination site located at the locus of the deleted mic3 gene.
- mutant strain also contains at the locus of the roplol gene, downstream of said recombination site specific to the locus of the roplol gene deleted, a gene coding for the GRA15II protein, as well as the means necessary for the expression of said protein,
- GRAs proteins are associated with the membranous nanotubular network and the parasitophorous vacuole membrane (Mercier et al, Int J Parasitol, 2005 Jul; 35 (8): 829-49.) Erratum in: Int J Parasitol, 2005 Dec; 35 (14): 1611-2). They participate in the exchange of nutrients between the parasite and the organelles (mitochondria and endoplasmic reticulum) of the host cell (Sibley, Immunol Rev. 2011 Mar; 240 (l): 72-91).
- GRA15 has a polymorphism according to the typology of the parasite (I, II, III ).
- said gene coding for the GRA15II protein at the locus of the deleted rop 161 gene is thus flanked upstream by the above-mentioned recombination site specific for an enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of said gene.
- rop 161 deleted is thus flanked upstream by the above-mentioned recombination site specific for an enzyme allowing specific recombination, in particular Cre-recombinase, at the locus of said gene.
- the present invention relates to a mutant strain of Sarcocystidae in which said mutant strain is a mutant strain of Toxoplasma spp., And in which the rop gene 161 is deleted and contains an enzyme-specific recombination site allowing a specific recombination, in particular Cre-recombinase, at the locus of said deleted rop gene 161,
- said site being different from said specific recombination site located at the deleted honey gene locus and said specific recombination site located at the locus of the deleted mic3 gene, and said strain comprising a gene encoding the GRA15II protein and the means necessary for the expressing said protein at the locus of said deleted rop gene 161,
- said gene coding for the GRA15II protein at the locus of said deleted rop gene 161, being flanked upstream by the aforesaid specific recombination site of the enzyme allowing a specific recombination, in particular Cre-recombinase, at the locus of said rop gene 161 deleted.
- the present invention relates to a mutant strain of Toxoplasma spp., In which the two mic 1 and mic 3 genes, and the roplol gene are deleted,
- the Cre-recombinase specific recombination site at the deleted honey gene locus is different from the locus of the mic3 gene-deleted recombination site, and the Cre-recombinase specific recombination site at the locus of the roplol gene deleted is different from the Cre-recombinase specific recombination site located at the locus of the deleted honey gene and the Cre-recombinase specific recombination site located at the locus. deleted mic3 gene
- Cre-recombinase specific recombination site at the locus of the roplol gene deleted is chosen from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68.
- the present invention relates to a mutant strain of Toxoplasma spp., In which the two mic 1 and mic 3 genes, and the roplol gene are deleted,
- the Cre-recombinase specific recombination site at the deleted honey gene locus is different from the locus of the mic3 gene-deleted recombination site
- Cre-recombinase specific recombination site at the locus of the roplol gene deleted is different from the Cre-recombinase specific recombination site located at the locus of the deleted honey gene and the Cre-recombinase specific recombination site located at the locus. deleted mic3 gene
- Cre-recombinase specific recombination sites at the locus of the genes miel, mic3 and roplôl deleted are chosen from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68,
- the present invention relates to a mutant strain of Toxoplasma spp., In which both the mic 1 and mic 3 genes, and the roplol gene are deleted, and which contains at the locus of each of these deleted genes a site of specific recombination of Cre-recombinase, such as the Cre-recombinase specific recombination site at the deleted honey gene locus, is different from the locus of the mic3 gene-deleted recombination site, and the Cre-recombinase specific recombination site at the locus of the roplol gene deleted is different from the Cre-recombinase specific recombination site located at the locus of the deleted honey gene and the Cre-recombinase specific recombination site located at the locus. deleted mic3 gene,
- said mutant strain also contains at the locus of the roplol gene, downstream of said recombination site specific to the locus of the roplol gene deleted, a gene coding for the GRA15II protein as well as the means necessary for the expression of said protein, said site Specific recombination of Cre-recombinase at the locus of the roplol gene deleted is chosen from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which said enzyme allowing a specific recombination is Cre-recombinase, and said site of specific recombination of an enzyme allowing a specific recombination at the locus of said gene roplol deleted.
- said enzyme allowing a specific recombination is Cre-recombinase
- said site of specific recombination of an enzyme allowing a specific recombination at the locus of said gene roplol deleted is a recombination site specific for Cre-recombinase chosen from the following sites: lox N of SEQ ID NO: 5, lox P of SEQ ID NO: 12 and lox 2272 of SEQ ID NO: 68, this specific recombination site being different from the Cre-recombinase specific recombination sites at the deleted honey gene locus and at the deleted mic3 gene locus.
- the present invention relates to a mutant strain of Toxoplasma spp., In which the two mic 1 and mic 3 genes, and the roplol gene are deleted,
- site A the Cre-recombinase specific recombination site at the deleted honey gene locus
- site B the mic3 gene-specific locus-specific recombination site
- site D the specific Cre-specific recombination site.
- said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or such
- said site A corresponds to a site lox P, SEQ ID NO: 12
- said site B corresponds to a lox N site, SEQ ID NO: 5
- said site D corresponds to a lox 2272 site, SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which said mutant strain is a mutant strain of Toxoplasma spp., In which both mic 1 and mic 3 genes are deleted, and containing two sites of specific recombination of the Cre-recombinase, each of the two sites being respectively at the locus of each of the above-mentioned deleted genes, the Cre recombinase-specific recombination site, at the locus of the deleted honey gene being different from that at the locus of the deleted mic3 gene .
- roplol gene is deleted and said strain contains a recombination site specific for Cre-recombinase, at the locus of said deleted roplol gene,
- said strain containing three specific recombination sites which are respectively:
- said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12,
- said site D is the site lox 2272 SEQ ID NO: 68; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said site D is the site lox 2272 SEQ ID NO: 68.
- the present invention relates to a mutant strain, wherein said mutant strain is a mutant strain of Toxoplasma spp.,
- the roplol gene is deleted and contains an enzyme-specific recombination site allowing locus-specific recombination of said deleted roplol gene, said site being different from said specific recombination site located at the deleted honey gene locus and said site specific recombination at the locus of the deleted mic3 gene
- said mutant strain comprising a gene coding for the GRA15II protein, as well as the means necessary for the expression of said protein, at the locus of said deleted roplol gene,
- said gene coding for the GRA15II protein at the locus of said deleted roplol gene being flanked upstream by the aforesaid recombination site specific for the enzyme allowing a specific recombination at the locus of said deleted roplol gene, in particular in which said enzyme allowing a specific recombination is , Cre-recombinase, and said site for recombination specific for an enzyme allowing locus-specific recombination of said deleted roplol gene, is a specific recombination site of Cre-recombinase chosen from the following sites: lox N SEQ ID NO: 5, lox P SEQ ID NO: 12 and lox 2272 SEQ ID NO: 68, this specific recombination site being different from the Cre recombinase specific recombination sites at the locus of the deleted honey gene and at the locus of the deleted mic3 gene, said strain containing three specific recombination sites which are respectively:
- said site A is the lox N site
- said site B is the lox P site
- said site D is the site lox 2272.
- the present invention relates to a mutant strain of Toxoplasma spp., In which the two mic 1 and mic 3 genes, and the roplol gene are deleted,
- site A the Cre-recombinase specific recombination site at the deleted honey gene locus
- site B the site of recombination specific to the locus of the deleted mic3 gene
- site D Cre-recombinase specific recombination site at the locus of the roplol gene deleted
- site A Cre recombinase-specific recombination site located at the deleted honey gene locus
- site B site of the specific recombination of the Cre-recombinase located at the locus of the deleted mic3 gene
- said strain optionally containing a coding for the GRA15II protein as well as the means of expression necessary for the expression of said protein,
- said strain containing a heterologous DNA at the deleted honey gene locus or the deleted mic3 gene locus or at the roplol gene locus deleted, different from the hetero-log DNA corresponding to the Cre-recombinase specific recombination sites, at the respective locus of each genes honey, mic3 and roplol deleted, so that: when said heterologous DNA is inserted at the locus of the deleted gene honey, it is flanked: a first Cre-recombinase specific recombination site, corresponding to a Cre-recombinase specific recombination site, at the deleted honey gene locus (site A), and
- site C a second specific recombination site identical to the first specific recombination site located at the deleted honey gene locus (site A), when said heterologous DNA is inserted at the locus of the deleted mic3 gene, it is flanked:
- site C a second specific recombination site identical to the first specific recombination site located at the locus of the mic3 gene (site B) deleted, when said heterologous DNA is inserted at the locus of the roplol gene deleted, it is flanked:
- a second specific recombination site identical to the first specific recombination site located at the locus of the roplol gene (site D) deleted, it being understood that said strain comprises the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA codes for at least one protein.
- said mutant strain then contains four recombination-specific recombination sites defined as follows: the site A corresponding to said Cre-recombinase specific recombination site at the location of the honey gene deleted the site B corresponding to said Cre recombinase-specific recombination site at the locus of the deleted mic3 gene, and the site C corresponding to a Cre recombinase-specific recombination site at the deleted honey gene locus (site A) when the heterologous DNA is inserted at the deleted honey gene locus or corresponding to a Cre-specific recombination site; recombinase at the locus of the deleted mic3 gene (site B) when the heterologous DNA is inserted at the locus of the deleted mic3 gene, or corresponding to a Cre-recombinase specific recombination site at the locus of the roplol gene deleted (site D) when the Heterologous DNA is inserted at the locus of
- said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said site C corresponds to a lox N site, SEQ ID NO: 5
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or said site A corresponds to a lox site P, SEQ ID NO: 12
- said site B corresponds to a lox N site, SEQ ID NO: 5
- said site C corresponds to a site lox P, SEQ ID NO: 12
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68;
- said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said site C corresponds to a site lox P, SEQ ID NO: 12
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or said site A corresponds to a lox site P, SEQ ID NO: 12
- said site B corresponds to a lox N site, SEQ ID NO: 5
- said site C corresponds to a lox N site, SEQ ID NO: 5
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or such that when the hetero logue DNA is inserted at the locus of the roplol gene deleted, said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said site C corresponds to a site lox 2272, SEQ ID NO: 68
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or said site A corresponds to a lox site P, SEQ ID NO: 12
- said site B corresponds to a lox N site, SEQ ID NO: 5
- said site C corresponds to a lox 2272, SEQ ID NO: 68
- said site D corresponds to a lox 2272 site, SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which said mutant strain is a mutant strain of Toxoplasma spp., Said enzyme allowing a specific recombination is Cre-recombinase, in which the roplol gene is deleted and said strain contains a recombination site specific for Cre-recombinase, at the locus of said deleted roplol gene, said strain containing four specific recombination sites which are respectively:
- said first Cre-recombinase specific recombination site corresponding to the aforementioned Cre-recombinase specific recombination site at the gene locus deleted honey (site A) or at the aforementioned Cre-recombinase specific recombination site at the locus of the deleted mic3 gene (site B), or at the Cre-recombinase specific recombination site at the locus of the roplol gene deleted (site D)
- said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12,
- said C site is the lox N SEQ ID NO: 5 site, said first Cre-recombinase specific recombination site being the A site, and
- said site D is the site lox 2272 SEQ ID NO: 68; or such
- said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12,
- said site C is the lox site SEQ ID NO: 12, said first Cre-recombinase specific recombination site being site B, and
- said site D is the site lox 2272 SEQ ID NO: 68; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said C site is the lox site SEQ ID NO: 12, said first Cre-recombinase specific recombination site being site A, and
- said site D is the site lox 2272 SEQ ID NO: 68; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said site C is the lox site N SEQ ID NO: 5, said first Cre-recombinase specific recombination site being site B, and
- said site D is the site lox 2272 SEQ ID NO: 68; or such
- said site A is the site lox P SEQ ID NO: 12
- said site B is the lox site N SEQ ID NO: 5
- said C site is the lox 2272 SEQ ID NO: 68 site, said first Cre-recombinase specific recombination site being the D site, and
- said site D is the site lox 2272 SEQ ID NO: 68; or such said site A is the lox site N SEQ ID NO: 5
- said site B is the site lox P SEQ ID NO: 12,
- said C site is the lox 2272 SEQ ID NO: 68 site, said first Cre-recombinase specific recombination site being the D site, and
- said site D is the site lox 2272 SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA as defined above, wherein said heterologous DNA encodes a protein of interest.
- said heterologous DNA cited in any one of the previously described embodiments is chosen from:
- sequence SEQ ID NO: 212 which codes for the protein SEQ ID NO: 208
- sequence SEQ ID NO: 213 which codes for the protein SEQ ID NO: 209
- sequence SEQ ID NO: 214 which codes for the protein SEQ ID NO: 210
- sequence SEQ ID NO: 215 which codes for the protein SEQ ID NO: 211
- sequence SEQ ID NO: 173 which codes for the protein SEQ ID NO: 167
- sequence SEQ ID NO: 168 which codes for the protein SEQ ID NO: 165.
- said heterologous DNA cited in any one of the previously described embodiments is chosen from:
- a sequence coding for the protein SEQ ID NO: 208 a sequence coding for the protein SEQ ID NO: 209, a sequence coding for the protein SEQ ID NO: 210, a sequence coding for the protein SEQ ID NO: 211, a sequence coding for the protein SEQ ID NO: 167, or a sequence coding for the protein SEQ ID NO: 165, according to the degeneracy of the genetic code.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA as defined above, wherein said protein of interest is an immunogenic heterologous antigen.
- immunological heterologous antigen any peptide or protein from an organism different from said mutant strain and capable of eliciting an immune response.
- an antigen may be an epitope or several epitopes.
- the present invention relates to a mutant strain of Sarcocystidae in which said heterologous DNA codes for at least two proteins of interest and comprises the means necessary for their expressions, each of said at least two proteins of interest being translated. independently, that is to say that they are each controlled by elements necessary for their independent translation.
- the present invention relates to a mutant strain of Sarcocystidae in which said heterologous DNA codes for at least two proteins of interest and comprises the means necessary for their expressions, each of said at least two proteins of interest being translated. independently, and wherein said at least two proteins of interest are immunogenic heterologous antigens.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA in which said heterologous DNA encodes at least one protein of interest and a resistance protein and the means necessary for the expression of said proteins, each said proteins of interest and resistance being translated independently.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA in which said heterologous DNA encodes at least one protein of interest and a resistance protein and the means necessary for the expression of said proteins, each said proteins of interest and resistance being translated independently, and wherein said at least one protein of interest is an immunogenic heterologous antigen.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA encoding an immunogenic heterologous antigen as defined above, wherein said immunogenic heterologous antigen is an immunogenic heterogenic virus antigen.
- the present invention relates to a mutant strain of Sarcocystidae comprising a heterologous DNA encoding an immunogenic heterologous antigen as defined above in which said immunogenic heterologous antigen is an immunogenic heterologous antigen of the influenza virus.
- the present invention relates to a mutant strain of Sarcocystidae as defined above, comprising a heterologous DNA encoding an immunogenic heterologous antigen, wherein said immunogenic heterologous antigen is an immunogenic heterologous antigen of the Influenza virus selected from: protein of SEQ ID NO: 208 (N-ter fragment of a human influenza virus I), or the protein of SEQ ID NO: 209 (N-ter fragment of the protein M2 of a swine influenza virus), or the protein of SEQ ID NO: 201 (N-ter fragment of the M2 protein of an avian influenza virus) or the protein of SEQ ID NO: 211 (N-ter fragment of the M2 protein of an avian influenza virus) or the protein of SEQ ID NO: 167, corresponding to the fusion, in the order, of two proteins SEQ ID NO: 208, a protein SEQ ID NO: 209, a protein SEQ ID NO: 210 and a protein SEQ ID NO: 211
- the two proteins SEQ ID NO: 208, the protein SEQ ID NO: 209, the protein SEQ ID NO: 210 and the protein SEQ ID NO: 211 can be fused in one of the sequences following, always ensuring that they are spaced by a linker:
- the protein resulting from the fusion of these proteins may also be expressed in fusion with the T. gondii SAG1 protein SEQ ID NO: 166.
- the present invention relates to a mutant strain of Sarcocystidae as defined above, wherein said immunogenic heterologous antigen is an immunogenic heterogenic bacterial antigen.
- the present invention relates to a mutant strain of Sarcocystidae as defined above, in which said immunogenic heterologous antigen is an immunogenic heterogenic parasite antigen.
- said heterologous DNA encodes an immunogenic heterologous antigen of virus, parasite or bacterium, and in particular consists of the nucleotide sequence SEQ ID NO: 173, coding for the influenza virus antigen SEQ ID NO: 167.
- the present invention relates to a mutant strain of Sarcocystidae as defined above in which said mutant strain is a strain of Toxoplasma gondii and in which the honey gene and the mic3 gene are deleted and in which the recombination site Cre-recombinase specificity at the deleted honey gene locus is the lox N site of SEQ ID NO: 5 and
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox P site of SEQ ID NO: 12.
- the present invention relates to a mutant strain of Sarcocystidae as defined above in which said mutant strain is a strain of Toxoplasma gondii, in which the honey gene and the mic3 gene are deleted and in which the recombination site Cre-recombinase specificity at the deleted honey gene locus is the lox N site of SEQ ID NO: 5 and
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox P site of SEQ ID NO: 12.
- Said strain comprising a heterologous DNA SEQ ID NO: 168 allowing the expression of a protein SEQ ID NO : 165,
- said heterologous DNA being at the deleted honey gene locus, and being flanked upstream by a first recombination site corresponding to said Cre recombinase specific recombination site at the deleted honey gene locus is the lox N site of SEQ ID NO: 5 and downstream by a second recombination site specific for Cre-recombinase lox N of SEQ ID NO: 5.
- the present invention relates to a mutant strain of Sarcocystidae as defined above in which said mutant strain is a strain of Toxoplasma gondii, in which the honey gene and the mic3 gene are deleted and in which the recombination site Cre-recombinase specificity at the deleted honey gene locus is the lox N site of SEQ ID NO: 5 and
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox P site of SEQ ID NO: 12.
- Said strain comprising a heterologous DNA SEQ ID NO: 168 allowing the expression of a protein SEQ ID NO : 165,
- said heterologous DNA being at the locus of the deleted mic3 gene, and being flanked upstream by a first recombination site corresponding to said Cre recombinase-specific recombination site at the locus of the deleted mic3 gene is the lox P site of SEQ ID NO: 12 and downstream by a second recombination site specific for Cre-recombinase lox P of SEQ ID NO: 12.
- the present invention relates to a mutant strain of Sarcocystidae, said mutant strain being a strain of Toxoplasma gondii, in which the mic 1 genes, the mic 3 gene, and the roplol gene are deleted, and in which the Cre-recombinase specific recombination site at the deleted honey gene locus is the lox N site of SEQ ID NO: 5, and
- the specific recombination site of the Cre-recombinase at the locus of the deleted mic3 gene is the lox P site of SEQ ID NO: 12, and
- the specific recombination site of Cre-recombinase at the locus of the roplol gene deleted is the lox 2272 site of SEQ ID NO: 68.
- the present invention relates to a mutant strain according to the invention, wherein said mutant strain is a strain of Toxoplasma gondii selected from
- the honey gene and the mic3 gene are deleted and in which the site of Cre recombinase-specific recombination at the locus of the deleted honey gene is the lox site N SEQ ID NO: 5 and
- the specific recombination site of the Cre-recombinase at the locus of the deleted mic3 gene is the lox site SEQ ID NO: 12.
- said gene encoding the GRA15II protein at the locus of said deleted roplol gene, being flanked upstream by a Cre recombinase specific recombination site,
- the site of recombination specific for Cre-recombinase at the locus of the deleted honey gene is the lox site N SEQ ID NO: 5, and
- the specific recombination site of the Cre-recombinase at the locus of the deleted mic3 gene is the lox P site SEQ ID NO: 12, and o said Cre recombinase-specific recombination site which upstream flanks said gene encoding the GRA15II protein at the locus of the roplol gene deleted, is the site lox 2272 SEQ ID NO: 68.
- the present invention relates to a mutant strain of Toxoplasma spp., In which the genes honey, mic3 and roplol are deleted, containing three Cre-recombinase specific recombination sites, at the respective locus of each of the aforesaid genes deleted, the Cre-recombinase specific recombination site, at the deleted honey gene locus being different from that at the locus of the deleted mic3 gene and the site of recombination specific to the roplol gene locus deleted being different from the specific recombination sites located at the loci of honey and mic3 gene deleted and said strain containing a heterologous DNA at the locus of the deleted honey gene or at the locus of the deleted mic3 gene or at the locus of the roplol gene deleted, said heterologous DNA being different from the heterologous DNA corresponding to the specific recombination sites Cre-recombinase, at the respective locus of each of the genes honey,
- heterologous DNA When said heterologous DNA is inserted at the locus of the deleted honey gene, it is flanked:
- site C a second Cre-recombinase specific recombination site identical to the first Cre-recombinase specific recombination site located at the deleted honey gene locus (site A),
- site C a second Cre-recombinase specific recombination site identical to the first Cre-recombinase specific recombination site located at the locus of the deleted mic3 gene (site B), when said heterologous DNA is inserted at the locus of the roplol gene deleted, it is flanked:
- a second Cre-recombinase specific recombination site identical to the first Cre-recombinase specific recombination site located at the locus of the roplol gene (site D) deleted, said strain comprising the elements necessary for the transcription of said heterologous DNA, or the means necessary for the expression of said heterologous DNA when said heterologous DNA codes for at least one protein, said mutant strain then containing four Cre recombinase specific recombination sites defined as follows:
- said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P
- said site C corresponds to a lox N site
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or such that when heterologous DNA is inserted at the locus of the deleted mic3 gene,
- said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said site C corresponds to a site lox P, SEQ ID NO: 12
- said D site corresponds to a lox 2272 site, SEQ ID NO: 68; or such that when the heterologous DNA is inserted at the locus of the roplol gene deleted, said site A corresponds to a lox N site, SEQ ID NO: 5
- said site B corresponds to a site lox P, SEQ ID NO: 12
- said site C corresponds to a site lox 2272, SEQ ID NO: 68
- said site D corresponds to a lox 2272 site, SEQ ID NO: 68.
- the present invention relates to a mutant strain of Sarcocystidae in which said mutant strain is a Neospora caninum strain and in which the honey gene and the mic3 gene are deleted and in which the Cre specific recombination site is deleted.
- -recombinase at the deleted honey gene locus is the lox P site of SEQ ID NO: 12 and
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox N site of SEQ ID NO: 5.
- the present invention relates to a mutant strain of Sarcocystidae as defined above in which said mutant strain is a strain of Neospora caninum, in which the honey gene and the mic3 gene are deleted and in which the recombination site Cre-recombinase specificity at the deleted honey gene locus is the lox P site of SEQ ID NO: 12.
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox N site of SEQ ID NO: 5 and said strain comprising a heterologous DNA SEQ ID NO: 168 allowing the expression of a protein SEQ ID NO : 165, said heterologous DNA being at the deleted honey gene locus, and being flanked upstream by a first recombination site corresponding to said Cre recombinase-specific recombination site at the deleted honey gene locus is the lox P site of SEQ ID NO: 12 and downstream by a second recombination site specific for Cre-recombinase lox P of SEQ ID NO: 12.
- the present invention relates to a mutant strain of Sarcocystidae as defined above in which said mutant strain is a strain of Neospora caninum, in which the honey gene and the mic3 gene are deleted and in which the recombination site Cre-recombinase specificity at the deleted honey gene locus is the lox P site of SEQ ID NO: 12.
- the Cre-recombinase specific recombination site at the locus of the deleted mic3 gene is the lox N site of SEQ ID NO: 5 and said strain comprising a heterologous DNA SEQ ID NO: 168 allowing the expression of a protein SEQ ID NO : 165,
- said heterologous DNA being at the locus of the deleted mic3 gene, and being flanked upstream by a first recombination site corresponding to said Cre recombinase-specific recombination site at the locus of the deleted mic3 gene is the lox N site of SEQ ID NO: 5 and downstream by a second recombination site specific for Cre-recombinase lox N of SEQ ID NO: 5.
- the present invention also relates to the use of a mutant strain as defined above, containing no heterologous DNA other than the heterologous DNAs corresponding to the specific Cre-recombinase recombination sites at the respective locus of each of the aforementioned deleted genes, for the targeted insertion of heterologous DNA, except for therapeutic use.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use as a medicament, in particular as a vaccine or as an immunostimulant.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of infectious pathologies of viral, parasitic or bacterial origin.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of infectious pathologies of viral, parasitic or bacterial origin in a mammal or birds.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of infectious pathologies of viral, parasitic or bacterial origin in a mammal said mammal being in particular selected from humans, ovines, goats, pigs, cattle, equines, camelids, canines or felids.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of infectious pathologies of viral, parasitic or bacterial origin in a bird , said bird being in particular chosen from chickens, turkeys, guinea fowl, ducks, geese, quails, pigeons, pheasants, partridges, ostriches, rheas, emus and kiwis bred or kept in captivity for the purpose of reproduction, the production of meat or eggs for consumption or the supply of game for restocking.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious disease affecting the digestive system, causing diarrhea , affecting food digestibility or intestinal absorption.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious pathology affecting the central or peripheral nervous system and all the consequences for other systems associated with it.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious disease affecting the musculoskeletal system, in particular affecting the musculoskeletal or articular system, particularly infectious diseases causing myositis, arthritis or theft.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, its use in the prevention of an infectious pathology affecting the respiratory system and in particular catarrhal fevers. , obstructive abscesses, perforations and emphysema of infectious origin, tracheitis, bronchitis, pneumonia, pleurisy or in the particular case of birds, aerosacculitis.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious pathology affecting the reproductive system, fertility and Fertility, in particular, an infectious pathology affecting the normal development of the reproductive system of the male or female, the physiology of the reproductive cycle in females, affecting the smooth progress of pregnancy in mammals including fetal development or affecting Egg quality, in particular, infectious pathologies inducing metritis, salpingitis, mastitis or oviposition syndrome.
- the present invention also relates to a mutant strain containing a heterologous DNA coding for an immunogenic heterologous antigen. as defined above, for its use in the prevention of a pathology of infectious origin affecting the cardio-circulatory system, bone marrow or blood, particularly in the prevention of infections of infectious origin causing an alteration of the genesis of figured elements of blood and sepsis including associated consequences on other organs.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in preventing the animal from carrying viruses, bacteria or parasites. by an animal or a by-product derived and having a potentially zoonotic character, in particular, for use in the prevention of animal carriage of Salmonella spp., Escherichia spp. zoonotic, Clostridia, mycobacteria including tuberculosis.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious pathology of viral origin caused by a virus belonging to to the following groups:
- Group I, II of the Baltimore classification including viruses whose genomes are made of DNA that is likely to infect a mammal or a bird, in particular a natural virus belonging to the family Herpesviridae, and more particularly the Epstein- Barr responsible for human mononucleosis, bovine herpes virus type I responsible for infectious bovine rhinotracheitis or Marek disease virus in domestic hen.
- Group III, IV and V of the Baltimore Classification including viruses with a single-stranded or double-stranded RNA genome that may affect a mammal or bird, particularly viruses belonging to the family of Orthomyxoviridae and more particularly human, avian and porcine influenza viruses.
- Retroviridae such as the virus of the human immunodeficiency (HIV), feline immunodeficiency virus (FIV), caprine arthritis and encephalitis virus or feline leukemia virus FELV.
- Group VII of the Baltimore classification including DNA viruses requiring reverse transcription to RNA for viral propagation and likely to infect a mammal or a bird, particularly viruses of the family Hepadnaviridae, and more particularly the virus of the human hepatitis B or the Beijing duck hepatitis virus (DHBV).
- DNA viruses requiring reverse transcription to RNA for viral propagation and likely to infect a mammal or a bird particularly viruses of the family Hepadnaviridae, and more particularly the virus of the human hepatitis B or the Beijing duck hepatitis virus (DHBV).
- DHBV Beijing duck hepatitis virus
- the present invention relates to a mutant strain containing a heterologous DNA encoding a heterologous antigen SEQ ID NO: 165, for its use in the prevention of influenza caused by Influenza virus.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of an infectious pathology of bacterial origin (or caused by a toxin from a bacterium), said bacterium being able to belong to the following groups:
- GRAM positive shells that are likely to affect directly or through one of these by-products, a mammal or a bird.
- GRAM positive bacilli that are likely to affect directly or by one of these by-products, a mammal or a bird, particularly bacteria belonging to the genus Listeria, Erysipelothryx, Corynebacterium or Bacillus;
- Mycoplasma-type bacteria that are likely to directly or by one of these by-products, a mammal or a bird, in particular bacteria belonging to the genus Mycoplasma and Ureaplasma;
- Bacteria not mentioned above having the ability to invade a cell of a mammal or a bird, especially bacteria belonging to the genus Chlamydia, Rickettsia or Micobacterium.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use in the prevention of a pathology originating from a parasitic infection, the parasite being able to belong to the following groups:
- Protozoa likely to directly affect a mammal or a bird, particularly protozoa belonging to the branch of sporozoites, Rhizoflagellates, ciliates or belonging to the genera Encephalitozoon, Enterocytozoon or blastocystis;
- Nemathelminthes that may directly affect a mammal or a bird, particularly Nemathelminthes belonging to the genus Trichuris, Ascaris, Anisakis, Necator, Strongyloids, Toxocara, Ancylostoma, Trichinella, Loa, Onchocerca, Wichereria, or Enterobius;
- Plathelminths that may directly affect a mammal or a bird, especially Plathelminthes belonging to the genus Fasciola, Paragonimus, Opisthorchis, Sasciolopsis, Dicrocoelium, Clonorchis, Taenia, Diphyllobothrium, Echinococcus, Multiceps, Hymenolepsis and Shistosoma;
- Arthropods that may be responsible for a disease or vectorization of an infectious agent to a mammal or a bird, in particular arthropods belonging to the order of Anoploures of Heteroptera, Shiphonaptera, Diptera, Brachycera or Mites.
- the present invention also relates to a mutant strain containing a heterologous DNA encoding an immunogenic heterologous antigen as defined above, for its use as an immunostimulant.
- immunogenic heterologous antigen makes it possible to stimulate the immune defenses (such as a vaccine, for example).
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a mutant strain as defined above and a pharmaceutically acceptable vehicle.
- the present invention also relates to a pharmaceutical composition, comprising at least one product chosen from: an adjuvant, a stabilizer or a preservative, or a mixture thereof.
- the present invention relates to a pharmaceutical composition, formulated in unit dose form varying from 10 2 to 10 9 tachyzoites of a mutant strain as defined above.
- the present invention also relates to a vaccine composition
- a vaccine composition comprising a mutant strain as defined above and a pharmaceutically acceptable vehicle.
- the present invention also relates to a method for preventing an infectious pathology of viral, parasitic or bacterial origin comprising a step of administering to a mammal or a bird of a mutant strain.
- the present invention also relates to a process for obtaining a mutant strain of Sarcocystidae in which the honey and mic3 genes are deleted, from a wild-type strain, comprising:
- step A comprising or consisting of the deletion of the mic3 gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre recombinase, following which only one of the two specific recombination sites surrounding the cassette remains integrated in the locus of said deleted mic3 gene,
- a step B comprising or consisting of the deletion of the honey gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre recombinase, following which only one of the two specific recombination sites flanking the cassette remains integrated with the locus of said deleted honey gene
- steps A and B can be carried out in an A followed by B or B followed by A, and the two specific recombination sites flanking the selection cassette inserted at the honey gene locus being different from the two specific recombination sites surrounding the cassette inserted at the locus of the mic3 gene.
- the present invention also relates to a process for obtaining a mutant strain of Sarcocystidae in which the genes honey, mic3 and roplol are deleted and in which a gene encoding the GRA15II protein is integrated into the locus of the roplol gene deleted, from a wild strain, comprising:
- a step A comprising or consisting of the deletion of the mic3 gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre-recombinase, continued to which only one of the two specific recombination sites surrounding the cassette remains integrated with the locus of said deleted mic3 gene,
- a step B comprising or consisting of the deletion of the honey gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by a step of excision of said selection cassette by the cre-recombinase , following which only one of the two specific recombination sites flanking the cassette remains integrated with the locus of said deleted honey gene, the two specific recombination sites flanking the selection cassette inserted at the locus of the honey gene being different from the two specific recombination sites surrounding the cassette. selection inserted at the mic3 gene locus
- a step C comprising or consisting of the deletion of the roplol gene by homologous recombination and insertion of a cassette comprising a selection cassette flanked by two specific recombination sites, and comprising, downstream of this selection cassette, a sequence encoding the gene; gral5II, followed by a step of excision of said selection cassette by the cre-recombinase, following which said sequence coding for the gral5II gene is then integrated into the locus of the roplol gene deleted downstream of a single specific recombination site the two specific recombination sites surrounding the selection cassette inserted at the locus of the roplol gene being different from the two specific recombination sites surrounding the selection cassettes inserted at the loci of the honey and mic3 genes.
- steps A, B and C can be carried out in an A followed by B followed by C, or A followed by C followed by B, or B followed by A followed by C, or B followed by C followed by A, or C followed by A followed by B, or C followed by B followed by A.
- the present invention also relates to a process for obtaining a mutant Sarcocystidae strain in which the honey and mic3 genes are deleted and in which a heterologous DNA is integrated at the locus of the deleted honey gene or at the locus of the deleted mic3 gene, from a wild strain, comprising:
- step A comprising or consisting of the deletion of the mic3 gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre-recombinase, continued to which only one of the two specific recombination sites surrounding the cassette remains integrated with the locus of said deleted mic3 gene,
- a step B comprising or consisting of the deletion of the honey gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said cre-recombinase selection cassette, following which only one of the two specific recombination sites flanking the cassette remains integrated with the locus of said deleted honey gene, the two specific recombination sites surrounding the selection cassette inserted at the honey gene locus being different. of the two specific recombination sites flanking the selection cassette inserted at the locus of the mic3 gene, steps A and B being able to be carried out in an A order followed by B or B followed by A,
- a step D comprising or consisting of the targeted insertion of a heterologous DNA flanked by a specific recombination site, said heterologous DNA is integrated at the locus of the deleted honey gene when the specific recombination site which the flank corresponds to the recombination site at the locus of the deleted honey gene,
- heterologous DNA is integrated at the locus of the deleted mic3 gene when the specific recombination site which flanks it corresponds to the specific recombination site situated at the locus of the deleted mic3 gene
- heterologous DNA once integrated, said heterologous DNA will therefore be flanked by two specific recombination sites.
- the present invention also relates to a process for obtaining a mutant strain of Sarcocystidae in which the honey, mic3 and roplol genes are deleted and in which a heterologous DNA is integrated into the locus of the deleted honey gene or at the locus of the deleted mic3 gene and a gene coding for the GRA15II protein is integrated into the locus of the roplol gene deleted, from a wild-type strain, comprising:
- a step A comprising or consisting of the deletion of the mic3 gene by homologous recombination and insertion of a first selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre-recombinase, after which only one of the two specific recombination sites surrounding the cassette remains integrated in the locus of said deleted mic3 gene,
- a step B comprising or consisting of the deletion of the honey gene by homologous recombination and insertion of a selection cassette flanked by two identical specific recombination sites, followed by the excision of said selection cassette by the cre-recombinase,
- a step C comprising or consisting of the deletion of the roplol gene by homologous recombination and insertion of a cassette comprising a selection cassette flanked by two specific recombination sites, these two specific recombination sites being different from the two specific recombination sites the selection cassette inserted at the locus of the honey gene and those surrounding the selection cassette inserted at the locus of the mic3 gene, and comprising, downstream of this selection cassette, a sequence coding for the gral5II gene,
- steps A, B and C can be performed in an A followed by B followed by C, followed by C followed by B, or B followed by A followed by C, or B followed by C followed by A, or C followed by A followed by B, or C followed by B followed by A, then
- a step D comprising or consisting of the targeted insertion of a heterologous DNA flanked by a specific recombination site, said heterologous DNA is integrated into the locus of the deleted honey gene when the specific recombination site which the flank corresponds to the specific recombination site located at the locus of the deleted honey gene,
- said heterologous DNA is integrated at the locus of the deleted mic3 gene when the specific recombination site which flanks it corresponds to the specific recombination site situated at the locus of the deleted mic3 gene, said hetero logue DNA is integrated at the locus of the deleted ropl6 gene when the specific recombination site which flanks it corresponds to the specific recombination site located at the locus of the deleted ropl6 gene,
- heterologous DNA once integrated, said heterologous DNA will therefore be flanked by two specific recombination sites.
- FIG. 1 this figure is a schematic representation of recombination by the Cre / loxP system applied to the X gene flanked by the identical loxP sites
- FIG. 2- A This figure is a schematic representation of plasmid pNcMIC3-KO-CAT-GFP loxN.
- This 10063 base pair plasmid comprises the selection gene coding for the CAT-GFP chimeric protein placed under the control of the Toxoplasma gondii ⁇ -tubulin promoter to allow expression of the gene in the parasite.
- This selection cassette is flanked by two identical loxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the ncmic3 gene.
- FIG. 2-B This figure is a schematic representation of plasmid pNcMIC1-KO-CAT-GFP loxP.
- This 10069 base pair plasmid comprises the selection gene coding for the CAT-GFP chimeric protein placed under the control of the Toxoplasma gondii ⁇ -tubulin promoter to allow expression of the gene in the parasite.
- This selection cassette is flanked by two identical loxP sites of the same orientation, added by PCR. On either side of the cassette were inserted homologous regions flanking the ncmicl gene.
- FIG. 2-C This figure is a schematic representation of the plasmid pTSAG1-Cre Recombinase.
- This 4,694 base pair plasmid comprises the gene coding for the CRE-Recombinase protein placed under the control of the promoter of the sagl gene of Toxoplasma gondii to allow expression of the gene in the parasite. Downstream of the gene encoding Cre Recombinase, the 3'UTR sequence of the sagl gene of Toxoplasma gondii is inserted to stabilize the mRNA encoding the Cre Recombinase protein.
- Figure 3-A This figure illustrates the 4 steps to obtain the strain Neo ncmicl-3 KO 2G.
- the first step of homologous recombination allows the integration of the gene coding for the CAT-GFP enzyme at the locus of the mic3 gene. A selection by chloramphenicol makes it possible to amplify the simple mutant strain Neo ncmic3 KO.
- the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.
- the third step allows the integration of the gene coding for the CAT-GFP enzyme at the gene locus of the honey gene. Selection by chloramphenicol amplifies the single mutant strain Neo ncmicl-3 KO.
- the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.
- FIG. 3-B this figure represents the electrophoretic profiles of the PCR products obtained with the wild-type NC-1 strain of Neospora caninum, the Neo ncmic3 KO strain, the Neo ncmic3 KO 2G strain, the Neo ncmicl-3 KO strain and the strain respectively.
- Figure 3-C This figure represents the results of sequencing obtained on the strain Neo ncmicl-3 KO 2G and confirms that the genes honey and mic3 were deleted and replaced respectively by scars LoxP and LoxN.
- FIG. 4A this figure illustrates the immunofluorescence analysis of the detection of the MIC3 protein obtained respectively with the wild-type NC-1 strain of Neospora caninum and Neo ncmicl-3 KO 2G strain using an antibody specifically directed against the protein MIC3.
- FIG. 4-B This figure illustrates the immunofluorescence analysis of the detection of the CATGFP protein obtained respectively with the wild-type NC-1 strain of Neospora caninum and the mutant strains of Neospora caninum using the intrinsic fluorescence of the CATGFP protein. This figure makes it possible to demonstrate the presence of the CATGFP protein or the absence of the CATGFP protein following the action of Cre Recombinase.
- Figure 5-A This figure is a schematic representation of the plasmid pTgMIC3-KO-CAT-GFP loxP.
- This 9,931 base pair plasmid comprises the selection gene coding for the CAT-GFP chimeric protein placed under the control of the Toxoplasma gondii ⁇ -tubulin promoter to allow expression of the gene in the parasite.
- This selection cassette is flanked by two identical loxP sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmic3 gene.
- FIG. 5-B This figure is a schematic representation of the plasmid pTgMIC1-KO-CAT-GFP loxN.
- This 10 285 base pair plasmid comprises the selection gene coding for the CAT-GFP chimeric protein placed under the control of the Toxoplasma gondii ⁇ -tubulin promoter to allow expression of the gene in the parasite.
- This selection cassette is flanked by two identical loxN sites of the same orientation, added by PCR. On either side of the cassette were inserted the homologous regions flanking the tgmicl gene.
- Figure 6-A This figure illustrates the 4 steps to obtain the strain Toxo tgmicl-3 KO 2G.
- the first step of homologous recombination allows the integration of the gene coding for the CAT-GFP enzyme at the locus of the mic3 gene. Chloramphenicol selection amplifies the single mutant strain Toxo tgmic3 KO.
- the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.
- the third step allows the integration of the gene coding for the CAT-GFP enzyme at the gene locus of the honey gene. Chloramphenicol selection amplifies the single strain mutant Toxo tgmicl-3 KO.
- the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase.
- FIG. 6-B this figure represents the electrophoretic profiles of the PCR products obtained respectively with the wild strain RH of Toxoplasma gondii, the strain Toxo tgmic3 KO, the strain Toxo tgmic3 KO 2G, the strain Toxo tgmicl-3 KO and the final strain Toxo tgmic1-3 KO 2G using PCR primers in Table 7.
- FIG. 7 this figure illustrates the immunofluorescence analysis of the detection of the MIC1, MIC3 or CAT-GFP proteins obtained respectively with the wild strain RH of Toxoplasma gondii, the strain Toxo tgmic3 KO, the strain Toxo tgmic3 KO 2G, the strain Toxo tgmicl-3 KO and strain Toxo tgmicl-3 KO 2G using an antibody specifically directed against the protein MIC1, MIC3 or directly with the intrinsic fluorescent properties of the CAT-GFP protein.
- FIG. 8 This figure is a schematic representation of the plasmid pTgRopl6KO-Gral5nKI-CAT-GFP lox2272.
- This 12721 base pair plasmid comprises the selection gene coding for the CAT-GFP chimeric protein placed under the control of the Toxoplasma gondii ⁇ -tubulin promoter to allow expression of the gene in the parasite.
- This selection cassette is flanked by two identical lox2272 sites of the same orientation, added by PCR. Downstream of this cassette was integrated the expression cassette for coding the Gra51HAII protein. Then on either side of these cassettes were inserted the homologous regions flanking the tgropl6 gene.
- Figure 9-A This figure illustrates the 2 steps to obtain the strain Toxo tgmicl-3 KO ropl6 KO GRA15n KI-2G.
- the first step of homologous recombination allows the integration of the gene coding for the CAT-GFP enzyme and the gral5IIHA gene at the locus of the ropl6 gene. Selection with chloramphenicol amplifies the mutant strain Toxo tgmicl-3 KO ropl6 KO GRA15n Kl.
- the gene coding for the CAT-GFP protein is deleted by the action of Cre Recombinase to obtain the strain Toxo tgmicl-KO ropl6 KO GRA15 n KI-2G.
- Figure 9-B This figure shows the electrophoretic profiles of the PCR products obtained respectively with strains Toxo tgmicl-3 KO 2G, Toxo tgmicl-3 KO ropl6 KO GRA15 n Kl and Toxo tgmicl-3 KO ropl6 KO GRA15 n Kl 2G.
- Figure 9-C This figure represents the results of sequencing obtained on the strain Toxo tgmicl-3 KO ropl6 KO GRA15n Kl 2G and confirms that the ropl6 and cat-gfp genes were deleted and replaced by the scar Lox2272 and the gral5HAII gene.
- FIG. 10 this figure illustrates the immunofluorescence analysis of the detection of the GRA15 protein (via the HA tag) obtained respectively with the strains Toxo tgmicl- 3 KO ropl6 KO GRA15 n KI and Toxo tgmicl-3 KO ropl6 KO GRA15 n KI-2G using an antibody specifically directed against the HA tag.
- This figure also illustrates the removal of the CATGFP cassette with the disappearance of the GFP fluorescence for the strain Toxo tgmicl-3 KO ropl6 KO GRA15 n KI-2G.
- FIG. 11-A this figure illustrates the position of the nucleic primers used in the present invention for detecting the presence of the three ncmic3, ncmicl, cat-gfp genes in wild-type strains and / or Neo ncmic3 KO and / or Neo mutant strains.
- the numbers represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.
- Figure 11-B This figure illustrates the position of the nucleic primers used in the present invention for detecting the presence of the three genes tgmic3, tgmic1, cat-gfp in wild-type strains and / or mutant strains of Toxo tgmic3 KO and / or Toxo tgmic3 KO 2G and / or Toxo tgmicl-3 KO and / or Toxo tgmicl-3 KO 2G Toxoplasma gondii.
- the numbers represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.
- Figure 11-C This figure illustrates the position of the nucleic primers used in the present invention for detecting the presence of the three genes tgroplo, gral511, cat-gfp in wild-type strains and / or mutant strains of Toxo tgmicl-3 KO roplo KO Gral5II Kl of Toxoplasma gondii.
- the numbers represent the numbering of the primer sequences (SEQ ID NO: x) defined in the present application.
- Figure 13-A This figure illustrates the follow-up of clinical scores observed for mice.
- Figure 13-B This figure illustrates the specific antibody titration against T. gondii in mouse serum at D-2, D28 and D129. ANOVA one way (****: pO.0001, *: p ⁇ 0.05).
- Figure 13-C This figure illustrates the assay of IFNy following restimulation of splenocytes with the total extract of T. gondii 72h after restimulation. ANOVA one way (****: p ⁇ 0.0001, *: p ⁇ 0.05).
- Lot 1 corresponds to the control group
- Lot 2 corresponds to the challenge group 76K
- Lot 3 corresponds to the group Toxo tgmic 1-3 KO 2G
- Lot 4 corresponds to the group Toxo tgmic 1-3 KO 2G + challenge 76K.
- Figure 13-D This figure illustrates the number of cerebral cysts detected in mothers. ANOVA one way (*: p ⁇ 0.05). Lot 1 corresponds to the control group, Lot 2 corresponds to the challenge group 76K, Lot 3 corresponds to the group Toxo tgmic 1-3 KO 2G and Lot 4 corresponds to the group Toxo tgmic 1-3 KO 2G + challenge 76K.
- FIG. 13-E This figure illustrates the prolificity obtained for each batch.
- Figure 13-F This figure illustrates the sex ratio obtained for each batch. Two-way ANOVA (**: p ⁇ 0.01), *: p ⁇ 0.05).
- FIG. 13-G This figure illustrates the results obtained for the mortinality.
- Figure 13-H This figure illustrates the results obtained for the observed mortality per litter for each batch. ANOVA one way (****: p ⁇ 0.0001, ***: p ⁇ 0.001). Lot 1 corresponds to the control group, Lot 2 corresponds to the challenge group 76K, Lot 3 corresponds to the group Toxo tgmic 1-3KO 2G and Lot 4 corresponds to the group Toxo tgmic 1-3 KO 2G + challenge 76K.
- Figure 13-1 This figure illustrates the survival percentage obtained for 32-day old mice. Log-rank (Mantel-Cox) test (****: p ⁇ 0.0001). Lot 1 corresponds to the control group, Lot 2 corresponds to the challenge group 76K, Lot 3 corresponds to the group Toxo tgmic 1-3 KO 2G and Lot 4 corresponds to the group Toxo tgmic 1-3 KO 2G + challenge 76K.
- Figure 13-J This figure illustrates the follow-up of observed clinical scores for young mice.
- Figure 13-K This figure illustrates the specific IgM titration against T. gondii in the mouse serum of each lot. ANOVA one way (****: p ⁇ 0.0001, **: p ⁇ 0.01).
- Neospora caninum during the proliferative phase allows the invalidation of a gene in a single homologous recombination.
- Neospora caninum strain All tachyzoites of the Neospora caninum strain used were produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in Dulbecco's minimal medium (DMEM) supplemented with 10% fetal calf serum (FV S), 2mM glutamine , 100 U / mL penicillin and 100 U / mL streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- DMEM Dulbecco's minimal medium
- FV S fetal calf serum
- FV S fetal calf serum
- the plasmid pNcMic3KO-CAT-GFP loxN SEQ ID NO: 1 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 coding for the CAT-GFP fusion protein allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP), under the control of the Toxoplasma gondii ⁇ -tubulin promoter SEQ ID NO: 3 to allow expression of the gene in the parasite.
- Downstream of the cat-gfp SEQ ID: 2 gene the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4is inserted. This sequence aims to stabilize the mRNA encoding the CAT / GFP fusion protein.
- This selection cassette SEQ ID NO: 6 is flanked by two identical loxN SEQ ID NO: 5 sites of the same orientation.
- the CAT-GFP selection cassette SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with the cat-gfp primers LoxN For SEQ ID NO: 7 and catgfp loxN SEQ ID NO: 8 (2380bp), digested with Clal and XbaI restriction enzymes (2348bp) and cloned into plasmid pNcMic3KO-DHFR SEQ ID NO: 10 digested with ClaI and XbaI (7715bp).
- the plasmid then obtained is the plasmid pNcMic3KO-CAT-GFP loxN SEQ ID NO: 1.
- the sequences of the primers are shown in Table 1 below.
- the pNcMic3KO-CAT-GFP loxN plasmid thus contains a CAT-GFP SEQ ID NO: 6 cassette flanked by a 5 'HR sequence of the ncmic3 gene SEQ ID NO: 98 and a 3'HR sequence of the ncmic3 gene SEQ ID NO: 97.
- Table 1 List of primers used for the construction of the pNcMIC3-KO-CAT-GFP plasmid loxN catgfp loxN For SEQ ID NO: 7
- the plasmid pNcMic1 KO-CAT-GFP loxP SEQ ID NO: 11 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 coding for a CAT-GFP fusion protein allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP), under the control of the toxoplasma gondii ⁇ -tubulin promoter SEQ ID NO: 3 to allow expression of the gene in the parasite. Downstream of the CAT-GFP coding sequence, the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. This sequence aims to stabilize PARNm encoding the CAT / GFP fusion protein.
- This selection cassette SEQ ID NO: 6 is flanked by two identical loxP SEQ ID NO: 12 sites of the same orientation.
- the CAT-GFP selection cassette SEQ ID NO: 6 was amplified by PCR on the plasmid pT230 CAT-GFP SEQ ID NO: 9 with primers CN10 SEQ ID NO: 13 and CN11 SEQ ID NO: 14 allowing the addition of loxP sites SEQ ID NO: 12 (2394 bp), digested with the HindIII and BamHI restriction enzymes (2339 bp) and cloned into the plasmid pT230-ble SEQ ID NO: 37 digested with HindIII and BamHI (293) lpb).
- the plasmid then obtained is the plasmid pT230 CAT-GFP loxP SEQ ID NO: 113.
- the 3 HR region of the ncmicl gene was amplified by PCR from the genomic DNA of the NC-1 strain of Neospora caninum.
- the primers 3 HR NCmicl F KpnI and 3 HR NCmicl R HindIII allow the amplification of the 3 HR region of the ncmicl gene and the creation of two restrictions that were used to clone the 3HR fragment upstream of the CAT-GFP selection cassette in pT230 CAT-GFP loxP SEQ ID NO: 113.
- the resulting plasmid is named pNcmic1-3HR CATGFP loxP SEQ ID NO: 118.
- the HR region of the ncmicl gene was amplified by PCR from the genomic DNA of the NC-1 strain of Neospora caninum.
- the primers 5 HR NCmicl F BamHI and HR NCmicl R NotI allow the amplification of the 5'UTR region of the ncmicl gene and the creation of two restriction sites which have been used to clone the 5HR fragment.
- downstream of the CAT-GFP selection cassette in the plasmid pNcmic1-3HR CATGFP loxP SEQ ID NO: 118 (BamHI-Not).
- the plasmid then obtained is the plasmid pNcMic1KO-CAT-GFP loxP SEQ ID NO: 11.
- the plasmid pNcMic1KO-CAT-GFP loxP thus contains a CAT-GFP cassette SEQ ID NO: 6 flanked by a 5'HR sequence of the gene ncmicl SEQ ID NO: 96 and a 3'HR sequence of the ncmicl gene SEQ ID NO: 95.
- Table 2 List of primers used for the construction of the plasmid pNcmicl KO CATGFP loxP
- the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene coding for Cre recombinase-derived Cre Recombinase protein (Brecht et al., 1999 , same reference as above).
- the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid). which contains an expression cassette of Cre Recombinase of bacteriophage Pl.
- the gene encoding Cre Recombinase SEQ ID NO: 16 is placed under the control of the promoter of the sagl gene of Toxoplasma gondii SEQ ID NO: 17, which allows the expression of Cre Recombinase protein in transfected Toxoplasma gondii parasites.
- the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. This sequence aims to stabilize the mRNA encoding the Cre Recombinase protein.
- Neo ncmicl - 3 KO - 2G The construction of the second generation live attenuated strain, called Neo ncmicl - 3 KO - 2G, is made in 4 distinct steps:
- the wild-type NC-1 strain of Neospora caninum is electroporated with the plasmid pNcMIC3-KO-CAT-GFP lox N SEQ ID NO: 1.
- 20 ⁇ g of plasmid purified then linearized with KpnI are added to 10 7 parasites put suspended in CYTOMIX electroporation medium containing ⁇ (3 mM) and Glutathione (3 mM) (Van den Hoff et al., Nucleic Acid Research, Jun 11; 20 (11): 2902), and electroporation was made in a 4 mm gap, in a volume of 800 on a BioRad device (Parameters: 2000V, 50 ohms, 25 ⁇ , with two electric shocks).
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 ⁇ l), 24 hours after the electroporation.
- the parasites are subcloned into a 96-well plate on a HFF cell monolayer and the clones of interest are identified by PCR after having carried out a DNAzol genomic DNA extraction of the clones of interest.
- the strain obtained is called Neo ncmic3 KO.
- the mic3 gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6.
- the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 101. Since the honey gene is not deleted, the sequence of the honey gene SEQ ID NO: 106 is present in the genome of strain.
- the transiently expressed enzyme will allow excision of the CAT-GFP selection cassette SEQ ID NO: 6.
- the electroporation protocol is similar to the previous protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a DNAzol genomic DNA extraction of the clones of interest. . The strain obtained is called Neo ncmic3 KO - 2G.
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P SEQ ID NO: 12 site is SEQ ID NO: 18.
- the honey gene is not deleted, the honey gene sequence SEQ ID NO: 106 is present in the genome of the strain.
- Neo ncmic3 KO-2G strain is electroporated with the plasmid pNcMIC1-KO-CAT-GFP lox P SEQ ID NO: 11 linearized with KpnI, according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 ⁇ l), 24 hours after electroporation.
- the selection agent chloramphenicol 20 ⁇ l
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Neo ncmicl-3 KO
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12 is SEQ ID NO: 18.
- the honey gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6.
- the theoretical sequence at the deleted honey gene locus containing the CATGFP selection cassette is SEQ ID NO: 102.
- the transiently expressed enzyme will allow excision of the CAT-GFP selection cassette SEQ ID NO: 6.
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a DNAzol genomic DNA extraction of the clones of interest. .
- the strain obtained is called Neo ncmicl-3 KO-2G.
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 18.
- the honey gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted honey gene containing a single lox site SEQ ID NO: 12 is SEQ ID NO: 91.
- PCR analyzes are carried out using the genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for the PCRs are described in Figure 11-A and are detailed in Table 3 below.
- the PCR products are analyzed by agarose gel electrophoresis (FIG. 3-B). Their expected size and observed size are also described in Table 4 below. For the sake of clarity in FIG.
- the electrophoreses of the PCR products carried out with the primers c SEQ ID NO: 22 and d SEQ ID NO: 23 (mix 1) make it possible to demonstrate a band at 850 base pairs for the strain NC-1, according to the size of the band expected and confirming the presence of the gene ncmic3 SEQ ID NO: 105 in this strain.
- This band is not detected in the strains Neo ncmic3 KO, Neo ncmic3 KO - 2G, Neo ncmicl - 3 KO and Neo ncmic 1-3 KO - 2G confirming the suppression of the gene in these strains.
- the electrophoreses of the PCR products carried out with the primers SEQ ID NO: 24 and SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and SEQ ID NO: 27 respectively make it possible to highlight a band. at 2960 and 3668 base pairs for the Neo strain ncmic3 KO, according to the expected band size and confirming the presence of the cat-gfp selection gene in this strain in place of the ncmic3 gene.
- This band is not detected in the NC-1, Neo ncmic3 KO-2G, Neo ncmic1-3 KO and Neo ncmic 1- 3 KO-2G strains confirming the absence of the cat-gfp selection gene SEQ ID NO: 2 at the ncmic 3 locus in these strains.
- Neo ncmic3 KO - 2G Neo ncmicl - 3 KO and Neo ncmicl - 3 KO - 2G strains confirming the deletion of the cat - gfp selection gene SEQ ID NO: 2 in these groups. strains, leaving a scar loxN SEQ ID NO: 5 in the genome.
- the electrophoreses of the PCR products made with the primers of SEQ ID NO: 20 and SEQ ID NO: 21 make it possible to demonstrate a 644 base pair band for the strains NC-1, Neo ncmic3 KO, Neo ncmic3 KO - 2G, in accordance with the expected band sizes and confirming the presence of the ncmic 1 SEQ ID NO: 106 gene in these strains. These bands are not detected in Neo ncmicl-3 KO and Neo ncmicl-3 KO-2G strains confirming the deletion of the gene in these strains.
- the electrophoreses of the PCR products carried out with the primers m SEQ ID NO: 28 and SEQ ID NO: 25 and the primers k SEQ ID NO: 26 and n SEQ ID NO: 29 make it possible respectively to highlight a 3359 and 3421 base pair band for the Neo strain ncmic1-3 KO, according to the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain in place of the ncmic 1 gene This band is not detected in wild strains NC-1 of N.
- Neo ncmic3 KO caninum, Neo ncmic3 KO, Neo ncmic3 KO - 2G, and Neo ncmic 1-3 KO - 2G confirming the absence of the at - gfp selection gene SEQ ID NO: 2 at the ncmic 1 locus in these strains.
- the electrophoreses of the PCR products made with the primers SEQ ID NO: 30 and SEQ ID NO: 31 make it possible to highlight different bands according to the expected band size.
- a 2182 base pair band for the NC-1, Neo ncmic3 KO and Neo ncmic3 KO-2G strains confirms the presence of the ncmic 1 gene in these strains.
- a 2560 base pair band is demonstrated for the Neo ncmicl-3 KO strain confirming the presence of the selection cassette CATGFP SEQ ID NO: 6 in place of the ncmic gene 1.
- the glass coverslips are mounted on a slide with Immu-Mount TM and observed under a fluorescence microscope.
- the primary antibody Tgmic3 allows recognition of the Ncmic3 protein, it makes it possible to detect the expression of the NcMIC3 protein SEQ ID NO: 118 in the parasite (anti-mic3 rabbit antibody: rnAb anti-MIC3 s3) and the antibody secondary trading is used fluorine Alexa ® 594 goat anti-rabbit (ref Life technologies. al 1012). The results show that no fluorescence is detectable at the apical pole of the parasite revealing the absence of MIC3 proteins ( Figure 4- A).
- the primary antibody Tgmic1 does not allow recognition of the NcMIC1 protein SEQ ID NO: 119.
- the haploid genome of Toxoplasma gondii during the proliferative phase allows the invalidation of a gene in a single homologous recombination.
- HFF Hs27 ATCC CRL-1634 human fibroblasts grown in Dulbecco's minimal medium (DMEM) supplemented with 10% fetal calf serum (VF S), 2mM glutamine , 100 U / mL penicillin and 100 U / mL streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- Plasmid pTgMIC3-KO-CAT-GFP LoxP SEQ ID NO: 34 was constructed to delete the gene encoding Toxoplasma gondii TgMIC3 protein (ATCC reference: RH Pra310 strain) by homologous recombination.
- the plasmid pTgMic3KO-CAT-GFP loxP SEQ ID NO: 34 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising a cat-gfp selection gene SEQ ID NO: 2 coding for a CAT-GFP fusion protein allowing both chloramphenicol resistance (CAT) and green fluorescence (GFP), under the control of the Toxoplasma gondii ⁇ -tubulin promoter SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO: 2, the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted.
- CAT chloramphenicol resistance
- GFP green fluorescence
- SEQ ID NO: 6 was amplified from plasmid pT230 CAT-GFP SEQ ID NO: 9 using primers SEQ ID NO: 35 and SEQ ID NO: 36 which allow the addition of loxP sites (SEQ ID NO: 12) and HindIII and Spel restriction sites.
- the amplified nucleotide sequence by PCR 2389 bp was then cloned into the plasmid pT230TUB Ble SEQ ID NO: 37 by enzymatic digestion with restriction enzymes HindIII and SpeI.
- the plasmid obtained is called pCATGFP loxP SEQ ID NO: 38.
- the 3'HR region of the tgmic3 gene SEQ ID NO: 39 was obtained by the enzymatic double digestion of the plasmid pmic3KO-2 SEQ ID NO: 40 with the restriction enzymes KpnI and HindIII (2145pb), and then cloned into the plasmid pCATGFP loxP SEQ ID NO: 38 digested with KpnI and HindIII (5238bp).
- the plasmid obtained is called p3'UTRmic3-CATGFP loxP SEQ ID NO: 41.
- the 5'HR region of the tgmic3 gene SEQ ID NO: 42 was amplified by PCR from the genomic DNA of the T. gondii RH strain.
- the primers SEQ ID NO: 43 and SEQ ID NO: 44 allow the amplification of the 5'UTR region of the tgmic3 gene and the creation of two restriction sites (2568bp / Spel and XbaI sites).
- Table 5 Sequences of the primers used for the construction of the plasmid pTgMIC3-KO-CAT-GFP loxP.
- Plasmid pTgMIC1-KO-CAT-GFP loxN SEQ ID NO: 45 ( Figure 5-B) was constructed to delete the gene encoding Toxoplasma gondii TgMIC 1 protein by homologous recombination.
- the plasmid pTgMic1 KO-CAT-GFP loxN SEQ ID NO: 45 contains a CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 coding for the CAT-GFP fusion protein allowing both the chloramphenicol resistance (CAT) and a green fluorescence (GFP: Green Fluorescent Protein), under the control of the toxoplasma gondii ⁇ -tubulin promoter SEQ ID NO: 3. Downstream of the cat-gfp gene SEQ ID NO : 2, the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 was inserted.
- CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2 coding for the CAT-GFP fusion protein allowing both the chloramphenicol resistance (CAT) and a green fluorescence (GFP: Green Fluorescent Protein),
- SEQ ID NO: 6 was amplified from plasmid pT230 CAT-GFP SEQ ID NO: 9 using primers SEQ ID NO: 46 and SEQ ID NO: 47 which allow the addition of loxN sites (SEQ ID NO: 5) and Clal and Xbal restriction sites.
- the PCR amplified nucleotide sequence was then cloned into plasmid pNcMic3KO-DHFR SEQ ID NO: 10 digested with Clal and XbaI (7715 bp) by enzymatic digestion with restriction enzymes ClaI and XbaI.
- the plasmid obtained is called pNCmic3KO CATGFP LoxN SEQ ID NO: 48.
- the 5HR tgmicl SEQ ID NO: 49 fragment was amplified by PCR with the primers SEQ ID NO: 50 and SEQ ID NO: 51 (2364bp), the KpnI and ClaI restriction sites were added by PCR.
- the amplified fragment is digested with the restriction enzymes KpnI and ClaI (2337bp) and cloned into the plasmid pNCmic3KO CATGFP LoxN SEQ ID NO: 48 (see Example 1 for obtaining the plasmid pNCmic3KO CATGFP LoxN) digested with KpnI and ClaI (7740bp). ) to replace the 5HR ncmic3 fragment (fragment digested with KpnI and ClaI).
- the plasmid obtained is called pTgmiclK05HR-NCmic3K03HR CATGFP LoxN SEQ ID NO: 111.
- the 3HR tgmicl SEQ ID NO: 52 fragment was amplified by PCR with the primers SEQ ID NO: 53 and SEQ ID NO: 54 (2750bp), the XbaI and NotI restriction sites were added by PCR.
- the amplified fragment is digested with the restriction enzymes XbaI and NotI (2720 bp) and then cloned into the plasmid pTgmic1K05HR-NCmic3K03HR CATGFP LoxN SEQ ID NO: 111 digested with restriction enzymes XbaI and NotI (7565 bp) to replace the 3HR fragment.
- ncmic3 fragment digested with Xbal and NotI.
- the plasmid obtained is called pTgmiclKO CAT-GFP LoxN SEQ ID NO: 45.
- the primers used for the PCRs are detailed in Table 6 below.
- the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 was constructed to transiently express in the parasite Toxoplasma gondii and its genetically modified derivatives the gene coding for Cre recombinase-derived Cre Recombinase protein (Brecht et al, 1999, same reference as before).
- the plasmid pT-SAG1-Cre-Recombinase SEQ ID NO: 15 is derived from the plasmid pUC18 (commercial plasmid) which contains an expression cassette of Cre Recombinase of bacteriophage Pl.
- the gene encoding Cre Recombinase SEQ ID NO: 16 is placed under the control of the promoter of the sagl gene of Toxoplasma gondii SEQ ID NO: 17, which allows expression of Cre Recombinase protein in transfected Toxoplasma gondii parasites.
- Toxo tgmicl-3 KO-2G The construction of the second generation live attenuated strain, called Toxo tgmicl-3 KO-2G, is done in 4 distinct steps ( Figure 6-A): Deletion by homologous recombination of the tgmic3 gene and its replacement with the CAT-GFP selection cassette SEQ ID NO: 6 flanked by LoxP sequences SEQ ID NO: 12.
- the wild strain of Toxoplasma gondii RH (ATCC reference: PRA-310) is electroporated with the plasmid pTgMIC3-KO-CAT-GFP loxP SEQ ID NO: 34.
- 20 ⁇ g of plasmid purified and then linearized with KpnI are added to 10 7 parasites suspended in the CYTOMIX electroporation medium containing ⁇ (3 mM) and Glutathione (3 mM) (Van den Hoff et al, Nucleic Acid Research, Jun 11; 20 (11): 2902), and the electroporation was carried out in a 4 mm gap, in a volume of 800 on a BioRad device (Parameters: 2000V, 50 ohms, 25 ⁇ , with two electric shocks ).
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 ⁇ l), 24 hours after the electroporation.
- the parasites are subcloned into a 96-well plate on a HFF cell monolayer and the clones of interest are identified by PCR after carrying out DNAzol genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmic3 KO.
- the mic3 gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6.
- the theoretical sequence at the locus of the deleted mic3 gene containing the CATGFP selection cassette is SEQ ID NO: 103. Since the honey gene is not deleted, the sequence of the honey gene SEQ ID NO: 108 is present in the genome of strain.
- the transiently expressed enzyme will allow excision of the CAT-GFP selection cassette SEQ ID NO: 6.
- the electroporation protocol is similar to the previous protocol. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a DNAzol genomic DNA extraction of the clones of interest. . The strain obtained is called Toxo igmic3 KO - 2G. In this strain, the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.
- the honey gene is not deleted, the honey gene sequence SEQ ID NO: 108 is present in the genome of the strain. Deletion by homologous recombination of the tgmicl gene and its replacement with the CAT-GFP selection cassette SEQ ID NO: 6 flanked by Lox N SEQ ID NO: 5 sequences.
- the strain Toxo tgmic3 KO-2G is electroporated with the plasmid pTgMIC1-KO-CAT-GFP lox N SEQ ID NO: 45 linearized by Pcil, according to the previously described protocol.
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 ⁇ l), 24 hours after electroporation.
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO.
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.
- the honey gene was deleted and replaced by the selection cassette CATGFP SEQ ID NO: 6.
- the theoretical sequence at the deleted honey gene locus containing the CATGFP selection cassette is SEQ ID NO: 104.
- the strain Toxo tgmic1-3 KO obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15.
- the transiently expressed enzyme will allow the excision of the selection cassette CAT-GFP SEQ ID NO: 6.
- the tachyzoites are deposited on a monolayer of HFF cells in culture. After 2 to 7 days of culture, the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a DNAzol genomic DNA extraction of the clones of interest. .
- the strain obtained is called Toxo tgmicl-3 KO-2G.
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12 is SEQ ID NO: 19.
- the honey gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted honey gene containing a single lox site N SEQ ID NO: 5 is SEQ ID NO: 92.
- PCR analyzes are carried out from genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for the PCRs are described in Figure 11-B and are detailed in Table 7 below.
- the PCR products are analyzed by agarose gel electrophoresis (FIG. 6-B). Their expected size and observed size are also described in Table 8 below. For the sake of clarity in FIG.
- Table 7 list of primers used for validation of strains.
- the electrophoreses of the PCR products made with the primers SEQ ID NO: 61 and SEQ ID NO: 62 make it possible to demonstrate an 808 base pair band for the strain RH, according to the expected band size. and confirming the presence of the tgmic3 gene in this strain. This band is not detected in the strains Toxo tgmic3 KO, Toxo tgmic3 KO - 2G, Toxo tgmicl - 3 KO and Toxo tgmicl - 3 KO - 2G confirming the suppression of the gene in these strains.
- the electrophoreses of the PCR products carried out with the primers SEQ ID NO: 57 and SEQ ID NO: 25, and the primers k SEQ ID NO: 26 and SEQ ID NO: 58 (mixes 6 and 7) make it possible to highlight respectively a 3040 and 3593 base pair band for the Toxo tgmic1-3 KO strain, according to the expected band size and confirming the presence of the cat-gfp selection gene SEQ ID NO: 2 in this strain in place of the gene tgmic3 SEQ ID NO: 107. This band is not detected in the RH wild strains of T.
- the electrophoreses of the PCR products made with the primers SEQ ID NO: 59 and SEQ ID NO: 60 8 (mix 8) can highlight different bands in accordance with the expected band size.
- a 4198 bp band for the RH, Toxo tgmic3 KO and Toxo tgmic3 KO-2G strains confirms the presence of the tgmicl SEQ ID NO: 108 gene in these strains.
- a 3129 base pair band is demonstrated for the Toxo tgmic1-3 KO strain confirming the presence of the CATGFP selection cassette SEQ ID NO: 6 in place of the tgmic1 gene.
- the tachyzoites are grown 24h on glass slides covered with a monolayer of HFF cells. Infected cells were washed twice with PBS1X, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After 3 washes with PB IX, a saturation step is carried out with a 10% PB S 1X / SVF solution for 30 min. The cells were then incubated with the primary antibody diluted in 2%> FCS for 1 hour, washed 3 times with PBS1X and then incubated with secondary antibody diluted in 2% PBS / FCS solution for 1 hour. After 2 washes with PBS1X, the glass coverslips are mounted on a slide with Immu-Mount TM and observed under a fluorescence microscope.
- the primary antibody Tgmic3 used is an antibody which makes it possible to detect the expression of the TgMIC3 protein SEQ ID NO: 121 in the parasite (anti-mic3 rabbit antibody: rnAb anti-MIC3 s3) and the commercial secondary antibody used is Alexa fluor ® 594 goat anti-rabbit (Life Technologies Ref Al 1012).
- the Tgmicl primary antibody used is an antibody that makes it possible to detect the expression of the TgMIC1 protein SEQ ID NO: 122 in the parasite (anti-honey mouse antibody: anti-MIC1 mAb T104F8E12) and the commercial secondary antibody used is Alexa fluor ® 594 goat anti-mouse, Life technologies ref. Al 1005).
- the haploid genome of Toxoplasma gondii during the proliferative phase allows the invalidation of a gene in a single homologous recombination.
- HFF human fibroblasts
- DMEM Dulbecco's minimal medium
- FV S fetal calf serum
- 2mM glutamine 100 U / mL of penicillin and 100 U / mL streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- the plasmid pTgRopl6KO-Gral5 n KI-CAT-GFP lox2272 SEQ ID NO: 67 contains the CAT-GFP selection cassette SEQ ID NO: 6 comprising the cat-gfp selection gene SEQ ID NO: 2, coding for the CAT-GFP fusion protein conferring resistance to chloramphenicol (CAT) and green fluorescence (GFP), under the control of the ⁇ -tubulin promoter of Toxoplasma gondii SEQ ID NO: 3 to allow expression of the gene in the parasite .
- CAT chloramphenicol
- GFP green fluorescence
- the 3'UTR sequence of the sagl gene of Toxoplasma gondii SEQ ID NO: 4 is inserted. This sequence aims to stabilize the mRNA encoding the CAT-GFP fusion protein.
- the selection cassette SEQ ID NO: 6 is flanked by two Lox2272 SEQ ID NO: 68 sites, recognition sites specifically recognized by Cre Recombinase and that will be used later to remove the CAT-GFP selection cassette.
- an expression cassette of the gral5n gene SEQ ID NO: 69 was cloned.
- This expression cassette consists of the ampl 15u promoter amplified from the genomic DNA of the ME49 strain and the gral5n gene SEQ ID NO: 70 amplified at from the genomic DNA of the ME49 strain, including a 3 'HA tag SEQ ID NO: 72 to facilitate localization and the 3' UTR sequence of the T. gondii sagl SEQ ID NO: 4 gene amplified from the genomic DNA of the RH strain.
- This plasmid therefore allows the simultaneous production of a mutant roploKO lox2272 CATGFP lox2272 and the insertion of gral5IIHA at locus ropl6.
- the plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 contains a CAT-td Tomato SEQ ID NO: 125 cassette flanked by a 5'HR sequence of the tgroplo gene SEQ ID NO: 99 and a 3'HR sequence of the tgroplo gene. SEQ ID NO: 100.
- Cloning was done from plasmid pTgROP16-KO-CAT-tdTomato SEQ ID NO: 73 digested with SphI and Agel enzymes (6073bp). This cloning required 4 independent PCRs.
- the first PCR allowed amplification from the plasmid pCATGFP lox P SEQ ID NO: 38, of a CAT-GFP screening cassette SEQ ID NO: 6 comprising the aTubulin promoter, the cat-gfp selection gene and the region. 3'UTR of sagl of T. gondii, with addition of the site lox2272 SEQ ID NO: 68 with the primers tub F Agel SEQ ID NO: 74 and 3 UTR lox2272 R SEQ ID NO: 75 (2090pb).
- the second PCR allowed the amplification from the plasmid pT230 2G gral5II SEQ ID NO: 76, of the gral5II promoter SEQ ID NO: 71 with 5 'addition of the site lox2272 SEQ ID NO: 68 with the primers pGral5 F lox2272 SEQ ID NO: 77 and P Gral5 R SEQ ID NO: 78 (1975bp).
- the third PCR allowed amplification from the plasmid pT230 2G gral5II SEQ ID NO: 1
- the last PCR allowed the amplification of a part of 3'Ropl6 SEQ ID NO: 80 with the primers Ropl6F SEQ ID NO: 81 and Ropl6R SphI SEQ ID NO: 82 (570pb) on the plasmid pTgroplo KO CAT-tdTomato SEQ ID NO: 73 as a matrix.
- the 4 amplified PCR fragments were directly cloned into the pTgroplo KO CAT-tdTomato SEQ ID NO: 73 vector digested with Agel and SphI using the Ozyme In-Fusion® kit (In-Fusion® HD Cloning Kit - Clonetech).
- In-Fusion® cloning technology allows one-step cloning without purification or digestion of one or more PCR products in a linearized vector. Complementary ends at the ends of adjacent fragments are added by PCR. The reaction is done according to the manufacturer's recommendations.
- the plasmid obtained is called pTgRopl6KO-Gral5 n KI-CAT-GFP lox2272 SEQ ID NO: 67.
- the plasmid called pTgRopl6KO-Gral5 n KI-CAT-GFP lox2272 SEQ ID NO: 67 therefore contains a CAT-GFP cassette SEQ ID NO: 6 and an expression cassette of gral5HAII SEQ ID NO: 69, flanked by a 5'HR sequence of the tgroplo SEQ ID NO: 99 gene and a 3'HR sequence of the tgroplo SEQ ID NO: 100 gene.
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO ropl6 KO GralSII KL
- the ropl6 gene was deleted and replaced by the CATGFP selection cassette SEQ ID NO: 6 and the gral5HAII expression cassette SEQ ID NO: 69.
- the theoretical sequence at the locus of the ropl6 deleted gene containing the CATGFP selection cassette and the gral5HAII expression cassette is SEQ ID NO: 112.
- the mic3 gene has been deleted and the selection cassette CATGFP SEQ ID NO: 6 has been excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12 is SEQ ID NO: 19.
- the honey gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted honey gene containing a single lox N site SEQ ID NO: 5 is SEQ ID NO: 92.
- Suppression of the selection cassette the strain Toxo tgmic1-3 KO ropl6 KO Gral5II K1 obtained is electroporated with the plasmid pT-SAG1-CRE-Recombinase SEQ ID NO: 15 (FIG. 2-C).
- the transiently expressed enzyme will allow excision of the CAT-GFP selection cassette. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a DNAzol genomic DNA extraction of the clones of interest. .
- the strain obtained is called Toxo tgmicl-3 KO ropl6 KO GralSII Kl -2G.
- the ropl6 gene was deleted and replaced by the gral5HAII expression cassette SEQ ID NO: 69 and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted ropl6 gene containing the single-site cassette lox 2272 SEQ ID NO: 68 and the gral5HAII expression cassette is SEQ ID NO: 93.
- the mic3 gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted mic3 gene containing a single lox P site SEQ ID NO: 12, is SEQ ID NO: 19.
- the honey gene was deleted and the selection cassette CATGFP SEQ ID NO: 6 was excised.
- the theoretical sequence at the locus of the deleted honey gene containing a single lox site N SEQ ID NO: 5 is SEQ ID NO: 92.
- PCR analyzes are carried out from the genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for the PCRs are described in Figure 11-C and are detailed in Table 10 below.
- the PCR products are analyzed by agarose gel electrophoresis (FIG. 9-B). Their expected size and observed size are also described in Table 11 below.
- Table 10 List of primers used for the validation of the Toxo strain tgmicl-3 KO ropl6 KO Gral5II Kl 2G.
- Table 11 Expected size of the amplicons (in base pairs) of the different validation PCRs for the construction of the Toxo tgmicl-3 KO strain ropl6 KO Gral5II Kl 2G
- the tachyzoites are grown 24h on glass slides covered with a monolayer of HFF cells. Infected cells were washed twice with PBS1X, and fixed with 4% formaldehyde for 30 min. After 3 washes in PBS1X, infected HFF cells were permeabilized with 0.1% Triton X-100 in PBS1X for 5 min. After 3 washes with PB IX, a saturation step is carried out with a 10% PB S 1X / SVF solution for 30 min. The cells were then incubated with the primary antibody diluted in 2%> FCS for 1 hour, washed 3 times with PBS1X and then incubated with secondary antibody diluted in 2% PBS / FCS solution for 1 hour. After 2 washes with PBS1X, the glass coverslips are mounted on a slide with Immu-Mount TM and observed under a fluorescence microscope.
- the primary antibody used is the mouse anti-HA antibody which makes it possible to detect the expression of the GRA15n-HA protein SEQ ID NO: 123 in the parasite.
- the secondary antibody is the commercial secondary antibody: Alexa fluor® 594 goat anti rabbit (Life Technologies A-1012). The antibodies are diluted 1/1000 in PBS 2% FCS.
- the Toxo tgmicl-3 KO ropl6 KO gral5II K1 strain expresses a green fluorescent reflecting the expression of the CATGFP protein SEQ ID NO: 120, whereas after the action of Cre recombinase, the Toxo tgmicl-3 KO strain ropl6 KO gral5II Kl lox2272 no longer fluorescent ( Figure 10).
- EXAMPLE 4 Construction of Recombinant Strains Expressing the M2eGPI Protein After Targeted Integration
- the objective of this experiment is to evaluate whether the Toxo tstnicl-3 KO 2G and Neo ncmicl-3 KO 2G strains can express heterologous antigens.
- HFF human fibroblasts
- DMEM Dulbecco's minimal medium
- F S fetal calf serum
- 2mM glutamine 100 U / mL of penicillin and 100 U / mL streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- the plasmid pUC 4G2 ICrel SEQ ID NO: 156 was constructed to allow the integration of a heterologous transgene in the strains Toxo tgmicl-3 KO 2G, Neo ncmicl-3 KO 2G and Toxo tgmicl-3 KO roplo KO gral5II Kl.
- the plasmid is in particular composed of:
- a selection cassette dhfr * -ty-tk SEQ ID NO: 229 (Donald & Roos, Proc Natl Acad Sci US A 1993 Dec 15; 90 (24): 11703-7; Scahill et al, (Mol Biochem Parasitol, 2008 Jan, 157 (1): 73-82, Epub 2007 Oct 6.)), placed under the control of the T. gondii dhfr * SEQ ID NO: 230 promoter and downstream of the 3'UTR sequence. of the dhfr gene * SEQ ID NO: 231 from Toxoplasma gondii.
- This selection cassette encodes the DHFR * TYTK SEQ ID NO: 207 fusion protein and allows positive selection by pyrimethamine and negative selection by ganciclovir.
- 2- an expression cassette consisting of the ⁇ -Tub8 promoter SEQ ID NO: 128 (Soldati et al., Mol Cell Biol., 1995 Jan. 15 (1): 87-93 - fusion of part of the Tgsag1 and Tgtub promoter), a multiple cloning site MCS to allow the future integration of heterologous transgene and the 3'UTR sequence of the tgsagl gene SEQ ID NO: 4 which should make it possible to stabilize the mRNA of the heterologous gene .
- the dhfr * -ty-tk selection cassette was made from 3 PCR fragments obtained with the primers of Table 20:
- the amplification of the first PCR fragment SEQ ID NO: 129 was carried out on the plasmid pUC18DHFR * SEQ ID NO: 130 (Donald & Roos 1993, same reference as above) with the primers Dhtk1 SEQ ID NO: 131 and Dhtk2 SEQ ID NO: 132 (674bp) and allows the amplification of the end of the coding sequence of DHFR * SEQ ID NO: 133 and to add the sequence encoding the TY in 3 'SEQ ID NO: 134.
- the second PCR was carried out on a synthesized sequence of the gene encoding the Thymidine Kinase of Human herpesvirus 1 (TK) SEQ ID NO: 135 with the primers Dhtk3 SEQ ID NO: 136 and Dhtk4 SEQ ID NO: 137 (1161pb) and allows the amplification of the coding sequence of Thymidine Kinase with the addition of the TY coding sequence at 5 'SEQ ID NO: 138.
- TK Human herpesvirus 1
- the amplification of the third PCR fragment was carried out on pUC18DHFR * SEQ ID NO: 130 with primers Dhtk5 SEQ ID NO: 139 and Dhtk6 SEQ ID NO: 140 (363pb) and allows the amplification of the end of the sequence coding for Thymidine Kinase and 3'UTR of DHFR * SEQ ID NO: 141.
- the second and third PCR fragments are fused by overlapping PCR with the primers Dhtk3 SEQ ID NO: 136 and Dhtk6 SEQ ID NO: 140 (1501pb) to give the sequence SEQ ID NO: 191.
- the first fragment SEQ ID NO: 129 digested with BamHI and BglII (646bp) and fusion of the other two BamHI and XbaI digested PCR (SEQ ID NO: 191) (1474bp) were cloned into plasmid pUC18DHFR * SEQ ID NO: 130 digested with BglII and XbaI (5258bp).
- the plasmid obtained is called pUC 18DHFR * TYTK SEQ ID NO: 142.
- the expression cassette is composed of the Pa-Tub8 promoter SEQ ID NO: 128 (Soldati et al, 1995, same reference as above), a multiple cloning site to allow future integration of heterologous transgene and the 3'UTR sequence of the sagl gene SEQ ID NO: 4 which should make it possible to stabilize the mRNA of the heterologous gene.
- the promoter portion of ⁇ -Tub8 SEQ ID NO: 128 was obtained by PCR with primers K7mcs1 SEQ ID NO: 143 and K7mcs2 SEQ ID NO: 144 (530pb) on pTUB8TY TAIL SEQ ID NO: 145 (Meissner and al., J Cell Sci., 2002: 115: 563-574).
- the 3 'UTR sequence of the sagI gene SEQ ID NO: 4 was obtained by PCR with primers K7mcs3 SEQ ID NO: 146 and K7mcs4 SEQ ID NO: 147 (395 bp).
- the two PCR fragments were fused by overlapping PCR with primers K7mcs1 SEQ ID NO: 143 and K7mcs4 SEQ ID NO: 147 (914pb) to give the sequence SEQ ID NO: 192.
- the overlapping PCR SEQ ID NO: 192 digested by KpnI and SacI (902bp) was cloned into pUC18 (commercial plasmid) KpnI SacI (2682bp).
- the primers used for the PCRs are detailed in Table 12 below.
- the resulting plasmid is pUC 18 -Tub8MCS 3UTR SEQ ID NO: 148.
- Table 12 List of primers used for the construction of the expression cassette
- the Tub8MCS 3UTR SEQ ID NO: 149 expression cassette obtained by digestion of the pUC 18 -Tub8MCS 3UTR SEQ ID NO: 148 with the XbaI enzyme (890bp) was then cloned into the plasmid pUC18 DHFR * TYTK SEQ ID NO: 142 digested with XbaI and dephosphorylated (7378bp).
- the resulting plasmid has its Tub8MCS 3UTR expression cassette transcribed in the opposite direction to the DHFR * TYTK cassette.
- the plasmid obtained is named pUC4G2 SEQ ID NO: 150.
- the two fragments PCR SEQ ID NO: 193 and SEQ ID NO: 194 were directly cloned into the pUC4G2 plasmid SEQ ID NO: 150 digested with the restriction enzymes Pml I and KasI (7990bp) with the In-Fusion technique of Ozyme.
- the primers used for PCR are detailed in Table 21 below.
- This plasmid will make it possible to produce a M2eGPI sagI fusion protein SEQ ID NO: 165, comprising the Toxoplasma gondii S AGI protein SEQ ID NO: 166, a repetition of 5 M2e (Nter fragment of the Influenza virus M 2 protein). spaced by linkers (Lee et al, 2015, PLoS ONE 10 (9): e0137822, doi: 10.1371 / journal.pone.0137822) SEQ ID NO: 167 and Cter a GPI anchoring sequence of the AGI protein S of Toxoplasma gondii SEQ ID NO: 169. The amplification of 3 PCR fragments was necessary for this construction.
- the amplification of the first PCR fragment SEQ ID NO: 197 was performed on the genomic DNA of Toxoplasma gondii of the sagl coding sequence SEQ ID NO: 170 with the primers of SEQ ID NO: 171 and db SEQ ID NO: 172 (906bp).
- the second PCR SEQ ID NO: 198 was performed on a synthesized sequence comprising a repetition of M2e SEQ ID NO: 173 (Lee et al) with the primers of SEQ ID NO: 174 and dd SEQ ID NO: 175 (588pb) . This M2e sequence has been optimized for expression in Toxoplasma gondii.
- the amplification of the third PCR fragment SEQ ID NO: 199 was carried out on the genomic DNA of Toxoplasma gondii of the sagl coding sequence (GPI anchor portion) SEQ ID NO: 176 with the primers of SEQ ID NO: 177 and SEQ ID NO: 178 (98bp).
- the primers used for the PCRs are detailed in Table 13 below.
- Table 13 List of primers used for the construction of plasmids pUC 4G2 Icrel M2eGPI
- PCR fragments were directly cloned into the plasmid p4G2 ICrel SEQ ID NO: 156 digested with the enzymes Pmel and NotI (8344pb) with the In-Fusion technique of Ozyme.
- the LoxP site SEQ ID NO: 12 was introduced by PCR into plasmid PUC 4G2 Icrel M2eGPI SEQ ID NO: 164 digested Pcil and PmeI (8901 bp).
- the PCR fragment SEQ ID NO: 200 obtained with the primers aa SEQ ID NO: 180 and ab SEQ ID NO: 181 (438bp) and the PCR fragment SEQ ID NO: 201 obtained with primers ac SEQ ID NO: 182 and ad SEQ ID NO: 183 (534bp) ) were cloned with the In-Fusion technique of Ozyme in plasmid PUC 4G2 Icrel M2eGPI SEQ ID NO: 164 digested Pcil and Pmel. Primers used for PCR are detailed in Table 14 below.
- Table 14 List of primers used for the introduction of the loxP site
- the loxN site SEQ ID NO: 5 was introduced by PCR into the plasmid PUC 4G2 Icrel M2eGPI SEQ ID NO: 164 digested Pcil and PmeI (8901 bp).
- the PCR fragment SEQ ID NO: 202 obtained with the primers aa SEQ ID NO: 180 and bb SEQ ID NO: 181 (438pb) and the PCR fragment SEQ ID NO: 203 obtained with the primers bc SEQ ID NO: 182 and ad SEQ ID NO: 183 (534bp) were cloned with the In-Fusion technique of Ozyme in the plasmid PUC 4G2 Icrel M2eGPI SEQ ID NO: 164 digested Pcil and Pmel.
- the primers used for PCR are detailed in Table 15 below.
- Table 15 List of primers used for the introduction of the loxN site
- the strain ToxoKO micI-3KO 2G is electroporated with 20 ⁇ g of circular plasmids purified pUC 4G2 Icrel M2eGPI loxP SEQ ID NO: 179 and pTsagI Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For selection of the mutants, the culture medium is replaced and supplemented with the selection agent (20 ⁇ M chloramphenol), 24 hours after electroporation.
- the selection agent (20 ⁇ M chloramphenol
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO -2G M2eGPI loxP.
- the strain ToxoKO micI-3KO 2G is electroporated with 20 ⁇ g of the circular plasmids purified pUC 4G2 Icrel M2eGPI loxN SEQ ID NO: 184 and pTsagI Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenol 20 ⁇ l), 24 hours after electroporation.
- the selection agent chloramphenol 20 ⁇ l
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO -2G M2eGPI loxN. Random integration
- the strain ToxoKO -3KO honey 2G is electroporated with 20 ⁇ g of the purified linearized plasmid pUC 4G2 Icrel M2eGPI loxP SEQ ID NO: 179 or pUC 4G2 Icrel M2eGPI loxN SEQ ID NO: 184 according to the protocol previously described.
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the culture medium is replaced and supplemented with the selection agent (chloramphenicol 20 ⁇ l), 24 hours after electroporation. 10 to 15 days after selection, the parasites are analyzed for the expression of the SAG1 M2eGPI fusion protein SEQ ID NO: 165 (analysis on the total population).
- PCR analyzes are carried out from genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for the PCRs are detailed in Table 16 below.
- the PCR products are analyzed by agarose gel electrophoresis.
- the clones having integrated the plasmid were validated by PCR with the primers SEQ ID NO: 187 and eb SEQ ID NO: 188 by obtaining the fragment SEQ ID NO: 204 (1719pb).
- the second PCR makes it possible to validate the location of the insertion of the plasmid at the Tgmic3 loxP locus.
- the clones having integrated one of the plasmids were validated by PCR with the primers ec SEQ ID NO: 189 and eb SEQ ID NO: 188 by obtaining the fragment SEQ ID NO: 205 (2704 bp).
- Table 16 List of primers used for validation of clones
- MCS F AACCCGCGCAGAAGACATCC MCS R ATGGGGCACATGCTGCACGAA
- PCR analyzes are carried out from genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for the PCRs are detailed in Table 17 below.
- the PCR products are analyzed by agarose gel electrophoresis.
- the clones having integrated one of the plasmids were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 (1719pb) by obtaining the fragment SEQ ID NO: 204.
- the second PCR makes it possible to validate the location of the insertion of the plasmid at the Tgmicl loxN locus.
- the clones having integrated one of the plasmids were validated by PCR with the primers ed SEQ ID NO: 55 and eb SEQ ID NO: 54 (2366pb) by obtaining the fragment SEQ ID NO: 206.
- Table 17 List of primers used for validation of clones
- M2eGPI SEQ ID NO: 165 The expression level of M2eGPI SEQ ID NO: 165 was analyzed for different populations of recombinant parasites following specific labeling with an anti-M2 antibody (anti-influenza A virus M2 Protein antibody ab5416 - Abcam). Expression of the M2eGPI transgene is similar or slightly higher for clones whose transgene is targeted (localized at the LoxP and LoxN scars at the honey locus or mic3) than for populations whose transgene is inserted randomly. . This result demonstrates that the Toxo tgmic1-3 KO 2G strain is an optimized expression vector for transgene expression.
- Example 5 Construction of recombinant strains of Toxo ts iclS KO expressing the CAT-GFP protein after targeted or random integration of the transgene cat-sfp
- the objective of this experiment is to study the level of expression of the cat-gpf gene after random or targeted integration at the LoxP or LoxN site of the transgene.
- HFF human fibroblasts
- DMEM Dulbecco's minimal medium
- F S fetal calf serum
- 2mM glutamine 100 U / mL of penicillin and 100 U / mL streptomycin. They were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- the CATGFP fragment SEQ ID NO: 222 was amplified by PCR with the primers ca SEQ ID NO: 223 and cb SEQ ID NO: 224 (1488 bp) on pCATGFP SEQ ID NO: 9. This PCR fragment was cloned with the Ozyme In-Fusion technique in the plasmid pUC 4G2 Icrel M2eGPI loxP SEQ ID NO: 179 was digested with PmeI and NotI (8372pb-replacement of M2eGPI by CATGFP). The primers used for the PCRs are detailed in Table 18 below.
- Table 18 List of primers used for the construction of plasmids pUC 4G2 Icrel CAT ⁇
- the CATGFP fragment SEQ ID NO: 222 was amplified by PCR with the primers ca SEQ ID NO: 223 and cb SEQ ID NO: 224 (1488 bp) on pCATGFP SEQ ID NO: 9. PCR was cloned with the In-Fusion technique of Ozyme in plasmid pUC 4G2 Icrel M2eGPI loxN SEQ ID NO: 184 was digested with Pmel and NotI (8372pb-replacement of M2eGPI by CATGFP). Primers used for PCR are detailed in Table 18 above.
- the ToxoKO mic1-3KO 2G strain is electroporated with 20 ⁇ g of the circular plasmids purified pUC 4G2 Icrel CATGFP loxP SEQ ID NO: 221 and pTsagl Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For selection of the mutants, the culture medium is replaced and supplemented with the selection agent (20 ⁇ M chloramphenol), 24 hours after electroporation.
- the selection agent (20 ⁇ M chloramphenol
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO -2G CATGFP loxP.
- the ToxoKO mic1-3KO 2G strain is electroporated with 20 ⁇ g of the purified circular plasmids pUC 4G2 Icrel CATGFP loxN SEQ ID NO: 225 and pTsagl Cre recombinase SEQ ID NO: 15 according to the protocol previously described. After electroporation, the tachyzoites are deposited on a monolayer of HFF cells in culture. For the selection of the mutants, the culture medium is replaced and supplemented with the selection agent (chloramphenol 20 ⁇ l), 24 hours after electroporation.
- the selection agent chloramphenol 20 ⁇ l
- the parasites are subcloned into a 96-well plate on a monolayer of HFF cells and the clones of interest are identified by PCR after carrying out a genomic DNA extraction of the clones of interest.
- the strain obtained is called Toxo tgmicl-3 KO -2G CATGFP loxN.
- the ToxoKO-3KO 2G strain is electroporated with 20 ⁇ g of the purified linearized plasmid pUC 4G2 Icrel CATGFP loxP SEQ ID NO: 221 or pUC 4G2 Icrel CATGFP loxN SEQ ID NO: 225 according to the protocol previously described.
- the tachyzoites are deposited on a monolayer of HFF cells in culture.
- the culture medium is replaced and supplemented with the selection agent (chloramphenol 20 ⁇ l), 24 hours after electroporation. 10 to 15 days after selection, the parasites are analyzed for the expression of the CATGFP protein SEQ ID NO: 120 (analysis on the total population).
- PCR analyzes are carried out from genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for PCR are detailed in Table 16 previously cited.
- the PCR products are analyzed by agarose gel electrophoresis.
- the clones having integrated the plasmid were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 226 (1647pb).
- the second PCR makes it possible to validate the location of the insertion of the plasmid at the Tgmic3 loxP locus.
- the clones having integrated one of the plasmids were validated by PCR with the primers ec SEQ ID NO: 189 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 227 (2600 bp).
- Primers used for PCR are detailed in Table 16.
- PCR analyzes are carried out from genomic DNA extracted with DNAzol from a parasitic pellet consisting of 10 7 parasites.
- the primers used for PCRs are detailed in Table 17 previously cited.
- the PCR products are analyzed by agarose gel electrophoresis.
- the clones having integrated one of the plasmids were validated by PCR with the primers ea SEQ ID NO: 187 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 226 (1647pb).
- Primers used for PCR are detailed in Table 16.
- the second PCR makes it possible to validate the location of the insertion of the plasmid at the TgmicI loxN locus.
- the clones having integrated one of the plasmids were validated by PCR with the primers ed SEQ ID NO: 190 and eb SEQ ID NO: 188 and obtaining a fragment SEQ ID NO: 228 (2294 bp).
- Primers used for PCR are detailed in Table 17.
- the level of expression of CAT-GFP SEQ ID NO: 120 was analyzed in the different populations of recombinant parasites (Table 19).
- the expression of the CATGFP transgene is systematically slightly higher for clones whose transgene is inserted in a targeted manner (located at the LoxP and LoxN scars at the honey locus or mic3) than for populations whose transgene is inserted at random.
- strain Toxo tgmic1-3KO is an optimized expression vector for transgene expression.
- Neo ncmicl-3 KO-2G was tested as a preventative vaccine for neosporosis.
- the objective is to determine whether or not the Neo ncmicl-3 KO-2G vaccine strain prevents spread and acute infection in a mouse model of lethal neosporosis.
- Neo ncmicl-3 KO-2G parasites and Nc-1 strain Production of Neo ncmicl-3 KO-2G parasites and Nc-1 strain.
- Neo ncmic1-3 KO-2G and Ne- not used for challenge parasites are produced on a confluent mat of VERO cells (ATCC CCL81) in a complete medium containing DMEM 1.5 g / L NaHCO3, 12% (v / v). SVF decomplemented, 100 IU / mL Penicillin-100 IU / mL Streptomycin.
- the cells are maintained independently of the parasites.
- the carpet is washed three times with 5 mL of HBSS, taken off with 1 mL of pure trypsin, re-suspended in complete medium, distributed at a rate of
- the cell layer is infected with 1.10 6 parasites per 25 cm 2 of cell culture at confluence.
- Vaccine parasites are harvested 4 days later. Briefly, the parasite-infected cell layer is washed with complete medium to remove extracellular parasites. The cell layer, containing parasites, is scrapped and passed through a 27G syringe. The preparation is centrifuged for 10 min at 1500 g. The supernatant is removed and the pellet is resuspended in a DMEM solution supplemented with 0.1 M sucrose, 0.1 M trehalose, 2.5% inulin, 0.1 M GSH, 1% proline and 1% ectoin. . The solution is prepared extemporaneously the day of the vaccination. The exact parasite concentration and viability are estimated by flow cytometric counting of parasites with or without propidium iodide (P4864-10ML, Sigma). The final solution prepared was diluted to contain 2.10 7 parasites per milliliter.
- mice were immunized on day 0 by intraperitoneal (IP) route with a single dose of 1.10 7 tachyzoites of the strain Neo ncmicl-3 KO-2G.
- IP intraperitoneal
- Control mice were inoculated by the vehicle.
- Two mice of each genetic background were inoculated per group, ie four mice per group.
- mice On day 60, the immunized mice were infected intraperitoneally at the lethal dose of 2.10 7 tachyzoites of virulent strain Nc-1. Two criteria are used to evaluate the efficacy of the vaccine, the evaluation of the mortality rate and the humoral response directed against Neospora caninum at D30 post vaccination. Animals
- the production of total IgG specific for N. caninum at the serum level was determined by ELISA.
- the total parasite extract of strain Nc-1 was diluted in 0.05M carbonate / bicarbonate buffer pH9.6 to obtain a final concentration of 1 ⁇ g / ml / 100 of this mixture was deposited on a 96-well flat-bottomed plate (Nunc MaxiSorp) After one night at + 4 ° C., the wells were washed three times with 300 ⁇ l of PBS buffer, Tween 20 0.05% (v / v), and then saturated with 200 ⁇ l. of PBS, Tween 20 0.05%, BSA 4% (w / v) for 1h30 at 37 ° C.
- the total serum IgG levels specific for Neospora caninum were expressed as antibody titers. Two methods were used for the titration.
- the IgG titre corresponds to the inverse of the highest dilution of the serum of interest whose OD is at least 2.5 times higher than that obtained with the negative control, or whose OD was 0.2.
- Neo ncmicl-3 KO-2G The efficacy of Neo ncmicl-3 KO-2G has been estimated on a lethal murine model. Clinical sign
- mice After vaccination, the vaccinated animals showed no specific clinical signs, no alteration of the weight and no significant increase in body temperature, suggesting a good tolerance of the mice vis-à-vis the strain Neo ncmicl-3 KO-2G.
- mice were inoculated with the wild strain Nc-1 at a lethal dose, ie at 2 ⁇ 10 7 tachyzoites per animal. All the mice that received the control solution died during the experiment, ie 100% lethality. In contrast, 100% of the vaccinated mice survived until the end of the experiment, sixty days later. In addition, none of these vaccinated mice showed significant clinical signs, suggesting a complete protective effect, both on morbidity and mortality.
- the main aim of this study is to study the efficacy of the Toxo tgmicl-3 KO-2G vaccine strain against congenital toxoplasmosis in a mouse model.
- Toxo tgmicl-3 KO-2G strains are produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in Dulbecco's minimal medium (DMEM) supplemented with 12% Australian fetal calf serum (FCS aust). Tachyzoites were harvested from the supernatant. The parasites were enumerated on Malassez cell and diluted in DMEM medium to reach a concentration of 500 parasites per mL.
- DMEM Dulbecco's minimal medium
- FCS aust Australian fetal calf serum
- Vaccination (100 tachyzoites in a volume of 200 DMEM) is performed on female mice on D0 subcutaneously using a 27G needle.
- mice Before injection (D-2) and 28 days post-injection, peripheral venous blood was removed and left at room temperature for a minimum of one hour. The serum was obtained by centrifugation at 5000 g for 10 minutes. The prepared sera were stored at -20 ° C. Eight weeks after vaccination, 23 seroconverted mice (for T. gondii) per batch were challenged and challenged by oral gestation with 15 cysts of T. gondii strain 76K. The mothers are then isolated, the farrowing followed. The mice are followed over a period of about one month and then euthanized. A small number of young mice will be analyzed after sacrifice. Then the mothers will be sacrificed, their spleen returned to culture to study the cellular response.
- mice per batch needed for the study is 16 pregnant mice to allow a statistical study.
- the analysis of the immune response in 16 pregnant mice requires a total of 50 mice per batch, taking into account the following parameters: the pregnancy rate and the potential mortality related to the injection of the parasite (the mouse is a relatively sensitive to an injection of Toxoplasma gondii and vaccination allowing to obtain an effective seroconversion can generate mortality).
- vaccinated lots contain 50 animals initially.
- the mice of lots 1 and 2 are not vaccinated, 23 mice are sufficient for these batches.
- the analysis is performed on 16 pregnant mice per batch. Supernumerary mice are sacrificed.
- Table 20 Distribution of animals in the different lots.
- mice After a period of 7 days of acclimation, the mice were individually identified and randomly divided into 4 groups.
- a 96-well plate was adsorbed with protein extract of strain RH of Toxoplasma gondii (10 ⁇ g / ml) diluted in carbonate buffer pH 9.6 overnight at 4 ° C. After 2 washes in PBS IX / Tween 0.05% and washing in PBS IX, the plate was saturated with PBS 3% BSA for 1h30 at room temperature. Then, for the titration, the serial dilutions 2 of 2 in, in PBS + 3% BSA of the murine sera to be tested were deposited.
- the plate was washed twice (PBS IX / 0.05% Tween), then the secondary antibody (anti-mouse IgG coupled to alkaline phosphatase (Sigma A3562) or anti-mouse IgM coupled to alkaline phosphatase (Sigma A9688) is added and diluted 1/30 000 in PBS ⁇ / Tween 0.05%, before a new incubation at 37 ° C for 1h30.
- the secondary antibody anti-mouse IgG coupled to alkaline phosphatase (Sigma A3562) or anti-mouse IgM coupled to alkaline phosphatase (Sigma A9688) is added and diluted 1/30 000 in PBS ⁇ / Tween 0.05%, before a new incubation at 37 ° C for 1h30.
- pNPP 4-nitrophenyl phosphate disodium hexahydrate
- the spleen was crushed on a 100 ⁇ sieve placed over a tube
- the tube was incubated for 3 min at 4 ° C, and the reaction was stopped with addition of 1X PBS / 2% excess SVF, and then the cells were centrifuged for 10 min at 400g. The resulting cell pellets were then taken up in 5 ml of stimulation medium. The cells were counted on Malassez cell in the presence of trypan blue which stains the dead cells.
- the cells were cultured in 96-well plates at a rate of 5.10 5 cells / well.
- the plates were cultured in an oven at 37 ° C, 5%> C0 2 for 72 hours.
- the IFN-gamma assay was performed on the culture supernatants of the splenocytes in the presence of these different stimulants.
- the assay was carried out by an ELISA test according to the kit protocol
- the collection of brains from mothers and young mice is done to determine the presence or absence of cerebral cysts. Following the sacrifice of the mice, the brains are removed and crushed. The number of cysts is then counted by microscopic observation of the totality of the crushed brain. Results
- mice in nonvaccinated lots did not show clinical signs, whereas mice in vaccinated lots showed some moderate clinical signs with a clinical score of less than 2. The peak of clinical signs was observed on D18. These clinical signs were observed until D33.
- the IFN- ⁇ (cytokine indicating the establishment of a Th1-type response) secreted in the culture supernatants of the splenocytes following various stimuli, was dosed 72 hours after culturing.
- the concentration of IFN- ⁇ is increased after a challenge compared to the control group.
- Toxo tgmicl-3 KO-2G having been challenged (lot 4) or not (lot3)
- significant concentrations of IFN- ⁇ are measured when the cells are stimulated with antigenic extracts of strain RH Toxoplasma gondii, compared to unvaccinated mice. This suggests an implementation of a cell response induced by vaccination.
- the results are shown in Figure 13-C.
- the mothers were sacrificed on D129.
- the number of cysts is obtained by microscopic observation of all the brain seed (4 brains per lot). No cysts were detected for batch 1 (unvaccinated, not challenged) whereas after challenge, an average of 2250.75 cysts per brain was obtained for batch 2 (unvaccinated, challenged). In lot 3 (only vaccinated), a very small number of cysts are observed (0.75 cysts per brain). In the 4th batch (vaccinated then challenged), there is a sharp decrease in the number of cysts compared to the non-vaccinated lot (lot 2), with an average of 52 cysts per brain.
- the mice vaccinated with the strain Toxo tgmicl-3 KO-2G form very few cerebral cysts following a challenge with the T. gondii strain 76K. The results are shown in Figure 13-D. Effectiveness of vaccination on young mice
- Stillbirth and mortality were increased following challenge in the absence of vaccination (lot 2 versus lot 1).
- the vaccinated and challenged group (lot 4) has a significant reduction in the number of stillbirths and mortality compared to the challenged non-vaccinated group (lot 2). Vaccination of mothers thus protects the offspring of an increase in stillbirths and mortality following a challenge.
- the results are shown in Figures 13-G and 13-H.
- mice were followed over a 32-day period to study the effectiveness of vaccination.
- mice decreases significantly for the batch whose mothers were challenged but not vaccinated.
- the other groups have a survival rate close to that obtained for the control lot (lot 1). Vaccination of mothers therefore increases the survival rate of young mice following a challenge during pregnancy.
- the results are shown in Figure 13-1.
- mice are observed daily for 30 days and clinical signs are noted. An overall clinical score is calculated according to the score scorecard (see below, Table 22). Mobility Score 2
- mice 1 Isolation from mother / nest / young mice 1
- mice from the challenged group had a higher clinical score than the mice in the control group (lot 1). This clinical score is due in particular to a slow growth of young mice in this group.
- the clinical score is similar to the control group. Vaccination of mothers has prevented the growth retardation induced by the challenge in young mice. The results are shown in Figure 13-J.
- the 32-day IgM assay reflects the immunity of the mice developed in response to T. gondii (vaccine strain or challenge strain) transmitted by the mother.
- the humoral response developed by the young mice is therefore evaluated by ELISA immunoglobulin IgM assay at 32 days of age. The results are shown in Figure 13-K.
- the IgM titer is increased for the mice of the group from the challenged mice (batch 2) compared with those from the non-challenged mice (batch 1).
- the IgM titre is close to the detection limit, which indicates a lack of vertical transmission of the strain to the young mice.
- the IgM titre assayed for suckling mice is signi fi cantly reduced in comparison with the titre obtained for young mice from the challenged group (lot 2). The vaccination of the mice thus made it possible to reduce the vertical transmission of the strain of challenge to the young mice.
- the strain Toxo tgmicl-3 KO-2G thus allowed the establishment in mice of a humoral and cellular immune response directed against the parasite T. gondii.
- the vaccination of the mice with the strain Toxo tgmicl-3 KO-2G allowed a significant decrease in the cerebral parasite load observed after a challenge with the virulent strain 76K.
- the strain Toxo tgmicl-3 KO-2G has a good safety.
- the Toxo tgmicl-3 KO-2G strain protected the offspring of a congenital toxoplasmosis (after a challenge with the virulent 76K strain at midgestation) with a decrease in stillbirths and mortality, a better clinical score. for young mice.
- the objective of this experiment is to determine if the strain Toxo tgmicl-3 KO-2G expressing the antigen influenza M2eGPI antigen makes it possible to obtain a humoral and cellular immune response towards the vector Toxoplasma gondii and against the viral antigen. target.
- Toxo tgmicl-3 KO-2G strains expressing influenza virus antigen (Toxo tgmicl-3 KO -2G M2eGPI loxP, Toxo tgmicl-3 KO -2G M2eGPI loxN and Toxo tgmicl-3 KO -2G M2eGPI total population-random insertion - Example 4) are produced in human fibroblasts (HFF Hs27 ATCC CRL-1634) grown in Dulbecco's minimal medium (DMEM) supplemented with 10% fetal calf serum (S VF), 2mM glutamine, 100 U / mL penicillin and 100 U / mL of streptomycin.
- HFF Hs27 ATCC CRL-1634 human fibroblasts
- S VF fetal calf serum
- S VF fetal calf serum
- the tachyzoites were harvested after mechanical lysis of the host cells by 3 passages in 25G syringe.
- the parasites were enumerated on Malassez cell and diluted in DMEM medium to reach a concentration of 500 parasites per mL. Animals
- mice After a period of 15 days of acclimation, the mice were individually identified and randomly divided into 5 groups.
- tachyzoites were injected intraperitoneally in a volume of 200 DMEM. The animals were then monitored and sacrificed 5 weeks post-injection (day 35) and the rats were removed. Before (D-1) and 34 days post-injection, peripheral venous blood was removed and left at room temperature for a minimum of 30 minutes. The serum was obtained by centrifugation at 3000 g for 10 minutes. The prepared sera were stored at -20 ° C.
- a 96-well plate was adsorbed with a mixture of 4 synthetic M2e peptides at 10 ⁇ g / ml (Anaspec) corresponding to the 4 M2e present in the construction of the saglM2eGP1 fusion protein or the Toxo tgmicl-3 KO protein extract.
- 2G (10 ⁇ g / ml) diluted in carbonate buffer pH 9.6 overnight at 4 ° C.
- PBS IX / 0.05% Tween the plate was saturated with PBS IX / Tween 0.05% - BSA 4% for 1 h 30 at 37 ° C.
- serial dilutions 2 of 2 in, in PBS IX / Tween 0.05%> murine sera to be tested were deposited.
- the plate was washed, then the secondary antibody (IgG anti-mouse IgG coupled to alkaline phosphatase) was added and diluted to 1/30 000 in PBS IX / Tween 0, 05%>, before a new incubation at 37 ° C for 1h30.
- pNPP was used at a concentration of 1 mg / ml diluted in DEA-HCL buffer for visualization, and the plate was incubated for 1 h at 37 ° C.
- the spleen was ground on a 100 ⁇ sieve placed over a 50 ml Falcon tube with the addition of 5 ml of RPMI medium. The crushed material was then centrifuged for 10 minutes at 400 g. The pellet was taken up in 300 ⁇ l of RPMI and then 1 ml of lysis buffer was added. The tube was incubated for 3 min at 4 ° C, and the reaction was stopped with addition of 1X PBS / 2% excess SVF, and then the cells were centrifuged for 10 min at 400g. The resulting cell pellets were then taken up in 5 ml of stimulation medium. The cells were counted on Malassez cell in the presence of trypan blue which stains the dead cells.
- the cells were cultured in 96-well plates at a rate of 5.10 5 cells / well.
- Various stimulants could be added: antigenic extracts of Toxo tgmicl-3 KO-2G (10 ⁇ g / ml), a mix of 4 synthetic M2e peptides at 10 ⁇ g / ml (Anaspec) corresponding to the 4 M2e present in the construction of the saglM2eGPI fusion protein or concanavalin A (5 ⁇ g / ml) which serves as a positive control.
- the plates were cultured in an oven at 37 ° C., 5% CO 2 for 72 hours.
- the IFN-gamma assay was performed on the culture supernatants of the splenocytes in the presence of different stimulants.
- the assay was carried out by an ELISA test according to the protocol of the kit "Mouse IFN- ⁇ ELISA Ready-set-go® (Ebiosciences).
- mice show clinical signs such as ruffled hair, swelling of the abdomen and prostration with the exception of mice that have not received parasitic strains.
- Toxo tgmicl-3 KO-2G strains expressing M2eGPL Following the injection of Toxo tgmicl-3 KO-2G strains expressing M2eGPL, a production of antibodies specific for the M2e antigen expressed by the Toxo tgmicl-3 KO -2G M2eGPI loxP, Toxo tgmicl-3 KO strains is observed.
- -2G M2eGPI loxN and Toxo tgmicl-3 KO -2G M2eGPI total population-random insertion, but no production of antibodies specific for the M2e antigen for the strain Toxo tgmicl-3 KO-2G.
- the IFN- ⁇ (cytokine indicating the establishment of a Th1-type response) secreted in the culture supernatants of the splenocytes following various stimuli, was dosed 72 hours after culturing.
- mice vaccinated with Toxo tgmicl-3 KO-2G or Toxo tgmicl-3 KO-2G M2eGPI targeted insertion in loxP, loxN or randomly integrated
- significant concentrations of IFN- ⁇ are measured when the cells are stimulated with antigenic extracts of Toxo tgmicl-3 KO-2G, compared to unvaccinated mice.
- mice no production of IFN- ⁇ is detectable for all mice, whether they are naive, vaccinated with Toxo tgmicl-3 KO-2G or with Toxo tgmicl-3 KO-2G M2eGPI (targeted insertion in loxP, loxN or integrated randomly).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Veterinary Medicine (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Immunology (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Crystallography & Structural Chemistry (AREA)
- Pulmonology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR1756276A FR3068362A1 (fr) | 2017-07-03 | 2017-07-03 | Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectueuses |
| PCT/FR2018/051660 WO2019008272A1 (fr) | 2017-07-03 | 2018-07-03 | Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectieuses |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3649235A1 true EP3649235A1 (fr) | 2020-05-13 |
Family
ID=60382303
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18753445.8A Withdrawn EP3649235A1 (fr) | 2017-07-03 | 2018-07-03 | Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectieuses |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US20210139883A1 (fr) |
| EP (1) | EP3649235A1 (fr) |
| FR (1) | FR3068362A1 (fr) |
| WO (1) | WO2019008272A1 (fr) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109847054B (zh) * | 2019-03-14 | 2022-06-07 | 暨南大学 | TgGRA15在制备诱导I型干扰素的药物中的应用 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8293224B2 (en) * | 2000-02-07 | 2012-10-23 | Trustees Of Dartmouth College | Attenuated uracil auxotroph of an apicomplexan and use thereof |
| FR2864966B1 (fr) * | 2004-01-13 | 2006-05-05 | Agronomique Inst Nat Rech | Souches vaccinales d'apicomplexes de la famille des sarcocystidae. |
-
2017
- 2017-07-03 FR FR1756276A patent/FR3068362A1/fr not_active Ceased
-
2018
- 2018-07-03 EP EP18753445.8A patent/EP3649235A1/fr not_active Withdrawn
- 2018-07-03 US US16/628,216 patent/US20210139883A1/en not_active Abandoned
- 2018-07-03 WO PCT/FR2018/051660 patent/WO2019008272A1/fr not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2019008272A1 (fr) | 2019-01-10 |
| FR3068362A1 (fr) | 2019-01-04 |
| US20210139883A1 (en) | 2021-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11707515B2 (en) | Modified Brucella vaccine strain for the treatment of brucellosis | |
| JP6178384B2 (ja) | コレラおよび毒素原性大腸菌(etec)下痢に対するワクチン | |
| KR102212503B1 (ko) | CRISPR/Cas9 기반 Bacillus subtilis 유전체 편집 메커니즘을 이용한 넙치의 스쿠티카증 백신 | |
| AU783508B2 (en) | Salmonella vaccine | |
| CA2552392C (fr) | Souches vaccinales d'apicomplexes de la famille des sarcocystidae | |
| EP3649235A1 (fr) | Nouvelles souches attenuees d'apicomplexes et leur utilisation comme vecteurs d'antigene pour la prevention de maladies infectieuses | |
| CA2483712A1 (fr) | Utilisation de novirhabdovirus modifies pour l'obtention de vaccins | |
| WO2019008274A1 (fr) | Utilisation de souches de sarcocystidae comme vecteurs multirecombinants d'antigenes pour la prevention de maladies infectieuses | |
| EP0817799A1 (fr) | Vaccin plasmidique contre le virus pseudorabique | |
| WO2007101948A2 (fr) | Nouveaux vaccins destines au traitement ou a la prevention des infections par parasites de la famille des taenidae et en particulier du genre echinococcus | |
| FR2617715A1 (fr) | Vecteur viral et adn recombinant codant pour une ou des proteines de surface (ha et/ou f) d'un morbillivirus, culture cellulaire infectee, proteines obtenues, vaccin et anticorps obtenus | |
| WO2019008273A1 (fr) | Utilisation de souches de sarcocystidae dans la prevention de maladies infectieuses de la volaille | |
| EP2880051B1 (fr) | Souches mutantes de neospora et leurs utilisations | |
| Grilló et al. | A modified brucella vaccine strain for the treatment of brucellosis | |
| FR2736358A1 (fr) | Virus myxomateux recombinant | |
| Cattaneo | Biomedical, Immunologicals and Epidemiological Studies on Leishmania | |
| Loh | Development of enhanced fitness Salmonella Live Vector Carrier vaccine by using Toxoplasma gondii antigens as a model candidate | |
| Lee et al. | Studies on the Engineering of Lactococcus Lactis and Streptococcus Gordonii for Vaccine Delivery of Giardia CWP2 to Mucosal Sites | |
| Abdul-Wahid | Development and evaluation of a cyst wall protein 2-encoding Giardia transmission-blocking DNA vaccine | |
| Baloglu | Applicability of vaccinia virus as cloning and expression vector for bacterial genes: mice immune responses to vaccinia virus expressing Brucella abortus and Listeria monocytogenes antigens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20200123 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: UNIVERSITE DE TOURS Owner name: INSTITUT NATIONAL DE RECHERCHE POUR L'AGRICULTURE, L'ALIMENTATION ET L'ENVIRONNEMENT |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20220201 |