EP3595695A1 - Compositions of hydrolyzed collagen peptides and commensal microorganisms and methods thereof - Google Patents
Compositions of hydrolyzed collagen peptides and commensal microorganisms and methods thereofInfo
- Publication number
- EP3595695A1 EP3595695A1 EP18710385.8A EP18710385A EP3595695A1 EP 3595695 A1 EP3595695 A1 EP 3595695A1 EP 18710385 A EP18710385 A EP 18710385A EP 3595695 A1 EP3595695 A1 EP 3595695A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- hcoll
- composition
- hydrolyzed collagen
- collagen peptides
- hcol2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/01—Hydrolysed proteins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/01—Hydrolysed proteins; Derivatives thereof
- A61K38/012—Hydrolysed proteins; Derivatives thereof from animals
- A61K38/014—Hydrolysed proteins; Derivatives thereof from animals from connective tissue peptides, e.g. gelatin, collagen
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/142—Amino acids; Derivatives thereof
- A23K20/147—Polymeric derivatives, e.g. peptides or proteins
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/715—Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
- A61K31/737—Sulfated polysaccharides, e.g. chondroitin sulfate, dermatan sulfate
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/39—Connective tissue peptides, e.g. collagen, elastin, laminin, fibronectin, vitronectin, cold insoluble globulin [CIG]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
- A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
Definitions
- the invention generally relates to pharmaceuticals and/or nutraceuticals. More particularly, the invention provides compositions of collagen-based peptides and specific digestive tract microbes useful for supporting or promoting joint, skin and/or bone health, and methods of preparation and use thereof. The invention further provides for the use of compositions of collagen-based peptides as a prebiotic for modulating the gut microbiome.
- Osteoarthritis is one of the most prevalent diseases in the world, with recent estimates projecting that >250 million people are afflicted globally. In the U.S., OA afflicts 35 million people, with diarthrodial and spinal OA being the most prevalent disease, surpassing the next top four causes of disability combined (heart, pulmonary, mental health and diabetic conditions). In a recent analysis, global medical costs for lower extremity OA exceed $350 billion/year, with the reduced quality of life and physical function of OA patients exerting an additional hidden economic impact that surpasses $50 billion/year. (Murray et al. 2010 Lancet. 2013;381(9871):997-102; Lawrence et al. 2008 Arthritis Rheum.
- OA is a joint disease of multifactorial etiology characterized by degeneration and loss of articular cartilage and meniscus, subchondral bone sclerosis, osteophyte formation, and synovial hyperplasia.
- Etiologic complexity and 'whole organ' involvement of multiple tissues within the OA joint during the degenerative process represent significant challenges in the development of disease modifying therapeutic strategies.
- TKA total joint arthroplasty
- Palliative management of OA primarily involves nonsteroidal anti-inflammatory drugs, intraarticular injection of corticosteroids or hyaluronic acid, narcotic-based analgesia including opioids, and joint arthroplasty.
- the invention is based in part on the unexpected discovery that hydro lyzed collagen peptides have effects on the gut microbiome, which are associated with positive effects in OA, joint health, skin health and bone health.
- This discovery enables the development of health supporting or promoting and disease-mitigating approaches that combine hColl and/or hCol2 as prebiotics, optionally with a probiotic mixture of microbes, including those from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria that are orally consumed as dietary supplements.
- These can be formulated, for example, as a powder or liquid mixture that may be added to food or compressed into a tablet or capsule for direct oral consumption on a daily, thrice weekly, twice weekly, or weekly basis.
- the present invention thus may fundamentally alter the treatment protocol for OA, joint health, skin health and bone health and provide a novel approach to improving gut microbiome.
- the present invention enables a novel approach that utilizes hydrolyzed type 1 and/or type 2 collagen peptides (hColl/2) as dietary supplements that have a biological effect rooted in distinct and specific changes in the populations of resident intestinal microbes. These changes in gut microbiome in turn influence numerous tissues, with potent joint health potential and therapeutic efficacy in OA, as well as other health- promoting benefits in the integument and skeletal systems.
- the invention provides a particular capability of preemptive protection and therapeutic efficacy in osteoarthritis (OA), to support or promote skin health, joint health or bone health.
- OA osteoarthritis
- a composition comprising hydrolyzed collagen peptides was shown in the experimental section to act as a prebiotic by improving the gut microbiome in a subject, in particular by increasing the microbial diversity in the gut of said subject. It is generally agreed upon in the literature that a more diverse gut microbiota is beneficial. It is also shown that oral administration of hydrolyzed collagen peptides reduces pro-inflammatory species in the gut, and increases anti-inflammatory species. It has further been shown that said composition comprising hydrolyzed collagen peptides reduces markers for systemic inflammation, in particular circulating TNF-alpha, an effect that is often observed following the administration of prebiotics (Delzenne et al.
- the invention provides for the use of a composition comprising hydrolyzed collagen peptides as a prebiotic.
- a composition comprising hydrolyzed collagen peptides as a prebiotic.
- the use of hydrolyzed collagen peptides as a prebiotic.
- the composition or the hydrolyzed collagen peptides are used for modulating the gut microbiome in a subject, more particularly for increasing the diversity of the gut microbiome.
- a related aspect relates to a method for modulating the gut microbiome in a subject, more particularly for increasing the diversity of the gut microbiome, comprising administering to the subject an effective amount of a composition comprising hydrolyzed collagen peptides.
- the composition comprises at least 90%, preferably at least 95%, by weight hydrolyzed collagen peptides, based on the dry mass of the composition.
- the hydrolyzed collagen peptides are type 1 hydrolyzed collagen peptides (hColl) and/or type 2 hydrolyzed collagen peptides (hCol2).
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da and/or the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- the hColl originates from porcine, bovine or fish and/or the hColl2 originates from porcine, bovine or fish.
- the composition is formulated in a food or feed product, or a food or feed ingredient for oral administration, or as a dietary supplement for oral administration.
- the composition is administered to a subject each day for at least 7 days, preferably for at least 14 days.
- the composition is administered to a subject at a daily dosage of between 0.5g and 15g.
- a composition comprising hydrolyzed collagen peptides is provided for use in the prevention or treatment of joint inflammation, in particular a synovial inflammation, in a subject.
- a related aspect relates to a method for preventing or treating joint inflammation, in particular a synovial inflammation, in a subject, said method comprising administering to the subject an effective amount of a composition comprising hydrolyzed collagen peptides.
- the composition comprises at least 90%, preferably at least 95%, by weight hydrolyzed collagen peptides, based on the dry mass of the composition.
- the hydrolyzed collagen peptides are type 1 hydrolyzed collagen peptides (hColl) and/or type 2 hydrolyzed collagen peptides (hCol2).
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da and/or the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- the hColl originates from porcine, bovine or fish and/or the hColl2 originates from porcine, bovine or fish.
- a further aspect is directed to a composition comprising hydrolyzed collagen peptides for use in the prevention or treatment of osteoarthritis, in particular posttraumatic osteoarthritis or obesity-induced osteoarthritis, in a subject, wherein the hydrolyzed collagen peptides are type 2 hydrolyzed collagen peptides (hCol2) that originate from porcine, bovine or fish collagen from cartilage.
- hydrolyzed collagen peptides are type 2 hydrolyzed collagen peptides (hCol2) that originate from porcine, bovine or fish collagen from cartilage.
- a related aspect is directed to a method for preventing or treating osteoarthritis, in particular posttraumatic osteoarthritis or obesity-induced osteoarthritis, in a subject, said method comprising administering to the subject an effective amount of a composition comprising hydro lyzed collagen peptides, wherein the hydro lyzed collagen peptides are type 2 hydro lyzed collagen peptides (hCol2) that originate from porcine, bovine or fish collagen from cartilage.
- the composition comprises at least 90%, preferably at least 95%, by weight hydrolyzed collagen peptides, based on the dry mass of the composition.
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- Yet another aspect relates to the use of a composition comprising hydrolyzed collagen peptides as a chondroprotective agent, wherein the hydrolyzed collagen peptides are type 2 hydrolyzed collagen peptides (hCol2).
- a related aspect is directed to a method for providing a chondroprotective effect in a subject, said method comprising administering to the subject an effective amount of a composition comprising hydrolyzed collagen peptides, wherein the hydrolyzed collagen peptides are type 2 hydrolyzed collagen peptides (hCol2).
- the composition comprises at least 90%, preferably at least 95%), by weight hCol2, based on the dry mass of the composition.
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- the hColl2 originates from porcine, bovine or fish collagen from cartilage.
- FIG. 1 Effective bolus delivery of hColl and experimental timeline.
- Experimental mixtures were placed on autoclavable ceramic tiles (A) and presented to individually house mice (B) at the same time daily. After 5-7 days of training with vehicle alone, mice consumed the full amount presented within 2 minutes.
- Panel (C) depicts the experimental timeline.
- FIG. 2 Cartilage loss following MLI in hColl -fed mice is reduced.
- FIG. 3 hColl is chondroprotective in the early stages of murine PTOA.
- Cartilage architecture was evaluated using the Osteomeasure System to determine the tibial uncalcified cartilage area (B), tibial calcified cartilage area (C), the number of chondrocytes in the tibial uncalcified cartilage (D), and the number (E) and percentage (F) of Safranin-0 positive (SafO ) chondrocytes in the tibial uncalcified cartilage.
- OARSI scoring of the sections analyzed by histomorphometry was also performed (G).
- FIG. 4 hColl protects against cartilage loss in mid to late stage murine PTOA.
- Cartilage architecture was evaluated using the Osteomeasure System to determine the tibial uncalcified cartilage area (B), the tibial calcified cartilage (C), the number of chondrocytes in the tibial uncalcified cartilage (D), and the number (E) and percentage (F) of Safranin-0 positive (SafO ) chondrocytes in the tibial uncalcified cartilage.
- OARSI scoring of the sections analyzed by histomorphometry was also performed (G).
- FIG. 6 Chondrocyte apoptosis post-MLI is reduced in hColl -supplemented mice. Joints were harvested from mice 3 weeks post-injury (Sham or MLI) and apoptotic cells were identified via TUNEL staining. Representative lOOx sagittal sections (right column of panels) show the overall scope of cellular apoptosis (green), with all cell nuclei DAPI labeled (blue). The yellow dashed lines depict the articular cartilage surface and the red dashed lines outline the anterior and posterior horns of the meniscus. The region demarcated with the white box is magnified in the right column (zoom). White scale bars depict 100 ⁇ .
- FIG. 7 Synovial hyperplasia is reduced in mice supplemented with hColl .
- FIG. 8 Post-injury upregulation of TNF in the synovium is reduced in mice supplemented with hColl .
- FIG. 10 hColl supplementation induces significant change in the gut microbiome.
- Microbial rDNA analysis was performed on fecal samples collected from lean and obese mice supplemented with control Nutella, 38 mg/day hColl, or glucosamine.
- PCoA plots reveal a significant effect of hColl on microbial diversity in lean mice (FIG. lOA-lOC), characterized by a significant increase in the abundance of Tenericutes (FIG. 10B and IOC).
- FIG. 10A Principal coordinate analysis of microbial abundance from obese control Nutella (1), obese glucosamine (2), obese hColl (3), lean hColl (4), lean glucosamine (5) and lean control Nutella (6) mice.
- FIG. 10A Principal coordinate analysis of microbial abundance from obese control Nutella (1), obese glucosamine (2), obese hColl (3), lean hColl (4), lean glucosamine (5) and lean control Nutella (6) mice.
- IOC shows the relative microbial abundance in lean control mice (Actinobacteria: 19.6127%, Bacteroidetes: 9.9887%, Proteobacteria: 0.0113%), Tenericutes: 1.6302%>, Firmicutes: 69%>, Verrucomicrobia: 0.0435%), lean hColl mice (Actinobacteria: 1.2523%, Bacteroidetes: 8.0434%, Proteobacteria: 0.0010%>, Tenericutes: 6.998%>, Firmicutes: 83.6593%), Verrucomicrobia: 0.0461%o), lean glucosamine mice (Actinobacteria: 12.07091%), Bacteroidetes: 13.4103%o, Tenericutes: 1.1749%>, Firmicutes: 72.6939%>, Verrucomicrobia: 0.0119%), obese control mice (Actinobacteria: 1.4051%, Bacteroidetes: 7.9330%, Prot
- FIG. 11 hColl and glucosamine elicit different effects on the gut microbiome. Principal coordinate analysis of microbial abundance from lean and obese mice supplemented with control Nutella, 38 mg/day hColl, or glucosamine. 1 : obese control Nutella, 2: obese glucosamine, 3: obese Peptan 1, 4: lean Peptan 1, 5: lean glucosamine, 6: lean control Nutella. Comparisons between groups show distinct differential effects of each treatment on microbial compositions.
- FIG. 13 Synovial hyperplasia is also reduced in mice supplemented with hCol2.
- FIG. 14 Post-injury upregulation of TNF in the synovium is reduced in mice supplemented with hColl or hCol2.
- FIG. 15 hColl and hCol2 supplementation induces significant change in the gut microbiome and provides protective effects in post-traumatic osteoarthritis.
- A Microbial rDNA analysis was performed on fecal samples collected from chow fed mice supplemented with control Nutella, 38 mg/day hColl, or 15 mg/day hCol2 for 4 weeks. Bars show relative microbial abundance in the indicated groups. Each bar represents an average of 3 mice. In the chow diet, hCol 1 and 2 tended to have similar effects: Increases in the abundance of Bacteroidales, Lactobacillales, Turicibacterales, and Anaeroplasmatales.
- FIG. 16 (A) Microbial rDNA analysis was performed on fecal samples collected from lean fed mice supplemented with control Nutella, 38 mg/day hColl, or 15 mg/day hCol2. Bars show relative microbial abundance in the indicated groups. In the lean diet, hColl and 2 also tended to have a similar effect: Most striking was the loss of Bifidobacteriales and emergence of Anaeroplasmatales and a minor decrease in LactobaciUales, Turicibacterales, and Anaeroplasmatales.
- vehicle Nutella
- PI DMM hColl
- P2 DMM hCol2
- FIG. 17 (A) Microbial rDNA analysis was performed on fecal samples collected from high fat (HF) (60% of caloric energy from saturated fat) fed mice supplemented with control Nutella, 38 mg/day hColl, or 15 mg/day hCol2 for 4 weeks. Bars show relative microbial abundance in the indicated groups. In the HF diet, hColl and 2 again tended to induce the same effect: ablation of Coriobacteriales and reduction of LactobaciUales. Loss of the LactobaciUales community correlated with an increase in the abundance of Clostridiales.
- HF high fat
- vehicle Nutella
- FIG. 18 Obesity-related increases in serum TNF-alpha are corrected by hColl and hCol2. Mice fed high fat (HF) diet for 3 months were supplemented daily with hColl (HF+P1), hCol2 (HF+P2) or vehicle (Nutella) (HF) for 12 weeks. A group of mice were fed the lean diet as a control. Serum was collected from all mice and an ELISA assay was performed to quantify levels of circulating TNF-alpha. The measured serum TNF-alpha levels in the indicated mice groups are shown.
- FIG. 19 hCol2 alters the gut microbiome.
- Mice fed chow or high fat diet for 3 months were supplemented daily with hCol2 (HFD+hCol2) or vehicle (Nutella) (HFD) for 4 weeks.
- Fecal samples were collected and microbial rDNA analysis was performed.
- a subset of bacterial species was altered in high fat diet-fed mice compared to chow fed mice, and hCol2 supplementation changed the gut microbiome of these high fat diet-fed mice.
- Numerous proinflammatory species, particularly Peptococcaceae rc4-4 sp were reduced in hCol2-supplemented mice (top heat map).
- several antiinflammatory species were enhanced in hCol2-supplemented animals, including Bifidobacterium pseudolongum (bottom heat map).
- FIG. 20 Effects of hColl and hCol2 on bone parameters.
- Non-obese, metabolically healthy mice were fed daily supplements of hColl (PI), hCol2 (P2) or vehicle (Nutella) (Con). After 12 weeks on supplement, MicroCT analysis was performed to examine femoral and vertebral bone parameters, and bone densitometry (DXA) was performed to determine whole body bone mineral density (BMD).
- PI hColl
- P2 hCol2
- Con Vehicle
- DXA bone densitometry
- Panels depict bone volume fraction (BV/TV, A), the density of trabecular connections (Conn-Density, B), and trabecular number (Tb.N., C) in distal femur, bone volume fraction (BV/TV) in the fourth lumbar vertebrae (L4) (D), and whole body bone mineral density (BMD) (E).
- FIG. 21 hColl and hCol2 supplementation is associated with reduced synovial TNF expression in obese mice following traumatic injury.
- Mice were provided ad lib access to high fat diet for 3 months. Mice were continued on the diet after this period, but were supplemented daily with hColl (PI), hCol2 (P2) or vehicle (Nutella).
- PI hColl
- P2 hCol2
- Nutella vehicle
- a surgical injury to the meniscus (DMM) was made, or an incision to the contralateral limb (Sham control), and knee joint tissues were harvested three weeks later. Representative images of TNF immunohistochemistry on the Sham and DMM joint tissues are shown. Definitions
- hydrolyzed collagen peptides refers to fragments of collagen that are prepared from animal tissues. Hydrolyzed collagen is produced from collagen found in the bones, skin, and connective tissue of animals. The process of hydrolysis typically involves breaking down the molecular bonds between individual collagen strands and peptides using combinations of physical, chemical or biological means.
- type 1 hydrolyzed collagen peptides or "hColl” refers to a mixture of type I collagen peptides of different molecular weights that are generated via enzymatic digestion of type I collagen extracted from animal connective tissues.
- Type 1 collagen is generally sourced from skin, tendon, ligaments, vascular ligature, organs, bone (main component of the organic part of bone).
- type 2 hydrolyzed collagen peptides or “hCol2” refers to a mixture of type 2 collagen peptides prepared via enzymatic digestion of animal connective tissues that are rich in type 2 collagen.
- Type 2 collagen is generally sourced from cartilage (main collagenous component of cartilage). Suitable source of type 1 collagen or type 2 collagen may be but are not limited to the hide, skin or cartilage of vertebrates, including, without limitation, porcine, bovine, horse and fish, or molluscae, including, without limitation, jellyfish.
- Hydrolyzed collagen is usually referred to with its mean molecular weight, indicating the mean molecular weight of the peptides present in the mixture.
- Treatments refers to a specific phylum of bacteria that resides in the gastrointestinal tract, and is altered by hydrolyzed collagen peptides.
- aeroplasmatales refers to a specific order of bacteria that reside in the gastrointestinal tract, and are altered by hydrolyzed collagen peptides.
- Bifidobacteria refers to a specific genus of bacteria that resides in the gastrointestinal tract, and is altered by oligofructose. Species in the genus Bifidobacteria include bifidum, breve, longum, animalis, pseudolongum, lactis, adolescentis, pseudocatenulatum, infantis, bifidus, and other species classified in the genus Bifidobacterium, including those not identified to date. (Famouri et al. Pediatric Gastroenterology and Nutrition. 64(3):p. 413-417; Hughes et al. Open Bio. 2017. 7(1); Meng et al.
- the term "effective amount" of an active agent refers to an amount sufficient to elicit the desired biological response.
- the effective amount of a compound of the invention may vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the disease being treated, the mode of administration, and the patient.
- treatment refers to a method of reducing, delaying or ameliorating such a condition before or after it has occurred. Treatment may be directed at one or more effects or symptoms of a disease and/or the underlying pathology.
- the treatment can be any reduction and can be, but is not limited to, the complete ablation of the disease or the symptoms of the disease. As compared with an equivalent untreated control, such reduction or degree of prevention is at least 5%, 10%, 20%, 40%, 50%, 60%, 80%, 90%, 95%, or 100% as measured by any standard technique.
- the terms "prevent”, “preventing”, or “prevention” refer to a method for precluding, delaying, averting, or stopping the onset, incidence, severity, or recurrence of a disease or condition.
- a method is considered to be a prevention if there is a reduction or delay in onset, incidence, severity, or recurrence of a disease or condition or one or more symptoms thereof in a subject susceptible to the disease or condition as compared to a subject not receiving the method.
- the disclosed method is also considered to be a prevention if there is a reduction or delay in onset, incidence, severity, or recurrence of osteoporosis or one or more symptoms of a disease or condition in a subject susceptible to the disease or condition after receiving the method as compared to the subject's progression prior to receiving treatment.
- the reduction or delay in onset, incidence, severity, or recurrence of osteoporosis can be about a 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%), or any amount of reduction in between.
- the term "pharmaceutically acceptable" excipient, carrier, or diluent refers to a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject pharmaceutical agent from one organ, or portion of the body, to another organ, or portion of the body.
- a pharmaceutically acceptable material, composition or vehicle such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject pharmaceutical agent from one organ, or portion of the body, to another organ, or portion of the body.
- Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
- materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ring
- the term “subject” refers to any animal (e.g., a mammal), including, but not limited to humans, non-human primates, rodents, and the like, which is to be the recipient of a particular treatment.
- the terms “subject” and “patient” are used interchangeably herein in reference to a human subject.
- the term "low dosage” refers to at least 5% less (e.g., at least 10%, 20%, 50%), 80%o, 90%), or even 95%>) than the lowest standard recommended dosage of a particular compound formulated for a given route of administration for treatment of any human disease or condition.
- a low dosage of an agent that is formulated for administration by inhalation will differ from a low dosage of the same agent formulated for oral administration.
- high dosage is meant at least 5%> (e.g., at least 10%>, 20%>, 50%), 100%), 200%o, or even 300%>) more than the highest standard recommended dosage of a particular compound for treatment of any human disease or condition.
- Any appropriate route of administration can be employed, for example rectal, or oral administration. Most suitable means of administration for a particular patient will depend on the nature and severity of the disease or condition being treated or the nature of the therapy being used and on the nature of the active compound.
- Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules.
- the compounds and organisms described herein or derivatives thereof are admixed with at least one inert customary excipient (or carrier) such as dicalcium phosphate or (i) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (ii) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (iii) humectants, as for example, glycerol, (iv) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (v) solution retarders, as for example, paraffin, (vi) absorption accelerators, as for example, quaternary ammonium compounds, (vii) wetting agents, as for example, glycerol monostearate, and combinations of the
- the dosage forms may also comprise buffering agents.
- Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.
- Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art.
- Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs.
- the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other bacterial-compatible solvents, for example, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.
- inert diluents commonly used in the art, such as water or other bacterial-compatible solvents, for example, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.
- the composition can also include additional agents, such as wetting, suspending, sweetening, flavoring, or perfuming agents.
- a “prebiotic” generally refers to a substrate that is selectively utilized by host microorganisms to confer a health benefit to the host (Gibson et al. 2017 Nature Reviews Gastroenterology & Hepatology 14:491-502).
- the phrase “improving the gut microbiome” refers to any beneficial effect on the gut microbiome, and may include, without limitation, one or more of enhancing one or more beneficial bacteria in the gut, reducing harmful bacteria in the gut, inhibiting the activity of harmful bacteria in the gut and/or increasing the microbial diversity in the gut.
- a "dietary supplement”, also known as “food supplement” or “nutritional supplement” is a preparation intended to supplement the diet and provide nutrients that may be missing or may not be consumed in sufficient quantities in a person's diet. Materials, compositions, and components disclosed herein can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. It is understood that when combinations, subsets, interactions, groups, etc.
- the invention provides novel compositions, and methods of use thereof, of collagen- based peptides and key digestive tract microbes combined as a dual orally consumed mixture to support joint, skin and/or bone health.
- the invention is based in part on the unexpected discovery that hydrolyzed collagen peptides have effects on the gut microbiome, which are associated with positive effects in OA, joint health, skin health and bone health.
- the present invention enables a novel approach that utilizes hydrolyzed type 1 and/or type 2 collagen peptides (hColl/2) as prebiotics alone or in combination with a probiotic mixture (e.g., microbes from the phylum Tenericutes, from the order Anaeroplasmatales or the genus Bifidobacterium) as dietary supplements (e.g., oral consumption on a daily, twice weekly, or weekly basis) that have a biological effect rooted in distinct and specific changes in the populations of resident intestinal microbes.
- a probiotic mixture e.g., microbes from the phylum Tenericutes, from the order Anaeroplasmatales or the genus Bifidobacterium
- dietary supplements e.g., oral consumption on a daily, twice weekly, or weekly basis
- the compositions of the invention can be formulated as a mixture that may be added to food or compressed into a tablet or capsule.
- Hydrolyzed collagens are fragments of collagen that are prepared from animal tissues for use as food additives or nutraceutical dietary supplements.
- hColl is a mixture of type I collagen peptides of different molecular weights that are generated via enzymatic digestion of type I collagen extracted from animal connective tissues. hColl is considered safe as an oral supplement.
- the peptide mixture which contains an abundance of hydroxyproline, proline and glycine, is absorbed dose- dependently following bolus oral delivery, with a series of di- and tri-peptides peaking in the circulation within one hour after consumption in humans.
- SCGRAS Select Committee on GRAS Substances
- hCol2 is prepared from animal connective tissues that are rich in type 2 collagen.
- hCol2 peptide mixtures contain an abundance of hydroxyproline, proline and glycine and glycosaminoglycans. These fragments are absorbed dose-dependent ly following bolus oral delivery, with a series of di- and tri-peptides peaking in the circulation within one hour after consumption in humans.
- Evidence disclosed herein not only solidly identifies joint protective effects of hColl and hCol2 in posttraumatic OA and obesity-induced OA, but it identifies marked effects on the gut microbiome, with specific population expansion of microbes in the phylum Tenericutes and the orders Anaeroplasmatales and Clostridiales, and reduction of pro -inflammatory species and increase of anti-inflammatory species, that are associated with systemic effects that play out in joints, skin and bone.
- mice were supplemented with hColl for a one-month pre-treatment period, followed by administration of MLI surgery and subsequent assessment of joints.
- Structural and cellular evaluation of the articular cartilage of sham and injured knee joints using both automated and manual histomorphometric methods revealed that while there were no discernable cartilage effects in the sham/normal joints, at early and later time points in the development of OA, mice administered hColl were chondroprotected, particularly at 12 weeks post-injury. Uncalcified tibial articular cartilage was preserved and the articular chondrocyte population was maintained (FIG.
- hColl and other nutraceuticals including type 2 collagen-based preparations and hColl
- these agents or their digested fragments, are absorbed across the intestinal lumen, enter the blood stream and have direct effects on articular chondrocytes or other cells in the joint and/or influence the microbial profile in the colon that prevents inflammation both locally and systemically, with implications in joints, skin and bone.
- a significant dose dependent surge was detected in serum hydroxyproline levels in mice that were supplemented with hColl (FIG. 1). Serum hydroxyproline was highest when blood was sampled within 1 hour of consumption (FIG.
- the novel approach is exemplified in the combination of the hColl and hCol2 supplement (as a prebiotic) with a seed culture of Tenericutes and/or the members of the order Anaeroplasmatales and/or the genus Bifidobacteria (as a probiotic), in particular with Bifidobacterium pseudolongum, to maximize therapeutic and health promoting effects in joints and in OA, in joint, in skin, and in bone.
- hCol 0.8 - 15 gm/day, either hColl or hCol2, or a mixture
- 10 7 -10 12 colony forming units of a mixed culture of Tenericutes and/or members of the order Anaeroplasmatales and/or the genus Bifidobacteria that can be delivered as a mixture in a drink can be combined into a food product ⁇ e.g., yogurt), or may be processed into tablet or capsule forms.
- the supplementation regimen can encompass consuming the combination formulation one time/day, two times per week, or one time per week, etc.
- the invention generally relates to a composition for use in preventing or treating a disease or disorder in a subject in need thereof or for providing health- supporting effects or a health benefit to a subject in need thereof, wherein the composition comprises hydro lyzed collagen peptides.
- the invention also relates to a therapeutic method comprising administering a composition comprising hydrolyzed collagen peptides to a subject in need thereof.
- the invention further relates to the use of a composition comprising hydrolyzed collagen peptides for the manufacture of a medicine for a subject in need thereof.
- Yet an alternative aspect relates to the use of a composition comprising hydrolyzed collagen peptides for providing health- supporting effects or a health benefit.
- the composition is used for providing a health benefit to skin, joint or bone.
- the composition for use in prevention or treatment, the therapeutic method or the medicine is for preventing or treating a disease or disorder of the joints, skin or bone, preferably wherein the disease is osteoarthritis, or a related disease, or to provide health effects in these organs.
- the composition for use, the therapeutic method or the medicine is for preventing or treating inflammation, preferably inflammation in joint or wherein the inflammation is related to synovial hyperplasia.
- Disease or diorders of the skin or bones may also relate to diseases of the joint or arthropathy, such as but not limited to: Arthritis, Spondylarthropathy, Arthropathy, Reactive arthropathy, Enteropathic arthropathy, Crystal arthropathy, Diabetic arthropathy, Neuropathic arthropathy.
- diseases of the joint or arthropathy such as but not limited to: Arthritis, Spondylarthropathy, Arthropathy, Reactive arthropathy, Enteropathic arthropathy, Crystal arthropathy, Diabetic arthropathy, Neuropathic arthropathy.
- Osteoarthritis is known to the skilled person as a type of joint disease that results from breakdown of joint cartilage and underlying bone.
- a related disease may be a disease with similar symptoms or similar underlying causes.
- a related disease may also refer to secondary osteoarthritis, where the osteoarthritis is caused by other factors such as Alkaptonuria, Congenital disorders of joints, Diabetes, Ehlers-Danlos Syndrome, Hemochromatosis and Wilson's disease, Inflammatory diseases, Injury to joints or ligaments, Marfan syndrome, Obesity, Joint infection.
- osteoarthritis is posttraumatic osteoarthritis or obesity-induced osteoarthritis.
- Inflammation is known to the skilled person, and may be caused by the skin or bone disease or disorder, the osteoarthritis or related disease, or the inflammation may be the cause of the skin or bone disease or disorder, the osteoarthritis or related disease.
- the inflammation is caused by or causing synovial hyperplasia.
- the invention generally relates to a composition for use in treating a disease or disorder or providing a health benefit, wherein the composition comprises hydrolyzed collagen peptides.
- the use is for preventing or treating a disease or disorder in skin, joint or bone or providing a health benefit to skin, joint or bone.
- the use is for preventing or treating inflammation, preferably wherein the disease is osteoarthritis, in particular posttraumatic osteoarthritis or obesity-induced osteoarthritis, or a related disease or disorder.
- the inflammation is related to synovial hyperplasia.
- composition comprising hydrolyzed collagen according to the invention comprises hColl or hCol2 or a combination thereof, preferably hColl or hCol2 or both are present in the composition according to the invention having a mean molecular weight in a preferred range as mentioned herein.
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and
- the hColl originates from bovine, porcine or fish collagen from skin or hide or bone, preferably skin or hide, i.e. the hColl is produced by enzymatic hydrolysis of collagen from bovine, porcine or fish skin or hide or bone and/or the hColl2 originates from bovine, porcine or fish collagen from cartilage, i.e. the hCol2 is produced by enzymatic hydrolysis of collagen from bovine, porcine or fish cartilage.
- composition it is suitable for oral administration.
- composition it is suitable for daily, thrice weekly, twice weekly, or weekly administration.
- the invention generally relates to a combination for use in preventing or treating a disease or disorder or providing a health benefit, wherein the combination comprises the above composition and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria in the same composition as the hydrolyzed collagen, or wherein the microbes are present in a separate composition.
- a related aspect is directed to the use of said combination comprising hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria in the same composition as the hydrolyzed collagen peptides, or wherein the microbes are present in a separate composition, for providing a health benefit.
- the amount of microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria are present in an amount effective for preventing or treating osteoarthritis or a related disease or disorder.
- the amount of microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria are present in an amount effective for preventing or treating inflammation, in particular inflammation related to synovial hyperplasia.
- the microbes are from the phylum Tenericutes and/or the genus Bifidobacteria. In embodiments of the combination, the microbes are from the genus Bifidobacteria, preferably Bifidobacterium pseudolongum. In yet another aspect, the invention generally relates to a composition comprising hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria.
- the microbes are from the genus Bifidobacteria, preferably Bifidobacterium pseudolongum.ln certain embodiments of the composition, the hydrolyzed collagen peptides are hColl and/or hCol2.
- the microbes are from the phylum Tenericutes and/or the genus Bifidobacteria.
- the invention generally relates to a unit dosage form comprising a composition disclosed herein, wherein the unit dosage form is a tablet, capsule, powder or liquid.
- the invention generally relates to a unit dosage form comprising a combination disclosed herein, wherein the unit dosage form is a tablet, capsule, powder or liquid.
- the composition comprises a unit dosage from about 1.5 grams to about 15, more preferably 2 to 12, more preferably 2.5 to 10, more preferably 3 to 8.5, more preferably 3.5 to 7.5, more preferably 4 to 6.5, most preferably 4.5 to 5.5, hColl and/or comprises a unit dosage from about 0.9 grams to about 7.5, more preferably 1.0 to 7.0, more preferably 1.2 to 6.5, more preferably 1.4 to 6.0, more preferably 1.6 to 5.5, more preferably 1.8 to 5.0, more preferably 2.0 to 4.5, more preferably 2.5 to 4.0 most preferably 3.0 to 3.5 grams of hCol2 and/or preferably comprises a unit dosage from about 10 8 CFU to about 10 11 , more preferably about 10 9 to 10 10 CFU of microbes from the phylum Tenericutes the order Anearoplasmatales, and/or and/or the genus Bifidobacteria.
- the unit dosage comprises from about 0.8 grams to about 15 grams (e.g., from about 1.5 to about 15, from about 2 to about 12, from about 2.5 to about 10, from about 3 to about 8.5, from about 3.5 to about 7.5, from about 4 to about 6.5, from about 4.5 to about 5.5, from about 1.0 to about 7.0, from about 1.2 to about 6.5, from about 1.4 to about 6.0, from about 1.6 to about 5.5, from about 1.8 to about 5.0, from about 2.0 to about 4.5, from about 2.5 to about 4.0, from about 3.0 to about 3.5 grams) of hydro lyzed collagen peptides and/or from about 10 7 CFU to about 10 12 CFU (e.g., from about 10 7 colony forming units (CFU) to about 10 11 CFU, from about 10 7 colony forming units (CFU) to about 10 10 CFU, from about 10 7 colony forming units (CFU) to about 10 9 CFU, from about 10 8 colony forming units (CFU) to
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and
- the hColl originates from bovine, porcine or fish collagen from skin or hide or bone, preferably skin or hide, or from jellyfish and/or the hColl2 originates from bovine, porcine or fish collagen from cartilage.
- the microbes are from the phylum Tenericutes and/or the genus Bifidobacteria. In embodiments of the unit dosage, the microbes are from the genus Bifidobacteria, preferably Bifidobacterium pseudolongum.
- the invention generally relates to a package or kit comprising a composition comprising hydro lyzed collagen peptides and a composition comprising microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria, or a composition comprising both hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria.
- the hydrolyzed collagen peptides are hColl and/or hCol2.
- the package or kit comprises from about 0.8 grams to about 15 grams (e.g., from about 1.5 to about 15, from about 2 to about 12, from about 2.5 to about 10, from about 3 to about 8.5, from about 3.5 to about 7.5, from about 4 to about 6.5, from about 4.5 to about 5.5, from about 1.0 to about 7.0, from about 1.2 to about 6.5, from about 1.4 to about 6.0, from about 1.6 to about 5.5, from about 1.8 to about 5.0, from about 2.0 to about 4.5, from about 2.5 to about 4.0, from about 3.0 to about 3.5 grams) of hydrolyzed collagen peptides and/or from about 10 7 CFU to about 10 12 CFU (e.g., from about 10 7 colony forming units (CFU) to about 10 11 CFU, from about 10 7 colony forming units (CFU) to about 10 10 CFU, from about 10 7 colony forming units (CFU) to about 10 9 CFU, from about 10 8 colony forming units (CFU) to
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and
- the hColl originates form porcine, bovine or fish collagen from skin or hide or bone, preferably skin or hide, or from jellyfish and/or the hColl2 originates form porcine, bovine or fish collagen from cartilage.
- the microbes are from the phylum Tenericutes and/or the genus Bifidobacteria. In embodiments of the package or kit, the microbes are from the genus Bifidobacteria, preferably Bifidobacterium pseudolongum.
- the invention generally relates to use of a composition comprising or consisting essentially of hydrolyzed collagen peptides for modulating or improving the gut microbiome, preferably for increasing the microbial diversity in the gut.
- a related aspect is directed to a method for modulating or improving the gut microbiome, preferably for increasing the microbial diversity in the gut. The method includes: administering to a subject in need thereof a composition comprising or consisting essentially of hydrolyzed collagen peptides in an amount effective to improve the gut microbiome.
- the composition comprising hydrolyzed collagen peptides is used for enhancing microbes in the phylum Tenericutes and in the order Anaeroplasmatales and/or the genus Bifidobacteria. In embodiments, the composition comprising hydrolyzed collagen peptides is used for enhancing microbes in the order of the Bifidobacterials, the Lactobacillales and/or the Clostridiales.
- the invention generally relates to use of a composition comprising hydrolyzed collagen peptides as a prebiotic.
- a related aspect is directed to a method for providing a prebiotic to a subject. The method includes: administering to a subject in need thereof a composition comprising an effective amount of hydrolyzed collagen peptides.
- the hydrolyzed collagen peptides are hColl and/or hCol2.
- it comprises from about 0.8 grams to about 15 grams (e.g., from about 1.5 to about 15, from about 2 to about 12, from about 2.5 to about 10, from about 3 to about 8.5, from about 3.5 to about 7.5, from about 4 to about 6.5, from about 4.5 to about 5.5, from about 1.0 to about 7.0, from about 1.2 to about 6.5, from about 1.4 to about 6.0, from about 1.6 to about 5.5, from about 1.8 to about 5.0, from about 2.0 to about 4.5, from about 2.5 to about 4.0, from about 3.0 to about 3.5 grams) of hydrolyzed collagen peptides.
- grams to about 15 grams e.g., from about 1.5 to about 15, from about 2 to about 12, from about 2.5 to about 10, from about 3 to about 8.5, from about 3.5 to about 7.5, from about 4 to about 6.5, from about 4.5 to about 5.5, from about 1.0 to about 7.0, from about 1.2 to about 6.5, from about 1.4 to about 6.0, from about 1.6 to about 5.5, from about
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and
- the hColl originates form porcine, bovine or fish collagen from skin or hide or bone, preferably skin or hide, or from jellyfish and/or the hColl2 originates form porcine, bovine or fish collagen from cartilage.
- the invention generally relates to a method for preventing or treating osteoarthritis, in particular posttraumatic osteoarthritis or obesity-induced osteoarthritis, or a related disease or disorder.
- the method includes: administering to a subject in need thereof a composition comprising hydrolyzed collagen peptides in an amount effective to treat osteoarthritis, or a related disease or disorder thereof.
- a related aspect is directed to a composition comprising hydrolyzed collagen peptides for use in preventing or treating osteoarthritis, or a related disease or disorder.
- the invention generally relates to a method for preventing or treating a disease or disorder in the skin, joint or bone.
- the method includes: administering to a subject in need thereof a composition comprising hydrolyzed collagen peptides in an amount effective to treat the disease or disorder in the skin, joint or bone, or a related disease or disorder thereof.
- a related aspect is directed to a composition comprising hydrolyzed collagen peptides for use in preventing or treating a disease or disorder in the skin, joint or bone, or a related disease or disorder thereof.
- the invention generally relates to a method for improving joint health, skin health or bone health.
- the method includes: administering to a subject in need thereof hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria, in a single composition or in separate compositions, in amounts effective improving joint health, skin health or bone health.
- a related aspect is directed to the use of hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria, in a single composition or in separate compositions, for improving joint health, skin health or bone health.
- the invention generally relates to a method for providing a chondroprotective effect or for protecting cartilage in a subject. The method includes: administering to a subject in need thereof a composition comprising an effective amount of hydrolyzed collagen peptides.
- the subject is diagnosed with osteoarthritis, preferably posttraumatic osteoarthritis or obesity-induced osteoarthritis.
- a related aspect is directed to the use of a composition comprising hydrolyzed collagen peptides as described herein as a chondroprotective agent.
- the invention generally relates to a method for improving gut microbiome and/or for treating a disease or condition related thereto.
- the method includes: administering to a subject in need thereof a composition comprising hydrolyzed collagen peptides in an amount effective to improve gut microbiome and/or to treat a disease or disorder related thereto.
- the hydrolyzed collagen peptides are hColl and/or hCol2.
- it comprises from about 0.8 grams to about 15 grams (e.g., from about 1.5 to about 15, from about 2 to about 12, from about 2.5 to about 10, from about 3 to about 8.5, from about 3.5 to about 7.5, from about 4 to about 6.5, from about 4.5 to about 5.5, from about 1.0 to about 7.0, from about 1.2 to about 6.5, from about 1.4 to about 6.0, from about 1.6 to about 5.5, from about 1.8 to about 5.0, from about 2.0 to about 4.5, from about 2.5 to about 4.0, from about 3.0 to about 3.5 grams) of hydrolyzed collagen peptides and/or from about 10 7 CFU to about 10 12 CFU (e.g., from about 10 7 colony forming units (CFU) to about 10 11 CFU, from about 10 7 colony forming units (CFU) to about 10 10 CFU, from about 10 7 colony forming units (CFU) to about 10 9 CFU, from about 10 8 colony forming units (CFU) to about 10
- CFU hydrolyze
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and
- the hColl originates form porcine, bovine or fish collagen from skin or hide or bone, preferably skin or hide, or from jellyfish and/or the hColl2 originates form porcine, bovine or fish collagen from cartilage.
- the hydrolyzed collagen peptides are administered daily, thrice weekly, twice weekly, or weekly.
- the microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria are administered daily, thrice weekly, twice weekly, or weekly.
- the microbes are from the phylum Tenericutes and/or the genus Bifidobacteria. In embodiments of the method, the microbes are from the genus Bifidobacteria, preferably Bifidobacterium pseudolongum.
- administration is performed via oral administration.
- the hydrolyzed collagen peptides make up the essential proportion of the composition.
- the composition of hydrolyzed collagen peptides comprises at least 50% by weight, such as at least 60% or 70%> by weight, preferably at least 80%> by weight, more preferably at least 85% or 90%, even more preferably at least 95%, 96% or 97%) by weight hydrolyzed collagen peptides, based on the dry mass of the composition.
- the hydrolyzed collagen peptides are type 1 hydrolyzed collagen peptides (hColl) and/or type 2 hydrolyzed collagen peptides (hCol2).
- the hColl has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da) and/or the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da (e.g., between about 600 Da and about 6000 Da, between about 1000 Da and about 5000 Da, between about 1300 Da and about 4500 Da, between about 1600 and about 4000 Da, between about 1800 Da and about 3500 Da, between about 2000 and about 3000 Da).
- the hColl is produced by enzymatic hydrolysis of collagen from vertebrates, in particular porcine, bovine or fish, or from molluscae, in particular jellyfish and/or hCol2 is produced by enzymatic hydrolysis of collagen from vertebrates, in particular porcine, bovine or fish.
- the hColl is produced by enzymatic hydrolysis of collagen from porcine, bovine or fish skin or hide or bone, preferably skin or hide and/or hCol2 is produced by enzymatic hydrolysis of collagen from form porcine, bovine or fish cartilage.
- the composition of hydrolyzed collagen peptides is incorporated or formulated into a food or feed product, preferably a food or feed product for oral administration, a food or feed ingredient.
- the food or feed product is a drink, preferably a drink for oral administration.
- suitable drinks include fruit juice, a fruit drink, an artificially flavored drink, an artificially sweetened drink, a carbonated beverage, a sports drink, a liquid diary product, a shake, an alcoholic beverage, a caffeinated beverage, infant formula and so forth.
- the food or feed product is a solid foodstuff or feedstuff.
- Suitable examples of a solid foodstuff include without limitation yoghurt, a food bar, a snack bar, and the like.
- the composition of hydrolyzed collagen peptides is formulated as a dietary supplement.
- the hydrolyzed collagen peptides can be present in the form, for example, of a powder, a granulate, a solution or a suspension or in the form of tablets, capsules, pills, dragees, caplets or sachets, syrups, elixirs, if appropriate, in combination with suitable additives or inactive ingredients as described elsewhere herein.
- composition comprising hydrolyzed collagen peptides disclosed herein may be administered for at least 1 week, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15 or 16 weeks.
- the composition may be administered daily, thrice weekly, twice weekly, or weekly.
- the composition comprising hydrolyzed collagen peptides is administered daily for at least 1 week, preferably for at least 2 weeks.
- the daily oral intake of the composition comprising hydrolyzed collagen peptides disclosed herein is preferably in the range from 0.5 g to 15 g of the composition, preferably from 1 g to 10 g, more preferably from 2 g to 10 g, even more preferably from 5 g to 10 g, and particularly preferably in the range from 6.0 g to 8.0 g such as about 7.5 g-
- FIG. 9 depicts similar analyses for mice that were administered hCol2. Like hColl, a chondroprotective effect was observed 3 weeks post- MLI in mice that were supplemented with hCol2 (FIG. 9A-9E). These hCol2 effects were at the LD hCol2, and notably were equally potent compared to effects elicited by HD hColl, suggesting the hCol2 elicits a more potent chondroprotective effect.
- both LD and HD hColl groups displayed both a greater number and greater percentage of Safranin O-stained lacunae in tibia uncalcified cartilage compared to Control Sham joints (FIG. 4E and 4F). While, as expected, the OARSI score was significantly increased 12 weeks post-MLI, hColl supplemented mice only showed modest improvement of the score, with the LD group trending toward significance (FIG. 4G).
- mice supplemented with the HD hColl may have been protected from cartilage degeneration in part due to reduced MMP13 production by chondrocytes residing in the uncalcified cartilage.
- FIG. 4D The remarkable ability of hColl supplementation to protect against chondrocyte loss in murine PTOA (FIG. 4D) could be a key driver of its chondroprotective effect by setting the stage for persisting chondrocytes to produce matrix molecules (FIG. 4E and 4F).
- FIG. 4E and 4F To determine if the protection against MLI-induced chondrocyte loss was due to stimulation of proliferation or inhibition of apoptosis, representative tissue sections were analyzed via PCNA and TUNEL staining.
- TNF is established as a central inflammatory mediator that is present in synovial fluid and upregulated in hyperplastic synovium in PTOA, particularly in the early post-trauma time frame.
- Goldring MB Potential Mechanisms of PTOA: Inflammation, In: Olson et al, editors. Post-Traumatic Arthritis: Pathogenesis, Diagnosis and Treatment, New York: Springer; 2015, p. 201-8; Golightly et al, Biomarkers of PTA, In: Olson et al, editors. Post- Traumatic Arthritis: Pathogenesis, Diagnosis and Management, New York: Springer; 2015, p. 317-30.
- the PCoA plot in FIG. 11A particularly shows that obese and lean Nutella-fed mice are completely different from each other, with a robust difference in microbial diversity between the groups.
- FIG. HE and 11C hColl fed lean mice were distinct from the controls suggesting that the hColl supplement is shifting the microbiome.
- the relative abundance plot in FIG. 10B and percentage breakdown in FIG. IOC reveal that the Lean Nutella group has more Actinobacteria (19.6127%) compared to the Lean hColl (1.2523%) and Lean Glucosamine (12.7091%) groups.
- mice fed this supplement displayed a spike in circulating hydroxyproline that paralleled the effect seen with hColl supplementation (FIG. 12). This was associated with chondroprotection in posttraumatic OA, including an increase in number of Safranin O-positive chondrocytes in the uncalcified cartilage layer 3 weeks after injury induction of disease (FIG. 9).
- hCol 1 and 2 tended to have similar effects: Increases in the abundance of Bacteroidales, Bifidobacteriales, Lactobacillales, Turicibacterales, and Anaeroplasmatales. These increases were at the expense of the Clostridiales community in both hColl and hCol2 supplemented mice, but this effect was marginal, and Clostridiales was the dominant order all three groups (FIG. 15).
- hCol 1 and 2 In the lean diet, hCol 1 and 2 also tended to have a similar effect: Most striking was the loss of Bifidobacteriales and emergence of Anaeroplasmatales and a minor decrease in Lactobacillales, Turicibacterales, and Anaeroplasmatales (FIG. 16). In the HF diet, hCol 1 and 2 again tended to induce the same effect: ablation of Coriobacteriales and reduction of Lactobacillales. Loss of the Lactobacillales community correlated with an increase in the abundance of the beneficial Clostridiales, which are known as butyrate producers (FIG. 17).
- hCol2 supplementation reduced the proinflammatory bacterial species Peptococcaceae rc4-4 sp., Enterococcus sp., Lactobacillus ND, Erysipelotrichaceae sp. and Adlercreutzia sp., and increased the anti- inflammatory bacterial species Lachnospiraceae sp., Dehalobacterium sp., Mogibacteriaceae sp., Dorea sp., Clostridiales ND, Oscillospira ND and Bifidobacterium pseudolongum (FIG. 19).
- hCol 1 and 2 both had significant effects on the gut microbiome in each of the background diets tested, supporting their activity as prebiotic agents that could influence host biology through effects on the gut microbiome.
- Non-obese, metabolically healthy mice were fed daily supplements of hColl, hCol2 or vehicle control (Nutella). After 12 weeks on supplement, MicroCT analysis was performed to examine femoral and vertebral bone parameters, and bone densitometry (DEXA) was performed to determine whole body bone mineral density (BMD).
- hColl and hCol2 supplementation increased bone volume fraction (BV/TV), the density of trabecular connections (Conn-Density), and trabecular number (Tb.N.) (FIG. 20A-C).
- the bone volume fraction (BV/TV) in the fourth lumbar vertebrae (L4) was increased in mice supplemented with hColl (FIG. 20D).
- DXA analysis of whole body bone mineral density revealed positive effects in mice supplemented with hColl or hCol2 (FIG. 20E). Overall, these data support improvement of bone quality by hColl and hCol2.
- mice All handling of mice and in vivo experimental procedures performed in studies reported here were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Rochester (protocol number UCAR-2005-226R). Male C57BL/6J mice were purchased from Jackson Laboratories and were housed individually in micro -isolator cages on a 12 hour light/dark cycle. Male mice were used in this study due to a faster and more temporally predictable progression of degeneration.
- IACUC Institutional Animal Care and Use Committee
- mice had ad libitum access to standard chow and fresh water, and were supplemented with hColl of bovine origin and a mean molecular weight of 2500 Da (Rousselot) or of hCol2 of porcine origin of mean molecular weight 2700Da using a method previously described to deliver daily doses of estradiol. (Ingberg et al. 2012 General and comparative endocrinology 175(1): 188-93.)
- hColl and hCol2 were incorporated into Nutella such that 150 mg of the mixture would deliver either low dose (LD, 3.8 mg) or high dose (HD, 38 mg) hColl or a low dose (3.8 mg) hCol2 when completely consumed.
- the HD is the body weight adjusted mouse equivalent to the 7.4 g/day recommended human dose for hColl .
- 12 week old mice were presented with an autoclavable ceramic tile loaded with a 150 mg aliquot of Nutella vehicle, LD hColl , HD hColl, or hCol2 (FIG. 1A).
- MMI meniscal- ligamentous injury
- mice in the experimental protocol were anesthetized via intraperitoneal injection of 60 mg/kg ketamine and 4 mg/kg xylazine.
- the medial collateral ligament of the right knee was transected and a segment of the anterior horn of the medial meniscus was excised. This injury leads to detectable PTOA joint changes by 4 weeks post-injury and progresses over 4 months, similar to that seen in the DMM model of posttraumatic OA.
- mice were sacrificed using an AMVA- approved method and the knee joints were dissected with the femur and tibia intact to maintain joint structure.
- Tissues were fixed in 4% paraformaldehyde at 4°C for 72 hours, decalcified in 5% formic acid for 10 days, processed using a microwave processor, and embedded in paraffin. Tissue blocks were then serially sectioned in the midsagittal plane through the medial compartment of the joint. A series of 5 ⁇ thick sections were cut at three distinct levels within the medial compartment, mounted on positively-charged glass slides, baked at 60°C overnight, de-paraffinized in xylene, and rehydrated in decreasing concentrations of ethanol.
- Synovial scores were also obtained from each joint section, with the score reporting on the degree of synovial hyperplasia (i.e., thickness and cellularity of the synovial membrane) as previously performed. (Hamada et al. 2015 Arthritis & rheumatology, doi: 10.1002/art.39561.)
- 0 a synovial lining that is several (2-3) cell layers thick or ⁇ 10 ⁇ thick (normal)
- 1 synovial thickening with a lining cell layer between 5 and 10 cells thick or between 10 ⁇ and 20 ⁇ thick
- 2 severe thickening of the synovial lining >10 cells and/or >20 ⁇ thick.
- OARSI and synovial scoring was performed by four blinded observers (QAD, EMS, RAM and MJZ) and observer agreement for each score was evaluated in pairs via calculation of a weighted kappa coefficient, using Fleiss-Cohen weights. (Sampson et al. 2011 J Orthop Res. 29(8): 1145-51.)
- the average pairwise coefficient was 0.90, indicative of strong agreement between the observers.
- the four scores (OARSI and synovium) for each section were averaged and the data from each group of mice were combined.
- TNF detection slides were then rinsed with phosphate-buffered saline containing 0.5% Tween 20, and incubated for 30 minutes at room temperature with a biotinylated goat anti-rabbit IgG (1 :200; Vector).
- Antibody binding to TNF was detected following application of ABC reagent from Vectastain Elite ABC Kit (Vector) for 30 minutes, with a 5 minute application of ImmPACT DAB Peroxidase (HRP) Substrate (Vector) for 5 minutes. Nuclei were counterstained for 20 seconds with Mayer's Hematoxylin (Biocare Medical).
- Ki-67 For detection of Ki-67, after overnight incubation with primary antibody, slides were rinsed with phosphate-buffered saline and incubated for 30 minutes at room temperature with Alexa Fluor 488-conjugated goat anti-rabbit IgG (1 :250; Invitrogen #abl50077). Apoptotic chondrocytes were identified using the TUNEL In Situ Cell Death Detection Kit (Roche, #11684795910) as instructed by the manufacturer. In the case of Ki-67 and TUNEL, nuclei were counterstained with DAPI and experimental fluorescence was imaged using a Zeiss Axioskop 40 BF/DF/Fluorescence Microscope with a SPOT RT3 Color/Slider Camera.
- knee joints and lumbar vertebrae were evaluated via micro- CT using a Scanco vivaCT 40 scanner with 55-kVp source (Scanco). Tissue samples were scanned at a resolution of 12 ⁇ , with a slice increment of ⁇ . Images from each group were reconstructed at identical thresholds to allow 3-dimensional structural rendering of each anatomical element and recovery of various structural parameters as previously described (Mooney et al. 2011 Arthritis research & therapy 13(6):R198).
- mice were anesthetized via intraperitoneal injection of ketamine (60 mg/kg) and xylazine (4 mg/kg), and scans were collected and analyzed using a previously described standard method (Ackert-Bicknell et al. 2012 Bone 50(5): 1188-95).
- synovial capsules were harvested from experimental joints with the aid of surgical loops. Recovered synovial tissue was stored at -80°C until extraction of total mRNA. mRNA was isolated from individual capsules using the Qiagen RNeasy Fibrous Tissue mini kit (Qiagen) using the manufacturer's instructions. One ⁇ g of total RNA was used to synthesize cDNA using the iScript cDNA Synthesis Kit (BioRad). The abundance of mouse ⁇ -actin, Tnf, ⁇ , Mmpl3 and Prg4 was then assessed by qRTPCR using SYBR Green Real Time PCR Master Mix (Qiagen). Reactions were carried out using a Rotor Gene 6000 PCR machine. Forward and reverse primer sequences for each of these gene transcripts are reported in Table 1.
- Prg4 5 ' AGTGCTGTCCTGATTTCAAGAG-3 ' 5 ' -GGTGATTTGGGTGAGCGTTTGGTA-3 '
- Fecal pellets were freshly harvested from mice after scruffing and immediately frozen at - 80°C. DNA was extracted using the ZR Fecal DNA Extraction Kit (Zymo Research) as directed by the manufacturer. 16S ribosomal DNA (rDNA) was amplified with Phusion High-Fidelity polymerase (Thermo Scientific, Waltham, MA) and dual indexed primers specific to the V3-V4 hypervariable regions (319F: 5' ACTCCTACGGGAGGCAGCAG 3' (SEQ ID NO: 11); 806R: 3' ACTCCTACGGGAGGCAGCAG 5 ' (SEQ ID NO: 12)) 68 .
- rDNA 16S ribosomal DNA
- Amplicons were pooled and paired-end sequenced on an Illumina MiSeq (Illumina, San Diego, CA) in the University of Rochester Genomics Research Center. Each sequencing run included: positive controls consisting of a 1 :5 mixture of Staphylococcus aureus, Lactococcus lactis, Porphyromonas gingivalis, Streptococcus mutans, and Escherichia coli; and negative controls consisting of sterile saline.
- Raw data from the Illumina MiSeq was first converted into FASTQ format 2x300 paired end sequence files using the bcl2fastq program, version 1.8.4, provided by Illumina. Format conversion was performed without de-multiplexing and the EAMMS algorithm was disabled.
- Read pairs were assembled using fastq-join from the ea-utils package, requiring at least 40 bases of overlap and allowing a maximum of 10% mismatched bases. Read pairs that could not be assembled were discarded.
- the concatenated barcode sequences were prepended to the corresponding assembled reads, and the resulting sequences were converted from FASTQ to FASTA and QUAL files for QIIME analysis. Barcodes, forward primer, spacer, and reverse primer sequences were removed during de-multiplexing. Reads containing more than four mismatches to the known primer sequences or more than three mismatches to all barcode sequences were excluded from subsequent processing and analysis.
- Assembled reads were truncated at the beginning of the first 30 base window with a mean Phred quality score of less than 20 or at the first ambiguous base, whichever came first. Resulting sequences shorter than 300 bases or containing a homopolymer longer than six bases were discarded.
- Operational taxonomic units were picked using the reference-based USEARCH (version 5.2) (Edgar et al. 2011 Bioinformatics 27(16):2194- 200.) pipeline in QIIME, using the May 2013 release of the GreenGenes 99% OTU database as a closed reference (DeSantis et al. 2006 Applied and environmental microbiology 72(7):5069-72; McDonald et al. 2012 ISME J.
- compositions for use in treating a disease or disorder or providing a health benefit wherein the composition comprises hydrolyzed collagen peptides.
- composition for use according to statement 1 wherein the use is for treating a disease or disorder in skin, joint or bone or providing a health benefit to skin, joint or bone.
- composition for use according to statement 1 or 2 wherein the use is for treating inflammation, preferably wherein the disease is osteoarthritis, or a related disease or disorder.
- composition for use according to any one of statements 1-7 suitable for oral administration.
- composition for use according to statement 8 suitable for daily, thrice weekly, twice weekly, or weekly administration.
- a combination for use in treating a disease or disorder or providing a health benefit comprising the composition of any of statements 1-
- microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria in the same composition as the hydrolyzed collagen, or wherein the microbes are present in a separate composition.
- a composition comprising hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria.
- composition according to statement 13 wherein the hydrolyzed collagen peptides are hColl and/or hCol2.
- a unit dosage form comprising a composition according to any of statements 1- 9, 13 and 14, wherein the unit dosage form is a tablet, capsule, powder or liquid.
- a unit dosage form comprising a combination according to any of statements 10- 12, wherein the unit dosage form is a tablet, capsule, powder or liquid.
- the unit dosage form according to statement 15 or 16 comprises from about 0.8 grams to about 15 grams of hydrolyzed collagen peptides and/or from about 10 7 CFU to about 10 12 CFU of microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria. 18. The unit dosage form according to any of statements 15-17, wherein the hColl has a mean molecular weight between about 300 Da and about 7500 Da and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- a package or kit comprising a composition comprising hydro lyzed collagen peptides and a composition comprising microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria, or a composition comprising both hydrolyzed collagen peptides and microbes from the phylum Tenericutes and/or the order Anaeroplasmatales and/or the genus Bifidobacteria.
- composition comprising hydrolyzed collagen peptides for improving the gut microbiome.
- hColl has a mean molecular weight between about 300 Da and about 7500 Da and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- hColl has a mean molecular weight between about 300 Da and about 7500 Da and/or wherein the hCol2 has a mean molecular weight between about 300 Da and about 7500 Da.
- 31. The use according to statement 29 or 30, wherein the hColl and/or the hColl2 originates form porcine, bovine or fish collagen.
- a method for treating osteoarthritis, or a related disease or disorder comprising: administering to a subject in need thereof a composition comprising hydrolyzed collagen peptides in an amount effective to treat osteoarthritis, or a related disease or disorder thereof.
- a method for treating a disease or disorder in the skin, joint or bone comprising: administering to a subject in need thereof a composition comprising hydrolyzed collagen peptides in an amount effective to treat the disease or disorder in the skin, joint or bone, or a related disease or disorder thereof.
- a method for improving joint health, skin health, joint health or bone health comprising:
- a method for providing a prebiotic material to a subject comprising administering to a subject in need thereof a composition comprising an effective amount of hydrolyzed collagen peptides.
- hydrolyzed collagen peptides comprise hColl and/or hCol2.
- Bifidobacteria are administered daily, thrice weekly, twice weekly, or weekly.
- a method for providing a chondroprotective effect comprising:
- composition comprising an effective amount of hydrolyzed collagen peptides.
- a method for improving gut microbiome and/or for treating a disease or condition related thereto comprising:
- composition comprising hydrolyzed collagen peptides in an amount effective to improve gut microbiome and/or to treat a disease or disorder related thereto.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Polymers & Plastics (AREA)
- Epidemiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Food Science & Technology (AREA)
- Biomedical Technology (AREA)
- Physical Education & Sports Medicine (AREA)
- Rheumatology (AREA)
- Molecular Biology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Animal Husbandry (AREA)
- Gastroenterology & Hepatology (AREA)
- Dermatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201762471582P | 2017-03-15 | 2017-03-15 | |
| US201762554555P | 2017-09-05 | 2017-09-05 | |
| PCT/EP2018/055060 WO2018166807A1 (en) | 2017-03-15 | 2018-03-01 | Compositions of hydrolyzed collagen peptides and commensal microorganisms and methods thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3595695A1 true EP3595695A1 (en) | 2020-01-22 |
Family
ID=61622542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP18710385.8A Withdrawn EP3595695A1 (en) | 2017-03-15 | 2018-03-01 | Compositions of hydrolyzed collagen peptides and commensal microorganisms and methods thereof |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US11110147B2 (en) |
| EP (1) | EP3595695A1 (en) |
| CN (1) | CN110691604A (en) |
| BR (1) | BR112019019056A2 (en) |
| WO (1) | WO2018166807A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3714890B1 (en) * | 2019-03-29 | 2022-09-21 | Acten AG | Composition comprising a collagen hydrolysate and a fucoidan |
| US20230129983A1 (en) * | 2021-10-22 | 2023-04-27 | Oklahoma Medical Research Foundation | Microbiome transplantation for osteoarthritis therapy |
| CN113980122B (en) * | 2021-10-28 | 2024-06-25 | 滨州医学院 | Preparation method and application of pigskin collagen peptide-ferrous chelate |
| EP4561607A1 (en) * | 2022-07-29 | 2025-06-04 | Lonza Greenwood LLC | Method and composition for treating conditions associated with a leaky gut barrier |
| CN117876712B (en) * | 2024-03-13 | 2024-05-31 | 汉滨区第一医院 | Automatic spine feature point identification method based on Harris |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008059927A1 (en) * | 2006-11-15 | 2008-05-22 | Meiji Seika Kaisha, Ltd. | Collagen peptide composition and food or beverage containing the same |
| US7678768B2 (en) * | 2004-07-28 | 2010-03-16 | Cargill Incorporated | Physiologically-active composition based on collagen |
| WO2010096564A2 (en) * | 2009-02-19 | 2010-08-26 | Probiohealth Llc | Dietary supplements containing polyunsaturated omega-3 fatty acids and probiotic bacteria with potential gastrointestinal and dermatological benefits |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA1302880C (en) * | 1986-07-25 | 1992-06-09 | Peter Koepff | Agents for the treatment of arthroses |
| US5948766A (en) * | 1994-08-23 | 1999-09-07 | Dgf Stoess Ag | Use of tasteless, hydrolyzed collagen and agent containing the same |
| AU6954598A (en) * | 1997-04-10 | 1998-10-30 | Richardson Labs, Inc. | Composition comprising a hydrolysed collagen protein and glucosamine for the treatment of arthroses |
| US6025327A (en) * | 1997-08-08 | 2000-02-15 | Biocell Technology, Llc | Hydrolyzed collagen type II and use thereof |
| CA2577352A1 (en) * | 2006-03-14 | 2007-09-14 | Ahmad Alkayali | Canine and equine collagen joint health supplement |
| CN101720928A (en) | 2008-10-27 | 2010-06-09 | 柯宏 | Combination for preventing and curing degenerative disease of bone and joint |
| CN101455396A (en) * | 2009-01-07 | 2009-06-17 | 成都自豪药业有限公司 | Nutrient health-care food capable of promoting bone and bone arthrosis health |
| DE102012110612A1 (en) * | 2012-11-06 | 2014-05-08 | Gelita Ag | Collagen hydrolyzate and its use |
| PL2996704T3 (en) * | 2013-05-14 | 2021-06-28 | Mars, Incorporated | Joint care composition |
| GB201414910D0 (en) * | 2014-05-23 | 2014-10-08 | Mars Inc | Composition |
| US10287339B2 (en) * | 2017-02-22 | 2019-05-14 | Ahmad Alkayali | Hydrolyzed jellyfish collagen types I, II, and V and use thereof |
-
2018
- 2018-03-01 WO PCT/EP2018/055060 patent/WO2018166807A1/en not_active Ceased
- 2018-03-01 BR BR112019019056A patent/BR112019019056A2/en unknown
- 2018-03-01 US US16/489,890 patent/US11110147B2/en active Active
- 2018-03-01 CN CN201880018235.XA patent/CN110691604A/en active Pending
- 2018-03-01 EP EP18710385.8A patent/EP3595695A1/en not_active Withdrawn
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7678768B2 (en) * | 2004-07-28 | 2010-03-16 | Cargill Incorporated | Physiologically-active composition based on collagen |
| WO2008059927A1 (en) * | 2006-11-15 | 2008-05-22 | Meiji Seika Kaisha, Ltd. | Collagen peptide composition and food or beverage containing the same |
| WO2010096564A2 (en) * | 2009-02-19 | 2010-08-26 | Probiohealth Llc | Dietary supplements containing polyunsaturated omega-3 fatty acids and probiotic bacteria with potential gastrointestinal and dermatological benefits |
Non-Patent Citations (3)
| Title |
|---|
| BORNSTEIN PAUL ET AL: "Structurally distinct collagen types", ANN. REV. BIOCHEM., 1 January 1980 (1980-01-01), XP093127863 * |
| See also references of WO2018166807A1 * |
| VAN VIJVEN J P J ET AL: "Symptomatic and chondroprotective treatment with collagen derivatives in osteoarthritis: a systematic review", OSTEOARTHRITIS AND CARTILAGE, ELSEVIER, AMSTERDAM, NL, vol. 20, no. 8, 11 April 2012 (2012-04-11), pages 809 - 821, XP028502243, ISSN: 1063-4584, [retrieved on 20120417], DOI: 10.1016/J.JOCA.2012.04.008 * |
Also Published As
| Publication number | Publication date |
|---|---|
| US20200069762A1 (en) | 2020-03-05 |
| BR112019019056A2 (en) | 2020-04-22 |
| CN110691604A (en) | 2020-01-14 |
| US11110147B2 (en) | 2021-09-07 |
| WO2018166807A1 (en) | 2018-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11110147B2 (en) | Collagen hydrolysates as a beneficial prebiotic and their effect on joint inflammation and osteoarthritis | |
| Dar et al. | Daily oral consumption of hydrolyzed type 1 collagen is chondroprotective and anti-inflammatory in murine posttraumatic osteoarthritis | |
| AU2018365217B2 (en) | Homovanillyl alcohol (HVA), HVA isomer, methods of making compositions comprising such compounds, and methods using such compounds | |
| HK1209360A1 (en) | Use of bacteroides ovatus in the treatment or prevention of rheumatoid arthritis or related diseases | |
| KR20180053336A (en) | Purpose of sterilized ackmannia to treat metabolic disorders | |
| HK1209347A1 (en) | Use of bacteroides dorei in the treatment or prevention of rheumatoid arthritis or related diseases | |
| JP2018513196A (en) | Microbiome regulators and related uses | |
| HK1209365A1 (en) | Use of bacteroides plebeius in the treatment or prevention of rheumatoid arthritis or related diseases | |
| KR20150093711A (en) | Use of akkermansia for treating metabolic disorders | |
| HK1209350A1 (en) | Use of bacteroides caccae in the treatment or prevention of rheumatoid arthritis or related diseases | |
| KR102397916B1 (en) | A novel anaerobic microbe isolated from human milk and method of preventing or treating metabolic disease using thereof | |
| CN111032677A (en) | Peptides for inhibiting bone resorption | |
| EP4108260A1 (en) | Composition for alleviating pulmonary hypertension, method for predicting prognosis of pulmonary hypertension, method for assisting in determining severity of pulmonary hypertension, and method for assisting in diagnosing pulmonary hypertension | |
| CN113286872A (en) | Novel bacterium genus Dysosmobacter of gastrointestinal tract microbiota and use thereof | |
| JP6218732B2 (en) | Composition for preventing or treating osteoarthritis | |
| US11452747B2 (en) | Compositions of oligofructose and commensal microorganisms and methods thereof | |
| JP2021019532A (en) | Blood-brain barrier protective agent | |
| JP2007031291A (en) | Body weight increase-inhibiting agent and body weight increase-inhibiting drink | |
| JP2020110066A (en) | Blood pressure elevation depressant including chondroitin sulfate-containing pig cartilage extract as active principle and food composition containing the same | |
| CN104546943A (en) | Application of alistipes shahii in treating or preventing rheumatoid arthritis or related diseases | |
| HK1209355A1 (en) | Use of coprococcus catus in the treatment or prevention of rheumatoid arthritis or related diseases | |
| HK1209368A1 (en) | Use of prevotella maculosa in the treatment or prevention of rheumatoid arthritis | |
| HK1209364A1 (en) | Use of actinomyces naeslundii in the treatment or prevention of rheumatoid arthritis or related diseases | |
| JP2017025028A (en) | Extracellular matrix degradation inhibitor | |
| HK1209349A1 (en) | Use of parabacteroides merdae in the treatment or prevention of rheumatoid arthritis or related diseases |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20191001 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: PRAWITT, JANNE Inventor name: SCHOTT, ERIC Inventor name: ZUSCIK, MICHAEL Inventor name: FARNSWORTH, CHRISTOPHER Inventor name: MOONEY, ROBERT |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: ROUSSELOT B.V. |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20230323 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20240613 |