EP3625338A1 - Engineering of a minimal sacas9 crispr/cas system for gene editing and transcriptional regulation optimized by enhanced guide rna - Google Patents

Engineering of a minimal sacas9 crispr/cas system for gene editing and transcriptional regulation optimized by enhanced guide rna

Info

Publication number
EP3625338A1
EP3625338A1 EP17910146.4A EP17910146A EP3625338A1 EP 3625338 A1 EP3625338 A1 EP 3625338A1 EP 17910146 A EP17910146 A EP 17910146A EP 3625338 A1 EP3625338 A1 EP 3625338A1
Authority
EP
European Patent Office
Prior art keywords
mini
sacas9
naturally occurring
split
dsacas9
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP17910146.4A
Other languages
German (de)
French (fr)
Other versions
EP3625338A4 (en
Inventor
Zhen XIE
Dacheng Ma
Shuguang PENG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
Original Assignee
Tsinghua University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University filed Critical Tsinghua University
Publication of EP3625338A1 publication Critical patent/EP3625338A1/en
Publication of EP3625338A4 publication Critical patent/EP3625338A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • the instant application is related to the biological arts, in particular the directed modification of genetic material.
  • the claimed invention is related to improvements upon the Cas9 CRISPR-associated protein and related products thereof.
  • the CRISPR-associated protein 9 (Cas9) discovered from Streptococcus pyogenes is a multi-domain protein, which has been widely used in genome editing and transcriptional control in mammalian cells due to its superior modularity and versatility. Delivering synthetic gene circuits in vivo has been limited due to size constraints particularly with smaller delivery systems with a payload capacity nearly equal to an entire Cas9 complex.
  • dCas9 nuclease deactivated Cas9
  • multiple transcriptional regulatory domains can be recruited to the dCas9 by tagging the dCas9 with a repeating peptide scaffold, or by fusing repeating RNA motifs to the cognate gRNA.
  • biomedical applications of the CRISPR/Cas system require the exploration of new platforms for engineering mammalian synthetic circuits that integrate and process multiple endogenous inputs.
  • the application of CRISPR/Cas therapeutic circuits is also challenging due to the restrictive cargo size of existing viral delivery vehicles.
  • the split Cas9 system can be used in general to bypass the packing limit of the viral delivery vehicles and in the claimed invention dCas9 is split and reconstituted in human cells.
  • One of the challenges of therapeutic applications is to find an optimal delivery system that can carry all CRISPR/Cas9 components to the desired organ or cell population for genetic manipulation.
  • Using the CRISPR/Cas system to greatest potential has been greatly limited by its physical size when incorporated into a viral delivery system.
  • the entire cas9 complex is akin to a computer operating system taking up 95%of available memory leaving only a small portion for synthetic biology programming purposes.
  • the claimed invention represents a substantial improvement over existing CAS9 delivery techniques and includes additional enhancements for genetic control and programming.
  • adeno-associated virus offers high gene transfer efficiency and very low immune response.
  • packaging capacity is confined to 4.7kb to 5kb which is problematic when compared with human optimized Cas9 size at over 4.2 kb with promoter sequences reaching over 5kb.
  • intein-mediated split Cas9 inteins function as protein introns and are excised out of a sequence and join the remaining flaking regions (exteins) with a peptide bond without leaving a scar.
  • split site selection particular attention is given to split sites which are surface exposed due to the sterical need for protein splicing.
  • This system allows the coding sequence of Cas9 to be distributed on a dual-vector or multi-vector system and reconstituted post-translationally.
  • the claimed invention expands the reach of synthetic biology by targeting specific diagnostic and therapeutic applications through improvements in genetic circuitry and higher level genetic circuit delivery enhancements.
  • the claimed embodiments of the invention overcome existing size limitations through optimal splitting of Cas9 allowing for higher level synthetic gene circuitry to be accommodated by smaller delivery systems.
  • the presently claimed invention utilizes downsized Staphylococcus aureus Cas9 variants (mini-SaCas9) which retain DNA binding activity by deleting conserved functional domains.
  • mini-SaCas9 downsized Staphylococcus aureus Cas9 variants
  • FokI nuclease domain is fused to the middle of the split mini-SaCas9 to trigger efficient DNA cleavage.
  • the genetic editing system is small enough to be housed within a single AAV containing the mini-SaCas9 fused with a downsized transactivation domain along with an optimized and compact gRNA expression cassette with an efficient transactivation activity.
  • the claimed invention highlights a practical approach to generate an all in one AAV-CRISPR/Cas9 system with different effector domains for in-vivo applications.
  • the 4.2-kb Cas9 from Streptococcus pyogenes (SpCas9) is split and packaged into two separate AAVs along with the guide RNA (gRNA) expression unit, which allows functional reconstitution of full-length SpCas9 in vivo.
  • Another strategy is to search for natural class 2 CRISPR effectors with a diminished size, such as the 3.2-kb SaCas9 and ⁇ 3-kb CasX identified in uncultivated organisms by using metagenomic datasets.
  • the ⁇ 70-bp glutamine tRNA can be used to replace the ⁇ 250-bp RNA polymerase III promoter to drive expression of the tRNA: gRNA fusion transcript that is cleaved by endogenous tRNase Z to produce the active gRNA.
  • CRISPR/Cas9 system has particular utility in biomedical applications in which viral delivery vehicles with a restrictive cargo size are preferred.
  • Foreseen variants include combination of the split Cas9/dCas9 system with rAAV delivery systems, Cas9/dCas9 activity can be controlled to edit and regulate endogenous genes in vivo.
  • Figure 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives fused with the VPR domain.
  • Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization and corresponding gene activation efficiency.
  • Figure 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives and results gene activation efficiency.
  • Figure 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization and corresponding gene activation efficiency.
  • Figure 5 is a schematic representation of optimized gRNAs and the corresponding gene activation efficiency.
  • Figure 6 is a diagram of Glutamine (Glu) tRNA used as the promoter to express the optimized gRNA-2.
  • Figure 7 is a diagram of domain organization of dSaCas9 variants including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain.
  • Figure 8 is a diagram of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 and split minidSaCas9-4.
  • Figure 9 is a graphical representation of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp.
  • Figure 10 is a schematic representation of VPR, VTR1, VTR2 and VTR3 transcription activation domain and their corresponding gene activation efficiency evaluated by using the EBFP2 reporting system.
  • Figure 11 is a schematic representation of the SpyTag and MoonTag repeating array for transcription activation with corresponding gene activation efficiency data.
  • Figure 12 is a schematic representation of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration of an activation efficiency of EBFP2.
  • Figure 13 is a schematic representation of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
  • Figure 14 is a schematic representation of miniSaCas9-3 and Split SaCas9 and the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
  • Figure 15 is a genetic sequence illustration of CCR5 gene illustrating spacer region and corresponding gel agarose graphical data.
  • FIG. 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives (101) fused with the VPR domain.
  • the constitutively expressed mKate2 is used as a transfection control.
  • the reporting system is utilized in cultured human embryonic kidney 293 (HEK293) cells.
  • Two mini-dSpCas9 are created by respectively deleting the Cterminal region of REC1 domain (REC-C, ⁇ 501-710) and the HNH domain ( ⁇ 777-891) that may be dispensable for DNA binding activity of the nuclease deactivated Cas9 (dCas9) and respectively fused to the VP64-p65-Rta (VPR) transactivation domain.
  • Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization (201) and graphical illustration of corresponding gene activation efficiency (203) .
  • the two mini-dSpCas9: VPR variants retain more than 50%of transactivation capacity compared to the dSpCas9: VPR.
  • FIG. 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives (301) and graphical illustration (303) depicting gene activation efficiency.
  • the wildtype SaCas9 has been engineered to recognize an altered PAM ( “NNNRRT” ) .
  • the disclosed embodiment constructs the mini-SaCas9-1: VPR by replacing the conserved REC-C domain ( ⁇ 234-444) with a “GGGGSGGGG” linker (GS-linker) , which only retained ⁇ 2.5%transactivation activity of the dSaCas9: VPR.
  • the GS-linker is widely used as a flexible linker, it may still distort the SaCas9 structure.
  • an adjacent residue searching (ARS) protocol is used to search for existing structures between discontinued Cas9 fragments.
  • Replacement of the GS-linker with a “KRRRRHR” (R-linker) from the SaCas9 BH domain that appropriately filled in the REC-C deletion gap by using the ARS protocol results in a 11-fold increase in the transactivation capacity of mini-SaCas9-2.
  • a “GSK” linker is used, derived from a putative gene (Accession number, O67859) in Aquifex aeolicus by using the SAR protocol, which fit the deletion gap of the HNH domain ( ⁇ 479-649) .
  • the 2-kb mini-SaCas9-3 is created by deleting both the REC-C domain and the HNH domain only retained 0.6%transactivation activity over the control.
  • FIG. 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization (401) and graphical illustration (403) of corresponding gene activation efficiency.
  • a reporter reconstitution assay is used where DNA cleavage can trigger the reconstitution of the active enhanced yellow fluorescent protein (EYFP) reporter gene from the inactive form. Either deleting the REC-C or deleting both the REC-C and HNH domains resulted in a background EYFP expression, suggesting that the domain deletion abolished the DNA cleavage activity of mini-SaCas9 variants.
  • EYFP active enhanced yellow fluorescent protein
  • Figure 5 is a schematic representation of optimized gRNAs (501) and the corresponding graphical illustration (503) of gene activation efficiency.
  • An A-U flip or a U-G conversion can be introduced to disrupt the putative RNA Pol III terminator sequences in the first stem loop of the gRNA scaffold to enhance the efficiency of the dCas9-mediated DNA labeling.
  • the putative RNA Pol III terminator sequences are shown in the box, and the A-U and G-C mutations are labeled in shading at the third and fourth positions.
  • Representative scatter plots of the flow cytometry data are also shown on the right.
  • the constitutively expressed mKate2 is used as a transfection control.
  • the transactivation efficiency of miniSaCas9-3 is increased ⁇ 100-fold by introducing either one or two point mutations in the putative RNA Pol III terminator sequences.
  • FIG. 6 is a diagram of Glutamine (Glu) tRNA (601) used as the promoter to express the optimized gRNA-2.
  • Glu Glutamine
  • HEK293 cells are cotransfected with plasmids expressing the mini-SaCas9-3: VPR and gRNA-2 driven by either the Glu RNA or the U6 promoter.
  • Representative flow cytometry scatter plots (603) are shown on the right.
  • the constitutively expressed iRFP is used as a transfection control. Data are shown as the mean ⁇ SEM fold change of EBFP2 fluorescence from three independent replicates measured by using flow cytometer 48 h after transfection into HEK293 cells.
  • ⁇ 50%transactivation activity is obtained when using glutamine tRNA instead of the U6 promoter to drive gRNA expression.
  • Figure 7 is a diagram of domain organization of dSaCas9 variants (701) including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain and additionally includes Fok1 fused to the N terminal of dSaCas9 and mini-dSaCas9-4.
  • Figure 8 is a diagram (801) of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration (803) of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 or split minidSaCas9-4.
  • EYFP reconstitution assay to evaluate the DNA cleavage efficiency of dSaCas9 derivatives fused with FokI along with two truncated gRNAs that respectively containing 18-nt sequences complementary to the target.
  • DNA cleavage activity is not detected when FokI is fused to the N-terminal of mini-SaCas9-2.
  • dSaCas9 is split at residue 733 and fused the FokI after the splitting point with a triplicate G-linker ( “GGGGS” ) .
  • GGGGS triplicate G-linker
  • the first four residues of the C-terminal fragment ( ⁇ 734-737) that might interfere with the reconstitution of two split fragments is removed.
  • split dSaCas9 or split mini-dSaCas9-4 without the HNH domain results in ⁇ 8%to 30%of the EYFP expression level induced by the wild-type SaCas9, with a spacer ranging from 12 bp to 24 bp in the PAM-out orientation.
  • Figure 9 is a graphical representation (901) of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp.
  • Figure 10 is a schematic representation (1001) of VPR, VTR1, VTR2 and VTR3 transcription activation domain and graphical representation (1003) of the corresponding gene activation efficiency evaluated by using the EBFP2 reporting system.
  • compact transcription activators based on dCas9-VPR are engineered.
  • the entire P65 contains a DNA binding domain in the N-terminal, and two transactivation domains (TA1 and TA2) in the C-terminal.
  • TA1 and TA2 transactivation domains in the C-terminal.
  • only the TA2 and the partial TA1 are included in the tripartite VPR domain.
  • VTR1 is constructed by replacing the P65 domain in the VPR with the TA1 and TA2 domains.
  • the P65 domain in the VPR with two repeats of the TA1 domain is constructed and termed VTR2.
  • the VTR1 and VTR2 domains retain 45%and 21%transactivation efficiency of the VPR domain respectively.
  • VTR3 is additionally depicted and is approximately 200 bp shorter than VTR2 and VTR1 making it an optimal illustrative embodiment.
  • Figure 11 is a schematic representation (1101) of the SpyTag and MoonTag repeating array for transcription activation with graphical representation (1103) for corresponding gene activation efficiency data.
  • SpyTag 13-residue peptide tag derived from Streptococcus pyogenes fibronectin-binding protein
  • a repeating peptide array with a smaller size than the SunTag system is constructed by fusing four tandem repeats of SpyTag to the C-terminal of mini-SaCas9-3 and fusing the SpyCatcher with the VPR domain, allowing spontaneous assembly of a VPR transactivation scaffold in cells.
  • the SpyTag system induces the expression of the enhanced blue fluorescent protein 2 (EBFP2) reporter gene to 100-fold compared to the negative control.
  • EBFP2 enhanced blue fluorescent protein 2
  • WP_054278706 from Streptococcus phocae with 60%sequence similarity to the FbaB.
  • this protein is split similarly to SpyTag and SpyCatcher.
  • a similar scaffold system called the MoonTag system is hereby disclosed and implemented by fusing four tandem repeats of the 13-residue MoonTag to the mini-SaCas9-3 and making a hybrid of the MoonCatcher and VPR domains.
  • the MoonTag system was not orthogonal to the SpyTag system, the MoonTag system is 5-fold more efficient to activate the EBFP2 expression.
  • Figure 12 is a schematic representation (1201) of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration (1203) of an activation efficiency of EBFP2.
  • transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system that contains the mini-SaCas9-3: VTR1 and U6-driven optimized gRNA-2 is depicted.
  • the plasmid DNAs that encode the EBFP2 reporter gene and the mKate2 control gene are introduced into HEK293 cells by transient transfection, following by the AAV infection.
  • the lower panel shows the activation efficiency of EBFP2 after infection of the AAV encoding the mini-SaCas9-3: VTR1 and the representative microscopic images (1205) .
  • Scale bar in images represents 200 ⁇ m.
  • a single AAV virus is produced that encoded the constitutively expressed mini-SaCas9-3: VTR1 and the optimized gRNA that targeted the TRE promoter.
  • a TREdriven EBFP2 reporter gene is introduced into HEK293 cells by transient transfection.
  • the AAV infection activated the EBFP2 expression up to ⁇ 130-fold over the negative control in the HEK293 cells, which was also more efficient than AAV virus loaded with the mini-SaCas9-3: VP64.
  • Figure 13 is a schematic representation (1301) of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
  • a set of compact Cas9 derivatives are engineered by deleting conserved HNH and/or REC-C domains based on the structural information across variant class 2 CRISPR effectors.
  • a novel strategy to engineer the dimeric gRNA-guided nuclease by splitting the mini-dSaCas9 and fusing the FokI domain right after the split point is disclosed, which can increase the on-target DNA cleavage efficiency and potentially reduce the off-target effect because of a closer proximity of dimeric FokI nuclease to the target sequence.
  • a practical approach is disclosed to load the entire CRISPR/Cas system with different effector domains for transactivation, DNA cleavage and base editing into a single AAV virus.
  • Such an all-in-one AAV-CRISPR/Cas9 system will be particularly appealing in biomedical applications that require safe and efficient delivery in vivo.
  • Figure 14 is a schematic representation (1401) of miniSaCas9-3 and Split SaCas9 and graphical data (1403) of the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
  • Figure 15 is a genetic sequence illustration (1501) of CCR5 gene illustrating spacer region and gel electrophoresis graphical data (1503) illustrating CCR5 gene relative percentage of cleavage.
  • the terms “comprises, ” “comprising, ” “includes, ” “including, ” “has, ” “having, ” or any other variation thereof, are intended to cover a non-exclusive inclusion.
  • a process, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, article, or apparatus.
  • any examples or illustrations given herein are not to be regarded in any way as restrictions on, limits to, or express definitions of any term or terms with which they are utilized. Instead, these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as being illustrative only. Those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized will encompass other embodiments which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms. Language designating such nonlimiting examples and illustrations includes, but is not limited to: “for example, ” “for instance, ” “e.g., ” and “in one embodiment. ”
  • the claimed invention has industrial applicability in biomedical and industrial biotechnology applications.
  • the improved Cas9 system provides greater gene editing and regulatory control capabilities over traditional Cas9 systems.
  • mini-SaCas9-2 VPR
  • mini-dSaCas9-6N AID
  • VTR3 SEQUENCE

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Programmable and precise regulation of Cas9 functions by utilizing a set of compact Cas9 derivatives created by deleting conserved HNH and/or REC-C domains based on the structural information across variant class 2 CRISPR effectors is provided. A novel strategy for engineering the dimeric gRNA-guided nuclease by splitting the mini-dSaCas9 and fusing the FokI domain right after the split point to increase the on-target DNA cleavage efficiency and potentially reduce the off-target effect because of a closer proximity of dimeric FokI nuclease to the target sequence is also provided. By combining the optimized and compact gRNA expression cassette and the downsized SaCas9 derivatives, the entire CRISPR/Cas system with different effector domains for transactivation, DNA cleavage and base editing is loaded into a single AAV virus. Such an all-in-one AAV-CRISPR/Cas9 system will be particularly appealing in biomedical applications that require safe and efficient delivery in vivo.

Description

    Engineering of a minimal SaCas9 CRISPR/Cas system for gene editing and transcriptional regulation optimized by enhanced guide RNA Technical Field
  • The instant application is related to the biological arts, in particular the directed modification of genetic material. With greater particularity, the claimed invention is related to improvements upon the Cas9 CRISPR-associated protein and related products thereof.
  • Background Art
  • The CRISPR-associated protein 9 (Cas9) discovered from Streptococcus pyogenes is a multi-domain protein, which has been widely used in genome editing and transcriptional control in mammalian cells due to its superior modularity and versatility. Delivering synthetic gene circuits in vivo has been limited due to size constraints particularly with smaller delivery systems with a payload capacity nearly equal to an entire Cas9 complex.
  • Summary of Invention
  • Technical Problem
  • Several strategies have been developed to engineer modular and layered gene circuits in mammalian cells by regulating dCas9 and gRNA expression. Transcriptional controls in mammalian cells can be achieved by directly fusing a transcriptional regulatory domain to the nuclease deactivated Cas9 (dCas9) . Alternatively, multiple transcriptional regulatory domains can be recruited to the dCas9 by tagging the dCas9 with a repeating peptide scaffold, or by fusing repeating RNA motifs to the cognate gRNA. However, biomedical applications of the CRISPR/Cas system require the exploration of new platforms for engineering mammalian synthetic circuits that integrate and process multiple endogenous inputs. In addition, the application of CRISPR/Cas therapeutic circuits is also challenging due to the restrictive cargo size of existing viral delivery vehicles.
  • Solution to Problem
  • The split Cas9 system can be used in general to bypass the packing limit of the viral delivery vehicles and in the claimed invention dCas9 is split and reconstituted in human cells. One of the challenges of therapeutic applications is to find an optimal delivery system that can carry all CRISPR/Cas9 components to the desired organ or cell population for genetic manipulation. Using the CRISPR/Cas system to greatest potential has been greatly limited by its physical size when incorporated into a viral delivery system. When used for synthetic biology purposes in high value delivery systems with site specific integration such as the Adeno-Associated Virus/AAV, the entire cas9 complex is akin to a computer operating system taking up 95%of available memory leaving only a small portion for synthetic biology programming purposes. By splitting the CRISPR/CAS9 into smaller regions and delivering the regions in separate viral delivery vectors, the powerful genetic manipulation functionality is retained alongside substantial increases in space for cellular programming purposes. The claimed invention represents a substantial improvement over existing CAS9 delivery techniques and includes additional enhancements for genetic control and programming.
  • While a variety of viral delivery systems have been employed with mixed success, implementation of systems relying on alternate virus systems can lead to an undesired strong immune response. Using the recombinant adeno-associated virus (rAAV) offers high gene transfer efficiency and very low immune response. Unfortunately packaging capacity is confined to 4.7kb to 5kb which is problematic when compared with human optimized Cas9 size at over 4.2 kb with promoter sequences reaching over 5kb. With intein-mediated split Cas9, inteins function as protein introns and are excised out of a sequence and join the remaining flaking regions (exteins) with a peptide bond without leaving a scar. In terms of split site selection particular attention is given to split sites which are surface exposed due to  the sterical need for protein splicing. This system allows the coding sequence of Cas9 to be distributed on a dual-vector or multi-vector system and reconstituted post-translationally.
  • The claimed invention expands the reach of synthetic biology by targeting specific diagnostic and therapeutic applications through improvements in genetic circuitry and higher level genetic circuit delivery enhancements. The claimed embodiments of the invention overcome existing size limitations through optimal splitting of Cas9 allowing for higher level synthetic gene circuitry to be accommodated by smaller delivery systems.
  • The presently claimed invention utilizes downsized Staphylococcus aureus Cas9 variants (mini-SaCas9) which retain DNA binding activity by deleting conserved functional domains. In a preferred illustrative embodiment, FokI nuclease domain is fused to the middle of the split mini-SaCas9 to trigger efficient DNA cleavage. In another illustrative embodiment the genetic editing system is small enough to be housed within a single AAV containing the mini-SaCas9 fused with a downsized transactivation domain along with an optimized and compact gRNA expression cassette with an efficient transactivation activity. The claimed invention highlights a practical approach to generate an all in one AAV-CRISPR/Cas9 system with different effector domains for in-vivo applications.
  • To bypass the AAV payload limit, the 4.2-kb Cas9 from Streptococcus pyogenes (SpCas9) is split and packaged into two separate AAVs along with the guide RNA (gRNA) expression unit, which allows functional reconstitution of full-length SpCas9 in vivo. Another strategy is to search for natural class 2 CRISPR effectors with a diminished size, such as the 3.2-kb SaCas9 and ~3-kb CasX identified in uncultivated organisms by using metagenomic datasets. To further reduced the transgene size, the ~70-bp glutamine tRNA can be used to replace the ~250-bp RNA polymerase III promoter to drive expression of the  tRNA: gRNA fusion transcript that is cleaved by endogenous tRNase Z to produce the active gRNA. These efforts facilitate the construction of an all-in-one AAV delivery vector for in vivo applications of the CRISPR/Cas technology.
  • Recent structural studies of SpCas9, SaCas9 and Acidaminococcus sp. Cpf1 (AsCpf1) have elucidated functions of conserved domains among these class 2 CRISPR effectors, including HNH/NUC and RuvC nuclease domains that respectively cleave complementary and non-complementary DNA strands, a recognition (REC) domain, and a protospacer adjacent motif (PAM) interacting (PI) domain. Interestingly, truncated SpCas9 mutant by deleting either the HNH or the REC2 domain retain nearly intact DNA binding activity or half of cleavage activity. These results highlight the possibility to further downsize the wild-type Cas9 to a minimal Cas9 (mini-Cas9) that has only DNA binding activity but no DNA cleavage activity, which allows accommodating additional DNA template, effector domains and control elements in a single AAV vector.
  • Advantageous Effects of Invention
  • Such a CRISPR/Cas9 system has particular utility in biomedical applications in which viral delivery vehicles with a restrictive cargo size are preferred. Foreseen variants include combination of the split Cas9/dCas9 system with rAAV delivery systems, Cas9/dCas9 activity can be controlled to edit and regulate endogenous genes in vivo.
  • Brief Description of Drawings
  • The accompanying drawings are included to better illustrate exemplary embodiments of the claimed invention.
  • Figure 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives fused with the VPR domain.
  • Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization and corresponding gene activation efficiency.
  • Figure 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives and results gene activation efficiency.
  • Figure 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization and corresponding gene activation efficiency.
  • Figure 5 is a schematic representation of optimized gRNAs and the corresponding gene activation efficiency.
  • Figure 6 is a diagram of Glutamine (Glu) tRNA used as the promoter to express the optimized gRNA-2.
  • Figure 7 is a diagram of domain organization of dSaCas9 variants including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain.
  • Figure 8 is a diagram of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 and split minidSaCas9-4.
  • Figure 9 is a graphical representation of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp.
  • Figure 10 is a schematic representation of VPR, VTR1, VTR2 and VTR3 transcription activation domain and their corresponding gene activation efficiency evaluated by using the EBFP2 reporting system.
  • Figure 11 is a schematic representation of the SpyTag and MoonTag repeating array for transcription activation with corresponding gene activation efficiency data.
  • Figure 12 is a schematic representation of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration of an activation efficiency of EBFP2.
  • Figure 13 is a schematic representation of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
  • Figure 14 is a schematic representation of miniSaCas9-3 and Split SaCas9 and the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
  • Figure 15 is a genetic sequence illustration of CCR5 gene illustrating spacer region and corresponding gel agarose graphical data.
  • Description of Embodiments
  • In the following embodiments as detailed further in the corresponding figures, rational design of the compact CRISPR/Cas9 system is further detailed.
  • Figure 1 is a diagram of EBFP2 transcription activation assay for the compact Cas9 derivatives (101) fused with the VPR domain. The constitutively expressed mKate2 is used as a transfection control. In the first illustrative example, the reporting system is utilized in cultured human embryonic kidney 293 (HEK293) cells. Two mini-dSpCas9 are created by respectively deleting the Cterminal region of REC1 domain (REC-C, △501-710) and the HNH domain (△777-891) that may be dispensable for DNA binding activity of the nuclease deactivated Cas9 (dCas9) and respectively fused to the VP64-p65-Rta (VPR) transactivation domain.
  • Figure 2 is a diagram of dSpCas9, mini-dSpCas9-1 and mini-dSpCas9-2 domain organization (201) and graphical illustration of corresponding gene activation efficiency  (203) . In the illustrative example, the two mini-dSpCas9: VPR variants retain more than 50%of transactivation capacity compared to the dSpCas9: VPR.
  • Figure 3 is a schematic diagram of domain organization of dSaCas9 and its derivatives (301) and graphical illustration (303) depicting gene activation efficiency. Recently, the wildtype SaCas9 has been engineered to recognize an altered PAM ( “NNNRRT” ) . Based on this mutant SaCas9, the disclosed embodiment constructs the mini-SaCas9-1: VPR by replacing the conserved REC-C domain (△234-444) with a “GGGGSGGGG” linker (GS-linker) , which only retained ~ 2.5%transactivation activity of the dSaCas9: VPR. Although the GS-linker is widely used as a flexible linker, it may still distort the SaCas9 structure. Inspired by a recent computational protocol called SEWING, an adjacent residue searching (ARS) protocol is used to search for existing structures between discontinued Cas9 fragments. Replacement of the GS-linker with a “KRRRRHR” (R-linker) from the SaCas9 BH domain that appropriately filled in the REC-C deletion gap by using the ARS protocol, results in a 11-fold increase in the transactivation capacity of mini-SaCas9-2. As an enhanced embodiment of the claimed invention, a “GSK” linker is used, derived from a putative gene (Accession number, O67859) in Aquifex aeolicus by using the SAR protocol, which fit the deletion gap of the HNH domain (△479-649) . The 2-kb mini-SaCas9-3 is created by deleting both the REC-C domain and the HNH domain only retained 0.6%transactivation activity over the control.
  • Figure 4 is a diagram of dAsCpf1 and mini-AsCpf1-1 domain organization (401) and graphical illustration (403) of corresponding gene activation efficiency. To evaluate the DNA cleavage efficiency of mini-SaCas9 variants in this illustrative embodiment, a reporter reconstitution assay is used where DNA cleavage can trigger the reconstitution of the active enhanced yellow fluorescent protein (EYFP) reporter gene from the inactive form. Either  deleting the REC-C or deleting both the REC-C and HNH domains resulted in a background EYFP expression, suggesting that the domain deletion abolished the DNA cleavage activity of mini-SaCas9 variants. In this illustrative embodiment, by deleting REC2 domain (△324-525) retained 46%transactivation capacity of dAsCpf1: VPR, suggesting that this deletion strategy is applicable for distinct class 2 CRISPR effectors.
  • Figure 5 is a schematic representation of optimized gRNAs (501) and the corresponding graphical illustration (503) of gene activation efficiency. An A-U flip or a U-G conversion can be introduced to disrupt the putative RNA Pol III terminator sequences in the first stem loop of the gRNA scaffold to enhance the efficiency of the dCas9-mediated DNA labeling. The putative RNA Pol III terminator sequences are shown in the box, and the A-U and G-C mutations are labeled in shading at the third and fourth positions. Representative scatter plots of the flow cytometry data are also shown on the right. The constitutively expressed mKate2 is used as a transfection control. In a preferred illustrative embodiment, the transactivation efficiency of miniSaCas9-3 is increased ~100-fold by introducing either one or two point mutations in the putative RNA Pol III terminator sequences.
  • Figure 6 is a diagram of Glutamine (Glu) tRNA (601) used as the promoter to express the optimized gRNA-2. In this illustrative example, HEK293 cells are cotransfected with plasmids expressing the mini-SaCas9-3: VPR and gRNA-2 driven by either the Glu RNA or the U6 promoter. Representative flow cytometry scatter plots (603) are shown on the right. The constitutively expressed iRFP is used as a transfection control. Data are shown as the mean ± SEM fold change of EBFP2 fluorescence from three independent replicates measured by using flow cytometer 48 h after transfection into HEK293 cells. In this illustrative embodiment, ~50%transactivation activity is obtained when using glutamine tRNA instead of the U6 promoter to drive gRNA expression.
  • Improving the DNA cleavage specificity of the CRISPR/Cas9 system is essential for future clinical applications. Dimerization of a hybrid protein in which FokI nuclease domain is fused to the N-terminal but not to the C-terminal of dSpCas9 improves the DNA cleavage specificity in the PAM-out orientation. Furthermore, truncated gRNAs with shorter regions of target complementarity decrease the off-target cleavage efficiency.
  • In the following illustrative embodiments, the effect of the compact SaCas9 derivatives on DNA cleavage and base editing is further disclosed.
  • Figure 7 is a diagram of domain organization of dSaCas9 variants (701) including split dSaCas9 and split mini-dSaCas9-4 fused with the FokI domain and additionally includes Fok1 fused to the N terminal of dSaCas9 and mini-dSaCas9-4.
  • Figure 8 is a diagram (801) of the EYFP reconstitution assay to demonstrate the DNA cleavage efficiency and illustration (803) of DNA cleavage by the dimeric FokI nuclease fused to split dSaCas9 or split minidSaCas9-4. EYFP reconstitution assay to evaluate the DNA cleavage efficiency of dSaCas9 derivatives fused with FokI along with two truncated gRNAs that respectively containing 18-nt sequences complementary to the target. In one illustrative embodiment, DNA cleavage activity is not detected when FokI is fused to the N-terminal of mini-SaCas9-2. One possible reason is that the FokI in this protein architecture may be distal to the target DNA. However, as the predicted distance between the N-terminal and the C-terminal of the FokI nuclease domain is  which makes challenging to find an appropriate insertion position in the middle of the dSaCas9. In an alternate embodiment, dSaCas9 is split at residue 733 and fused the FokI after the splitting point with a triplicate G-linker ( “GGGGS” ) . In an alternative illustrative embodiment the first four residues of the C-terminal fragment (△734-737) that might interfere with the reconstitution of two split fragments is removed. The split dSaCas9 or split mini-dSaCas9-4 without the HNH domain  results in ~8%to 30%of the EYFP expression level induced by the wild-type SaCas9, with a spacer ranging from 12 bp to 24 bp in the PAM-out orientation.
  • Figure 9 is a graphical representation (901) of DNA cleavage efficiency by the split dSaCas9 variants with a spacer length ranging from 12-bp to 24-bp. DNA cleavage efficiency by the split dSaCas9: FokI, the split mini-dSaCas9-4: FokI and Fok1 fused to the N terminal of dSaCas9 and mini-dSacas9-4 with a spacer length ranging from 12-bp to 24-bp. Each bar shows mean fold changes (mean ± SEM; n = 3) of EYFP fluorescence measured by using flow cytometer 48 h after transfection in HEK293 cells.
  • In the next illustrative embodiments, construction of the compact CRISPR/Cas system for transcription activation is further detailed.
  • Figure 10 is a schematic representation (1001) of VPR, VTR1, VTR2 and VTR3 transcription activation domain and graphical representation (1003) of the corresponding gene activation efficiency evaluated by using the EBFP2 reporting system. In the illustrative embodiment, compact transcription activators based on dCas9-VPR are engineered. The entire P65 contains a DNA binding domain in the N-terminal, and two transactivation domains (TA1 and TA2) in the C-terminal. However, only the TA2 and the partial TA1 are included in the tripartite VPR domain. To reduce the size of dCas9-VPR, mini-SaCas9-3: VTR1 is constructed by replacing the P65 domain in the VPR with the TA1 and TA2 domains. In a further illustrative embodiment, the P65 domain in the VPR with two repeats of the TA1 domain is constructed and termed VTR2. The VTR1 and VTR2 domains retain 45%and 21%transactivation efficiency of the VPR domain respectively. VTR3 is additionally depicted and is approximately 200 bp shorter than VTR2 and VTR1 making it an optimal illustrative embodiment.
  • Figure 11 is a schematic representation (1101) of the SpyTag and MoonTag repeating array for transcription activation with graphical representation (1103) for corresponding gene activation efficiency data. The corresponding gene activation efficiency was evaluated by using the EBFP2 reporting system utilizing optimized gRNA-2 in the illustrative embodiments. Data are shown as the mean fold change (mean ± SEM; n = 3) of EBFP2 fluorescence measured by using flow cytometer 72 h after transfection into HEK293 cells.
  • Recently, a 13-residue peptide tag (SpyTag) derived from Streptococcus pyogenes fibronectin-binding protein (FbaB) has been shown to form a covalent bond with its 116-residue binding partner, called SpyCatcher.
  • In the illustrative embodiment, a repeating peptide array with a smaller size than the SunTag system is constructed by fusing four tandem repeats of SpyTag to the C-terminal of mini-SaCas9-3 and fusing the SpyCatcher with the VPR domain, allowing spontaneous assembly of a VPR transactivation scaffold in cells. The SpyTag system induces the expression of the enhanced blue fluorescent protein 2 (EBFP2) reporter gene to 100-fold compared to the negative control. In the illustrative embodiment, by searching for the homologue of SpyTag and SpyCatcher, a putative protein is found (accession No. WP_054278706) from Streptococcus phocae with 60%sequence similarity to the FbaB. In the illustrative embodiment, this protein is split similarly to SpyTag and SpyCatcher. As a direct and intended consequence of the illustrative embodiment, a similar scaffold system called the MoonTag system is hereby disclosed and implemented by fusing four tandem repeats of the 13-residue MoonTag to the mini-SaCas9-3 and making a hybrid of the MoonCatcher and VPR domains. Although the MoonTag system was not orthogonal to the SpyTag system, the MoonTag system is 5-fold more efficient to activate the EBFP2 expression.
  • Figure 12 is a schematic representation (1201) of transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system with a graphical illustration (1203) of an activation efficiency of EBFP2. In the illustrative example, transcription activation by using a single AAV loaded with the compact CRISPR/Cas9 system that contains the mini-SaCas9-3: VTR1 and U6-driven optimized gRNA-2 is depicted. The plasmid DNAs that encode the EBFP2 reporter gene and the mKate2 control gene are introduced into HEK293 cells by transient transfection, following by the AAV infection. The lower panel shows the activation efficiency of EBFP2 after infection of the AAV encoding the mini-SaCas9-3: VTR1 and the representative microscopic images (1205) . Scale bar in images represents 200 μm. Data are shown as the mean fold change (mean ± SEM; n = 3) of EBFP2 fluorescence measured by using flow cytometer 72 hours after transfection and AAV infection. In this illustrative embodiment, a single AAV virus is produced that encoded the constitutively expressed mini-SaCas9-3: VTR1 and the optimized gRNA that targeted the TRE promoter. A TREdriven EBFP2 reporter gene is introduced into HEK293 cells by transient transfection. In the illustrative embodiment, the AAV infection activated the EBFP2 expression up to ~130-fold over the negative control in the HEK293 cells, which was also more efficient than AAV virus loaded with the mini-SaCas9-3: VP64.
  • Figure 13 is a schematic representation (1301) of packaging mini-Cas9, effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing. By combining the illustrative embodiments to a broad working example, a set of compact Cas9 derivatives are engineered by deleting conserved HNH and/or REC-C domains based on the structural information across variant class 2 CRISPR effectors. In addition, a novel strategy to engineer the dimeric gRNA-guided nuclease by splitting the mini-dSaCas9 and fusing the FokI domain right after the split point  is disclosed, which can increase the on-target DNA cleavage efficiency and potentially reduce the off-target effect because of a closer proximity of dimeric FokI nuclease to the target sequence. By combining the optimized and compact gRNA expression cassette and the downsized SaCas9 derivatives, a practical approach is disclosed to load the entire CRISPR/Cas system with different effector domains for transactivation, DNA cleavage and base editing into a single AAV virus. Such an all-in-one AAV-CRISPR/Cas9 system will be particularly appealing in biomedical applications that require safe and efficient delivery in vivo.
  • Figure 14 is a schematic representation (1401) of miniSaCas9-3 and Split SaCas9 and graphical data (1403) of the corresponding miniSaCas9-3 and Split SaCas9 activation efficiency.
  • Figure 15 is a genetic sequence illustration (1501) of CCR5 gene illustrating spacer region and gel electrophoresis graphical data (1503) illustrating CCR5 gene relative percentage of cleavage.
  • In the description, numerous specific details are set forth in order to provide a thorough understanding of the present embodiments. It will be apparent, however, to one having ordinary skill in the art that the specific detail need not be employed to practice the present embodiments. In other instances, well-known materials or methods have not been described in detail in order to avoid obscuring the present embodiments.
  • Reference throughout this specification to “one embodiment” , “an embodiment” , “one example” or “an example” means that a particular feature, structure or characteristic described in connection with the embodiment or example is included in at least one embodiment of the present embodiments. Thus, appearances of the phrases “in one embodiment” , “in an embodiment” , “one example” or “an example” in various places  throughout this specification are not necessarily all referring to the same embodiment or example. Furthermore, the particular features, structures or characteristics may be combined in any suitable combinations and/or sub-combinations in one or more embodiments or examples. In addition, it is appreciated that the figures provided herewith are for explanation purposes to persons ordinarily skilled in the art and that the drawings are not necessarily drawn to scale.
  • As used herein, the terms “comprises, ” “comprising, ” “includes, ” “including, ” “has, ” “having, ” or any other variation thereof, are intended to cover a non-exclusive inclusion. For example, a process, article, or apparatus that comprises a list of elements is not necessarily limited to only those elements but may include other elements not expressly listed or inherent to such process, article, or apparatus.
  • Additionally, any examples or illustrations given herein are not to be regarded in any way as restrictions on, limits to, or express definitions of any term or terms with which they are utilized. Instead, these examples or illustrations are to be regarded as being described with respect to one particular embodiment and as being illustrative only. Those of ordinary skill in the art will appreciate that any term or terms with which these examples or illustrations are utilized will encompass other embodiments which may or may not be given therewith or elsewhere in the specification and all such embodiments are intended to be included within the scope of that term or terms. Language designating such nonlimiting examples and illustrations includes, but is not limited to: “for example, ” “for instance, ” “e.g., ” and “in one embodiment. ”
  • Industrial Applicability
  • The claimed invention has industrial applicability in biomedical and industrial biotechnology applications. With greater particularity, the improved Cas9 system provides greater gene editing and regulatory control capabilities over traditional Cas9 systems.
  • Sequence Listing Free Text
  • The instant application contains a Sequence Listing which has been submitted in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on April 28, 2017, is named ZX2seqlist_ST25. txt and is 225kbytes in size.
  • The sequence involved in the patent is as follows.
  • Sequence Listing
  • Seq ID 1 gRNAa TACGTTCTCTATCACTGATA
  • Seq ID 2 gRNAb TACGTTCTCTATCACTGATA
  • Seq ID 3 crRNAa CTCCCTATCAGTGATAGAGAACG
  • Seq ID 4 gRNAc CGTTCTCTATCACTGATA
  • Seq ID 5 gRNAd ACTAGAAATTCACCGAGC
  • Seq ID 6 gRNA-15bp CTCACTCAACAGTGATAGAGA
  • Seq ID 7 gRNA-12bp TTGCTCACTCAACAGTGATAG
  • Seq ID 8
  • dSpCas9: VPR
  • Seq ID 9
  • mini-dSpCas9-1: VPR
  • Seq ID 10
  • mini-dSpCas9-2: VPR
  • Seq ID 11
  • dSaCas9: VPR
  • Seq ID 12
  • mini-SaCas9-1: VPR
  • Seq ID 13
  • mini-SaCas9-2: VPR
  • Seq ID 14
  • mini-SaCas9-3: VPR
  • Seq ID 15
  • dAsCpf1: VPR
  • Seq ID 16
  • mini-AsCpf1-1: VPR
  • Seq ID 17
  • dSaCas9N: FokI
  • Seq ID 18
  • dSaCas9C
  • Seq ID 19
  • mini-dSaCas9-4N: FokI
  • Seq ID 20
  • AID: dSaCas9: UGI
  • Seq ID 21
  • AID: mini-dSaCas9-5: UGI
  • Seq ID 22
  • mini-dSaCas9-6N: AID
  • Seq ID 23
  • mini-dSaCas9-6C: UGI
  • Seq ID 24
  • VTR1
  • Seq ID 25
  • VTR2
  • Seq ID 26
  • SpyCatcher: VPR
  • Seq ID 27
  • 4x SpyTag
  • Seq ID 28
  • MoonCatcher: VPR
  • Seq ID 29
  • 4x MoonTag
  • Seq ID 30
  • VTR3 SEQUENCE
  • Seq ID 31
  • gRNA-ccr5-1
  • Seq ID 32
  • gRNA-ccr5-2
  • Seq ID 33
  • Mini-saCas9-4: VPR
  • Seq ID 34
  • Mini-saCas9-5: VPR
  • Seq ID 35
  • GSK Linker

Claims (20)

  1. A non-naturally occurring rationally designed reduced Cas9 comprising a downsized Staphylococcus aureus mini-SaCas9 which retains DNA binding activity by deleting conserved functional domains.
  2. The non-naturally occurring mini-SaCas9 protein system of claim 1 wherein said mini-SaCas9 conserved functional domains are removed between the RuvC2 and RuvC3 regions and connected with a GSK linker.
  3. The non-naturally occurring mini-SaCas9 protein system of claim 2 wherein said mini-SaCas9 conserved functional domains are removed at amino acid locations 479-649 between the RuvC2 and RuvC3 regions and connected with a GSK linker.
  4. The non-naturally occurring mini-SaCas9 protein system of claim 1 wherein said mini-SaCas9 conserved functional domains are removed between the RuvC2 and RuvC3 regions, connected with a GSK linker and split into two or more portions.
  5. The non-naturally occurring mini-SaCas9 protein system of claim 4 wherein said mini-SaCas9 conserved functional domains are removed at residue locations 479-649 between the RuvC2 and RuvC3 regions, connected with a GSK linker and split into two or more portions at residue 738.
  6. The non-naturally occurring split mini-SaCas9 protein system of claim 4 additionally comprising split Cas9 portions across different split pairs to yield combinations that provided the complete polypeptide sequence activate gene expression even when fragments are partially redundant.
  7. The non-naturally occurring mini-SaCas9 protein system of claim 3 additionally comprising a FokI domain.
  8. The non-naturally occurring split mini-SaCas9 protein system of claim 5 additionally comprising a FokI domain.
  9. The non-naturally occurring mini-SaCas9 protein system of claim 7 wherein said miniSaCas9 is mini-dSaCas9 and additionally comprises a plurality of genetic regulatory components to form a FokI dimer configuration upon hybridization.
  10. The non-naturally occurring mini-SaCas9 protein system of claim 9 wherein said FokI dimer hybridization creates a space between the dimerized mini-dSaCas9 ranging from 4-40 base pairs.
  11. The non-naturally occurring mini-dSaCas9 protein system of claim 9 wherein said FokI dimer configuration creates a space between the dimerized mini-dSaCas9 which is 14 base pairs.
  12. The non-naturally occurring split mini-SaCas9 protein system of claim 8 wherein said split miniSaCas9 is split mini-dSaCas9 additionally comprises a plurality of genetic regulatory components to form a dimer configuration upon hybridization.
  13. The non-naturally occurring split mini-dSaCas9 protein system of claim 12 wherein said FokI dimer configuration creates a space between the dimerized mini-dSaCas9 ranging from 12-24 base pairs.
  14. The non-naturally occurring mini-SaCas9 protein system of claim 12 wherein said FokI dimer configuration restores nuclease activity when in dimer configuration.
  15. A non-naturally occurring rationally designed downsized Staphylococcus aureus mini-SaCas9 of claim 2 additionally comprising repeating peptide Moontag array with four tandem repeats of 13-residue MoonTag fused to the C-terminal of mini-SaCas9-3 and making a hybrid of the MoonCatcher the VPR domain.
  16. A non-naturally occurring rationally designed downsized Staphylococcus aureus mini-SaCas9 with repeating peptide Moontag array of claim 15 wherein said Moontag corresponds to Sequence ID number 29 and said MoonCatcher VPR corresponds to Sequence ID number 28.
  17. A non-naturally occurring rationally designed guide RNA comprising an optimized guide RNA wherein said four repeat U-A regions are optimized with a A-U codon flip at the third position and a G-C replacement at the fourth position.
  18. A non-naturally occurring rationally designed guide RNA of claim 17 additionally comprising Glu tRNA coupled to said optimized guide RNA.
  19. A non-naturally occurring rationally designed reduced Cas9 comprising a downsized Staphylococcus aureus mini-SaCas9 which retains DNA binding activity by deleting conserved functional domains between REC and HNH regions and connected to incorporate effector domain, gRNA expression cassette and additional parts in a single AAV vector for transcription activation, DNA cleavage and base editing.
  20. The non-naturally occurring rationally designed reduced mini-SaCas9 of claim 19 wherein said gRNA expression cassette is optimized at the four repeat U-A region with a A-U codon flip at the third position and a G-C replacement at the fourth position and additionally incorporates Glu tRNA coupled to the optimized guide RNA.
EP17910146.4A 2017-05-19 2017-05-19 ENGINEERING OF A SACAS9 MINIMUM CRISPR / CAS SYSTEM FOR GENE EDITING AND TRANSCRIPTIONAL REGULATION OPTIMIZED BY AN IMPROVED GUIDE RNA Withdrawn EP3625338A4 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2017/085202 WO2018209712A1 (en) 2017-05-19 2017-05-19 Engineering of a minimal sacas9 crispr/cas system for gene editing and transcriptional regulation optimized by enhanced guide rna

Publications (2)

Publication Number Publication Date
EP3625338A1 true EP3625338A1 (en) 2020-03-25
EP3625338A4 EP3625338A4 (en) 2021-01-20

Family

ID=64273211

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17910146.4A Withdrawn EP3625338A4 (en) 2017-05-19 2017-05-19 ENGINEERING OF A SACAS9 MINIMUM CRISPR / CAS SYSTEM FOR GENE EDITING AND TRANSCRIPTIONAL REGULATION OPTIMIZED BY AN IMPROVED GUIDE RNA

Country Status (3)

Country Link
EP (1) EP3625338A4 (en)
CN (1) CN110662835B (en)
WO (1) WO2018209712A1 (en)

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2015330699B2 (en) 2014-10-10 2021-12-02 Editas Medicine, Inc. Compositions and methods for promoting homology directed repair
EP3294896A1 (en) 2015-05-11 2018-03-21 Editas Medicine, Inc. Optimized crispr/cas9 systems and methods for gene editing in stem cells
KR102796744B1 (en) 2015-06-09 2025-04-15 에디타스 메디신, 인코포레이티드 CRISPR/CAS-related methods and compositions for improving transplantation
EP3353296B1 (en) 2015-09-24 2020-11-04 Editas Medicine, Inc. Use of exonucleases to improve crispr/cas-mediated genome editing
US11597924B2 (en) 2016-03-25 2023-03-07 Editas Medicine, Inc. Genome editing systems comprising repair-modulating enzyme molecules and methods of their use
WO2017180694A1 (en) 2016-04-13 2017-10-19 Editas Medicine, Inc. Cas9 fusion molecules gene editing systems, and methods of use thereof
WO2018119010A1 (en) 2016-12-19 2018-06-28 Editas Medicine, Inc. Assessing nuclease cleavage
EP3565907B1 (en) 2017-01-06 2022-05-04 Editas Medicine, Inc. Methods of assessing nuclease cleavage
US11499151B2 (en) 2017-04-28 2022-11-15 Editas Medicine, Inc. Methods and systems for analyzing guide RNA molecules
JP7518620B2 (en) 2017-06-09 2024-07-18 エディタス・メディシン,インコーポレイテッド Engineered CAS9 nuclease
WO2019014564A1 (en) 2017-07-14 2019-01-17 Editas Medicine, Inc. Systems and methods for targeted integration and genome editing and detection thereof using integrated priming sites
WO2019235627A1 (en) 2018-06-08 2019-12-12 株式会社モダリス MODIFIED Cas9 PROTEIN AND USE THEREOF
AU2019291918B2 (en) 2018-06-29 2025-06-12 Editas Medicine, Inc. Synthetic guide molecules, compositions and methods relating thereto
CN114026226B (en) * 2019-04-26 2024-10-18 株式会社图尔金 Target-specific CRISPR mutants
US20220220472A1 (en) * 2019-05-06 2022-07-14 The Regents Of The University Of Michigan Targeted therapy
US20220235340A1 (en) * 2019-05-20 2022-07-28 The Broad Institute, Inc. Novel crispr-cas systems and uses thereof
CN110551760B (en) * 2019-08-08 2022-11-18 复旦大学 CRISPR/Sa-SeqCas9 gene editing system and its application
CN110423736B (en) * 2019-08-16 2021-09-17 中国人民解放军陆军军医大学第一附属医院 Base editing tool, application thereof and method for editing wide-window and non-sequence preference bases in eukaryotic cells
ES3055163T3 (en) 2020-03-31 2026-02-10 Metagenomi Inc Class ii, type ii crispr systems
CN112553246A (en) * 2020-12-08 2021-03-26 安徽省农业科学院水稻研究所 Efficient genome editing vector based on CRISPR-SaCas9 system and application thereof
KR20240049306A (en) 2021-08-27 2024-04-16 메타지노미, 인크. Enzymes with RUVC domains
CN113717961B (en) * 2021-09-10 2023-05-05 成都赛恩吉诺生物科技有限公司 Fusion protein and polynucleotide, base editor and application thereof in preparation of medicines
EP4437096A4 (en) 2021-11-24 2025-09-24 Metagenomi Inc ENDONUCLEASE SYSTEMS
CN118742642A (en) * 2022-03-04 2024-10-01 益杰立科(上海)生物科技有限公司 Cas proteins and their uses and methods
WO2024138481A1 (en) * 2022-12-29 2024-07-04 中国科学院微生物研究所 Type i-f2 crispr-cas system for regulating and controlling eukaryotic cell gene transcription, and use thereof
CN116621947B (en) * 2023-07-18 2023-11-07 北京智源人工智能研究院 Topological protein based on Soxhlet skeleton, preparation method and application
CN121752603A (en) * 2023-09-08 2026-03-27 北京齐禾生科生物科技有限公司 Modularized gene editing tool and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9637739B2 (en) * 2012-03-20 2017-05-02 Vilnius University RNA-directed DNA cleavage by the Cas9-crRNA complex
SG11201507378UA (en) * 2013-03-14 2015-10-29 Caribou Biosciences Inc Compositions and methods of nucleic acid-targeting nucleic acids
WO2015089486A2 (en) * 2013-12-12 2015-06-18 The Broad Institute Inc. Systems, methods and compositions for sequence manipulation with optimized functional crispr-cas systems
US20160304893A1 (en) * 2013-12-13 2016-10-20 Cellectis Cas9 nuclease platform for microalgae genome engineering
EP3307762B1 (en) * 2015-06-12 2021-12-15 The Regents of The University of California Reporter cas9 variants and methods of use thereof
IL293323B2 (en) * 2015-06-18 2024-01-01 Massachusetts Inst Technology CRISPR enzyme mutations that reduce unintended effects
WO2016205759A1 (en) * 2015-06-18 2016-12-22 The Broad Institute Inc. Engineering and optimization of systems, methods, enzymes and guide scaffolds of cas9 orthologs and variants for sequence manipulation

Also Published As

Publication number Publication date
EP3625338A4 (en) 2021-01-20
WO2018209712A1 (en) 2018-11-22
CN110662835B (en) 2023-04-28
CN110662835A (en) 2020-01-07

Similar Documents

Publication Publication Date Title
US11674128B2 (en) Engineering of a minimal SaCas9 CRISPR/Cas system for gene editing and transcriptional regulation optimized by enhanced guide RNA
WO2018209712A1 (en) Engineering of a minimal sacas9 crispr/cas system for gene editing and transcriptional regulation optimized by enhanced guide rna
US12202861B2 (en) Inducible, tunable, and multiplex human gene regulation using CRISPR-Cpf1
JP5374584B2 (en) Improved protein expression system
JP7275043B2 (en) Enhanced hAT Family Transposon-Mediated Gene Transfer and Related Compositions, Systems and Methods
US10760064B2 (en) RNA-guided targeting of genetic and epigenomic regulatory proteins to specific genomic loci
US20180030425A1 (en) Variants of CRISPR from Prevotella and Francisella 1 (Cpf1)
US20240425832A1 (en) Compositions and methods of genome editing
CN111117985B (en) A method for splitting Cas9 and its application
EP1427746A2 (en) Protein and nucleic acid expression systems
CN112543808A (en) Enhanced hAT family transposon mediated gene transfer and related compositions, systems and methods
WO2020123512A1 (en) Anti-crispr-mediated control of genome editing and synthetic circuits in eukaryotic cells
CN112708605A (en) Proteome obtained by splitting Cas9 protein and application thereof
Luke et al. Development of antibiotic-free selection system for safer DNA vaccination
WO2020032057A1 (en) Novel transcription activator
WO2023235879A1 (en) Methods of genome editing oocytes
WO2022197693A2 (en) System of stable gene expression in cell lines and methods of making and using the same
WO2025166633A2 (en) Split gene editing systems and uses thereof
WO2025261493A1 (en) Method for targeted regulation of pcsk9 by means of epigenetic editing and use thereof
WO2026102174A1 (en) Systems for transgene expression
WO2025054409A1 (en) Mutant tcbuster transposase with improved solubility
HK40120944B (en) Compositions and methods of genome editing
HK40120944A (en) Compositions and methods of genome editing
AU2002354964A1 (en) Protein and nucleic acid expression systems

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20191218

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

RIN1 Information on inventor provided before grant (corrected)

Inventor name: PENG, SHUGUANG

Inventor name: MA, DACHENG

Inventor name: XIE, ZHEN

RIN1 Information on inventor provided before grant (corrected)

Inventor name: XIE, ZHEN

Inventor name: PENG, SHUGUANG

Inventor name: MA, DACHENG

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20201223

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/115 20100101ALI20201217BHEP

Ipc: C12N 9/22 20060101AFI20201217BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20220413

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20240409