EP3430141B1 - Oligonucleotides for reduction of pd-l1 expression - Google Patents

Oligonucleotides for reduction of pd-l1 expression Download PDF

Info

Publication number
EP3430141B1
EP3430141B1 EP17710874.3A EP17710874A EP3430141B1 EP 3430141 B1 EP3430141 B1 EP 3430141B1 EP 17710874 A EP17710874 A EP 17710874A EP 3430141 B1 EP3430141 B1 EP 3430141B1
Authority
EP
European Patent Office
Prior art keywords
oligonucleotide
nucleosides
conjugate
antisense oligonucleotide
region
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
EP17710874.3A
Other languages
German (de)
French (fr)
Other versions
EP3430141A1 (en
Inventor
Lykke PEDERSEN
Hassan JAVANBAKHT
Malene JACKEROTT
Søren OTTOSEN
Souphalone LUANGSAY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
F Hoffmann La Roche AG
Original Assignee
F Hoffmann La Roche AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by F Hoffmann La Roche AG filed Critical F Hoffmann La Roche AG
Priority to EP20201780.2A priority Critical patent/EP3786297A1/en
Priority to SI201730645T priority patent/SI3430141T1/en
Priority to PL17710874T priority patent/PL3430141T3/en
Priority to RS20210240A priority patent/RS61528B1/en
Publication of EP3430141A1 publication Critical patent/EP3430141A1/en
Application granted granted Critical
Publication of EP3430141B1 publication Critical patent/EP3430141B1/en
Priority to HRP20210315TT priority patent/HRP20210315T1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/1703—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • A61K38/1709—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
    • A61P33/06—Antimalarials
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/04—Antineoplastic agents specific for metastasis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55516—Proteins; Peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/322—2'-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/341—Gapmers, i.e. of the type ===---===
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/346—Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/26—Infectious diseases, e.g. generalised sepsis
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to oligonucleotides (oligomers) that are complementary to programmed death ligand-1 (PD-L1), leading to reduction of the expression of PD-L1 the liver.
  • the present invention also relates to a method of alleviating the T cell exhaustion caused by an infection of the liver or cancer in the liver.
  • Relevant infections are chronic HBV, HCV and HDV and parasite infections like malaria and toxoplasmosis (e.g. caused by protozoa of the Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum).
  • the costimulatory pathway consisting of the programmed death-1 (PD-1) receptor and its ligand, PD-L1 (or B7-H1 or CD274) is known to contribute directly to T cell exhaustion resulting in lack of viral control during chronic infections of the liver.
  • the PD-1 pathway also plays a role in autoimmunity as mice disrupted in this pathway develop autoimmune diseases.
  • WO 2006/042237 describes a method of diagnosing cancer by assessing PD-L1 (B7-H1) expression in tumors and suggests delivering an agent, which interferes with the PD-1/PD-L1 interaction, to a patient.
  • Interfering agents can be antibodies, antibody fragments, siRNA or antisense oligonucleotides. There are no specific examples of such interfering agents nor is there any mentioning of chronic liver infections.
  • RNA interference mediated inhibition of PD-L1 using double stranded RNA (dsRNA, RNAi or siRNA) molecules have also been disclosed in for example WO 2005/007855 , WO 2007/084865 and US 8,507,663 . None of these describes targeted delivery to the liver.
  • siRNA approach is significantly different from the single stranded antisense oligonucleotide approach since the biodistribution and the mode of actions is quite different.
  • antisense oligonucleotides and siRNAs have different preferences for target sites in the mRNA.
  • WO2016/138278 describes inhibition of immune checkpoints including PD-L1, using two or more single stranded antisense oligonucleotides that are linked at their 5' ends.
  • the application does not mention HBV or targeted delivery to the liver.
  • the present invention identifies novel oligonucleotides and oligonucleotide conjugates which reduce PD-L1 mRNA very efficiently in liver cells, both in parenchymal cells (e.g. hepatocytes) and in non-parenchymal cells such as Kupffer cells and liver sinusoidal endothelial cells (LSECs).
  • parenchymal cells e.g. hepatocytes
  • non-parenchymal cells e.g. Kupffer cells and liver sinusoidal endothelial cells (LSECs).
  • LSECs liver sinusoidal endothelial cells
  • Natural killer (NK) cells and natural killer T (NKT) cells may also be activated by the oligonucleotides and oligonucleotide conjugates of the present invention.
  • the oligonucleotide conjugates secures local reduction of PD-L1 in liver cells and therefore reduces the risk of autoimmune side effects, such as pneumonitis, non-viral hepatitis and colitis associated with systemic depletion of PD-L1.
  • the present invention is an antisense oligonucleotide of formula CCtatttaacatcAGAC, wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine and all internucleoside linkages are phosphorothioate internucleoside linkages.
  • the present invention is an antisense oligonucleotide conjugate comprising the oligonucleotide of the present invention and a conjugate moiety covalently attached to said oligonucleotide.
  • the present invention is a pharmaceutical composition
  • a pharmaceutical composition comprising the antisense oligonucleotide of the present invention or the antisense oligonucleotide conjugate of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
  • the present invention is an in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of any one of the present invention in an effective amount to said cell.
  • the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in restoration of immune response against a virus.
  • the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in restoration of immune response against a parasite.
  • the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use as a medicament.
  • the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in the treatment of HBV infection.
  • the present invention relates to oligonucleotides or conjugates thereof targeting a nucleic acid capable of modulating the expression of PD-L1 and to treat or prevent diseases related to the functioning of the PD-L1.
  • the oligonucleotides or oligonucleotide conjugates may in particular be used to treat diseases where the immune response against an infectious agent has been exhausted.
  • oligonucleotides which comprise a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid.
  • the oligonucleotide can be an antisense oligonucleotide, preferably with a gapmer design.
  • the oligonucleotide is capable of inhibiting the expression of PD-L1 by cleavage of a target nucleic acid. The cleavage is preferably achieved via nuclease recruitment.
  • the oligonucleotide of the present invention is conjugated to at least one asialoglycoprotein receptor targeting conjugate moiety, such as a conjugate moiety comprising at least one N-Acetylgalactosamine (GalNAc) moiety.
  • the conjugation moiety and the oligonucleotide may be linked together by a linker, in particular a biocleavable linker.
  • the invention provides pharmaceutical compositions comprising the oligonucleotides or oligonucleotide conjugates of the invention and pharmaceutically acceptable diluents, carriers, salts and/or adjuvants.
  • Described herein are methods for in vivo or in vitro method for reduction of PD-L1 expression in a target cell which is expressing PD-L1, by administering an oligonucleotide or composition of the invention in an effective amount to said cell.
  • the invention provides oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention for use in restoration of immunity against a virus or parasite.
  • the invention provides oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention for use as a medicament.
  • oligonucleotide of the invention a subject suffering from or susceptible to the disease, disorder or dysfunction, in particular diseases selected from viral liver infections or parasite infections.
  • the oligonucleotide, oligonucleotide conjugates or pharmaceutical composition of the invention is used in the treatment or prevention of viral liver infections such as HBV, HCV and HDV or a parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis or liver cancer or metastases in the liver.
  • viral liver infections such as HBV, HCV and HDV
  • a parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis or liver cancer or metastases in the liver.
  • oligonucleotide as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides.
  • the oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated.
  • the oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
  • Antisense oligonucleotide as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid.
  • the antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs.
  • the antisense oligonucleotides of the present invention are single stranded.
  • oligonucleotide sequence refers to the region of the oligonucleotide which is complementary to the target nucleic acid.
  • the term is used interchangeably herein with the term “contiguous nucleobase sequence” and the term “oligonucleotide motif sequence".
  • all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence.
  • the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence.
  • the nucleotide linker region may or may not be complementary to the target nucleic acid.
  • Nucleotides are the building blocks of oligonucleotides and polynucleotides and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides.
  • nucleotides such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides).
  • Nucleosides and nucleotides may also interchangeably be referred to as "units" or "monomers”.
  • modified nucleoside or “nucleoside modification” as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety.
  • the modified nucleoside comprise a modified sugar moiety.
  • modified nucleoside may also be used herein interchangeably with the term “nucleoside analogue” or modified "units” or modified “monomers”.
  • modified internucleoside linkage is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed “modified nucleotides”. In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides.
  • Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.
  • the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack.
  • Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art.
  • SVPD snake venom phosphodiesterase
  • Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages.
  • At least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified.
  • nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate may be phosphodiester.
  • all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.
  • Modified internucleoside linkages may be selected from the group comprising phosphorothioate, diphosphorothioate and boranophosphate.
  • the modified internucleoside linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate, diphosphorothioate or boranophosphate.
  • the internucleoside linkage comprises sulphur (S), such as a phosphorothioate internucleoside linkage.
  • a phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture.
  • at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
  • all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof are phosphorothioate.
  • the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester, methylphosphonate, MMI, amide-3, formacetal or thioformacetal.
  • internucleoside linkages are disclosed in WO2009/124238 .
  • the internucleoside linkage is selected from linkers disclosed in WO2007/031091 .
  • the internucleoside linkage may be selected from -O-P(O) 2 -O-, -O-P(O,S)-O-, -O-P(S) 2 -O-, -S-P(O) 2 -O-, -S-P(O,S)-O-, -S-P(O) 2 -O-, -O-P(O) 2 -S-, -O-P(O,S)-S-, -S-P(O) 2 -S-, -O-PO(R H )-O-, 0-PO(OCH 3 )-0-, -O-PO(NR H )-O-, -O-PO(OCH 2 CH 2 S-R)-O-, -O-PO(BH 3
  • Nuclease resistant linkages such as phosphothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers.
  • Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F' for gapmers, or the modified nucleoside region of headmers and tailmers.
  • Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation.
  • phosphodiester linkages such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and/or bio-distribution of an oligonucleotide - see WO2008/113832 .
  • all the internucleoside linkages in the oligonucleotide are phosphorothioate and/or boranophosphate linkages.
  • all the internucleoside linkages in the oligonucleotide are phosphorothioate linkages.
  • nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization.
  • pyrimidine e.g. uracil, thymine and cytosine
  • nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization.
  • nucleobase refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1 .
  • the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
  • a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-brom
  • the nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function.
  • the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine.
  • 5-methyl cytosine LNA nucleosides may be used.
  • modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages.
  • chimeric oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.
  • Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U).
  • oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1 ).
  • % complementary refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to ( i.e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid).
  • the percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5'-3' and the oligonucleotide sequence from 3'-5'), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.
  • oligonucleotide SEQ ID NO: 5
  • target nucleic acid SEQ ID NO: 772
  • Identity refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to ( i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid).
  • hybridizing or “hybridizes” as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex.
  • the affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (T m ) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions T m is not strictly proportional to the affinity ( Mergny and Lacroix, 2003, Oligonucleotides 13:515-537 ).
  • ⁇ G° is the energy associated with a reaction where aqueous concentrations are 1M, the pH is 7, and the temperature is 37°C.
  • ⁇ G° The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ⁇ G° is less than zero.
  • ⁇ G° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today .
  • ITC isothermal titration calorimetry
  • ⁇ G° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA.
  • oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ⁇ G° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length.
  • the degree or strength of hybridization is measured by the standard state Gibbs free energy ⁇ G°.
  • the oligonucleotides may hybridize to a target nucleic acid with estimated ⁇ G° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length.
  • the oligonucleotides hybridize to a target nucleic acid with an estimated ⁇ G° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or-16 to -27 kcal such as -18 to -25 kcal.
  • the target nucleic acid is a nucleic acid which encodes mammalian PD-L1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence.
  • the target may therefore be referred to as a PD-L1 target nucleic acid.
  • the oligonucleotide as described herein may for example target exon regions of a mammalian PD-L1, or may for example target intron region in the PD-L1 pre-mRNA (see Table 1).
  • Table 1 human PD-L1 Exons and Introns Exonic regions in the human PD-L1 premRNA (SEQ ID NO 1) Intronic regions in the human PD-L1 premRNA (SEQ ID NO 1) ID start end ID start end e1 1 94 i1 95 5597 e2 5598 5663 i2 5664 6576 e3 6577 6918 i3 6919 12331 e4 12332 12736 i4 12737 14996 e5 14997 15410 i5 15411 16267 e6 16268 16327 i6 16328 17337 e7 17338 20064
  • the target nucleic acid encodes a PD-L1 protein, in particular mammalian PD-L1, such as human PD-L1 (See for example tables 2 and 3, which provide reference to the mRNA and pre-mRNA sequences for human, monkey, and mouse PD-L1).
  • pre-mRNA is also considered as a nucleic acid that encodes a protein.
  • the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2 and 3 or naturally occurring variants thereof (e.g. sequences encoding a mammalian PD-L1 protein).
  • the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
  • the oligonucleotide of the invention is typically capable of inhibiting the expression of the PD-L1 target nucleic acid in a cell which is expressing the PD-L1 target nucleic acid.
  • the contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the PD-L1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g.
  • the target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA.
  • the target nucleic acid is a RNA or DNA which encodes mammalian PD-L1 protein, such as human PD-L1, e.g. the human PD-L1 premRNA sequence, such as that disclosed as SEQ ID NO 1 or the human mRNA sequence with NCBI reference number NM_014143. Further information on exemplary target nucleic acids is provided in tables 2 and 3. Table 2: Genome and assembly information for PD-L1 across species. Species Chr.
  • the genome coordinates provide the pre-mRNA sequence (genomic sequence).
  • the NCBI reference provides the mRNA sequence (cDNA sequence).
  • RNA type Length SEQ ID NO Human premRNA 20064 1 Monkey Cyno premRNA GCF ref 20261 2 Monkey Cyno premRNA Internal 20340 3 Mouse premRNA 20641 4
  • target sequence refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention.
  • the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention.
  • the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention.
  • the target sequence may be a sub-sequence of the target nucleic acid.
  • the sub-sequence is a sequence selected from the group consisting of a1-a149 (see tables 4). In some embodiments the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA exon, such as a PD-L1 human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, and e7 (see table 1 above).
  • the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA intron, such as a PD-L1 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5 and i6 (see table 1 above).
  • the oligonucleotide as described herein comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a sub-sequence of the target nucleic acid, such as a target sequence described herein.
  • the oligonucleotide as described herein comprises a contiguous nucleotide sequence of at least 8 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule.
  • the contiguous nucleotide sequence (and therefore the target sequence) comprises of at least 8 contiguous nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as from 12-25, such as from 14-18 contiguous nucleotides.
  • target cell refers to a cell which is expressing the target nucleic acid. As described herein the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell.
  • rodent cell such as a mouse cell or a rat cell
  • primate cell such as a monkey cell or a human cell.
  • the target cell expresses PD-L1 mRNA, such as the PD-L1 pre-mRNA or PD-L1 mature mRNA.
  • PD-L1 mRNA such as the PD-L1 pre-mRNA or PD-L1 mature mRNA.
  • the poly A tail of PD-L1 mRNA is typically disregarded for antisense oligonucleotide targeting.
  • naturally occurring variant refers to variants of PD-L1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
  • the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian PD-L1 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO 1, 2 and 3.
  • modulation of expression is to be understood as an overall term for an oligonucleotide's ability to alter the amount of PD-L1 when compared to the amount of PD-L1 before administration of the oligonucleotide.
  • modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock). It may however also be an individual treated with the standard of care.
  • modulation is an oligonucleotide's ability to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of PD-L1, e.g. by degradation of mRNA or blockage of transcription.
  • modulation is an oligonucleotide's ability to restore, increase or enhance expression of PD-L1, e.g. by repair of splice sites or prevention of splicing or removal or blockage of inhibitory mechanisms such as microRNA repression.
  • a high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (T m ).
  • a high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside.
  • Numerous high affinity modified nucleosides are known in the art and include for example, many 2' substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213 ).
  • the oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
  • nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
  • Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA).
  • HNA hexose ring
  • LNA ribose ring
  • UPA unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons
  • Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids ( WO2011/017521 ) or tricyclic nucleic acids ( WO2013/154798 ). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example
  • Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions.
  • Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. Indeed, much focus has been spent on developing 2' substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.
  • a 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradicle, and includes 2' substituted nucleosides and LNA (2' - 4' biradicle bridged) nucleosides.
  • the 2' modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide.
  • 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleoside.
  • MOE 2'-O-methoxyethyl-RNA
  • 2'-amino-DNA 2'-Fluoro-RNA
  • 2'-F-ANA nucleoside examples of 2' substituted modified nucleosides.
  • LNA Locked Nucleic Acid Nucleosides
  • LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2' and C4' of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.
  • a linker group referred to as a biradicle or a bridge
  • BNA bicyclic nucleic acid
  • the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II:
  • -X-Y- designates -O-CH 2 - or -O-CH(CH 3 )-.
  • Z is selected from -O-, -S-, and -N(R a )-
  • R a and, when present R b each is independently selected from hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -alkynyl, hydroxy, optionally substituted C 1-6 -alkoxy, C 2-6 -alkoxyalkyl, C 2-6 -alkenyloxy, carboxy, c 1-6 -alkoxycarbonyl, C 1-6 -alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C 1-6 -alkyl,
  • R 1 , R 2 , R 3 , R 5 and R 5* are independently selected from the group consisting of: hydrogen, optionally substituted C 1-6 -alkyl, optionally substituted C 2-6 -alkenyl, optionally substituted C 2-6 -alkynyl, hydroxy, C 1-6 -alkoxy, C 2-6 -alkoxyalkyl, C 2-6 -alkenyloxy, carboxy, C 1-6 -alkoxycarbonyl, C 1-6 -alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C 1-6 -alkyl)amino, carbamoyl, mono- and di(C 1-6 -alkyl)-amino-carbonyl, amino-C 1-6 -alkylaminocarbonyl,
  • R 1 , R 2 , R 3 , R 5 and R 5* are independently selected from C 1-6 alkyl, such as methyl, and hydrogen.
  • R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R 1 , R 2 , R 3 are all hydrogen, and either R 5 and R 5* is also hydrogen and the other of R 5 and R 5* is other than hydrogen, such as C 1-6 alkyl such as methyl.
  • R a is either hydrogen or methyl. In some embodiments, when present, R b is either hydrogen or methyl.
  • R a and R b is hydrogen
  • one of R a and R b is hydrogen and the other is other than hydrogen
  • one of R a and R b is methyl and the other is hydrogen
  • both of R a and R b are methyl.
  • the biradicle -X-Y- is -O-CH 2 -
  • W is O
  • all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • LNA nucleosides are disclosed in WO99/014226 , WO00/66604 , WO98/039352 and WO2004/046160 and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides.
  • the biradicle -X-Y- is -S-CH 2 -, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • Such thio LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 .
  • the biradicle -X-Y- is -NH-CH 2 -
  • W is O
  • all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • amino LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 .
  • the biradicle -X-Y- is -O-CH 2 -CH 2 - or -O-CH 2 -CH 2 - CH 2 -
  • W is O
  • all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • LNA nucleosides are disclosed in WO00/047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76 and include what are commonly known as 2'-O-4'C-ethylene bridged nucleic acids (ENA).
  • the biradicle -X-Y- is -O-CH 2 -
  • W is O
  • all of R 1 , R 2 , R 3 , and one of R 5 and R 5* are hydrogen
  • the other of R 5 and R 5* is other than hydrogen such as C 1-6 alkyl, such as methyl.
  • Such 5' substituted LNA nucleosides are disclosed in WO2007/134181 .
  • the biradicle -X-Y- is -O-CR a R b -, wherein one or both of R a and R b are other than hydrogen, such as methyl, W is O, and all of R 1 , R 2 , R 3 , and one of R 5 and R 5* are hydrogen, and the other of R 5 and R 5* is other than hydrogen such as C 1-6 alkyl, such as methyl.
  • R a and R b are other than hydrogen, such as methyl
  • W is O
  • all of R 1 , R 2 , R 3 , and one of R 5 and R 5* are hydrogen
  • the other of R 5 and R 5* is other than hydrogen such as C 1-6 alkyl, such as methyl.
  • Such bis modified LNA nucleosides are disclosed in WO2010/077578 .
  • the biradicle -X-Y- designate the bivalent linker group -O-CH(CH 2 OCH 3 )- (2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81 ). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH 2 CH 3 )- (2'O-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81 ).
  • the biradicle -X-Y- is -O-CHR a -
  • W is O
  • all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • Such 6' substituted LNA nucleosides are disclosed in WO10036698 and WO07090071 .
  • the biradicle -X-Y- is -O-CH(CH 2 OCH 3 )-, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071 .
  • the biradicle -X-Y- designate the bivalent linker group -O-CH(CH 3 )-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-CH 2 -O-CH 2 - ( Seth at al., 2010, J. Org. Chem ). In some embodiments, the biradicle -X-Y- is -O-CH(CH 3 )-, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • Such 6' methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010/036698 (alpha-L).
  • the biradicle -X-Y- is -O-CR a R b -, wherein in neither R a or R b is hydrogen, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a and R b are both methyl.
  • Such 6' di-substituted LNA nucleosides are disclosed in WO 2009006478 .
  • the biradicle -X-Y- is -S-CHR a -
  • W is O
  • all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a is methyl.
  • vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 .
  • the biradicle -X-Y- is -N(-OR a )-, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a is C 1-6 alkyl such as methyl.
  • Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008/150729 .
  • the biradicle -X-Y- together designate the bivalent linker group -O-NR a -CH 3 -( Seth at al., 2010, J. Org. Chem ).
  • the biradicle -X-Y- is -N(R a )-, W is O, and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a is C 1-6 alkyl such as methyl.
  • R 5 and R 5* is hydrogen and, when substituted the other of R 5 and R 5* is C 1-6 alkyl such as methyl.
  • R 1 , R 2 , R 3 may all be hydrogen, and the biradicle -X-Y- may be selected from -O-CH2- or -O-C(HCR a )-, such as -O-C(HCH3)-.
  • the biradicle is -CR a R b -O-CR a R b -, such as CH 2 -O-CH 2 -, W is O and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a is C 1-6 alkyl such as methyl.
  • LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 .
  • the biradicle is -O-CR a R b -O-CR a R b -, such as O-CH 2 -O-CH 2 -, W is O and all of R 1 , R 2 , R 3 , R 5 and R 5* are all hydrogen.
  • R a is C 1-6 alkyl such as methyl.
  • Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238 .
  • the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides.
  • Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.
  • the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H.
  • RNase endoribonuclease
  • oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.
  • the RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule.
  • WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH.
  • an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 .
  • gapmer refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5' and 3' by regions which comprise one or more affinity enhancing modified nucleosides (flanks or wings).
  • oligonucleotides capable of recruiting RNase H where one of the flanks is missing, i.e. only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides.
  • the 3' flank is missing (i.e. the 5' flank comprises affinity enhancing modified nucleosides) and for tailmers the 5' flank is missing (i.e. the 3' flank comprises affinity enhancing modified nucleosides).
  • LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside.
  • mixed wing gapmer or mixed flank gapmer refers to a LNA gapmer wherein at least one of the flank regions comprise at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA and 2'-F-ANA nucleoside(s).
  • the mixed wing gapmer has one flank which comprises only LNA nucleosides (e.g. 5' or 3') and the other flank (3' or 5' respectfully) comprises 2' substituted modified nucleoside(s) and optionally LNA nucleosides.
  • gapbreaker oligonucleotide is used in relation to a gapmer capable of maintaining RNAseH recruitment even though the gap region is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker nucleoside, E) such that the gap region comprise less than 5 consecutive DNA nucleosides.
  • Non-RNaseH recruiting nucleosides are for example nucleosides in the 3' endo conformation, such as LNA's where the bridge between C2' and C4' of the ribose sugar ring of a nucleoside is in the beta conformation, such as beta-D-oxy LNA or ScET nucleoside.
  • gapbreaker oligonucleotide to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487 , which discloses "gapbreaker" oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA.
  • the oligonucleotide of the invention described herein may be a gapbreaker oligonucleotide.
  • the gapbreaker oligonucleotide may comprise a 5'-flank (F), a gap (G) and a 3'-flank (F'), wherein the gap is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker nucleoside, E) such that the gap contain at least 3 or 4 consecutive DNA nucleosides.
  • the gapbreaker nucleoside (E) may be an LNA nucleoside where the bridge between C2' and C4' of the ribose sugar ring of a nucleoside is in the beta conformation and is placed within the gap region such that the gap-breaker LNA nucleoside is flanked 5' and 3' by at least 3 (5') and 3 (3') or at least 3 (5') and 4 (3') or at least 4(5') and 3(3') DNA nucleosides, and wherein the oligonucleotide is capable of recruiting RNaseH.
  • the gapbreaker oligonucleotide can be represented by the following formulae:
  • the gapbreaker nucleoside (E) is a beta-D-oxy LNA or ScET or another beta-LNA nucleosides shown in Scheme 1).
  • conjugate refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region), also termed a oligonucleotide conjugate.
  • Conjugation of the oligonucleotides of the invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g. by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotide.
  • the conjugate moiety targets the oligonucleotide to the liver. A the same time the conjugate serve to reduce activity of the oligonucleotide in non-target cell types, tissues or organs, e.g. off target activity or activity in non-target cell types, tissues or organs.
  • the oligonucleotide conjugate of the invention display improved inhibition of PD-L1 in the target cell when compared to an unconjugated oligonucleotide.
  • the oligonucleotide conjugate of the invention has improved cellular distribution between liver and other organs, such as spleen or kidney (i.e. more conjugated oligonucleotide goes to the liver than the spleen or kidney) when compared to an unconjugated oligonucleotide.
  • the oligonucleotide conjugate of the invention show improved cellular uptake into the liver of the conjugate oligonucleotide when compared to an unconjugated oligonucleotide.
  • WO 93/07883 and WO2013/033230 provides suitable conjugate moieties.
  • Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr).
  • ASGPr asialoglycoprotein receptor
  • tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the the ASGPr, see for example WO 2014/076196 , WO 2014/207232 and WO 2014/179620 .
  • the conjugate moiety is essentially the part of the antisense oligonucleotides conjugates which is not composed of nucleic acids.
  • Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103 .
  • the non-nucleotide moiety is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.
  • a linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds.
  • Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether).
  • Linkers serve to covalently connect a third region, e.g. a conjugate moiety (Region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).
  • the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
  • a linker region second region or region B and/or region Y
  • Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body.
  • Conditions under which physiologically labile linkers undergo chemical transformation include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells.
  • Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases.
  • the biocleavable linker is susceptible to S1 nuclease cleavage.
  • the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages.
  • the nucleosides are DNA or RNA.
  • Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195 .
  • Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region).
  • the region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups
  • the oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C.
  • the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group.
  • treatment refers to both treatment of an existing disease (e.g . a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.
  • the immune response is divided into the innate and adaptive immune response.
  • the innate immune system provides an immediate, but non-specific response.
  • the adaptive immune response is activated by innate immune response and is highly specific to a particular pathogen.
  • immune cells of the adaptive immune response i.e. T and B lymphocytes
  • T and B lymphocytes Upon presentation of a pathogen-derived antigen on the surface of antigen-presenting cells, immune cells of the adaptive immune response (i.e. T and B lymphocytes) are activated through their antigen-specific receptors leading to a pathogenic-specifc immune response and development of immunological memory.
  • Chronic viral infections, such as HBV and HCV are associated with T cell exhaustion characterized by unresponsiveness of the viral-specific T cells. T cell exhaustion is well studied, for a review see for example Yi et al 2010 Immunology129, 474-481 .
  • Chronic viral infections are also associated with reduced function of NK cells that are innate immune cells. Enhancing viral immune response is important for clearance of chronic infection. Restoration of immune response against pathogens, mediated by T cells and NK cells, can be assessed by measurement of proliferation, cytokine secretion and cytolytic function ( Dolina et al. 2013 Molecular Therapy-Nucleic Acids, 2 e72 and Example 6 herein).
  • the present invention relates to the use of antisense oligonucleotides and conjugates thereof and pharmaceutical compositions comprising these to restore immune response against pathogens that have infected an animal, in particular a human.
  • the antisense oligonucleotide conjugates of the present invention are particular useful against pathogens that have infected the liver, in particular chronic liver infections like HBV.
  • the conjugates allow targeted distribution of the oligonucleotides and prevents systemic knockdown of the target nucleic acid.
  • the invention relates to oligonucleotides capable of modulating expression of PD-L1.
  • the modulation is may achieved by hybridizing to a target nucleic acid encoding PD-L1 or which is involved in the regulation of PD-L1.
  • the target nucleic acid may be a mammalian PD-L1 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3.
  • the target nucleic acid may be a pre-mRNA, an mRNA or any RNA sequence expressed from a mammalian cell that supports the expression or regulation of PD-L1.
  • the oligonucleotide of the invention is an antisense oligonucleotide which targets PD-L1.
  • the oligonucleotide of the invention is conjugated to a conjugate moiety, in particular an asialoglycoprotein receptor targeting conjugate moiety.
  • the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it.
  • modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target.
  • such modulation produces an inhibition of expression of at least 20% compared to the expression level when the cell or organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an infectious agent (eg poly I:C or LPS), more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the expression level when the cell or organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an infectious agent (eg poly I:C or LPS).
  • the oligonucleotide of the invention may be capable of inhibiting expression levels of PD-L1 mRNA by at least 60% or 70% in vitro using KARPAS-299 or THP1 cells.
  • compounds of the invention may be capable of inhibiting expression levels of PD-L1 protein by at least 50% in vitro using KARPAS-299 or THP1 cells.
  • the examples provide assays which may be used to measure PD-L1 RNA (e.g. example 1).
  • the target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid.
  • the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches, hybridization to the target nucleic acid may still be sufficient to show a desired modulation of PD-L1 expression.
  • Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2' modified nucleosides, including LNA, present within the oligonucleotide sequence.
  • the antisense oligonucleotide of the invention is capable of restoring pathogen-specific T cells. In some embodiments, the oligonucleotide of the invention is capable of increasing the pathogen-specific T cells by at least 40%, 50%, 60% or 70% when compared to untreated controls or controls treated with standard of care. In one embodiment the antisense oligonucleotide or conjugate of the invention is capable increasing HBV-specific T cells when compared to untreated controls or controls treated with standard of care.
  • the examples provide assays which may be used to measure the HBV-specific T cells (e.g. T cell proliferation, cytokine secretion and cytolytic activity).
  • the antisense oligonucleotide or conjugate of the invention is capable increasing HCV-specific T cells when compared to untreated controls or controls treated with standard of care. In another embodiment the antisense oligonucleotide or conjugate of the invention is capable increasing HDV-specific T cells when compared to untreated controls or controls treated with standard of care.
  • the antisense oligonucleotide of the invention is capable reducing HBsAg levels in an animal or human. In some embodiments, the oligonucleotide of the invention is capable of reducing the HBsAg levels by at least 40%, 50%, 60% or 70%, more preferably by at least 80%, 90% or 95% when compared to the level prior to treatment. Most preferably oligonucleotides of the invention are capable of achieving seroconversion of HBsAg in an animal or human infected with HBV.
  • an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid.
  • the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid.
  • the oligonucleotide of the invention is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
  • the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%) complementary, to a region target nucleic acid region present in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 2.
  • the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 3.
  • the oligonucleotide or oligonucleotide conjugate comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid selected from the group consisting of position 371-3068, 5467-12107 and 15317-19511 on SEQ ID NO: 1.
  • the sub-sequence of the target nucleic acid is selected from the group consisting of position 371-510, 822-1090, 1992-3068, 5467-5606, 6470-12107, 15317-15720, 15317-18083, 18881-19494 and 1881-19494 on SEQ ID NO: 1.
  • the sub-sequence of the target nucleic acid is selected from the group consisting of position 7300-7333, 8028-8072, 9812-9859, 11787-11873 and 15690-15735 on SEQ ID NO: 1.
  • the oligonucleotide or oligonucleotide conjugate comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region present in SEQ ID NO: 1, wherein the target nucleic acid region is selected from the group consisting of region a1 to a449 in table 4.
  • Table 4 Regions of SEQ ID NO 1 which may be targeted using oligonucleotide as described herein Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg.
  • the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of a7, a26, a43, a119, a142, a159, a160, a163, a169, a178, a179, a180, a189, a201, a202, a204, a214, a221, a224, a226, a243, a254, a258, 269, a274, a350, a360, a364, a365, a370, a372, a381, a383, a386, a389, a400, a427, a435 and a438.
  • the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of a160, a180, a221, a269 and a360.
  • the oligonucleotide of the invention comprises or consists of 8 to 35 nucleotides in length, such as from 9 to 30, such as 10 to 22, such as from 11 to 20, such as from 12 to 18, such as from 13 to 17 or 14 to 16 contiguous nucleotides in length.
  • the oligonucleotide comprises or consists of 16 to 20 nucleotides in length. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included.
  • the contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length.
  • the oligonucleotide comprises or consists of 16, 17, 18, 19 or 20 nucleotides in length.
  • the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences listed in table 5.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 (see motif sequences listed in table 5).
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 and 771.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 6, 8, 9, 13, 41, 42, 58, 77, 92, 111, 128, 151, 164, 166, 169, 171, 222, 233, 245, 246, 250, 251, 252, 256, 272, 273, 287, 292, 303, 314, 318, 320, 324, 336, 342, 343, 344, 345, 346, 349, 359, 360, 374, 408, 409, 415, 417, 424, 429, 430, 458, 464, 466, 474, 490, 493, 512, 519, 519, 529, 533, 534, 547, 566, 567, 578, 582, 601, 619, 620, 636,
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 287.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 342.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 640.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 466.
  • the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 566.
  • the motif sequences in table 5 form the contigious nucleotide sequence part of the antisense oligonucleotides of the invention.
  • the sequence of the oligonucleotide is equivalent to the contigious nucleotide sequence (e.g. if no biocleavable linkers are added).
  • contiguous nucleobase sequences can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid. Modifications are described in the definitions and in the "Oligonucleotide design" section. Table 5 lists preferred designs of each motif sequence.
  • Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence.
  • the oligonucleotides as described herein comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides.
  • the oligonucleotide described herein comprises sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotide described herein may enhance the affinity of the oligonucleotide for the target nucleic acid.
  • the modified nucleosides can be referred to as affinity enhancing modified nucleotides, the modified nucleosides may also be termed units.
  • the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides.
  • the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 8 modified nucleosides, such as from 3 to 7 modified nucleosides, such as from 4 to 6 modified nucleosides, such as 3, 4, 5, 6 or 7 modified nucleosides.
  • the oligonucleotide comprises one or more sugar modified nucleosides, such as 2' sugar modified nucleosides.
  • the oligonucleotide described herein comprise the one or more 2' sugar modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.
  • the one or more modified nucleoside is a locked nucleic acid (LNA).
  • the oligonucleotide comprises at least one modified internucleoside linkage.
  • all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages.
  • all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages.
  • the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as from 2 to 6 LNA nucleosides, such as from 3 to 7 LNA nucleosides, 4 to 6 LNA nucleosides or 3, 4, 5, 6 or 7 LNA nucleosides.
  • at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides.
  • the modified nucleosides in the oligonucleotide are LNA nucleosides.
  • the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, and/or ENA in either the beta-D or alpha-L configurations or combinations thereof.
  • all LNA cytosine units are 5-methyl-cytosine.
  • the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA nucleoside at the 5' end and at least 2 LNA nucleosides at the 3' end of the nucleotide sequence.
  • the oligonucleotide of the invention comprises at least one modified nucleoside which is a 2'-MOE-RNA nucleoside, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-MOE-RNA nucleosides.
  • at least one of said modified nucleoside is 2'-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-fluoro-DNA nucleosides.
  • the oligonucleotide as described herein comprises at least one LNA nucleoside and at least one 2' substituted modified nucleoside.
  • the oligonucleotide comprise both 2' sugar modified nucleosides and DNA units.
  • the oligonucleotide comprises both LNA and DNA nucleosides (units).
  • the combined total of LNA and DNA units is 8-30, such as 10 - 25, preferably 12-22, such as 12 - 18, even more preferably 11-16.
  • the nucleotide sequence of the oligonucleotide such as the contiguous nucleotide sequence consists of at least one or two LNA nucleosides and the remaining nucleosides are DNA units.
  • the oligonucleotide comprises only LNA nucleosides and naturally occurring nucleosides (such as RNA or DNA, most preferably DNA nucleosides), optionally with modified internucleoside linkages such as phosphorothioate.
  • the oligonucleotide of the invention is capable of recruiting RNase H.
  • the structural design of the oligonucleotide as described herein may be selected from gapmers, gapbreakers, headmers and tailmers.
  • the oligonucleotide of the invention has a gapmer design or structure also referred herein merely as "Gapmer".
  • Gapmer the oligonucleotide comprises at least three distinct structural regions a 5'-flank, a gap and a 3'-flank, F-G-F' in '5 -> 3' orientation.
  • flanking regions F and F' (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the PD-L1 target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the oligonucleotide is in duplex with the target nucleic acid.
  • Nucleosides which are capable of recruiting a nuclease, in particular RNase H can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2'-Flouro-ANA and UNA.
  • Regions F and F', flanking the 5' and 3' ends of region G preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3' endo structure), more preferably one or more affinity enhancing modified nucleosides.
  • the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides.
  • the 5' flank comprises at least one LNA nucleoside.
  • both the 5' and 3' flanking regions comprise a LNA nucleoside.
  • all the nucleosides in the flanking regions are LNA nucleosides.
  • flanking regions may comprise both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and/or non-LNA modified nucleosides, such as 2' substituted nucleosides.
  • the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2' endo structure, preferably DNA) flanked at the 5' and 3' end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA. Consequently, the nucleosides of the 5' flanking region and the 3' flanking region which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides.
  • Region F (5' flank or 5' wing) attached to the '5 end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides.
  • region F comprises or consists of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleosides, such as from 2 to 5 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1, 2, 3 or 4 modified nucleosides.
  • the F region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.
  • the modified nucleosides in region F have a 3' endo structure.
  • one or more of the modified nucleosides in region F are 2' modified nucleosides. As described herein all the nucleosides in Region F are 2' modified nucleosides.
  • region F comprises DNA and/or RNA in addition to the 2' modified nucleosides.
  • Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3' end (adjacent to the G region) of the F region.
  • the region F comprise DNA nucleosides, such as from 1 to 3 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides.
  • the DNA nucleosides in the flanks should preferably not be able to recruit RNase H.
  • flanks in the F region alternate with 1 to 3 2' modified nucleosides and 1 to 3 DNA and/or RNA nucleosides.
  • flanks can also be termed alternating flanks.
  • the length of the 5' flank (region F) in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides.
  • region F with alternating nucleosides are 2' 1-3 -N' 1-4 -2' 1-3 2' 1-2 -N' 1-2 -2' 1-2 -N' 1-2 -2' 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2
  • 2' indicates a modified nucleoside and N' is a RNA or DNA.
  • all the modified nucleosides in the alternating flanks are LNA and the N' is DNA.
  • one or more of the 2' modified nucleosides in region F are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.
  • the F region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.
  • all the modified nucleosides in region F are LNA nucleosides.
  • all the nucleosides in Region F are LNA nucleosides.
  • the LNA nucleosides in region F are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof.
  • region F comprise at least 1 beta-D-oxy LNA unit, at the 5' end of the contiguous sequence.
  • Region G preferably comprise, contain or consist of at least 4, such as at least 5, such as at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 consecutive nucleosides capable of recruiting the aforementioned nuclease, in particular RNaseH.
  • region G comprise, contain or consist of from 5 to 12, or from 6 to 10 or from 7 to 9, such as 8 consecutive nucleotide units capable of recruiting aforementioned nuclease.
  • the nucleoside units in region G which are capable of recruiting nuclease are as described hereinselected from the group consisting of DNA, alpha-L-LNA, C4' alkylated DNA (as described in PCT/EP2009/050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300 ), arabinose derived nucleosides like ANA and 2'F-ANA ( Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661 ), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 ). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked "sugar" residue.
  • At least one nucleoside unit in region G is a DNA nucleoside unit, such as from 1 to 18 DNA units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16 or 17 DNA units, preferably from 2 to 17 DNA units, such as from 3 to 16 DNA units, such as from 4 to 15 DNA units.
  • DNA nucleoside unit such as from 1 to 18 DNA units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16 or 17 DNA units, preferably from 2 to 17 DNA units, such as from 3 to 16 DNA units, such as from 4 to 15 DNA units.
  • 5 to 14 DNA units such as from 6 to 13 DNA units, such as from 7 to 12 DNA units, such as from 8 to 11 DNA units, more preferably from units 8 to 17 DNA units, or from 9 to 16 DNA units, 10 to 15 DNA units or 11 to 13 DNA units, such as 8, 9, 10, 11, 12, 13, 14, 154, 16, 17 DNA units.
  • region G consists of 100% DNA units.
  • region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage.
  • Region G may consist of at least 50% DNA, more preferably 60 %, 70% or 80 % DNA, and even more preferred 90% or 95% DNA.
  • At least one nucleoside unit in region G is an alpha-L-LNA nucleoside unit, such as at least one alpha-L-LNA, such as 2, 3, 4, 5, 6, 7, 8 or 9 alpha-L-LNA.
  • region G comprises the least one alpha-L-LNA is alpha-L-oxy-LNA.
  • region G comprises a combination of DNA and alpha-L-LNA nucleoside units.
  • nucleosides in region G have a 2' endo structure.
  • region G may comprise a gapbreaker nucleoside, leading to a gapbreaker oligonucleotide, which is capable of recruiting RNase H.
  • Region F' (3' flank or 3' wing) attached to the '3 end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides.
  • F' comprise or consist of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleoside, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1, 2, 3 or 4 modified nucleosides.
  • the F' region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.
  • the modified nucleosides in region F' have a 3' endo structure.
  • one or more of the modified nucleosides in region F' are 2' modified nucleosides. As described herein all the nucleosides in Region F' are 2' modified nucleosides.
  • one or more of the modified nucleosides in region F' are 2' modified nucleosides.
  • region F' comprises DNA or RNA in addition to the 2' modified nucleosides.
  • Flanks comprising DNA or RNA are characterized by having a 2' modified nucleoside in the 5' end (adjacent to the G region) and the 3' end of the F' region.
  • region F' comprises DNA nucleosides, such as from 1 to 4 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides.
  • the DNA nucleosides in the flanks should preferably not be able to recruit RNase H.
  • the 2' modified nucleosides and DNA and/or RNA nucleosides in the F' region alternate with 1 to 3 2' modified nucleosides and 1 to 3 DNA and/or RNA nucleosides, such flanks can also be termed alternating flanks.
  • the length of the 3' flank (region F') in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides.
  • region F' with alternating nucleosides are 2' 1-2 -N' 1-4 -2' 1-4 2' 1-2 -N' 1-2 -2' 1-2 -N' 1-2 -2' 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2
  • modified nucleosides in region F' are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.
  • the F' region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.
  • all the modified nucleosides in region F' are LNA nucleosides. As described herein all the nucleosides in Region F' are LNA nucleosides. As described herein the LNA nucleosides in region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. As described herein region F' has at least 2 beta-D-oxy LNA unit, at the 3' end of the contiguous sequence.
  • Region D' and D" Region D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively. Region D' or D" are optional.
  • Region D' or D" may independently comprise 0 to 5, such as 1 to 5, such as 2 to 4, such as 0, 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid.
  • the oligonucleotide of the invention may in some embodiments comprise a contiguous nucleotide sequence capable of modulating the target which is flanked at the 5' and/or 3' end by additional nucleotides.
  • additional nucleotides may serve as a nuclease susceptible biocleavable linker (see definition of linkers).
  • the additional 5' and/or 3' end nucleosides are linked with phosphodiester linkages, and may be DNA or RNA.
  • the additional 5' and/or 3' end nucleosides are modified nucleosides which may for example be included to enhance nuclease stability or for ease of synthesis.
  • the oligonucleotide of the invention comprises a region D' and/or D" at the 5' or 3' end of the contiguous nucleotide sequence.
  • the D' and/or D" region is composed of 1 to 5 phosphodiester linked DNA or RNA nucleosides which are not complementary to the target nucleic acid.
  • the gapmer oligonucleotide of the present invention can be represented by the following formulae:
  • the oligonucleotide conjugates of the present invention have a region C covalently attached to either the 5' or 3' end of the oligonucleotide, in particular the gapmer oligonucleotides presented above.
  • the oligonucleotide conjugate of the invention comprises a oligonucleotide with the formula 5'-D'-F-G-F'-3' or 5'-F-G-F'-D"-3', where region F and F' independently comprise 1 - 7 modified nucleosides, G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH and region D' or D" comprise 1 - 5 phosphodiester linked nucleosides.
  • region D' or D" is present in the end of the oligonucleotide where conjugation to a conjugate moiety is contemplated.
  • oligonucleotides with alternating flanks can be represented by the following formulae: 2' 1-3 -N' 1-4 -2' 1-3 -G 6-12 -2' 1-2 -N' 1-4 -2' 1-4 2' 1-2 -N' 1-2 -2' 1-2 -N' 1-2 -2' 1-2 -G 6-12 -2' 1-2 -N' 1-2 -2' 1-2 -N' 1-2 -2' 1-2 1-2 F-G 6-12 -2' 1-2 -N' 1-4 -2' 1-4 F-G 6-12 -2' 1-2 -N' 1-2 -2' 1-2 -N' 1-2 -2' 1-2 1-2 1-2 2' 1-3 -N' 1-4 -2' 1-3 -G 6-12 -F' 2' 1-2 -N' 1-2 -2' 1-2 -N 1-2 -2' 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 1-2 2' 1-3 -N' 1-4 -2'
  • flank is indicated by F or F' it only contains 2' modified nucleosides, such as LNA nucleosides.
  • modified nucleosides such as LNA nucleosides.
  • the preferred number and types of nucleosides in the alternating regions, and region F, G and F', D' and D" have been described above.
  • the oligonucleotide is a gapmer consisting of 16, 17, 18, 19, 20, 21, 22 nucleotides in length, wherein each of regions F and F' independently consists of 1, 2, 3 or 4 modified nucleoside units complementary to the PD-L1 target nucleic acid and region G consists of 8, 9, 10, 11,12,13,14,15,16,17 nucleoside units, capable of recruiting nuclease when in duplex with the PD-L1 target nucleic acid and region D' consists of 2 phosphodiester linked DNAs.
  • the oligonucleotide is a gapmer wherein each of regions F and F' independently consists of 3, 4, 5 or 6 modified nucleoside units, such as nucleoside units containing a 2'-O-methoxyethyl-ribose sugar (2'-MOE) or nucleoside units containing a 2'-fluoro-deoxyribose sugar and/or LNA units, and region G consists of 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 nucleoside units, such as DNA units or other nuclease recruiting nucleosides such as alpha-L-LNA or a mixture of DNA and nuclease recruiting nucleosides.
  • 2'-MOE 2'-O-methoxyethyl-ribose sugar
  • region G consists of 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 nucleoside units, such as DNA units or other nuclease recruiting nucleosides such as alpha-L-LNA or a mixture of DNA
  • the oligonucleotide is a gapmer wherein each of regions F and F' region consists of two LNA units each, and region G consists of 12, 13, 14 nucleoside units, preferably DNA units.
  • Specific gapmer designs of this nature include 2-12-2, 2-13-2 and 2-14-2.
  • the oligonucleotide is a gapmer wherein each of regions F and F' independently consists of three LNA units, and region G consists of 8, 9, 10, 11, 12, 13 or 14 nucleoside units, preferably DNA units.
  • Specific gapmer designs of this nature include 3-8-3, 3-9-3 3-10-3, 3-11-3, 3-12-3, 3-13-3 and 3-14-3.
  • the oligonucleotide is a gapmer wherein each of regions F and F' consists of four LNA units each, and region G consists of 8 or 9, 10, 11 or 12 nucleoside units, preferably DNA units.
  • Specific gapmer designs of this nature include 4-8-4, 4-9-4, 4-10-4, 4-11-4 and 4-12-4.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 6 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-6-1, 1-6-2, 2-6-1, 1-6-3, 3-6-1, 1-6-4, 4-6-1, 2-6-2, 2-6-3, 3-6-2 2-6-4, 4-6-2, 3-6-3, 3-6-4 and 4-6-3 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 7 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-7-1, 2-7-1, 1-7-2, 1-7-3, 3-7-1, 1-7-4, 4-7-1, 2-7-2, 2-7-3, 3-7-2, 2-7-4, 4-7-2, 3-7-3, 3-7-4, 4-7-3 and 4-7-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 8 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-8-1, 1-8-2, 1-8-3, 3-8-1, 1-8-4, 4-8-1,2-8-1, 2-8-2, 2-8-3, 3-8-2, 2-8-4, , 4-8-2, 3-8-3, 3-8-4, 4-8-3 and 4-8-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 9 nucleosides and independently 1 to 4 modified nucleosides in the wings including, 1-9-1, 2-9-1, 1-9-2, 1-9-3, 3-9-1, 1-9-4, 4-9-1, 2-9-2, 2-9-3, 3-9-2, 2-9-4, 4-9-2, 3-9-3, 3-9-4, 4-9-3 and 4-9-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 10 nucleosides including, 1-10-1, 2-10-1, 1-10-2, 1-10-3, 3-10-1, 1-10-4, 4-10-1, 2-10-2, 2-10-3, 3-10-2, 2-10-4, 4-10-2, 3-10-3, 3-10-4, 4-10-3 and 4-10-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 11 nucleosides including, 1-11-1, 2-11-1, 1-11-2, 1-11-3, 3-11-1, 1-11-4, 4-11-1, 2-11-2, 2-11-3, 3-11-2, 2-11-4, 4-11-2, 3-11-3, 3-11-4, 4-11-3 and 4-11-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 12 nucleosides including, 1-12-1, 2-12-1, 1-12-2, 1-12-3, 3-12-1, 1-12-4, 4-12-1, 2-12-2, 2-12-3, 3-12-2, 2-12-4, 4-12-2, 3-12-3, 3-12-4, 4-12-3 and 4-12-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 13 nucleosides including, 1-13-1, 2-13-1, 1-13-2, 1-13-3, 3-13-1, 1-13-4, 4-13-1, 2-13-2, 2-13-3, 3-13-2, 2-13-4, 4-13-2, 3-13-3, 3-13-4, 4-13-3 and 4-13-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 14 nucleosides including, 1-14-1, 2-14-1, 1-14-2, 1-14-3, 3-14-1, 1-14-4, 4-14-1, 2-14-2, 2-14-3, 3-14-2, 2-14-4, 4-14-2, 3-14-3, 3-14-4, 4-14-3 and 4-14-4 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 15 nucleosides including, 1-15-1, 2-15-1, 1-15-2, 1-15-3, 3-15-1, 1-15-4, 4-15-1, 2-15-2, 2-15-3, 3-15-2, 2-15-4, 4-15-2 and 3-15-3 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 16 nucleosides including, 1-16-1, 2-16-1, 1-16-2, 1-16-3, 3-16-1, 1-16-4, 4-16-1, 2-16-2, 2-16-3, 3-16-2, 2-16-4, 4-16-2 and 3-16-3 gapmers.
  • gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 17 nucleosides including, 1-17-1, 2-17-1, 1-17-2, 1-17-3, 3-17-1, 1-17-4, 4-17-1, 2-17-2, 2-17-3 and 3-17-2 gapmers.
  • the F-G-F' design may further include region D' and/or D", which may have 1, 2 or 3 nucleoside units, such as DNA units, such as 2 phosphodiester linked DNA units.
  • region D' and/or D may have 1, 2 or 3 nucleoside units, such as DNA units, such as 2 phosphodiester linked DNA units.
  • the nucleosides in region F and F' are modified nucleosides, while nucleotides in region G are preferably unmodified nucleosides.
  • the preferred modified nucleoside is LNA.
  • internucleoside linkages in the gap in a gapmer are phosphorothioate and/or boranophosphate linkages.
  • all the internucleoside linkages in the flanks (F and F' region) in a gapmer are phosphorothioate and/or boranophosphate linkages.
  • all the internucleoside linkages in the D' and D" region in a gapmer are phosphodiester linkages.
  • cytosine (C) residues are annotated as 5-methyl-cytosine, as described herein, one or more of the Cs present in the oligonucleotide may be unmodified C residues.
  • the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 5_1 to 743_1 and 771_1.
  • the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO 6_1, 8_1, 9_1, 13_1, 41_1, 42_1, 58_1, 77_1, 92_1, 111_1, 128_1, 151_1, 164_1, 166_1, 169_1, 171_1, 222_1, 233_1, 245_1, 246_1, 250_1, 251_1, 252_1, 256_1, 272_1, 273_1, 287_1, 292_1, 303_1, 314_1, 318_1, 320_1, 324_1, 336_1, 342_1, 343_1, 344_1, 345_1, 346_1, 349_1, 359_1, 360_1, 374_1, 408_1, 409_1, 415_1, 417_1, 424_1, 429_1, 430_1, 458_1, 464_1, 466_1, 474_1, 490_1, 493_1, 512_
  • the oligonucleotide is CMP-ID-NO: 287_1.
  • the oligonucleotide is CMP-ID-NO: 342_1.
  • the oligonucleotide is CMP-ID-NO: 466_1.
  • the oligonucleotide is CMP-ID-NO: 566_1.
  • the contiguous nucleotide sequence of the oligonucleotide motifs and oligonucleotide compounds of the invention comprise two to four additional phosphodiester linked nucleosides at the 5' end of the contiguous nucleotide sequence (e.g. region D').
  • the nucleosides serve as a biocleavable linker (see sectionon biocleavable linkers).
  • a ca (cytidine-adenosine) dinucleotide is linked to the 5' end of contiguous nucleotide sequence (i.e.
  • the ca di nucleotide is not complementary to the target sequence at the position where the reminder of the contigious nucleotide is complementary.
  • oligonucleotide or contiguous nucleotide sequence is selected from the group consisting of the nucleotide motif sequences with SEQ ID NO: 766, 767, 768, 769 and 770.
  • the oligonucleotide is selected from the group consisting of the oligonucleotide compounds with CMP-ID-NO 766_1, 767_1, 768_1, 769_1 and 770_1.
  • Carbohydrate conjugate moieties include galactose, lactose, n-acetylgalactosamine, mannose and mannose-6-phosphate. Carbohydrate conjugates may be used to enhance delivery or activity in a range of tissues, such as liver and/or muscle. See, for example, EP1495769 , WO99/65925 , Yang et al., Bioconjug Chem (2009) 20(2): 213-21 . Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17 .
  • the carbohydrate conjugate moiety is multivalent, such as, for example 2, 3 or 4 identical or non-identical carbohydrate moieties may be covalently joined to the oligonucleotide, optionally via a linker or linkers.
  • the invention provides a conjugate comprising the oligonucleotide of the invention and a carbohydrate conjugate moiety.
  • the conjugate moiety is or may comprise mannose or mannose-6-phosphate. This is particular useful for targeting muscle cells, see for example US 2012/122801 .
  • Conjugate moieties capable of binding to the asialoglycoprotein receptor are particular useful for targeting hepatocytes in liver.
  • the invention provides a oligonucleotide conjugate comprising the oligonucleotide of the invention and an asialoglycoprotein receptor targeting conjugate moiety.
  • the asialoglycoprotein receptor targeting conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGr binding carbohydrate moieties) with affinity equal to or greater than that of galactose.
  • the affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271, 6686 ) or are readily determined using methods typical in the art.
  • an antisense oligonucleotide conjugate comprising a) an oligonucleotide (Region A) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid; and b) at least one asialoglycoprotein receptor targeting conjugate moiety (Region C) covalently attached to the oligonucleotide in a).
  • the oligonucleotide or a contiguous nucleotide sequence can be as described in any of the sections "oligonucleotides of the invention", “oligonucleotide design and "gapmer design”.
  • asialoglycoprotein receptor targeting conjugate moiety comprises at least one ASPGr binding carbohydrate moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine.
  • the asialoglycoprotein receptor targeting conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent (i.e. containing 1, 2, 3 or 4 terminal carbohydrate moieties capable of binding to the asialoglycoprotein receptor).
  • the asialoglycoprotein receptor targeting conjugate moiety is di-valent, even more preferred it is trivalent.
  • the asialoglycoprotein receptor targeting conjugate moiety comprises 1 to 3 N-acetylgalactosamine (GalNAc) moieties (also termed a GalNAc conjugate).
  • the oligonucleotide conjugate comprises a asialoglycoprotein receptor targeting conjugate moiety that is a tri-valent N-acetylgalactosamine (GalNAc) moiety.
  • GalNAc conjugates have been used with phosphodiester, methylphosphonate and PNA antisense oligonucleotides (e.g.
  • ASPGr binding carbohydrate moieties preferably GalNAc
  • the ASPGr binding carbohydrate moieties are preferably linked to the brancher molecule via spacers.
  • a preferred spacer is a flexible hydrophilic spacer ( U.S. Patent 5885968 ; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546 ).
  • a preferred flexible hydrophilic spacer is a PEG spacer.
  • a preferred PEG spacer is a PEG3 spacer (three ethylene units).
  • the brancher molecule can be any small molecule which permits attachment of two or three terminal ASPGr binding carbohydrate moieties and further permits attachment of the branch point to the oligonucleotide.
  • An exemplary brancher molecule is a di-lysine.
  • a di-lysine molecule contains three amine groups through which three ASPGr binding carbohydrate moieties may be attached and a carboxyl reactive group through which the di-lysine may be attached to the oligonucleotide.
  • Alternative brancher molecules may be a doubler or trebler such as those supplied by Glen Research.
  • the brancher may be selected from the from the group consisting of 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (Glen Research Catalogue Number: 10-1920-xx), tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1922-xx), tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 1-[5-(4,4'-d
  • WO 2014/179620 and PCT application No. PCT/EP2015/073331 describes the generation of various GalNAc conjugate moieties.
  • One or more linkers may be inserted between the brancher molecule and the oligonucleotide.
  • the linker is a biocleavable linker.
  • the linker may be selected from the linkers described in the section "Linkers" and its subsections.
  • the asialoglycoprotein receptor targeting conjugate moiety in particular the GalNAc conjugate moiety, may be attached to the 3'- or 5'-end of the oligonucleotide using methods known in the art. In preferred embodiments the asialoglycoprotein receptor targeting conjugate moiety is linked to the 5'-end of the oligonucleotide.
  • the carbohydrate conjugate moiety comprises a pharmacokinetic modulator selected from the group consisting of a hydrophobic group having 16 or more carbon atoms, hydrophobic group having 16-20 carbon atoms, palmitoyl, hexadec-8-enoyl, oleyl, (9E,12E)-octadeca-9,12dienoyl, dioctanoyl, and C16-C20 acyl, and cholesterol.
  • the pharmacokinetic modulator containing carbohydrate conjugate moiety is a GalNAc conjugate.
  • Preferred carbohydrate conjugate moieties comprises one to three terminal ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moiety(s).
  • the carbohydrate conjugate moiety comprises three ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moieties, linked via a spacer to a brancher molecule.
  • the spacer molecule can be between 8 and 30 atoms long.
  • a preferred carbohydrate conjugate moiety comprises three terminal GalNAc moieties linked via a PEG spacer to a di-lysine brancher molecule.
  • the PEG spacer is a 3PEG spacer.
  • Suitable asialoglycoprotein receptor targeting conjugate moieties are shown in Figure 1 .
  • a preferred asialoglycoprotein receptor targeting conjugate moiety is shown in figure 3 .
  • GalNAc conjugate moieties can include, for example, small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297 ); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214 ); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor).
  • small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that
  • the antisense oligonucleotide conjugate is selected from the group consisting of the following CPM ID NO: 766_2, 767 2, 768_2, 769_2 and 770_2.
  • antisense oligonucleotide conjugate corresponds to the compound represented in figure 4 .
  • antisense oligonucleotide conjugate corresponds to the compound represented in figure 5 .
  • the antisense oligonucleotide conjugate corresponds to the compound represented in figure 6 .
  • antisense oligonucleotide conjugate corresponds to the compound represented in figure 7 .
  • antisense oligonucleotide conjugate corresponds to the compound represented in figure 8 .
  • a conjugate is often associated with enhanced pharmacokinetic or pharmeodynamic dynamic properties.
  • the presence of a conjugate moiety may interfere with the activity of the oligonucleotide against its intended target, for example via steric hindrance preventing hybridization or nuclease recruitment (e.g. RNAseH).
  • a physiologically labile bond biocleavable linker
  • region A or first region the oligonucleotide
  • the conjugate moiety region C or third region
  • Cleavage of the physiologically labile bond occurs spontaneously when a molecule containing the labile bond reaches an appropriate intra-and/or extra-cellular environment.
  • a pH labile bond may be cleaved when the molecule enters an acidified endosome.
  • a pH labile bond may be considered to be an endosomal cleavable bond.
  • Enzyme cleavable bonds may be cleaved when exposed to enzymes such as those present in an endosome or lysosome or in the cytoplasm.
  • a disulfide bond may be cleaved when the molecule enters the more reducing environment of the cell cytoplasm.
  • a disulfide may be considered to be a cytoplasmic cleavable bond.
  • a pH-labile bond is a labile bond that is selectively broken under acidic conditions (pH ⁇ 7). Such bonds may also be termed endosomally labile bonds, since cell endosomes and lysosomes have a pH less than 7.
  • the cleavage rate seen in the target tissue is greater than that found in blood serum.
  • Suitable methods for determining the level (%) of cleavage in target tissue versus serum or cleavage by S1 nuclease are described in the "Materials and methods" section.
  • the biocleavable linker (also referred to as the physiologically labile linker, or nuclease susceptible linker or region B), in a conjugate of the invention, is at least about 20% cleaved, such as at least about 30% cleaved, such as at least about 40% cleaved, such as at least about 50% cleaved, such as at least about 60% cleaved, such as at least about 70% cleaved, such as at least about 75% cleaved when compared against a standard.
  • the oligonucleotide conjugate comprises three regions: i) a first region (region A), which comprises 10 - 25 contiguous nucleotides complementary to the target nucleic acid; ii) a second region (region B) which comprises a biocleavable linker and iii) a third region (region C) which comprises a conjugate moiety, such as an asialoglycoprotein receptor targeting conjugate moiety, wherein the third region is covalent linked to the second region which is covalently linked to the first region.
  • region A a first region
  • region B which comprises a biocleavable linker
  • region C which comprises a conjugate moiety, such as an asialoglycoprotein receptor targeting conjugate moiety
  • the oligonucleotide conjugate comprises a biocleavable linker (Region B) between the contiguous nucleotide sequence (region A) and the asialoglycoprotein receptor targeting conjugate moiety (region C).
  • the biocleavable linker may be situated either at the 5' end and/or the 3'-end of the contiguous nucleotides complementary to the target nucleic acid (region A). In a preferred embodiment the biocleavable linker is at the 5'-end.
  • the cleavable linker is susceptible to nuclease(s) which may for example, be expressed in the target cell.
  • the biocleavable linker is composed of 2 to 5 consecutive phosphodiester linkages.
  • the linker may be a short region (e.g. 1 - 10 as detailed in the definition of linkers) phosphodiester linked nucleosides.
  • the nucleosides in the biocleavable linker region B is (optionally independently) selected from the group consisting of DNA and RNA or modifications thereof which do not interfere with nuclease cleavage.
  • Modifications of DNA and RNA nucleosides which do not interfere with nuclease cleavage may be non-naturally occurring nucleobases. Certain sugar-modified nucleosides may also allow nuclease cleavage such as an alpha-L-oxy-LNA.
  • all the nucleosides of region B comprise (optionally independently) either a 2'-OH ribose sugar (RNA) or a 2'-H sugar - i.e. RNA or DNA.
  • at least two consecutive nucleosides of region B are DNA or RNA nucleosides (such as at least 3 or 4 or 5 consecutive DNA or RNA nucleosides).
  • the nucleosides of region B are DNA nucleosides
  • region B consists of between 1 to 5, or 1 to 4, such as 2, 3, 4 consecutive phosphodiester linked DNA nucleosides.
  • region B is so short that it does not recruit RNAseH.
  • region B comprises no more than 3 or no more than 4 consecutive phospodiester linked DNA and/or RNA nucleosides (such as DNA nucleosides).
  • region A and B may together form the oligonucleotide that is linked to region C.
  • region A can be differentiated from region B in that Region A starts with at least one, preferably at least two, modified nucleosides with increased binding affinity to the target nucleic acid (e.g. LNA or nucleosides with a 2' substituted sugar moiety) and region A on its own is capable of modulation of the expression the target nucleic acid in a relevant cell line.
  • region A comprises DNA or RNA nucleosides these are linked with nuclease resistant internucleoside linkage, such phosphorothioate or boranophosphate.
  • Region B on the other hand comprises phophodiester linkages between DNA or RNA nucleosides.
  • region B is not complementary to or comprises at least 50% mismatches to the target nucleic acid.
  • region B is not complementary to the target nucleic acid sequence or to the contiguous nucleotides complementary to the target nucleic acid in region A.
  • region B is complementary with the target nucleic acid sequence.
  • region A and B together may form a single contiguous sequence which is complementary to the target sequence.
  • the internucleoside linkage between the first (region A) and the second region (region B) may be considered part of the second region.
  • the sequence of bases in region B is selected to provide an optimal endonuclease cleavage site, based upon the predominant endonuclease cleavage enzymes present in the target tissue or cell or sub-cellular compartment.
  • endonuclease cleavage sequences for use in region B may be selected based upon a preferential cleavage activity in the desired target cell (e.g. liver/hepatocytes) as compared to a non-target cell (e.g. kidney).
  • the potency of the compound for target down-regulation may be optimized for the desired tissue/cell.
  • region B comprises a dinucleotide of sequence AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein C may be 5-methylcytosine, and/or T may be replaced with U.
  • the internucleoside linkage is a phosphodiester linkage.
  • region B comprises a trinucleotide of sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, and GGG wherein C may be 5-methylcytosine and/or T may be replaced with U.
  • region B comprises a trinucleotide of sequence AAAX, AATX, AACX, AAGX, ATAX, ATTX, ATCX, ATGX, ACAX, ACTX, ACCX, ACGX, AGAX, AGTX, AGCX, AGGX, TAAX, TATX, TACX, TAGX, TTAX, TTTX, TTCX, TAGX, TCAX, TCTX, TCCX, TCGX, TGAX, TGTX, TGCX, TGGX, CAAX, CATX, CACX, CAGX, CTAX, CTGX, CTCX, CTTX, CCAX, CCTX, CCCX, CCGX, CGAX, CGTX, CGCX, CGGX, GAAX, GATX, GACX, CAGX, GTAX, GTTX, GTC
  • the internucleoside linkages are phosphodiester linkages. It will be recognized that when referring to (naturally occurring) nucleobases A, T, U, G, C, these may be substituted with nucleobase analogues which function as the equivalent natural nucleobase (e.g. base pair with the complementary nucleoside).
  • the linker can have at least two functionalities, one for attaching to the oligonucleotide and the other for attaching to the conjugate moiety.
  • Example linker functionalities can be electrophilic for reacting with nucleophilic groups on the oligonucleotide or conjugate moiety, or nucleophilic for reacting with electrophilic groups.
  • linker functionalities include amino, hydroxyl, carboxylic acid, thiol, phosphoramidate, phosphorothioate, phosphate, phosphite, unsaturations (e.g., double or triple bonds).
  • linkers include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate (SMCC), 6- aminohexanoic acid (AHEX or AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4-aminocyclohexylcarboxylic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxy-(6-amido-caproate) (LCSMCC), succinimidyl m-maleimido-benzoylate (MBS), succinimidyl N-e-maleimido-caproylate (EMCS), succinimidyl 6-(beta - maleimido-propionamido) hexanoate (SMPH), succinimidyl N-(a-maleimido acetate)
  • ADO 8-
  • the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group.
  • the amino alkyl group may be added to the oligonucleotide (region A or region A-B) as part of standard oligonucleotide synthesis, for example using a (e.g. protected) amino alkyl phosphoramidite.
  • the linkage group between the amino alkyl and the oligonucleotide may for example be a phosphorothioate or a phosphodiester, or one of the other nucleoside linkage groups referred to herein.
  • the amino alkyl group is covalently linked to the 5' or 3'-end of the oligonucleotide.
  • Commercially available amino alkyl linkers are for example 3'-Amino-Modifier reagent for linkage at the 3'-end of the oligonucleotide and for linkage at the 5 '-end of an oligonucleotide 5'- Amino-Modifier C6 is available. These reagents are available from Glen Research Corporation (Sterling, Va.).
  • Linkers and their use in preparation of conjugates of oligonucleotides are provided throughout the art such as in WO 96/11205 and WO 98/52614 and U.S. Pat. Nos. 4,948,882 ; 5,525,465 ; 5,541,313 ; 5,545,730 ; 5,552,538 ; 5,580,731 ; 5,486,603 ; 5,608,046 ; 4,587,044 ; 4,667,025 ; 5,254,469 ; 5,245,022 ; 5,112,963 ; 5,391,723 ; 5,510475 ; 5,512,667 ; 5,574,142 ; 5,684,142 ; 5,770,716 ; 6,096,875 ; 6,335,432 ; and 6,335,437 , WO 2012/083046 .
  • oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide.
  • the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313 ).
  • the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand).
  • composition of the invention comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
  • the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
  • a pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include sodium and potassium salts.
  • the pharmaceutically acceptable diluent is sterile phosphate buffered saline.
  • the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300 ⁇ M solution.
  • Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985 .
  • WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants.
  • Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091 .
  • Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations.
  • Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including route of administration, extent of disease, or dose to be administered.
  • compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered.
  • the resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration.
  • the pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5.
  • the resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules.
  • the composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.
  • the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug.
  • the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell.
  • oligonucleotides or oligonucleotide conjugates of the present invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
  • oligonucleotides or oligonucleotide conjugates may be used to specifically modulate the synthesis of PD-L1 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention.
  • the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.
  • the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
  • Described herein is an in vivo or in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering an oligonucleotide or oligonucleotide conjugate of the invention in an effective amount to said cell.
  • the target cell is a mammalian cell in particular a human cell.
  • the target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal.
  • the target cell is present in the liver.
  • Liver target cell can be selected from parenchymal cells (e.g. hepatocytes) and non-parenchymal cells such as Kupffer cells, LSECs, stellate cells (or Ito cells), cholangiocytes and liver-associated leukocytes (including T cells and NK cells).
  • the target cell is an antigen-presenting cell.
  • Antigen-presenting cells displays foreign antigens complexed with major histocompatibility complex (MHC) class I or class II on their surfaces.
  • MHC major histocompatibility complex
  • the antigen-presenting cell expresses MHC class II (i.e. professional antigen-presenting cells such as dendritic cells, macrophages and B cells).
  • the oligonucleotides may be used to detect and quantitate PD-L1 expression in cell and tissues by northern blotting, in-situ hybridisation or similar techniques.
  • oligonucleotides or oligonucleotide conjugates of the present invention or pharmaceutical compositions thereof may be administered to an animal or a human, suspected of having a disease or disorder, which can be alleviated or treated by reduction of the expression of PD-L1, in particular by reduction of the expression of PD-L1 in liver target cells.
  • Described herein are methods for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.
  • the invention also relates to an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention for use as a medicament.
  • oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.
  • oligonucleotide or oligonucleotide conjugate or pharmaceutical composition of the invention as described for the manufacture of a medicament for the treatment of a disease or disorder as referred to herein.
  • the disease is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver.
  • oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from viral or parasitic infections.
  • the disease is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver.
  • the disease or disorder is associated with immune exhaustion.
  • the disease or disorder is associated with exhaustion of virus-specific T-cell responses.
  • the disease or disorder may be alleviated or treated by reduction of PD-L1 expression.
  • the methods of the invention are preferably employed for treatment or prophylaxis against diseases associated with immune exhaustion.
  • oligonucleotide, oligonucleotide conjugate or pharmaceutical compositions of the invention are used in restoration of immune response against a liver cancer or metastases in the liver.
  • the oligonucleotide, oligonucleotide conjugate or pharmaceutical compositions of the invention are used in restoration of immune response against a pathogen.
  • the pathogen can be found in the liver.
  • the pathogens can be a virus or a parasite, in particular those described herein.
  • the pathogen is HBV.
  • oligonucleotide oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the restoration of immunity against a viral or parasite infection as mentioned herein.
  • Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment of viral infections, in particular viral infections in the liver where the PD-1 patheway is affected (see for example Kapoor and Kottilil 2014 Future Virol Vol. 9 pp. 565-585 and Salem and El-Badawy 2015 World J Hepatol Vol. 7 pp. 2449-2458 ).
  • Viral liver infections can be selected from the group consisting of hepatitis viruses, in particular HBV, HCV and HDV, in particular chronic forms of these infections.
  • the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are used to treat HBV, in particular chronic HBV.
  • Indicators of chronic HBV infections are high levels of viral load (HBV DNA) and even higher levels of empty HBsAg particles (>100-fold in excess of virions) in the circulation.
  • Oligonucleotides or oligonucleotide conjugates of the present invention can also be used to treat viral liver infections that occur as co-infections with HIV.
  • Other viral infections which can be treated with the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are Icmv (Lymphocytic Choriomeningitis Virus), and HIV as a mono infection, HSV-1 and -2, and other herpesviruses. These viruses are not hepatotrophic, however they may be sensitive to PDL1 down regulation.
  • the restoration of immunity or immune response involves improvement of the T-cell and/or NK cell response and/or alleviation of the T-cell exhaustion, in particular the HBV-specific T-cell response, the HCV-specific T-cell response and or the HDV-specific T-cell response is restored.
  • An improvement of the T cell response can for example be assessed as an increase in T cells in the liver, in particular an increase in CD8+ and/or CD4+ T cells when compared to a control (e.g.
  • CD8 + T cells specific for HBV s antigen (HBsAg) and/or CD8 + T cells specific for HBV e antigen (HBeAg) and/or CD8 + T cells specific for HBV core antigen (HBcAg) are increased in subjects treated with an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention compared to control.
  • the HBV antigen specific CD8 + T cells produce one or more cytokines, such as interferon-gamma (IFN- ⁇ ) or tumor necrosis factor alpha (TNF- ⁇ ).
  • cytokines such as interferon-gamma (IFN- ⁇ ) or tumor necrosis factor alpha (TNF- ⁇ ).
  • IFN- ⁇ interferon-gamma
  • TNF- ⁇ tumor necrosis factor alpha
  • the increase in CD8 + T cells described above is in particular observed in the liver.
  • the increase described herein should be statistically significant when compared to a control.
  • the increase is at least 20%, such as 25%, such as 50% such as 75% when compared to control.
  • natural killer (NK) cells and/or natural killer T (NKT) cells are activated by the oligonucleotides or oligonucleotide conjugates of the present invention.
  • Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment parasite infections, in particular parasite infections where the PD-1 pathway is affected (see for example Bhadra et al. 2012 J Infect Dis vol 206 pp. 125-134 ; Bhadra et al. 2011 Proc Natl Acad Sci U S A Vol. 108 pp. 9196-9201 ; Esch et al. J Immunol vol 191 pp 5542-5550 ; Freeman and Sharpe 2012 Nat Immunol Vol 13 pp. 113-115 ; Gutierrez et al. 2011 Infect Immun Vol 79 pp. 1873-1881 ; Joshi et al.
  • Parasite infections can be selected from the group consisting of malaria, toxoplasmosis, leishmaniasis and trypanosomiasis. Malaria infection is caused by protozoa of the genus Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum. Toxoplasmosis is a parasitic disease caused by Toxoplasma gondii.
  • Leishmaniasis is a disease caused by protozoan parasites of the genus Leishmania. Trypanosomiasis is caused by the protozoan of the genus Trypanosoma. Chaga disease which is the tropical form caused by the species Trypanosoma cruzi, and sleeping disease is caused by the species Trypanosoma brucei.
  • the restoration of immunity involves restoration of a parasite-specific T cell and NK cell response, in particular a Plasmodium-specific T-cell response, a Toxoplasma gondii -specific T-cell and NK cell response, a Leishmania-specific T-cell and NK cell response, a Trypanosoma cruzi -specific T-cell and NK cell response or a Trypanosoma brucei -specific T-cell and NK cell response.
  • a parasite-specific CD8 + T cell and NK cell response that is restored.
  • oligonucleotides or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).
  • topical such as, to the skin, inhalation, ophthalmic or otic
  • enteral such as, orally or through the gastrointestinal tract
  • parenteral such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal.
  • the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g. intracerebral or intraventricular, intravitreal administration.
  • a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g. intracerebral or intraventricular, intravitreal administration.
  • the active oligonucleotide or oligonucleotide conjugate is administered intravenously.
  • the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.
  • the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg/kg, such as from 0.1 - 10 mg/kg, such as from 0.2 - 10 mg/kg, such as from 0.25 - 10 mg/kg, such as from 0.1 - 5 mg/kg, such as from 0.2 - 5 mg/kg, such as from 0.25 - 5 mg/kg.
  • the administration can be once a week, every 2 nd week, every third week or even once a month.
  • the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent.
  • the therapeutic agent can for example be the standard of care for the diseases or disorders described above.
  • the antiviral drugs effective against HBV are for example nucleos(t)ide analogs.
  • nucleos(t)ide analogs licensed for therapy of HBV namely lamivudine (Epivir), adefovir (Hepsera), tenofovir (Viread), telbivudine (Tyzeka), entecavir (Baraclude) these are effective in suppressing viral replication (HBV DNA) but have no effect on HBsAg levels.
  • Other antiviral drugs include ribavirin and an HBV antibody therapy (monoclonal or polyclonal).
  • the immune system modulators can for example be interferon alpha-2a and PEGylated interferon alpha-2a (Pegasys) or TLR7 agonists (e.g. GS-9620) or therapeutic vaccines.
  • IFN- ⁇ treatment show only very modest effect in reducing viral load, but result in some HBsAg decline, albeit very inefficiently ( ⁇ 10% after 48 week therapy).
  • oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective against HBV such as the antisense oligonucleotides described in WO2012/145697 and WO 2014/179629 or the siRNA molecules described in WO 2005/014806 , WO 2012/024170 , WO 2012/2055362 , WO 2013/003520 and WO 2013/159109 .
  • compositions according to the present invention may be comprised of a combination of an oligonucleotide or oligonucleotide conjugate of the present invention in association with a pharmaceutically acceptable excipient, as described herein, and another therapeutic or prophylactic agent known in the art.
  • Table 5 list of oligonucleotide motif sequences (indicated by SEQ ID NO) targeting the human PD-L1 transcript (SEQ ID NO: 1), designs of these, as well as specific antisense oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence.
  • Oligonucleotide compounds represent specific designs of a motif sequence.
  • Oligonucleotide compounds represent specific designs of a motif sequence.
  • Table 8 GalNAc conjugated antisense oligonucleotide compounds.
  • antisense oligonucleotide conjugate CMP ID NO G N2-C6 o c o a o AGTttacattttcTG C 755_2 GN2-C6 o c o a o TATgtgaagaggaGAG 756_2 GN2-C6 o c o a o CACctttaaaaccCCA 757_2 GN2-C6 o c o a o TCCtttataatcaCAC 758_2 G N2-C6 o c o a o ACGgtattttcacAGG 759_2 G N2-C6 o c o a o GACactacaatgaGGA 760_2 G N2-C6 o c o a o TGGtttttaggacTGT 761_2 G N2-C
  • HLA-A2.1-/HLA-DR1-transgenic H-2 class I-/class II-knockout mice were created and bred at the Institut Pasteur. These mice represent an in vivo experimental model for human immune function studies without any interference with mouse MHC response (Pajot et al 2004 Eur J Immunol. 34(11):3060-9.
  • Adeno-associated virus (AAV) vector AAV serotype 2/8 carrying a replication competent HBV DNA genome was used in these studies.
  • the AAV-HBV vector (batch GVPN #6163) was diluted in sterile Phosphate buffered Saline (PBS) to reach a titer of 5 x 10 11 vg/mL.
  • Mice were injected intravenously (i.v.) with 100 ⁇ L of this diluted solution (dose/mouse: 5 x 10 10 vg) in a tail vein.
  • Complete viral particles containing HBV DNA were detected in the blood of HBV-carrier mice.
  • HBcAg was detected for up to one year in the liver together with HBV circulating proteins HBeAg and HBsAg in the blood. In all AAV2/8-HBV-transduced mice, HBsAg, HBeAg, and HBV DNA persisted in serum for at least one year ( Dion et al 2013 J Virol 87:5554-5563 ).
  • mice infected with a recombinant adeno-associated virus (AAV) carrying the HBV genome maintains stable viremia and antigenimia for more than 30 weeks ( Dan Yang, et al. 2014 Cellular & Molecular Immunology 11, 71-78 ).
  • mice Male C57BL/6 mice (4-6 weeks old), specific pathogen free, were purchased from SLAC (Shanghai Laboratory Animal Center of Chinese Academy of Sciences) and housed in an animal care facility in individually ventilated cages. Guidelines were followed for the care and use of animals as indicated by WuXi IACUC (Institutional Animal Care and Use Committee, WUXI IACUC protocol number R20131126-Mouse). Mice were allowed to acclimate to the new environment for 3 days and are grouped according to the experimental design.
  • Recombinant AAV-HBV was diluted in PBS, 200 ⁇ L per injection. This recombinant virus carries 1.3 copies of the HBV genome (genotype D, serotype ayw).
  • mice On day 0, all mice were injected through tail vein with 200 ⁇ L AAV-HBV. On days 6, 13 and 20 after AAV injection, all mice in were submandibularly bled (0.1 ml blood/mouse) for serum collection. On day 22 post injection, mice with stable viremia were ready for oligonucleotide treatment.
  • the oligonucleotides can be unconjugated or GalNAc conjugated.
  • Plasmid DNA were endotoxin-free and manufactured by Plasmid-Factory (Germany).
  • pCMV-S2.S ayw encodes the preS2 and S domains of the HBsAg (genotype D), and its expression is controlled by the cytomegalovirus immediate early gene promoter ( Michel et al 1995 Proc Natl Acad Sci U S A 92:5307-5311 ).
  • pCMV-HBc encodes the HBV capsid carrying the hepatitis core (HBc) Ag ( Dion et al 2013 J Virol 87:5554-5563 ).
  • Treatment with DNA vaccine was conducted as described here. Five days prior to vacciantion cardiotoxine (CaTx, Latoxan refL81-02, 50 ⁇ l/ muscle) was injected into the muscle of the mice. CaTx depolarizees the muscular fibers to induce cell degeneration, 5 days post injection, new muscular fibers will appear and will receive the DNA vaccine for a better efficacy for transfection.
  • CaTx vacciantion cardiotoxine
  • the antibody was adminstredadministered by intraperitoneal (i.p.) injection at a dose of 12.5 ⁇ g/g.
  • Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
  • Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 ⁇ mol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
  • RP-HPLC reverse phase HPLC
  • UPLC UPLC
  • the coupling of ⁇ -cyanoethyl- phosphoramidites is performed by using a solution of 0.1 M of the 5'-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator.
  • a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such.
  • Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.
  • conjugation For post solid phase synthesis conjugation a commercially available C6 amino linker phosphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated.
  • the conjugates are introduced via activation of the functional group using standard synthesis methods.
  • the conjugate moiety can be added to the oligonucleotide while still on the solid support by using a GalNAc- or GalNAc-cluster phosphoramidite as described in PCT/EP2015/073331 or in EP appl. NO. 15194811.4 .
  • the crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10 ⁇ 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
  • Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x T m -buffer (200mM NaCl, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95oC for 3 min and then allowed to anneal in room temperature for 30 min.
  • the duplex melting temperatures (T m ) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20oC to 95oC and then down to 25oC, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex T m .
  • FAM-labeled oligonucleotides with the biocleavable linker to be tested e.g. a DNA phosphodiester linker (PO linker)
  • a DNA phosphodiester linker PO linker
  • FAM-labeled oligonucleotides with the biocleavable linker to be tested are subjected to in vitro cleavage using homogenates of the relevant tissues (e.g. liver or kidney) and Serum.
  • tissue and serum samples are collected from a suitable animal (e.g. mice, monkey, pig or rat) and homogenized in a homogenisation buffer (0,5% Igepal CA-630, 25 mM Tris pH 8.0, 100 mM NaCl, pH 8.0 (adjusted with 1 N NaOH).
  • a homogenisation buffer 0,5% Igepal CA-630, 25 mM Tris pH 8.0, 100 mM NaCl, pH 8.0 (adjusted with 1 N NaOH).
  • the tissue homogenates and Serum are spiked with oligonucleotide to concentrations of 200 ⁇ g/g tissue.
  • the samples are incubated for 24 hours at 37°C and thereafter the samples are extracted with phenol - chloroform.
  • the solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p-100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5.
  • the content of cleaved and non-cleaved oligonucleotide are determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm.
  • FAM-labelled oligonucleotides with S1 nuclease susceptible linkers are subjected to in vitro cleavage in S1 nuclease extract or Serum.
  • S1 nuclease susceptible linkers e.g. a DNA phosphodiester linker (PO linker)
  • oligonucleotides 100 ⁇ M are subjected to in vitro cleavage by S1 nuclease in nuclease buffer (60 U pr. 100 ⁇ L) for 20 and 120 minutes. The enzymatic activity is stopped by adding EDTA to the buffer solution. The solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p-100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5. The content of cleaved and non-cleaved oligonucleotide is determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm.
  • Liver cells from AAV/HBV mice were prepared as described below and according to a method described by Tupin et al 2006 Methods Enzymol 417:185-201 with minor modifications. After mouse euthanasia, the liver was perfused with 10 ml of sterile PBS via hepatic portal vein using syringe with G25 needle. When organ is pale, the organ was harvested in Hank's Balanced Salt Solution (HBSS) (GIBCO® HBSS, 24020) + 5 % decomplemented fetal calf serum (FCS). The harvested liver was gently pressed through 100 ⁇ m cell-strainer (BD Falcon, 352360) and cells were suspended in 30 ml of HBSS + 5 % FCS.
  • HBSS Hank's Balanced Salt Solution
  • FCS fetal calf serum
  • Cells were cultured in complete medium (a-minimal essential medium (Gibco, 22571) supplemented with 10 % FCS (Hyclone, # SH30066, lot APG21570), 100 U/mL penicillin + 100 ⁇ g/mL streptomycin + 0.3 mg/mL L-glutamine (Gibco, 10378), 1X non-essential amino acids (Gibco, 11140), 10 mM Hepes (Gibco, 15630), 1 mM sodium pyruvate (Gibco, 11360) and 50 ⁇ M ⁇ -mercaptoethanol (LKB, 1830)).
  • a-minimal essential medium Gibco, 22571
  • FCS Hyclone, # SH30066, lot APG21570
  • 100 U/mL penicillin + 100 ⁇ g/mL streptomycin + 0.3 mg/mL L-glutamine Gibco, 10378
  • 1X non-essential amino acids Gibco
  • PBS FACS PBS containing 1 % bovine serum albumin and 0.01% sodium azide. Cells were incubated with 5 ⁇ L of PBS FACS containing a rat anti-mouse CD16/CD32 antibody and a viability marker LD fixable yellow, Thermofisher, L34959 for 10 min in the dark at 4°C.
  • NK P46 BV421 Ros Mab anti mouse NK P46, Biolegend, 137612
  • F4/80 rat Mab anti-mouse F4/80 FITC, BD Biolegend, 123108
  • PD1 rat Mab anti-mouse PD1 PE, BD Biosciences, 551892
  • PDL1 rat Mab anti-mouse PDL1 BV711, Biolegend, 124319
  • ICS assays were performed on both splenocytes and liver mononuclear cells. Cells were seeded in Ubottom 96-well plates. Plates with cells were incubated overnight at 37 °C either in complete medium alone as negative control or with the peptides described in Table 9 at a concentration of 2 ⁇ g/ml. Brefeldin A at 2 ⁇ g/mL (Sigma, B6542) was added after one hour of incubation.
  • the mix was composed of monoclonal antibodies against CD3 (hamster Mab anti-mouse CD3-PerCP, BD Biosciences, 553067), CD8 (rat Mab anti-mouse CD8-APC-H7, BD Biosciences, 560182), CD4 (rat Mab anti-mouse CD4-PE-Cy7, BD Biosciences, 552775), and NK cells (Rat Mab anti mouse NK P46 BV421, Biolegend, 137612). Cells were fixed after several washes and permeabilized for 20 min in the dark at room temperature with Cytofix/Cytoperm, washed with Perm/Wash solution (BD Biosciences, 554714) at 4 °C.
  • CD3 hamster Mab anti-mouse CD3-PerCP, BD Biosciences, 553067
  • CD8 rat Mab anti-mouse CD8-APC-H7, BD Biosciences, 560182
  • CD4 rat Mab anti
  • Intracellular cytokine staining with antibodies against IFN ⁇ (rat Mab anti-mouse IFN ⁇ -APC, clone XMG1.2, BD Biosciences, 554413) and tumor necrosis factor alpha (TNF ⁇ ) (rat Mab anti-mouse TNF ⁇ -FITC, clone MP6-XT22; 1/250 (BD Biosciences 554418) was performed for 30 min in the dark at 4 °C. Before analysis by flow cytometry using the MACSQuant Analyzer, cells were washed with Perm/Wash and re-suspended in PBS FACS containing 1% Formaldehyde.
  • Live CD3+CD8+CD4- and cells CD3+CD8-CD4+ were gated and presented on dot-plot. Two regions were defined to gate for positive cells for each cytokine. Numbers of events found in these gates were divided by total number of events in parental population to yield percentages of responding T cells. For each mouse, the percentage obtained in medium alone was considered as background and subtracted from the percentage obtained with peptide stimulations.
  • Threshold of positivity was defined according to experiment background i.e. the mean percentage of stained cells obtained for each group in medium alone condition plus two standard deviations. Only percentage of cytokine represented at least 5 events were considered as positive.
  • Table 9 HLA-A2/DR1 restricted epitopes contained in the HBV Core protein and the Envelope domains of the HBsAg (S2+S).
  • a gene walk was performed across the human PD-L1 transcript primarily using 16 to 20mer gapmers. Efficacy testing was performed in an in vitro experiment in the human leukemia monocytic cell line THP1 and in the human non-Hodgkin's K lymphoma cell line (KARPAS-299).
  • THP1 and Karpas-299 cell line were originally purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO 2 .
  • THP-1 cells (3.104 in RPMI-GLutamax, 10% FBS, 1% Pen-Strep (Thermo Fisher Scientific) were added to the oligonucleotides (4-5 ul) into 96-well round bottom plates and cultured for 6 days in a final volume of 100 ⁇ l/well. Oligonucleotides were screened at one single concentration (20 ⁇ M) and in dose-range concentrations from 25 ⁇ M to 0.004 ⁇ M (1:3 dilution in water). Total mRNA was extracted using the MagNA Pure 96 Cellular RNA Large Volume Kit on the MagNA Pure 96 System (Roche Diagnostics) according to the manufacturer's instructions.
  • RT-qPCR was performed using the TaqMan RNA-to-ct 1-Step kit (Thermo Fisher Scientific) on the QuantStudio machine (Applied Biosystems) with pre-designed Taqman primers targeting human PDL1 and ACTB used as endogenous control (Thermo Fisher Scientific).
  • the relative PD-L1 mRNA expression level was calculated using 2(-Delta Delta C(T)) method and the percentage of inhibition as the % compared to the control sample (non-treated cells).
  • Karpas-299 cells were cultured in RPMI 1640, 2 mM Glutamine and 20% FBS (Sigma). The cells were plated at 10000 cell/well in 96 wells plates incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Final concentration of oligonucleotides was in a single dose of 5 ⁇ M, in a final culture volume was 100 ⁇ l/well or added in a dose response ranging from 50 ⁇ M, 15.8 ⁇ M, 5.0 ⁇ M, 1.58 ⁇ M, 0.5 ⁇ M, 0.158 ⁇ M, 0.05 ⁇ M, to 0.0158 ⁇ M in 100 ⁇ L culture volume.
  • cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction.
  • qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Applied Biosystems; Hs01125299_m1) and TBP (Applied Biosystems; 4325803).
  • the relative PD-L1 mRNA expression level is shown in table 10 as % of control sample (PBS-treated cells).
  • PD-L1 mRNA levels are normalized to TBP in KARPAS-299 cells or ACTB in THP1 cells and shown as % of control (PBS treated cells).
  • CMP ID NO KARPAS-299 cells 5 ⁇ M CMP THP1 cells 20 ⁇ M CMP Compound (CMP) Start on SEQ ID NO 1 % mRNA of control sd % mRNA of control sd 4_1 50 1 32 11 TAattggctctacTGC 236 5_1 25 5 9 6 TCGCataagaatgaCT 371 6_1 29 2 15 5 TGaacacacagtcgCA 382 7_1 27 7 3 1 CTGaacacacagtCGC 383 8_1 23 4 11 3 TCTgaacacacagtCG 384 9_1 32 3 19 6 TTCtgaacacacagTC 385 10_1 57 5 39 16 ACaagtcatgttaCTA 463 11_1 75 5 37 12 ACacaagtcatgttAC 465 12_1 22 2 10 3 CTtacttagatgcTGC 495 13_1 33 4 23 11 ACttacttag
  • oligonucleotides from Table 10 were tested in KARPAS-299 cells using half-log serial dilutions in in PBS (50 ⁇ M, 15.8 ⁇ M, 5.0 ⁇ M, 1.58 ⁇ M, 0.5 ⁇ M, 0.158 ⁇ M, 0.05 ⁇ M, to 0.0158 ⁇ M oligonucleotide) in the in vitro efficacy assay described in Example 1. IC 50 and max inhibition (% residual PD-L1 expression) was assessed for the oligonucleotides.
  • EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock down level is shown in table 11 as % of control (PBS) treated cells. Table 11: Max inhibition as % of saline and EC50 in KARPAS-299 cell line.
  • oligonucleotides from Table 6 were tested in THP-1 cells using 1:3 serial in water from 25 ⁇ M to 0.004 ⁇ M in the in vitro efficacy assay described in Example 1. IC 50 and max inhibition (Percent residual PD-L1 expresson) was assessed for the oligonucleotides.
  • EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock down level is shown in table 12 as % of control (PBS) treated cells. Table 12: Max inhibition as % of saline and EC50 in THP1 cell line.
  • Example 3 In vitro potency and efficacy and in vivo PD-L1 reduction in poly(I:C) induced mice using naked and GalNAc conjugated PD-L1 antisense oligonucleotides
  • MCP-11 cells (originally purchased from ATCC) suspended in DMEM (Sigma cat. no. D0819) supplemented with 10% horse serum, 2 mM L-glutamine, 0.025 mg/ml gentamicin and 1 mM sodium pyruvate were added at a density of 8000 cells/well to the oligonucleotides (10 ⁇ l) in 96-well round bottom plates and cultured for 3 days in a final volume of 200 ⁇ l/well in a humidified incubator at 37°C with 5% CO 2 .
  • Oligonucleotides were screened in dose-range concentrations (50 ⁇ M, 15.8 ⁇ M, 5.0 ⁇ M, 1.58 ⁇ M, 0.5 ⁇ M, 0.158 ⁇ M, 0.05 ⁇ M and 0.0158 ⁇ M).
  • qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and Gusb (Thermo Fisher Scientific; VIC-MGB-PL Mm01197698-m1).
  • the relative PD-L1 mRNA expression level is shown in table 9 as % of residual PD-L1 expression in % of PBS control samples (PBS-treated cells).
  • EC50 calculations were performed in GraphPad Prism6.
  • the EC50 and maximum PD-L1 knockdown level is shown in table 13 as % of control (PBS) cells.
  • mice C57BL/6J female mice (20-23 g; 5 mice per group) were injected s.c. with 5 mg/kg unconjugated oligonucleotides to mouse PD-L1 or 2.8 mg/kg GalNAc-conjugated oligonucleotides to mouse PD-L1.
  • mice were injected i.v. with 10 mg/kg poly(I:C) (LWM, Invivogen).
  • the mice were sacrificed 5 h after poly(I:C) injection and liver samples were placed in RNAlater (Thermo Fisher Scientific) for RNA extraction or frozen at dry ice for protein extraction.
  • qPCR was performed using TaqMan® Fast Advanced Master Mix TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 mRNA (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and TBP (Thermo Fisher Scientific; VIC-MGB-PL Mm00446971_m1).
  • the relative PD-L1 mRNA expression level is shown in table 13 as % of control samples from mice injected with saline and poly(I:C).
  • Liver homogenates were prepared by homogenizing liver samples in 2 ml per 100 mg tissue T-PER® Tissue Protein Extraction Reagent (Thermo Fisher Scientific) mixed with 1x Halt Protease Inhibitor Cocktail, EDTA-Free (Thermo Fisher Scientific). Protein concentrations in liver homogenates were measured using Coomassie Plus (Bradford) Assay Reagent (Thermo Scientific) according to the manufacturer's instructions. Liver homogenates (40 ⁇ g protein) were separated on 4-12% Bis-Tris Plus polyacrylamide gels (Thermo Fisher Scientific) in 1xMOPS running buffer and transferred to nitrocellulose membranes using iBLOT Dry blotting system (Thermo Fisher Scientific) according to the manufacturer's instructions.
  • Each blot was cut in to two parts horizontally at the 64 kDa band.
  • the membranes were incubated overnight at 4°C with rabbit monoclonal anti-vinculin (Abcam cat. no. ab129002) diluted 1:10000 (upper membranes) or goat polyclonal anti-mPD-L1 (R&D Systems cat. no. AF1019) diluted 1:1000 (lower membranes) in TBS containing 5% skim milk and 0.05% Tween20.
  • the membranes were washed in TBS containing 0.05% Tween20 and exposed for 1 h at room temperature to HRP-conjugated swine anti-rabbit IgG (DAKO) diluted 1:3000 (upper membranes) or HRP-conjugated rabbit anti-goat IgG (DAKO) diluted 1:2000 in TBS containing 5% skim milk and 0.05% Tween20. Following washing of the membranes, the reactivity was detected using ECL select (Amersham GE Healthcare).
  • Table 13 In vitro and in vivo efficacy of oligonucleotides to mouse PD-L1 CMP ID NO Compound CMP Max Inhibition (%of PBS) EC50 ( ⁇ M) PD-L1 mRNA (% of control) PD-L1 protein (relative to control) 744_1 AGTttacattttcTGC 9.1 0.56 86 ++ 746_1 CACctttaaaccCCA 5.0 0.46 181 nd 747_1 TCCtttataatcaCAC 4.4 0.52 104 ++ 748_1 ACGgtattttcacAGG 1.8 0.26 102 +++ 749_1 GACactacaatgaGGA 7.6 1.21 104 nd 750_1 TGGtttttaggacTGT 12.4 0.74 84 nd 751_1 CGAcaaattctatCCT 9.9 0.69 112 nd 752_1 TGAtatacaatgcTA
  • GalNAc conjugation of the oligonucleotides clearly improves the in vivo PD-L1 reduction.
  • the reduction of mRNA generally correlates with a reduction in PD-L1 protein.
  • a low in vitro EC50 value generally reflects a good in vivo PD-L1 mRNA reduction once the oligonucleotide is conjugated to GalNAc.
  • Example 4 In vivo PK/PD in sorted hepatocytes and non-parenchymal cells from poly(I:C) induced mice
  • LWM poly(I:C)
  • mice were anesthesized 18-20 h after poly(I:C) injection and the liver was perfused at a flow rate of 7 ml per min through the vena cava using Hank's balanced salt solution containing 15 mM Hepes and 0.38 mM EGTA for 5 min followed by collagenase solution (Hank's balanced salt solution containing 0.17 mg/ml Collagenase type 2 (Worthington 4176), 0.03% BSA, 3.2 mM CaCl 2 and 1.6 g/l NaHCO 3 ) for 12 min.
  • Hank's balanced salt solution containing 15 mM Hepes and 0.38 mM EGTA
  • collagenase solution Hank's balanced salt solution containing 0.17 mg/ml Collagenase type 2 (Worthington 4176), 0.03% BSA, 3.2 mM CaCl 2 and 1.6 g/l NaHCO 3
  • William E medium Sigma cat. no. W1878 complemented with 1x Pen/Strep, 2 mM L-glutamine and 10% FBS (ATCC #30-2030)
  • the precipitated hepatocytes were resuspended in Williams E medium.
  • the supernant containing non-parenchymal cells was centrifuged at 500xg 7 min and the cells were resuspended in 4 ml RPMI medium and centrifugated through two layers of percoll (25% and 50% percoll) at 1800xg for 30 min. Following collection of the non-parenchymal cells between the two percoll layers, the cells were washed and resuspended in RPMI medium.
  • Total mRNA was extracted from purified hepatocytes, non-parenchymal cells and total liver suspension (non-fractionated liver cells) using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer's instructions.
  • cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction.
  • qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and TBP (Thermo Fisher Scientific; VIC-MGB-PL Mm00446971_m1).
  • the relative PD-L1 mRNA expression level is shown in table 10 as % of control samples from mice injected with saline and poly(I:C).
  • Oligonucleotide content analysis was performed using ELISA employing a biotinylated capture probe with the sequence 5'-TACCGT-s-Bio-3' and a digoxigenin conjugated detection probe with the sequence 5'- DIG-C12-S1-CCTGTG - 3'.
  • the probes consisted of only LNA with a phosphodiester backbone.
  • Liver samples (approximately 50 mg) were homogenized in 1.4 mL MagNa pure lysis buffer (Roche Cat. No 03604721001) in a 2 mL Eppendorf tube containing one 5mm stainless steel bead. Samples were homogenized on Retsch MM400 homogenizer (Merck Eurolab) until a uniform lysate was obtained.
  • the homogenized samples were diluted a minimum of 10 times in 5 x SSCT buffer (750 mM NaCl, and 75 mM sodium citrate, containing 0.05 % (v/v) Tween-20, pH 7.0) and a dilution series of 6 times 2 fold dilutions using capture-detection solution (35 nM capture probe and 35 nM detection probe in 5xSSCT buffer) were made and incubated for 30 min at room temperature.
  • the samples were transferred to a 96 well streptavidin coated plate (Nunc Cat. No. 436014) with 100 ⁇ L in each well. The plates were incubated for 1 hour at room temperature with gentle agitation.
  • Example 5 In vivo PD-L1 knock down in AAV/HBV mice using naked and GalNAc conjugated PD-L1 antisense oligonucleotides
  • AAV/HBV mice were treated with naked or conjugated to GalNAc PD-L1 antisense oligonucleotides, and the PD-L1 mRNA expression and HBV gene expression was evaluated in the liver.
  • the mice were transduced by 5x 10 10 vg AAV-HBV at week 0 (for further details see description AAV/HBV mouse model in the Materials and Methods section). From W1 post AAV-HBV transduction to W4, mice received 4 additional s.c. injections of PD-L1 oligonucleotides or vehicle (saline solution), given one week apart.
  • mice were sacrificed two weeks after the last injections and their liver were removed following PBS perfusion. The liver was cut in smaller pieces and directly frozen.
  • F3_core CTG TGC CTT GGG TGG CTT T
  • R3_core AAG GAA AGA AGT CAG AAG GCA AAA (SEQ ID NO: 785)
  • Probe P3_core:56-FAM-AGC TCC AAA/ZEN/TTC TTT ATA AGG GTC GAT GTC CAT G-3IABkFQ (SEQ ID NO: 786)
  • a standard curve using HBV plasmid (Genotype D, GTD) was prepared using 10-fold dilutions starting with 1x10 9 copies/ ⁇ l down to 1 copy/ ⁇ l and used in 5 ⁇ l per reaction.
  • PD-L1 mRNA expression was measured using qPCR.
  • mRNA was extracted from frozen liver pieces that were added to 2ml tubes containing ceramic beads (Lysing Matrix D tubes, 116913500, mpbio) and 1ml of Trizol.
  • the liver piece was homogenized using the Precellys Tissue Disruptor.200 ⁇ l Chloroform was added to the homogenate, vortexed and centrifuged at 4°C for 20min at 10000rpm.
  • the RNA containing clear phase (around 500ul) was transferred into a fresh tube and the same volume of 70% EtOH was added. After mixing well the solution was transferred onto a RNeasy spin column and RNA was further extracted following the RNeasy Kit's manual RNeasy Mini Kit, cat.# 74104, Qiagen (including the RNA digestion RNase-free DNase Set, cat.# 79254). Elution in 50 ⁇ l H 2 O. The final RNA concentration was measured and adjusted to 100ng/ul for all samples.
  • the qPCR was conducted on 7.5 ⁇ l RNA using the Taqman RNA-to-ct 1-step Kit, cat.# 4392938, Thermo Fisher according to the manufactures instructions.
  • the fprimer mixed used contained PD-L1_1-3 (Primer number Mm00452054_m1, Mm03048247_m1 and Mm03048248_m1) and endogounous controls (ATCB Mm00607939_s1, CANX Mm00500330_m1, YWHAZ Mm03950126_s1 and GUSB Mm01197698_m1)
  • both naked and GalNAc conjugated oligonucleotides are capable of reducing PD-L1 mRNA expression in the liver of an AAV/HBV mouse, with the GalNAc conjugated oligonucleotide being somewhat better. Both oligonucleotides also resulted in some reduction in HBV DNA in the serum.
  • AAV/HBV mice from Pasteur were treated with an antibody or antisense oligonucleotides targeting PD-L1.
  • the antisense oligonucleotides were either naked or conjugated to GalNAc.
  • the animals were immunized with a DNA vaccine against HBs and HBc antigens (see Materials and Methods section) to ensure efficient T cell priming by the antigen presenting cells. It was evaluated how the treatment affected the cell population in liver and spleen, as well as the PD-L1 expression on these populations and whether a HBV specific T cell response could be identified.
  • mice Female HLA-A2/DR1 mice were treated according to the protocols below. The study was conducted in two separate sub-studies, with slight differences in the administration regimens as indicated in Table 16 and 17 below.
  • DNA vaccine and anti-PD-L1 antibody was administered as described in the materials and method section.
  • the antisense oligonucleotides used were CMP ID NO 748_1 (naked) at 5 mg/kg and CMP ID NO: 759_2 (GalNAc conjugated) at 7mg/kg, both where administered as subcutaneous injections (s.c.).
  • liver mononuclear cells of each mouse from each group were collected and depleted of red blood cells (Lysing Buffer, BD biosciences, 555899).
  • the liver mononuclear cells required a specific preparation as described in the materials and method section.
  • liver mononuclear cells see materials and methods
  • Table 18 T-cells in the liver following treatment in millions of cells T-cells (millinons) CD4+ T-cells (millions) CD8+ T-cells (millions) Avg Std Avg Std Avg Std Vehicle (Group 1) 0.77 0.44 0.51 0.35 0.11 0.05 DNA vaccine (Group 2) 0.90 0.24 0.58 0.16 0.16 0.08 DNA vaccine + anti-PD-L1 Ab (Group 13) 1.98 0.90 1.40 0.81 0.41 0.23 Vehicle (Group 10) 1.73 0.87 1.13 0.55 0.40 0.25 DNA vaccine (Group 11) 1.27 0.97 0.79 0.58 0.32 0.32 DNA vaccine + PD-L1 ASO (Group 7) 3.78 1.31 2.46 0.72 0.79 0.39 DNA vaccine + GN-PD-L1 ASO (Group 8) 3.33 0.66 2.18 0.40 0.67 0.17
  • PD-L1 protein was evaluated on macrophages, B and T cells from spleen and liver at time of sacrifice.
  • the presence of PD-L1 antibody in the surface labeling antibody mix allowed quantification of PD-L1 expressing cells by cytometry.
  • PD-L1 was expressed mainly on CD8+ T cells with a mean frequency of 32% and 41% in the control groups (the two vehicle and DNA vaccination groups combined, respectively, figure 11A ).
  • Treatment with naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide resulted in a decrease of the frequency of CD8+ T cells expressing PD-L1 (see table 19 figure 11A ).
  • Significant differences in the % of cells expressing PD-L1 were also noticed for B cells and CD4+ T-cells after ASO treatment, although these cell types express significantly less PD-L1 than the CD8+ T cells (see table 19 and figure 11B and C ).
  • Treatment with anti-PD-L1 Ab also resulted in an apparent decrease in the PD-L1 expression in all cell types. It is, however, possible that this decrease is due to partly blockage of the PD-L1 epitope by the anti-PD-L1 antibody used for treatment, so that the PD-L1 detection antibody in the surface labeling antibody mix is prevented from binding to PD-L1. Therefore what appears to be a PD-L1 down regulation by the anti-PD-L1 antibody used for treatment may be the result of epitope competition between the treatment antibody and the detection antibody.
  • Table 19 % of liver cell population with PD-L1 expression % of CD8+ T-cells % of CD4+ T-cells % of B-cells Avg Std Avg Std Avg Std Vehicle (Group 10) 35.5 4.7 0.75 0.52 5.9 1.5 DNA vaccine (Group 11) 36.8 7.7 0.61 0.08 5.5 1.1 DNA vaccine + anti-PD-L1 Ab (Group 13) 18.6 12.3 0.33 0.10 2.9 1.7 Vehicle (Group 1) 28.5 11.5 0.64 0.21 5.9 1.7 DNA vaccine (Group 2) 44.9 14.4 1.43 0.69 8.7 3.1 DNA vaccine + PD-L1 ASO (Group 7) 9.6 2.4 0.37 0.21 2.9 0.8 DNA vaccine + GN-PD-L1 ASO Group 8) 14.6 3.3 0.31 0.11 2.8 0.8
  • NK cells and CD4+ and CD8+ T cells producing pro-inflammatory cytokines were detected using the intracellular cytokine staining assays (see Materials and Methods section) detecting IFN ⁇ and TNF ⁇ production.
  • mice In the spleen no NK cells and few CD4+ T cells secreting IFN ⁇ - and TNF ⁇ were detectable (frequency ⁇ 0.1%) at sacrifice. IFN ⁇ -producing CD8+ T cells targeting the two HBV antigens were detected in mice treated with naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide as well as in mice from this study which received only DNA vaccine (data not shown).
  • IFN ⁇ -secreting CD8+ T cells increased in mice treated with combination of DNA vaccine and naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide, whereas treatment with anti-PD-L1 antibody did not add any apparent additional effect to the DNA vaccination ( figure 12 ).
  • IFN ⁇ -producing CD8+ T cells targeting the envelope and core antigens were detected in most DNA-immunized groups (except anti-PD-L1 antibody) ( figure 12B ). Most of the S2-S specific T cells produced both IFN ⁇ and TNF ⁇ ( figure 12C ). The results are also shown in Table 20.
  • Table 20 % of HBV antigen (S2-S or core) specific CD8+ T cells from total IFN ⁇ or IFN ⁇ + TNF ⁇ cell population
  • PreS2-S specific T cells % of IFN ⁇ cells
  • Core specific T cells % of IFN ⁇ cells
  • S2-S specific T cells % of IFN ⁇ + TNF ⁇
  • Avg Std Avg Std Avg Std Vehicle (Group 10) 0.15 0.37 0.18 0.43 0.00 0.00 0.00 0.00 0.00 DNA vaccine (Group 11) 1.48 1.10 0.47 0.53 0.42 1.02 DNA vaccine + anti-PDL-1 Ab 1.18 0.95 0 0 0.38 0.49 Vehicle (Group 1) 0.17 0.45 0.11 0.28 0.00 0.00 DNA vaccine (Group 2) 1.70 1.02 0.27 0.51 0.98 0.90 DNA vaccine + PDL-1 ASO 2.56 1.60 0.78 0.80 1.44 1.55 DNA vaccine + GN-PDL-1 ASO 3.83 2.18 0.68 1.16 2.62 1.62
  • mice infected with recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV/HBV) as described under the Shanghai model in the materials and method section were used in this study.
  • the mice (6 mice pr. group) were injected once a week for 8 weeks with the antisense oligonucleotide CMP ID NO: 759_2 at 5 mg/kg or vehicle (saline) both where administered as subcutaneous injections (s.c.).
  • Blood samples were collected each week during treatment as well as 6 weeks post treatment.
  • HBV DNA, HBsAg and HBeAg levels were measured in the serum samples as described below.
  • the results for the first 10 weeks are shown in table 21 and in figure 13 . The study was still ongoing at the time of filing the application therefore data for the remaining 4 weeks have not been obtained.
  • Serum HBsAg and HBeAg levels were determined in the serum of infected AAV-HBV mouse using the HBsAg chemoluminescence immunoassay (CLIA) and the HBeAg CLIA kit (Autobio diagnostics Co. Ltd., Zhengzhou,China, Cat. no.CL0310-2 and CL0312-2 respectively), according to the manufacturer's protocol. Briefly, 50 ⁇ l of serum was transferred to the respective antibody coated microtiter plate and 50 ⁇ l of enzyme conjugate reagent was added. The plate was incubated for 60 min on a shaker at room temperature before all wells were washed six times with washing buffer using an automatic washer. 25 ⁇ l of substrate A and then 25 ⁇ l of substrate B was added to each well.
  • CLIA chemoluminescence immunoassay
  • HBeAg is given in the unit NCU/ml serum.
  • mice serum was diluted by a factor of 10 (1:10) with Phosphate buffered saline (PBS).
  • DNA was extracted using the MagNA Pure 96 (Roche) robot. 50 ⁇ l of the diluted serum was mixed in a processing cartridge with 200ul MagNA Pure 96 external lysis buffer (Roche, Cat. no. 06374913001) and incubated for 10 minutes. DNA was then extracted using the "MagNA Pure 96 DNA and Viral Nucleic Acid Small Volume Kit" (Roche, Cat. no. 06543588001) and the "Viral NA Plasma SV external lysis 2.0" protocol. DNA elution volume was 50 ⁇ l.
  • GalNAc conjugated PD-L1 antisense oligonucleotide CMP NO 759_2 has a significant effect on the reduction of HBV-DNA, HBsAg and HBeAg levels in serum after 6 weeks of treatment, and effect that is sustained for at least 2 weeks after the treatment has ended.
  • Example 8 In vitro PD-L1 knock down in human primary hepatocytes using GalNAc conjugated PD-L1 oligonucleotides
  • GalNAc conjugated PD-L1 antisense oligonucleotide compounds to reduce the PD-L1 transcript in primary human hepatocytes was investigated using genomics.
  • Cryopreserved human hepatocytes were suspended in WME supplemented with 10% fetal calf serum, penicillin (100 U/ml), streptomycin (0.1 mg/ml) and L-glutamine (0.292 mg/ml) at a density of approx. 5 x 10 6 cells/ml and seeded into collagen-coated 24-well plates (Becton Dickinson AG, Allschwil, Switzerland) at a density of 2 x 10 5 cells/well. Cells were pre-cultured for 4h allowing for attachment to cell culture plates before start of treatment with oligonucleotides at a final concentration of 100 ⁇ M. The oligonucleotides used are shown in table 21 and table 8, vehicle was PBS.
  • Seeding medium was replaced by 315 ⁇ l of serum free WME (supplemented with penicillin (100 U/ml), streptomycin (0.1 mg/ml), L-glutamine (0.292 mg/ml)) and 35 ⁇ l of 1 mM oligonucleotide stock solutions in PBS were added to the cell culture and left on the cells for 24 hours or 66 hours.
  • serum free WME supplemented with penicillin (100 U/ml), streptomycin (0.1 mg/ml), L-glutamine (0.292 mg/ml)
  • 35 ⁇ l of 1 mM oligonucleotide stock solutions in PBS were added to the cell culture and left on the cells for 24 hours or 66 hours.
  • Transcript expression profiling was performed using Illumina Stranded mRNA chemistry on the Illumina sequencing platform with a sequencing strategy of 2 x 51 bp paired end reads and a minimum read depth of 30M per specimen (Q squared EA). Cells were lysed in the wells by adding 350 ⁇ l of Qiagen RLT buffer and were accessioned in a randomization scheme.
  • Sequencing libraries were generated for all samples using the Illumina TruSeq Stranded mRNA Library Preparation, starting with 100 ng of total RNA.
  • Final cDNA libraries were analyzed for size distribution and using an Agilent Bioanalyzer (DNA 1000 kit), quantitated by qPCR (KAPA Library Quant Kit) and normalized to 2 nM in preparation for sequencing.
  • the Standard Cluster Generation Kit v5 was used to bind the cDNA libraries to the flow cell surface and the cBot isothermally to amplify the attached cDNA constructs up to clonal clusters of ⁇ 1000 copies each.
  • the DNA sequence was determined by sequencing-by-synthesis technology using the TruSeq SBS Kit.
  • Illumina paired-end sequencing reads of length 2x51bp were mapped on the human reference genome hg19 using the GSNAP short read alignment program. SAM-format alignments were converted into sorted alignment BAM-format files using the SAMTOOLS program. Gene read counts were estimated for PD-L1 based on the exon annotation from NCBI RefSeq, specified by the corresponding GTF file for hg19. A normalization step accounting for the different library size of each sample was applied using the DESeq2 R package.
  • Table 22 The reduction in PD-L1 transcript after incubation with GalNAc conjugated PD-L1 antisense oligonucleotide compounds are shown in table 22.
  • Example 9 - EC50 of conjugated and naked PD-L1 antisense oligonucleotides in HBV infected ASGPR-HepaRG cells
  • HepaRG cells (Biopredic International, Saint-Gregoire, France) were cultured in Williams E medium (supplemented with 10% HepaRG growth supplement (Biopredic). From this cell line a HepaRG cell line stably overexpressing human ASGPR1 and ASGPR2 was generated using a lentiviral method. Proliferating HepaRG cells were transduced at MOI 300 with a lentivirus produced on demand by Sirion biotech (CLV-CMV-ASGPR1-T2a_ASGPR2-IRES-Puro) coding for Human ASGPR1 and 2 under the control of a CMV promoter and a puromycin resistance gene.
  • Sirion biotech CLV-CMV-ASGPR1-T2a_ASGPR2-IRES-Puro
  • Transduced cells were selected for 11 days with 1 ⁇ g/ml puromycin and then maintained in the same concentration of antibiotic to ensure stable expression of the transgenes.
  • ASGPR1/2 overexpression was confirmed both at mRNA level by RT-qPCR (ASGPR1: 8560 fold vs non-transduced, ASGPR2: 2389 fold vs non transduced), and at protein level by flow cytometry analysis.
  • HBV genotype D was derived from HepG2.2.15 cell culture supernatant and was concentrated using PEG precipitation.
  • differentiated ASGPR-HepaRG cells in 96 well plates were infected with HBV at an MOI of 20 to 30 for 20 h, before the cells were washed 4 times with PBS to remove the HBV inoculum.
  • Naked PD-L1 ASO Equivalent GalNAc conjugated PD-L1 ASO CPM ID NO: 640_1 CPM ID NO: 768_2 CPM ID NO: 466_1 CPM ID NO: 769_2 were added to the HBV infected ASGPR-HepaRG cells on day 7 and day 10 post infection using serial dilutions from 25 ⁇ M to 0.4 nM (1:4 dilutions in PBS). Cells were harvested on day 13 post infection.
  • RT-qPCR was performed as described in Example 5.
  • ActinB was used as the endogenous control to calculate dct values.
  • the PD-L1 expression is relative to the endogenous controls and to the saline vehicle.
  • Example 10 Stimulation T cell function in PBMCs derived from chronic HBV patients
  • PBMCs peripheral blood mononuclear cells
  • PBMCs from three chronic HBV infected patients were thawed and seeded at a density of 200'000 cells/well in 100 ⁇ l medium (RPM11640 + GlutaMax+ 8% Human Serum + 25mM Hepes + 1% PenStrep).
  • RPM11640 + GlutaMax+ 8% Human Serum + 25mM Hepes + 1% PenStrep The next day, cells were stimulated with 1 ⁇ M PepMix HBV Large Envelope Protein or 1 ⁇ M PepMix HBV Core Protein (see table 9) with or without 5 ⁇ M of CMP ID NO: 466_1 or CMP ID NO: 640_1 in 100 ⁇ l medium containing 100pg/ml IL-12 and 5ng/ml IL-7 (Concanavalin stimulation was only applied at day 8).
  • PD-L1 antisense oligonucleotide treatment was renewed with medium containing 50IU IL-2.
  • the cells were re-stimulated with PepMix or 5 ⁇ g/ml Concanavalin A plus PD-L1 antisense oligonucleotide for 24h.
  • 0.1 ⁇ l Brefeldin A, 0.1 ⁇ l Monensin and 3 ⁇ l anti-human CD-107 (APC) were added.
  • FACS measurement was performed on a BD Fortessa (BD Biosciences).
  • the whole cell population was first gated on live cells (Live and Death stain, BV510), and then on CD3+ (BV605) cells.
  • the CD3+ cells were then graphed as CD107a+ (APC) vs IFN ⁇ + (PE).
  • Table 24 Effect of PD-L1 ASO treatment on CD3+ T cell from PBMCs isolated from three chronically HBV infected patients.
  • No antigen stimulation Envelope antigen Core antigen Saline CMP 466_1 CMP 640_1 Saline CMP 466_1 CMP 640_1 Saline CMP 466_1 CMP 640_1 INF ⁇ -/CD107+ 1.16 4.95 4.81 4.7 9.12 8.62 3.84 9.66 7.31 2.7 3.59 2.74 2.57 3.69 3.2 3.25 3.34 2.92 3 3.87 3.98 4.59 12.5 10.9 9.23 6.11 6.88 INF ⁇ +/CD107+ 0.12 1.03 1.15 3.19 17.3 18.9 2.38 15.1 5.75 0.49 3.12 1.75 2.73 7 5.34 1.63 2.35 1.9 0.24 1.13 1.5 1.6 8.16 3.06 1.68 1.9 1.91 INF ⁇ +/ CD107- 0.33 1.43 1.08 5.11 7.74 9.47 3.14 7.76 2.83 0.61 2.9 2.26 7.84 5.79
  • the addition of PD-L1 antisense oligonucleotide CMP 466_1 or 640_1 resulted in an additional increase of CD3+ T cell response. This increase was mainly observed in the HBV envelop stimulated group.

Description

    FIELD OF INVENTION
  • The present invention relates to oligonucleotides (oligomers) that are complementary to programmed death ligand-1 (PD-L1), leading to reduction of the expression of PD-L1 the liver. The present invention also relates to a method of alleviating the T cell exhaustion caused by an infection of the liver or cancer in the liver. Relevant infections are chronic HBV, HCV and HDV and parasite infections like malaria and toxoplasmosis (e.g. caused by protozoa of the Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum).
    • BACKGROUND
  • The costimulatory pathway consisting of the programmed death-1 (PD-1) receptor and its ligand, PD-L1 (or B7-H1 or CD274) is known to contribute directly to T cell exhaustion resulting in lack of viral control during chronic infections of the liver. The PD-1 pathway also plays a role in autoimmunity as mice disrupted in this pathway develop autoimmune diseases.
  • It has been shown that antibodies that block the interaction between PD-1 and PD-L1 enhance T cell responses, in particular the response of CD8+ cytotoxic T cells (see Barber et al 2006 Nature Vol 439 p682 and Maier et al 2007 J. Immunol. Vol 178 p 2714).
  • WO 2006/042237 describes a method of diagnosing cancer by assessing PD-L1 (B7-H1) expression in tumors and suggests delivering an agent, which interferes with the PD-1/PD-L1 interaction, to a patient. Interfering agents can be antibodies, antibody fragments, siRNA or antisense oligonucleotides. There are no specific examples of such interfering agents nor is there any mentioning of chronic liver infections.
  • RNA interference mediated inhibition of PD-L1 using double stranded RNA (dsRNA, RNAi or siRNA) molecules have also been disclosed in for example WO 2005/007855 , WO 2007/084865 and US 8,507,663 . None of these describes targeted delivery to the liver.
  • Dolina et al. 2013 Molecular Therapy-Nucleic Acids, 2 e72 describes in vivo delivery of PD-L1 targeting siRNA molecules to Kupffer cells thereby enhancing NK and CD8+ T cell clearance in MCMV infected mice. This paper concludes that PD-L1 targeting siRNA molecules delivered to hepatocytes are not effective in relation to enhancing CD8+ T cell effector function.
  • The siRNA approach is significantly different from the single stranded antisense oligonucleotide approach since the biodistribution and the mode of actions is quite different. As described in Xu et al 2003 Biochem. Biophys. Res .Comm. Vol 306 page 712-717, antisense oligonucleotides and siRNAs have different preferences for target sites in the mRNA.
  • WO2016/138278 describes inhibition of immune checkpoints including PD-L1, using two or more single stranded antisense oligonucleotides that are linked at their 5' ends. The application does not mention HBV or targeted delivery to the liver.
    • OBJECTIVE OF THE INVENTION
  • The present invention identifies novel oligonucleotides and oligonucleotide conjugates which reduce PD-L1 mRNA very efficiently in liver cells, both in parenchymal cells (e.g. hepatocytes) and in non-parenchymal cells such as Kupffer cells and liver sinusoidal endothelial cells (LSECs). By reducing or silencing PD-L1, the oligonucleotides and oligonucleotide conjugates decrease PD-1-mediated inhibition and thereby promote immunostimulation of exhausted T cells. Alleviation of the T cell exhaustion in a chronic pathogenic infection of the liver will result in regained immune control and reduced levels of viral antigens in the blood during a chronic pathogenic infection of the liver. Natural killer (NK) cells and natural killer T (NKT) cells may also be activated by the oligonucleotides and oligonucleotide conjugates of the present invention.
  • The oligonucleotide conjugates secures local reduction of PD-L1 in liver cells and therefore reduces the risk of autoimmune side effects, such as pneumonitis, non-viral hepatitis and colitis associated with systemic depletion of PD-L1.
    • SUMMARY OF INVENTION
  • In one aspect the present invention is an antisense oligonucleotide of formula CCtatttaacatcAGAC, wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine and all internucleoside linkages are phosphorothioate internucleoside linkages.
  • In another aspect the present invention is an antisense oligonucleotide conjugate comprising the oligonucleotide of the present invention and a conjugate moiety covalently attached to said oligonucleotide.
  • In another aspect the present invention is a pharmaceutical composition comprising the antisense oligonucleotide of the present invention or the antisense oligonucleotide conjugate of the present invention and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
  • In another aspect the present invention is an in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of any one of the present invention in an effective amount to said cell.
  • In another aspect the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in restoration of immune response against a virus.
  • In another aspect the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in restoration of immune response against a parasite.
  • In another aspect the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use as a medicament.
  • In another aspect the present invention is the antisense oligonucleotide of the present invention, the antisense oligonucleotide conjugate of the present invention or the pharmaceutical composition of the present invention for use in the treatment of HBV infection.
  • The present invention relates to oligonucleotides or conjugates thereof targeting a nucleic acid capable of modulating the expression of PD-L1 and to treat or prevent diseases related to the functioning of the PD-L1. The oligonucleotides or oligonucleotide conjugates may in particular be used to treat diseases where the immune response against an infectious agent has been exhausted.
  • Accordingly, described herein are oligonucleotides which comprise a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid. The oligonucleotide can be an antisense oligonucleotide, preferably with a gapmer design. Preferably, the oligonucleotide is capable of inhibiting the expression of PD-L1 by cleavage of a target nucleic acid. The cleavage is preferably achieved via nuclease recruitment.
  • In a further aspect, the oligonucleotide of the present invention is conjugated to at least one asialoglycoprotein receptor targeting conjugate moiety, such as a conjugate moiety comprising at least one N-Acetylgalactosamine (GalNAc) moiety. The conjugation moiety and the oligonucleotide may be linked together by a linker, in particular a biocleavable linker.
  • In a further aspect, the invention provides pharmaceutical compositions comprising the oligonucleotides or oligonucleotide conjugates of the invention and pharmaceutically acceptable diluents, carriers, salts and/or adjuvants.
  • Described herein are methods for in vivo or in vitro method for reduction of PD-L1 expression in a target cell which is expressing PD-L1, by administering an oligonucleotide or composition of the invention in an effective amount to said cell.
  • In a further aspect, the invention provides oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention for use in restoration of immunity against a virus or parasite.
  • In a further aspect, the invention provides oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions of the present invention for use as a medicament.
  • Decribed herein are methods for treating or preventing a disease, disorder or dysfunction by administering a therapeutically or prophylactically effective amount of the oligonucleotide of the invention to a subject suffering from or susceptible to the disease, disorder or dysfunction, in particular diseases selected from viral liver infections or parasite infections.
  • As described herein the oligonucleotide, oligonucleotide conjugates or pharmaceutical composition of the invention is used in the treatment or prevention of viral liver infections such as HBV, HCV and HDV or a parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis or liver cancer or metastases in the liver.
    • BRIEF DESCRIPTION OF FIGURES
    • Figure 1 : Illustrates exemplary antisense oligonucleotide conjugates, where the oligonucleotide either is represented as a wavy line (A-D) or as "oligonucleotide" (E-H) or as T2 (I) and the asialoglycoprotein receptor targeting conjugate moieties are trivalent N-acetylgalactosamine moieties. Compounds A to D comprise a di-lysine brancher molecule a PEG3 spacer and three terminal GalNAc carbohydrate moieties. In compound A and B the oligonucleotide is attached directly to the asialoglycoprotein receptor targeting conjugate moiety without a linker. In compound C and D the oligonucleotide is attached directly to the asialoglycoprotein receptor targeting conjugate moiety via a C6 linker. Compounds E-I comprise a trebler brancher molecule and spacers of varying length and structure and three terminal GalNAc carbohydrate moieties.
    • Figure 2 : Graph showing EC50 (A) and PD-L1 knock down as % of saline (B) for the compounds tested in Example 2, in relation to their position on the target nucleic acid. The cell line in which the compound were tested are THP1(•) and Karpas (*).
    • Figure 3 : Structural formula of the trivalent GalNAc cluster (GN2). GN2 is useful as conjugation moiety in the present invention. The wavy line illustrates the site of conjugation of the cluster to e.g. a C6 amino linker or directly to the oligonucleotide.
    • Figure 4 : Structural formula of CMP ID NO 766_2.
    • Figure 5 : Structural formula of CMP ID NO 767_2.
    • Figure 6 : Structural formula of CMP ID NO 768_2.
    • Figure 7 : Structural formula of CMP ID NO 769_2.
    • Figure 8 : Structural formula of CMP ID NO 770_2.
    • Figure 9 : Western blot detecting PD-L1 protein expression in liver from poly(IC) induced animals following treatment with saline and the indicated CMP ID NO's. Each blot shows a naked oligonucleotide versus a GalNAc conjugated version of the same oligonucleotide, blot A) CMP ID NO 744_1 and 755_2, B) CMP ID NO 747_1 and 758_2, C) CMP ID NO 748_1 and 759_2, D) CMP ID NO 752_1 and 763_2 and E) CMP ID NO 753_1 and 764_2. The upper band is the vinculin loading control, the lower band is the PD-L1 protein. The first lane in each blot show saline treated mice without Poly(IC) induction. These mice express very little PD-L protein.
    • Figure 10 : Population of mononuclear cells in the liver after treatment with ● vehicle (group 10 and 1), ◆ DNA vaccine (group 11 and 2), ○ anti-PD-L1 antibody (group 12), ▲naked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), for each group the individual animals are represented and the average is indicated by the vertical line for each group (see table 18). Statistical significance between the DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by * between the groups (* = P< 0.05, *** = P< 0.001 and **** = P< 0.0001). A) represents the number of T cells in the liver following treatment. B) represents the fraction of CD4+ T cells and C) represents the fraction of CD8+ T cells.
    • Figure 11 : Modulation of PD-L1 positive cells in the liver after treatment with ● vehicle (group 10 and 1), ◆ DNA vaccine (group 11 and 2), ○ anti-PD-L1 antibody (group 12), ▲naked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), for each group the individual animals are represented and the average is indicated by the vertical line for each group (see table 19). Statistical significance between the DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by * between the groups (* = P< 0.05 and **** = P< 0.0001). A) represents the pertentage of CD8+ T cells which express PD-L1 in the liver following treatment. B) represents the pertentage of CD4+ T cells which express PD-L1 in the liver following treatment and C) represents the pertentage of B cells which express PD-L1 in the liver following treatment.
    • Figure 12 : HBV antigen specific CD8+ cytokine secreting cells in the liver after treatment with ● vehicle (group 10 and 1), ◆ DNA vaccine (group 11 and 2), ○ anti-PD-L1 antibody (group 12), ▲naked PD-L1 ASO + DNA vaccine (group 7) or △ GalNAc conjugated PD-L1 ASO + DNA vaccine (group 8), for each group the individual animals are represented and the average is indicated by the vertical line for each group (see table 20). Statistical significance between the DNA vaccine group and the three treatment groups has been assessed and if present it is indicated by * between the groups (* = P< 0.05). A) represents the pertentage of IFN-γ secreting CD8+ T cells in the liver which are specific towards HBV PreS2+S antigen following treatment. B) represents the pertentage of IFN-γ secreting CD8+ T cells in the liver which are specific towards HBV core antigen following treatment and C) represents the pertentage of IFN-γ and TNF-α secreting CD8+ T cells in the liver which are specific towards HBV PreS2+S antigen following treatment.
    • Figure 13 : HBV-DNA, HBsAg and HBeAg in AAV/HBV mice following treatment with GalNAc conjugated PD-L1 antisense CMP NO: 759_2 (▼) compared to vehicle (■). The vertical line indicates the end of treatment.
    DEFINITIONS Oligonucleotide
  • The term "oligonucleotide" as used herein is defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are commonly made in the laboratory by solid-phase chemical synthesis followed by purification. When referring to a sequence of the oligonucleotide, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides. The oligonucleotide of the invention is man-made, and is chemically synthesized, and is typically purified or isolated. The oligonucleotide of the invention may comprise one or more modified nucleosides or nucleotides.
    • Antisense oligonucleotides
  • The term "Antisense oligonucleotide" as used herein is defined as oligonucleotides capable of modulating expression of a target gene by hybridizing to a target nucleic acid, in particular to a contiguous sequence on a target nucleic acid. The antisense oligonucleotides are not essentially double stranded and are therefore not siRNAs. Preferably, the antisense oligonucleotides of the present invention are single stranded.
    • Contiguous Nucleotide Sequence
  • The term "contiguous nucleotide sequence" refers to the region of the oligonucleotide which is complementary to the target nucleic acid. The term is used interchangeably herein with the term "contiguous nucleobase sequence" and the term "oligonucleotide motif sequence". In some embodiments all the nucleotides of the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments the oligonucleotide comprises the contiguous nucleotide sequence and may optionally comprise further nucleotide(s), for example a nucleotide linker region which may be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid.
    • Nucleotides
  • Nucleotides are the building blocks of oligonucleotides and polynucleotides and for the purposes of the present invention include both naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides, such as DNA and RNA nucleotides comprise a ribose sugar moiety, a nucleobase moiety and one or more phosphate groups (which is absent in nucleosides). Nucleosides and nucleotides may also interchangeably be referred to as "units" or "monomers".
    • Modified nucleoside
  • The term "modified nucleoside" or "nucleoside modification" as used herein refers to nucleosides modified as compared to the equivalent DNA or RNA nucleoside by the introduction of one or more modifications of the sugar moiety or the (nucleo)base moiety. The modified nucleoside comprise a modified sugar moiety. The term modified nucleoside may also be used herein interchangeably with the term "nucleoside analogue" or modified "units" or modified "monomers".
    • Modified internucleoside linkage
  • The term "modified internucleoside linkage" is defined as generally understood by the skilled person as linkages other than phosphodiester (PO) linkages, that covalently couples two nucleosides together. Nucleotides with modified internucleoside linkage are also termed "modified nucleotides". In some embodiments, the modified internucleoside linkage increases the nuclease resistance of the oligonucleotide compared to a phosphodiester linkage. For naturally occurring oligonucleotides, the internucleoside linkage includes phosphate groups creating a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful in stabilizing oligonucleotides for in vivo use, and may serve to protect against nuclease cleavage at regions of DNA or RNA nucleosides in the oligonucleotide of the invention, for example within the gap region of a gapmer oligonucleotide, as well as in regions of modified nucleosides.
  • In an embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from the natural phosphodiester to a linkage that is for example more resistant to nuclease attack. Nuclease resistance may be determined by incubating the oligonucleotide in blood serum or by using a nuclease resistance assay (e.g. snake venom phosphodiesterase (SVPD)), both are well known in the art. Internucleoside linkages which are capable of enhancing the nuclease resistance of an oligonucleotide are referred to as nuclease resistant internucleoside linkages. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are modified. It will be recognized that, in some embodiments the nucleosides which link the oligonucleotide of the invention to a non-nucleotide functional group, such as a conjugate, may be phosphodiester. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are nuclease resistant internucleoside linkages.
  • Modified internucleoside linkages may be selected from the group comprising phosphorothioate, diphosphorothioate and boranophosphate. In some embodiments, the modified internucleoside linkages are compatible with the RNaseH recruitment of the oligonucleotide of the invention, for example phosphorothioate, diphosphorothioate or boranophosphate.
  • In some embodiments the internucleoside linkage comprises sulphur (S), such as a phosphorothioate internucleoside linkage.
  • A phosphorothioate internucleoside linkage is particularly useful due to nuclease resistance, beneficial pharmakokinetics and ease of manufacture. In some embodiments at least 50% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate, such as at least 60%, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside linkages in the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate. In some embodiments all of the internucleoside linkages of the oligonucleotide, or contiguous nucleotide sequence thereof, are phosphorothioate.
  • In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkage, particularly a internucleoside linkage selected from phosphotriester, methylphosphonate, MMI, amide-3, formacetal or thioformacetal.
  • Further internucleoside linkages are disclosed in WO2009/124238 . In an embodiment the internucleoside linkage is selected from linkers disclosed in WO2007/031091 . Particularly, the internucleoside linkage may be selected from -O-P(O)2-O-, -O-P(O,S)-O-, -O-P(S)2-O-, -S-P(O)2-O-, -S-P(O,S)-O-, -S-P(S)2-O-, -O-P(O)2-S-, -O-P(O,S)-S-, -S-P(O)2-S-, -O-PO(RH)-O-, 0-PO(OCH3)-0-, -O-PO(NRH)-O-, -O-PO(OCH2CH2S-R)-O-, -O-PO(BH3)-O-, -O-PO(NHRH)-O-, -OP(O)2-NRH-, -NRH-P(O)2-O-, -NRH-CO-O-, -NRH-CO-NRH-, and/or the internucleoside linker may be selected form the group consisting of: -O-CO-O-, -O-CO-NRH-, -NRH-CO-CH2-, -O-CH2-CO-NRH-, -O-CH2-CH2-NRH-, -CO-NRH-CH2-, -CH2-NRHCO-, -O-CH2-CH2-S-, -S-CH2-CH2-O-, -S-CH2-CH2-S-, -CH2-SO2-CH2-, -CH2-CO-NRH-, -O-CH2-CH2-NRH-CO-, -CH2-NCH3-O-CH2-, where RH is selected from hydrogen and C1 -4-alkyl.
  • Nuclease resistant linkages, such as phosphothioate linkages, are particularly useful in oligonucleotide regions capable of recruiting nuclease when forming a duplex with the target nucleic acid, such as region G for gapmers, or the non-modified nucleoside region of headmers and tailmers. Phosphorothioate linkages may, however, also be useful in non-nuclease recruiting regions and/or affinity enhancing regions such as regions F and F' for gapmers, or the modified nucleoside region of headmers and tailmers.
  • Each of the design regions may however comprise internucleoside linkages other than phosphorothioate, such as phosphodiester linkages, in particularly in regions where modified nucleosides, such as LNA, protect the linkage against nuclease degradation. Inclusion of phosphodiester linkages, such as one or two linkages, particularly between or adjacent to modified nucleoside units (typically in the non-nuclease recruiting regions) can modify the bioavailability and/or bio-distribution of an oligonucleotide - see WO2008/113832 .
  • As described herein all the internucleoside linkages in the oligonucleotide are phosphorothioate and/or boranophosphate linkages. Preferably, all the internucleoside linkages in the oligonucleotide are phosphorothioate linkages.
    • Nucleobase
  • The term nucleobase includes the purine (e.g. adenine and guanine) and pyrimidine (e.g. uracil, thymine and cytosine) moiety present in nucleosides and nucleotides which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention the term nucleobase also encompasses modified nucleobases which may differ from naturally occurring nucleobases, but are functional during nucleic acid hybridization. In this context "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine and hypoxanthine, as well as non-naturally occurring variants. Such variants are for example described in Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.
  • In a some embodiments the nucleobase moiety is modified by changing the purine or pyrimidine into a modified purine or pyrimidine, such as substituted purine or substituted pyrimidine, such as a nucleobased selected from isocytosine, pseudoisocytosine, 5-methyl cytosine, 5-thiozolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.
  • The nucleobase moieties may be indicated by the letter code for each corresponding nucleobase, e.g. A, T, G, C or U, wherein each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplified oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methyl cytosine. Optionally, for LNA gapmers, 5-methyl cytosine LNA nucleosides may be used.
    • Modified oligonucleotide
  • The term modified oligonucleotide describes an oligonucleotide comprising one or more sugar-modified nucleosides and/or modified internucleoside linkages. The term chimeric" oligonucleotide is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.
    • Complementarity
  • The term "complementarity" describes the capacity for Watson-Crick base-pairing of nucleosides/nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A) - thymine (T)/uracil (U). It will be understood that oligonucleotides may comprise nucleosides with modified nucleobases, for example 5-methyl cytosine is often used in place of cytosine, and as such the term complementarity encompasses Watson Crick base-paring between non-modified and modified nucleobases (see for example Hirao et al (2012) Accounts of Chemical Research vol 45 page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).
  • The term "% complementary" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are complementary to (i.e. form Watson Crick base pairs with) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that form pairs between the two sequences (when aligned with the target sequence 5'-3' and the oligonucleotide sequence from 3'-5'), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such a comparison a nucleobase/nucleotide which does not align (form a base pair) is termed a mismatch.
  • The term "fully complementary", refers to 100% complementarity.
  • The following is an example of an oligonucleotide (SEQ ID NO: 5) that is fully complementary to the target nucleic acid (SEQ ID NO: 772).
    • 5'gcagtagagccaatta3' (SEQ ID NO:772)
    • 3'cgtcatctcggttaat5' (SEQ ID NO: 5)
    Identity
  • The term "Identity" as used herein, refers to the number of nucleotides in percent of a contiguous nucleotide sequence in a nucleic acid molecule (e.g. oligonucleotide) which, at a given position, are identical to (i.e. in their ability to form Watson Crick base pairs with the complementary nucleoside) a contiguous nucleotide sequence, at a given position of a separate nucleic acid molecule (e.g. the target nucleic acid). The percentage is calculated by counting the number of aligned bases that are identical between the two sequences, including gaps, dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. Percent Identity = Matches × 100 / Length of aligned region with gaps .
    Figure imgb0001
    • Hybridization
  • The term "hybridizing" or "hybridizes" as used herein is to be understood as two nucleic acid strands (e.g. an oligonucleotide and a target nucleic acid) forming hydrogen bonds between base pairs on opposite strands thereby forming a duplex. The affinity of the binding between two nucleic acid strands is the strength of the hybridization. It is often described in terms of the melting temperature (Tm) defined as the temperature at which half of the oligonucleotides are duplexed with the target nucleic acid. At physiological conditions Tm is not strictly proportional to the affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515-537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (Kd) of the reaction by ΔG°=-RTIn(Kd), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and the target nucleic acid reflects a strong hybridization between the oligonucleotide and target nucleic acid. ΔG° is the energy associated with a reaction where aqueous concentrations are 1M, the pH is 7, and the temperature is 37°C. The hybridization of oligonucleotides to a target nucleic acid is a spontaneous reaction and for spontaneous reactions ΔG° is less than zero. ΔG° can be measured experimentally, for example, by use of the isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discov Today . The skilled person will know that commercial equipment is available for ΔG° measurements. ΔG° can also be estimated numerically by using the nearest neighbor model as described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460-1465 using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. In order to have the possibility of modulating its intended nucleic acid target by hybridization, oligonucleotides of the present invention hybridize to a target nucleic acid with estimated ΔG° values below -10 kcal for oligonucleotides that are 10-30 nucleotides in length. In some embodiments the degree or strength of hybridization is measured by the standard state Gibbs free energy ΔG°. The oligonucleotides may hybridize to a target nucleic acid with estimated ΔG° values below the range of -10 kcal, such as below -15 kcal, such as below -20 kcal and such as below -25 kcal for oligonucleotides that are 8-30 nucleotides in length. In some embodiments the oligonucleotides hybridize to a target nucleic acid with an estimated ΔG° value of -10 to -60 kcal, such as -12 to -40, such as from -15 to -30 kcal or-16 to -27 kcal such as -18 to -25 kcal.
    • Target nucleic acid
  • According to the present invention, the target nucleic acid is a nucleic acid which encodes mammalian PD-L1 and may for example be a gene, a RNA, a mRNA, and pre-mRNA, a mature mRNA or a cDNA sequence. The target may therefore be referred to as a PD-L1 target nucleic acid. The oligonucleotide as described herein may for example target exon regions of a mammalian PD-L1, or may for example target intron region in the PD-L1 pre-mRNA (see Table 1). Table 1: human PD-L1 Exons and Introns
    Exonic regions in the human PD-L1 premRNA (SEQ ID NO 1) Intronic regions in the human PD-L1 premRNA (SEQ ID NO 1)
    ID start end ID start end
    e1
    1 94 i1 95 5597
    e2 5598 5663 i2 5664 6576
    e3 6577 6918 i3 6919 12331
    e4 12332 12736 i4 12737 14996
    e5 14997 15410 i5 15411 16267
    e6 16268 16327 i6 16328 17337
    e7 17338 20064
  • Suitably, the target nucleic acid encodes a PD-L1 protein, in particular mammalian PD-L1, such as human PD-L1 (See for example tables 2 and 3, which provide reference to the mRNA and pre-mRNA sequences for human, monkey, and mouse PD-L1). In the context of the present invention pre-mRNA is also considered as a nucleic acid that encodes a protein.
  • In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NO: 1, 2 and 3 or naturally occurring variants thereof (e.g. sequences encoding a mammalian PD-L1 protein).
  • If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
  • For in vivo or in vitro application, the oligonucleotide of the invention is typically capable of inhibiting the expression of the PD-L1 target nucleic acid in a cell which is expressing the PD-L1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotide of the invention is typically complementary to the PD-L1 target nucleic acid, as measured across the length of the oligonucleotide, optionally with the exception of one or two mismatches, and optionally excluding nucleotide based linker regions which may link the oligonucleotide to an optional functional group such as a conjugate, or other non-complementary terminal nucleotides (e.g. region D' or D"). The target nucleic acid may, in some embodiments, be a RNA or DNA, such as a messenger RNA, such as a mature mRNA or a pre-mRNA. In some embodiments the target nucleic acid is a RNA or DNA which encodes mammalian PD-L1 protein, such as human PD-L1, e.g. the human PD-L1 premRNA sequence, such as that disclosed as SEQ ID NO 1 or the human mRNA sequence with NCBI reference number NM_014143. Further information on exemplary target nucleic acids is provided in tables 2 and 3. Table 2: Genome and assembly information for PD-L1 across species.
    Species Chr. Strand Genomic coordinates Assembly NCBI reference sequence* accession number for mRNA
    Start End
    Human
    9 fwd 5450503 5470566 GRCh38:CM000671.2 NM_014143
    Cynomol gus monkey 15 73560846 73581371 GCF_000364345.1 XM_005581779
    Mouse
    19 fwd 29367455 29388095 GRCm38:CM001012.2 NM_021893
    Fwd = forward strand. The genome coordinates provide the pre-mRNA sequence (genomic sequence). The NCBI reference provides the mRNA sequence (cDNA sequence).
    *The National Center for Biotechnology Information reference sequence database is a comprehensive, integrated, non-redundant, well-annotated set of reference sequences including genomic, transcript, and protein. It is hosted at www.ncbi.nlm.nih.gov/refseq.
    Table 3: Sequence details for PD-L1 across species.
    Species RNA type Length (nt) SEQ ID NO
    Human premRNA 20064 1
    Monkey Cyno premRNA GCF ref 20261 2
    Monkey Cyno premRNA Internal 20340 3
    Mouse premRNA 20641 4
    • Target Sequence
  • The term "target sequence" as used herein refers to a sequence of nucleotides present in the target nucleic acid which comprises the nucleobase sequence which is complementary to the oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid which is complementary to the contiguous nucleotide sequence of the oligonucleotide of the invention. In some embodiments the target sequence is longer than the complementary sequence of a single oligonucleotide, and may, for example represent a preferred region of the target nucleic acid which may be targeted by several oligonucleotides of the invention.
  • The target sequence may be a sub-sequence of the target nucleic acid.
  • In some embodiments the sub-sequence is a sequence selected from the group consisting of a1-a149 (see tables 4). In some embodiments the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA exon, such as a PD-L1 human mRNA exon selected from the group consisting of e1, e2, e3, e4, e5, e6, and e7 (see table 1 above).
  • In some embodiments the sub-sequence is a sequence selected from the group consisting of a human PD-L1 mRNA intron, such as a PD-L1 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5 and i6 (see table 1 above).
  • The oligonucleotide as described herein comprises a contiguous nucleotide sequence which is complementary to or hybridizes to the target nucleic acid, such as a sub-sequence of the target nucleic acid, such as a target sequence described herein.
  • The oligonucleotide as described herein comprises a contiguous nucleotide sequence of at least 8 nucleotides which is complementary to or hybridizes to a target sequence present in the target nucleic acid molecule. The contiguous nucleotide sequence (and therefore the target sequence) comprises of at least 8 contiguous nucleotides, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as from 12-25, such as from 14-18 contiguous nucleotides.
    • Target Cell
  • The term a "target cell" as used herein refers to a cell which is expressing the target nucleic acid. As described herein the target cell may be in vivo or in vitro. In some embodiments the target cell is a mammalian cell such as a rodent cell, such as a mouse cell or a rat cell, or a primate cell such as a monkey cell or a human cell.
  • In preferred embodiments the target cell expresses PD-L1 mRNA, such as the PD-L1 pre-mRNA or PD-L1 mature mRNA. The poly A tail of PD-L1 mRNA is typically disregarded for antisense oligonucleotide targeting.
    • Naturally occurring variant
  • The term "naturally occurring variant" refers to variants of PD-L1 gene or transcripts which originate from the same genetic loci as the target nucleic acid, but may differ for example, by virtue of degeneracy of the genetic code causing a multiplicity of codons encoding the same amino acid, or due to alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms, and allelic variants. Based on the presence of the sufficient complementary sequence to the oligonucleotide, the oligonucleotide of the invention may therefore target the target nucleic acid and naturally occurring variants thereof.
  • In some embodiments, the naturally occurring variants have at least 95% such as at least 98% or at least 99% homology to a mammalian PD-L1 target nucleic acid, such as a target nucleic acid selected form the group consisting of SEQ ID NO 1, 2 and 3.
  • Numerous single nucleotide polymorphisms are known in the PD-L1 gene, for example those disclosed in the following table (human premRNA start/reference sequence is SEQ ID NO 2)
    Variant name Variant alleles minor allele Minor allele frequency Start on SEQ ID NO: 1
    rs73397192 G/A A 0,10 2591
    rs12342381 A/G G 0,12 308
    rs16923173 G/A A 0,13 14760
    rs2890658 C/A A 0,16 14628
    rs2890657 G/C C 0,21 2058
    rs3780395 A/G A 0,21 14050
    rs147367592 AG/- - 0,21 13425
    rs7023227 T/C T 0,22 6048
    rs2297137 G/A A 0,23 15230
    rs1329946 G/A A 0,23 2910
    rs5896124 -/G G 0,23 2420
    rs61061063 T/C C 0,23 11709
    rs1411263 T/C C 0,23 8601
    rs59906468 A/G G 0,23 15583
    rs6476976 T/C T 0,24 21012
    rs35744625 C/A A 0,24 3557
    rs17804441 T/C C 0,24 7231
    rs148602745 C/T T 0,25 22548
    rs4742099 G/A A 0,25 20311
    rs10815228 T/C C 0,25 21877
    rs58817806 A/G G 0,26 20769
    rs822342 T/C T 0,27 3471
    rs10481593 G/A A 0,27 7593
    rs822339 A/G A 0,28 2670
    rs860290 A/C A 0,28 2696
    rs822340 A/G A 0,28 2758
    rs822341 T/C T 0.28 2894
    rs12002985 C/G C 0.28 6085
    rs822338 C/T C 0.28 1055
    rs866066 C/T T 0.28 451
    rs6651524 A/T T 0.28 8073
    rs6415794 A/T A 0.28 8200
    rs4143815 G/C C 0.28 17755
    rs111423622 G/A A 0.28 24096
    rs6651525 C/A A 0.29 8345
    rs4742098 A/G G 0.29 19995
    rs10975123 C/T T 0.30 10877
    rs2282055 T/G G 0.30 5230
    rs4742100 A/C C 0.30 20452
    rs60520638 -/TC TC 0.30 9502
    rs17742278 T/C C 0.30 6021
    rs7048841 T/C T 0.30 10299
    rs10815229 T/G G 0.31 22143
    rs10122089 C/T C 0.32 13278
    rs1970000 C/A C 0.32 14534
    rs112071324 AGAGAG/- AGAGAG 0.33 16701
    rs2297136 G/A G 0.33 17453
    rs10815226 A/T T 0.33 9203
    rs10123377 A/G A 0.36 10892
    rs10123444 A/G A 0.36 11139
    rs7042084 G/T G 0.36 7533
    rs10114060 G/A A 0.36 11227
    rs7028894 G/A G 0.36 10408
    rs4742097 C/T C 0.37 5130
    rs1536926 G/T G 0.37 13486
    rs1411262 C/T T 0.39 8917
    rs7041009 G/A A 0.45 12741
    • Modulation of expression
  • The term "modulation of expression" as used herein is to be understood as an overall term for an oligonucleotide's ability to alter the amount of PD-L1 when compared to the amount of PD-L1 before administration of the oligonucleotide. Alternatively modulation of expression may be determined by reference to a control experiment. It is generally understood that the control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mock). It may however also be an individual treated with the standard of care.
  • One type of modulation is an oligonucleotide's ability to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, lessen, lower, avoid or terminate expression of PD-L1, e.g. by degradation of mRNA or blockage of transcription. Another type of modulation is an oligonucleotide's ability to restore, increase or enhance expression of PD-L1, e.g. by repair of splice sites or prevention of splicing or removal or blockage of inhibitory mechanisms such as microRNA repression.
    • High affinity modified nucleosides
  • A high affinity modified nucleoside is a modified nucleotide which, when incorporated into the oligonucleotide enhances the affinity of the oligonucleotide for its complementary target, for example as measured by the melting temperature (Tm). A high affinity modified nucleoside of the present invention preferably result in an increase in melting temperature between +0.5 to +12°C, more preferably between +1.5 to +10°C and most preferably between+3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art and include for example, many 2' substituted nucleosides as well as locked nucleic acids (LNA) (see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).
    • Sugar modifications
  • The oligomer of the invention may comprise one or more nucleosides which have a modified sugar moiety, i.e. a modification of the sugar moiety when compared to the ribose sugar moiety found in DNA and RNA.
  • Numerous nucleosides with modification of the ribose sugar moiety have been made, primarily with the aim of improving certain properties of oligonucleotides, such as affinity and/or nuclease resistance.
  • Such modifications include those where the ribose ring structure is modified, e.g. by replacement with a hexose ring (HNA), or a bicyclic ring, which typically have a biradicle bridge between the C2 and C4 carbons on the ribose ring (LNA), or an unlinked ribose ring which typically lacks a bond between the C2 and C3 carbons (e.g. UNA). Other sugar modified nucleosides include, for example, bicyclohexose nucleic acids ( WO2011/017521 ) or tricyclic nucleic acids ( WO2013/154798 ). Modified nucleosides also include nucleosides where the sugar moiety is replaced with a non-sugar moiety, for example in the case of peptide nucleic acids (PNA), or morpholino nucleic acids.
  • Sugar modifications also include modifications made via altering the substituent groups on the ribose ring to groups other than hydrogen, or the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents may, for example be introduced at the 2', 3', 4' or 5' positions. Nucleosides with modified sugar moieties also include 2' modified nucleosides, such as 2' substituted nucleosides. Indeed, much focus has been spent on developing 2' substituted nucleosides, and numerous 2' substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides, such as enhanced nucleoside resistance and enhanced affinity.
    • 2' modified nucleosides.
  • A 2' sugar modified nucleoside is a nucleoside which has a substituent other than H or -OH at the 2' position (2' substituted nucleoside) or comprises a 2' linked biradicle, and includes 2' substituted nucleosides and LNA (2' - 4' biradicle bridged) nucleosides. For example, the 2' modified sugar may provide enhanced binding affinity and/or increased nuclease resistance to the oligonucleotide. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA, and 2'-F-ANA nucleoside. For further examples, please see e.g. Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavey and Damha, Chemistry and . Below are illustrations of some 2' substituted modified nucleosides.
    Figure imgb0002
    Figure imgb0003
    • Locked Nucleic Acid Nucleosides (LNA).
  • LNA nucleosides are modified nucleosides which comprise a linker group (referred to as a biradicle or a bridge) between C2' and C4' of the ribose sugar ring of a nucleotide. These nucleosides are also termed bridged nucleic acid or bicyclic nucleic acid (BNA) in the literature.
  • As described herein, the modified nucleoside or the LNA nucleosides of the oligomer of the invention has a general structure of the formula I or II:
    Figure imgb0004
    • wherein W is selected from -O-, -S-, -N(Ra)-, -C(RaRb)-, such as, in some embodiments -O-; B designates a nucleobase or modified nucleobase moiety;
    • Z designates an internucleoside linkage to an adjacent nucleoside, or a 5'-terminal group;
    • Z* designates an internucleoside linkage to an adjacent nucleoside, or a 3'-terminal group;
    • X designates a group selected from the list consisting of -C(RaRb)-, -C(Ra)=C(Rb)-,-C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z
  • In some embodiments, X is selected from the group consisting of: -O-, -S-, NH-, NRaRb, -CH2-, CRaRb, -C(=CH2)-, and -C(=CRaRb)-
  • In some embodiments, X is -O-
    Y designates a group selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-,-C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z
  • In some embodiments, Y is selected from the group consisting of: -CH2-, -C(RaRb)-,-CH2CH2-, -C(RaRb)-C(RaRb)-, -CH2CH2CH2-, -C(RaRb)C(RaRb)C(RaRb)-, -C(Ra)=C(Rb)-, and -C(Ra)=N-
  • In some embodiments, Y is selected from the group consisting of: -CH2-, -CHRa-,-CHCH3-, CRaRb-
    or -X-Y- together designate a bivalent linker group (also referred to as a radicle) together designate a bivalent linker group consisting of 1, 2, 3 or 4 groups/atoms selected from the group consisting of -C(RaRb)-, -C(Ra)=C(Rb)-, -C(Ra)=N-, -O-, -Si(Ra)2-, -S-, -SO2-, -N(Ra)-, and >C=Z,
  • In some embodiments, -X-Y- designates a biradicle selected from the groups consisting of: -X-CH2-, -X-CRaRb-, -X-CHRa-, -X-C(HCH3)-, -O-Y-, -O-CH2-, -S-CH2-, -NH-CH2-, -O-CHCH3-, -CH2-O-CH2, -O-CH(CH3CH3)-, -O-CH2-CH2-, OCH2-CH2-CH2-,-O-CH2OCH2-,-O-NCH2-, -C(=CH2)-CH2-, -NRa-CH2-, N-O-CH2, -S-CRaRb- and -S-CHRa-.
  • In some embodiments -X-Y- designates -O-CH2- or -O-CH(CH3)-.
    wherein Z is selected from -O-, -S-, and -N(Ra)-,
    and Ra and, when present Rb, each is independently selected from hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, optionally substituted C1-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, c1-6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkylaminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkylcarbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (=CH2), wherein for all chiral centers, asymmetric groups may be found in either R or S orientation.
    wherein R1, R2, R3, R5 and R5* are independently selected from the group consisting of: hydrogen, optionally substituted C1-6-alkyl, optionally substituted C2-6-alkenyl, optionally substituted C2-6-alkynyl, hydroxy, C1-6-alkoxy, C2-6-alkoxyalkyl, C2-6-alkenyloxy, carboxy, C1-6-alkoxycarbonyl, C1-6-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkylaminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkylcarbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene.
  • In some embodiments R1, R2, R3, R5 and R5* are independently selected from C1-6 alkyl, such as methyl, and hydrogen.
  • In some embodiments R1, R2, R3, R5 and R5* are all hydrogen.
  • In some embodiments R1, R2, R3, are all hydrogen, and either R5 and R5* is also hydrogen and the other of R5 and R5* is other than hydrogen, such as C1-6 alkyl such as methyl.
  • In some embodiments, Ra is either hydrogen or methyl. In some embodiments, when present, Rb is either hydrogen or methyl.
  • In some embodiments, one or both of Ra and Rb is hydrogen
  • In some embodiments, one of Ra and Rb is hydrogen and the other is other than hydrogen
  • In some embodiments, one of Ra and Rb is methyl and the other is hydrogen
  • In some embodiments, both of Ra and Rb are methyl.
  • In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO99/014226 , WO00/66604 , WO98/039352 and WO2004/046160 and include what are commonly known as beta-D-oxy LNA and alpha-L-oxy LNA nucleosides.
  • In some embodiments, the biradicle -X-Y- is -S-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such thio LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 .
  • In some embodiments, the biradicle -X-Y- is -NH-CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such amino LNA nucleosides are disclosed in WO99/014226 and WO2004/046160 .
  • In some embodiments, the biradicle -X-Y- is -O-CH2-CH2- or -O-CH2-CH2- CH2-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are disclosed in WO00/047599 and Morita et al, Bioorganic & Med.Chem. Lett. 12 73-76 and include what are commonly known as 2'-O-4'C-ethylene bridged nucleic acids (ENA).
  • In some embodiments, the biradicle -X-Y- is -O-CH2-, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such 5' substituted LNA nucleosides are disclosed in WO2007/134181 .
  • In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein one or both of Ra and Rb are other than hydrogen, such as methyl, W is O, and all of R1, R2, R3, and one of R5 and R5* are hydrogen, and the other of R5 and R5* is other than hydrogen such as C1-6 alkyl, such as methyl. Such bis modified LNA nucleosides are disclosed in WO2010/077578 .
  • In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2OCH3)- (2' O-methoxyethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH2CH3)- (2'O-ethyl bicyclic nucleic acid - Seth at al., 2010, J. Org. Chem. Vol 75(5) pp. 1569-81). In some embodiments, the biradicle -X-Y- is -O-CHRa-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6' substituted LNA nucleosides are disclosed in WO10036698 and WO07090071 .
  • In some embodiments, the biradicle -X-Y- is -O-CH(CH2OCH3)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such LNA nucleosides are also known as cyclic MOEs in the art (cMOE) and are disclosed in WO07090071 .
  • In some embodiments, the biradicle -X-Y- designate the bivalent linker group -O-CH(CH3)-. - in either the R- or S- configuration. In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-CH2-O-CH2- (Seth at al., 2010, J. Org. Chem). In some embodiments, the biradicle -X-Y- is -O-CH(CH3)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6' methyl LNA nucleosides are also known as cET nucleosides in the art, and may be either (S)cET or (R)cET stereoisomers, as disclosed in WO07090071 (beta-D) and WO2010/036698 (alpha-L).
  • In some embodiments, the biradicle -X-Y- is -O-CRaRb-, wherein in neither Ra or Rb is hydrogen, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments, Ra and Rb are both methyl. Such 6' di-substituted LNA nucleosides are disclosed in WO 2009006478 .
  • In some embodiments, the biradicle -X-Y- is -S-CHRa-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such 6' substituted thio LNA nucleosides are disclosed in WO11156202 . In some 6' substituted thio LNA embodiments Ra is methyl.
  • In some embodiments, the biradicle -X-Y- is -C(=CH2)-C(RaRb)-, such as -C(=CH2)-CH2- , or-C(=CH2)-CH(CH3)-W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. Such vinyl carbo LNA nucleosides are disclosed in WO08154401 and WO09067647 .
  • In some embodiments the biradicle -X-Y- is -N(-ORa)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as N substituted LNAs and are disclosed in WO2008/150729 . In some embodiments, the biradicle -X-Y- together designate the bivalent linker group -O-NRa-CH3-(Seth at al., 2010, J. Org. Chem). In some embodiments the biradicle -X-Y- is -N(Ra)-, W is O, and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl.
  • In some embodiments, one or both of R5 and R5* is hydrogen and, when substituted the other of R5 and R5* is C1-6 alkyl such as methyl. In such an embodiment, R1, R2, R3, may all be hydrogen, and the biradicle -X-Y- may be selected from -O-CH2- or -O-C(HCRa)-, such as -O-C(HCH3)-.
  • In some embodiments, the biradicle is -CRaRb-O-CRaRb-, such as CH2-O-CH2-, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as conformationally restricted nucleotides (CRNs) and are disclosed in WO2013036868 .In some embodiments, the biradicle is -O-CRaRb-O-CRaRb-, such as O-CH2-O-CH2-, W is O and all of R1, R2, R3, R5 and R5* are all hydrogen. In some embodiments Ra is C1-6 alkyl such as methyl. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuoka et al., Nucleic Acids Research 2009 37(4), 1225-1238.
  • Certain examples of LNA nucleosides are presented in Scheme 1.
    Figure imgb0005
  • As illustrated in the examples, in some embodiments of the invention the LNA nucleosides in the oligonucleotides are beta-D-oxy-LNA nucleosides.
    • Nuclease mediated degradation
  • Nuclease mediated degradation refers to an oligonucleotide capable of mediating degradation of a complementary nucleotide sequence when forming a duplex with such a sequence.
  • In some embodiments, the oligonucleotide may function via nuclease mediated degradation of the target nucleic acid, where the oligonucleotides of the invention are capable of recruiting a nuclease, particularly and endonuclease, preferably endoribonuclease (RNase), such as RNase H. Examples of oligonucleotide designs which operate via nuclease mediated mechanisms are oligonucleotides which typically comprise a region of at least 5 or 6 DNA nucleosides and are flanked on one side or both sides by affinity enhancing nucleosides, for example gapmers, headmers and tailmers.
    • RNase H Activity and Recruitment
  • The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when in a duplex with a complementary RNA molecule. WO01/23613 provides in vitro methods for determining RNaseH activity, which may be used to determine the ability to recruit RNaseH. Typically an oligonucleotide is deemed capable of recruiting RNase H if it, when provided with a complementary target nucleic acid sequence, has an initial rate, as measured in pmol/l/min, of at least 5%, such as at least 10% or more than 20% of the of the initial rate determined when using a oligonucleotide having the same base sequence as the modified oligonucleotide being tested, but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, and using the methodology provided by Example 91 - 95 of WO01/23613 .
    • Gapmer
  • The term gapmer as used herein refers to an antisense oligonucleotide which comprises a region of RNase H recruiting oligonucleotides (gap) which is flanked 5' and 3' by regions which comprise one or more affinity enhancing modified nucleosides (flanks or wings). Various gapmer designs are described herein and a characterized by their ability to recruit RNaseH. Headmers and tailmers are oligonucleotides capable of recruiting RNase H where one of the flanks is missing, i.e. only one of the ends of the oligonucleotide comprises affinity enhancing modified nucleosides. For headmers the 3' flank is missing (i.e. the 5' flank comprises affinity enhancing modified nucleosides) and for tailmers the 5' flank is missing (i.e. the 3' flank comprises affinity enhancing modified nucleosides).
    • LNA Gapmer
  • The term LNA gapmer is a gapmer oligonucleotide wherein at least one of the affinity enhancing modified nucleosides is an LNA nucleoside.
    • Mixed Wing Gapmer
  • The term mixed wing gapmer or mixed flank gapmer refers to a LNA gapmer wherein at least one of the flank regions comprise at least one LNA nucleoside and at least one non-LNA modified nucleoside, such as at least one 2' substituted modified nucleoside, such as, for example, 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-Fluoro-RNA and 2'-F-ANA nucleoside(s). As described herein the mixed wing gapmer has one flank which comprises only LNA nucleosides (e.g. 5' or 3') and the other flank (3' or 5' respectfully) comprises 2' substituted modified nucleoside(s) and optionally LNA nucleosides.
    • Gapbreaker
  • The term "gapbreaker oligonucleotide" is used in relation to a gapmer capable of maintaining RNAseH recruitment even though the gap region is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker nucleoside, E) such that the gap region comprise less than 5 consecutive DNA nucleosides. Non-RNaseH recruiting nucleosides are for example nucleosides in the 3' endo conformation, such as LNA's where the bridge between C2' and C4' of the ribose sugar ring of a nucleoside is in the beta conformation, such as beta-D-oxy LNA or ScET nucleoside. The ability of gapbreaker oligonucleotide to recruit RNaseH is typically sequence or even compound specific - see Rukov et al. 2015 Nucl. Acids Res. Vol. 43 pp. 8476-8487, which discloses "gapbreaker" oligonucleotides which recruit RNaseH which in some instances provide a more specific cleavage of the target RNA.
  • The oligonucleotide of the invention described herein may be a gapbreaker oligonucleotide. As described herein the gapbreaker oligonucleotide may comprise a 5'-flank (F), a gap (G) and a 3'-flank (F'), wherein the gap is disrupted by a non-RNaseH recruiting nucleoside (a gap-breaker nucleoside, E) such that the gap contain at least 3 or 4 consecutive DNA nucleosides. As described herein the gapbreaker nucleoside (E) may be an LNA nucleoside where the bridge between C2' and C4' of the ribose sugar ring of a nucleoside is in the beta conformation and is placed within the gap region such that the gap-breaker LNA nucleoside is flanked 5' and 3' by at least 3 (5') and 3 (3') or at least 3 (5') and 4 (3') or at least 4(5') and 3(3') DNA nucleosides, and wherein the oligonucleotide is capable of recruiting RNaseH.
  • The gapbreaker oligonucleotide can be represented by the following formulae:
    • F-G-E-G-F'; in particular F1-7-G3-4-E1-G3-4-F'1-7
    • D'-F-G-F', in particular D'1-3-F1-7-G3-4-E1-G3-4-F'1-7
    • F-G-F'-D", in particular F1-7-G3-4-E1-G3-4-F'1-7-D"1-3
    • D'-F-G-F'-D", in particular D'1-3-F1-7-G3-4-E1-G3-4-F'1-7-D"1-3
  • Where region D' and D" are as described in the section "Gapmer design".
  • As described herein the gapbreaker nucleoside (E) is a beta-D-oxy LNA or ScET or another beta-LNA nucleosides shown in Scheme 1).
    • Conjugate
  • The term conjugate as used herein refers to an oligonucleotide which is covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region), also termed a oligonucleotide conjugate.
  • Conjugation of the oligonucleotides of the invention to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, e.g. by affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotide. In some embodiments the conjugate moiety targets the oligonucleotide to the liver. A the same time the conjugate serve to reduce activity of the oligonucleotide in non-target cell types, tissues or organs, e.g. off target activity or activity in non-target cell types, tissues or organs. In one embodiment of the invention the oligonucleotide conjugate of the invention display improved inhibition of PD-L1 in the target cell when compared to an unconjugated oligonucleotide. In another embodiment the oligonucleotide conjugate of the invention has improved cellular distribution between liver and other organs, such as spleen or kidney (i.e. more conjugated oligonucleotide goes to the liver than the spleen or kidney) when compared to an unconjugated oligonucleotide. In another embodiment the oligonucleotide conjugate of the invention show improved cellular uptake into the liver of the conjugate oligonucleotide when compared to an unconjugated oligonucleotide.
  • WO 93/07883 and WO2013/033230 provides suitable conjugate moieties. Further suitable conjugate moieties are those capable of binding to the asialoglycoprotein receptor (ASGPr). In particular tri-valent N-acetylgalactosamine conjugate moieties are suitable for binding to the the ASGPr, see for example WO 2014/076196 , WO 2014/207232 and WO 2014/179620 . The conjugate moiety is essentially the part of the antisense oligonucleotides conjugates which is not composed of nucleic acids.
  • Oligonucleotide conjugates and their synthesis has also been reported in comprehensive reviews by Manoharan in Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103.
  • In an embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of carbohydrates, cell surface receptor ligands, drug substances, hormones, lipophilic substances, polymers, proteins, peptides, toxins (e.g. bacterial toxins), vitamins, viral proteins (e.g. capsids) or combinations thereof.
    • Linkers
  • A linkage or linker is a connection between two atoms that links one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. Conjugate moieties can be attached to the oligonucleotide directly or through a linking moiety (e.g. linker or tether). Linkers serve to covalently connect a third region, e.g. a conjugate moiety (Region C), to a first region, e.g. an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A).
  • In some embodiments of the invention the conjugate or oligonucleotide conjugate of the invention may optionally, comprise a linker region (second region or region B and/or region Y) which is positioned between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).
  • Region B refers to biocleavable linkers comprising or consisting of a physiologically labile bond that is cleavable under conditions normally encountered or analogous to those encountered within a mammalian body. Conditions under which physiologically labile linkers undergo chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or agents, and salt concentration found in or analogous to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activity normally present in a mammalian cell such as from proteolytic enzymes or hydrolytic enzymes or nucleases. In one embodiment the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment the nuclease susceptible linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides comprising at least two consecutive phosphodiester linkages, such as at least 3 or 4 or 5 consecutive phosphodiester linkages. Preferably the nucleosides are DNA or RNA. Phosphodiester containing biocleavable linkers are described in more detail in WO 2014/076195 .
  • Region Y refers to linkers that are not necessarily biocleavable but primarily serve to covalently connect a conjugate moiety (region C or third region), to an oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region). The region Y linkers may comprise a chain structure or an oligomer of repeating units such as ethylene glycol, amino acid units or amino alkyl groups The oligonucleotide conjugates of the present invention can be constructed of the following regional elements A-C, A-B-C, A-B-Y-C, A-Y-B-C or A-Y-C. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group.
    • Treatment
  • The term 'treatment' as used herein refers to both treatment of an existing disease (e.g. a disease or disorder as herein referred to), or prevention of a disease, i.e. prophylaxis. It will therefore be recognized that treatment as referred to herein may, in some embodiments, be prophylactic.
    • Restoration of immune response against pathogens
  • The immune response is divided into the innate and adaptive immune response. The innate immune system provides an immediate, but non-specific response. The adaptive immune response is activated by innate immune response and is highly specific to a particular pathogen. Upon presentation of a pathogen-derived antigen on the surface of antigen-presenting cells, immune cells of the adaptive immune response (i.e. T and B lymphocytes) are activated through their antigen-specific receptors leading to a pathogenic-specifc immune response and development of immunological memory. Chronic viral infections, such as HBV and HCV, are associated with T cell exhaustion characterized by unresponsiveness of the viral-specific T cells. T cell exhaustion is well studied, for a review see for example Yi et al 2010 Immunology129, 474-481. Chronic viral infections are also associated with reduced function of NK cells that are innate immune cells. Enhancing viral immune response is important for clearance of chronic infection. Restoration of immune response against pathogens, mediated by T cells and NK cells, can be assessed by measurement of proliferation, cytokine secretion and cytolytic function (Dolina et al. 2013 Molecular Therapy-Nucleic Acids, 2 e72 and Example 6 herein).
    • DETAILED DESCRIPTION OF THE INVENTION
  • The present invention relates to the use of antisense oligonucleotides and conjugates thereof and pharmaceutical compositions comprising these to restore immune response against pathogens that have infected an animal, in particular a human. The antisense oligonucleotide conjugates of the present invention are particular useful against pathogens that have infected the liver, in particular chronic liver infections like HBV. The conjugates allow targeted distribution of the oligonucleotides and prevents systemic knockdown of the target nucleic acid.
    • The Oligonucleotides of the Invention
  • The invention relates to oligonucleotides capable of modulating expression of PD-L1. The modulation is may achieved by hybridizing to a target nucleic acid encoding PD-L1 or which is involved in the regulation of PD-L1. The target nucleic acid may be a mammalian PD-L1 sequence, such as a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2 and/or SEQ ID NO: 3. The target nucleic acid may be a pre-mRNA, an mRNA or any RNA sequence expressed from a mammalian cell that supports the expression or regulation of PD-L1.
  • The oligonucleotide of the invention is an antisense oligonucleotide which targets PD-L1.
  • In one aspect of the invention the oligonucleotide of the invention is conjugated to a conjugate moiety, in particular an asialoglycoprotein receptor targeting conjugate moiety.
  • In some embodiments the antisense oligonucleotide of the invention is capable of modulating the expression of the target by inhibiting or down-regulating it. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the normal expression level of the target, more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the normal expression level of the target. Preferably, such modulation produces an inhibition of expression of at least 20% compared to the expression level when the cell or organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an infectious agent (eg poly I:C or LPS), more preferably at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% inhibition compared to the expression level when the cell or organism is challenged by an infectious agent, or treated with an agent simulating the challenge by an infectious agent (eg poly I:C or LPS). In some embodiments the oligonucleotide of the invention may be capable of inhibiting expression levels of PD-L1 mRNA by at least 60% or 70% in vitro using KARPAS-299 or THP1 cells. In some embodiments compounds of the invention may be capable of inhibiting expression levels of PD-L1 protein by at least 50% in vitro using KARPAS-299 or THP1 cells. Suitably, the examples provide assays which may be used to measure PD-L1 RNA (e.g. example 1). The target modulation is triggered by the hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments the oligonucleotide of the invention comprises mismatches between the oligonucleotide and the target nucleic acid. Despite mismatches, hybridization to the target nucleic acid may still be sufficient to show a desired modulation of PD-L1 expression. Reduced binding affinity resulting from mismatches may advantageously be compensated by increased number of nucleotides in the oligonucleotide and/or an increased number of modified nucleosides capable of increasing the binding affinity to the target, such as 2' modified nucleosides, including LNA, present within the oligonucleotide sequence.
  • In some embodiments the antisense oligonucleotide of the invention is capable of restoring pathogen-specific T cells. In some embodiments, the oligonucleotide of the invention is capable of increasing the pathogen-specific T cells by at least 40%, 50%, 60% or 70% when compared to untreated controls or controls treated with standard of care. In one embodiment the antisense oligonucleotide or conjugate of the invention is capable increasing HBV-specific T cells when compared to untreated controls or controls treated with standard of care. Suitably, the examples provide assays which may be used to measure the HBV-specific T cells (e.g. T cell proliferation, cytokine secretion and cytolytic activity). In another embodiment the the antisense oligonucleotide or conjugate of the invention is capable increasing HCV-specific T cells when compared to untreated controls or controls treated with standard of care. In another embodiment the the antisense oligonucleotide or conjugate of the invention is capable increasing HDV-specific T cells when compared to untreated controls or controls treated with standard of care.
  • In some embodiments the antisense oligonucleotide of the invention is capable reducing HBsAg levels in an animal or human. In some embodiments, the oligonucleotide of the invention is capable of reducing the HBsAg levels by at least 40%, 50%, 60% or 70%, more preferably by at least 80%, 90% or 95% when compared to the level prior to treatment. Most preferably oligonucleotides of the invention are capable of achieving seroconversion of HBsAg in an animal or human infected with HBV.
  • Described herein is an antisense oligonucleotide which comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid.
  • As decribed herein, the oligonucleotide comprises a contiguous sequence which is at least 90% complementary, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, or 100% complementary with a region of the target nucleic acid.
  • As described herein, the oligonucleotide of the invention, or contiguous nucleotide sequence thereof is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments may comprise one or two mismatches between the oligonucleotide and the target nucleic acid.
  • As described herein, the oligonucleotide comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as fully (or 100%) complementary, to a region target nucleic acid region present in SEQ ID NO: 1 or SEQ ID NO: 2. As described herein the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 2. As described herein the oligonucleotide sequence is 100% complementary to a corresponding target nucleic acid region present SEQ ID NO: 1 and SEQ ID NO: 3.
  • As described herein, the oligonucleotide or oligonucleotide conjugate comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region wherein the contiguous nucleotide sequence is complementary to a sub-sequence of the target nucleic acid selected from the group consisting of position 371-3068, 5467-12107 and 15317-19511 on SEQ ID NO: 1. As described herein the sub-sequence of the target nucleic acid is selected from the group consisting of position 371-510, 822-1090, 1992-3068, 5467-5606, 6470-12107, 15317-15720, 15317-18083, 18881-19494 and 1881-19494 on SEQ ID NO: 1. As described herein the sub-sequence of the target nucleic acid is selected from the group consisting of position 7300-7333, 8028-8072, 9812-9859, 11787-11873 and 15690-15735 on SEQ ID NO: 1.
  • As described herein, the oligonucleotide or oligonucleotide conjugate comprises a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementary, such as 100% complementarity, to a corresponding target nucleic acid region present in SEQ ID NO: 1, wherein the target nucleic acid region is selected from the group consisting of region a1 to a449 in table 4. Table 4: Regions of SEQ ID NO 1 which may be targeted using oligonucleotide as described herein
    Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length Reg. a Position in SEQ ID NO 1 Length
    from to from to from to
    a1 51 82 32 a151 6994 7020 27 a301 13092 13115 24
    a2 87 116 30 a152 7033 7048 16 a302 13117 13134 18
    a3 118 133 16 a153 7050 7066 17 a303 13136 13169 34
    a4 173 206 34 a154 7078 7094 17 a304 13229 13249 21
    a5 221 287 67 a155 7106 7122 17 a305 13295 13328 34
    a6 304 350 47 a156 7123 7144 22 a306 13330 13372 43
    a7 354 387 34 a157 7146 7166 21 a307 13388 13406 19
    a8 389 423 35 a158 7173 7193 21 a308 13408 13426 19
    a9 425 440 16 a159 7233 7291 59 a309 13437 13453 17
    a10 452 468 17 a160 7300 7333 34 a310 13455 13471 17
    a11 470 484 15 a161 7336 7351 16 a311 13518 13547 30
    a12 486 500 15 a162 7353 7373 21 a312 13565 13597 33
    a13 503 529 27 a163 7375 7412 38 a313 13603 13620 18
    a14 540 574 35 a164 7414 7429 16 a314 13630 13663 34
    a15 576 649 74 a165 7431 7451 21 a315 13665 13679 15
    a16 652 698 47 a166 7453 7472 20 a316 13706 13725 20
    a17 700 750 51 a167 7474 7497 24 a317 13727 13774 48
    a18 744 758 15 a168 7517 7532 16 a318 13784 13821 38
    a19 774 801 28 a169 7547 7601 55 a319 13831 13878 48
    a20 805 820 16 a170 7603 7617 15 a320 13881 13940 60
    a21 827 891 65 a171 7632 7647 16 a321 13959 14013 55
    a22 915 943 29 a172 7649 7666 18 a322 14015 14031 17
    a23 950 982 33 a173 7668 7729 62 a323 14034 14049 16
    a24 984 1000 17 a174 7731 7764 34 a324 14064 14114 51
    a25 1002 1054 53 a175 7767 7817 51 a325 14116 14226 111
    a26 1060 1118 59 a176 7838 7860 23 a326 14229 14276 48
    a27 1124 1205 82 a177 7862 7876 15 a327 14292 14306 15
    a28 1207 1255 49 a178 7880 7944 65 a328 14313 14384 72
    a29 1334 1349 16 a179 7964 8012 49 a329 14386 14408 23
    a30 1399 1425 27 a180 8028 8072 45 a330 14462 14481 20
    a31 1437 1458 22 a181 8086 8100 15 a331 14494 14519 26
    a32 1460 1504 45 a182 8102 8123 22 a332 14557 14577 21
    a33 1548 1567 20 a183 8125 8149 25 a333 14608 14628 21
    a34 1569 1586 18 a184 8151 8199 49 a334 14646 14668 23
    a35 1608 1662 55 a185 8218 8235 18 a335 14680 14767 88
    a36 1677 1700 24 a186 8237 8276 40 a336 14765 14779 15
    a37 1702 1721 20 a187 8299 8344 46 a337 14815 14844 30
    a38 1723 1745 23 a188 8346 8436 91 a338 14848 14925 78
    a39 1768 1794 27 a189 8438 8470 33 a339 14934 14976 43
    a40 1820 1835 16 a190 8472 8499 28 a340 14978 15009 32
    a41 1842 1874 33 a191 8505 8529 25 a341 15013 15057 45
    a42 1889 1979 91 a192 8538 8559 22 a342 15064 15091 28
    a43 1991 2011 21 a193 8562 8579 18 a343 15094 15140 47
    a44 2013 2038 26 a194 8581 8685 105 a344 15149 15165 17
    a45 2044 2073 30 a195 8688 8729 42 a345 15162 15182 21
    a46 2075 2155 81 a196 8730 8751 22 a346 15184 15198 15
    a47 2205 2228 24 a197 8777 8800 24 a347 15200 15221 22
    a48 2253 2273 21 a198 8825 8865 41 a348 15232 15247 16
    a49 2275 2303 29 a199 8862 8894 33 a349 15250 15271 22
    a50 2302 2333 32 a200 8896 8911 16 a350 15290 15334 45
    a51 2335 2366 32 a201 8938 8982 45 a351 15336 15369 34
    a52 2368 2392 25 a202 8996 9045 50 a352 15394 15416 23
    a53 2394 2431 38 a203 9048 9070 23 a353 15433 15451 19
    a54 2441 2455 15 a204 9072 9139 68 a354 15453 15491 39
    a55 2457 2494 38 a205 9150 9168 19 a355 15496 15511 16
    a56 2531 2579 49 a206 9170 9186 17 a356 15520 15553 34
    a57 2711 2732 22 a207 9188 9202 15 a357 15555 15626 72
    a58 2734 2757 24 a208 9204 9236 33 a358 15634 15652 19
    a59 2772 2786 15 a209 9252 9283 32 a359 15655 15688 34
    a60 2788 2819 32 a210 9300 9331 32 a360 15690 15735 46
    a61 2835 2851 17 a211 9339 9354 16 a361 15734 15764 31
    a62 2851 2879 29 a212 9370 9398 29 a362 15766 15787 22
    a63 2896 2912 17 a213 9400 9488 89 a363 15803 15819 17
    a64 2915 2940 26 a214 9490 9537 48 a364 15846 15899 54
    a65 2944 2973 30 a215 9611 9695 85 a365 15901 15934 34
    a66 2973 2992 20 a216 9706 9721 16 a366 15936 15962 27
    a67 2998 3016 19 a217 9723 9746 24 a367 15964 15985 22
    a68 3018 3033 16 a218 9748 9765 18 a368 15987 16023 37
    a69 3036 3051 16 a219 9767 9788 22 a369 16025 16061 37
    a70 3114 3139 26 a220 9794 9808 15 a370 16102 16122 21
    a71 3152 3173 22 a221 9812 9859 48 a371 16134 16183 50
    a72 3181 3203 23 a222 9880 9913 34 a372 16185 16281 97
    a73 3250 3271 22 a223 9923 9955 33 a373 16283 16298 16
    a74 3305 3335 31 a224 9966 10007 42 a374 16305 16323 19
    a75 3346 3363 18 a225 10009 10051 43 a375 16325 16356 32
    a76 3391 3446 56 a226 10053 10088 36 a376 16362 16404 43
    a77 3448 3470 23 a227 10098 10119 22 a377 16406 16456 51
    a78 3479 3497 19 a228 10133 10163 31 a378 16494 16523 30
    a79 3538 3554 17 a229 10214 10240 27 a379 16536 16562 27
    a80 3576 3597 22 a230 10257 10272 16 a380 16564 16580 17
    a81 3603 3639 37 a231 10281 10298 18 a381 16582 16637 56
    a82 3663 3679 17 a232 10300 10318 19 a382 16631 16649 19
    a83 3727 3812 86 a233 10339 10363 25 a383 16655 16701 47
    a84 3843 3869 27 a234 10409 10426 18 a384 16737 16781 45
    a85 3874 3904 31 a235 10447 10497 51 a385 16783 16804 22
    a86 3926 3955 30 a236 10499 10529 31 a386 16832 16907 76
    a87 3974 3993 20 a237 10531 10546 16 a387 16934 16965 32
    a88 3995 4042 48 a238 10560 10580 21 a388 16972 17035 64
    a89 4053 4073 21 a239 10582 10596 15 a389 17039 17069 31
    a90 4075 4123 49 a240 10600 10621 22 a390 17072 17109 38
    a91 4133 4157 25 a241 10623 10664 42 a391 17135 17150 16
    a92 4158 4188 31 a242 10666 10685 20 a392 17167 17209 43
    a93 4218 4250 33 a243 10717 10773 57 a393 17211 17242 32
    a94 4277 4336 60 a244 10775 10792 18 a394 17244 17299 56
    a95 4353 4375 23 a245 10794 10858 65 a395 17304 17344 41
    a96 4383 4398 16 a246 10874 10888 15 a396 17346 17400 55
    a97 4405 4446 42 a247 10893 10972 80 a397 17447 17466 20
    a98 4448 4464 17 a248 10974 10994 21 a398 17474 17539 66
    a99 4466 4493 28 a249 10996 11012 17 a399 17561 17604 44
    a100 4495 4558 64 a250 11075 11097 23 a400 17610 17663 54
    a101 4571 4613 43 a251 11099 11124 26 a401 17681 17763 83
    a102 4624 4683 60 a252 11140 11157 18 a402 17793 17810 18
    a103 4743 4759 17 a253 11159 11192 34 a403 17812 17852 41
    a104 4761 4785 25 a254 11195 11226 32 a404 17854 17928 75
    a105 4811 4858 48 a255 11235 11261 27 a405 17941 18005 65
    a106 4873 4932 60 a256 11279 11337 59 a406 18007 18035 29
    a107 4934 4948 15 a257 11344 11381 38 a407 18041 18077 37
    a108 4955 4974 20 a258 11387 11411 25 a408 18085 18146 62
    a109 4979 5010 32 a259 11427 11494 68 a409 18163 18177 15
    a110 5012 5052 41 a260 11496 11510 15 a410 18179 18207 29
    a111 5055 5115 61 a261 11512 11526 15 a411 18209 18228 20
    a112 5138 5166 29 a262 11528 11551 24 a412 18230 18266 37
    a113 5168 5198 31 a263 11570 11592 23 a413 18268 18285 18
    a114 5200 5222 23 a264 11594 11634 41 a414 18287 18351 65
    a115 5224 5284 61 a265 11664 11684 21 a415 18365 18395 31
    a116 5286 5302 17 a266 11699 11719 21 a416 18402 18432 31
    a117 5317 5332 16 a267 11721 11746 26 a417 18434 18456 23
    a118 5349 5436 88 a268 11753 11771 19 a418 18502 18530 29
    a119 5460 5512 53 a269 11787 11873 87 a419 18545 18590 46
    a120 5514 5534 21 a270 11873 11905 33 a420 18603 18621 19
    a121 5548 5563 16 a271 11927 11942 16 a421 18623 18645 23
    a122 5565 5579 15 a272 11946 11973 28 a422 18651 18708 58
    a123 5581 5597 17 a273 11975 11993 19 a423 18710 18729 20
    a124 5600 5639 40 a274 12019 12114 96 a424 18731 18758 28
    a125 5644 5661 18 a275 12116 12135 20 a425 18760 18788 29
    a126 5663 5735 73 a276 12137 12158 22 a426 18799 18859 61
    a127 5737 5770 34 a277 12165 12192 28 a427 18861 18926 66
    a128 5778 5801 24 a278 12194 12216 23 a428 18928 18980 53
    a129 5852 5958 107 a279 12218 12246 29 a429 19001 19018 18
    a130 6007 6041 35 a280 12262 12277 16 a430 19034 19054 21
    a131 6049 6063 15 a281 12283 12319 37 a431 19070 19092 23
    a132 6065 6084 20 a282 12334 12368 35 a432 19111 19154 44
    a133 6086 6101 16 a283 12370 12395 26 a433 19191 19213 23
    a134 6119 6186 68 a284 12397 12434 38 a434 19215 19240 26
    a135 6189 6234 46 a285 12436 12509 74 a435 19255 19356 102
    a136 6236 6278 43 a286 12511 12543 33 a436 19358 19446 89
    a137 6291 6312 22 a287 12545 12565 21 a437 19450 19468 19
    a138 6314 6373 60 a288 12567 12675 109 a438 19470 19512 43
    a139 6404 6447 44 a289 12677 12706 30 a439 19514 19541 28
    a140 6449 6482 34 a290 12708 12724 17 a440 19543 19568 26
    a141 6533 6555 23 a291 12753 12768 16 a441 19570 19586 17
    a142 6562 6622 61 a292 12785 12809 25 a442 19588 19619 32
    a143 6624 6674 51 a293 12830 12859 30 a443 19683 19739 57
    a144 6679 6762 84 a294 12864 12885 22 a444 19741 19777 37
    a145 6764 6780 17 a295 12886 12916 31 a445 19779 19820 42
    a146 6782 6822 41 a296 12922 12946 25 a446 19822 19836 15
    a147 6824 6856 33 a297 12948 12970 23 a447 19838 19911 74
    a148 6858 6898 41 a298 12983 13003 21 a448 19913 19966 54
    a149 6906 6954 49 a299 13018 13051 34 a449 19968 20026 59
    a150 6969 6992 24 a300 13070 13090 21
  • As described herein the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of a7, a26, a43, a119, a142, a159, a160, a163, a169, a178, a179, a180, a189, a201, a202, a204, a214, a221, a224, a226, a243, a254, a258, 269, a274, a350, a360, a364, a365, a370, a372, a381, a383, a386, a389, a400, a427, a435 and a438.
  • As described herein the oligonucleotide or contiguous nucleotide sequence is complementary to a region of the target nucleic acid, wherein the target nucleic acid region is selected from the group consisting of a160, a180, a221, a269 and a360.
  • As described herein, the oligonucleotide of the invention comprises or consists of 8 to 35 nucleotides in length, such as from 9 to 30, such as 10 to 22, such as from 11 to 20, such as from 12 to 18, such as from 13 to 17 or 14 to 16 contiguous nucleotides in length. As described herein, the oligonucleotide comprises or consists of 16 to 20 nucleotides in length. It is to be understood that any range given herein includes the range endpoints. Accordingly, if an oligonucleotide is said to include from 10 to 30 nucleotides, both 10 and 30 nucleotides are included.
  • As described herein, the contiguous nucleotide sequence comprises or consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides in length. As described herein, the oligonucleotide comprises or consists of 16, 17, 18, 19 or 20 nucleotides in length.
  • As described herein, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of sequences listed in table 5.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 (see motif sequences listed in table 5).
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 5 to 743 and 771.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to a sequence selected from the group consisting of SEQ ID NO: 6, 8, 9, 13, 41, 42, 58, 77, 92, 111, 128, 151, 164, 166, 169, 171, 222, 233, 245, 246, 250, 251, 252, 256, 272, 273, 287, 292, 303, 314, 318, 320, 324, 336, 342, 343, 344, 345, 346, 349, 359, 360, 374, 408, 409, 415, 417, 424, 429, 430, 458, 464, 466, 474, 490, 493, 512, 519, 519, 529, 533, 534, 547, 566, 567, 578, 582, 601, 619, 620, 636, 637, 638, 640, 645, 650, 651, 652, 653, 658, 659, 660, 665, 678, 679, 680, 682, 683, 684, 687, 694, 706, 716, 728, 733, 734, and 735.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 287.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 342.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 640.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 466.
  • As described herein, the antisense oligonucleotide or contiguous nucleotide sequence comprises or consists of 10 to 30 nucleotides in length with at least 90% identity, preferably 100% identity, to SEQ ID NO: 566.
  • As described herein where the oligonucleotide is longer than the contigious nucleotide sequence (which is complementary to the target nucleic acid), the motif sequences in table 5 form the contigious nucleotide sequence part of the antisense oligonucleotides of the invention. As described herein the sequence of the oligonucleotide is equivalent to the contigious nucleotide sequence (e.g. if no biocleavable linkers are added).
  • It is understood that the contiguous nucleobase sequences (motif sequence) can be modified to for example increase nuclease resistance and/or binding affinity to the target nucleic acid. Modifications are described in the definitions and in the "Oligonucleotide design" section. Table 5 lists preferred designs of each motif sequence.
    • Oligonucleotide design
  • Oligonucleotide design refers to the pattern of nucleoside sugar modifications in the oligonucleotide sequence. The oligonucleotides as described herein comprise sugar-modified nucleosides and may also comprise DNA or RNA nucleosides. In some embodiments, the oligonucleotide described herein comprises sugar-modified nucleosides and DNA nucleosides. Incorporation of modified nucleosides into the oligonucleotide described herein may enhance the affinity of the oligonucleotide for the target nucleic acid. In that case, the modified nucleosides can be referred to as affinity enhancing modified nucleotides, the modified nucleosides may also be termed units.
  • As described herein, the oligonucleotide comprises at least 1 modified nucleoside, such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 modified nucleosides. As described herein the oligonucleotide comprises from 1 to 10 modified nucleosides, such as from 2 to 8 modified nucleosides, such as from 3 to 7 modified nucleosides, such as from 4 to 6 modified nucleosides, such as 3, 4, 5, 6 or 7 modified nucleosides.
  • As described herein, the oligonucleotide comprises one or more sugar modified nucleosides, such as 2' sugar modified nucleosides. Preferably the oligonucleotide described herein comprise the one or more 2' sugar modified nucleoside independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. Even more preferably the one or more modified nucleoside is a locked nucleic acid (LNA).
  • As described herein the oligonucleotide comprises at least one modified internucleoside linkage. As described herein all the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate or boranophosphate internucleoside linkages. In some embodiments all the internucleotide linkages in the contiguous sequence of the oligonucleotide are phosphorothioate linkages.
  • As described herein, the oligonucleotide of the invention comprises at least one LNA nucleoside, such as 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, such as from 2 to 6 LNA nucleosides, such as from 3 to 7 LNA nucleosides, 4 to 6 LNA nucleosides or 3, 4, 5, 6 or 7 LNA nucleosides. As described herein, at least 75% of the modified nucleosides in the oligonucleotide are LNA nucleosides, such as 80%, such as 85%, such as 90% of the modified nucleosides are LNA nucleosides. As described herein all the modified nucleosides in the oligonucleotide are LNA nucleosides. As described herein, the oligonucleotide may comprise both beta-D-oxy-LNA, and one or more of the following LNA nucleosides: thio-LNA, amino-LNA, oxy-LNA, and/or ENA in either the beta-D or alpha-L configurations or combinations thereof. In a further embodiment, all LNA cytosine units are 5-methyl-cytosine. As described herein the oligonucleotide or contiguous nucleotide sequence has at least 1 LNA nucleoside at the 5' end and at least 2 LNA nucleosides at the 3' end of the nucleotide sequence.
  • As described herein, the oligonucleotide of the invention comprises at least one modified nucleoside which is a 2'-MOE-RNA nucleoside, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-MOE-RNA nucleosides. As described herein, at least one of said modified nucleoside is 2'-fluoro DNA, such as 2, 3, 4, 5, 6, 7, 8, 9 or 10 2'-fluoro-DNA nucleosides.
  • The oligonucleotide as described herein comprises at least one LNA nucleoside and at least one 2' substituted modified nucleoside.
  • As described herein, the oligonucleotide comprise both 2' sugar modified nucleosides and DNA units. Preferably the oligonucleotide comprises both LNA and DNA nucleosides (units). Preferably, the combined total of LNA and DNA units is 8-30, such as 10 - 25, preferably 12-22, such as 12 - 18, even more preferably 11-16. As described herein, the nucleotide sequence of the oligonucleotide, such as the contiguous nucleotide sequence consists of at least one or two LNA nucleosides and the remaining nucleosides are DNA units. As described herein the oligonucleotide comprises only LNA nucleosides and naturally occurring nucleosides (such as RNA or DNA, most preferably DNA nucleosides), optionally with modified internucleoside linkages such as phosphorothioate.
  • In an embodiment of the invention the oligonucleotide of the invention is capable of recruiting RNase H.
  • The structural design of the oligonucleotide as described herein may be selected from gapmers, gapbreakers, headmers and tailmers.
    • Gapmer design
  • In a preferred embodiment the oligonucleotide of the invention has a gapmer design or structure also referred herein merely as "Gapmer". In a gapmer structure the oligonucleotide comprises at least three distinct structural regions a 5'-flank, a gap and a 3'-flank, F-G-F' in '5 -> 3' orientation. In this design, flanking regions F and F' (also termed wing regions) comprise a contiguous stretch of modified nucleosides, which are complementary to the PD-L1 target nucleic acid, while the gap region, G, comprises a contiguous stretch of nucleotides which are capable of recruiting a nuclease, preferably an endonuclease such as RNase, for example RNase H, when the oligonucleotide is in duplex with the target nucleic acid. Nucleosides which are capable of recruiting a nuclease, in particular RNase H, can be selected from the group consisting of DNA, alpha-L-oxy-LNA, 2'-Flouro-ANA and UNA. Regions F and F', flanking the 5' and 3' ends of region G, preferably comprise non-nuclease recruiting nucleosides (nucleosides with a 3' endo structure), more preferably one or more affinity enhancing modified nucleosides. As described herein, the 3' flank comprises at least one LNA nucleoside, preferably at least 2 LNA nucleosides. As described herein, the 5' flank comprises at least one LNA nucleoside. As described herein both the 5' and 3' flanking regions comprise a LNA nucleoside. As described herein all the nucleosides in the flanking regions are LNA nucleosides. As described herein the flanking regions may comprise both LNA nucleosides and other nucleosides (mixed flanks), such as DNA nucleosides and/or non-LNA modified nucleosides, such as 2' substituted nucleosides. In this case the gap is defined as a contiguous sequence of at least 5 RNase H recruiting nucleosides (nucleosides with a 2' endo structure, preferably DNA) flanked at the 5' and 3' end by an affinity enhancing modified nucleoside, preferably LNA, such as beta-D-oxy-LNA. Consequently, the nucleosides of the 5' flanking region and the 3' flanking region which are adjacent to the gap region are modified nucleosides, preferably non-nuclease recruiting nucleosides.
    • Region F
  • Region F (5' flank or 5' wing) attached to the '5 end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. As described herein region F comprises or consists of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleosides, such as from 2 to 5 modified nucleosides, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1, 2, 3 or 4 modified nucleosides. The F region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.
  • As described herein, the modified nucleosides in region F have a 3' endo structure.
  • As described herein, one or more of the modified nucleosides in region F are 2' modified nucleosides. As described herein all the nucleosides in Region F are 2' modified nucleosides.
  • As described herein region F comprises DNA and/or RNA in addition to the 2' modified nucleosides. Flanks comprising DNA and/or RNA are characterized by having a 2' modified nucleoside in the 5' end and the 3' end (adjacent to the G region) of the F region. As described herein the region F comprise DNA nucleosides, such as from 1 to 3 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. As described herein the 2' modified nucleosides and DNA and/or RNA nucleosides in the F region alternate with 1 to 3 2' modified nucleosides and 1 to 3 DNA and/or RNA nucleosides. Such flanks can also be termed alternating flanks. The length of the 5' flank (region F) in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. As described herein only the 5' flank of the oligonucleotide is alternating. Specific examples of region F with alternating nucleosides are

            2'1-3-N'1-4-2'1-3

            2'1-2-N'1-2-2'1-2-N'1-2-2'1-2

  • Where 2' indicates a modified nucleoside and N' is a RNA or DNA. As described herein all the modified nucleosides in the alternating flanks are LNA and the N' is DNA. In a further embodiment one or more of the 2' modified nucleosides in region F are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.
  • As described herein, the F region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.
  • As described herein all the modified nucleosides in region F are LNA nucleosides. In a further embodiment all the nucleosides in Region F are LNA nucleosides. As described herein the LNA nucleosides in region F are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET, and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. As described herein region F comprise at least 1 beta-D-oxy LNA unit, at the 5' end of the contiguous sequence.
    • Region G
  • Region G (gap region) preferably comprise, contain or consist of at least 4, such as at least 5, such as at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15 or at least 16 consecutive nucleosides capable of recruiting the aforementioned nuclease, in particular RNaseH. As described herein region G comprise, contain or consist of from 5 to 12, or from 6 to 10 or from 7 to 9, such as 8 consecutive nucleotide units capable of recruiting aforementioned nuclease.
  • The nucleoside units in region G, which are capable of recruiting nuclease are as described hereinselected from the group consisting of DNA, alpha-L-LNA, C4' alkylated DNA (as described in PCT/EP2009/050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296 - 2300), arabinose derived nucleosides like ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039). UNA is unlocked nucleic acid, typically where the bond between C2 and C3 of the ribose has been removed, forming an unlocked "sugar" residue.
  • As described herein at least one nucleoside unit in region G is a DNA nucleoside unit, such as from 1 to 18 DNA units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,12, 13, 14, 15, 16 or 17 DNA units, preferably from 2 to 17 DNA units, such as from 3 to 16 DNA units, such as from 4 to 15 DNA units. such as from 5 to 14 DNA units, such as from 6 to 13 DNA units, such as from 7 to 12 DNA units, such as from 8 to 11 DNA units, more preferably from units 8 to 17 DNA units, or from 9 to 16 DNA units, 10 to 15 DNA units or 11 to 13 DNA units, such as 8, 9, 10, 11, 12, 13, 14, 154, 16, 17 DNA units. In some embodiments, region G consists of 100% DNA units.
  • As described herein the region G may consist of a mixture of DNA and other nucleosides capable of mediating RNase H cleavage. Region G may consist of at least 50% DNA, more preferably 60 %, 70% or 80 % DNA, and even more preferred 90% or 95% DNA.
  • As described herein at least one nucleoside unit in region G is an alpha-L-LNA nucleoside unit, such as at least one alpha-L-LNA, such as 2, 3, 4, 5, 6, 7, 8 or 9 alpha-L-LNA. As described herein, region G comprises the least one alpha-L-LNA is alpha-L-oxy-LNA. As described herein region G comprises a combination of DNA and alpha-L-LNA nucleoside units.
  • As described herein, nucleosides in region G have a 2' endo structure.
  • As described herein region G may comprise a gapbreaker nucleoside, leading to a gapbreaker oligonucleotide, which is capable of recruiting RNase H.
    • Region F'
  • Region F' (3' flank or 3' wing) attached to the '3 end of region G comprises, contains or consists of at least one modified nucleoside such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 modified nucleosides. As described herein F' comprise or consist of from 1 to 7 modified nucleosides, such as from 2 to 6 modified nucleoside, such as from 2 to 4 modified nucleosides, such as from 1 to 3 modified nucleosides, such as 1, 2, 3 or 4 modified nucleosides. The F' region is defined by having at least on modified nucleoside at the 5' end and at the 3' end of the region.
  • As described herein, the modified nucleosides in region F' have a 3' endo structure.
  • As described herein, one or more of the modified nucleosides in region F' are 2' modified nucleosides. As described herein all the nucleosides in Region F' are 2' modified nucleosides.
  • As described herein, one or more of the modified nucleosides in region F' are 2' modified nucleosides.
  • As described herein all the nucleosides in Region F' are 2' modified nucleosides. As described herein region F' comprises DNA or RNA in addition to the 2' modified nucleosides. Flanks comprising DNA or RNA are characterized by having a 2' modified nucleoside in the 5' end (adjacent to the G region) and the 3' end of the F' region. As described herein the region F' comprises DNA nucleosides, such as from 1 to 4 contiguous DNA nucleosides, such as 1 to 3 or 1 to 2 contiguous DNA nucleosides. The DNA nucleosides in the flanks should preferably not be able to recruit RNase H. In some embodiments the 2' modified nucleosides and DNA and/or RNA nucleosides in the F' region alternate with 1 to 3 2' modified nucleosides and 1 to 3 DNA and/or RNA nucleosides, such flanks can also be termed alternating flanks. The length of the 3' flank (region F') in oligonucleotides with alternating flanks may be 4 to 10 nucleosides, such as 4 to 8, such as 4 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. As described herein only the 3' flank of the oligonucleotide is alternating. Specific examples of region F' with alternating nucleosides are

            2'1-2-N'1-4-2'1-4

            2'1-2-N'1-2-2'1-2-N'1-2-2'1-2

  • Where 2' indicates a modified nucleoside and N' is a RNA or DNA. As described herein all the modified nucleosides in the alternating flanks are LNA and the N' is DNA. As described herein modified nucleosides in region F' are selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units.
  • As described herein the F' region comprises both LNA and a 2' substituted modified nucleoside. These are often termed mixed wing or mixed flank oligonucleotides.
  • As described herein all the modified nucleosides in region F' are LNA nucleosides. As described herein all the nucleosides in Region F' are LNA nucleosides. As described herein the LNA nucleosides in region F' are independently selected from the group consisting of oxy-LNA, thio-LNA, amino-LNA, cET and/or ENA, in either the beta-D or alpha-L configurations or combinations thereof. As described herein region F' has at least 2 beta-D-oxy LNA unit, at the 3' end of the contiguous sequence.
  • Region D' and D"
    Region D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively. Region D' or D" are optional.
  • Region D' or D" may independently comprise 0 to 5, such as 1 to 5, such as 2 to 4, such as 0, 1, 2, 3, 4 or 5 additional nucleotides, which may be complementary or non-complementary to the target nucleic acid. In this respect the oligonucleotide of the invention, may in some embodiments comprise a contiguous nucleotide sequence capable of modulating the target which is flanked at the 5' and/or 3' end by additional nucleotides. Such additional nucleotides may serve as a nuclease susceptible biocleavable linker (see definition of linkers). In some embodiments the additional 5' and/or 3' end nucleosides are linked with phosphodiester linkages, and may be DNA or RNA. In another embodiment, the additional 5' and/or 3' end nucleosides are modified nucleosides which may for example be included to enhance nuclease stability or for ease of synthesis. In one embodiment, the oligonucleotide of the invention, comprises a region D' and/or D" at the 5' or 3' end of the contiguous nucleotide sequence. In a further embodiment the D' and/or D" region is composed of 1 to 5 phosphodiester linked DNA or RNA nucleosides which are not complementary to the target nucleic acid.
  • The gapmer oligonucleotide of the present invention can be represented by the following formulae:
    • 5'-F-G-F'-3'; in particular F1-7-G4-12-F'1-7
    • 5'-D'-F-G-F'-3', in particular D'1-3-F1-7-G4-12-F'1-7
    • 5'-F-G-F'-D"-3', in particular F1-7-G4-12-F'1-7-D"1-3
    • 5'-D'-F-G-F'-D'-3", in particular D'1-3-F1-7-G4-12-F'1-7-D"1-3
  • The preferred number and types of nucleosides in regions F, G and F', D' and D" have been described above. The oligonucleotide conjugates of the present invention have a region C covalently attached to either the 5' or 3' end of the oligonucleotide, in particular the gapmer oligonucleotides presented above.
  • As described herein the oligonucleotide conjugate of the invention comprises a oligonucleotide with the formula 5'-D'-F-G-F'-3' or 5'-F-G-F'-D"-3', where region F and F' independently comprise 1 - 7 modified nucleosides, G is a region between 6 and 16 nucleosides which are capable of recruiting RNaseH and region D' or D" comprise 1 - 5 phosphodiester linked nucleosides. Preferably region D' or D" is present in the end of the oligonucleotide where conjugation to a conjugate moiety is contemplated.
  • Examples of oligonucleotides with alternating flanks can be represented by the following formulae:

            2'1-3-N'1-4-2'1-3-G6-12-2'1-2-N'1-4-2'1-4

            2'1-2-N'1-2-2'1-2-N'1-2-2'1-2-G6-12-2'1-2-N'1-2-2'1-2-N'1-2-2'1-2

            F-G6-12-2'1-2-N'1-4-2'1-4

            F-G6-12-2'1-2-N'1-2-2'1-2-N'1-2-2'1-2

            2'1-3-N'1-4-2'1-3-G6-12-F'

            2'1-2-N'1-2-2'1-2-N1-2-2'1-2-G6-12-F'

  • Where a flank is indicated by F or F' it only contains 2' modified nucleosides, such as LNA nucleosides. The preferred number and types of nucleosides in the alternating regions, and region F, G and F', D' and D" have been described above.
  • As described herein the oligonucleotide is a gapmer consisting of 16, 17, 18, 19, 20, 21, 22 nucleotides in length, wherein each of regions F and F' independently consists of 1, 2, 3 or 4 modified nucleoside units complementary to the PD-L1 target nucleic acid and region G consists of 8, 9, 10, 11,12,13,14,15,16,17 nucleoside units, capable of recruiting nuclease when in duplex with the PD-L1 target nucleic acid and region D' consists of 2 phosphodiester linked DNAs.
  • As described herein, the oligonucleotide is a gapmer wherein each of regions F and F' independently consists of 3, 4, 5 or 6 modified nucleoside units, such as nucleoside units containing a 2'-O-methoxyethyl-ribose sugar (2'-MOE) or nucleoside units containing a 2'-fluoro-deoxyribose sugar and/or LNA units, and region G consists of 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 nucleoside units, such as DNA units or other nuclease recruiting nucleosides such as alpha-L-LNA or a mixture of DNA and nuclease recruiting nucleosides.
  • As described herein, the oligonucleotide is a gapmer wherein each of regions F and F' region consists of two LNA units each, and region G consists of 12, 13, 14 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 2-12-2, 2-13-2 and 2-14-2.
  • As described herein, the oligonucleotide is a gapmer wherein each of regions F and F' independently consists of three LNA units, and region G consists of 8, 9, 10, 11, 12, 13 or 14 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 3-8-3, 3-9-3 3-10-3, 3-11-3, 3-12-3, 3-13-3 and 3-14-3.
  • As described herein, the oligonucleotide is a gapmer wherein each of regions F and F' consists of four LNA units each, and region G consists of 8 or 9, 10, 11 or 12 nucleoside units, preferably DNA units. Specific gapmer designs of this nature include 4-8-4, 4-9-4, 4-10-4, 4-11-4 and 4-12-4.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 6 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-6-1, 1-6-2, 2-6-1, 1-6-3, 3-6-1, 1-6-4, 4-6-1, 2-6-2, 2-6-3, 3-6-2 2-6-4, 4-6-2, 3-6-3, 3-6-4 and 4-6-3 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 7 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-7-1, 2-7-1, 1-7-2, 1-7-3, 3-7-1, 1-7-4, 4-7-1, 2-7-2, 2-7-3, 3-7-2, 2-7-4, 4-7-2, 3-7-3, 3-7-4, 4-7-3 and 4-7-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 8 nucleosides and independently 1 to 4 modified nucleosides in the wings including 1-8-1, 1-8-2, 1-8-3, 3-8-1, 1-8-4, 4-8-1,2-8-1, 2-8-2, 2-8-3, 3-8-2, 2-8-4, , 4-8-2, 3-8-3, 3-8-4, 4-8-3 and 4-8-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 9 nucleosides and independently 1 to 4 modified nucleosides in the wings including, 1-9-1, 2-9-1, 1-9-2, 1-9-3, 3-9-1, 1-9-4, 4-9-1, 2-9-2, 2-9-3, 3-9-2, 2-9-4, 4-9-2, 3-9-3, 3-9-4, 4-9-3 and 4-9-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 10 nucleosides including, 1-10-1, 2-10-1, 1-10-2, 1-10-3, 3-10-1, 1-10-4, 4-10-1, 2-10-2, 2-10-3, 3-10-2, 2-10-4, 4-10-2, 3-10-3, 3-10-4, 4-10-3 and 4-10-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 11 nucleosides including, 1-11-1, 2-11-1, 1-11-2, 1-11-3, 3-11-1, 1-11-4, 4-11-1, 2-11-2, 2-11-3, 3-11-2, 2-11-4, 4-11-2, 3-11-3, 3-11-4, 4-11-3 and 4-11-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 12 nucleosides including, 1-12-1, 2-12-1, 1-12-2, 1-12-3, 3-12-1, 1-12-4, 4-12-1, 2-12-2, 2-12-3, 3-12-2, 2-12-4, 4-12-2, 3-12-3, 3-12-4, 4-12-3 and 4-12-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 13 nucleosides including, 1-13-1, 2-13-1, 1-13-2, 1-13-3, 3-13-1, 1-13-4, 4-13-1, 2-13-2, 2-13-3, 3-13-2, 2-13-4, 4-13-2, 3-13-3, 3-13-4, 4-13-3 and 4-13-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 14 nucleosides including, 1-14-1, 2-14-1, 1-14-2, 1-14-3, 3-14-1, 1-14-4, 4-14-1, 2-14-2, 2-14-3, 3-14-2, 2-14-4, 4-14-2, 3-14-3, 3-14-4, 4-14-3 and 4-14-4 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 15 nucleosides including, 1-15-1, 2-15-1, 1-15-2, 1-15-3, 3-15-1, 1-15-4, 4-15-1, 2-15-2, 2-15-3, 3-15-2, 2-15-4, 4-15-2 and 3-15-3 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 16 nucleosides including, 1-16-1, 2-16-1, 1-16-2, 1-16-3, 3-16-1, 1-16-4, 4-16-1, 2-16-2, 2-16-3, 3-16-2, 2-16-4, 4-16-2 and 3-16-3 gapmers.
  • Specific gapmer designs of this nature include F-G-F' designs selected from a group consisting of a gap with 17 nucleosides including, 1-17-1, 2-17-1, 1-17-2, 1-17-3, 3-17-1, 1-17-4, 4-17-1, 2-17-2, 2-17-3 and 3-17-2 gapmers.
  • In all instances the F-G-F' design may further include region D' and/or D", which may have 1, 2 or 3 nucleoside units, such as DNA units, such as 2 phosphodiester linked DNA units. Preferably, the nucleosides in region F and F' are modified nucleosides, while nucleotides in region G are preferably unmodified nucleosides.
  • In each design, the preferred modified nucleoside is LNA.
  • As described herein all the internucleoside linkages in the gap in a gapmer are phosphorothioate and/or boranophosphate linkages. As described herein all the internucleoside linkages in the flanks (F and F' region) in a gapmer are phosphorothioate and/or boranophosphate linkages. As described herein all the internucleoside linkages in the D' and D" region in a gapmer are phosphodiester linkages.
  • For specific gapmers as disclosed herein, when the cytosine (C) residues are annotated as 5-methyl-cytosine, as described herein, one or more of the Cs present in the oligonucleotide may be unmodified C residues.
  • As described herein, the gapmer is a so-called shortmer as described in WO2008/113832 .
  • Further gapmer designs are disclosed in WO2004/046160 , WO2007/146511 .
  • As described herein, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO: 5_1 to 743_1 and 771_1.
  • As described herein, the oligonucleotide is selected from the group of oligonucleotide compounds with CMP-ID-NO 6_1, 8_1, 9_1, 13_1, 41_1, 42_1, 58_1, 77_1, 92_1, 111_1, 128_1, 151_1, 164_1, 166_1, 169_1, 171_1, 222_1, 233_1, 245_1, 246_1, 250_1, 251_1, 252_1, 256_1, 272_1, 273_1, 287_1, 292_1, 303_1, 314_1, 318_1, 320_1, 324_1, 336_1, 342_1, 343_1, 344_1, 345_1, 346_1, 349_1, 359_1, 360_1, 374_1, 408_1, 409_1, 415_1, 417_1, 424_1, 429_1, 430_1, 458_1, 464_1, 466_1, 474_1, 490_1, 493_1, 512_1, 519_1, 519_1, 529_1, 533_1, 534_1, 547_1, 566_1, 567_1, 578_1, 582_1, 601_1, 619_1, 620_1, 636_1, 637_1, 638_1, 640_1, 645_1, 650_1, 651_1, 652_1, 653_1, 658_1, 659_1, 660_1, 665_1, 678_1, 679_1, 680_1, 682_1, 683_1, 684_1, 687_1, 694_1, 706_1, 716_1, 728_1, 733_1, 734_1, and 735_1.
  • As described herein, the oligonucleotide is CMP-ID-NO: 287_1.
  • As described herein, the oligonucleotide is CMP-ID-NO: 342_1.
  • In another preferred embodiment of the invention, the oligonucleotide is CMP-ID-NO: 640_1.
  • As described herein, the oligonucleotide is CMP-ID-NO: 466_1.
  • As described herein, the oligonucleotide is CMP-ID-NO: 566_1.
  • In a further embodiment of the invention the contiguous nucleotide sequence of the oligonucleotide motifs and oligonucleotide compounds of the invention comprise two to four additional phosphodiester linked nucleosides at the 5' end of the contiguous nucleotide sequence (e.g. region D'). In one embodiment the nucleosides serve as a biocleavable linker (see sectionon biocleavable linkers). In a preferred embodiment a ca (cytidine-adenosine) dinucleotide is linked to the 5' end of contiguous nucleotide sequence (i.e. any one of the motif sequences or oligonucleotide compounds listed in table 5) via a phosphodiester linkage. In a preferred emboduiment the ca di nucleotide is not complementary to the target sequence at the position where the reminder of the contigious nucleotide is complementary.
  • As described herein the oligonucleotide or contiguous nucleotide sequence is selected from the group consisting of the nucleotide motif sequences with SEQ ID NO: 766, 767, 768, 769 and 770.
  • As described herein the oligonucleotide is selected from the group consisting of the oligonucleotide compounds with CMP-ID-NO 766_1, 767_1, 768_1, 769_1 and 770_1.
    • Carbohydrate conjugate moieties
  • Carbohydrate conjugate moieties include galactose, lactose, n-acetylgalactosamine, mannose and mannose-6-phosphate. Carbohydrate conjugates may be used to enhance delivery or activity in a range of tissues, such as liver and/or muscle. See, for example, EP1495769 , WO99/65925 , Yang et al., Bioconjug Chem (2009) 20(2): 213-21. Zatsepin & Oretskaya Chem Biodivers. (2004) 1(10): 1401-17.
  • In some embodiments the carbohydrate conjugate moiety is multivalent, such as, for example 2, 3 or 4 identical or non-identical carbohydrate moieties may be covalently joined to the oligonucleotide, optionally via a linker or linkers. In some embodiments the invention provides a conjugate comprising the oligonucleotide of the invention and a carbohydrate conjugate moiety. In some embodiments, the conjugate moiety is or may comprise mannose or mannose-6-phosphate. This is particular useful for targeting muscle cells, see for example US 2012/122801 .
  • Conjugate moieties capable of binding to the asialoglycoprotein receptor (ASGPr) are particular useful for targeting hepatocytes in liver. In some embodiments the invention provides a oligonucleotide conjugate comprising the oligonucleotide of the invention and an asialoglycoprotein receptor targeting conjugate moiety. The asialoglycoprotein receptor targeting conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGr binding carbohydrate moieties) with affinity equal to or greater than that of galactose. The affinities of numerous galactose derivatives for the asialoglycoprotein receptor have been studied (see for example: Jobst, S.T. and Drickamer, K. JB.C. 1996, 271, 6686) or are readily determined using methods typical in the art.
  • Described herein is an antisense oligonucleotide conjugate comprising a) an oligonucleotide (Region A) comprising a contiguous nucleotide sequence of 10 to 30 nucleotides in length with at least 90% complementarity to a PD-L1 target nucleic acid; and b) at least one asialoglycoprotein receptor targeting conjugate moiety (Region C) covalently attached to the oligonucleotide in a). The oligonucleotide or a contiguous nucleotide sequence can be as described in any of the sections "oligonucleotides of the invention", "oligonucleotide design and "gapmer design".
  • In some embodiments asialoglycoprotein receptor targeting conjugate moiety comprises at least one ASPGr binding carbohydrate moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, N-n-butanoyl-galactosamine and N-isobutanoylgalactosamine. In some embodiments, the asialoglycoprotein receptor targeting conjugate moiety is mono-valent, di-valent, tri-valent or tetra-valent (i.e. containing 1, 2, 3 or 4 terminal carbohydrate moieties capable of binding to the asialoglycoprotein receptor). Preferably, the asialoglycoprotein receptor targeting conjugate moiety is di-valent, even more preferred it is trivalent. In a preferred embodiment the asialoglycoprotein receptor targeting conjugate moiety comprises 1 to 3 N-acetylgalactosamine (GalNAc) moieties (also termed a GalNAc conjugate). In some embodiments the oligonucleotide conjugate comprises a asialoglycoprotein receptor targeting conjugate moiety that is a tri-valent N-acetylgalactosamine (GalNAc) moiety. GalNAc conjugates have been used with phosphodiester, methylphosphonate and PNA antisense oligonucleotides (e.g. US 5,994517 and Hangeland et al., Bioconjug Chem. 1995 Nov-Dec;6(6):695-701, Biessen et al 1999 Biochem J. 340, 783-792 and Maier et al 2003 Bioconjug Chem 14, 18-29) and siRNAs (e.g. WO 2009/126933 , WO 2012/089352 & WO 2012/083046 ) and with LNA and 2'-MOE modified nucleosides WO 2014/076196 WO 2014/207232 and WO 2014/179620 .
  • To generate the asialoglycoprotein receptor targeting conjugate moiety the ASPGr binding carbohydrate moieties (preferably GalNAc) are attached to a brancher molecule through the C-I carbons of the saccharides. The ASPGr binding carbohydrate moieties are preferably linked to the brancher molecule via spacers. A preferred spacer is a flexible hydrophilic spacer ( U.S. Patent 5885968 ; Biessen et al. J. Med. Chern. 1995 Vol. 39 p. 1538-1546). A preferred flexible hydrophilic spacer is a PEG spacer. A preferred PEG spacer is a PEG3 spacer (three ethylene units). The brancher molecule can be any small molecule which permits attachment of two or three terminal ASPGr binding carbohydrate moieties and further permits attachment of the branch point to the oligonucleotide. An exemplary brancher molecule is a di-lysine. A di-lysine molecule contains three amine groups through which three ASPGr binding carbohydrate moieties may be attached and a carboxyl reactive group through which the di-lysine may be attached to the oligonucleotide. Alternative brancher molecules may be a doubler or trebler such as those supplied by Glen Research. In some embodiments the brancher may be selected from the from the group consisting of 1,3-bis-[5-(4,4'-dimethoxytrityloxy)pentylamido]propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)] phosphoramidite (Glen Research Catalogue Number: 10-1920-xx), tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1922-xx), tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propyloxymethyl]methyleneoxypropyl-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite and 1-[5-(4,4'-dimethoxy-trityloxy)pentylamido]-3-[5-fluorenomethoxy-carbonyloxy-pentylamido]-propyl-2-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite (Glen Research Catalogue Number: 10-1925-xx). WO 2014/179620 and PCT application No. PCT/EP2015/073331 describes the generation of various GalNAc conjugate moieties. One or more linkers may be inserted between the brancher molecule and the oligonucleotide. In a preferred embodiment the linker is a biocleavable linker. The linker may be selected from the linkers described in the section "Linkers" and its subsections.
  • The asialoglycoprotein receptor targeting conjugate moiety, in particular the GalNAc conjugate moiety, may be attached to the 3'- or 5'-end of the oligonucleotide using methods known in the art. In preferred embodiments the asialoglycoprotein receptor targeting conjugate moiety is linked to the 5'-end of the oligonucleotide.
  • Pharmacokinetic modulators in relation to siRNAs delivery has been described in WO 2012/083046 . In some embodiments the carbohydrate conjugate moiety comprises a pharmacokinetic modulator selected from the group consisting of a hydrophobic group having 16 or more carbon atoms, hydrophobic group having 16-20 carbon atoms, palmitoyl, hexadec-8-enoyl, oleyl, (9E,12E)-octadeca-9,12dienoyl, dioctanoyl, and C16-C20 acyl, and cholesterol. In a preferred embodiment the pharmacokinetic modulator containing carbohydrate conjugate moiety is a GalNAc conjugate.
  • Preferred carbohydrate conjugate moieties comprises one to three terminal ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moiety(s). In some embodiments the carbohydrate conjugate moiety comprises three ASPGr binding carbohydrate moieties, preferably N-acetylgalactosamine moieties, linked via a spacer to a brancher molecule. The spacer molecule can be between 8 and 30 atoms long. A preferred carbohydrate conjugate moiety comprises three terminal GalNAc moieties linked via a PEG spacer to a di-lysine brancher molecule. Preferably the PEG spacer is a 3PEG spacer. Suitable asialoglycoprotein receptor targeting conjugate moieties are shown in Figure 1. A preferred asialoglycoprotein receptor targeting conjugate moiety is shown in figure 3.
  • Other GalNAc conjugate moieties can include, for example, small peptides with GalNAc moieties attached such as Tyr-Glu-Glu-(aminohexyl GalNAc)3 (YEE(ahGalNAc)3; a glycotripeptide that binds to asialoglycoprotein receptor on hepatocytes, see, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297); lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholane-based galactose clusters (e.g., carbohydrate recognition motif for asialoglycoprotein receptor).
  • As described herein the antisense oligonucleotide conjugate is selected from the group consisting of the following CPM ID NO: 766_2, 767 2, 768_2, 769_2 and 770_2.
  • As described herein the antisense oligonucleotide conjugate corresponds to the compound represented in figure 4.
  • As described herein the antisense oligonucleotide conjugate corresponds to the compound represented in figure 5.
  • In another preferred embodiment the antisense oligonucleotide conjugate corresponds to the compound represented in figure 6.
  • As described herein the antisense oligonucleotide conjugate corresponds to the compound represented in figure 7.
  • As described herein the antisense oligonucleotide conjugate corresponds to the compound represented in figure 8.
    • Linkers Biocleavable linkers (Region B)
  • The use of a conjugate is often associated with enhanced pharmacokinetic or pharmeodynamic dynamic properties. However, the presence of a conjugate moiety may interfere with the activity of the oligonucleotide against its intended target, for example via steric hindrance preventing hybridization or nuclease recruitment (e.g. RNAseH). The use of a physiologically labile bond (biocleavable linker) between the oligonucleotide (region A or first region) and the conjugate moiety (region C or third region), allows for the improved properties due to the presence of the conjugate moiety, whilst ensuring that once at the target tissue, the conjugate group does not prevent effective activity of the oligonucleotide.
  • Cleavage of the physiologically labile bond occurs spontaneously when a molecule containing the labile bond reaches an appropriate intra-and/or extra-cellular environment. For example, a pH labile bond may be cleaved when the molecule enters an acidified endosome. Thus, a pH labile bond may be considered to be an endosomal cleavable bond. Enzyme cleavable bonds may be cleaved when exposed to enzymes such as those present in an endosome or lysosome or in the cytoplasm. A disulfide bond may be cleaved when the molecule enters the more reducing environment of the cell cytoplasm. Thus, a disulfide may be considered to be a cytoplasmic cleavable bond. As used herein, a pH-labile bond is a labile bond that is selectively broken under acidic conditions (pH<7). Such bonds may also be termed endosomally labile bonds, since cell endosomes and lysosomes have a pH less than 7.
  • For biocleavable linkers associated with a conjugate moiety for targeted delivery it is preferred that, the cleavage rate seen in the target tissue (for example muscle, liver, kidney or a tumor) is greater than that found in blood serum. Suitable methods for determining the level (%) of cleavage in target tissue versus serum or cleavage by S1 nuclease are described in the "Materials and methods" section. In some embodiments, the biocleavable linker (also referred to as the physiologically labile linker, or nuclease susceptible linker or region B), in a conjugate of the invention, is at least about 20% cleaved, such as at least about 30% cleaved, such as at least about 40% cleaved, such as at least about 50% cleaved, such as at least about 60% cleaved, such as at least about 70% cleaved, such as at least about 75% cleaved when compared against a standard.
  • As described herein the oligonucleotide conjugate comprises three regions: i) a first region (region A), which comprises 10 - 25 contiguous nucleotides complementary to the target nucleic acid; ii) a second region (region B) which comprises a biocleavable linker and iii) a third region (region C) which comprises a conjugate moiety, such as an asialoglycoprotein receptor targeting conjugate moiety, wherein the third region is covalent linked to the second region which is covalently linked to the first region.
  • As described herein the oligonucleotide conjugate comprises a biocleavable linker (Region B) between the contiguous nucleotide sequence (region A) and the asialoglycoprotein receptor targeting conjugate moiety (region C).
  • In some embodiments, the biocleavable linker may be situated either at the 5' end and/or the 3'-end of the contiguous nucleotides complementary to the target nucleic acid (region A). In a preferred embodiment the biocleavable linker is at the 5'-end.
  • In some embodiments, the cleavable linker is susceptible to nuclease(s) which may for example, be expressed in the target cell. In some embodiments the biocleavable linker is composed of 2 to 5 consecutive phosphodiester linkages. The linker may be a short region (e.g. 1 - 10 as detailed in the definition of linkers) phosphodiester linked nucleosides. In some embodiments, the nucleosides in the biocleavable linker region B is (optionally independently) selected from the group consisting of DNA and RNA or modifications thereof which do not interfere with nuclease cleavage. Modifications of DNA and RNA nucleosides which do not interfere with nuclease cleavage may be non-naturally occurring nucleobases. Certain sugar-modified nucleosides may also allow nuclease cleavage such as an alpha-L-oxy-LNA. In some embodiments, all the nucleosides of region B comprise (optionally independently) either a 2'-OH ribose sugar (RNA) or a 2'-H sugar - i.e. RNA or DNA. In a preferred embodiment, at least two consecutive nucleosides of region B are DNA or RNA nucleosides (such as at least 3 or 4 or 5 consecutive DNA or RNA nucleosides). In an even more preferred embodiment, the nucleosides of region B are DNA nucleosides Preferably region B consists of between 1 to 5, or 1 to 4, such as 2, 3, 4 consecutive phosphodiester linked DNA nucleosides. In preferred embodiments region B is so short that it does not recruit RNAseH. In some embodiments, region B comprises no more than 3 or no more than 4 consecutive phospodiester linked DNA and/or RNA nucleosides (such as DNA nucleosides).
  • Where region B is composed of phosphodiester linked nucleosides, region A and B may together form the oligonucleotide that is linked to region C. In this context region A can be differentiated from region B in that Region A starts with at least one, preferably at least two, modified nucleosides with increased binding affinity to the target nucleic acid (e.g. LNA or nucleosides with a 2' substituted sugar moiety) and region A on its own is capable of modulation of the expression the target nucleic acid in a relevant cell line. Furthermore, if region A comprises DNA or RNA nucleosides these are linked with nuclease resistant internucleoside linkage, such phosphorothioate or boranophosphate. Region B on the other hand comprises phophodiester linkages between DNA or RNA nucleosides. In some embodiments region B is not complementary to or comprises at least 50% mismatches to the target nucleic acid.
  • In some embodiments, region B is not complementary to the target nucleic acid sequence or to the contiguous nucleotides complementary to the target nucleic acid in region A.
  • In some embodiments, region B is complementary with the target nucleic acid sequence. In this respect region A and B together may form a single contiguous sequence which is complementary to the target sequence.
  • In some aspects of the invention the internucleoside linkage between the first (region A) and the second region (region B) may be considered part of the second region.
  • In some embodiments, the sequence of bases in region B is selected to provide an optimal endonuclease cleavage site, based upon the predominant endonuclease cleavage enzymes present in the target tissue or cell or sub-cellular compartment. In this respect, by isolating cell extracts from target tissues and non-target tissues, endonuclease cleavage sequences for use in region B may be selected based upon a preferential cleavage activity in the desired target cell (e.g. liver/hepatocytes) as compared to a non-target cell (e.g. kidney). In this respect, the potency of the compound for target down-regulation may be optimized for the desired tissue/cell.
  • In some embodiments region B comprises a dinucleotide of sequence AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein C may be 5-methylcytosine, and/or T may be replaced with U. Preferably, the internucleoside linkage is a phosphodiester linkage. In some embodiments region B comprises a trinucleotide of sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, and GGG wherein C may be 5-methylcytosine and/or T may be replaced with U. Preferably, the internucleoside linkages are phosphodiester linkages. In some embodiments region B comprises a trinucleotide of sequence AAAX, AATX, AACX, AAGX, ATAX, ATTX, ATCX, ATGX, ACAX, ACTX, ACCX, ACGX, AGAX, AGTX, AGCX, AGGX, TAAX, TATX, TACX, TAGX, TTAX, TTTX, TTCX, TAGX, TCAX, TCTX, TCCX, TCGX, TGAX, TGTX, TGCX, TGGX, CAAX, CATX, CACX, CAGX, CTAX, CTGX, CTCX, CTTX, CCAX, CCTX, CCCX, CCGX, CGAX, CGTX, CGCX, CGGX, GAAX, GATX, GACX, CAGX, GTAX, GTTX, GTCX, GTGX, GCAX, GCTX, GCCX, GCGX, GGAX, GGTX, GGCX, and GGGX, wherein X may be selected from the group consisting of A, T, U, G, C and analogues thereof, wherein C may be 5-methylcytosine and/or T may be replaced with U. Preferably, the internucleoside linkages are phosphodiester linkages. It will be recognized that when referring to (naturally occurring) nucleobases A, T, U, G, C, these may be substituted with nucleobase analogues which function as the equivalent natural nucleobase (e.g. base pair with the complementary nucleoside).
    • Other linkers (Region Y)
  • The linker can have at least two functionalities, one for attaching to the oligonucleotide and the other for attaching to the conjugate moiety. Example linker functionalities can be electrophilic for reacting with nucleophilic groups on the oligonucleotide or conjugate moiety, or nucleophilic for reacting with electrophilic groups. In some embodiments, linker functionalities include amino, hydroxyl, carboxylic acid, thiol, phosphoramidate, phosphorothioate, phosphate, phosphite, unsaturations (e.g., double or triple bonds). Some example linkers (region Y) include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxylate (SMCC), 6- aminohexanoic acid (AHEX or AHA), 6-aminohexyloxy, 4-aminobutyric acid, 4-aminocyclohexylcarboxylic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxy-(6-amido-caproate) (LCSMCC), succinimidyl m-maleimido-benzoylate (MBS), succinimidyl N-e-maleimido-caproylate (EMCS), succinimidyl 6-(beta - maleimido-propionamido) hexanoate (SMPH), succinimidyl N-(a-maleimido acetate) (AMAS), succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB), beta -alanine (beta -ALA), phenylglycine (PHG), 4-aminocyclohexanoic acid (ACHC), beta -(cyclopropyl) alanine (beta -CYPR), amino dodecanoic acid (ADC), alylene diols, polyethylene glycols, amino acids. In some embodiments the linker (region Y) is an amino alkyl, such as a C2 - C36 amino alkyl group, including, for example C6 to C12 amino alkyl groups. In a preferred embodiment the linker (region Y) is a C6 amino alkyl group. The amino alkyl group may be added to the oligonucleotide (region A or region A-B) as part of standard oligonucleotide synthesis, for example using a (e.g. protected) amino alkyl phosphoramidite. The linkage group between the amino alkyl and the oligonucleotide may for example be a phosphorothioate or a phosphodiester, or one of the other nucleoside linkage groups referred to herein. The amino alkyl group is covalently linked to the 5' or 3'-end of the oligonucleotide. Commercially available amino alkyl linkers are for example 3'-Amino-Modifier reagent for linkage at the 3'-end of the oligonucleotide and for linkage at the 5 '-end of an oligonucleotide 5'- Amino-Modifier C6 is available. These reagents are available from Glen Research Corporation (Sterling, Va.). These compounds or similar ones were utilized by Krieg, et al, Antisense Research and to link fluorescein to the 5'- terminus of an oligonucleotide. A wide variety of further linker groups are known in the art and can be useful in the attachment of conjugate moieties to oligonucleotides. A review of many of the useful linker groups can be found in, for example, Antisense Research and Applications, S. T. Crooke and B. Lebleu, Eds., CRC Press, Boca Raton, Fla., 1993, p. 303-350. Other compounds such as acridine have been attached to the 3 '-terminal phosphate group of an oligonucleotide via a polymethylene linkage (Asseline, et al., Proc. Natl. Acad. Sci. USA 1984, 81, 3297). Any of the above groups can be used as a single linker (region Y) or in combination with one or more further linkers (region Y-Y' or region Y-B or B-Y).
    • Method of manufacture
  • Described herein are methods for manufacturing the oligonucleotides of the invention comprising reacting nucleotide units and thereby forming covalently linked contiguous nucleotide units comprised in the oligonucleotide. Preferably, the method uses phophoramidite chemistry (see for example Caruthers et al, 1987, Methods in Enzymology vol. 154, pages 287-313). As described herein the method further comprises reacting the contiguous nucleotide sequence with a conjugating moiety (ligand). Described herein is a method is provided for manufacturing the composition of the invention, comprising mixing the oligonucleotide or conjugated oligonucleotide of the invention with a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
    • Pharmaceutical Composition
  • As described herein, the invention provides pharmaceutical compositions comprising any of the aforementioned oligonucleotides and/or oligonucleotide conjugates and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS) and pharmaceutically acceptable salts include sodium and potassium salts. In some embodiments the pharmaceutically acceptable diluent is sterile phosphate buffered saline. In some embodiments the oligonucleotide is used in the pharmaceutically acceptable diluent at a concentration of 50 - 300µM solution.
  • Suitable formulations for use in the present invention are found in Remington's Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, Pa., 17th ed., 1985. For a brief review of methods for drug delivery, see, e.g., Langer (Science 249:1527-1533, 1990). WO 2007/031091 provides further suitable and preferred examples of pharmaceutically acceptable diluents, carriers and adjuvants. Suitable dosages, formulations, administration routes, compositions, dosage forms, combinations with other therapeutic agents, pro-drug formulations are also provided in WO2007/031091 .
  • Oligonucleotides or oligonucleotide conjugates of the invention may be mixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including route of administration, extent of disease, or dose to be administered.
  • These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 11, more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. The resulting compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above-mentioned agent or agents, such as in a sealed package of tablets or capsules. The composition in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.
  • In some embodiments, the oligonucleotide or oligonucleotide conjugate of the invention is a prodrug. In particular with respect to oligonucleotide conjugates the conjugate moiety is cleaved of the oligonucleotide once the prodrug is delivered to the site of action, e.g. the target cell.
    • Applications
  • The oligonucleotides or oligonucleotide conjugates of the present invention may be utilized as research reagents for, for example, diagnostics, therapeutics and prophylaxis.
  • In research, such oligonucleotides or oligonucleotide conjugates may be used to specifically modulate the synthesis of PD-L1 protein in cells (e.g. in vitro cell cultures) and experimental animals thereby facilitating functional analysis of the target or an appraisal of its usefulness as a target for therapeutic intervention. Typically the target modulation is achieved by degrading or inhibiting the mRNA producing the protein, thereby prevent protein formation or by degrading or inhibiting a modulator of the gene or mRNA producing the protein.
  • If employing the oligonucleotide of the invention in research or diagnostics the target nucleic acid may be a cDNA or a synthetic nucleic acid derived from DNA or RNA.
  • Described herein is an in vivo or in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering an oligonucleotide or oligonucleotide conjugate of the invention in an effective amount to said cell.
  • As described herein, the target cell, is a mammalian cell in particular a human cell. The target cell may be an in vitro cell culture or an in vivo cell forming part of a tissue in a mammal. As described herein the target cell is present in the liver. Liver target cell can be selected from parenchymal cells (e.g. hepatocytes) and non-parenchymal cells such as Kupffer cells, LSECs, stellate cells (or Ito cells), cholangiocytes and liver-associated leukocytes (including T cells and NK cells). As described herein the target cell is an antigen-presenting cell. Antigen-presenting cells displays foreign antigens complexed with major histocompatibility complex (MHC) class I or class II on their surfaces. In some embodiments the antigen-presenting cell expresses MHC class II (i.e. professional antigen-presenting cells such as dendritic cells, macrophages and B cells).
  • In diagnostics the oligonucleotides may be used to detect and quantitate PD-L1 expression in cell and tissues by northern blotting, in-situ hybridisation or similar techniques.
  • For therapeutics oligonucleotides or oligonucleotide conjugates of the present invention or pharmaceutical compositions thereof may be administered to an animal or a human, suspected of having a disease or disorder, which can be alleviated or treated by reduction of the expression of PD-L1, in particular by reduction of the expression of PD-L1 in liver target cells.
  • Described herein are methods for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an oligonucleotide, an oligonucleotide conjugate or a pharmaceutical composition of the invention to a subject suffering from or susceptible to the disease.
  • The invention also relates to an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention for use as a medicament.
  • The oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition according to the invention is typically administered in an effective amount.
  • Described herein is the use of the oligonucleotide or oligonucleotide conjugate or pharmaceutical composition of the invention as described for the manufacture of a medicament for the treatment of a disease or disorder as referred to herein. As described herein the disease is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver.
  • Described herein are oligonucleotides, oligonucleotide conjugates or pharmaceutical compositions for use in the treatment of diseases or disorders selected from viral or parasitic infections. As described herein the disease is selected from a) viral liver infections such as HBV, HCV and HDV; b) parasite infections such as malaria, toxoplasmosis, leishmaniasis and trypanosomiasis and c) liver cancer or metastases in the liver.
  • The disease or disorder, as referred to herein, is associated with immune exhaustion. In particular the disease or disorder is associated with exhaustion of virus-specific T-cell responses. As described herein, the disease or disorder may be alleviated or treated by reduction of PD-L1 expression.
  • The methods of the invention are preferably employed for treatment or prophylaxis against diseases associated with immune exhaustion.
  • As described herein the oligonucleotide, oligonucleotide conjugate or pharmaceutical compositions of the invention are used in restoration of immune response against a liver cancer or metastases in the liver.
  • As described herein the oligonucleotide, oligonucleotide conjugate or pharmaceutical compositions of the invention are used in restoration of immune response against a pathogen. As described herein the pathogen can be found in the liver. The pathogens can be a virus or a parasite, in particular those described herein. In a preferred embodiment the pathogen is HBV.
  • Described herein is the use of an oligonucleotide, oligonucleotide conjugate or a pharmaceutical composition as defined herein for the manufacture of a medicament for the restoration of immunity against a viral or parasite infection as mentioned herein.
  • Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment of viral infections, in particular viral infections in the liver where the PD-1 patheway is affected (see for example Kapoor and Kottilil 2014 Future Virol Vol. 9 pp. 565-585 and Salem and El-Badawy 2015 World J Hepatol Vol. 7 pp. 2449-2458). Viral liver infections can be selected from the group consisting of hepatitis viruses, in particular HBV, HCV and HDV, in particular chronic forms of these infections. In one embodiment the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are used to treat HBV, in particular chronic HBV. Indicators of chronic HBV infections are high levels of viral load (HBV DNA) and even higher levels of empty HBsAg particles (>100-fold in excess of virions) in the circulation.
  • Oligonucleotides or oligonucleotide conjugates of the present invention can also be used to treat viral liver infections that occur as co-infections with HIV. Other viral infections which can be treated with the oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention are Icmv (Lymphocytic Choriomeningitis Virus), and HIV as a mono infection, HSV-1 and -2, and other herpesviruses. These viruses are not hepatotrophic, however they may be sensitive to PDL1 down regulation.
  • In some embodiments the restoration of immunity or immune response involves improvement of the T-cell and/or NK cell response and/or alleviation of the T-cell exhaustion, in particular the HBV-specific T-cell response, the HCV-specific T-cell response and or the HDV-specific T-cell response is restored. An improvement of the T cell response can for example be assessed as an increase in T cells in the liver, in particular an increase in CD8+ and/or CD4+ T cells when compared to a control (e.g. the level prior to treatment or the level in a vehicle treated subject) In a further embodiment it is the virus specific CD8+ T cells that are restored or increased when compared to cotrol), in particular HBV specific CD8+ T cells or HCV specific CD8+ T cells or HDV specific CD8+ T cells are restored or increased when compared to control. In a preferred embodiment CD8+ T cells specific for HBV s antigen (HBsAg) and/or CD8+ T cells specific for HBV e antigen (HBeAg) and/or CD8+ T cells specific for HBV core antigen (HBcAg) are increased in subjects treated with an oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the present invention compared to control. Preferably the HBV antigen specific CD8+ T cells produce one or more cytokines, such as interferon-gamma (IFN-γ) or tumor necrosis factor alpha (TNF-α). The increase in CD8+ T cells described above is in particular observed in the liver. The increase described herein should be statistically significant when compared to a control. Preferably the increase is at least 20%, such as 25%, such as 50% such as 75% when compared to control. In another embodiment natural killer (NK) cells and/or natural killer T (NKT) cells are activated by the oligonucleotides or oligonucleotide conjugates of the present invention.
  • Oligonucleotides or oligonucleotide conjugates or pharmaceutical compositions of the present invention can be used in the treatment parasite infections, in particular parasite infections where the PD-1 pathway is affected (see for example Bhadra et al. 2012 J Infect Dis vol 206 pp. 125-134; Bhadra et al. 2011 Proc Natl Acad Sci U S A Vol. 108 pp. 9196-9201; Esch et al. J Immunol vol 191 pp 5542-5550; Freeman and Sharpe 2012 ; Gutierrez et al. 2011 Infect Immun Vol 79 pp. 1873-1881; Joshi et al. 2009 ; Liang et al. 2006 Eur J Immunol Vol. 36 pp 58-64; Wykes et al. 2014 ). Parasite infections can be selected from the group consisting of malaria, toxoplasmosis, leishmaniasis and trypanosomiasis. Malaria infection is caused by protozoa of the genus Plasmodium, in particular of the species P. vivax, P. malariae and P. falciparum. Toxoplasmosis is a parasitic disease caused by Toxoplasma gondii. Leishmaniasis is a disease caused by protozoan parasites of the genus Leishmania. Trypanosomiasis is caused by the protozoan of the genus Trypanosoma. Chaga disease which is the tropical form caused by the species Trypanosoma cruzi, and sleeping disease is caused by the species Trypanosoma brucei.
  • In some embodiments the restoration of immunity involves restoration of a parasite-specific T cell and NK cell response, in particular a Plasmodium-specific T-cell response, a Toxoplasma gondii-specific T-cell and NK cell response, a Leishmania-specific T-cell and NK cell response, a Trypanosoma cruzi-specific T-cell and NK cell response or a Trypanosoma brucei-specific T-cell and NK cell response. In a further embodiment it is the parasite-specific CD8+ T cell and NK cell response that is restored.
    • Administration
  • The oligonucleotides or pharmaceutical compositions of the present invention may be administered topical (such as, to the skin, inhalation, ophthalmic or otic) or enteral (such as, orally or through the gastrointestinal tract) or parenteral (such as, intravenous, subcutaneous, intra-muscular, intracerebral, intracerebroventricular or intrathecal).
  • In a preferred embodiment the oligonucleotide or pharmaceutical compositions of the present invention are administered by a parenteral route including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, e.g. intracerebral or intraventricular, intravitreal administration. In one embodiment the active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment the active oligonucleotide or oligonucleotide conjugate is administered subcutaneously.
  • In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1 - 15 mg/kg, such as from 0.1 - 10 mg/kg, such as from 0.2 - 10 mg/kg, such as from 0.25 - 10 mg/kg, such as from 0.1 - 5 mg/kg, such as from 0.2 - 5 mg/kg, such as from 0.25 - 5 mg/kg. The administration can be once a week, every 2nd week, every third week or even once a month.
    • Combination therapies
  • In some embodiments the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is for use in a combination treatment with another therapeutic agent. The therapeutic agent can for example be the standard of care for the diseases or disorders described above.
  • For the treatment of chronic HBV infections a combination of antiviral drugs and immune system modulators is recommended as standard of care. The antiviral drugs effective against HBV are for example nucleos(t)ide analogs. There are five nucleos(t)ide analogs licensed for therapy of HBV namely lamivudine (Epivir), adefovir (Hepsera), tenofovir (Viread), telbivudine (Tyzeka), entecavir (Baraclude) these are effective in suppressing viral replication (HBV DNA) but have no effect on HBsAg levels. Other antiviral drugs include ribavirin and an HBV antibody therapy (monoclonal or polyclonal). The immune system modulators can for example be interferon alpha-2a and PEGylated interferon alpha-2a (Pegasys) or TLR7 agonists (e.g. GS-9620) or therapeutic vaccines. IFN-α treatment show only very modest effect in reducing viral load, but result in some HBsAg decline, albeit very inefficiently (<10% after 48 week therapy).
  • The oligonucleotide or oligonucleotide conjugates of the present invention may also be combined with other antiviral drugs effective against HBV such as the antisense oligonucleotides described in WO2012/145697 and WO 2014/179629 or the siRNA molecules described in WO 2005/014806 , WO 2012/024170 , WO 2012/2055362 , WO 2013/003520 and WO 2013/159109 .
  • When the oligonucleotides or oligonucleotide conjugates of this invention are administered in combination therapies with other agents, they may be administered sequentially or concurrently to an individual. Alternatively, pharmaceutical compositions according to the present invention may be comprised of a combination of an oligonucleotide or oligonucleotide conjugate of the present invention in association with a pharmaceutically acceptable excipient, as described herein, and another therapeutic or prophylactic agent known in the art.
    • EXAMPLES Materials and methods Motif sequences and oligonucleotide compounds
  • Table 5: list of oligonucleotide motif sequences (indicated by SEQ ID NO) targeting the human PD-L1 transcript (SEQ ID NO: 1), designs of these, as well as specific antisense oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence.
    SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start ID NO: 1 dG
    5 taattggctctactgc 2-11-3 TAattggctctacTGC 5_1 236 -20
    6 tcgcataagaatgact 4-10-2 TCGCataagaatgaCT 6_1 371 -19
    7 tgaacacacagtcgca 2-12-2 TGaacacacagtcgCA 7_1 382 -19
    8 ctgaacacacagtcgc 3-10-3 CTGaacacacagtCGC 8_1 383 -22
    9 tctgaacacacagtcg 3-11-2 TCTgaacacacagtCG 9_1 384 -19
    10 ttctgaacacacagtc 3-11-2 TTCtgaacacacagTC 10_1 385 -17
    11 acaagtcatgttacta 2-11-3 ACaagtcatgttaCTA 11_1 463 -16
    12 acacaagtcatgttac 2-12-2 ACacaagtcatgttAC 12_1 465 -14
    13 cttacttagatgctgc 2-11-3 CTtacttagatgcTGC 13_1 495 -20
    14 acttacttagatgctg 2-11-3 ACttacttagatgCTG 14_1 496 -18
    15 gacttacttagatgct 3-11-2 GACttacttagatgCT 15_1 497 -19
    16 agacttacttagatgc 2-11-3 AGacttacttagaTGC 16_1 498 -18
    17 gcaggaagagacttac 3-10-3 GCAggaagagactTAC 17_1 506 -20
    18 aataaattccgttcagg 4-9-4 AATAaattccgttCAGG 18_1 541 -22
    19 gcaaataaattccgtt 3-10-3 GCAaataaattccGTT 19_2 545 -18
    19 gcaaataaattccgtt 4-8-4 GCAAataaattcCGTT 19_1 545 -20
    20 agcaaataaattccgt 4-9-3 AGCAaataaattcCGT 20_1 546 -20
    21 cagagcaaataaattcc 4-10-3 CAGAgcaaataaatTCC 21_1 548 -21
    22 tggacagagcaaataaat 4-11-3 TGGAcagagcaaataAAT 22_1 551 -19
    23 atggacagagcaaata 4-8-4 ATGGacagagcaAATA 23_1 554 -20
    24 cagaatggacagagca 2-11-3 CAgaatggacagaGCA 24_1 558 -21
    25 ttctcagaatggacag 3-11-2 TTCtcagaatggacAG 25_1 562 -17
    26 ctgaactttgacatag 4-8-4 CTGAactttgacATAG 26_1 663 -20
    27 aagacaaacccagactga 2-13-3 AAgacaaacccagacTGA 27_1 675 -21
    28 tataagacaaacccagac 4-10-4 TATAagacaaacccAGAC 28_1 678 -22
    29 ttataagacaaacccaga 4-10-4 TTATaagacaaaccCAGA 29_1 679 -23
    30 tgttataagacaaaccc 4-10-3 TGTTataagacaaaCCC 30_1 682 -22
    31 tagaacaatggtacttt 4-9-4 TAGAacaatggtaCTTT 31_1 708 -20
    32 gtagaacaatggtact 4-10-2 GTAGaacaatggtaCT 32_1 710 -19
    33 aggtagaacaatggta 3-10-3 AGGtagaacaatgGTA 33_1 712 -19
    34 aagaggtagaacaatgg 4-9-4 AAGAggtagaacaATGG 34_1 714 -21
    35 gcatccacagtaaatt 2-12-2 GCatccacagtaaaTT 35_1 749 -17
    36 gaaggttatttaattc 2-11-3 GAaggttatttaaTTC 36_1 773 -13
    37 ctaatcgaatgcagca 4-9-3 CTAAtcgaatgcaGCA 37_1 805 -22
    38 tacccaatctaatcga 3-10-3 TACccaatctaatCGA 38_1 813 -20
    39 tagttacccaatctaa 3-10-3 TAGttacccaatcTAA 39_1 817 -19
    40 catttagttacccaat 3-10-3 CATttagttacccAAT 40_1 821 -18
    41 tcatttagttacccaa 3-10-3 TCAtttagttaccCAA 41_1 822 -19
    42 ttcatttagttaccca 2-10-4 TTcatttagttaCCCA 42_1 823 -22
    43 gaattaatttcatttagt 4-10-4 GAATtaatttcattTAGT 43_1 829 -19
    44 cagtgaggaattaattt 4-9-4 CAGTgaggaattaATTT 44_1 837 -20
    45 ccaacagtgaggaatt 4-8-4 CCAAcagtgaggAATT 45_1 842 -21
    46 cccaacagtgaggaat 3-10-3 CCCaacagtgaggAAT 46_1 843 -22
    47 tatacccaacagtgagg 2-12-3 TAtacccaacagtgAGG 47_1 846 -21
    48 ttatacccaacagtgag 2-11-4 TTatacccaacagTGAG 48_1 847 -21
    49 tttatacccaacagtga 3-11-3 TTTatacccaacagTGA 49_1 848 -21
    50 cctttatacccaacag 3-10-3 CCTttatacccaaCAG 50_1 851 -23
    51 taacctttatacccaa 4-8-4 TAACctttatacCCAA 51_1 854 -22
    52 aataacctttataccca 3-10-4 AATaacctttataCCCA 52_1 855 -23
    53 gtaaataacctttata 3-11-2 GTAaataacctttaTA 53_1 859 -14
    54 actgtaaataacctttat 4-10-4 ACTGtaaataacctTTAT 54_1 860 -20
    55 atatatatgcaatgag 3-11-2 ATAtatatgcaatgAG 55_1 903 -14
    56 agatatatatgcaatg 2-12-2 AGatatatatgcaaTG 56_1 905 -12
    57 gagatatatatgcaat 3-10-3 GAGatatatatgcAAT 57_1 906 -15
    58 ccagagatatatatgc 2-11-3 CCagagatatataTGC 58_1 909 -19
    59 caatattccagagatat 4-9-4 CAATattccagagATAT 59_1 915 -20
    60 gcaatattccagagata 4-10-3 GCAAtattccagagATA 60_1 916 -22
    61 agcaatattccagagat 3-11-3 AGCaatattccagaGAT 61_1 917 -22
    62 cagcaatattccagag 3-9-4 CAGcaatattccAGAG 62_1 919 -22
    63 aatcagcaatattccag 4-9-4 AATCagcaatattCCAG 63_1 921 -23
    64 acaatcagcaatattcc 4-9-4 ACAAtcagcaataTTCC 64_1 923 -21
    65 actaagtagttacacttct 2-14-3 ACtaagtagttacactTCT 65_1 957 -20
    66 ctaagtagttacacttc 4-11-2 CTAAgtagttacactTC 66_1 958 -18
    67 gactaagtagttacactt 3-12-3 GACtaagtagttacaCTT 67_1 959 -20
    68 tgactaagtagttaca 3-9-4 TGActaagtagtTACA 68_1 962 -19
    69 ctttgactaagtagtta 4-10-3 CTTTgactaagtagTTA 69_1 964 -19
    70 ctctttgactaagtag 3-10-3 CTCtttgactaagTAG 70_1 967 -19
    71 gctctttgactaagta 4-10-2 GCTCtttgactaagTA 71_1 968 -21
    72 ccttaaatactgttgac 2-11-4 CCttaaatactgtTGAC 72_1 1060 -20
    73 cttaaatactgttgac 2-12-2 CTtaaatactgttgAC 73_1 1060 -13
    74 tccttaaatactgttg 3-10-3 TCCttaaatactgTTG 74_1 1062 -18
    75 tctccttaaatactgtt 4-11-2 TCTCcttaaatactgTT 75_1 1063 -19
    76 tatcatagttctcctt 2-10-4 TAtcatagttctCCTT 76_1 1073 -21
    77 agtatcatagttctcc 3-10-3 AGTatcatagttcTCC 77_1 1075 -22
    78 gagtatcatagttctc 2-11-3 GAgtatcatagttCTC 78_1 1076 -18
    79 agagtatcatagttct 2-10-4 AGagtatcatagTTCT 79_1 1077 -18
    79 agagtatcatagttct 3-10-3 AGAgtatcatagtTCT 79_2 1077 -19
    80 cagagtatcatagttc 3-10-3 CAGagtatcatagTTC 80_1 1078 -18
    81 ttcagagtatcatagt 4-10-2 TTCAgagtatcataGT 81_1 1080 -18
    82 cttcagagtatcatag 3-9-4 CTTcagagtatcATAG 82_1 1081 -19
    83 ttcttcagagtatcata 4-11-2 TTCTtcagagtatcaTA 83_1 1082 -19
    84 tttcttcagagtatcat 3-10-4 TTTcttcagagtaTCAT 84_1 1083 -20
    85 gagaaaggctaagttt 4-9-3 GAGAaaggctaagTTT 85_1 1099 -19
    86 gacactcttgtacatt 2-10-4 GAcactcttgtaCATT 86_1 1213 -19
    87 tgagacactcttgtaca 2-13-2 TGagacactcttgtaCA 87_1 1215 -18
    88 tgagacactcttgtac 2-11-3 TGagacactcttgTAC 88_1 1216 -18
    89 ctttattaaactccat 2-10-4 CTttattaaactCCAT 89_1 1266 -18
    90 accaaactttattaaa 4-10-2 ACCAaactttattaAA 90_1 1272 -14
    91 aaacctctactaagtg 4-10-2 AAACctctactaagTG 91_1 1288 -16
    92 agattaagacagttga 2-11-3 AGattaagacagtTGA 92_1 1310 -16
    93 aagtaggagcaagaggc 2-12-3 AAgtaggagcaagaGGC 93_1 1475 -22
    94 aaagtaggagcaagagg 4-10-3 AAAGtaggagcaagAGG 94_1 1476 -20
    95 gttaagcagccaggag 2-12-2 GTtaagcagccaggAG 95_1 1806 -20
    96 agggtaggatgggtag 2-12-2 AGggtaggatgggtAG 96_1 1842 -20
    97 aagggtaggatgggta 3-11-2 AAGggtaggatgggTA 97_1 1843 -20
    98 caagggtaggatgggt 2-12-2 CAagggtaggatggGT 98_2 1844 -20
    98 caagggtaggatgggt 3-11-2 CAAgggtaggatggGT 98_1 1844 -21
    99 ccaagggtaggatggg 2-12-2 CCaagggtaggatgGG 99_1 1845 -22
    100 tccaagggtaggatgg 2-12-2 TCcaagggtaggatGG 100_1 1846 -20
    101 cttccaagggtaggat 4-10-2 CTTCcaagggtaggAT 101_1 1848 -21
    102 atcttccaagggtagga 3-12-2 A TCttccaagggtagGA 102_1 1849 -22
    103 agaagtgatggctcatt 2-11-4 AGaagtgatggctCATT 103_1 1936 -21
    104 aagaagtgatggctcat 3-10-4 AAGaagtgatggcTCAT 104_1 1937 -21
    105 gaagaagtgatggctca 3-11-3 GAAgaagtgatggcTCA 105_1 1938 -21
    106 atgaaatgtaaactggg 4-9-4 ATGAaatgtaaacTGGG 106_1 1955 -21
    107 caatgaaatgtaaactgg 4-10-4 CAATgaaatgtaaaCTGG 107_1 1956 -20
    108 gcaatgaaatgtaaactg 4-10-4 GCAAtgaaatgtaaACTG 108_1 1957 -20
    109 agcaatgaaatgtaaact 4-10-4 AGCAatgaaatgtaAACT 109_1 1958 -20
    110 gagcaatgaaatgtaaac 4-10-4 GAGCaatgaaatgtAAAC 110_1 1959 -19
    111 tgaattcccatatccga 2-12-3 TGaattcccatatcCGA 111_1 1992 -22
    112 agaattatgaccatat 2-11-3 AGaattatgaccaTAT 112_1 2010 -15
    113 aggtaagaattatgacc 3-10-4 AGGtaagaattatGACC 113_1 2014 -21
    114 tcaggtaagaattatgac 4-10-4 TCAGgtaagaattaTGAC 114_1 2015 -22
    115 cttcaggtaagaattatg 4-10-4 CTTCaggtaagaatTATG 115_1 2017 -21
    116 tcttcaggtaagaatta 4-9-4 TCTTcaggtaagaATTA 116_1 2019 -20
    117 cttcttcaggtaagaat 4-9-4 CTTCttcaggtaaGAAT 117_1 2021 -21
    118 tcttcttcaggtaagaa 4-10-3 TCTTcttcaggtaaGAA 118_1 2022 -20
    119 tcttcttcaggtaaga 3-10-3 TCTtcttcaggtaAGA 119_1 2023 -20
    120 tggtctaagagaagaag 3-10-4 TGGtctaagagaaGAAG 120_1 2046 -20
    121 gttggtctaagagaag 4-9-3 GTTGgtctaagagAAG 121_1 2049 -19
    123 cagttggtctaagagaa 2-11-4 CAgttggtctaagAGAA 123_1 2050 -20
    124 gcagttggtctaagagaa 3-13-2 GCAgttggtctaagagAA 124_1 2050 -22
    122 agttggtctaagagaa 3-9-4 AGTtggtctaagAGAA 122_1 2050 -20
    126 gcagttggtctaagaga 2-13-2 GCagttggtctaagaGA 126_1 2051 -21
    125 cagttggtctaagaga 4-10-2 CAGTtggtctaagaGA 125_1 2051 -21
    127 gcagttggtctaagag 2-11-3 GCagttggtctaaGAG 127_1 2052 -21
    128 ctcatatcagggcagt 2-10-4 CTcatatcagggCAGT 128_1 2063 -24
    129 cacacatgttctttaac 4-11-2 CACAcatgttctttaAC 129_1 2087 -18
    130 taaatacacacatgttct 3-11-4 TAAatacacacatgTTCT 130_1 2092 -19
    131 gtaaatacacacatgttc 4-11-3 GTAAatacacacatgTTC 131_1 2093 -19
    132 tgtaaatacacacatgtt 4-10-4 TGTAaatacacacaTGTT 132_1 2094 -22
    133 gatcatgtaaatacacac 4-10-4 GATCatgtaaatacACAC 133_1 2099 -20
    134 agatcatgtaaatacaca 4-10-4 AGATcatgtaaataCACA 134_1 2100 -21
    135 caaagatcatgtaaatacac 4-12-4 CAAAgatcatgtaaatACAC 135_1 2101 -19
    136 acaaagatcatgtaaataca 4-12-4 ACAAagatcatgtaaaTACA 136_1 2102 -20
    137 gaatacaaagatcatgta 4-10-4 GAATacaaagatcaTGTA 137_1 2108 -20
    138 agaatacaaagatcatgt 4-10-4 AGAAtacaaagatcATGT 138_1 2109 -20
    139 cagaatacaaagatcatg 4-10-4 CAGAatacaaagatCATG 139_1 2110 -21
    140 gcagaatacaaagatca 4-9-4 GCAGaatacaaagATCA 140_1 2112 -22
    141 aggcagaatacaaagat 4-11-2 AGGCagaatacaaagAT 141_1 2114 -19
    142 aaggcagaatacaaaga 4-10-3 AAGGcagaatacaaAGA 142_1 2115 -19
    143 attagtgagggacgaa 3-10-3 ATTagtgagggacGAA 143_1 2132 -18
    144 cattagtgagggacga 2-11-3 CAttagtgagggaCGA 144_1 2133 -20
    145 gagggtgatggattag 2-11-3 GAgggtgatggatTAG 145_1 2218 -19
    146 ttaggagtaataaagg 2-10-4 TT aggagtaataAAG G 146_1 2241 -14
    147 ttaatgaatttggttg 3-11-2 TTAatgaatttggtTG 147_1 2263 -13
    148 ctttaatgaatttggt 2-12-2 CTttaatgaatttgGT 148_1 2265 -14
    149 catggattacaactaa 4-10-2 CATGgattacaactAA 149_1 2322 -16
    150 tcatggattacaacta 2-11-3 TCatggattacaaCTA 150_1 2323 -16
    151 gtcatggattacaact 3-11-2 GTCatggattacaaCT 151_1 2324 -18
    152 cattaaatctagtcat 2-10-4 CAttaaatctagTCAT 152_1 2335 -16
    153 gacattaaatctagtca 4-10-3 GACAttaaatctagTCA 153_1 2336 -19
    154 agggacattaaatcta 4-10-2 AGGGacattaaatcTA 154_1 2340 -18
    155 caaagcattataacca 4-9-3 CAAAgcattataaCCA 155_1 2372 -18
    156 acttactaggcagaag 2-10-4 ACttactaggcaGAAG 156_1 2415 -19
    157 cagagttaactgtaca 4-10-2 CAGAgttaactgtaCA 157_1 2545 -20
    158 ccagagttaactgtac 4-10-2 CCAGagttaactgtAC 158_1 2546 -20
    159 gccagagttaactgta 2-12-2 GCcagagttaactgTA 159_1 2547 -20
    160 tgggccagagttaact 2-12-2 TGggccagagttaaCT 160_1 2550 -21
    161 cagcatctatcagact 2-12-2 CAgcatctatcagaCT 161_1 2576 -19
    162 tgaaataacatgagtcat 3-11-4 TGAaataacatgagTCAT 162_1 2711 -19
    163 gtgaaataacatgagtc 3-10-4 GTGaaataacatgAGTC 163_1 2713 -19
    164 tctgtttatgtcactg 4-10-2 TCTGtttatgtcacTG 164_1 2781 -20
    165 gtctgtttatgtcact 4-10-2 GTCTgtttatgtcaCT 165_1 2782 -22
    166 tggtctgtttatgtca 2-10-4 TGgtctgtttatGTCA 166_1 2784 -21
    167 ttggtctgtttatgtc 4-10-2 TTGGtctgtttatgTC 167_1 2785 -20
    168 tcacccattgtttaaa 2-12-2 TCacccattgtttaAA 168_1 2842 -15
    169 ttcagcaaatattcgt 2-10-4 TTcagcaaatatTCGT 169_1 2995 -17
    170 gtgtgttcagcaaatat 3-10-4 GTGtgttcagcaaATAT 170_1 2999 -21
    171 tctattgttaggtatc 3-10-3 TCTattgttaggtATC 171_1 3053 -18
    172 attgcccatcttactg 2-12-2 A TtgcccatcttacTG 172_1 3118 -19
    173 tattgcccatcttact 3-11-2 TATtgcccatcttaCT 173_1 3119 -21
    174 aaatattgcccatctt 2-11-3 AAatattgcccatCTT 174_1 3122 -17
    175 ataaccttatcataca 3-11-2 ATAaccttatcataCA 175_1 3174 -16
    176 tataaccttatcatac 2-11-3 TAtaaccttatcaTAC 176_1 3175 -14
    177 ttataaccttatcata 3-11-2 TTAtaaccttatcaTA 177_1 3176 -14
    178 tttataaccttatcat 3-10-3 TTTataaccttatCAT 178_1 3177 -16
    179 actgctattgctatct 2-11-3 ACtgctattgctaTCT 179_1 3375 -19
    180 aggactgctattgcta 2-11-3 AGgactgctattgCTA 180_1 3378 -21
    181 gaggactgctattgct 3-11-2 GAGgactgctattgCT 181_1 3379 -22
    182 acgtagaataataaca 2-12-2 ACgtagaataataaCA 182_1 3561 -11
    183 ccaagtgatataatgg 2-10-4 CCaagtgatataATGG 183_1 3613 -19
    184 ttagcagaccaagtga 2-10-4 TTagcagaccaaGTGA 184_1 3621 -21
    185 gtttagcagaccaagt 2-12-2 GTttagcagaccaaGT 185_1 3623 -19
    186 tgacagtgattatatt 2-12-2 TGacagtgattataTT 186_1 3856 -13
    187 tgtccaagatattgac 4-10-2 TGTCcaagatattgAC 187_1 3868 -18
    188 gaatatcctagattgt 3-10-3 GAAtatcctagatTGT 188_1 4066 -18
    189 caaactgagaatatcc 2-11-3 CAaactgagaataTCC 189_1 4074 -16
    190 gcaaactgagaatatc 3-11-2 GCAaactgagaataTC 190_1 4075 -16
    191 tcctattacaatcgta 3-11-2 TCCtattacaatcgTA 191_1 4214 -19
    192 ttcctattacaatcgt 4-10-2 TTCCtattacaatcGT 192_1 4215 -19
    193 actaatgggaggattt 2-12-2 ACtaatgggaggatTT 193_1 4256 -15
    194 tagttcagagaataag 2-12-2 TAgttcagagaataAG 194_1 4429 -13
    195 taacatatagttcaga 2-11-3 TAacatatagttcAGA 195_1 4436 -15
    196 ataacatatagttcag 3-11-2 AT AacatatagttcAG 196_1 4437 -14
    197 cataacatatagttca 2-12-2 CAtaacatatagttCA 197_1 4438 -13
    198 tcataacatatagttc 2-12-2 TCataacatatagtTC 198_1 4439 -12
    199 tagctcctaacaatca 4-10-2 TAG CtcctaacaatCA 199_1 4507 -22
    200 ctccaatctttgtata 4-10-2 CTCCaatctttgtaTA 200_1 4602 -20
    201 tctccaatctttgtat 4-10-2 TCTCcaatctttgtAT 201_1 4603 -19
    202 tctatttcagccaatc 2-12-2 TCtatttcagccaaTC 202_1 4708 -17
    203 cggaagtcagagtgaa 3-10-3 CGGaagtcagagtGAA 203_1 4782 -19
    204 ttaagcatgaggaata 4-10-2 TTAAgcatgaggaaTA 204_1 4798 -16
    205 tgattgagcacctctt 3-10-3 TGAttgagcacctCTT 205_1 4831 -22
    206 gactaattatttcgtt 3-11-2 GACtaattatttcgTT 206_1 4857 -15
    207 tgactaattatttcgt 3-10-3 TGActaattatttCGT 207_1 4858 -17
    208 gtgactaattatttcg 3-10-3 GTGactaattattTCG 208_1 4859 -17
    209 ctgcttgaaatgtgac 4-10-2 CTGCttgaaatgtgAC 209_1 4870 -20
    210 cctgcttgaaatgtga 2-11-3 CCtgcttgaaatgTGA 210_1 4871 -21
    211 atcctgcttgaaatgt 2-10-4 ATcctgcttgaaATGT 211_1 4873 -20
    212 attataaatctattct 3-10-3 ATTataaatctatTCT 212_1 5027 -13
    213 gctaaatactttcatc 2-11-3 GCtaaatactttcATC 213_1 5151 -16
    214 cattgtaacataccta 2-10-4 CAttgtaacataCCTA 214_1 5251 -19
    215 gcattgtaacatacct 2-12-2 GCattgtaacatacCT 215_1 5252 -18
    216 taatattgcaccaaat 2-12-2 TAatattgcaccaaAT 216_1 5295 -13
    217 gataatattgcaccaa 2-11-3 GAtaatattgcacCAA 217_1 5297 -16
    218 agataatattgcacca 2-12-2 AGaatattgcacCA 218_1 5298 -16
    219 gccaagaagataatat 2-10-4 GCcaagaagataATAT 219_1 5305 -17
    220 cacagccacataaact 4-10-2 CACAgccacataaaCT 220_1 5406 -21
    221 ttgtaattgtggaaac 2-12-2 TTgtaattgtggaaAC 221_1 5463 -12
    222 tgacttgtaattgtgg 2-11-3 TGacttgtaattgTGG 222_1 5467 -18
    223 tctaactgaaatagtc 2-12-2 TCtaactgaaatagTC 223_1 5503 -13
    224 gtggttctaactgaaa 3-11-2 GTGgttctaactgaAA 224_1 5508 -16
    225 caatatgggacttggt 2-12-2 CAatatgggacttgGT 225_1 5522 -18
    226 atgacaatatgggact 3-11-2 ATGacaatatgggaCT 226_1 5526 -17
    227 tatgacaatatgggac 4-10-2 TATGacaatatgggAC 227_1 5527 -17
    228 atatgacaatatggga 4-10-2 ATATgacaatatggGA 228_1 5528 -17
    229 cttcacttaataatta 2-11-3 CTtcacttaataaTTA 229_1 5552 -13
    230 ctgcttcacttaataa 4-10-2 CTGCttcacttaatAA 230_1 5555 -18
    231 aagactgcttcactta 2-11-3 AAgactgcttcacTTA 231_1 5559 -17
    232 gaatgccctaattatg 4-10-2 GAATgccctaattaTG 232_1 5589 -19
    233 tggaatgccctaatta 3-11-2 TGGaatgccctaatTA 233_1 5591 -19
    234 gcaaatgccagtaggt 3-11-2 GCAaatgccagtagGT 234_1 5642 -23
    235 ctaatggaaggatttg 3-11-2 CTAatggaaggattTG 235_1 5673 -15
    236 aatatagaacctaatg 2-12-2 AAtatagaacctaaTG 236_1 5683 -10
    237 gaaagaatagaatgtt 3-10-3 GAAagaatagaatGTT 237_1 5769 -12
    238 atgggtaatagattat 3-11-2 ATGggtaatagattAT 238_1 5893 -15
    239 gaaagagcacagggtg 2-12-2 GAaagagcacagggTG 239_1 6103 -18
    240 ctacatagagggaatg 4-10-2 CTACatagagggaaTG 240_1 6202 -18
    241 gcttcctacatagagg 2-10-4 GCttcctacataGAGG 241_1 6207 -24
    242 tgcttcctacatagag 4-10-2 TGCTtcctacatagAG 242_1 6208 -22
    243 tgggcttgaaatatgt 2-11-3 TGggcttgaaataTGT 243_1 6417 -19
    244 cattatatttaagaac 3-11-2 CATtatatttaagaAC 244_1 6457 -11
    245 tcggttatgttatcat 2-10-4 TCggttatgttaTCAT 245_1 6470 -19
    246 cactttatctggtcgg 2-10-4 CActttatctggTCGG 246_1 6482 -22
    247 aaattggcacagcgtt 3-10-3 AAAttggcacagcGTT 247_1 6505 -18
    248 accgtgacagtaaatg 4-9-3 ACCGtgacagtaaATG 248_1 6577 -20
    249 tgggaaccgtgacagta 2-13-2 TGggaaccgtgacagTA 249_1 6581 -22
    250 ccacatataggtcctt 2-11-3 CCacatataggtcCTT 250_1 6597 -21
    251 catattgctaccatac 2-11-3 CAtattgctaccaTAC 251_1 6617 -18
    252 tcatattgctaccata 3-10-3 TCAtattgctaccATA 252_1 6618 -19
    253 caattgtcatattgct 4-8-4 CAATtgtcatatTGCT 253_1 6624 -21
    254 cattcaattgtcatattg 3-12-3 CATtcaattgtcataTTG 254_1 6626 -18
    255 tttctactgggaatttg 4-9-4 TTTCtactgggaaTTTG 255_1 6644 -20
    256 caattagtgcagccag 3-10-3 CAAttagtgcagcCAG 256_1 6672 -21
    257 gaataatgttcttatcc 4-10-3 GAATaatgttcttaTCC 257_1 6704 -20
    258 cacaaattgaataatgttct 4-13-3 CACAaattgaataatgtTCT 258_1 6709 -20
    259 catgcacaaattgaataat 4-11-4 CATGcacaaattgaaTAAT 259_1 6714 -20
    260 atcctgcaatttcacat 3-11-3 ATCctgcaatttcaCAT 260_1 6832 -22
    261 ccaccatagctgatca 2-12-2 CCaccatagctgatCA 261_1 6868 -22
    262 accaccatagctgatca 2-12-3 ACcaccatagctgaTCA 262_1 6868 -23
    263 caccaccatagctgatc 2-13-2 CAccaccatagctgaTC 263_1 6869 -21
    264 tagtcggcaccaccat 2-12-2 TAgtcggcaccaccAT 264_1 6877 -22
    265 cttgtagtcggcaccac 1-14-2 CttgtagtcggcaccAC 265_1 6880 -21
    266 cttgtagtcggcacca 1-13-2 CttgtagtcggcacCA 266_1 6881 -21
    267 cgcttgtagtcggcac 2-12-2 CGcttgtagtcggcAC 267_1 6883 -21
    268 tcaataaagatcaggc 3-11-2 TCAataaagatcagGC 268_1 6942 -17
    269 tggacttacaagaatg 2-12-2 TGgacttacaagaaTG 269_1 6986 -14
    270 atggacttacaagaat 3-11-2 ATGgacttacaagaAT 270_1 6987 -15
    271 gctcaagaaattggat 4-10-2 GCTCaagaaattggAT 271_1 7073 -19
    272 tactgtagaacatggc 4-10-2 TACTgtagaacatgGC 272_1 7133 -21
    273 gcaattcatttgatct 4-9-3 GCAAttcatttgaTCT 273_1 7239 -20
    274 tgaagggaggagggacac 2-14-2 TGaagggaggagggacAC 274_1 7259 -20
    275 agtggtgaagggaggag 2-13-2 AGtggtgaagggaggAG 275_1 7265 -21
    276 tagtggtgaagggaggag 2-14-2 TAgtggtgaagggaggAG 276_1 7265 -21
    277 atagtggtgaagggaggag 1-16-2 AtagtggtgaagggaggAG 277_1 7265 -20
    278 tagtggtgaagggagga 2-13-2 TAgtggtgaagggagGA 278_1 7266 -21
    279 atagtggtgaagggagga 2-14-2 ATagtggtgaagggagGA 279_1 7266 -21
    280 tagtggtgaagggagg 3-11-2 TAGtggtgaagggaGG 280_1 7267 -21
    281 atagtggtgaagggagg 3-12-2 ATAgtggtgaagggaGG 281_1 7267 -22
    282 gatagtggtgaagggagg 2-14-2 GAtagtggtgaagggaGG 282_1 7267 -21
    283 atagtggtgaagggag 4-10-2 ATAGtggtgaagggAG 283_1 7268 -20
    284 gatagtggtgaagggag 2-12-3 GAtagtggtgaaggGAG 284_1 7268 -21
    285 gagatagtggtgaagg 2-10-4 GAgatagtggtgAAGG 285_1 7271 -20
    286 catgggagatagtggt 4-10-2 CATGggagatagtgGT 286_1 7276 -22
    287 acaaataatggttactct 4-10-4 ACAAataatggttaCTCT 287_1 7302 -20
    288 acacacaaataatggtta 4-10-4 ACACacaaataatgGTTA 288_1 7306 -20
    289 gagggacacacaaataat 3-11-4 GAGggacacacaaaTAAT 289_1 7311 -21
    290 atatagagaggctcaa 4-8-4 ATATagagaggcTCAA 290_1 7390 -21
    291 ttgatatagagaggct 2-10-4 TTgatatagagaGGCT 291_1 7393 -20
    292 gcatttgatatagaga 4-9-3 GCATttgatatagAGA 292_1 7397 -20
    293 tttgcatttgatatag 2-11-3 TTtgcatttgataTAG 293_1 7400 -15
    294 ctggaagaataggttc 3-11-2 CTGgaagaataggtTC 294_1 7512 -17
    295 actggaagaataggtt 4-10-2 ACTGgaagaataggTT 295_1 7513 -18
    296 tactggaagaataggt 4-10-2 TACTggaagaatagGT 296_1 7514 -18
    297 tggcttatcctgtact 4-10-2 TGGCttatcctgtaCT 297_1 7526 -25
    298 atggcttatcctgtac 2-10-4 ATggcttatcctGTAC 298_1 7527 -22
    299 tatggcttatcctgta 4-10-2 TATGgcttatcctgTA 299_1 7528 -22
    300 gtatggcttatcctgt 3-10-3 GTAtggcttatccTGT 300_1 7529 -23
    301 atgaatatatgcccagt 2-11-4 ATgaatatatgccCAGT 301_1 7547 -22
    302 gatgaatatatgccca 2-10-4 GAtgaatatatgCCCA 302_1 7549 -22
    303 caagatgaatatatgcc 3-10-4 CAAgatgaatataTGCC 303_1 7551 -21
    304 gacaacatcagtataga 4-9-4 GACAacatcagtaTAGA 304_1 7572 -22
    305 caagacaacatcagta 4-8-4 CAAGacaacatcAGTA 305_1 7576 -20
    306 cactcctagttccttt 3-10-3 CACtcctagttccTTT 306_1 7601 -22
    307 aacactcctagttcct 3-10-3 AACactcctagttCCT 307_1 7603 -22
    308 taacactcctagttcc 2-11-3 TAacactcctagtTCC 308_1 7604 -20
    309 ctaacactcctagttc 2-12-2 CTaacactcctagtTC 309_1 7605 -18
    310 tgataacataactgtg 2-12-2 TGataacataactgTG 310_1 7637 -13
    311 ctgataacataactgt 2-10-4 CTgataacataaCTGT 311_1 7638 -18
    312 tttgaactcaagtgac 4-10-2 TTTGaactcaagtgAC 312_1 7654 -16
    313 tcctttacttagctag 4-9-3 TCCTttacttagcTAG 313_1 7684 -23
    314 gagtttggattagctg 2-11-3 GAgtttggattagCTG 314_1 7764 -20
    315 tgggatatgacaggga 2-11-3 TGggatatgacagGGA 315_1 7838 -21
    316 tgtgggatatgacagg 4-10-2 TGTGggatatgacaGG 316_1 7840 -22
    317 atatggaagggatatc 4-10-2 ATATggaagggataTC 317_1 7875 -17
    318 acaggatatggaaggg 3-10-3 ACAggatatggaaGGG 318_1 7880 -21
    319 atttcaacaggatatgg 4-9-4 ATTTcaacaggatATGG 319_1 7885 -20
    320 gagtaatttcaacagg 2-11-3 GAgtaatttcaacAGG 320_1 7891 -17
    321 agggagtaatttcaaca 4-9-4 AGGGagtaatttcAACA 321_1 7893 -22
    322 attagggagtaatttca 4-9-4 ATTAgggagtaatTTCA 322_1 7896 -21
    323 cttactattagggagt 2-10-4 CTtactattaggGAGT 323_1 7903 -20
    324 cagcttactattaggg 2-11-3 CAgcttactattaGGG 324_1 7906 -20
    326 atttcagcttactattag 3-11-4 ATTtcagcttactaTTAG 326_1 7908 -20
    325 tcagcttactattagg 3-10-3 TCAgcttactattAGG 325_1 7907 -20
    327 ttcagcttactattag 2-10-4 TTcagcttactaTTAG 327_1 7908 -17
    328 cagatttcagcttact 4-10-2 CAGAtttcagcttaCT 328_1 7913 -21
    329 gactacaactagaggg 3-11-2 GACtacaactagagGG 329_1 7930 -19
    330 agactacaactagagg 4-10-2 AGACtacaactagaGG 330_1 7931 -19
    331 aagactacaactagag 2-12-2 AAgactacaactagAG 331_1 7932 -13
    332 atgatttaattctagtcaaa 4-12-4 ATGAtttaattctagtCAAA 332_1 7982 -20
    333 tttaattctagtcaaa 3-10-3 TTTaattctagtcAAA 333_1 7982 -12
    334 gatttaattctagtca 4-8-4 GATTtaattctaGTCA 334_1 7984 -20
    771 tgatttaattctagtca 3-10-4 TGAtttaattctaGTCA 771_1 7984 -20
    335 atgatttaattctagtca 4-11-3 ATGAtttaattctagTCA 335_1 7984 -20
    336 gatgatttaattctagtca 4-13-2 GATGatttaattctagtCA 336_1 7984 -20
    337 gatttaattctagtca 2-10-4 GAtttaattctaGTCA 337_1 7984 -18
    338 gatgatttaattctagtc 4-11-3 GATGatttaattctaGTC 338_1 7985 -20
    339 tgatttaattctagtc 2-12-2 TGatttaattctagTC 339_1 7985 -13
    340 gagatgatttaattcta 4-9-4 GAGAtgatttaatTCTA 340_1 7988 -20
    341 gagatgatttaattct 3-10-3 GAGatgatttaatTCT 341_1 7989 -16
    342 cagattgatggtagtt 4-10-2 CAGAttgatggtagTT 342_1 8030 -19
    343 ctcagattgatggtag 2-10-4 CTcagattgatgGTAG 343_1 8032 -20
    344 gttagccctcagattg 3-10-3 GTTagccctcagaTTG 344_1 8039 -23
    345 tgtattgttagccctc 2-10-4 TGtattgttagcCCTC 345_1 8045 -24
    346 acttgtattgttagcc 2-10-4 ACttgtattgttAGCC 346_1 8048 -22
    347 agccagtatcagggac 3-11-2 AGCcagtatcagggAC 347_1 8191 -23
    348 ttgacaatagtggcat 2-10-4 TTgacaatagtgGCAT 348_1 8213 -20
    349 acaagtggtatcttct 3-10-3 ACAagtggtatctTCT 349_1 8228 -19
    350 aatctactttacaagt 4-10-2 AATCtactttacaaGT 350_1 8238 -16
    351 cacagtagatgcctgata 2-12-4 CAcagtagatgcctGATA 351_1 8351 -24
    352 gaacacagtagatgcc 2-11-3 GAacacagtagatGCC 352_1 8356 -21
    353 cttggaacacagtagat 4-11-2 CTTGgaacacagtagAT 353_1 8359 -20
    354 atatcttggaacacag 3-10-3 ATAtcttggaacaCAG 354_1 8364 -18
    355 tctttaatatcttggaac 3-11-4 TCTttaatatcttgGAAC 355_1 8368 -19
    356 tgatttctttaatatcttg 2-13-4 TGatttctttaatatCTTG 356_1 8372 -19
    357 tgatgatttctttaatatc 2-13-4 TGatgatttctttaaTATC 357_1 8375 -18
    358 aggctaagtcatgatg 3-11-2 AGGctaagtcatgaTG 358_1 8389 -19
    359 ttgatgaggctaagtc 4-10-2 TTGAtgaggctaagTC 359_1 8395 -19
    360 ccaggattatactctt 3-11-2 CCAggattatactcTT 360_1 8439 -20
    361 gccaggattatactct 2-10-4 GCcaggattataCTCT 361_1 8440 -23
    362 ctgccaggattatact 3-11-2 CTGccaggattataCT 362_1 8442 -21
    363 cagaaacttatactttatg 4-13-2 CAGAaacttatactttaTG 363_1 8473 -19
    364 aagcagaaacttatact 4-9-4 AAGCagaaacttaTACT 364_1 8478 -20
    365 gaagcagaaacttatact 3-11-4 GAAgcagaaacttaTACT 365_1 8478 -20
    366 tggaagcagaaacttatact 3-15-2 TGGaagcagaaacttataCT 366_1 8478 -21
    367 tggaagcagaaacttatac 3-13-3 TGGaagcagaaacttaTAC 367_1 8479 -20
    368 aagcagaaacttatac 2-11-3 AAgcagaaacttaTAC 368_1 8479 -13
    369 tggaagcagaaacttata 3-11-4 TGGaagcagaaactTATA 369_1 8480 -21
    370 aagggatattatggag 4-10-2 AAGGgatattatggAG 370_1 8587 -18
    371 tgccggaagatttcct 2-12-2 TGccggaagatttcCT 371_1 8641 -21
    372 atggattgggagtaga 4-10-2 ATGGattgggagtaGA 372_1 8772 -21
    373 agatggattgggagta 2-12-2 AGatggattgggagTA 373_1 8774 -18
    374 aagatggattgggagt 3-11-2 AAGatggattgggaGT 374_1 8775 -18
    375 acaagatggattggga 2-10-4 ACaagatggattGGGA 375_1 8777 -20
    375 acaagatggattggga 2-12-2 ACaagatggattggGA 375_2 8777 -17
    376 agaaggttcagacttt 3-9-4 AGAaggttcagaCTTT 376_1 8835 -20
    377 gcagaaggttcagact 2-11-3 GCagaaggttcagACT 377 1 8837 -21
    377 gcagaaggttcagact 3-11-2 GCAgaaggttcagaCT 377_2 8837 -22
    378 tgcagaaggttcagac 4-10-2 TGCAgaaggttcagAC 378_1 8838 -22
    379 agtgcagaaggttcag 2-11-3 AGtgcagaaggttCAG 379_1 8840 -20
    379 agtgcagaaggttcag 4-10-2 AGTGcagaaggttcAG 379_2 8840 -21
    380 aagtgcagaaggttca 4-10-2 AAGTgcagaaggttCA 380_1 8841 -20
    381 taagtgcagaaggttc 2-10-4 TAagtgcagaagGTTC 381_1 8842 -19
    382 tctaagtgcagaaggt 2-10-4 TCtaagtgcagaAGGT 382_1 8844 -21
    383 ctcaggagttctacttc 3-12-2 CTCaggagttctactTC 383_1 8948 -20
    384 ctcaggagttctactt 3-10-3 CTCaggagttctaCTT 384_1 8949 -21
    385 atggaggtgactcaggag 1-15-2 AtggaggtgactcaggAG 385_1 8957 -20
    386 atggaggtgactcagga 2-13-2 ATggaggtgactcagGA 386_1 8958 -21
    387 atggaggtgactcagg 2-11-3 ATggaggtgactcAG G 387_1 8959 -21
    388 tatggaggtgactcagg 2-12-3 TAtggaggtgactcAGG 388_1 8959 -21
    389 atatggaggtgactcagg 2-14-2 ATatggaggtgactcaGG 389_1 8959 -21
    390 tatggaggtgactcag 4-10-2 TATGgaggtgactcAG 390_1 8960 -21
    391 atatggaggtgactcag 2-11-4 ATatggaggtgacTCAG 391_1 8960 -22
    392 catatggaggtgactcag 2-14-2 CAtatggaggtgactcAG 392_1 8960 -20
    393 atatggaggtgactca 3-10-3 ATAtggaggtgacTCA 393_1 8961 -20
    394 catatggaggtgactca 2-12-3 CAtatggaggtgacTCA 394_1 8961 -21
    395 catatggaggtgactc 2-10-4 CAtatggaggtgACTC 395_1 8962 -20
    396 gcatatggaggtgactc 2-13-2 GCatatggaggtgacTC 396_1 8962 -21
    397 tgcatatggaggtgactc 2-14-2 TGcatatggaggtgacTC 397_1 8962 -21
    398 ttgcatatggaggtgactc 1-16-2 TtgcatatggaggtgacTC 398_1 8962 -20
    399 tttgcatatggaggtgactc 1-17-2 TttgcatatggaggtgacTC 399_1 8962 -21
    400 gcatatggaggtgact 2-12-2 GCatatggaggtgaCT 400_1 8963 -20
    401 tgcatatggaggtgact 2-13-2 TGcatatggaggtgaCT 401_1 8963 -20
    402 ttgcatatggaggtgact 3-13-2 TTGcatatggaggtgaCT 402_1 8963 -22
    403 tttgcatatggaggtgact 1-16-2 TttgcatatggaggtgaCT 403_1 8963 -20
    404 tgcatatggaggtgac 3-11-2 TGCatatggaggtgAC 404_1 8964 -20
    405 ttgcatatggaggtgac 3-11-3 TTGcatatggaggtGAC 405_1 8964 -21
    406 tttgcatatggaggtgac 4-12-2 TTTGcatatggaggtgAC 406_1 8964 -21
    407 tttgcatatggaggtga 4-11-2 TTTGcatatggaggtGA 407_1 8965 -21
    408 tttgcatatggaggtg 2-10-4 TTtgcatatggaGGTG 408_1 8966 -21
    409 aagtgaagttcaacagc 2-11-4 AAgtgaagttcaaCAGC 409_1 8997 -20
    410 tgggaagtgaagttca 2-10-4 TGggaagtgaagTTCA 410_1 9002 -20
    411 atgggaagtgaagttc 2-11-3 ATgggaagtgaagTTC 411_1 9003 -17
    412 gatgggaagtgaagtt 4-9-3 GATGggaagtgaaGTT 412_1 9004 -21
    413 ctgtgatgggaagtgaa 3-11-3 CTGtgatgggaagtGAA 413_1 9007 -20
    414 attgagtgaatccaaa 3-10-3 ATTgagtgaatccAAA 414_1 9119 -14
    415 aattgagtgaatccaa 2-10-4 AAttgagtgaatCCAA 415_1 9120 -16
    416 gataattgagtgaatcc 4-10-3 GATAattgagtgaaTCC 416_1 9122 -20
    417 gtgataattgagtgaa 3-10-3 GTGataattgagtGAA 417_1 9125 -16
    418 aagaaaggtgcaataa 3-10-3 AAGaaaggtgcaaTAA 418_1 9155 -14
    419 caagaaaggtgcaata 2-10-4 CAagaaaggtgcAATA 419_1 9156 -15
    420 acaagaaaggtgcaat 4-10-2 ACAAgaaaggtgcaAT 420_1 9157 -16
    421 atttaaactcacaaac 2-12-2 ATttaaactcacaaAC 421_1 9171 -10
    422 ctgttaggttcagcga 2-10-4 CTgttaggttcaGCGA 422_1 9235 -24
    423 tctgaatgaacatttcg 4-9-4 TCTGaatgaacatTTCG 423_1 9260 -20
    424 ctcattgaaggttctg 2-10-4 CTcattgaaggtTCTG 424_1 9281 -20
    425 ctaatctcattgaagg 3-11-2 CTAatctcattgaaGG 425_1 9286 -17
    426 cctaatctcattgaag 2-12-2 CCtaatctcattgaAG 426_1 9287 -16
    427 actttgatctttcagc 3-10-3 ACTttgatctttcAGC 427_1 9305 -20
    428 actatgcaacactttg 2-12-2 ACtatgcaacacttTG 428_1 9315 -15
    429 caaatagctttatcgg 3-10-3 CAAatagctttatCGG 429_1 9335 -17
    430 ccaaatagctttatcg 2-10-4 CCaaatagctttATCG 430_1 9336 -19
    431 tccaaatagctttatc 4-10-2 TCCAaatagctttaTC 431_1 9337 -18
    432 gatccaaatagcttta 4-10-2 GATCcaaatagcttTA 432_1 9339 -18
    433 atgatccaaatagctt 2-10-4 ATgatccaaataGCTT 433_1 9341 -19
    434 tatgatccaaatagct 4-10-2 TATGatccaaatagCT 434_1 9342 -18
    435 taaacagggctgggaat 4-9-4 TAAAcagggctggGAAT 435_1 9408 -22
    436 acttaaacagggctgg 2-10-4 ACttaaacagggCTGG 436_1 9412 -21
    437 acacttaaacagggct 2-10-4 ACacttaaacagGGCT 437_1 9414 -22
    438 gaacacttaaacaggg 4-8-4 GAACacttaaacAGGG 438_1 9416 -20
    439 agagaacacttaaacag 4-9-4 AGAGaacacttaaACAG 439_1 9418 -20
    440 ctacagagaacactta 4-8-4 CTACagagaacaCTTA 440_1 9423 -20
    441 atgctacagagaacact 3-10-4 ATGctacagagaaCACT 441_1 9425 -22
    442 ataaatgctacagagaaca 4-11-4 ATAAatgctacagagAACA 442_1 9427 -20
    443 agataaatgctacagaga 2-12-4 AGataaatgctacaGAGA 443_1 9430 -20
    444 tagagataaatgctaca 4-9-4 TAGAgataaatgcTACA 444_1 9434 -21
    445 tagatagagataaatgct 4-11-3 TAGAtagagataaatGCT 445_1 9437 -20
    446 caatatactagatagaga 4-10-4 CAATatactagataGAGA 446_1 9445 -21
    447 tacacaatatactagatag 4-11-4 TACAcaatatactagATAG 447_1 9448 -21
    448 ctacacaatatactag 3-10-3 CTAcacaatatacTAG 448_1 9452 -16
    449 gctacacaatatacta 4-8-4 GCTAcacaatatACTA 449_1 9453 -21
    450 atatgctacacaatatac 4-10-4 ATATgctacacaatATAC 450_1 9455 -20
    451 tgatatgctacacaat 4-8-4 TGATatgctacaCAAT 451_1 9459 -20
    452 atgatatgatatgctac 4-9-4 ATGAtatgatatgCTAC 452_1 9464 -21
    453 gaggagagagacaataaa 4-10-4 GAGGagagagacaaTAAA 453_1 9495 -20
    454 ctaggaggagagagaca 3-11-3 CTAggaggagagagACA 454_1 9500 -22
    455 tattctaggaggagaga 4-10-3 TATTctaggaggagAGA 455_1 9504 -21
    456 ttatattctaggaggag 4-10-3 TTATattctaggagGAG 456_1 9507 -21
    457 gtttatattctaggag 3-9-4 GTTtatattctaGGAG 457_1 9510 -20
    458 tggagtttatattctagg 2-12-4 TGgagtttatattcTAGG 458_1 9512 -22
    459 cgtaccaccactctgc 2-11-3 CGtaccaccactcTGC 459_1 9590 -25
    460 tgaggaaatcattcattc 4-10-4 TGAGgaaatcattcATTC 460_1 9641 -22
    461 tttgaggaaatcattcat 4-10-4 TTTGaggaaatcatTCAT 461_1 9643 -20
    462 aggctaatcctatttg 4-10-2 AGGCtaatcctattTG 462_1 9657 -22
    463 tttaggctaatcctat 4-8-4 TTTAggctaatcCTAT 463_1 9660 -22
    464 tgctccagtgtaccct 3-11-2 TGCtccagtgtaccCT 464_1 9755 -27
    465 tagtagtactcgatag 2-10-4 TAgtagtactcgATAG 465_1 9813 -18
    466 ctaattgtagtagtactc 3-12-3 CTAattgtagtagtaCTC 466_1 9818 -20
    467 tgctaattgtagtagt 2-10-4 TGctaattgtagTAGT 467_1 9822 -19
    468 agtgctaattgtagta 4-10-2 AGTGctaattgtagTA 468_1 9824 -19
    469 gcaagtgctaattgta 4-10-2 GCAAgtgctaattgTA 469_1 9827 -20
    470 gaggaaatgaactaattta 4-13-2 GAGGaaatgaactaattTA 470_1 9881 -18
    471 caggaggaaatgaacta 4-11-2 CAGGaggaaatgaacTA 471_1 9886 -19
    472 ccctagagtcatttcc 2-11-3 CCctagagtcattTCC 472_1 9902 -24
    473 atcttacatgatgaagc 3-11-3 ATCttacatgatgaAGC 473_1 9925 -20
    475 agacacactcagatttcag 2-15-2 AG acacactcagatttcAG 475_1 9967 -20
    474 gacacactcagatttcag 3-13-2 GACacactcagatttcAG 474_1 9967 -20
    476 aagacacactcagatttcag 3-15-2 AAGacacactcagatttcAG 476_1 9967 -21
    477 agacacactcagatttca 2-13-3 AG acacactcagattTCA 477_1 9968 -20
    478 aagacacactcagatttca 3-13-3 AAGacacactcagattTCA 478_1 9968 -21
    479 aaagacacactcagatttca 2-14-4 AAagacacactcagatTTCA 479_1 9968 -20
    480 gaaagacacactcagatttc 3-14-3 GAAagacacactcagatTTC 480_1 9969 -20
    481 aagacacactcagatttc 4-11-3 AAGAcacactcagatTTC 481_1 9969 -21
    482 aaagacacactcagatttc 4-11-4 AAAGacacactcagaTTTC 482_1 9969 -20
    483 tgaaagacacactcagattt 4-14-2 TGAAagacacactcagatTT 483_1 9970 -20
    484 tgaaagacacactcagatt 2-13-4 TGaaagacacactcaGATT 484_1 9971 -21
    485 tgaaagacacactcagat 3-12-3 TGAaagacacactcaGAT 485_1 9972 -20
    486 attgaaagacacactca 4-10-3 ATTGaaagacacacTCA 486_1 9975 -19
    487 tcattgaaagacacact 2-11-4 TCattgaaagacaCACT 487_1 9977 -18
    488 ttccatcattgaaaga 3-9-4 TTCcatcattgaAAGA 488_1 9983 -18
    489 ataataccacttatcat 4-9-4 ATAAtaccacttaTCAT 489_1 10010 -20
    490 ttacttaatttctttgga 2-12-4 TTacttaatttcttTGGA 490_1 10055 -20
    491 ttagaactagctttatca 3-12-3 TTAgaactagctttaTCA 491_1 10101 -20
    492 gaggtacaaatatagg 3-10-3 GAGgtacaaatatAGG 492_1 10171 -18
    493 cttatgatacaactta 3-10-3 CTTatgatacaacTTA 493_1 10384 -15
    494 tcttatgatacaactt 2-11-3 TCttatgatacaaCTT 494_1 10385 -15
    495 ttcttatgatacaact 3-11-2 TTCttatgatacaaCT 495_1 10386 -15
    496 cagtttcttatgatac 2-11-3 CAgtttcttatgaTAC 496_1 10390 -16
    497 gcagtttcttatgata 3-11-2 GCAgtttcttatgaTA 497_1 10391 -19
    498 tacaaatgtctattaggtt 4-12-3 TACAaatgtctattagGTT 498_1 10457 -21
    499 tgtacaaatgtctattag 4-11-3 TGTAcaaatgtctatTAG 499_1 10460 -20
    500 agcatcacaattagta 3-11-2 AGCatcacaattagTA 500_1 10535 -18
    501 ctaatgatagtgaagc 3-11-2 CTAatgatagtgaaGC 501_1 10548 -17
    502 agctaatgatagtgaa 3-11-2 AGCtaatgatagtgAA 502_1 10550 -16
    503 atgccttgacatatta 4-10-2 ATGCcttgacatatTA 503_1 10565 -20
    504 ctcaagattattgacac 4-9-4 CTCAagattattgACAC 504_1 10623 -20
    505 acctcaagattattga 2-10-4 ACctcaagattaTTGA 505_2 10626 -18
    505 acctcaagattattga 3-9-4 ACCtcaagattaTTGA 505_1 10626 -20
    506 aacctcaagattattg 4-10-2 AACCtcaagattatTG 506_1 10627 -17
    507 cacaaacctcaagattatt 4-13-2 CACAaacctcaagattaTT 507_1 10628 -20
    508 gtacttaattagacct 3-9-4 GTActtaattagACCT 508_1 10667 -21
    509 agtacttaattagacc 4-9-3 AGTActtaattagACC 509_1 10668 -20
    510 gtatgaggtggtaaac 4-10-2 GTATgaggtggtaaAC 510_1 10688 -18
    511 aggaaacagcagaagtg 2-11-4 AGgaaacagcagaAGTG 511_1 10723 -21
    512 gcacaacccagaggaa 2-12-2 GCacaacccagaggAA 512_1 10735 -20
    513 caagcacaacccagag 3-11-2 CAAgcacaacccagAG 513_1 10738 -20
    514 ttcaagcacaacccag 3-10-3 TTCaagcacaaccCAG 514_1 10740 -21
    515 aattcaagcacaaccc 2-10-4 AAttcaagcacaACCC 515_1 10742 -20
    516 taataattcaagcacaacc 4-13-2 TAATaattcaagcacaaCC 516_1 10743 -20
    517 actaataattcaagcac 4-9-4 ACTAataattcaaGCAC 517_1 10747 -20
    518 ataatactaataattcaagc 4-12-4 ATAAtactaataattcAAGC 518_1 10749 -19
    519 tagatttgtgaggtaa 2-10-4 TAgatttgtgagGTAA 519_1 11055 -18
    520 agccttaattctccat 4-10-2 AGCCttaattctccAT 520_1 11091 -24
    521 aatgatctagagcctta 4-9-4 AATGatctagagcCTTA 521_1 11100 -22
    522 ctaatgatctagagcc 3-10-3 CTAatgatctagaGCC 522_1 11103 -22
    523 actaatgatctagagc 3-9-4 ACTaatgatctaGAGC 523_1 11104 -21
    524 cattaacatgttcttatt 3-11-4 CATtaacatgttctTATT 524_1 11165 -19
    525 acaagtacattaacatgttc 4-12-4 ACAAgtacattaacatGTTC 525_1 11170 -22
    526 ttacaagtacattaacatg 4-11-4 TTACaagtacattaaCATG 526_1 11173 -20
    527 gctttattcatgtttat 4-9-4 GCTTtattcatgtTTAT 527_1 11195 -22
    528 gctttattcatgttta 3-11-2 GCTttattcatgttTA 528_1 11196 -18
    529 agagctttattcatgttt 3-13-2 AGAgctttattcatgtTT 529_1 11197 -20
    530 ataagagctttattcatg 4-10-4 ATAAgagctttattCATG 530_1 11200 -21
    531 cataagagctttattca 4-9-4 CATAagagctttaTTCA 531_1 11202 -21
    532 agcataagagctttat 4-8-4 AGCAtaagagctTTAT 532_1 11205 -22
    533 tagattgtttagtgca 3-10-3 TAGattgtttagtGCA 533_1 11228 -20
    534 gtagattgtttagtgc 2-10-4 GTagattgtttaGTGC 534_1 11229 -21
    535 gacaattctagtagatt 4-9-4 GACAattctagtaGATT 535_1 11238 -21
    536 ctgacaattctagtag 3-9-4 CTGacaattctaGTAG 536_1 11241 -20
    537 gctgacaattctagta 4-10-2 GCTGacaattctagTA 537_1 11242 -21
    538 aggattaagatacgta 2-12-2 AGgattaagatacgTA 538_1 11262 -15
    539 caggattaagatacgt 2-11-3 CAggattaagataCGT 539_1 11263 -17
    540 tcaggattaagatacg 3-11-2 TCAggattaagataCG 540_1 11264 -16
    541 ttcaggattaagatac 2-10-4 TTcaggattaagATAC 541_1 11265 -15
    542 aggaagaaagtttgattc 4-10-4 AGGAagaaagtttgATTC 542_1 11308 -21
    543 tcaaggaagaaagtttga 4-10-4 TCAAggaagaaagtTTGA 543_1 11311 -20
    544 ctcaaggaagaaagtttg 4-10-4 CTCAaggaagaaagTTTG 544_1 11312 -20
    545 tgctcaaggaagaaagt 3-10-4 TGCtcaaggaagaAAGT 545_1 11315 -21
    546 aattatgctcaaggaaga 4-11-3 AATTatgctcaaggaAGA 546_1 11319 -20
    547 taggataccacattatga 4-12-2 TAGGataccacattatGA 547_1 11389 -22
    548 cataatttattccattcctc 2-15-3 CAtaatttattccattcCTC 548_1 11449 -22
    549 tgcataatttattccat 4-10-3 TGCAtaatttattcCAT 549_1 11454 -22
    550 actgcataatttattcc 4-10-3 ACTGcataatttatTCC 550_1 11456 -21
    551 ctaaactgcataatttatt 4-11-4 CTAAactgcataattTATT 551_1 11458 -20
    552 ataactaaactgcata 2-10-4 ATaactaaactgCATA 552_1 11465 -16
    553 ttattaataactaaactgc 3-12-4 TTAttaataactaaaCTGC 553_1 11468 -19
    554 tagtacattattaataact 4-13-2 TAGTacattattaataaCT 554_1 11475 -18
    555 cataactaaggacgtt 4-10-2 CATAactaaggacgTT 555_1 11493 -17
    556 tcataactaaggacgt 2-11-3 TCataactaaggaCGT 556_1 11494 -16
    557 cgtcataactaaggac 4-10-2 CGTCataactaaggAC 557_1 11496 -17
    558 tcgtcataactaagga 2-12-2 TCgtcataactaagGA 558_1 11497 -16
    559 atcgtcataactaagg 2-10-4 ATcgtcataactAAGG 559_1 11498 -17
    560 gttagtatcttacatt 2-11-3 GTtagtatcttacATT 560_1 11525 -15
    561 ctctattgttagtatc 3-10-3 CTCtattgttagtATC 561_1 11532 -17
    562 agtatagagttactgt 3-10-3 AGTatagagttacTGT 562_1 11567 -19
    563 ttcctggtgatacttt 4-10-2 TTCCtggtgatactTT 563_1 11644 -21
    564 gttcctggtgatactt 4-10-2 GTTCctggtgatacTT 564_1 11645 -21
    565 tgttcctggtgatact 2-12-2 TGttcctggtgataCT 565_1 11646 -20
    566 ataaacatgaatctctcc 2-12-4 ATaaacatgaatctCTCC 566_1 11801 -20
    567 ctttataaacatgaatctc 3-12-4 CTTtataaacatgaaTCTC 567_1 11804 -19
    568 ctgtctttataaacatg 3-10-4 CTGtctttataaaCATG 568_1 11810 -19
    569 ttgttataaatctgtctt 2-12-4 TTgttataaatctgTCTT 569_1 11820 -18
    570 ttaaatttattcttggata 3-12-4 TTAaatttattcttgGATA 570_1 11849 -19
    571 cttaaatttattcttgga 2-12-4 CTtaaatttattctTGGA 571_1 11851 -19
    572 cttcttaaatttattcttg 4-13-2 CTTCttaaatttattctTG 572_1 11853 -18
    573 tatgtttctcagtaaag 4-9-4 TATGtttctcagtAAAG 573_1 11877 -19
    574 gaattatctttaaacca 3-10-4 GAAttatctttaaACCA 574_1 11947 -18
    575 cccttaaatttctaca 3-11-2 CCCttaaatttctaCA 575_1 11980 -20
    576 acactgctcttgtacc 4-10-2 ACACtgctcttgtaCC 576_1 11995 -23
    577 tgacaacactgctctt 3-10-3 TGAcaacactgctCTT 577_1 12000 -21
    578 tacatttattgggctc 4-10-2 TACAtttattgggcTC 578_1 12081 -19
    579 gtacatttattgggct 2-10-4 GTacatttattgGGCT 579_1 12082 -23
    580 ttggtacatttattgg 3-10-3 TTGgtacatttatTGG 580_1 12085 -18
    581 catgttggtacatttat 4-10-3 CATGttggtacattTAT 581_1 12088 -21
    582 aatcatgttggtacat 4-10-2 AATCatgttggtacAT 582_1 12092 -16
    583 aaatcatgttggtaca 2-12-2 AAatcatgttggtaCA 583_1 12093 -14
    584 gacaagtttggattaa 3-11-2 GACaagtttggattAA 584_1 12132 -14
    585 aatgttcagatgcctc 2-10-4 AAtgttcagatgCCTC 585_1 12197 -21
    586 gcttaatgttcagatg 2-12-2 GCttaatgttcagaTG 586_1 12201 -17
    587 cgtacatagcttgatg 4-10-2 CGTAcatagcttgaTG 587_1 12267 -20
    588 gtgaggaattaggata 3-11-2 GTGaggaattaggaTA 588_1 12753 -17
    589 gtaacaatatggtttg 3-11-2 GTAacaatatggttTG 589_1 12780 -15
    590 gaaatattgtagacta 2-11-3 GAaatattgtagaCTA 590_1 13151 -14
    591 ttgaaatattgtagac 3-11-2 TTGaaatattgtagAC 591_1 13153 -12
    592 aagtctagtaatttgc 2-10-4 AAgtctagtaatTTGC 592_1 13217 -17
    593 gctcagtagattataa 4-10-2 GCTCagtagattatAA 593_1 13259 -17
    594 catacactgttgctaa 3-10-3 CATacactgttgcTAA 594_1 13296 -19
    595 atggtctcaaatcatt 3-10-3 ATGgtctcaaatcATT 595_1 13314 -17
    596 caatggtctcaaatca 4-10-2 CAATggtctcaaatCA 596_1 13316 -18
    597 ttcctattgattgact 4-10-2 TTCCtattgattgaCT 597_1 13568 -20
    598 tttctgttcacaacac 4-10-2 TTTCtgttcacaacAC 598_1 13600 -17
    599 aggaacccactaatct 2-11-3 AGgaacccactaaTCT 599_1 13702 -20
    600 taaatggcaggaaccc 3-11-2 TAAatggcaggaacCC 600_1 13710 -19
    601 gtaaatggcaggaacc 4-10-2 GTAAatggcaggaaCC 601_1 13711 -20
    602 ttgtaaatggcaggaa 2-11-3 TTgtaaatggcagGAA 602_1 13713 -16
    603 ttatgagttaggcatg 2-10-4 TTatgagttaggCATG 603_1 13835 -19
    604 ccaggtgaaactttaa 3-11-2 CCAggtgaaactttAA 604_1 13935 -17
    605 cccttagtcagctcct 3-10-3 CCCttagtcagctCCT 605_1 13997 -30
    606 acccttagtcagctcc 2-10-4 ACccttagtcagCTCC 606_1 13998 -27
    607 cacccttagtcagctc 2-11-3 CAcccttagtcagCTC 607_1 13999 -24
    608 tctcttactaggctcc 3-10-3 TCTcttactaggcTCC 608_1 14091 -24
    609 cctatctgtcatcatg 2-11-3 CCtatctgtcatcATG 609_1 14178 -20
    610 tcctatctgtcatcat 3-11-2 TCCtatctgtcatcAT 610_1 14179 -20
    611 gagaagtgtgagaagc 3-11-2 GAGaagtgtgagaaGC 611_1 14808 -19
    612 catccttgaagtttag 4-10-2 CATCcttgaagtttAG 612_1 14908 -19
    613 taataagatggctccc 3-10-3 TAAtaagatggctCCC 613_1 15046 -21
    614 caaggcataataagat 3-11-2 CAAggcataataagAT 614_1 15053 -14
    615 ccaaggcataataaga 2-10-4 CCaaggcataatAAGA 615_1 15054 -18
    616 tgatccaattctcacc 2-12-2 TGatccaattctcaCC 616_1 15151 -19
    617 atgatccaattctcac 3-10-3 ATGatccaattctCAC 617_1 15152 -19
    618 cgcttcatcttcaccc 3-11-2 CGCttcatcttcacCC 618_1 15260 -26
    619 tatgacactgcatctt 2-10-4 TAtgacactgcaTCTT 619_1 15317 -19
    620 gtatgacactgcatct 3-10-3 GTAtgacactgcaTCT 620_1 15318 -21
    621 tgtatgacactgcatc 2-10-4 TGtatgacactgCATC 621_1 15319 -20
    622 ttctcttctgtaagtc 4-10-2 TTCTcttctgtaagTC 622_1 15363 -19
    623 ttctacagaggaacta 2-10-4 TTctacagaggaACTA 623_1 15467 -17
    624 actacagttctacaga 3-10-3 ACTacagttctacAGA 624_1 15474 -19
    625 ttcccacaggtaaatg 4-10-2 TTCCcacaggtaaaTG 625_1 15561 -21
    626 attatttgaatatactcatt 4-12-4 ATTAtttgaatatactCATT 626_1 15594 -20
    627 tgggaggaaattatttg 4-10-3 TGGGaggaaattatTTG 627_1 15606 -20
    628 tgactcatcttaaatg 4-10-2 TGACtcatcttaaaTG 628_1 15621 -17
    629 ctgactcatcttaaat 3-11-2 CTGactcatcttaaAT 629_1 15622 -16
    630 tttactctgactcatc 3-10-3 TTTactctgactcATC 630_1 15628 -17
    631 tattggaggaattatt 3-11-2 TATtggaggaattaTT 631_1 15642 -14
    632 gtattggaggaattat 3-11-2 GTAttggaggaattAT 632_1 15643 -16
    633 tggtatacttctctaagtat 2-15-3 TGgtatacttctctaagTAT 633_1 15655 -22
    634 gatctcttggtatact 4-10-2 GATCtcttggtataCT 634_1 15666 -20
    635 cagacaactctatacc 2-12-2 CAgacaactctataCC 635_1 15689 -18
    636 aacatcagacaactcta 4-9-4 AACAtcagacaacTCTA 636_1 15693 -21
    637 taacatcagacaactc 4-10-2 TAACatcagacaacTC 637_1 15695 -16
    638 tttaacatcagacaactc 4-10-4 TTTAacatcagacaACTC 638_1 15695 -20
    639 atttaacatcagacaa 2-12-2 ATttaacatcagacAA 639_1 15698 -11
    640 cctatttaacatcagac 2-11-4 CCtatttaacatcAGAC 640_1 15700 -20
    641 tccctatttaacatca 3-10-3 TCCctatttaacaTCA 641_1 15703 -21
    642 tcaacgactattggaat 4-9-4 TCAAcgactattgGAAT 642_1 15737 -20
    643 cttatattctggctat 4-9-3 CTTAtattctggcTAT 643_1 15850 -20
    644 atccttatattctggc 4-10-2 ATCCttatattctgGC 644_1 15853 -23
    645 gatccttatattctgg 2-10-4 GAtccttatattCTGG 645_1 15854 -21
    646 tgatccttatattctg 3-10-3 TGAtccttatattCTG 646_1 15855 -19
    647 attgaaacttgatcct 4-8-4 ATTGaaacttgaTCCT 647_1 15864 -21
    648 actgtcattgaaactt 2-10-4 ACtgtcattgaaACTT 648_1 15870 -16
    649 tcttactgtcattgaa 3-11-2 TCTtactgtcattgAA 649_1 15874 -16
    650 aggatcttactgtcatt 2-11-4 AGgatcttactgtCATT 650_1 15877 -21
    651 gcaaatcaactccatc 3-10-3 GCAaatcaactccATC 651_1 15896 -20
    652 gtgcaaatcaactcca 3-10-3 GTGcaaatcaactCCA 652_1 15898 -22
    653 caattatttctttgtgc 4-10-3 CAATtatttctttgTGC 653_1 15910 -21
    654 tggcaacaattatttctt 3-11-4 TGGcaacaattattTCTT 654_1 15915 -21
    655 gctggcaacaattatt 3-9-4 GCTggcaacaatTATT 655_1 15919 -21
    656 atccatttctactgcc 4-10-2 ATCCatttctactgCC 656_1 15973 -24
    657 taatatctattgatttcta 4-11-4 TAATatctattgattTCTA 657_1 15988 -20
    658 tcaatagtgtagggca 2-12-2 TCaatagtgtagggCA 658_1 16093 -18
    659 ttcaatagtgtagggc 3-11-2 TTCaatagtgtaggGC 659_1 16094 -19
    660 aggttaattaattcaatag 4-11-4 AGGTtaattaattcaATAG 660_1 16102 -21
    661 catttgtaatccctag 3-10-3 CATttgtaatcccTAG 661_2 16163 -20
    661 catttgtaatccctag 3-9-4 CATttgtaatccCTAG 661_1 16163 -22
    662 acatttgtaatcccta 3-10-3 ACAtttgtaatccCTA 662_1 16164 -20
    663 aacatttgtaatccct 2-10-4 AAcatttgtaatCCCT 663_2 16165 -21
    663 aacatttgtaatccct 3-9-4 AACatttgtaatCCCT 663_1 16165 -22
    664 taaatttcaagttctg 2-11-3 TAaatttcaagttCTG 664_1 16184 -14
    665 gtttaaatttcaagttct 3-11-4 GTTtaaatttcaagTTCT 665_1 16185 -19
    666 ccaagtttaaatttcaag 4-10-4 CCAAgtttaaatttCAAG 666_1 16189 -21
    667 acccaagtttaaatttc 4-9-4 ACCCaagtttaaaTTTC 667_1 16192 -22
    668 catacagtgacccaagttt 2-14-3 CAtacagtgacccaagTTT 668_1 16199 -23
    669 acatcccatacagtga 2-11-3 ACatcccatacagTGA 669_1 16208 -21
    670 agcacagctctacatc 2-10-4 AGcacagctctaCATC 670_1 16219 -22
    671 atatagcacagctcta 3-9-4 ATAtagcacagcTCTA 671_1 16223 -21
    672 tccatatagcacagct 3-11-2 TCCatatagcacagCT 672_1 16226 -22
    673 atttccatatagcaca 3-9-4 ATTtccatatagCACA 673_1 16229 -20
    674 tttatttccatatagca 4-9-4 TTTAtttccatatAGCA 674_1 16231 -22
    675 tttatttccatatagc 3-10-3 TTTatttccatatAGC 675_1 16232 -18
    676 aaggagaggagattatg 4-9-4 AAGGagaggagatTATG 676_1 16409 -21
    677 agttcttgtgttagct 3-11-2 AGTtcttgtgttagCT 677_1 16456 -21
    678 gagttcttgtgttagc 2-12-2 GAgttcttgtgttaGC 678_1 16457 -20
    679 attaattatccatccac 3-10-4 ATTaattatccatCCAC 679_1 16590 -21
    680 atcaattaattatccatc 3-11-4 ATCaattaattatcCATC 680_1 16593 -19
    681 agaatcaattaattatcc 3-12-3 AGAatcaattaattaTCC 681_1 16596 -18
    682 tgagataccgtgcatg 2-12-2 TGagataccgtgcaTG 682_1 16656 -18
    683 aatgagataccgtgca 2-10-4 AAtgagataccgTGCA 683_1 16658 -21
    684 ctgtggttaggctaat 3-11-2 CTGtggttaggctaAT 684_1 16834 -19
    685 aagagtaagggtctgtggtt 1-17-2 AagagtaagggtctgtggTT 685_1 16842 -21
    686 gatgggttaagagtaa 4-9-3 GATGggttaagagTAA 686_1 16854 -19
    687 agcagatgggttaaga 3-11-2 AGCagatgggttaaGA 687_1 16858 -20
    688 tgtaaacatttgtagc 2-10-4 TGtaaacatttgTAGC 688_1 16886 -19
    689 cctgcttataaatgta 3-11-2 CCTgcttataaatgTA 689_1 16898 -19
    690 tgccctgcttataaat 4-10-2 TGCCctgcttataaAT 690_1 16901 -23
    691 tcttcttagttcaata 2-12-2 TCttcttagttcaaTA 691_1 16935 -15
    692 tggtttctaactacat 2-10-4 TGgtttctaactACAT 692_1 16980 -18
    693 agtttggtttctaacta 2-12-3 AGtttggtttctaaCTA 693_1 16983 -19
    694 gaatgaaacttgcctg 3-10-3 GAAtgaaacttgcCTG 694_1 17047 -18
    695 attatccttacatgat 3-10-3 ATTatccttacatGAT 695_1 17173 -17
    696 gtacccaattatcctt 2-11-3 GTacccaattatcCTT 696_1 17180 -21
    697 tgtacccaattatcct 3-10-3 TGTacccaattatCCT 697_1 17181 -24
    698 ttgtacccaattatcc 2-11-3 TTgtacccaattaTCC 698_1 17182 -20
    699 tttgtacccaattatc 3-11-2 TTTgtacccaattaTC 699_1 17183 -17
    700 agcagcaggttatatt 4-10-2 AGCAgcaggttataTT 700_1 17197 -22
    701 tgggaagtggtctggg 3-10-3 TGGgaagtggtctGGG 701_1 17292 -25
    702 ctggagagtgataata 3-11-2 CTGgagagtgataaTA 702_1 17322 -17
    703 aatgctggattacgtc 4-10-2 AATGctggattacgTC 703_1 17354 -19
    704 caatgctggattacgt 2-11-3 CAatgctggattaCGT 704_1 17355 -19
    705 ttgttcagaagtatcc 2-10-4 TTgttcagaagtATCC 705_1 17625 -19
    706 gatgatttgcttggag 2-10-4 GAtgatttgcttGGAG 706_1 17646 -21
    707 gaaatcattcacaacc 3-10-3 GAAatcattcacaACC 707_1 17860 -17
    708 ttgtaacatctactac 3-10-3 TTGtaacatctacTAC 708_1 17891 -16
    709 cattaagcagcaagtt 3-11-2 CATtaagcagcaagTT 709_1 17923 -17
    710 ttactagatgtgagca 3-11-2 TTActagatgtgagCA 710_1 17942 -18
    711 tttactagatgtgagc 2-11-3 TTtactagatgtgAGC 711_1 17943 -18
    712 gaccaagcaccttaca 3-11-2 GACcaagcaccttaCA 712_1 17971 -22
    713 agaccaagcaccttac 3-10-3 AGAccaagcacctTAC 713_1 17972 -22
    714 atgggttaaataaagg 2-10-4 ATgggttaaataAAGG 714_1 18052 -15
    715 tcaaccagagtattaa 2-12-2 TCaaccagagtattAA 715_1 18067 -13
    716 gtcaaccagagtatta 3-11-2 GTCaaccagagtatTA 716_1 18068 -18
    717 attgtaaagctgatat 2-11-3 ATtgtaaagctgaTAT 717_1 18135 -14
    718 cacataattgtaaagc 2-10-4 CAcataattgtaAAGC 718_1 18141 -16
    719 gaggtctgctatttac 2-11-3 GAggtctgctattTAC 719_1 18274 -19
    720 tgtagattcaatgcct 2-11-3 TGtagattcaatgCCT 720_1 18404 -20
    721 cctcattatactatga 2-11-3 CCtcattatactaTGA 721_1 18456 -19
    722 ccttatgctatgacac 2-12-2 CCttatgctatgacAC 722_1 18509 -18
    723 tccttatgctatgaca 4-10-2 TCCTtatgctatgaCA 723_1 18510 -22
    724 aagatgtttaagtata 3-10-3 AAGatgtttaagtATA 724_1 18598 -13
    725 ctgattattaagatgt 2-10-4 CTgattattaagATGT 725_1 18607 -17
    726 tggaaaggtatgaatt 2-12-2 TGgaaaggtatgaaTT 726_1 18808 -13
    727 acttgaatggcttgga 2-12-2 ACttgaatggcttgGA 727_1 18880 -18
    728 aacttgaatggcttgg 3-10-3 AACttgaatggctTGG 728_1 18881 -19
    729 caatgtgttactattt 4-10-2 CAATgtgttactatTT 729_1 19004 -16
    730 acaatgtgttactatt 3-10-3 ACAatgtgttactATT 730_1 19005 -15
    731 catctgctatataaga 4-10-2 CATCtgctatataaGA 731_1 19063 -18
    732 cctagagcaaatactt 4-10-2 CCTAgagcaaatacTT 732_1 19223 -20
    733 cagagttaataataag 3-10-3 CAGagttaataatAAG 733_1 19327 -13
    734 gttcaagcacaacgaa 4-10-2 GTTCaagcacaacgAA 734_1 19493 -18
    735 agggttcaagcacaac 2-11-3 AGggttcaagcacAAC 735_1 19496 -18
    736 tgttggagacactgtt 2-12-2 TGttggagacactgTT 736_1 19677 -17
    737 aaggaggagttaggac 3-11-2 AAGgaggagttaggAC 737_1 19821 -18
    738 ctatgccatttacgat 4-10-2 CTATgccatttacgAT 738_1 19884 -21
    739 tcaaatgcagaattag 2-12-2 TCaaatgcagaattAG 739_1 19913 -12
    740 agtgacaatcaaatgc 2-10-4 AGtgacaatcaaATGC 740_1 19921 -18
    741 aagtgacaatcaaatg 2-11-3 AAgtgacaatcaaATG 741_1 19922 -12
    742 gtgtaccaagtaacaa 3-11-2 GTGtaccaagtaacAA 742_1 19978 -16
    743 tgggatgttaaactga 3-10-3 TGGgatgttaaacTGA 743_1 20037 -20
    Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide.
    Designs refer to the gapmer design, F-G-F', where each number represents the number of consecutive modified nucleosides, e.g. 2' modified nucleosides (first number=5' flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g. 2' modified nucleosides (third number=3' flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is complementary to the target nucleic acid.
    Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages.
    Table 6: Oligonucleotides targeting mouse PD-L1 transcript (SEQ ID NO: 4) designs of these, as well as specific oligonucleotide compounds (indicated by CMP ID NO) designed based on the motif sequence.
    SEQ ID NO Motif sequence Design Oligonucleotide Compound CMP ID NO Start on SEQ ID NO: 4 dG
    744 agtttacattttctgc 3-10-3 AGTttacattttcTGC 744_1 4189 -20
    745 tatgtgaagaggagag 3-10-3 TATgtgaagaggaGAG 745_1 7797 -19
    746 cacctttaaaacccca 3-10-3 CACctttaaaaccCCA 746_1 9221 -23
    747 tcctttataatcacac 3-10-3 TCCtttataatcaCAC 747_1 10386 -19
    748 acggtattttcacagg 3-10-3 ACGgtattttcacAGG 748_1 12389 -21
    749 gacactacaatgagga 3-10-3 GACactacaatgaGGA 749_1 15088 -20
    750 tggtttttaggactgt 3-10-3 TGGtttttaggacTGT 750_1 16410 -21
    751 cgacaaattctatcct 3-10-3 CGAcaaattctatCCT 751_1 18688 -20
    752 tgatatacaatgctac 3-10-3 TGAtatacaatgcTAC 752_1 18735 -16
    753 tcgttgggtaaattta 3-10-3 TCGttgggtaaatTTA 753_1 19495 -17
    754 tgctttataaatggtg 3-10-3 TGCtttataaatgGTG 754_1 19880 -19
    Motif sequences represent the contiguous sequence of nucleobases present in the oligonucleotide.
    Designs refer to the gapmer design, F-G-F', where each number represents the number of consecutive modified nucleosides, e.g. 2' modified nucleosides (first number=5' flank), followed by the number of DNA nucleosides (second number= gap region), followed by the number of modified nucleosides, e.g. 2' modified nucleosides (third number=3' flank), optionally preceded by or followed by further repeated regions of DNA and LNA, which are not necessarily part of the contiguous sequence that is complementary to the target nucleic acid.
    Oligonucleotide compounds represent specific designs of a motif sequence. Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, all internucleoside linkages are phosphorothioate internucleoside linkages.
    Table 7: Oligonucleotide motif sequences and antisense compounds with 5' ca biocleavable linker.
    SEQ ID NO motif sequence oligonucleotide compound with ca linker CMP ID NO
    755 caagtttacattttctgc coaoAGTttacattttcTGC 755_1
    756 catatgtgaagaggagag coaoTATgtgaagaggaGAG 756_1
    757 cacctttaaaacccca coaoCACctttaaaaccCCA 757_1
    758 catcctttataatcacac coaoTCCtttataatcaCAC 758_1
    759 caacggtattttcacagg coaoACGgtattttcacAGG 759_1
    760 cagacactacaatgagga coaoGACactacaatgaGGA 760_1
    761 catggtttttaggactgt coaoTGGtttttaggacTGT 761_1
    762 cacgacaaattctatcct coaoCGAcaaattctatCCT 762_1
    763 catgatatacaatgctac coaoTGAtatacaatgcTAC 763_1
    764 catcgttgggtaaattta coaoTCGttgggtaaatTTA 764_1
    765 catgctttataaatggtg coaoTGCtttataaatgGTG 765_1
    766 caacaaataatggttactct coaoACAAataatggttaCTCT 766_1
    767 cacagattgatggtagtt coaoCAGAttgatggtagTT 767_1
    768 cacctatttaacatcagac coaoCCtatttaacatcAGAC 768_1
    769 cactaattgtagtagtactc coaoCTAattgtagtagtaCTC 769_1
    770 caataaacatgaatctctcc coaoATaaacatgaatctCTCC 770_1
    Capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester internucleoside linkage and unless otherwise indicated other internucleoside linkages are phosphorothioate internucleoside linkages.
    Table 8: GalNAc conjugated antisense oligonucleotide compounds.
    antisense oligonucleotide conjugate CMP ID NO
    G N2-C6ocoaoAGTttacattttcTG C 755_2
    GN2-C6ocoaoTATgtgaagaggaGAG 756_2
    GN2-C6ocoaoCACctttaaaaccCCA 757_2
    GN2-C6ocoaoTCCtttataatcaCAC 758_2
    G N2-C6ocoaoACGgtattttcacAGG 759_2
    G N2-C6ocoaoGACactacaatgaGGA 760_2
    G N2-C6ocoaoTGGtttttaggacTGT 761_2
    G N2-C6ocoaoCGAcaaattctatCCT 762_2
    G N2-C6ocoaoTGAtatacaatgcTAC 763_2
    G N2-C6ocoaoTCGttgggtaaatTTA 764_2
    G N2-C6ocoaoTGCtttataaatgGTG 765_2
    G N2-C6ocoaoACAAataatggttaCTCT 766_2
    G N2-C6ocoaoCAGAttgatggtagTT 767_2
    G N2-C6ocoaoCCtatttaacatcAGAC 768_2
    GN2-C6ocoaoCTAattgtagtagtaCTC 769_2
    GN2-C6ocoaoATaaacatgaatctCTCC 770_2
    GN2 represents the trivalent GalNAc cluster shown in Figure 3, C6 represents an amino alkyl group with 6 carbons, capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine, subscript o represent a phosphodiester nucleoside linkage and unless otherwise indicated internucleoside linkages are phosphorothioate internucleoside linkages. Chemical drawings representing some of the molecules are shown in figures 4 to 8.
    • AAV/HBV mouse models Pasteur model:
  • HLA-A2.1-/HLA-DR1-transgenic H-2 class I-/class II-knockout (here referred to as HLA-A2/DR1) mice were created and bred at the Institut Pasteur. These mice represent an in vivo experimental model for human immune function studies without any interference with mouse MHC response (Pajot et al 2004 Eur J Immunol. 34(11):3060-9.
  • Adeno-associated virus (AAV) vector, AAV serotype 2/8 carrying a replication competent HBV DNA genome was used in these studies. The AAV-HBV vector (batch GVPN #6163) was diluted in sterile Phosphate buffered Saline (PBS) to reach a titer of 5 x 1011 vg/mL. Mice were injected intravenously (i.v.) with 100µL of this diluted solution (dose/mouse: 5 x 1010 vg) in a tail vein. Complete viral particles containing HBV DNA were detected in the blood of HBV-carrier mice. HBcAg was detected for up to one year in the liver together with HBV circulating proteins HBeAg and HBsAg in the blood. In all AAV2/8-HBV-transduced mice, HBsAg, HBeAg, and HBV DNA persisted in serum for at least one year (Dion et al 2013 J Virol 87:5554-5563).
    • Shanghai model:
  • In this model, mice infected with a recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV/HBV) maintains stable viremia and antigenimia for more than 30 weeks (Dan Yang, et al. 2014 Cellular & Molecular Immunology 11, 71-78).
  • Male C57BL/6 mice (4-6 weeks old), specific pathogen free, were purchased from SLAC (Shanghai Laboratory Animal Center of Chinese Academy of Sciences) and housed in an animal care facility in individually ventilated cages. Guidelines were followed for the care and use of animals as indicated by WuXi IACUC (Institutional Animal Care and Use Committee, WUXI IACUC protocol number R20131126-Mouse). Mice were allowed to acclimate to the new environment for 3 days and are grouped according to the experimental design.
  • Recombinant AAV-HBV was diluted in PBS, 200 µL per injection. This recombinant virus carries 1.3 copies of the HBV genome (genotype D, serotype ayw).
  • On day 0, all mice were injected through tail vein with 200 µL AAV-HBV. On days 6, 13 and 20 after AAV injection, all mice in were submandibularly bled (0.1 ml blood/mouse) for serum collection. On day 22 post injection, mice with stable viremia were ready for oligonucleotide treatment. The oligonucleotides can be unconjugated or GalNAc conjugated.
    • DNA vaccine
  • Plasmid DNA were endotoxin-free and manufactured by Plasmid-Factory (Germany). pCMV-S2.S ayw encodes the preS2 and S domains of the HBsAg (genotype D), and its expression is controlled by the cytomegalovirus immediate early gene promoter (Michel et al 1995 Proc Natl Acad Sci U S A 92:5307-5311). pCMV-HBc encodes the HBV capsid carrying the hepatitis core (HBc) Ag (Dion et al 2013 J Virol 87:5554-5563).
  • Treatment with DNA vaccine was conducted as described here. Five days prior to vacciantion cardiotoxine (CaTx, Latoxan refL81-02, 50 µl/ muscle) was injected into the muscle of the mice. CaTx depolarizees the muscular fibers to induce cell degeneration, 5 days post injection, new muscular fibers will appear and will receive the DNA vaccine for a better efficacy for transfection. The pCMV-S2.S ayw and pCMVCore at 1 mg/ml each were mixed in equal amount and each mouse received a total of 100 µg by bilateral intramuscular injection into cardiotoxin-treated tibialis anterior muscles as previously described in Michel et al 1995 Proc Natl Acad Sci U S A 92:5307-5311, under anesthesia (100 µL of 12.5 mg/mL ketamine, 1.25 mg/mL xylazine).
    • Anti-PD-L1 antibody
  • This is a mouse anti mouse PD-L1 IgG1 antibody clone 6E11 internally produced at Genetech. It is a surrogate antibody that cross blocks Atezolizumab and has similar in vitro blocking activity Atezolizumabproduced internally at Roche. The antibody was adminstredadministered by intraperitoneal (i.p.) injection at a dose of 12.5 µg/g.
    • Oligonucleotide synthesis
  • Oligonucleotide synthesis is generally known in the art. Below is a protocol which may be applied. The oligonucleotides of the present invention may have been produced by slightly varying methods in terms of apparatus, support and concentrations used.
  • Oligonucleotides are synthesized on uridine universal supports using the phosphoramidite approach on an Oligomaker 48 at 1 µmol scale. At the end of the synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia for 5-16hours at 60°C. The oligonucleotides are purified by reverse phase HPLC (RP-HPLC) or by solid phase extractions and characterized by UPLC, and the molecular mass is further confirmed by ESI-MS.
    • Elongation of the oligonucleotide:
  • The coupling of β-cyanoethyl- phosphoramidites (DNA-A(Bz), DNA- G(ibu), DNA- C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA- G(dmf), or LNA-T) is performed by using a solution of 0.1 M of the 5'-O-DMT-protected amidite in acetonitrile and DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as activator. For the final cycle a phosphoramidite with desired modifications can be used, e.g. a C6 linker for attaching a conjugate group or a conjugate group as such. Thiolation for introduction of phosphorthioate linkages is carried out by using xanthane hydride (0.01 M in acetonitrile/pyridine 9:1). Phosphordiester linkages can be introduced using 0.02 M iodine in THF/Pyridine/water 7:2:1. The rest of the reagents are the ones typically used for oligonucleotide synthesis.
  • For post solid phase synthesis conjugation a commercially available C6 amino linker phosphoramidite can be used in the last cycle of the solid phase synthesis and after deprotection and cleavage from the solid support the aminolinked deprotected oligonucleotide is isolated. The conjugates are introduced via activation of the functional group using standard synthesis methods.
  • Alternatively, the conjugate moiety can be added to the oligonucleotide while still on the solid support by using a GalNAc- or GalNAc-cluster phosphoramidite as described in PCT/EP2015/073331 or in EP appl. NO. 15194811.4 .
    • Purification by RP-HPLC:
  • The crude compounds are purified by preparative RP-HPLC on a Phenomenex Jupiter C18 10µ 150x10 mm column. 0.1 M ammonium acetate pH 8 and acetonitrile is used as buffers at a flow rate of 5 mL/min. The collected fractions are lyophilized to give the purified compound typically as a white solid.
    • Abbreviations:
    • DCI:
    4,5-Dicyanoimidazole
    DCM:
    Dichloromethane
    DMF:
    Dimethylformamide
    DMT:
    4,4'-Dimethoxytrityl
    THF:
    Tetrahydrofurane
    Bz:
    Benzoyl
    Ibu:
    Isobutyryl
    RP-HPLC:
    Reverse phase high performance liquid chromatography
    Tm Assay
  • Oligonucleotide and RNA target (phosphate linked, PO) duplexes are diluted to 3 mM in 500 ml RNase-free water and mixed with 500 ml 2x Tm-buffer (200mM NaCl, 0.2mM EDTA, 20mM Naphosphate, pH 7.0). The solution is heated to 95ºC for 3 min and then allowed to anneal in room temperature for 30 min. The duplex melting temperatures (Tm) is measured on a Lambda 40 UV/VIS Spectrophotometer equipped with a Peltier temperature programmer PTP6 using PE Templab software (Perkin Elmer). The temperature is ramped up from 20ºC to 95ºC and then down to 25ºC, recording absorption at 260 nm. First derivative and the local maximums of both the melting and annealing are used to assess the duplex Tm.
    • Tissue specific In vitro linker cleavage assay
  • FAM-labeled oligonucleotides with the biocleavable linker to be tested (e.g. a DNA phosphodiester linker (PO linker)) are subjected to in vitro cleavage using homogenates of the relevant tissues (e.g. liver or kidney) and Serum.
  • The tissue and serum samples are collected from a suitable animal (e.g. mice, monkey, pig or rat) and homogenized in a homogenisation buffer (0,5% Igepal CA-630, 25 mM Tris pH 8.0, 100 mM NaCl, pH 8.0 (adjusted with 1 N NaOH).The tissue homogenates and Serum are spiked with oligonucleotide to concentrations of 200 µg/g tissue. The samples are incubated for 24 hours at 37°C and thereafter the samples are extracted with phenol - chloroform. The solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p-100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5. The content of cleaved and non-cleaved oligonucleotide are determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm.
    • S1 nuclease cleavage assay
  • FAM-labelled oligonucleotides with S1 nuclease susceptible linkers (e.g. a DNA phosphodiester linker (PO linker)) are subjected to in vitro cleavage in S1 nuclease extract or Serum.
  • 100 µM of the oligonucleotides are subjected to in vitro cleavage by S1 nuclease in nuclease buffer (60 U pr. 100 µL) for 20 and 120 minutes. The enzymatic activity is stopped by adding EDTA to the buffer solution. The solutions are subjected to AIE HPLC analyses on a Dionex Ultimate 3000 using an Dionex DNApac p-100 column and a gradient ranging from 10mM - 1 M sodium perchlorate at pH 7.5. The content of cleaved and non-cleaved oligonucleotide is determined against a standard using both a fluorescence detector at 615 nm and a uv detector at 260 nm.
    • Preparation of liver mononuclear cells
  • Liver cells from AAV/HBV mice were prepared as described below and according to a method described by Tupin et al 2006 Methods Enzymol 417:185-201 with minor modifications. After mouse euthanasia, the liver was perfused with 10 ml of sterile PBS via hepatic portal vein using syringe with G25 needle. When organ is pale, the organ was harvested in Hank's Balanced Salt Solution (HBSS) (GIBCO® HBSS, 24020) + 5 % decomplemented fetal calf serum (FCS). The harvested liver was gently pressed through 100 µm cell-strainer (BD Falcon, 352360) and cells were suspended in 30 ml of HBSS + 5 % FCS. Cell suspension was centrifuged at 50 g for 5 min. Supernatants were then centrifuged at 289 g for 10 min at 4 °C. After centrifugation, supernatants were discarded and pellets were re-suspended in 15 mL at room temperature in a 35 % isotonic Percoll solution (GE Healthcare Percoll #17-0891-01 diluted into RPMI 1640 (GIBCO, 31870)) and transferred to a 15 ml tube. Cells were further centrifuged at 1360g for 25 min at room temperature. The supernatant was discarded by aspiration and the pellet containing mononuclear cells was washed twice with HBSS + 5 % FCS.
  • Cells were cultured in complete medium (a-minimal essential medium (Gibco, 22571) supplemented with 10 % FCS (Hyclone, # SH30066, lot APG21570), 100 U/mL penicillin + 100 µg/mL streptomycin + 0.3 mg/mL L-glutamine (Gibco, 10378), 1X non-essential amino acids (Gibco, 11140), 10 mM Hepes (Gibco, 15630), 1 mM sodium pyruvate (Gibco, 11360) and 50 µM β-mercaptoethanol (LKB, 1830)).
    • Surface labeling of cells
  • Cells were seeded in U-bottom 96-well plates and washed with PBS FACS (PBS containing 1 % bovine serum albumin and 0.01% sodium azide). Cells were incubated with 5 µL of PBS FACS containing a rat anti-mouse CD16/CD32 antibody and a viability marker LD fixable yellow, Thermofisher, L34959 for 10 min in the dark at 4°C. Then, cells were stained for 20 min in the dark at 4°C with 25 µL of PBS FACS containing monoclonal antibodies (Mab) against NK P46 BV421 (Rat Mab anti mouse NK P46, Biolegend, 137612) and F4/80 (rat Mab anti-mouse F4/80 FITC, BD Biolegend, 123108) and two supplemental surface markers: PD1 (rat Mab anti-mouse PD1 PE, BD Biosciences, 551892) and PDL1 (rat Mab anti-mouse PDL1 BV711, Biolegend, 124319) were also added.
    • Intracelluar cytokine staining (ICS) assay
  • ICS assays were performed on both splenocytes and liver mononuclear cells. Cells were seeded in Ubottom 96-well plates. Plates with cells were incubated overnight at 37 °C either in complete medium alone as negative control or with the peptides described in Table 9 at a concentration of 2 µg/ml. Brefeldin A at 2µg/mL (Sigma, B6542) was added after one hour of incubation.
  • After the overnight culture, cells were washed with PBS FACS and incubated with 5 µL of PBS FACS containing rat anti-mouse CD16/CD32 antibody and a viability marker LD fixable yellow, Thermofisher, L34959 for 10 min in the dark at 4°C. Then, cells were stained for 20 min in the dark at 4°C with 25 µL of PBS FACS containing Mab. The mix was composed of monoclonal antibodies against CD3 (hamster Mab anti-mouse CD3-PerCP, BD Biosciences, 553067), CD8 (rat Mab anti-mouse CD8-APC-H7, BD Biosciences, 560182), CD4 (rat Mab anti-mouse CD4-PE-Cy7, BD Biosciences, 552775), and NK cells (Rat Mab anti mouse NK P46 BV421, Biolegend, 137612). Cells were fixed after several washes and permeabilized for 20 min in the dark at room temperature with Cytofix/Cytoperm, washed with Perm/Wash solution (BD Biosciences, 554714) at 4 °C.
  • Intracellular cytokine staining with antibodies against IFNγ (rat Mab anti-mouse IFNγ-APC, clone XMG1.2, BD Biosciences, 554413) and tumor necrosis factor alpha (TNFα) (rat Mab anti-mouse TNFα-FITC, clone MP6-XT22; 1/250 (BD Biosciences 554418) was performed for 30 min in the dark at 4 °C. Before analysis by flow cytometry using the MACSQuant Analyzer, cells were washed with Perm/Wash and re-suspended in PBS FACS containing 1% Formaldehyde.
  • Live CD3+CD8+CD4- and cells CD3+CD8-CD4+ were gated and presented on dot-plot. Two regions were defined to gate for positive cells for each cytokine. Numbers of events found in these gates were divided by total number of events in parental population to yield percentages of responding T cells. For each mouse, the percentage obtained in medium alone was considered as background and subtracted from the percentage obtained with peptide stimulations.
  • Threshold of positivity was defined according to experiment background i.e. the mean percentage of stained cells obtained for each group in medium alone condition plus two standard deviations. Only percentage of cytokine represented at least 5 events were considered as positive. Table 9: HLA-A2/DR1 restricted epitopes contained in the HBV Core protein and the Envelope domains of the HBsAg (S2+S).
    Protein Start Position End Position Sequence HLA restriction References
    Core 18 27 FLPSDFFPSV (SEQ ID NO: 773) A2 Bertoletti et al Gastroenterology 1997;112:193-199
    111 125 GRETVLEYLVSFGVW (SEQ ID NO: 774) DR1 (Bertoletti et al Gastroenterology 1997;112:193-199
    Envelope (S2+S) 114 128 TTFHQTLQDPRVRGL (SEQ ID NO: 775) DR1 Pajot et al Microbes Infect 2006;8:2783-2790.
    179 194 QAGFFLLTRILTIPQS (SEQ ID NO: 776) A2 + DR1 Pajot et al Microbes Infect 2006;8:2783-2790.
    183 191 FLLTRILTI (SEQ ID NO: 777) A2 Sette et al J Immunol 1994;153:5586-5592.
    200 214 TSLNFLGGTTVCLGQ (SEQ ID NO: 778) A2 + DR1 Pajot et al Microbes Infect 2006;8:2783-2790.
    204 212 FLGGTTVCL (SEQ ID NO: 779) A2 Rehermann et al J Exp Med 1995;181: 1047-1058.
    335 343 WLSLLVPFV (SEQ ID NO: 780) A2 Nayersina et alJ Immunol 1993;150: 4659-4671.
    337 357 SLLVPFVQWFVGLSPTVWLSV (SEQ ID NO: 781) A2 + DR1 Loirat et al J Immunol 2000;165: 4748-4755
    348 357 GLSPTVWLSV (SEQ ID NO: 782) A2 Loirat et al J Immunol 2000;165: 4748-4755
    370 379 SILSPFLPLL (SEQ ID NO: 783) A2 Mizukoshi et al J Immunol 2004;173: 5863-5871.
    • Example 1 Testing in vitro efficacy
  • A gene walk was performed across the human PD-L1 transcript primarily using 16 to 20mer gapmers. Efficacy testing was performed in an in vitro experiment in the human leukemia monocytic cell line THP1 and in the human non-Hodgkin's K lymphoma cell line (KARPAS-299).
    • Cell lines
  • THP1 and Karpas-299 cell line were originally purchased from European Collection of Authenticated Cell Cultures (ECACC) and maintained as recommended by the supplier in a humidified incubator at 37°C with 5% CO2.
    • Oligonucleotide efficacy
  • THP-1 cells (3.104 in RPMI-GLutamax, 10% FBS, 1% Pen-Strep (Thermo Fisher Scientific) were added to the oligonucleotides (4-5 ul) into 96-well round bottom plates and cultured for 6 days in a final volume of 100 µl/well. Oligonucleotides were screened at one single concentration (20 µM) and in dose-range concentrations from 25 µM to 0.004 µM (1:3 dilution in water). Total mRNA was extracted using the MagNA Pure 96 Cellular RNA Large Volume Kit on the MagNA Pure 96 System (Roche Diagnostics) according to the manufacturer's instructions. For gene expression analysis, RT-qPCR was performed using the TaqMan RNA-to-ct 1-Step kit (Thermo Fisher Scientific) on the QuantStudio machine (Applied Biosystems) with pre-designed Taqman primers targeting human PDL1 and ACTB used as endogenous control (Thermo Fisher Scientific). The relative PD-L1 mRNA expression level was calculated using 2(-Delta Delta C(T)) method and the percentage of inhibition as the % compared to the control sample (non-treated cells).
  • Karpas-299 cells were cultured in RPMI 1640, 2 mM Glutamine and 20% FBS (Sigma). The cells were plated at 10000 cell/well in 96 wells plates incubated for 24 hours before addition of oligonucleotides dissolved in PBS. Final concentration of oligonucleotides was in a single dose of 5 µM, in a final culture volume was 100 µl/well or added in a dose response ranging from 50 µM, 15.8 µM, 5.0 µM, 1.58 µM, 0.5 µM, 0.158 µM, 0.05 µM, to 0.0158 µM in 100 µL culture volume. The cells were harvested 3 days after addition of oligonucleotide compounds and RNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer's instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction. For gene expressions analysis, qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Applied Biosystems; Hs01125299_m1) and TBP (Applied Biosystems; 4325803). The relative PD-L1 mRNA expression level is shown in table 10 as % of control sample (PBS-treated cells). Table 10: in vitro efficacy of anti-PD-L1 compounds in THP1 and KARPAS-299 cell lines (Average from n=3 experiments). PD-L1 mRNA levels are normalized to TBP in KARPAS-299 cells or ACTB in THP1 cells and shown as % of control (PBS treated cells).
    CMP ID NO KARPAS-299 cells 5 µM CMP THP1 cells 20 µM CMP Compound (CMP) Start on SEQ ID NO 1
    % mRNA of control sd % mRNA of control sd
    4_1 50 1 32 11 TAattggctctacTGC 236
    5_1 25 5 9 6 TCGCataagaatgaCT 371
    6_1 29 2 15 5 TGaacacacagtcgCA 382
    7_1 27 7 3 1 CTGaacacacagtCGC 383
    8_1 23 4 11 3 TCTgaacacacagtCG 384
    9_1 32 3 19 6 TTCtgaacacacagTC 385
    10_1 57 5 39 16 ACaagtcatgttaCTA 463
    11_1 75 5 37 12 ACacaagtcatgttAC 465
    12_1 22 2 10 3 CTtacttagatgcTGC 495
    13_1 33 4 23 11 ACttacttagatgCTG 496
    14_1 33 7 21 6 GACttacttagatgCT 497
    15_1 41 6 18 10 AGacttacttagaTGC 498
    16_1 96 14 40 7 GCAggaagagactTAC 506
    17_1 22 2 9 3 AATAaattccgttCAGG 541
    18_1 34 6 21 9 GCAAataaattcCGTT 545
    18_2 51 4 27 11 GCAaataaattccGTT 545
    19_1 38 5 23 7 AG CAaataaattcCGT 546
    20_1 73 8 56 15 CAGAgcaaataaatTCC 548
    21_1 83 8 65 10 TGGAcagagcaaataAAT 551
    22_1 86 6 80 8 ATGGacagagcaAATA 554
    23_1 44 4 30 2 CAgaatggacagaGCA 558
    24_1 63 10 40 11 TTCtcagaatggacAG 562
    25_1 31 1 39 5 CTGAactttgacATAG 663
    26_1 60 4 56 19 AAgacaaacccagacTGA 675
    27_1 36 4 34 10 TATAagacaaacccAGAC 678
    28_1 40 4 28 13 TTATaagacaaaccCAGA 679
    29_1 30 2 18 6 TGTTataagacaaaCCC 682
    30_1 77 3 67 10 TAGAacaatggtaCTTT 708
    31_1 81 17 20 14 GTAGaacaatggtaCT 710
    32_1 29 5 14 8 AGGtagaacaatgGTA 712
    33_1 32 1 43 20 AAGAggtagaacaATGG 714
    34_1 70 4 35 13 GCatccacagtaaaTT 749
    35_1 83 2 66 21 GAaggttatttaaTTC 773
    36_1 18 2 15 5 CTAAtcgaatgcaGCA 805
    37_1 64 7 35 10 TACccaatctaatCGA 813
    38_1 69 1 49 13 TAGttacccaatcTAA 817
    39_1 49 5 26 9 CATttagttacccAAT 821
    40_1 23 7 8 2 TCAtttagttaccCAA 822
    41_1 24 6 12 3 TTcatttagttaCCCA 823
    42_1 51 7 40 5 GAATtaatttcattTAGT 829
    43_1 71 9 45 3 CAGTgaggaattaATTT 837
    44_1 60 5 45 17 CCAAcagtgaggAATT 842
    45_1 63 1 37 15 CCCaacagtgaggAAT 843
    46_1 31 3 29 12 TAtacccaacagtgAGG 846
    47_1 44 3 27 0 TTatacccaacagTGAG 847
    48_1 38 3 26 6 TTTatacccaacagTGA 848
    49_1 20 4 7 1 CCTttatacccaaCAG 851
    50_1 22 3 6 2 TAACctttatacCCAA 854
    51_1 28 1 29 16 AATaacctttataCCCA 855
    52_1 80 11 48 10 GTAaataacctttaTA 859
    53_1 54 4 37 14 ACTGtaaataacctTTAT 860
    54_1 81 4 53 15 AT AtatatgcaatgAG 903
    55_1 86 12 70 15 AGatatatatgcaaTG 905
    56_1 56 8 27 7 GAGatatatatgcAAT 906
    57_1 28 7 13 5 CCagagatatataTGC 909
    58_1 88 13 69 23 CAATattccagagATAT 915
    59_1 29 3 14 6 GCAAtattccagagATA 916
    60_1 25 3 14 3 AGCaatattccagaGAT 917
    61_1 29 4 17 2 CAGcaatattccAGAG 919
    62_1 27 3 14 3 AATCagcaatattCCAG 921
    63_1 23 6 12 6 ACAAtcagcaataTTCC 923
    64_1 53 9 43 15 ACtaagtagttacactTCT 957
    65_1 32 5 14 6 CTAAgtagttacactTC 958
    66_1 35 4 31 6 GACtaagtagttacaCTT 959
    67_1 64 10 55 14 TGActaagtagtTACA 962
    68_1 62 11 57 16 CTTTgactaagtagTTA 964
    69_1 42 9 59 13 CTCtttgactaagTAG 967
    70_1 81 6 56 12 GCTCtttgactaagTA 968
    71_1 27 3 39 9 CCttaaatactgtTGAC 1060
    72_1 75 5 36 7 CTtaaatactgttgAC 1060
    73_1 35 6 43 13 TCCttaaatactgTTG 1062
    74_1 57 4 79 25 TCTCcttaaatactgTT 1063
    75_1 53 6 28 6 TAtcatagttctCCTT 1073
    76_1 26 4 9 2 AGTatcatagttcTCC 1075
    77_1 74 5 39 12 GAgtatcatagttCTC 1076
    78_1 49 5 35 6 AGagtatcatagTTCT 1077
    78_2 74 6 36 8 AGAgtatcatagtTCT 1077
    79_1 19 2 19 13 CAGagtatcatagTTC 1078
    80_1 23 2 26 2 TTCAgagtatcataGT 1080
    81_1 35 3 36 11 CTTcagagtatcATAG 1081
    82_1 24 6 20 7 TTCTtcagagtatcaTA 1082
    83_1 20 2 16 2 TTTcttcagagtaTCAT 1083
    84_1 33 4 37 10 GAGAaaggctaagTTT 1099
    85_1 42 2 35 18 GAcactcttgtaCATT 1213
    86_1 50 4 54 8 TGagacactcttgtaCA 1215
    87_1 50 8 28 8 TGagacactcttgTAC 1216
    88_1 61 4 33 6 CTttattaaactCCAT 1266
    89_1 71 8 43 12 ACCAaactttattaAA 1272
    90_1 62 5 42 9 AAACctctactaagTG 1288
    91_1 22 3 12 5 AGattaagacagtTGA 1310
    92_1 46 3 ND ND AAgtaggagcaagaGGC 1475
    93_1 42 4 60 24 AAAGtaggagcaagAGG 1476
    94_1 86 15 46 10 GTtaagcagccaggAG 1806
    95_1 66 6 82 27 AGggtaggatgggtAG 1842
    96_1 83 19 62 36 AAGggtaggatgggTA 1843
    97_1 60 9 69 5 CAAgggtaggatggGT 1844
    97_2 76 13 34 7 CAagggtaggatggGT 1844
    98_1 65 8 76 28 CCaagggtaggatgGG 1845
    99_1 61 2 75 17 TCcaagggtaggatGG 1846
    100_1 83 4 82 13 CTTCcaagggtaggAT 1848
    101_1 45 3 52 14 A TCttccaagggtagGA 1849
    102_1 29 2 17 7 AGaagtgatggctCATT 1936
    103_1 26 3 22 1 AAGaagtgatggcTCAT 1937
    104_1 34 6 22 2 GAAgaagtgatggcTCA 1938
    105_1 41 5 21 5 ATGAaatgtaaacTGGG 1955
    106_1 40 8 29 6 CAATgaaatgtaaaCTGG 1956
    107_1 24 3 16 4 GCAAtgaaatgtaaACTG 1957
    108_1 30 4 20 6 AGCAatgaaatgtaAACT 1958
    109_1 44 4 34 14 GAGCaatgaaatgtAAAC 1959
    110_1 18 1 13 3 TGaattcccatatcCGA 1992
    111_1 69 8 35 8 AGaattatgaccaTAT 2010
    112_1 77 7 38 10 AGGtaagaattatGACC 2014
    113_1 97 10 56 13 TCAGgtaagaattaTGAC 2015
    114_1 69 8 54 21 CTTCaggtaagaatTATG 2017
    115_1 91 7 115 42 TCTTcaggtaagaATTA 2019
    116_1 88 6 104 36 CTTCttcaggtaaGAAT 2021
    117_1 85 6 118 17 TCTTcttcaggtaaGAA 2022
    118_1 105 14 102 9 TCTtcttcaggtaAGA 2023
    119_1 37 2 76 18 TGGtctaagagaaGAAG 2046
    120_1 46 6 81 11 GTTGgtctaagagAAG 2049
    121_1 74 11 64 4 AGTtggtctaagAGAA 2050
    122_1 74 9 55 21 CAgttggtctaagAGAA 2050
    123_1 65 9 95 21 GCAgttggtctaagagAA 2050
    124_1 63 7 ND ND CAGTtggtctaagaGA 2051
    125_1 65 6 ND ND GCagttggtctaagaGA 2051
    126_1 67 14 104 34 GCagttggtctaaGAG 2052
    127_1 22 6 10 3 CTcatatcagggCAGT 2063
    128_1 50 4 46 9 CACAcatgttctttaAC 2087
    129_1 22 4 12 12 TAAatacacacatgTTCT 2092
    130_1 24 2 43 28 GTAAatacacacatgTTC 2093
    131_1 33 3 20 12 TGTAaatacacacaTGTT 2094
    132_1 73 17 57 21 GATCatgtaaatacACAC 2099
    133_1 47 5 28 14 AGATcatgtaaataCACA 2100
    134_1 35 6 26 11 CAAAgatcatgtaaatACAC 2101
    135_1 30 2 14 3 ACAAagatcatgtaaaTACA 2102
    136_1 52 6 24 18 GAATacaaagatcaTGTA 2108
    137_1 33 5 20 6 AGAAtacaaagatcATGT 2109
    138_1 37 1 22 15 CAGAatacaaagatCATG 2110
    139_1 85 6 53 8 GCAGaatacaaagATCA 2112
    140_1 79 4 40 6 AGGCagaatacaaagAT 2114
    141_1 56 2 53 20 AAGGcagaatacaaAGA 2115
    142_1 28 5 20 5 ATTagtgagggacGAA 2132
    143_1 26 2 22 10 CAttagtgagggaCGA 2133
    144_1 29 6 16 4 GAgggtgatggatTAG 2218
    145_1 45 6 22 5 TTaggagtaataAAGG 2241
    146_1 65 7 44 9 TTAatgaatttggtTG 2263
    147_1 84 8 43 10 CTttaatgaatttgGT 2265
    148_1 32 0 15 3 CATGgattacaactAA 2322
    149_1 33 2 20 4 TCatggattacaaCTA 2323
    150_1 29 1 11 3 GTCatggattacaaCT 2324
    151_1 64 2 40 9 CAttaaatctagTCAT 2335
    152_1 97 8 63 22 GACAttaaatctagTCA 2336
    153_1 92 7 ND ND AGGGacattaaatcTA 2340
    154_1 35 4 25 15 CAAAgcattataaCCA 2372
    155_1 34 3 24 6 ACttactaggcaGAAG 2415
    156_1 102 6 113 18 CAGAgttaactgtaCA 2545
    157_1 102 10 103 15 CCAGagttaactgtAC 2546
    158_1 88 7 95 18 GCcagagttaactgTA 2547
    159_1 78 10 ND ND TGggccagagttaaCT 2550
    160_1 59 5 26 5 CAgcatctatcagaCT 2576
    161_1 78 8 42 10 TGAaataacatgagTCAT 2711
    162_1 31 6 ND ND GTGaaataacatgAGTC 2713
    163_1 18 2 11 3 TCTGtttatgtcacTG 2781
    164_1 56 5 29 9 GTCTgtttatgtcaCT 2782
    165_1 37 8 12 5 TGgtctgtttatGTCA 2784
    166_1 39 1 19 3 TTGGtctgtttatgTC 2785
    167_1 41 3 35 14 TCacccattgtttaAA 2842
    168_1 18 3 14 4 TTcagcaaatatTCGT 2995
    169_1 36 8 13 2 GTGtgttcagcaaATAT 2999
    170_1 18 2 11 4 TCTattgttaggtATC 3053
    171_1 67 4 26 12 ATtgcccatcttacTG 3118
    172_1 71 2 33 9 TATtgcccatcttaCT 3119
    173_1 47 4 20 5 AAatattgcccatCTT 3122
    174_1 74 4 34 7 ATAaccttatcataCA 3174
    175_1 98 19 44 12 TAtaaccttatcaTAC 3175
    176_1 100 10 64 11 TTAtaaccttatcaTA 3176
    177_1 72 38 28 5 TTTataaccttatCAT 3177
    178_1 47 6 34 6 ACtgctattgctaTCT 3375
    179_1 41 3 23 6 AGgactgctattgCTA 3378
    180_1 32 6 27 7 GAGgactgctattgCT 3379
    181_1 83 1 46 20 ACgtagaataataaCA 3561
    182_1 94 4 52 9 CCaagtgatataATGG 3613
    183_1 49 2 16 3 TTagcagaccaaGTGA 3621
    184_1 96 3 26 5 GTttagcagaccaaGT 3623
    185_1 78 3 46 10 TGacagtgattataTT 3856
    186_1 88 5 45 21 TGTCcaagatattgAC 3868
    187_1 46 6 23 6 GAAtatcctagatTGT 4066
    188_1 79 3 45 14 CAaactgagaataTCC 4074
    189_1 63 5 27 8 GCAaactgagaataTC 4075
    190_1 77 9 37 11 TCCtattacaatcgTA 4214
    191_1 74 10 36 9 TTCCtattacaatcGT 4215
    192_1 91 8 51 28 ACtaatgggaggatTT 4256
    193_1 95 14 67 24 TAgttcagagaataAG 4429
    194_1 86 5 47 16 TAacatatagttcAGA 4436
    195_1 87 4 81 20 ATAacatatagttcAG 4437
    196_1 101 6 67 20 CAtaacatatagttCA 4438
    197_1 91 6 60 13 TCataacatatagtTC 4439
    198_1 61 3 31 10 TAGCtcctaacaatCA 4507
    199_1 79 12 49 11 CTCCaatctttgtaTA 4602
    200_1 74 2 58 13 TCTCcaatctttgtAT 4603
    201_1 53 3 33 10 TCtatttcagccaaTC 4708
    202_1 25 4 30 9 CGGaagtcagagtGAA 4782
    203_1 32 5 21 7 TTAAgcatgaggaaTA 4798
    204_1 34 10 26 11 TGAttgagcacctCTT 4831
    205_1 81 12 62 12 GACtaattatttcgTT 4857
    206_1 57 7 37 7 TGActaattatttCGT 4858
    207_1 26 5 21 6 GTGactaattattTCG 4859
    208_1 48 3 33 13 CTGCttgaaatgtgAC 4870
    209_1 32 1 34 13 CCtgcttgaaatgTGA 4871
    210_1 60 5 50 19 ATcctgcttgaaATGT 4873
    211_1 111 8 110 26 ATTataaatctatTCT 5027
    212_1 107 1 67 12 GCtaaatactttcATC 5151
    213_1 26 3 19 6 CAttgtaacataCCTA 5251
    214_1 33 2 20 4 GCattgtaacatacCT 5252
    215_1 89 8 53 16 TAatattgcaccaaAT 5295
    216_1 25 2 29 9 GAtaatattgcacCAA 5297
    217_1 27 1 27 6 AGataatattgcacCA 5298
    218_1 79 6 45 11 GCcaagaagataATAT 5305
    219_1 159 16 68 14 CACAgccacataaaCT 5406
    220_1 90 2 72 12 TTgtaattgtggaaAC 5463
    221_1 10 2 11 5 TGacttgtaattgTGG 5467
    222_1 82 1 67 18 TCtaactgaaatagTC 5503
    223_1 30 1 32 9 GTGgttctaactgaAA 5508
    224_1 53 7 53 15 CAatatgggacttgGT 5522
    225_1 44 1 33 10 ATGacaatatgggaCT 5526
    226_1 49 1 41 14 TATGacaatatgggAC 5527
    227_1 77 1 54 15 ATATgacaatatggGA 5528
    228_1 100 3 98 29 CTtcacttaataaTTA 5552
    229_1 90 12 80 19 CTGCttcacttaatAA 5555
    230_1 91 0 79 23 AAgactgcttcacTTA 5559
    231_1 49 8 77 34 GAATgccctaattaTG 5589
    232_1 17 7 88 33 TGGaatgccctaatTA 5591
    233_1 40 5 35 10 GCAaatgccagtagGT 5642
    234_1 81 6 72 25 CTAatggaaggattTG 5673
    235_1 97 17 87 25 AAtatagaacctaaTG 5683
    236_1 98 4 83 21 GAAagaatagaatGTT 5769
    237_1 93 2 102 26 ATGggtaatagattAT 5893
    238_1 110 24 44 14 GAaagagcacagggTG 6103
    239_1 66 5 36 10 CTACatagagggaaTG 6202
    240_1 70 4 34 8 GCttcctacataGAGG 6207
    241_1 64 NA 33 6 TGCTtcctacatagAG 6208
    242_1 30 NA 19 7 TGggcttgaaataTGT 6417
    243_1 88 6 69 15 CATtatatttaagaAC 6457
    244_1 8 2 5 2 TCggttatgttaTCAT 6470
    245_1 18 9 12 4 CActttatctggTCGG 6482
    246_1 37 2 19 5 AAAttggcacagcGTT 6505
    247_1 46 12 29 8 ACCGtgacagtaaATG 6577
    248_1 31 2 25 2 TGggaaccgtgacagTA 6581
    249_1 17 2 23 9 CCacatataggtcCTT 6597
    250_1 15 6 23 7 CAtattgctaccaTAC 6617
    251_1 4 2 9 2 TCAtattgctaccATA 6618
    252_1 65 12 85 14 CAATtgtcatatTGCT 6624
    253_1 20 2 51 7 CATtcaattgtcataTTG 6626
    254_1 48 8 91 41 TTTCtactgggaaTTTG 6644
    255_1 11 5 23 8 CAAttagtgcagcCAG 6672
    256_1 43 7 62 13 GAATaatgttcttaTCC 6704
    257_1 28 2 36 19 CACAaattgaataatgtTCT 6709
    258_1 64 4 78 22 CATGcacaaattgaaTAAT 6714
    259_1 53 8 104 73 ATCctgcaatttcaCAT 6832
    260_1 54 5 59 14 CCaccatagctgatCA 6868
    261_1 42 8 52 22 ACcaccatagctgaTCA 6868
    262_1 68 5 118 66 CAccaccatagctgaTC 6869
    263_1 40 2 73 20 TAgtcggcaccaccAT 6877
    264_1 64 6 72 35 CttgtagtcggcaccAC 6880
    265_1 56 4 82 35 CttgtagtcggcacCA 6881
    266_1 41 5 46 21 CGcttgtagtcggcAC 6883
    267_1 51 4 33 14 TCAataaagatcagGC 6942
    268_1 61 2 49 10 TGgacttacaagaaTG 6986
    269_1 45 7 40 9 ATGgacttacaagaAT 6987
    270_1 51 12 36 12 GCTCaagaaattggAT 7073
    271_1 17 0 14 5 TACTgtagaacatgGC 7133
    272_1 15 3 11 3 GCAAttcatttgaTCT 7239
    273_1 64 11 ND ND TGaagggaggagggacAC 7259
    274_1 52 6 50 28 AGtggtgaagggaggAG 7265
    275_1 79 7 ND ND TAgtggtgaagggaggAG 7265
    276_1 81 6 ND ND AtagtggtgaagggaggAG 7265
    277_1 70 9 ND ND TAgtggtgaagggagGA 7266
    278_1 84 9 ND ND ATagtggtgaagggagGA 7266
    279_1 40 6 64 53 TAGtggtgaagggaGG 7267
    280_1 42 10 ND ND ATAgtggtgaagggaGG 7267
    281_1 63 7 ND ND GAtagtggtgaagggaGG 7267
    282_1 27 7 38 11 ATAGtggtgaagggAG 7268
    283_1 60 22 ND ND GAtagtggtgaaggGAG 7268
    284_1 23 3 97 54 GAgatagtggtgAAGG 7271
    285_1 51 6 72 19 CATGggagatagtgGT 7276
    286_1 7 1 21 9 ACAAataatggttaCTCT 7302
    287_1 66 8 48 20 ACACacaaataatgGTTA 7306
    288_1 67 6 58 20 GAGggacacacaaaTAAT 7311
    289_1 46 2 50 21 ATATagagaggcTCAA 7390
    290_1 22 6 ND ND TTgatatagagaGGCT 7393
    291_1 11 2 17 3 GCATttgatatagAGA 7397
    292_1 70 18 44 8 TTtgcatttgataTAG 7400
    293_1 30 1 30 9 CTGgaagaataggtTC 7512
    294_1 53 5 42 10 ACTGgaagaataggTT 7513
    295_1 56 2 41 15 TACTggaagaatagGT 7514
    296_1 80 8 53 13 TGGCttatcctgtaCT 7526
    297_1 73 6 52 14 ATggcttatcctGTAC 7527
    298_1 75 7 89 25 TATGgcttatcctgTA 7528
    299_1 52 5 50 11 GTAtggcttatccTGT 7529
    300_1 27 3 31 6 ATgaatatatgccCAGT 7547
    301_1 41 8 33 9 GAtgaatatatgCCCA 7549
    302_1 8 2 ND ND CAAgatgaatataTGCC 7551
    303_1 32 5 37 14 GACAacatcagtaTAGA 7572
    304_1 28 5 30 23 CAAGacaacatcAGTA 7576
    305_1 47 5 41 9 CACtcctagttccTTT 7601
    306_1 39 6 33 7 AACactcctagttCCT 7603
    307_1 68 3 42 14 TAacactcctagtTCC 7604
    308_1 115 5 69 22 CTaacactcctagtTC 7605
    309_1 97 16 57 14 TGataacataactgTG 7637
    310_1 36 1 23 10 CTgataacataaCTGT 7638
    311_1 38 5 24 5 TTTGaactcaagtgAC 7654
    312_1 42 3 39 5 TCCTttacttagcTAG 7684
    313_1 15 2 14 3 GAgtttggattagCTG 7764
    314_1 49 28 ND ND TGggatatgacagGGA 7838
    315_1 34 6 ND ND TGTGggatatgacaGG 7840
    316_1 47 3 37 8 ATATggaagggataTC 7875
    317_1 11 3 ND ND ACAggatatggaaGGG 7880
    318_1 48 4 ND ND ATTTcaacaggatATGG 7885
    319_1 18 2 16 4 GAgtaatttcaacAG G 7891
    320_1 74 6 44 5 AGGGagtaatttcAACA 7893
    321_1 38 5 56 28 ATTAgggagtaatTTCA 7896
    322_1 66 9 32 11 CTtactattaggGAGT 7903
    323_1 13 1 15 5 CAgcttactattaGGG 7906
    324_1 26 4 20 9 TCAgcttactattAGG 7907
    325_1 43 4 17 2 ATTtcagcttactaTTAG 7908
    326_1 54 5 57 16 TTcagcttactaTTAG 7908
    327_1 28 3 8 2 CAGAtttcagcttaCT 7913
    328_1 43 4 37 16 GACtacaactagagGG 7930
    329_1 45 12 36 10 AGACtacaactagaGG 7931
    330_1 99 8 94 32 AAgactacaactagAG 7932
    331_1 59 4 52 19 ATGAtttaattctagtCAAA 7982
    332_1 100 2 84 23 TTTaattctagtcAAA 7982
    333_1 91 9 60 19 GATTtaattctaGTCA 7984
    771_1 74 6 50 5 TGAtttaattctaGTCA 7984
    334_1 73 5 54 12 ATGAtttaattctagTCA 7984
    335_1 15 1 26 3 GATGatttaattctagtCA 7984
    336_1 71 22 49 16 GAtttaattctaGTCA 7984
    337_1 43 5 30 11 GATGatttaattctaGTC 7985
    338_1 98 5 90 27 TGatttaattctagTC 7985
    339_1 87 21 86 2 GAGAtgatttaatTCTA 7988
    340_1 92 5 85 27 GAGatgatttaatTCT 7989
    341_1 7 1 7 1 CAGAttgatggtagTT 8030
    342_1 7 2 24 11 CTcagattgatgGTAG 8032
    343_1 3 1 14 9 GTTagccctcagaTTG 8039
    344_1 14 5 20 7 TGtattgttagcCCTC 8045
    345_1 10 2 11 5 ACttgtattgttAGCC 8048
    346_1 52 4 52 17 AGCcagtatcagggAC 8191
    347_1 33 3 18 8 TTgacaatagtgGCAT 8213
    348_1 7 2 13 5 ACAagtggtatctTCT 8228
    349_1 63 8 44 15 AATCtactttacaaGT 8238
    350_1 36 2 ND ND CAcagtagatgcctGATA 8351
    351_1 24 2 30 9 GAacacagtagatGCC 8356
    352_1 23 4 103 14 CTTGgaacacagtagAT 8359
    353_1 20 2 45 2 ATAtcttggaacaCAG 8364
    354_1 25 3 24 6 TCTttaatatcttgGAAC 8368
    355_1 39 2 41 10 TGatttctttaatatCTTG 8372
    356_1 54 5 88 43 TGatgatttctttaaTATC 8375
    357_1 31 4 45 27 AGGctaagtcatgaTG 8389
    358_1 18 3 43 20 TTGAtgaggctaagTC 8395
    359_1 6 2 11 2 CCAggattatactcTT 8439
    360_1 43 5 40 14 GCcaggattataCTCT 8440
    361_1 56 8 73 13 CTGccaggattataCT 8442
    362_1 23 1 33 7 CAGAaacttatactttaTG 8473
    363_1 49 8 45 14 AAGCagaaacttaTACT 8478
    364_1 39 6 37 4 GAAgcagaaacttaTACT 8478
    365_1 26 4 45 13 TGGaagcagaaacttataCT 8478
    366_1 21 4 44 5 TGGaagcagaaacttaTAC 8479
    367_1 97 4 70 22 AAgcagaaacttaTAC 8479
    368_1 34 3 32 11 TGGaagcagaaactTATA 8480
    369_1 71 7 46 19 AAGGgatattatggAG 8587
    370_1 51 9 79 38 TGccggaagatttcCT 8641
    371_1 45 6 52 25 ATGGattgggagtaGA 8772
    372_1 27 7 30 8 AGatggattgggagTA 8774
    373_1 13 3 28 6 AAGatggattgggaGT 8775
    374_1 42 10 44 11 ACaagatggattGGGA 8777
    374_2 41 3 45 14 ACaagatggattggGA 8777
    375_1 83 9 88 32 AGAaggttcagaCTTT 8835
    376_1 40 5 33 3 GCAgaaggttcagaCT 8837
    376_2 28 5 20 4 GCagaaggttcagACT 8837
    377_1 70 2 43 8 TGCAgaaggttcagAC 8838
    378_1 23 3 55 17 AGtgcagaaggttCAG 8840
    378_2 51 6 41 8 AGTGcagaaggttcAG 8840
    379_1 34 6 35 7 AAGTgcagaaggttCA 8841
    380_1 44 11 24 6 TAagtgcagaagGTTC 8842
    381_1 37 5 45 9 TCtaagtgcagaAGGT 8844
    382_1 75 5 147 26 CTCaggagttctactTC 8948
    383_1 90 10 141 55 CTCaggagttctaCTT 8949
    384_1 73 8 234 116 AtggaggtgactcaggAG 8957
    385_1 33 4 42 7 ATggaggtgactcagGA 8958
    386_1 24 3 29 14 ATggaggtgactcAGG 8959
    387_1 37 2 65 15 TAtggaggtgactcAGG 8959
    388_1 50 10 81 19 ATatggaggtgactcaGG 8959
    389_1 42 5 61 10 TATGgaggtgactcAG 8960
    390_1 36 2 76 50 ATatggaggtgacTCAG 8960
    391_1 52 6 64 6 CAtatggaggtgactcAG 8960
    392_1 63 5 57 6 ATAtggaggtgacTCA 8961
    393_1 53 7 64 12 CAtatggaggtgacTCA 8961
    394_1 51 5 56 24 CAtatggaggtgACTC 8962
    395_1 23 3 41 34 GCatatggaggtgacTC 8962
    396_1 34 3 54 10 TGcatatggaggtgacTC 8962
    397_1 54 5 71 24 TtgcatatggaggtgacTC 8962
    398_1 61 11 59 13 TttgcatatggaggtgacTC 8962
    399_1 25 2 30 6 GCatatggaggtgaCT 8963
    400_1 34 4 25 9 TGcatatggaggtgaCT 8963
    401_1 25 4 31 20 TTGcatatggaggtgaCT 8963
    402_1 51 6 37 11 TttgcatatggaggtgaCT 8963
    403_1 26 1 33 5 TGCatatggaggtgAC 8964
    404_1 25 2 69 19 TTGcatatggaggtGAC 8964
    405_1 26 4 24 4 TTTGcatatggaggtgAC 8964
    406_1 19 3 20 7 TTTGcatatggaggtGA 8965
    407_1 16 5 46 16 TTtgcatatggaGGTG 8966
    408_1 9 2 9 6 AAgtgaagttcaaCAGC 8997
    409_1 26 8 109 52 TGggaagtgaagTTCA 9002
    410_1 31 5 24 5 ATgggaagtgaagTTC 9003
    411_1 49 9 19 10 GATGggaagtgaaGTT 9004
    412_1 28 10 17 9 CTGtgatgggaagtGAA 9007
    413_1 54 4 34 8 ATTgagtgaatccAAA 9119
    414_1 11 1 14 2 AAttgagtgaatCCAA 9120
    415_1 58 6 14 2 GATAattgagtgaaTCC 9122
    416_1 5 1 16 3 GTGataattgagtGAA 9125
    417_1 73 5 61 14 AAGaaaggtgcaaTAA 9155
    418_1 86 6 64 13 CAagaaaggtgcAATA 9156
    419_1 75 19 64 14 ACAAgaaaggtgcaAT 9157
    420_1 75 8 50 13 ATttaaactcacaaAC 9171
    421_1 21 8 23 6 CTgttaggttcaGCGA 9235
    422_1 54 10 30 5 TCTGaatgaacatTTCG 9260
    423_1 11 4 15 5 CTcattgaaggtTCTG 9281
    424_1 87 3 52 8 CTAatctcattgaaGG 9286
    425_1 95 1 85 13 CCtaatctcattgaAG 9287
    426_1 31 7 22 7 ACTttgatctttcAGC 9305
    427_1 64 7 49 16 ACtatgcaacacttTG 9315
    428_1 18 6 21 3 CAAatagctttatCGG 9335
    429_1 19 6 17 4 CCaaatagctttATCG 9336
    430_1 35 4 27 8 TCCAaatagctttaTC 9337
    431_1 75 8 43 7 GATCcaaatagcttTA 9339
    432_1 67 11 32 8 ATgatccaaataGCTT 9341
    433_1 53 5 43 6 TATGatccaaatagCT 9342
    434_1 97 9 66 29 TAAAcagggctggGAAT 9408
    435_1 58 12 44 17 ACttaaacagggCTGG 9412
    436_1 58 10 30 12 ACacttaaacagGGCT 9414
    437_1 87 38 41 3 GAACacttaaacAGGG 9416
    438_1 70 4 59 33 AGAGaacacttaaACAG 9418
    439_1 83 17 28 9 CTACagagaacaCTTA 9423
    440_1 49 12 27 4 ATGctacagagaaCACT 9425
    441_1 53 10 24 13 ATAAatgctacagagAACA 9427
    442_1 23 6 20 10 AGataaatgctacaGAGA 9430
    443_1 48 6 27 7 TAGAgataaatgcTACA 9434
    444_1 51 3 32 8 TAGAtagagataaatGCT 9437
    445_1 38 5 ND ND CAATatactagataGAGA 9445
    446_1 52 3 31 1 TACAcaatatactagATAG 9448
    447_1 65 6 48 11 CTAcacaatatacTAG 9452
    448_1 67 9 29 2 GCTAcacaatatACTA 9453
    449_1 103 17 65 15 ATATgctacacaatATAC 9455
    450_1 71 13 129 22 TGATatgctacaCAAT 9459
    451_1 19 4 9 1 ATGAtatgatatgCTAC 9464
    452_1 75 10 45 21 GAGGagagagacaaTAAA 9495
    453_1 68 6 43 10 CTAggaggagagagACA 9500
    454_1 72 7 79 25 TATTctaggaggagAGA 9504
    455_1 31 3 29 9 TTATattctaggagGAG 9507
    456_1 38 5 62 17 GTTtatattctaGGAG 9510
    457_1 15 6 15 8 TGgagtttatattcTAGG 9512
    458_1 34 3 21 3 CGtaccaccactcTGC 9590
    459_1 41 5 55 22 TGAGgaaatcattcATTC 9641
    460_1 81 8 47 22 TTTGaggaaatcatTCAT 9643
    461_1 76 8 39 5 AGGCtaatcctattTG 9657
    462_1 93 12 216 12 TTTAggctaatcCTAT 9660
    463_1 15 6 30 9 TGCtccagtgtaccCT 9755
    464_1 27 3 25 6 TAgtagtactcgATAG 9813
    465_1 9 2 7 3 CTAattgtagtagtaCTC 9818
    466_1 52 3 32 6 TGctaattgtagTAGT 9822
    467_1 68 11 36 16 AGTGctaattgtagTA 9824
    468_1 35 6 32 3 GCAAgtgctaattgTA 9827
    469_1 91 9 ND ND GAGGaaatgaactaattTA 9881
    470_1 92 5 ND ND CAGGaggaaatgaacTA 9886
    471_1 67 5 42 6 CCctagagtcattTCC 9902
    472_1 35 5 20 8 ATCttacatgatgaAGC 9925
    473_1 13 1 20 5 GACacactcagatttcAG 9967
    474_1 24 4 20 2 AGacacactcagatttcAG 9967
    475_1 25 4 24 7 AAGacacactcagatttcAG 9967
    476_1 26 6 19 4 AGacacactcagattTCA 9968
    477_1 28 4 32 13 AAGacacactcagattTCA 9968
    478_1 31 8 37 6 AAagacacactcagatTTCA 9968
    479_1 63 7 51 26 GAAagacacactcagatTTC 9969
    480_1 37 10 ND ND AAGAcacactcagatTTC 9969
    481_1 41 4 ND ND AAAGacacactcagaTTTC 9969
    482_1 19 5 48 14 TGAAagacacactcagatTT 9970
    483_1 60 8 68 10 TGaaagacacactcaGATT 9971
    484_1 42 8 63 22 TGAaagacacactcaGAT 9972
    485_1 48 9 41 20 ATTGaaagacacacTCA 9975
    486_1 27 6 27 12 TCattgaaagacaCACT 9977
    487_1 88 13 121 33 TTCcatcattgaAAGA 9983
    488_1 80 12 ND ND ATAAtaccacttaTCAT 10010
    489_1 13 4 27 15 TTacttaatttcttTGGA 10055
    490_1 32 5 60 24 TTAgaactagctttaTCA 10101
    491_1 58 10 55 17 GAGgtacaaatatAGG 10171
    492_1 4 1 12 3 CTTatgatacaacTTA 10384
    493_1 37 6 35 5 TCttatgatacaaCTT 10385
    494_1 30 0 27 6 TTCttatgatacaaCT 10386
    495_1 27 8 18 3 CAgtttcttatgaTAC 10390
    496_1 25 10 25 6 GCAgtttcttatgaTA 10391
    497_1 77 6 72 29 TACAaatgtctattagGTT 10457
    498_1 66 5 69 17 TGTAcaaatgtctatTAG 10460
    499_1 27 10 20 4 AGCatcacaattagTA 10535
    500_1 31 10 25 5 CTAatgatagtgaaGC 10548
    501_1 21 7 30 8 AGCtaatgatagtgAA 10550
    502_1 35 5 39 8 ATGCcttgacatatTA 10565
    503_1 64 11 79 26 CTCAagattattgACAC 10623
    504_2 25 4 83 32 ACctcaagattaTTGA 10626
    504_1 94 7 22 6 ACCtcaagattaTTGA 10626
    505_1 31 6 34 10 AACCtcaagattatTG 10627
    506_1 55 6 62 17 CACAaacctcaagattaTT 10628
    507_1 66 12 40 4 GTActtaattagACCT 10667
    508_1 78 5 80 10 AGTActtaattagACC 10668
    509_1 36 5 42 15 GTATgaggtggtaaAC 10688
    510_1 40 4 48 22 AGgaaacagcagaAGTG 10723
    511_1 27 7 13 6 GCacaacccagaggAA 10735
    512_1 54 5 ND ND CAAgcacaacccagAG 10738
    513_1 35 7 ND ND TTCaagcacaaccCAG 10740
    514_1 49 6 52 15 AAttcaagcacaACCC 10742
    515_1 72 4 106 49 TAATaattcaagcacaaCC 10743
    516_1 43 4 57 21 ACTAataattcaaGCAC 10747
    517_1 37 3 60 12 ATAAtactaataattcAAGC 10749
    518_1 9 3 6 1 TAgatttgtgagGTAA 11055
    519_1 59 10 31 5 AGCCttaattctccAT 11091
    520_1 41 4 34 9 AATGatctagagcCTTA 11100
    521_1 34 6 34 7 CTAatgatctagaGCC 11103
    522_1 52 6 52 17 ACTaatgatctaGAGC 11104
    523_1 60 4 54 10 CATtaacatgttctTATT 11165
    524_1 57 4 55 8 ACAAgtacattaacatGTTC 11170
    525_1 53 6 44 5 TTACaagtacattaaCATG 11173
    526_1 54 11 49 17 GCTTtattcatgtTTAT 11195
    527_1 34 7 17 5 GCTttattcatgttTA 11196
    528_1 11 2 21 4 AGAgctttattcatgtTT 11197
    529_1 22 4 33 7 ATAAgagctttattCATG 11200
    530_1 30 5 32 15 CATAagagctttaTTCA 11202
    531_1 77 8 24 4 AGCAtaagagctTTAT 11205
    532_1 8 3 15 6 TAGattgtttagtGCA 11228
    533_1 4 2 10 2 GTagattgtttaGTGC 11229
    534_1 41 6 33 11 GACAattctagtaGATT 11238
    535_1 50 1 37 7 CTGacaattctaGTAG 11241
    536_1 49 7 36 6 GCTGacaattctagTA 11242
    537_1 59 2 42 11 AGgattaagatacgTA 11262
    538_1 28 11 28 4 CAggattaagataCGT 11263
    539_1 96 5 20 6 TCAggattaagataCG 11264
    540_1 70 11 59 11 TTcaggattaagATAC 11265
    541_1 53 5 28 4 AGGAagaaagtttgATTC 11308
    542_1 92 13 59 12 TCAAggaagaaagtTTGA 11311
    543_1 44 3 67 7 CTCAaggaagaaagTTTG 11312
    544_1 43 4 32 4 TGCtcaaggaagaAAGT 11315
    545_1 41 7 44 20 AATTatgctcaaggaAGA 11319
    546_1 11 4 26 8 TAGGataccacattatGA 11389
    547_1 25 4 26 12 CAtaatttattccattcCTC 11449
    548_1 64 6 ND ND TGCAtaatttattcCAT 11454
    549_1 48 17 49 7 ACTGcataatttatTCC 11456
    550_1 91 10 92 15 CTAAactgcataattTATT 11458
    551_1 85 8 38 9 ATaactaaactgCATA 11465
    552_1 86 4 ND ND TTAttaataactaaaCTGC 11468
    553_1 91 13 92 21 TAGTacattattaataaCT 11475
    554_1 50 4 37 7 CATAactaaggacgTT 11493
    555_1 41 5 30 7 TCataactaaggaCGT 11494
    556_1 80 7 55 13 CGTCataactaaggAC 11496
    557_1 86 3 59 11 TCgtcataactaagGA 11497
    558_1 51 9 33 12 ATcgtcataactAAGG 11498
    559_1 91 6 65 26 GTtagtatcttacATT 11525
    560_1 30 3 41 8 CTCtattgttagtATC 11532
    561_1 59 8 18 6 AGTatagagttacTGT 11567
    562_1 65 11 41 11 TTCCtggtgatactTT 11644
    563_1 57 13 45 13 GTTCctggtgatacTT 11645
    564_1 57 15 30 7 TGttcctggtgataCT 11646
    565_1 17 4 35 4 ATaaacatgaatctCTCC 11801
    566_1 16 3 30 4 CTTtataaacatgaaTCTC 11804
    567_1 60 5 45 11 CTGtctttataaaCATG 11810
    568_1 20 2 19 5 TTgttataaatctgTCTT 11820
    569_1 68 9 44 4 TTAaatttattcttgGATA 11849
    570_1 76 8 48 12 CTtaaatttattctTGGA 11851
    571_1 62 5 66 5 CTTCttaaatttattctTG 11853
    572_1 28 4 44 10 TATGtttctcagtAAAG 11877
    573_1 29 6 36 11 GAAttatctttaaACCA 11947
    574_1 74 6 34 7 CCCttaaatttctaCA 11980
    575_1 37 8 30 9 ACACtgctcttgtaCC 11995
    576_1 45 14 27 6 TGAcaacactgctCTT 12000
    577_1 2 1 12 5 TACAtttattgggcTC 12081
    578_1 65 14 39 9 GTacatttattgGGCT 12082
    579_1 34 4 53 12 TTGgtacatttatTGG 12085
    580_1 41 7 35 6 CATGttggtacattTAT 12088
    581_1 11 4 12 5 AATCatgttggtacAT 12092
    582_1 96 16 48 9 AAatcatgttggtaCA 12093
    583_1 71 15 42 13 GACaagtttggattAA 12132
    584_1 46 34 39 6 AAtgttcagatgCCTC 12197
    585_1 37 26 28 12 GCttaatgttcagaTG 12201
    586_1 75 8 43 12 CGTAcatagcttgaTG 12267
    587_1 41 10 28 5 GTGaggaattaggaTA 12753
    588_1 41 5 27 9 GTAacaatatggttTG 12780
    589_1 67 10 37 7 GAaatattgtagaCTA 13151
    590_1 97 10 80 12 TTGaaatattgtagAC 13153
    591_1 64 10 47 9 AAgtctagtaatTTGC 13217
    592_1 84 7 60 9 GCTCagtagattatAA 13259
    593_1 42 8 32 9 CATacactgttgcTAA 13296
    594_1 101 6 79 17 ATGgtctcaaatcATT 13314
    595_1 53 14 46 7 CAATggtctcaaatCA 13316
    596_1 47 6 36 6 TTCCtattgattgaCT 13568
    597_1 97 12 41 6 TTTCtgttcacaacAC 13600
    598_1 85 1 49 11 AGgaacccactaaTCT 13702
    599_1 56 3 34 7 TAAatggcaggaacCC 13710
    600_1 15 4 24 8 GTAAatggcaggaaCC 13711
    601_1 40 6 26 8 TTgtaaatggcagGAA 13713
    602_1 59 12 26 6 TTatgagttaggCATG 13835
    603_1 62 2 42 10 CCAggtgaaactttAA 13935
    604_1 77 9 55 18 CCCttagtcagctCCT 13997
    605_1 82 13 42 11 ACccttagtcagCTCC 13998
    606_1 74 1 39 10 CAcccttagtcagCTC 13999
    607_1 76 9 30 8 TCTcttactaggcTCC 14091
    608_1 82 5 50 13 CCtatctgtcatcATG 14178
    609_1 82 1 48 12 TCCtatctgtcatcAT 14179
    610_1 41 6 50 13 GAGaagtgtgagaaGC 14808
    611_1 70 5 84 19 CATCcttgaagtttAG 14908
    612_1 64 14 61 16 TAAtaagatggctCCC 15046
    613_1 85 2 51 14 CAAggcataataagAT 15053
    614_1 47 1 35 10 CCaaggcataatAAGA 15054
    615_1 74 8 53 11 TGatccaattctcaCC 15151
    616_1 63 4 41 11 ATGatccaattctCAC 15152
    617_1 46 7 42 9 CGCttcatcttcacCC 15260
    618_1 104 4 15 4 TAtgacactgcaTCTT 15317
    619_1 8 3 8 5 GTAtgacactgcaTCT 15318
    620_1 21 3 27 10 TGtatgacactgCATC 15319
    621_1 37 7 38 11 TTCTcttctgtaagTC 15363
    622_1 49 7 36 11 TTctacagaggaACTA 15467
    623_1 47 1 32 10 ACTacagttctacAGA 15474
    624_1 78 8 69 6 TTCCcacaggtaaaTG 15561
    625_1 70 7 ND ND ATTAtttgaatatactCATT 15594
    626_1 73 7 49 25 TGGGaggaaattatTTG 15606
    627_1 80 5 64 11 TGACtcatcttaaaTG 15621
    628_1 71 6 66 19 CTGactcatcttaaAT 15622
    629_1 31 6 41 6 TTTactctgactcATC 15628
    630_1 88 2 68 18 TATtggaggaattaTT 15642
    631_1 53 2 27 6 GTAttggaggaattAT 15643
    632_1 23 3 39 7 TGgtatacttctctaagTAT 15655
    633_1 42 9 33 3 GATCtcttggtataCT 15666
    634_1 38 1 30 16 CAgacaactctataCC 15689
    635_1 10 2 19 3 AACAtcagacaacTCTA 15693
    636_1 13 1 11 3 TAACatcagacaacTC 15695
    637_1 14 2 27 2 TTTAacatcagacaACTC 15695
    638_1 101 14 81 16 ATttaacatcagacAA 15698
    639_1 14 1 17 1 CCtatttaacatcAGAC 15700
    640_1 65 2 ND ND TCCctatttaacaTCA 15703
    641_1 41 6 42 12 TCAAcgactattgGAAT 15737
    642_1 37 2 29 5 CTTAtattctggcTAT 15850
    643_1 31 7 35 4 ATCCttatattctgGC 15853
    644_1 13 3 8 1 GAtccttatattCTGG 15854
    645_1 25 5 20 4 TGAtccttatattCTG 15855
    646_1 33 6 54 10 ATTGaaacttgaTCCT 15864
    647_1 43 3 27 6 ACtgtcattgaaACTT 15870
    648_1 54 7 32 12 TCTtactgtcattgAA 15874
    649_1 12 1 25 2 AGgatcttactgtCATT 15877
    650_1 13 4 11 3 GCAaatcaactccATC 15896
    651_1 10 5 16 3 GTGcaaatcaactCCA 15898
    652_1 7 0 36 18 CAATtatttctttgTGC 15910
    653_1 21 3 31 7 TGGcaacaattattTCTT 15915
    654_1 75 9 73 24 GCTggcaacaatTATT 15919
    655_1 21 6 39 6 ATCCatttctactgCC 15973
    656_1 25 3 38 8 TAATatctattgattTCTA 15988
    657_1 14 2 11 5 TCaatagtgtagggCA 16093
    658_1 11 4 10 3 TTCaatagtgtaggGC 16094
    659_1 18 1 32 12 AGGTtaattaattcaATAG 16102
    660_1 33 7 25 10 CATttgtaatccCTAG 16163
    660_2 64 14 31 8 CATttgtaatcccTAG 16163
    661_1 48 6 34 6 ACAtttgtaatccCTA 16164
    662_2 29 6 23 5 AAcatttgtaatCCCT 16165
    662_1 30 6 18 6 AACatttgtaatCCCT 16165
    663_1 49 1 26 6 TAaatttcaagttCTG 16184
    664_1 17 3 30 10 GTTtaaatttcaagTTCT 16185
    665_1 22 7 40 9 CCAAgtttaaatttCAAG 16189
    666_1 89 11 ND ND ACCCaagtttaaaTTTC 16192
    667_1 60 16 87 8 CAtacagtgacccaagTTT 16199
    668_1 65 9 50 12 ACatcccatacagTGA 16208
    669_1 83 8 103 4 AGcacagctctaCATC 16219
    670_1 80 9 150 36 ATAtagcacagcTCTA 16223
    671_1 57 14 ND ND TCCatatagcacagCT 16226
    672_1 53 10 106 8 ATTtccatatagCACA 16229
    673_1 78 3 96 14 TTTAtttccatatAGCA 16231
    674_1 77 9 31 7 TTTatttccatatAGC 16232
    675_1 32 6 ND ND AAGGagaggagatTATG 16409
    676_1 32 5 24 6 AGTtcttgtgttagCT 16456
    677_1 19 4 17 4 GAgttcttgtgttaGC 16457
    678_1 14 3 25 3 ATTaattatccatCCAC 16590
    679_1 11 2 20 6 ATCaattaattatcCATC 16593
    680_1 31 5 40 11 AGAatcaattaattaTCC 16596
    681_1 8 3 30 10 TGagataccgtgcaTG 16656
    682_1 11 3 ND ND AAtgagataccgTGCA 16658
    683_1 15 3 33 10 CTGtggttaggctaAT 16834
    684_1 45 7 38 7 AagagtaagggtctgtggTT 16842
    685_1 24 5 ND ND GATGggttaagagTAA 16854
    686_1 11 2 ND ND AGCagatgggttaaGA 16858
    687_1 ND ND 51 7 TGtaaacatttgTAGC 16886
    688_1 83 1 54 11 CCTgcttataaatgTA 16898
    689_1 103 4 73 14 TGCCctgcttataaAT 16901
    690_1 104 2 64 22 TCttcttagttcaaTA 16935
    691_1 ND ND 60 9 TGgtttctaactACAT 16980
    692_1 ND ND 94 22 AGtttggtttctaaCTA 16983
    693_1 8 2 17 5 GAAtgaaacttgcCTG 17047
    694_1 98 6 51 9 ATTatccttacatGAT 17173
    695_1 48 4 18 4 GTacccaattatcCTT 17180
    696_1 94 2 48 9 TGTacccaattatCCT 17181
    697_1 31 5 42 13 TTgtacccaattaTCC 17182
    698_1 41 4 39 6 TTTgtacccaattaTC 17183
    699_1 63 0 28 12 AGCAgcaggttataTT 17197
    700_1 99 6 43 12 TGGgaagtggtctGGG 17292
    701_1 103 2 28 5 CTGgagagtgataaTA 17322
    702_1 52 6 27 9 AATGctggattacgTC 17354
    703_1 67 3 37 7 CAatgctggattaCGT 17355
    704_1 36 10 80 12 TTgttcagaagtATCC 17625
    705_1 19 9 47 9 GAtgatttgcttGGAG 17646
    706_1 44 NA 60 9 GAAatcattcacaACC 17860
    707_1 46 9 32 9 TTGtaacatctacTAC 17891
    708_1 56 0 79 17 CATtaagcagcaagTT 17923
    709_1 30 9 46 7 TTActagatgtgagCA 17942
    710_1 29 4 36 6 TTtactagatgtgAG C 17943
    711_1 41 13 41 6 GACcaagcaccttaCA 17971
    712_1 36 19 49 11 AGAccaagcacctTAC 17972
    713_1 30 6 34 7 ATgggttaaataAAGG 18052
    714_1 70 2 24 8 TCaaccagagtattAA 18067
    715_1 11 4 26 8 GTCaaccagagtatTA 18068
    716_1 126 56 26 6 ATtgtaaagctgaTAT 18135
    717_1 73 1 42 10 CAcataattgtaAAGC 18141
    718_1 23 9 55 18 GAggtctgctattTAC 18274
    719_1 50 1 42 11 TGtagattcaatgCCT 18404
    720_1 79 3 39 10 CCtcattatactaTGA 18456
    721_1 27 6 30 8 CCttatgctatgacAC 18509
    722_1 26 7 50 13 TCCTtatgctatgaCA 18510
    723_1 59 1 48 12 AAGatgtttaagtATA 18598
    724_1 54 2 50 13 CTgattattaagATGT 18607
    725_1 92 10 84 19 TGgaaaggtatgaaTT 18808
    726_1 24 8 61 16 ACttgaatggcttgGA 18880
    727_1 8 4 51 14 AACttgaatggctTGG 18881
    728_1 35 4 35 10 CAATgtgttactatTT 19004
    729_1 36 9 53 11 ACAatgtgttactATT 19005
    730_1 70 2 41 11 CATCtgctatataaGA 19063
    731_1 38 NA 42 9 CCTAgagcaaatacTT 19223
    732_1 102 15 15 4 CAG agttaataatAAG 19327
    733_1 37 10 8 5 GTTCaagcacaacgAA 19493
    734_1 13 1 38 11 AGggttcaagcacAAC 19496
    735_1 49 NA 36 11 TGttggagacactgTT 19677
    736_1 48 NA 32 10 AAGgaggagttaggAC 19821
    737_1 36 NA 64 11 CTATgccatttacgAT 19884
    738_1 105 19 66 19 TCaaatgcagaattAG 19913
    739_1 44 NA 41 6 AGtgacaatcaaATGC 19921
    740_1 107 NA 68 18 AAgtgacaatcaaATG 19922
    741_1 102 4 27 6 GTGtaccaagtaacAA 19978
    742_1 110 10 30 16 TGGgatgttaaacTGA 20037
    • Example 2 - Testing in vitro efficacy in a dose response curve
  • A selection of oligonucleotides from Table 10 were tested in KARPAS-299 cells using half-log serial dilutions in in PBS (50 µM, 15.8 µM, 5.0 µM, 1.58 µM, 0.5 µM, 0.158 µM, 0.05 µM, to 0.0158 µM oligonucleotide) in the in vitro efficacy assay described in Example 1. IC 50 and max inhibition (% residual PD-L1 expression) was assessed for the oligonucleotides.
  • EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock down level is shown in table 11 as % of control (PBS) treated cells. Table 11: Max inhibition as % of saline and EC50 in KARPAS-299 cell line.
    CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline-treated) EC50 (µM) Compound CMP Start on SEQ ID NO: 1
    Avg SD Avg SD
    6_1 11 3.3 0.69 0.11 TCGCataagaatgaCT 371
    8_1 29 1.7 0.06 0.01 CTGaacacacagtCGC 383
    9_1 19 1.7 0.23 0.02 TCTgaacacacagtCG 384
    13_1 14 4.7 0.45 0.12 CTtacttagatgcTGC 495
    41_1 10 1.8 0.19 0.02 TCAtttagttaccCAA 822
    42_1 17 1.3 0.19 0.02 TTcatttagttaCCCA 823
    58_1 23 1.5 0.17 0.01 CCagagatatataTGC 909
    77_1 24 2.4 0.16 0.02 AGTatcatagttcTCC 1075
    92_1 12 2.4 0.25 0.03 AGattaagacagtTGA 1310
    111_1 3 2.0 0.27 0.03 TGaattcccatatcCGA 1992
    128_1 11 1.8 0.25 0.03 CTcatatcagggCAGT 2063
    151_1 16 2.7 0.28 0.05 GTCatggattacaaCT 2324
    164_1 19 1.6 0.15 0.01 TCTGtttatgtcacTG 2781
    166_1 36 1.7 0.11 0.02 TGgtctgtttatGTCA 2784
    169_1 10 1.6 0.22 0.02 TTcagcaaatatTCGT 2995
    171_1 12 2.0 0.21 0.02 TCTattgttaggtATC 3053
    222_1 1 2.0 0.21 0.02 TGacttgtaattgTGG 5467
    233_1 1 4.3 0.89 0.17 TGGaatgccctaatTA 5591
    245_1 4 2.0 0.17 0.02 TCggttatgttaTCAT 6470
    246_1 7 2.1 0.25 0.03 CActttatctggTCGG 6482
    250_1 0 2.5 0.23 0.03 CCacatataggtcCTT 6597
    251_1 0 2.8 0.75 0.10 CAtattgctaccaTAC 6617
    252_1 3 2.2 0.19 0.02 TCAtattgctaccATA 6618
    256_1 5 2.2 0.32 0.03 CAAttagtgcagcCAG 6672
    272_1 1 3.2 0.69 0.10 TACTgtagaacatgGC 7133
    273_1 3 2.8 0.28 0.04 GCAAttcatttgaTCT 7239
    287_1 1 1.4 0.13 0.01 ACAAataatggttaCTCT 7302
    292_1 2 2.1 0.21 0.02 GCATttgatatagAGA 7397
    303_1 0 1.2 0.21 0.01 CAAgatgaatataTGCC 7551
    314_1 3 2.1 0.39 0.04 GAgtttggattagCTG 7764
    318_1 3 1.4 0.14 0.01 ACAggatatggaaGGG 7880
    320_1 2 2.4 0.22 0.03 GAgtaatttcaacAGG 7891
    324_1 0 2.4 0.44 0.05 CAgcttactattaGGG 7906
    336_1 0 2.5 0.21 0.03 GATGatttaattctagtCA 7984
    342_1 1 2.2 0.12 0.01 CAGAttgatggtagTT 8030
    343_1 4 1.8 0.11 0.01 CTcagattgatgGTAG 8032
    344_1 0 0.9 0.12 0.01 GTTagccctcagaTTG 8039
    345_1 0 2.3 0.36 0.04 TGtattgttagcCCTC 8045
    346_1 1 2.1 0.22 0.02 ACttgtattgttAGCC 8048
    349_1 4 2.9 0.21 0.03 ACAagtggtatctTCT 8228
    359_1 6 2.9 0.39 0.05 TTGAtgaggctaagTC 8395
    360_1 0 1.7 0.18 0.02 CCAggattatactcTT 8439
    374_1 5 1.7 0.33 0.03 AAGatggattgggaGT 8775
    408_1 3 1.8 0.21 0.02 TTtgcatatggaGGTG 8966
    409_1 0 1.8 0.21 0.02 AAgtgaagttcaaCAGC 8997
    415_1 0 1.4 0.23 0.02 AAttgagtgaatCCAA 9120
    417_1 7 0.9 0.15 0.01 GTGataattgagtGAA 9125
    424_1 6 3.2 0.19 0.03 CTcattgaaggtTCTG 9281
    429_1 5 2.5 0.48 0.05 CAAatagctttatCGG 9335
    430_1 1 2.7 0.68 0.09 CCaaatagctttATCG 9336
    458_1 0 4.1 0.35 0.07 TGgagtttatattcTAGG 9512
    464_1 0 4.1 0.56 0.10 TGCtccagtgtaccCT 9755
    466_1 1 2.1 0.21 0.02 CTAattgtagtagtaCTC 9818
    474_1 0 2.4 0.27 0.03 GACacactcagatttcAG 9967
    490_1 0 1.9 0.29 0.03 TTacttaatttcttTGGA 10055
    493_1 3 1.8 0.20 0.02 CTTatgatacaacTTA 10384
    512_1 0 3.3 0.63 0.10 GCacaacccagaggAA 10735
    519_1 5 1.5 0.15 0.01 TAgatttgtgagGTAA 11055
    529_1 0 2.7 0.24 0.03 AGAgctttattcatgtTT 11197
    533_1 6 1.5 0.14 0.01 TAGattgtttagtGCA 11228
    534_1 5 0.9 0.06 0.00 GTagattgtttaGTGC 11229
    547_1 1 1.6 0.26 0.02 TAGGataccacattatGA 11389
    566_1 0 3.0 0.40 0.06 ATaaacatgaatctCTCC 11801
    567_1 2 2.5 0.34 0.04 CTTtataaacatgaaTCTC 11804
    578_1 2 1.3 0.09 0.01 TACAtttattgggcTC 12081
    582_1 1 1.6 0.20 0.02 AATCatgttggtacAT 12092
    601_1 1 2.1 0.47 0.05 GTAAatggcaggaaCC 13711
    619_1 4 3.4 0.44 0.08 TAtgacactgcaTCTT 15317
    620_1 1 1.2 0.12 0.01 GTAtgacactgcaTCT 15318
    636_1 0 1.3 0.19 0.01 AACAtcagacaacTCTA 15693
    638_1 0 2.2 0.36 0.04 TAACatcagacaacTC 15695
    637_1 0 2.1 0.21 0.02 TTTAacatcagacaACTC 15695
    640_1 2 3.3 0.42 0.06 CCtatttaacatcAGAC 15700
    645_1 1 2.9 0.34 0.04 GAtccttatattCTGG 15854
    650_1 0 2.4 0.24 0.03 AGgatcttactgtCATT 15877
    651_1 4 3.4 0.33 0.05 GCAaatcaactccATC 15896
    652_1 0 1.3 0.16 0.01 GTGcaaatcaactCCA 15898
    653_1 4 2.0 0.09 0.01 CAATtatttctttgTGC 15910
    658_1 3 1.6 0.32 0.02 TCaatagtgtagggCA 16093
    659_1 5 1.4 0.20 0.01 TTCaatagtgtaggGC 16094
    660_1 4 2.1 0.22 0.02 AGGTtaattaattcaATAG 16102
    665_1 3 1.8 0.18 0.02 GTTtaaatttcaagTTCT 16185
    678_1 3 2.1 0.43 0.04 GAgttcttgtgttaGC 16457
    679_1 0 3.5 0.31 0.05 ATTaattatccatCCAC 16590
    680_1 4 1.6 0.12 0.01 ATCaattaattatcCATC 16593
    682_1 3 2.4 0.27 0.03 TGagataccgtgcaTG 16656
    683_1 0 3.2 0.16 0.03 AAtgagataccgTGCA 16658
    684_1 2 2.3 0.25 0.03 CTGtggttaggctaAT 16834
    687_1 5 1.3 0.13 0.01 AGCagatgggttaaGA 16858
    694_1 0 1.7 0.16 0.02 GAAtgaaacttgcCTG 17047
    706_1 15 3.6 0.27 0.06 GAtgatttgcttGGAG 17646
    716_1 10 2.1 0.15 0.02 GTCaaccagagtatTA 18068
    728_1 5 1.2 0.09 0.01 AACttgaatggctTGG 18881
    733_1 0 12.7 8.01 3.62 CAGagttaataatAAG 19327
    734_1 0 14.6 3.49 2.39 GTTCaagcacaacgAA 19493
    735_1 0 2.5 0.30 0.04 AGggttcaagcacAAC 19496
  • A selection of oligonucleotides from Table 6 were tested in THP-1 cells using 1:3 serial in water from 25 µM to 0.004 µM in the in vitro efficacy assay described in Example 1. IC 50 and max inhibition (Percent residual PD-L1 expresson) was assessed for the oligonucleotides.
  • EC50 calculations were performed in GraphPad Prism6. The IC50 and maximum PD-L1 knock down level is shown in table 12 as % of control (PBS) treated cells. Table 12: Max inhibition as % of saline and EC50 in THP1 cell line.
    CMP ID NO Max Inhibition (% residual PD-L1 expression; % of saline) EC50 (µM) Compound CMP Start on SEQ ID NO: 1
    Avq SD Avg SD
    6_1 12 11.5 0.73 0.38 TCGCataagaatgaCT 371
    8_1 6 5.6 0.11 0.04 CTGaacacacagtCGC 383
    9_1 1 14.3 0.36 0.27 TCTgaacacacagtCG 384
    13_1 2 12.4 0.49 0.31 CTtacttagatgcTGC 495
    41_1 14 14.6 0.38 0.27 TCAtttagttaccCAA 822
    42_1 21 10.4 0.22 0.10 TTcatttagttaCCCA 823
    58_1 6 19.8 0.97 0.81 CCagagatatataTGC 909
    77_1 5 4.8 0.14 0.04 AGTatcatagttcTCC 1075
    92_1 0 12.9 0.57 0.39 AGattaagacagtTGA 1310
    128_1 15 10.1 0.23 0.13 CTcatatcagggCAGT 2063
    151_1 9 14.4 0.18 0.15 GTCatggattacaaCT 2324
    164_1 16 22.0 0.57 0.60 TCTGtttatgtcacTG 2781
    166_1 13 11.9 0.17 0.11 TGgtctgtttatGTCA 2784
    169_1 0 9.3 0.22 0.11 TTcagcaaatatTCGT 2995
    171_1 11 12.9 0.28 0.20 TCTattgttaggtATC 3053
    222_1 16 19.7 0.68 0.64 TGacttgtaattgTGG 5467
    245_1 14 6.1 0.26 0.08 TCggttatgttaTCAT 6470
    246_1 28 7.3 0.10 0.20 CActttatctggTCGG 6482
    252_1 19 8.0 0.29 0.12 TCAtattgctaccATA 6618
    272_1 3 9.7 0.25 0.14 TACTgtagaacatgGC 7133
    314_1 13 9.6 0.31 0.15 GAgtttggattagCTG 7764
    344_1 11 8.0 0.14 0.06 GTTagccctcagaTTG 8039
    349_1 12 12.5 0.18 0.14 ACAagtggtatctTCT 8228
    415_1 11 9.6 0.26 0.12 AAttgagtgaatCCAA 9120
    493_1 15 16.5 0.48 0.34 CTTatgatacaacTTA 10384
    512_1 43 14.1 0.31 0.68 GCacaacccagaggAA 10735
    519_1 9 12.2 0.45 0.26 TAgatttgtgagGTAA 11055
    533_1 11 13.6 0.29 0.21 TAGattgtttagtGCA 11228
    534_1 9 6.5 0.09 0.03 GTagattgtttaGTGC 11229
    582_1 0 12.3 0.33 0.23 AATCatgttggtacAT 12092
    619_1 8 10.4 0.32 0.18 TAtgacactgcaTCTT 15317
    620_1 12 24.6 1.10 1.08 GTAtgacactgcaTCT 15318
    638_1 2 5.4 0.00 0.00 TAACatcagacaacTC 15695
    645_1 20 29.6 1.10 1.50 GAtccttatattCTGG 15854
    651_1 0 11.2 0.14 0.09 GCAaatcaactccATC 15896
    658_1 11 13.8 0.48 0.32 TCaatagtgtagggCA 16093
    659_1 0 8.2 0.11 0.06 TTCaatagtgtaggGC 16094
    733_1 0 69.6 11.03 26.95 CAGagttaataatAAG 19327
    734_1 36 16.8 2.84 2.12 GTTCaagcacaacgAA 19493
  • The results in table 7 and 8 are also shown in figure 2 in relation to their position where they target the PD-L1 pre mRNA of SEQ ID NO: 1.
  • From this it can be seen that almost all of the compounds have EC50 values below 1 µM and a target knock down below 25% of the PD-L1 expression level in the control cells (treated with saline).
    • Example 3 - In vitro potency and efficacy and in vivo PD-L1 reduction in poly(I:C) induced mice using naked and GalNAc conjugated PD-L1 antisense oligonucleotides
  • Efficacy and potency testing was performed in an in vitro experiment in in dose-response studies in MCP-11 cells using the oligonucleotides in table 6. The same oligonucleotides as well as GalNAc conjugated versions (Table 8 CMP ID NO 755_2 - 765_2) were tested in vivo in poly(I:C) induced C57BL/6J female mice for their ability to reduce PD-L1 mRNA and protein expression
    • In vitro assay
  • MCP-11 cells (originally purchased from ATCC) suspended in DMEM (Sigma cat. no. D0819) supplemented with 10% horse serum, 2 mM L-glutamine, 0.025 mg/ml gentamicin and 1 mM sodium pyruvate were added at a density of 8000 cells/well to the oligonucleotides (10 µl) in 96-well round bottom plates and cultured for 3 days in a final volume of 200 µl/well in a humidified incubator at 37°C with 5% CO2. Oligonucleotides were screened in dose-range concentrations (50 µM, 15.8 µM, 5.0 µM, 1.58 µM, 0.5 µM, 0.158 µM, 0.05 µM and 0.0158 µM).
  • Total mRNA was extracted using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer's instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction. For gene expressions analysis, qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and Gusb (Thermo Fisher Scientific; VIC-MGB-PL Mm01197698-m1). The relative PD-L1 mRNA expression level is shown in table 9 as % of residual PD-L1 expression in % of PBS control samples (PBS-treated cells). EC50 calculations were performed in GraphPad Prism6. The EC50 and maximum PD-L1 knockdown level is shown in table 13 as % of control (PBS) cells.
    • In vivo assay
  • C57BL/6J female mice (20-23 g; 5 mice per group) were injected s.c. with 5 mg/kg unconjugated oligonucleotides to mouse PD-L1 or 2.8 mg/kg GalNAc-conjugated oligonucleotides to mouse PD-L1. Three days later, the mice were injected i.v. with 10 mg/kg poly(I:C) (LWM, Invivogen). The mice were sacrificed 5 h after poly(I:C) injection and liver samples were placed in RNAlater (Thermo Fisher Scientific) for RNA extraction or frozen at dry ice for protein extraction.
  • Total mRNA was extracted from homogenized liver samples using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer's instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction. For gene expressions analysis, qPCR was performed using TaqMan® Fast Advanced Master Mix TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 mRNA (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and TBP (Thermo Fisher Scientific; VIC-MGB-PL Mm00446971_m1). The relative PD-L1 mRNA expression level is shown in table 13 as % of control samples from mice injected with saline and poly(I:C).
  • Liver homogenates were prepared by homogenizing liver samples in 2 ml per 100 mg tissue T-PER® Tissue Protein Extraction Reagent (Thermo Fisher Scientific) mixed with 1x Halt Protease Inhibitor Cocktail, EDTA-Free (Thermo Fisher Scientific). Protein concentrations in liver homogenates were measured using Coomassie Plus (Bradford) Assay Reagent (Thermo Scientific) according to the manufacturer's instructions. Liver homogenates (40 µg protein) were separated on 4-12% Bis-Tris Plus polyacrylamide gels (Thermo Fisher Scientific) in 1xMOPS running buffer and transferred to nitrocellulose membranes using iBLOT Dry blotting system (Thermo Fisher Scientific) according to the manufacturer's instructions. Each blot was cut in to two parts horizontally at the 64 kDa band. Following blocking in TBS containing 5% skim milk and 0.05% Tween20, the membranes were incubated overnight at 4°C with rabbit monoclonal anti-vinculin (Abcam cat. no. ab129002) diluted 1:10000 (upper membranes) or goat polyclonal anti-mPD-L1 (R&D Systems cat. no. AF1019) diluted 1:1000 (lower membranes) in TBS containing 5% skim milk and 0.05% Tween20. The membranes were washed in TBS containing 0.05% Tween20 and exposed for 1 h at room temperature to HRP-conjugated swine anti-rabbit IgG (DAKO) diluted 1:3000 (upper membranes) or HRP-conjugated rabbit anti-goat IgG (DAKO) diluted 1:2000 in TBS containing 5% skim milk and 0.05% Tween20. Following washing of the membranes, the reactivity was detected using ECL select (Amersham GE Healthcare). For each group of mice treated with oligonucleotides, the intensity of the PD-L1 bands in relation to vinculin bands were evaluated by comparison with the PD-L1/vinculin band intensities of mice injected with saline and poly(I:C) (control). Results are shown in table 13, and westernblots with pairs of naked and conjugated oligonucleotides are shown in figure 9A-E. Table 13: In vitro and in vivo efficacy of oligonucleotides to mouse PD-L1
    CMP ID NO Compound CMP Max Inhibition (%of PBS) EC50 (µM) PD-L1 mRNA (% of control) PD-L1 protein (relative to control)
    744_1 AGTttacattttcTGC 9.1 0.56 86 ++
    746_1 CACctttaaaaccCCA 5.0 0.46 181 nd
    747_1 TCCtttataatcaCAC 4.4 0.52 104 ++
    748_1 ACGgtattttcacAGG 1.8 0.26 102 +++
    749_1 GACactacaatgaGGA 7.6 1.21 104 nd
    750_1 TGGtttttaggacTGT 12.4 0.74 84 nd
    751_1 CGAcaaattctatCCT 9.9 0.69 112 nd
    752_1 TGAtatacaatgcTAC 10.5 1.11 142 +++
    753_1 TCGttgggtaaatTTA 5.7 0.53 116 +++
    754_1 TGCtttataaatgGTG 5.2 0.35 98 nd
    755_2 5'-G N2-C6-caAGTttacattttcTG C nd nd 58 +
    757_2 5'-GN2-C6-caCACctttaaaaccCCA nd nd 62 nd
    758_2 5'-GN2-C6-caTCCtttataatcaCAC nd nd 53 +
    759_2 5'-G N2-C6-caACGgtattttcacAG G nd nd 66 +
    760_2 5'-GN2-C6-caGACactacaatgaGGA nd nd 101 nd
    761_2 5'-GN2-C6-caTGGtttttaggacTGT nd nd 99 nd
    762_2 5'-GN2-C6-caCGAcaaattctatCCT nd nd 84 nd
    763_2 5'-GN2-C6-caTGAtatacaatgcTAC nd nd 93 +++
    764_2 5'-GN2-C6-caTCGttgggtaaatTTA nd nd 53 +
    765_2 5'-GN2-C6-caTGCtttataaatgGTG nd nd 106 nd
    +++: similar to PD-L1/vinculin band intensity of control; ++: weaker than PD-L1/vinculin band intensity of control; +: much weaker than PD-L1/vinculin band intensity of control; nd= not determined.
  • From the data in table 13 it can be seen that GalNAc conjugation of the oligonucleotides clearly improves the in vivo PD-L1 reduction. The reduction of mRNA generally correlates with a reduction in PD-L1 protein. Except for CMP ID NO: 754_1, a low in vitro EC50 value generally reflects a good in vivo PD-L1 mRNA reduction once the oligonucleotide is conjugated to GalNAc.
    • Example 4 - In vivo PK/PD in sorted hepatocytes and non-parenchymal cells from poly(I:C) induced mice
  • The distribution of naked and GalNAc conjugated oligonucleotides as well as PD-L1 mRNA reduction was investigated in hepatocytes and non-parenchymal cells isolated from poly(I:C) induced mice.
  • C57BU6J female mice (n=3 per group) were injected s.c. with 5 mg/kg unconjugated oligonucleotide (748_1) or 7 mg/kg GalNAc-conjugated oligonucleotides (759_2) targeting mouse PD-L1 mRNA. Two days later, the mice were injected i.p. with 15 mg/kg poly(I:C) (LWM, Invivogen). The mice were anesthesized 18-20 h after poly(I:C) injection and the liver was perfused at a flow rate of 7 ml per min through the vena cava using Hank's balanced salt solution containing 15 mM Hepes and 0.38 mM EGTA for 5 min followed by collagenase solution (Hank's balanced salt solution containing 0.17 mg/ml Collagenase type 2 (Worthington 4176), 0.03% BSA, 3.2 mM CaCl2 and 1.6 g/l NaHCO3) for 12 min. Following perfusion , the liver was removed and the liver capsule was opened, the liver suspension was filtered through 70 µm cell strainer using William E medium and an aliquot of the cell suspension (= mixed liver cells) was removed for later analysis. The rest of the cell suspension was centrifuged for 3 min at 50xg. The supernatant was collected for later purification of non-parenchymal cells. The pellet was resuspended in 25 ml William E medium (Sigma cat. no. W1878 complemented with 1x Pen/Strep, 2 mM L-glutamine and 10% FBS (ATCC #30-2030)), mixed with 25 ml William E medium containing 90% percoll and the hepatocytes were precipitated by centrifugation at 50xg for 10 min. Following 2x washing in William E medium, the precipitated hepatocytes were resuspended in Williams E medium. The supernant containing non-parenchymal cells was centrifuged at 500xg 7 min and the cells were resuspended in 4 ml RPMI medium and centrifugated through two layers of percoll (25% and 50% percoll) at 1800xg for 30 min. Following collection of the non-parenchymal cells between the two percoll layers, the cells were washed and resuspended in RPMI medium.
  • Total mRNA was extracted from purified hepatocytes, non-parenchymal cells and total liver suspension (non-fractionated liver cells) using the PureLink Pro 96 RNA Purification kit (Ambion), according to the manufacturer's instructions. cDNA was synthesized using M-MLT Reverse Transcriptase, random decamers RETROscript, RNase inhibitor (Ambion) and 100 mM dNTP set (Invitrogen, PCR Grade) according to the manufacturer's instruction. For gene expressions analysis, qPCR was performed using TaqMan Fast Advanced Master Mix (2X) (Ambion) in a duplex set up with TaqMan primer assays for the PD-L1 (Thermo Fisher Scientific; FAM-MGB Mm00452054-m1) and TBP (Thermo Fisher Scientific; VIC-MGB-PL Mm00446971_m1). The relative PD-L1 mRNA expression level is shown in table 10 as % of control samples from mice injected with saline and poly(I:C).
  • Oligonucleotide content analysis was performed using ELISA employing a biotinylated capture probe with the sequence 5'-TACCGT-s-Bio-3' and a digoxigenin conjugated detection probe with the sequence 5'- DIG-C12-S1-CCTGTG - 3'. The probes consisted of only LNA with a phosphodiester backbone. Liver samples (approximately 50 mg) were homogenized in 1.4 mL MagNa pure lysis buffer (Roche Cat. No 03604721001) in a 2 mL Eppendorf tube containing one 5mm stainless steel bead. Samples were homogenized on Retsch MM400 homogenizer (Merck Eurolab) until a uniform lysate was obtained. The samples were incubated for 30 min at room temperature. Standards were generated by spiking the unconjugated antisense oligonucleotide compound (CMP ID NO 748_1) in defined concentrations into an untreated liver sample and processing them as the samples. Spike-in concentrations are chosen to match the expected sample oligo content (within ∼10-fold).
  • The homogenized samples were diluted a minimum of 10 times in 5 x SSCT buffer (750 mM NaCl, and 75 mM sodium citrate, containing 0.05 % (v/v) Tween-20, pH 7.0) and a dilution series of 6 times 2 fold dilutions using capture-detection solution (35 nM capture probe and 35 nM detection probe in 5xSSCT buffer) were made and incubated for 30 min at room temperature. The samples were transferred to a 96 well streptavidin coated plate (Nunc Cat. No. 436014) with 100 µL in each well. The plates were incubated for 1 hour at room temperature with gentle agitation. Wash three times with 2 x SSCT buffer and add 100 µL anti-DIG-AP Fab fragment (Roche Applied Science, Cat. No. 11 093 274 910) diluted 1:4000 in PBST (Phosphate buffered saline, containing 0.05 % (v/v) Tween-20, pH 7.2, freshly made) was added to each well and incubated for 1 hour at room temperature under gentle agitation. Wash three times with 2 x SSCT buffer and add 100 µL of alkaline phosphatase (AP) substrate solution (Blue Phos Substrate, KPL product code 50-88-00, freshly prepared). The intensity of the color was measured spectrophotometrically at 615 nm after 30 minutes incubation with gentle agitation. Raw data were exported from the readers (Gen5 2.0 software) to excel format and further analyzed in excel. Standard curves were generated using GraphPad Prism 6 software and a logistic 4PL regression model. Table 14: PD-L1 expression and oligo content in total liver suspension, hepatocytes and non-parenchymal cells from poly(I:C) mice treated with unconjugated and GalNAc-conjugated oligonucleotides, n=3.
    Cell type CMP ID no PD-L1 expression (% of saline-poly(I:C)) oligo content (ng/105 cells)
    Avg SD Avg SD
    Total liver 748_1 31 12.4 2.3 0.3
    759_2 28 5.3 8.3 1.1
    Hepatocytes 748_1 33 8.0 5.1 3.7
    759_2 7 1.0 43.8 18.9
    Non-parenchymal cells 748_1 31 10.1 2.2 0.7
    759_2 66 1.6 1.7 0.9
  • The results show that naked (CMP ID NO: 748_1) and conjugated (CMP ID NO: 759_2) oligonucleotide reduce PD-L1 mRNA equally well in total liver cells. In isolated hepatocytes, the effect of the conjugated oligonucleotide is almost 5 fold stronger than the effect of the naked oligonucleotide, while naked oligonucleotides showed two fold stronger effect than GalNAc-conjugated oligonucleotides in non-parenchymal cells. In hepatocytes and non- parenchymal cells the reduction of PD-L1 mRNA expression correlates to some extent with the oligonucleotide content in these cell types.
    • Example 5 - In vivo PD-L1 knock down in AAV/HBV mice using naked and GalNAc conjugated PD-L1 antisense oligonucleotides
  • In the present study AAV/HBV mice were treated with naked or conjugated to GalNAc PD-L1 antisense oligonucleotides, and the PD-L1 mRNA expression and HBV gene expression was evaluated in the liver.
  • Female HLA-A2/DR1 mice 5-8 weeks old (5 animals pr. group) were pretreated at week -1 vehicle (saline), naked PD-L1 antisense oligonucleotides (CMP ID NO 752_1 at 5 mg/kg s.c.) and GalNAc PD-L1 antisense oligonucleotides (CMP ID NO 763_2 at 7 mg/kg s.c.), these doses correspond to equimolar concentrations of the oligonucleotides. The mice were transduced by 5x 1010 vg AAV-HBV at week 0 (for further details see description AAV/HBV mouse model in the Materials and Methods section). From W1 post AAV-HBV transduction to W4, mice received 4 additional s.c. injections of PD-L1 oligonucleotides or vehicle (saline solution), given one week apart.
  • Blood samples were taken one week before transduction and one week after each injection.
  • Mice were sacrificed two weeks after the last injections and their liver were removed following PBS perfusion. The liver was cut in smaller pieces and directly frozen.
  • To measure HBV gene expression, DNA was extracted from serum with Qiagen Biorobot using the QIAamp One for all nucleic acid kit, Cat.# 965672, serum was diluted 1:20 dilution in PBS a total of 100 µl was lysed in 200ul Buffer AL. DNA was eluted from the kit in 100 µl.
  • For the Real-Time qPCR the TaqMan Gene Expression Master Mix (cat.#4369016, Applied Biosystems) was used together with a primer mix prepared by adding 1:1:0.5 of the following primers F3_core, R3_core, P3_core (Integrated DNA Technologies, all reconstituted at 100uM each)
  • Forward (F3_core): CTG TGC CTT GGG TGG CTT T (SEQ ID NO: 784)
    Reverse (R3_core): AAG GAA AGA AGT CAG AAG GCA AAA (SEQ ID NO: 785)
    Probe (P3_core):56-FAM-AGC TCC AAA/ZEN/TTC TTT ATA AGG GTC GAT GTC CAT G-3IABkFQ (SEQ ID NO: 786)
  • A standard curve using HBV plasmid (Genotype D, GTD) was prepared using 10-fold dilutions starting with 1x109 copies/µl down to 1 copy/µl and used in 5µl per reaction.
  • For each reaction 10µl Gene Expression Master Mix, 4.5µl water, 0.5µl Primer mix and 5µl sample or standard was added and the qPCR was run.
  • For the analysis the copy number / ml / well was calculated using the standard curve. The results are shown in table 15.
  • PD-L1 mRNA expression was measured using qPCR.
  • mRNA was extracted from frozen liver pieces that were added to 2ml tubes containing ceramic beads (Lysing Matrix D tubes, 116913500, mpbio) and 1ml of Trizol.
  • The liver piece was homogenized using the Precellys Tissue Disruptor.200µl Chloroform was added to the homogenate, vortexed and centrifuged at 4°C for 20min at 10000rpm. The RNA containing clear phase (around 500ul) was transferred into a fresh tube and the same volume of 70% EtOH was added. After mixing well the solution was transferred onto a RNeasy spin column and RNA was further extracted following the RNeasy Kit's manual RNeasy Mini Kit, cat.# 74104, Qiagen (including the RNA digestion RNase-free DNase Set, cat.# 79254). Elution in 50µl H2O. The final RNA concentration was measured and adjusted to 100ng/ul for all samples.
  • The qPCR was conducted on 7.5µl RNA using the Taqman RNA-to-ct 1-step Kit, cat.# 4392938, Thermo Fisher according to the manufactures instructions. The fprimer mixed used contained PD-L1_1-3 (Primer number Mm00452054_m1, Mm03048247_m1 and Mm03048248_m1) and endogounous controls (ATCB Mm00607939_s1, CANX Mm00500330_m1, YWHAZ Mm03950126_s1 and GUSB Mm01197698_m1)
  • Data were analysed using the 2^-ddct method. The mean of all four endogenous controls was used to calculate dct values. The PD-L1 expression relative to mean of the endogenous controls and in % of saline Table 15: PD-L1 mRNA expression and HBV DNA in AAV/HBV mice treated with unconjugated and GalNAc-conjugated oligonucleotides, n=5.
    CMP ID no PD-L1 mRNA expression (% of saline) HBV DNA expression (% of saline)
    Avq SD Avg SD
    Naked 752_1 55 35 72 16
    GalNAc conjugated 763_2 34 3 79 9
  • From these results it can be seen that both naked and GalNAc conjugated oligonucleotides are capable of reducing PD-L1 mRNA expression in the liver of an AAV/HBV mouse, with the GalNAc conjugated oligonucleotide being somewhat better. Both oligonucleotides also resulted in some reduction in HBV DNA in the serum.
    • Example 6 - In vivo effect on T cell response in AAV/HBV mice
  • In the present study AAV/HBV mice from Pasteur were treated with an antibody or antisense oligonucleotides targeting PD-L1. The antisense oligonucleotides were either naked or conjugated to GalNAc. During the treatment the animals were immunized with a DNA vaccine against HBs and HBc antigens (see Materials and Methods section) to ensure efficient T cell priming by the antigen presenting cells. It was evaluated how the treatment affected the cell population in liver and spleen, as well as the PD-L1 expression on these populations and whether a HBV specific T cell response could be identified.
    • Treatment protocol:
  • Female HLA-A2/DR1 mice were treated according to the protocols below. The study was conducted in two separate sub-studies, with slight differences in the administration regimens as indicated in Table 16 and 17 below.
  • DNA vaccine and anti-PD-L1 antibody was administered as described in the materials and method section. The antisense oligonucleotides used were CMP ID NO 748_1 (naked) at 5 mg/kg and CMP ID NO: 759_2 (GalNAc conjugated) at 7mg/kg, both where administered as subcutaneous injections (s.c.). Table 16: AAV/HBV mouse treatment protocol with DNA vaccine and DNA vaccine + anti-PD-L1 antibody, 6 mice in each group
    Day Vehicle (Group 10) DNA vaccine (Group 11) DNA vaccine + anti-PDL-1 Ab (Group 13)
    0 AAV/HBV
    29* Animal randomization
    34 Saline+Isotype - Ab
    41 Saline+Isotype - Ab
    48 Saline+Isotype - Ab
    50 - CaTx CaTx
    55* PBS+Isotype DNA DNA+Ab
    62 Saline+Isotype - Ab
    69 PBS+Isotype DNA DNA+Ab
    76* Saline+Isotype - Ab
    83 Saline+Isotype - Ab
    97* Sacrifice
    Isotype= mouse IgG control Ab, CaTx = cardiotoxine, DNA = DNA vaccine, Ab=anti-PD-L1 Ab and *= serum collection
    Table 17: AAV/HBV mouse treatment protocol with DNA vaccine and DNA vaccine + naked or conjugated PD-L1 oligonucleotide (ASO), 7 mice in each group
    Day Vehicle (Group 1) DNA vaccine (Group 2) DNA vaccine + PDL-1 ASO (Group 7) DNA vaccine + GN-PDL-1 ASO (Group 8)
    0 AAV/HBV
    29* Animal randomization
    39 Saline Saline
    41 Saline ASO GN-ASO
    46 Saline Saline
    49 Saline ASO GN-ASO
    53 Saline Saline
    55 CaTx CaTx CaTx CaTx
    56 Saline ASO GN-ASO
    59 PBS+ Saline DNA+PBS DNA DNA
    62* Saline ASO GN-ASO
    67 Saline Saline
    70 Saline ASO GN-ASO
    74 PBS+ Saline DNA+PBS DNA DNA
    77 Saline ASO GN-ASO
    81 Saline Saline
    84* Saline ASO GN-ASO
    88 Saline Saline
    91 Saline ASO GN-ASO
    102 Sacrifice
    DNA = DNA vaccine, CaTx = cardiotoxine, Ab=anti-PD-L1 Ab, ASO= naked PDL-1 oligonucleotide, GN-ASO= GalNAc-PDL-1 oligonucleotide and *= serum collection
  • At the time of sacrifice blood, spleen and liver mononuclear cells of each mouse from each group were collected and depleted of red blood cells (Lysing Buffer, BD biosciences, 555899). The liver mononuclear cells required a specific preparation as described in the materials and method section.
    • Cell populations:
  • In the liver the cell population was analyzed by surface labeling on liver mononuclear cells (see materials and methods) using cytometry.
  • No significant changes were noticed in the frequencies of NK cells in the spleen and liver of treated mice compared to control groups (i.e. vehicle and DNA-immunized groups). Table 18 show that in the liver, groups treated with naked PD-L1 oligonucleotide (CMP ID NO 748_1) and GalNAc conjugated PD-L1 oligonucleotide (CMP ID NO: 759_2) had a significant increase in T cell numbers compared to either control groups (i.e. vehicle and DNA-immunized groups) also presented in figure 10A. This increase was due to an increase in both CD4+ and CD8+ T cell populations (Table 18 and figure 10B and 10C, respectively). Table 18: T-cells in the liver following treatment in millions of cells
    T-cells (millinons) CD4+ T-cells (millions) CD8+ T-cells (millions)
    Avg Std Avg Std Avg Std
    Vehicle (Group 1) 0.77 0.44 0.51 0.35 0.11 0.05
    DNA vaccine (Group 2) 0.90 0.24 0.58 0.16 0.16 0.08
    DNA vaccine + anti-PD-L1 Ab (Group 13) 1.98 0.90 1.40 0.81 0.41 0.23
    Vehicle (Group 10) 1.73 0.87 1.13 0.55 0.40 0.25
    DNA vaccine (Group 11) 1.27 0.97 0.79 0.58 0.32 0.32
    DNA vaccine + PD-L1 ASO (Group 7) 3.78 1.31 2.46 0.72 0.79 0.39
    DNA vaccine + GN-PD-L1 ASO (Group 8) 3.33 0.66 2.18 0.40 0.67 0.17
    • PD-L1 expression:
  • The expression of PD-L1 protein was evaluated on macrophages, B and T cells from spleen and liver at time of sacrifice. The presence of PD-L1 antibody in the surface labeling antibody mix (see materials and methods) allowed quantification of PD-L1 expressing cells by cytometry.
  • In spleen, no significant difference between the treatments was observed in the % of macrophages, B cells and CD4+ T cells expressing PD-L1. The % of the CD8+ T cells expressing PD-L1 was lower in mice treated with naked PD-L1 oligonucleotide (CMP ID NO 748_1) and GalNAc conjugated PD-L1 oligonucleotide (CMP ID NO: 759_2) when compared to the other treatments (data not shown).
  • In liver, PD-L1 was expressed mainly on CD8+ T cells with a mean frequency of 32% and 41% in the control groups (the two vehicle and DNA vaccination groups combined, respectively, figure 11A). Treatment with naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide resulted in a decrease of the frequency of CD8+ T cells expressing PD-L1 (see table 19 figure 11A). Significant differences in the % of cells expressing PD-L1 were also noticed for B cells and CD4+ T-cells after ASO treatment, although these cell types express significantly less PD-L1 than the CD8+ T cells (see table 19 and figure 11B and C). Treatment with anti-PD-L1 Ab, also resulted in an apparent decrease in the PD-L1 expression in all cell types. It is, however, possible that this decrease is due to partly blockage of the PD-L1 epitope by the anti-PD-L1 antibody used for treatment, so that the PD-L1 detection antibody in the surface labeling antibody mix is prevented from binding to PD-L1. Therefore what appears to be a PD-L1 down regulation by the anti-PD-L1 antibody used for treatment may be the result of epitope competition between the treatment antibody and the detection antibody. Table 19: % of liver cell population with PD-L1 expression
    % of CD8+ T-cells % of CD4+ T-cells % of B-cells
    Avg Std Avg Std Avg Std
    Vehicle (Group 10) 35.5 4.7 0.75 0.52 5.9 1.5
    DNA vaccine (Group 11) 36.8 7.7 0.61 0.08 5.5 1.1
    DNA vaccine + anti-PD-L1 Ab (Group 13) 18.6 12.3 0.33 0.10 2.9 1.7
    Vehicle (Group 1) 28.5 11.5 0.64 0.21 5.9 1.7
    DNA vaccine (Group 2) 44.9 14.4 1.43 0.69 8.7 3.1
    DNA vaccine + PD-L1 ASO (Group 7) 9.6 2.4 0.37 0.21 2.9 0.8
    DNA vaccine + GN-PD-L1 ASO Group 8) 14.6 3.3 0.31 0.11 2.8 0.8
    • HBV specific T cell response:
  • NK cells and CD4+ and CD8+ T cells producing pro-inflammatory cytokines were detected using the intracellular cytokine staining assays (see Materials and Methods section) detecting IFNγ and TNFα production.
  • In the spleen no NK cells and few CD4+ T cells secreting IFNγ- and TNFα were detectable (frequency < 0.1%) at sacrifice. IFNγ-producing CD8+ T cells targeting the two HBV antigens were detected in mice treated with naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide as well as in mice from this study which received only DNA vaccine (data not shown).
  • In the livers of DNA-immunized HBV-carrier mice, no IFNγ-producing NK cells were detected at sacrifice, whereas IFNγ-secreting CD4+ T cells specific for Core or for S2+S were detected in the liver of a few DNA-immunized mice at a low frequency (< 0.4%, data not shown). HBV S2+S -specific CD8+ T cells producing IFNγ were detected in the majority of DNA-immunized mice. The frequency of IFNγ-secreting CD8+ T cells increased in mice treated with combination of DNA vaccine and naked PD-L1 oligonucleotide or GalNAc PD-L1 oligonucleotide, whereas treatment with anti-PD-L1 antibody did not add any apparent additional effect to the DNA vaccination (figure 12). IFNγ-producing CD8+ T cells targeting the envelope and core antigens were detected in most DNA-immunized groups (except anti-PD-L1 antibody) (figure 12B). Most of the S2-S specific T cells produced both IFNγ and TNFα (figure 12C). The results are also shown in Table 20. Table 20: % of HBV antigen (S2-S or core) specific CD8+ T cells from total IFNγ or IFNγ + TNFα cell population
    PreS2-S specific T cells (% of IFNγ cells) Core specific T cells (% of IFNγ cells) S2-S specific T cells (% of IFNγ + TNFα)
    Avg Std Avg Std Avg Std
    Vehicle (Group 10) 0.15 0.37 0.18 0.43 0.00 0.00
    DNA vaccine (Group 11) 1.48 1.10 0.47 0.53 0.42 1.02
    DNA vaccine + anti-PDL-1 Ab 1.18 0.95 0 0 0.38 0.49
    Vehicle (Group 1) 0.17 0.45 0.11 0.28 0.00 0.00
    DNA vaccine (Group 2) 1.70 1.02 0.27 0.51 0.98 0.90
    DNA vaccine + PDL-1 ASO 2.56 1.60 0.78 0.80 1.44 1.55
    DNA vaccine + GN-PDL-1 ASO 3.83 2.18 0.68 1.16 2.62 1.62
    • Example 7 - In vivo effect on HBV antigen and HBV DNA in the serum of AAV/HBV mice
  • In the present study AAV/HBV mice from Shanghai (see Materials and Methods section) were treated with the GalNAc conjugated PD-L1 antisense oligonucleotide CMP ID NO 759_2.
  • It was evaluated how the treatment affected the HBe and HBs antigens and HBV DNA levels in the serum compared to vehicle treated animals.
    • Treatment protocol:
  • Male C57BL/6 mice infected with recombinant adeno-associated virus (AAV) carrying the HBV genome (AAV/HBV) as described under the Shanghai model in the materials and method section were used in this study. The mice (6 mice pr. group) were injected once a week for 8 weeks with the antisense oligonucleotide CMP ID NO: 759_2 at 5 mg/kg or vehicle (saline) both where administered as subcutaneous injections (s.c.). Blood samples were collected each week during treatment as well as 6 weeks post treatment. HBV DNA, HBsAg and HBeAg levels were measured in the serum samples as described below. The results for the first 10 weeks are shown in table 21 and in figure 13. The study was still ongoing at the time of filing the application therefore data for the remaining 4 weeks have not been obtained.
    • HBsAg and HBeAg detection:
  • Serum HBsAg and HBeAg levels were determined in the serum of infected AAV-HBV mouse using the HBsAg chemoluminescence immunoassay (CLIA) and the HBeAg CLIA kit (Autobio diagnostics Co. Ltd., Zhengzhou,China, Cat. no.CL0310-2 and CL0312-2 respectively), according to the manufacturer's protocol. Briefly, 50µl of serum was transferred to the respective antibody coated microtiter plate and 50µl of enzyme conjugate reagent was added. The plate was incubated for 60 min on a shaker at room temperature before all wells were washed six times with washing buffer using an automatic washer. 25µl of substrate A and then 25µl of substrate B was added to each well. The plate was incubated for 10 min at RT before luminescence was measured using an Envision luminescence reader. HBsAg is given in the unit IU/ml; where 1 ng HBsAg =1.14 IU. HBeAg is given in the unit NCU/ml serum.
    • HBV DNA extraction and qPCR:
  • Initially mice serum was diluted by a factor of 10 (1:10) with Phosphate buffered saline (PBS). DNA was extracted using the MagNA Pure 96 (Roche) robot. 50µl of the diluted serum was mixed in a processing cartridge with 200ul MagNA Pure 96 external lysis buffer (Roche, Cat. no. 06374913001) and incubated for 10 minutes. DNA was then extracted using the "MagNA Pure 96 DNA and Viral Nucleic Acid Small Volume Kit" (Roche, Cat. no. 06543588001) and the "Viral NA Plasma SV external lysis 2.0" protocol. DNA elution volume was 50µl.
  • Quantification of extracted HBV DNA was performed using a Taqman qPCR machine (ViiA7, life technologies). Each DNA sample was tested in duplicate in the PCR. 5µl of DNA sample was added to 15µl of PCR mastermix containing 10µl TaqMan Gene Expression Master Mix (Applied Biosystems, Cat. no. 4369016), 0.5 µl PrimeTime XL qPCR Primer/Probe (IDT) and 4.5µl distilled water in a 384 well plate and the PCR was performed using the following settings: UDG Incubation (2min, 50°C), Enzyme Activation (10min, 95°C) and PCR (40 cycles with 15sec, 95° for Denaturing and 1min, 60°C for annealing and extension). DNA copy numbers were calculated from Ct values based on a HBV plasmid DNA standard curve by the ViiA7 software.
  • Sequences for TaqMan primers and probes (IDT):
    • Forward core primer (F3_core): CTG TGC CTT GGG TGG CTT T (SEQ ID NO: 784)
    • Reverse primer (R3_core): AAG GAA AGA AGT CAG AAG GCA AAA (SEQ ID NO: 785)
    • Taqman probe (P3_core): 56-FAM/AGC TCC AAA /ZEN/TTC TTT ATA AGG GTC GAT GTC CAT G/3IABkFQ (SEQ ID NO: 786).
    Table 21: HBV-DNA, HBsAg and HBeAg levels in serum from AAV/HBV mice following treatment with GalNAc conjugated PD-L1 antisense oligonucleotide.
    Saline CMP ID NO: 759_2 at 5 mg/kg
    HBV-DNA HBsAg HBeAg HBV-DNA HBsAg HBeAg
    Day Avg Std Avg Std Avg Std Avg Std Avg Std Avg Std
    0 7.46 0.35 3.96 0.48 3.23 0.14 7.44 0.29 3.87 0.40 3.17 0.13
    7 7.53 0.23 4.17 0.45 3.35 0.10 7.53 0.20 3.91 0.42 3.19 0.18
    14 7.57 0.24 4.12 0.49 3.19 0.11 7.45 0.22 3.90 0.50 2.99 0.27
    21 7.47 0.27 3.93 0.51 3.12 0.05 7.33 0.47 3.71 0.76 2.78 0.26
    28 7.68 0.26 3.88 0.67 3.18 0.13 7.45 0.46 3.65 0.93 2.67 0.38
    35 7.69 0.21 4.03 0.54 2.95 0.08 7.13 0.75 2.98 1.05 2.04 0.38
    42 7.58 0.23 3.89 0.65 3.34 0.10 6.69 0.89 2.60 1.05 1.98 0.45
    49 7.77 0.17 3.54 1.06 3.08 0.26 6.56 1.26 2.19 0.70 1.47 0.37
    56 7.71 0.24 3.99 0.86 3.28 0.05 6.21 1.48 2.28 0.84 1.38 0.30
    63 7.59 0.28 3.67 1.07 3.25 0.13 6.08 1.39 2.08 0.71 1.35 0.30
  • From this study it can be seen that GalNAc conjugated PD-L1 antisense oligonucleotide CMP NO 759_2 has a significant effect on the reduction of HBV-DNA, HBsAg and HBeAg levels in serum after 6 weeks of treatment, and effect that is sustained for at least 2 weeks after the treatment has ended.
    • Example 8 - In vitro PD-L1 knock down in human primary hepatocytes using GalNAc conjugated PD-L1 oligonucleotides
  • The ability of GalNAc conjugated PD-L1 antisense oligonucleotide compounds to reduce the PD-L1 transcript in primary human hepatocytes was investigated using genomics.
    • Cell culture
  • Cryopreserved human hepatocytes were suspended in WME supplemented with 10% fetal calf serum, penicillin (100 U/ml), streptomycin (0.1 mg/ml) and L-glutamine (0.292 mg/ml) at a density of approx. 5 x 106 cells/ml and seeded into collagen-coated 24-well plates (Becton Dickinson AG, Allschwil, Switzerland) at a density of 2 x 105 cells/well. Cells were pre-cultured for 4h allowing for attachment to cell culture plates before start of treatment with oligonucleotides at a final concentration of 100 µM. The oligonucleotides used are shown in table 21 and table 8, vehicle was PBS. Seeding medium was replaced by 315 µl of serum free WME (supplemented with penicillin (100 U/ml), streptomycin (0.1 mg/ml), L-glutamine (0.292 mg/ml)) and 35 µl of 1 mM oligonucleotide stock solutions in PBS were added to the cell culture and left on the cells for 24 hours or 66 hours.
    • Library preparation
  • Transcript expression profiling was performed using Illumina Stranded mRNA chemistry on the Illumina sequencing platform with a sequencing strategy of 2 x 51 bp paired end reads and a minimum read depth of 30M per specimen (Q squared EA). Cells were lysed in the wells by adding 350 µl of Qiagen RLT buffer and were accessioned in a randomization scheme.
  • mRNA was purified using the Qiagen RNeasy Mini Kit. mRNA was quantitated and integrity was assessed using an Agilent Bioanalyzer. Upon initial quality assessment of the isolated RNA, it was observed that all samples met the input quality metric of 100ng with RIN scores >7.0.
  • Sequencing libraries were generated for all samples using the Illumina TruSeq Stranded mRNA Library Preparation, starting with 100 ng of total RNA. Final cDNA libraries were analyzed for size distribution and using an Agilent Bioanalyzer (DNA 1000 kit), quantitated by qPCR (KAPA Library Quant Kit) and normalized to 2 nM in preparation for sequencing. The Standard Cluster Generation Kit v5 was used to bind the cDNA libraries to the flow cell surface and the cBot isothermally to amplify the attached cDNA constructs up to clonal clusters of ∼1000 copies each. The DNA sequence was determined by sequencing-by-synthesis technology using the TruSeq SBS Kit.
    • Data processing
  • Illumina paired-end sequencing reads of length 2x51bp were mapped on the human reference genome hg19 using the GSNAP short read alignment program. SAM-format alignments were converted into sorted alignment BAM-format files using the SAMTOOLS program. Gene read counts were estimated for PD-L1 based on the exon annotation from NCBI RefSeq, specified by the corresponding GTF file for hg19. A normalization step accounting for the different library size of each sample was applied using the DESeq2 R package.
  • The reduction in PD-L1 transcript after incubation with GalNAc conjugated PD-L1 antisense oligonucleotide compounds are shown in table 22. Table 22: PD-L1 transcript reduction in human primary hepatocytes following treatment with GalNAc conjugated oligonucleotides, n=4
    Compound PD-L1 expression level 24 h (library size adjusted counts) PD-L1 expression level 66 h (library size adjusted counts)
    Vehicle 259 156
    159 168
    192 136
    202 211
    767_2 7 7
    11 14
    22 9
    28 15
    766_2 16 13
    15 10
    17 11
    29 13
    769_2 15 21
    18 18
    25 18
    26 25
    768_2 41 25
    27 48
    31 25
    34 22
    770_2 21 16
    44 62
    67 51
    38 63
  • All five GalNAc conjugated antisense compounds showed significant PD-L1 transcript reduction after 24 and 66 hour incubation when compared to samples treated with vehicle.
    • Example 9 - EC50 of conjugated and naked PD-L1 antisense oligonucleotides in HBV infected ASGPR-HepaRG cells
  • The potency of two naked and the equivalent GalNAc conjugated PD-L1 antisense oligonucleotides were compared in HBV infected ASGPR-HepaRG cells.
    • Cell line
  • HepaRG cells (Biopredic International, Saint-Gregoire, France) were cultured in Williams E medium (supplemented with 10% HepaRG growth supplement (Biopredic). From this cell line a HepaRG cell line stably overexpressing human ASGPR1 and ASGPR2 was generated using a lentiviral method. Proliferating HepaRG cells were transduced at MOI 300 with a lentivirus produced on demand by Sirion biotech (CLV-CMV-ASGPR1-T2a_ASGPR2-IRES-Puro) coding for Human ASGPR1 and 2 under the control of a CMV promoter and a puromycin resistance gene. Transduced cells were selected for 11 days with 1µg/ml puromycin and then maintained in the same concentration of antibiotic to ensure stable expression of the transgenes. ASGPR1/2 overexpression was confirmed both at mRNA level by RT-qPCR (ASGPR1: 8560 fold vs non-transduced, ASGPR2: 2389 fold vs non transduced), and at protein level by flow cytometry analysis.
  • The cells were differentiated using 1.8% DMSO for at least 2 weeks before infection. HBV genotype D was derived from HepG2.2.15 cell culture supernatant and was concentrated using PEG precipitation. To evaluate activity of test compounds against HBV, differentiated ASGPR-HepaRG cells in 96 well plates were infected with HBV at an MOI of 20 to 30 for 20 h, before the cells were washed 4 times with PBS to remove the HBV inoculum.
    • Oligonucleotide potency The following oligonucleotides
  • Naked PD-L1 ASO Equivalent GalNAc conjugated PD-L1 ASO
    CPM ID NO: 640_1 CPM ID NO: 768_2
    CPM ID NO: 466_1 CPM ID NO: 769_2
    were added to the HBV infected ASGPR-HepaRG cells on day 7 and day 10 post infection using serial dilutions from 25 µM to 0.4 nM (1:4 dilutions in PBS). Cells were harvested on day 13 post infection.
  • Total mRNA was extracted using the MagNA Pure 96 Cellular RNA Large Volume Kit on the MagNA Pure 96 System (Roche Diagnostics) according to the manufacturer's instructions. For gene expression analysis, RT-qPCR was performed as described in Example 5.
  • Data were analysed using the 2^-ddct method. ActinB was used as the endogenous control to calculate dct values. The PD-L1 expression is relative to the endogenous controls and to the saline vehicle.
  • EC50 calculations were performed in GraphPad Prism6 and is shown in table 23. Table 23: EC50 in ASGPR-HepaRG HBV infected cells, n=4.
    CMP ID NO EC50 (µM)
    640_1 2.25
    768_2 0.10
    466_1 5.82
    769_2 0.13
  • These data clearly shows that GalNAc conjugation of the PD-L1 antisense oligonucleotides improves the EC50 values significantly.
    • Example 10 - Stimulation T cell function in PBMCs derived from chronic HBV patients
  • It was investigated whether naked PD-L1 antisense compounds could increase the T cells function of chronically infected HBV (CHB) patients after ex-vivo HBV antigen stimulation of the peripheral blood mononuclear cells (PBMCs).
  • Frozen PBMCs from three chronic HBV infected patients were thawed and seeded at a density of 200'000 cells/well in 100µl medium (RPM11640 + GlutaMax+ 8% Human Serum + 25mM Hepes + 1% PenStrep). The next day, cells were stimulated with 1µM PepMix HBV Large Envelope Protein or 1µM PepMix HBV Core Protein (see table 9) with or without 5µM of CMP ID NO: 466_1 or CMP ID NO: 640_1 in 100µl medium containing 100pg/ml IL-12 and 5ng/ml IL-7 (Concanavalin stimulation was only applied at day 8). Four days later PD-L1 antisense oligonucleotide treatment was renewed with medium containing 50IU IL-2. At day 8 after the first stimulation the cells were re-stimulated with PepMix or 5µg/ml Concanavalin A plus PD-L1 antisense oligonucleotide for 24h. For the last 5h of the stimulation, 0.1µl Brefeldin A, 0.1µl Monensin and 3µl anti-human CD-107 (APC) were added.
  • After 24h the cells were washed with Stain Buffer (PBS + 1% BSA + 0.09% Sodium Azide + EDTA) and surface staining was applied for 30min at 4°C [anti-human CD3 (BV 605), anti-human CD4 (FITC), anti-human CD8 (BV711), anti-human PDL1 (BV421), anti-human PD1 (PerCP-Cy5.5) and Live and Dead stain (BV510) (BD Biosciences)]. Cells were fixed in BD Fixation Buffer for 15min at 4°C. The next morning, cells were permeabilized with BD Perm/Wash Buffer for 15min at 4°C and intracellular staining was done for 30min at 4°C [anti-human INFγ (PE)]. After washing in Perm/Wash Buffer cells were dissolved in 250µl stain buffer.
  • FACS measurement was performed on a BD Fortessa (BD Biosciences). For the analysis, the whole cell population was first gated on live cells (Live and Death stain, BV510), and then on CD3+ (BV605) cells. The CD3+ cells were then graphed as CD107a+ (APC) vs IFNγ+ (PE).
  • The results are shown in table 24. Table 24: Effect of PD-L1 ASO treatment on CD3+ T cell from PBMCs isolated from three chronically HBV infected patients.
    No antigen stimulation Envelope antigen Core antigen
    Saline CMP 466_1 CMP 640_1 Saline CMP 466_1 CMP 640_1 Saline CMP 466_1 CMP 640_1
    INFγ-/CD107+ 1.16 4.95 4.81 4.7 9.12 8.62 3.84 9.66 7.31
    2.7 3.59 2.74 2.57 3.69 3.2 3.25 3.34 2.92
    3 3.87 3.98 4.59 12.5 10.9 9.23 6.11 6.88
    INFγ+/CD107+ 0.12 1.03 1.15 3.19 17.3 18.9 2.38 15.1 5.75
    0.49 3.12 1.75 2.73 7 5.34 1.63 2.35 1.9
    0.24 1.13 1.5 1.6 8.16 3.06 1.68 1.9 1.91
    INFγ+/ CD107- 0.33 1.43 1.08 5.11 7.74 9.47 3.14 7.76 2.83
    0.61 2.9 2.26 7.84 5.79 5.78 2.33 2.82 2.95
    0.17 1.57 1.72 1.22 2.58 0.99 0.1 0.61 1.04
  • From these data it can be seen that the antigen stimulation by itself is capable of inducing T cell activation (increase % of CD3+ cells expressing INFγ and/or CD107a) in the PBMCs of CHB patients (n=3). The addition of PD-L1 antisense oligonucleotide CMP 466_1 or 640_1 resulted in an additional increase of CD3+ T cell response. This increase was mainly observed in the HBV envelop stimulated group.
    • SEQUENCE LISTING
    • <110> F. Hoffmann-La Roche AG
      Roche Innovation Center Copenhagen A/S
    • <120> OLIGONUCLEOTIDES FOR REDUCTION OF PD-L1 EXPRESSION
    • <130> P33358-WO
    • <160> 786
    • <170> PatentIn version 3.5
    • <210> 1
      <211> 20064
      <212> DNA
      <213> homo sapiens
    • <400> 1
      Figure imgb0006
      Figure imgb0007
      Figure imgb0008
      Figure imgb0009
      Figure imgb0010
      Figure imgb0011
      Figure imgb0012
      Figure imgb0013
      Figure imgb0014
      Figure imgb0015
      Figure imgb0016
    • <210> 2
      <211> 20261
      <212> DNA
      <213> macaca fascicularis
    • <400> 2
      Figure imgb0017
      Figure imgb0018
      Figure imgb0019
      Figure imgb0020
      Figure imgb0021
      Figure imgb0022
      Figure imgb0023
      Figure imgb0024
      Figure imgb0025
      Figure imgb0026
      Figure imgb0027
    • <210> 3
      <211> 20340
      <212> DNA
      <213> macaca fascicularis
    • <220>
      <221> misc_feature
      <222> (1658)..(1881)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (2742)..(2745)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (2747)..(2747)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (2749)..(2749)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (4764)..(4802)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (8775)..(8778)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (8980)..(8984)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (9161)..(9293)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (9344)..(9348)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (9840)..(9874)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (9958)..(9973)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (10437)..(10452)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (10603)..(10603)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (10830)..(10830)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (10989)..(11006)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (11105)..(11122)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (11457)..(11457)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (13710)..(13710)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (14015)..(14049)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (14518)..(14585)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (14689)..(14699)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (14707)..(14767)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (14837)..(14865)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (15703)..(15741)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (17403)..(17415)
      <223> n is a, c, g, or t
    • <220>
      <221> misc_feature
      <222> (19122)..(19135)
      <223> n is a, c, g, or t
    • <400> 3
      Figure imgb0028
      Figure imgb0029
      Figure imgb0030
      Figure imgb0031
      Figure imgb0032
      Figure imgb0033
      Figure imgb0034
      Figure imgb0035
      Figure imgb0036
      Figure imgb0037
      Figure imgb0038
      Figure imgb0039
    • <210> 4
      <211> 20641
      <212> DNA
      <213> mus musculus
    • <400> 4
      Figure imgb0040
      Figure imgb0041
      Figure imgb0042
      Figure imgb0043
      Figure imgb0044
      Figure imgb0045
      Figure imgb0046
      Figure imgb0047
      Figure imgb0048
      Figure imgb0049
      Figure imgb0050
      Figure imgb0051
    • <210> 5
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 5
      taattggctc tactgc   16
      <210> 6
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 6
      tcgcataaga atgact   16
    • <210> 7
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 7
      tgaacacaca gtcgca   16
    • <210> 8
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 8
      ctgaacacac agtcgc   16
    • <210> 9
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 9
      tctgaacaca cagtcg   16
    • <210> 10
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 10
      ttctgaacac acagtc   16
    • <210> 11
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 11
      acaagtcatg ttacta   16
    • <210> 12
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 12
      acacaagtca tgttac   16
    • <210> 13
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 13
      cttacttaga tgctgc   16
    • <210> 14
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 14
      acttacttag atgctg   16
    • <210> 15
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 15
      gacttactta gatgct   16
    • <210> 16
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 16
      agacttactt agatgc   16
    • <210> 17
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 17
      gcaggaagag acttac   16
    • <210> 18
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 18
      aataaattcc gttcagg   17
    • <210> 19
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 19
      gcaaataaat tccgtt   16
    • <210> 20
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 20
      agcaaataaa ttccgt   16
    • <210> 21
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 21
      cagagcaaat aaattcc   17
    • <210> 22
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 22
      tggacagagc aaataaat   18
    • <210> 23
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 23
      atggacagag caaata   16
    • <210> 24
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 24
      cagaatggac agagca   16
    • <210> 25
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 25
      ttctcagaat ggacag   16
    • <210> 26
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 26
      ctgaactttg acatag   16
    • <210> 27
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 27
      aagacaaacc cagactga   18
    • <210> 28
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 28
      tataagacaa acccagac   18
    • <210> 29
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 29
      ttataagaca aacccaga   18
    • <210> 30
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 30
      tgttataaga caaaccc   17
    • <210> 31
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 31
      tagaacaatg gtacttt   17
    • <210> 32
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 32
      gtagaacaat ggtact   16
    • <210> 33
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 33
      aggtagaaca atggta   16
    • <210> 34
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 34
      aagaggtaga acaatgg   17
    • <210> 35
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 35
      gcatccacag taaatt   16
    • <210> 36
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 36
      gaaggttatt taattc   16
    • <210> 37
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 37
      ctaatcgaat gcagca   16
    • <210> 38
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 38
      tacccaatct aatcga   16
    • <210> 39
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 39
      tagttaccca atctaa   16
    • <210> 40
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 40
      catttagtta cccaat   16
    • <210> 41
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 41
      tcatttagtt acccaa   16
    • <210> 42
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 42
      ttcatttagt taccca   16
    • <210> 43
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 43
      gaattaattt catttagt   18
    • <210> 44
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 44
      cagtgaggaa ttaattt   17
    • <210> 45
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 45
      ccaacagtga ggaatt   16
    • <210> 46
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 46
      cccaacagtg aggaat   16
    • <210> 47
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 47
      tatacccaac agtgagg   17
    • <210> 48
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 48
      ttatacccaa cagtgag   17
    • <210> 49
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 49
      tttataccca acagtga   17
    • <210> 50
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 50
      cctttatacc caacag   16
    • <210> 51
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 51
      taacctttat acccaa   16
    • <210> 52
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 52
      aataaccttt ataccca   17
    • <210> 53
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 53
      gtaaataacc tttata   16
    • <210> 54
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 54
      actgtaaata acctttat   18
    • <210> 55
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 55
      atatatatgc aatgag   16
    • <210> 56
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 56
      agatatatat gcaatg   16
    • <210> 57
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 57
      gagatatata tgcaat   16
    • <210> 58
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 58
      ccagagatat atatgc   16
    • <210> 59
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 59
      caatattcca gagatat   17
    • <210> 60
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 60
      gcaatattcc agagata   17
    • <210> 61
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 61
      agcaatattc cagagat   17
    • <210> 62
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 62
      cagcaatatt ccagag   16
    • <210> 63
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 63
      aatcagcaat attccag   17
    • <210> 64
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 64
      acaatcagca atattcc   17
    • <210> 65
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 65
      actaagtagt tacacttct   19
    • <210> 66
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 66
      ctaagtagtt acacttc   17
    • <210> 67
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 67
      gactaagtag ttacactt   18
    • <210> 68
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 68
      tgactaagta gttaca   16
    • <210> 69
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 69
      ctttgactaa gtagtta   17
    • <210> 70
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 70
      ctctttgact aagtag   16
    • <210> 71
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 71
      gctctttgac taagta   16
    • <210> 72
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 72
      ccttaaatac tgttgac   17
    • <210> 73
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 73
      cttaaatact gttgac   16
    • <210> 74
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 74
      tccttaaata ctgttg   16
    • <210> 75
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 75
      tctccttaaa tactgtt   17
    • <210> 76
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 76
      tatcatagtt ctcctt   16
    • <210> 77
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 77
      agtatcatag ttctcc   16
    • <210> 78
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 78
      gagtatcata gttctc   16
    • <210> 79
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 79
      agagtatcat agttct   16
    • <210> 80
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 80
      cagagtatca tagttc   16
    • <210> 81
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 81
      ttcagagtat catagt   16
    • <210> 82
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 82
      cttcagagta tcatag   16
    • <210> 83
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 83
      ttcttcagag tatcata   17
    • <210> 84
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 84
      tttcttcaga gtatcat   17
    • <210> 85
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 85
      gagaaaggct aagttt   16
    • <210> 86
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 86
      gacactcttg tacatt   16
    • <210> 87
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 87
      tgagacactc ttgtaca   17
    • <210> 88
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 88
      tgagacactc ttgtac   16
    • <210> 89
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 89
      ctttattaaa ctccat   16
    • <210> 90
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 90
      accaaacttt attaaa   16
    • <210> 91
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 91
      aaacctctac taagtg   16
    • <210> 92
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 92
      agattaagac agttga   16
    • <210> 93
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 93
      aagtaggagc aagaggc   17
    • <210> 94
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 94
      aaagtaggag caagagg   17
    • <210> 95
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 95
      gttaagcagc caggag   16
    • <210> 96
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 96
      agggtaggat gggtag   16
    • <210> 97
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 97
      aagggtagga tgggta   16
    • <210> 98
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 98
      caagggtagg atgggt   16
    • <210> 99
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 99
      ccaagggtag gatggg   16
    • <210> 100
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 100
      tccaagggta ggatgg   16
    • <210> 101
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 101
      cttccaaggg taggat   16
    • <210> 102
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 102
      atcttccaag ggtagga   17
    • <210> 103
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 103
      agaagtgatg gctcatt   17
    • <210> 104
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 104
      aagaagtgat ggctcat   17
    • <210> 105
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 105
      gaagaagtga tggctca   17
    • <210> 106
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 106
      atgaaatgta aactggg   17
    • <210> 107
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 107
      caatgaaatg taaactgg   18
    • <210> 108
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 108
      gcaatgaaat gtaaactg   18
    • <210> 109
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 109
      agcaatgaaa tgtaaact   18
    • <210> 110
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 110
      gagcaatgaa atgtaaac   18
    • <210> 111
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 111
      tgaattccca tatccga   17
    • <210> 112
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 112
      agaattatga ccatat   16
    • <210> 113
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 113
      aggtaagaat tatgacc   17
    • <210> 114
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 114
      tcaggtaaga attatgac   18
    • <210> 115
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 115
      cttcaggtaa gaattatg   18
    • <210> 116
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 116
      tcttcaggta agaatta   17
    • <210> 117
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 117
      cttcttcagg taagaat   17
    • <210> 118
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 118
      tcttcttcag gtaagaa   17
    • <210> 119
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 119
      tcttcttcag gtaaga   16
    • <210> 120
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 120
      tggtctaaga gaagaag   17
    • <210> 121
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 121
      gttggtctaa gagaag   16
    • <210> 122
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 122
      agttggtcta agagaa   16
    • <210> 123
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 123
      cagttggtct aagagaa   17
    • <210> 124
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 124
      gcagttggtc taagagaa   18
    • <210> 125
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 125
      cagttggtct aagaga   16
    • <210> 126
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 126
      gcagttggtc taagaga   17
    • <210> 127
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 127
      gcagttggtc taagag   16
    • <210> 128
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 128
      ctcatatcag ggcagt   16
    • <210> 129
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 129
      cacacatgtt ctttaac   17
    • <210> 130
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 130
      taaatacaca catgttct   18
    • <210> 131
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 131
      gtaaatacac acatgttc   18
    • <210> 132
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 132
      tgtaaataca cacatgtt   18
    • <210> 133
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 133
      gatcatgtaa atacacac   18
    • <210> 134
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 134
      agatcatgta aatacaca   18
    • <210> 135
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 135
      caaagatcat gtaaatacac   20
    • <210> 136
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 136
      acaaagatca tgtaaataca   20
    • <210> 137
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 137
      gaatacaaag atcatgta   18
    • <210> 138
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 138
      agaatacaaa gatcatgt   18
    • <210> 139
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 139
      cagaatacaa agatcatg   18
    • <210> 140
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 140
      gcagaataca aagatca   17
    • <210> 141
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 141
      aggcagaata caaagat   17
    • <210> 142
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 142
      aaggcagaat acaaaga   17
    • <210> 143
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 143
      attagtgagg gacgaa   16
    • <210> 144
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 144
      cattagtgag ggacga   16
    • <210> 145
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 145
      gagggtgatg gattag   16
    • <210> 146
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 146
      ttaggagtaa taaagg   16
    • <210> 147
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 147
      ttaatgaatt tggttg   16
    • <210> 148
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 148
      ctttaatgaa tttggt   16
    • <210> 149
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 149
      catggattac aactaa   16
    • <210> 150
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 150
      tcatggatta caacta   16
    • <210> 151
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 151
      gtcatggatt acaact   16
    • <210> 152
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 152
      cattaaatct agtcat   16
    • <210> 153
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 153
      gacattaaat ctagtca   17
    • <210> 154
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 154
      agggacatta aatcta   16
    • <210> 155
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 155
      caaagcatta taacca   16
    • <210> 156
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 156
      acttactagg cagaag   16
    • <210> 157
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 157
      cagagttaac tgtaca   16
    • <210> 158
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 158
      ccagagttaa ctgtac   16
    • <210> 159
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 159
      gccagagtta actgta   16
    • <210> 160
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 160
      tgggccagag ttaact   16
    • <210> 161
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 161
      cagcatctat cagact   16
    • <210> 162
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 162
      tgaaataaca tgagtcat   18
    • <210> 163
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 163
      gtgaaataac atgagtc   17
    • <210> 164
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 164
      tctgtttatg tcactg   16
    • <210> 165
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 165
      gtctgtttat gtcact   16
    • <210> 166
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 166
      tggtctgttt atgtca   16
    • <210> 167
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 167
      ttggtctgtt tatgtc   16
    • <210> 168
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 168
      tcacccattg tttaaa   16
    • <210> 169
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 169
      ttcagcaaat attcgt   16
    • <210> 170
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 170
      gtgtgttcag caaatat   17
    • <210> 171
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 171
      tctattgtta ggtatc   16
    • <210> 172
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 172
      attgcccatc ttactg   16
    • <210> 173
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 173
      tattgcccat cttact   16
    • <210> 174
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 174
      aaatattgcc catctt   16
    • <210> 175
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 175
      ataaccttat cataca   16
    • <210> 176
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 176
      tataacctta tcatac   16
    • <210> 177
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 177
      ttataacctt atcata   16
    • <210> 178
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 178
      tttataacct tatcat   16
    • <210> 179
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 179
      actgctattg ctatct   16
    • <210> 180
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 180
      aggactgcta ttgcta   16
    • <210> 181
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 181
      gaggactgct attgct   16
    • <210> 182
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 182
      acgtagaata ataaca   16
    • <210> 183
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 183
      ccaagtgata taatgg   16
    • <210> 184
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 184
      ttagcagacc aagtga   16
    • <210> 185
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 185
      gtttagcaga ccaagt   16
    • <210> 186
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 186
      tgacagtgat tatatt   16
    • <210> 187
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 187
      tgtccaagat attgac   16
    • <210> 188
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 188
      gaatatccta gattgt   16
    • <210> 189
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 189
      caaactgaga atatcc   16
    • <210> 190
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 190
      gcaaactgag aatatc   16
    • <210> 191
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 191
      tcctattaca atcgta   16
    • <210> 192
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 192
      ttcctattac aatcgt   16
    • <210> 193
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 193
      actaatggga ggattt   16
    • <210> 194
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 194
      tagttcagag aataag   16
    • <210> 195
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 195
      taacatatag ttcaga   16
    • <210> 196
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 196
      ataacatata gttcag   16
    • <210> 197
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 197
      cataacatat agttca   16
    • <210> 198
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 198
      tcataacata tagttc   16
    • <210> 199
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 199
      tagctcctaa caatca   16
    • <210> 200
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 200
      ctccaatctt tgtata   16
    • <210> 201
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 201
      tctccaatct ttgtat   16
    • <210> 202
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 202
      tctatttcag ccaatc   16
    • <210> 203
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 203
      cggaagtcag agtgaa   16
    • <210> 204
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 204
      ttaagcatga ggaata   16
    • <210> 205
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 205
      tgattgagca cctctt   16
    • <210> 206
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 206
      gactaattat ttcgtt   16
    • <210> 207
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 207
      tgactaatta tttcgt   16
    • <210> 208
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 208
      gtgactaatt atttcg   16
    • <210> 209
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 209
      ctgcttgaaa tgtgac   16
    • <210> 210
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 210
      cctgcttgaa atgtga   16
    • <210> 211
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 211
      atcctgcttg aaatgt   16
    • <210> 212
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 212
      attataaatc tattct   16
    • <210> 213
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 213
      gctaaatact ttcatc   16
    • <210> 214
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 214
      cattgtaaca taccta   16
    • <210> 215
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 215
      gcattgtaac atacct   16
    • <210> 216
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 216
      taatattgca ccaaat   16
    • <210> 217
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 217
      gataatattg caccaa   16
    • <210> 218
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 218
      agataatatt gcacca   16
    • <210> 219
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 219
      gccaagaaga taatat   16
    • <210> 220
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 220
      cacagccaca taaact   16
    • <210> 221
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 221
      ttgtaattgt ggaaac   16
    • <210> 222
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 222
      tgacttgtaa ttgtgg   16
    • <210> 223
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 223
      tctaactgaa atagtc   16
    • <210> 224
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 224
      gtggttctaa ctgaaa   16
    • <210> 225
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 225
      caatatggga cttggt   16
    • <210> 226
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 226
      atgacaatat gggact   16
    • <210> 227
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 227
      tatgacaata tgggac   16
    • <210> 228
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 228
      atatgacaat atggga   16
    • <210> 229
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 229
      cttcacttaa taatta   16
    • <210> 230
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 230
      ctgcttcact taataa   16
    • <210> 231
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 231
      aagactgctt cactta   16
    • <210> 232
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 232
      gaatgcccta attatg   16
    • <210> 233
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 233
      tggaatgccc taatta   16
    • <210> 234
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 234
      gcaaatgcca gtaggt   16
    • <210> 235
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 235
      ctaatggaag gatttg   16
    • <210> 236
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 236
      aatatagaac ctaatg   16
    • <210> 237
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 237
      gaaagaatag aatgtt   16
    • <210> 238
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 238
      atgggtaata gattat   16
    • <210> 239
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 239
      gaaagagcac agggtg   16
    • <210> 240
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 240
      ctacatagag ggaatg   16
    • <210> 241
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 241
      gcttcctaca tagagg   16
    • <210> 242
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 242
      tgcttcctac atagag   16
    • <210> 243
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 243
      tgggcttgaa atatgt   16
    • <210> 244
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 244
      cattatattt aagaac   16
    • <210> 245
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 245
      tcggttatgt tatcat   16
    • <210> 246
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 246
      cactttatct ggtcgg   16
    • <210> 247
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 247
      aaattggcac agcgtt   16
    • <210> 248
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 248
      accgtgacag taaatg   16
    • <210> 249
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 249
      tgggaaccgt gacagta   17
    • <210> 250
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 250
      ccacatatag gtcctt   16
    • <210> 251
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 251
      catattgcta ccatac   16
    • <210> 252
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 252
      tcatattgct accata   16
    • <210> 253
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 253
      caattgtcat attgct   16
    • <210> 254
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 254
      cattcaattg tcatattg   18
    • <210> 255
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 255
      tttctactgg gaatttg   17
    • <210> 256
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 256
      caattagtgc agccag   16
    • <210> 257
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 257
      gaataatgtt cttatcc   17
    • <210> 258
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 258
      cacaaattga ataatgttct   20
    • <210> 259
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 259
      catgcacaaa ttgaataat   19
    • <210> 260
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 260
      atcctgcaat ttcacat   17
    • <210> 261
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 261
      ccaccatagc tgatca   16
    • <210> 262
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 262
      accaccatag ctgatca   17
    • <210> 263
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 263
      caccaccata gctgatc   17
    • <210> 264
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 264
      tagtcggcac caccat   16
    • <210> 265
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 265
      cttgtagtcg gcaccac   17
    • <210> 266
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 266
      cttgtagtcg gcacca   16
    • <210> 267
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 267
      cgcttgtagt cggcac   16
    • <210> 268
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 268
      tcaataaaga tcaggc   16
    • <210> 269
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 269
      tggacttaca agaatg   16
    • <210> 270
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 270
      atggacttac aagaat   16
    • <210> 271
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 271
      gctcaagaaa ttggat   16
    • <210> 272
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 272
      tactgtagaa catggc   16
    • <210> 273
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 273
      gcaattcatt tgatct   16
    • <210> 274
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 274
      tgaagggagg agggacac   18
    • <210> 275
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 275
      agtggtgaag ggaggag   17
    • <210> 276
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 276
      tagtggtgaa gggaggag   18
    • <210> 277
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 277
      atagtggtga agggaggag   19
    • <210> 278
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 278
      tagtggtgaa gggagga   17
    • <210> 279
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 279
      atagtggtga agggagga   18
    • <210> 280
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 280
      tagtggtgaa gggagg   16
    • <210> 281
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 281
      atagtggtga agggagg   17
    • <210> 282
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 282
      gatagtggtg aagggagg   18
    • <210> 283
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 283
      atagtggtga agggag   16
    • <210> 284
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 284
      gatagtggtg aagggag   17
    • <210> 285
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 285
      gagatagtgg tgaagg   16
    • <210> 286
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 286
      catgggagat agtggt   16
    • <210> 287
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 287
      acaaataatg gttactct   18
    • <210> 288
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 288
      acacacaaat aatggtta   18
    • <210> 289
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 289
      gagggacaca caaataat   18
    • <210> 290
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 290
      atatagagag gctcaa   16
    • <210> 291
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 291
      ttgatataga gaggct   16
    • <210> 292
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 292
      gcatttgata tagaga   16
    • <210> 293
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 293
      tttgcatttg atatag   16
    • <210> 294
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 294
      ctggaagaat aggttc   16
    • <210> 295
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 295
      actggaagaa taggtt   16
    • <210> 296
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 296
      tactggaaga ataggt   16
    • <210> 297
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 297
      tggcttatcc tgtact   16
    • <210> 298
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 298
      atggcttatc ctgtac   16
    • <210> 299
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 299
      tatggcttat cctgta   16
    • <210> 300
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 300
      gtatggctta tcctgt   16
    • <210> 301
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 301
      atgaatatat gcccagt   17
    • <210> 302
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 302
      gatgaatata tgccca   16
    • <210> 303
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 303
      caagatgaat atatgcc   17
    • <210> 304
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 304
      gacaacatca gtataga   17
    • <210> 305
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 305
      caagacaaca tcagta   16
    • <210> 306
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 306
      cactcctagt tccttt   16
    • <210> 307
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 307
      aacactccta gttcct   16
    • <210> 308
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 308
      taacactcct agttcc   16
    • <210> 309
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 309
      ctaacactcc tagttc   16
    • <210> 310
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 310
      tgataacata actgtg   16
    • <210> 311
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 311
      ctgataacat aactgt   16
    • <210> 312
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 312
      tttgaactca agtgac   16
    • <210> 313
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 313
      tcctttactt agctag   16
    • <210> 314
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 314
      gagtttggat tagctg   16
    • <210> 315
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 315
      tgggatatga caggga   16
    • <210> 316
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 316
      tgtgggatat gacagg   16
    • <210> 317
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 317
      atatggaagg gatatc   16
    • <210> 318
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 318
      acaggatatg gaaggg   16
    • <210> 319
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 319
      atttcaacag gatatgg   17
    • <210> 320
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 320
      gagtaatttc aacagg   16
    • <210> 321
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 321
      agggagtaat ttcaaca   17
    • <210> 322
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 322
      attagggagt aatttca   17
    • <210> 323
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 323
      cttactatta gggagt   16
    • <210> 324
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 324
      cagcttacta ttaggg   16
    • <210> 325
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 325
      tcagcttact attagg   16
    • <210> 326
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 326
      atttcagctt actattag   18
    • <210> 327
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 327
      ttcagcttac tattag   16
    • <210> 328
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 328
      cagatttcag cttact   16
    • <210> 329
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 329
      gactacaact agaggg   16
    • <210> 330
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 330
      agactacaac tagagg   16
    • <210> 331
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 331
      aagactacaa ctagag   16
    • <210> 332
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 332
      atgatttaat tctagtcaaa   20
    • <210> 333
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 333
      tttaattcta gtcaaa   16
    • <210> 334
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 334
      gatttaattc tagtca   16
    • <210> 335
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 335
      atgatttaat tctagtca   18
    • <210> 336
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 336
      gatgatttaa ttctagtca   19
    • <210> 337
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 337
      gatttaattc tagtca   16
    • <210> 338
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 338
      gatgatttaa ttctagtc   18
    • <210> 339
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 339
      tgatttaatt ctagtc   16
    • <210> 340
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 340
      gagatgattt aattcta   17
    • <210> 341
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 341
      gagatgattt aattct   16
    • <210> 342
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 342
      cagattgatg gtagtt   16
    • <210> 343
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 343
      ctcagattga tggtag   16
    • <210> 344
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 344
      gttagccctc agattg   16
    • <210> 345
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 345
      tgtattgtta gccctc   16
    • <210> 346
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 346
      acttgtattg ttagcc   16
    • <210> 347
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 347
      agccagtatc agggac   16
    • <210> 348
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 348
      ttgacaatag tggcat   16
    • <210> 349
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 349
      acaagtggta tcttct   16
    • <210> 350
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 350
      aatctacttt acaagt   16
    • <210> 351
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 351
      cacagtagat gcctgata   18
    • <210> 352
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 352
      gaacacagta gatgcc   16
    • <210> 353
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 353
      cttggaacac agtagat   17
    • <210> 354
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 354
      atatcttgga acacag   16
    • <210> 355
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 355
      tctttaatat cttggaac   18
    • <210> 356
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 356
      tgatttcttt aatatcttg   19
    • <210> 357
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 357
      tgatgatttc tttaatatc   19
    • <210> 358
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 358
      aggctaagtc atgatg   16
    • <210> 359
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 359
      ttgatgaggc taagtc   16
    • <210> 360
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 360
      ccaggattat actctt   16
    • <210> 361
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 361
      gccaggatta tactct   16
    • <210> 362
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 362
      ctgccaggat tatact   16
    • <210> 363
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 363
      cagaaactta tactttatg   19
    • <210> 364
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 364
      aagcagaaac ttatact   17
    • <210> 365
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 365
      gaagcagaaa cttatact   18
    • <210> 366
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 366
      tggaagcaga aacttatact   20
    • <210> 367
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 367
      tggaagcaga aacttatac   19
    • <210> 368
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 368
      aagcagaaac ttatac   16
    • <210> 369
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 369
      tggaagcaga aacttata   18
    • <210> 370
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 370
      aagggatatt atggag   16
    • <210> 371
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 371
      tgccggaaga tttcct   16
    • <210> 372
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 372
      atggattggg agtaga   16
    • <210> 373
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 373
      agatggattg ggagta   16
    • <210> 374
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 374
      aagatggatt gggagt   16
    • <210> 375
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 375
      acaagatgga ttggga   16
    • <210> 376
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 376
      agaaggttca gacttt   16
    • <210> 377
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 377
      gcagaaggtt cagact   16
    • <210> 378
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 378
      tgcagaaggt tcagac   16
    • <210> 379
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 379
      agtgcagaag gttcag   16
    • <210> 380
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 380
      aagtgcagaa ggttca   16
    • <210> 381
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 381
      taagtgcaga aggttc   16
    • <210> 382
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 382
      tctaagtgca gaaggt   16
    • <210> 383
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 383
      ctcaggagtt ctacttc   17
    • <210> 384
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 384
      ctcaggagtt ctactt   16
    • <210> 385
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 385
      atggaggtga ctcaggag   18
    • <210> 386
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 386
      atggaggtga ctcagga   17
    • <210> 387
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 387
      atggaggtga ctcagg   16
    • <210> 388
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 388
      tatggaggtg actcagg   17
    • <210> 389
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 389
      atatggaggt gactcagg   18
    • <210> 390
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 390
      tatggaggtg actcag   16
    • <210> 391
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 391
      atatggaggt gactcag   17
    • <210> 392
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 392
      catatggagg tgactcag   18
    • <210> 393
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 393
      atatggaggt gactca   16
    • <210> 394
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 394
      catatggagg tgactca   17
    • <210> 395
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 395
      catatggagg tgactc   16
    • <210> 396
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 396
      gcatatggag gtgactc   17
    • <210> 397
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 397
      tgcatatgga ggtgactc   18
    • <210> 398
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 398
      ttgcatatgg aggtgactc   19
    • <210> 399
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 399
      tttgcatatg gaggtgactc   20
    • <210> 400
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 400
      gcatatggag gtgact   16
    • <210> 401
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 401
      tgcatatgga ggtgact   17
    • <210> 402
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 402
      ttgcatatgg aggtgact   18
    • <210> 403
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 403
      tttgcatatg gaggtgact   19
    • <210> 404
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 404
      tgcatatgga ggtgac   16
    • <210> 405
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 405
      ttgcatatgg aggtgac   17
    • <210> 406
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 406
      tttgcatatg gaggtgac   18
    • <210> 407
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 407
      tttgcatatg gaggtga   17
    • <210> 408
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 408
      tttgcatatg gaggtg   16
    • <210> 409
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 409
      aagtgaagtt caacagc   17
    • <210> 410
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 410
      tgggaagtga agttca   16
    • <210> 411
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 411
      atgggaagtg aagttc   16
    • <210> 412
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 412
      gatgggaagt gaagtt   16
    • <210> 413
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 413
      ctgtgatggg aagtgaa   17
    • <210> 414
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 414
      attgagtgaa tccaaa   16
    • <210> 415
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 415
      aattgagtga atccaa   16
    • <210> 416
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 416
      gataattgag tgaatcc   17
    • <210> 417
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 417
      gtgataattg agtgaa   16
    • <210> 418
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 418
      aagaaaggtg caataa   16
    • <210> 419
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 419
      caagaaaggt gcaata   16
    • <210> 420
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 420
      acaagaaagg tgcaat   16
    • <210> 421
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 421
      atttaaactc acaaac   16
    • <210> 422
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 422
      ctgttaggtt cagcga   16
    • <210> 423
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 423
      tctgaatgaa catttcg   17
    • <210> 424
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 424
      ctcattgaag gttctg   16
    • <210> 425
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 425
      ctaatctcat tgaagg   16
    • <210> 426
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 426
      cctaatctca ttgaag   16
    • <210> 427
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 427
      actttgatct ttcagc   16
    • <210> 428
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 428
      actatgcaac actttg   16
    • <210> 429
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 429
      caaatagctt tatcgg   16
    • <210> 430
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 430
      ccaaatagct ttatcg   16
    • <210> 431
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 431
      tccaaatagc tttatc   16
    • <210> 432
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 432
      gatccaaata gcttta   16
    • <210> 433
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 433
      atgatccaaa tagctt   16
    • <210> 434
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 434
      tatgatccaa atagct   16
    • <210> 435
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 435
      taaacagggc tgggaat   17
    • <210> 436
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 436
      acttaaacag ggctgg   16
    • <210> 437
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 437
      acacttaaac agggct   16
    • <210> 438
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 438
      gaacacttaa acaggg   16
    • <210> 439
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 439
      agagaacact taaacag   17
    • <210> 440
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 440
      ctacagagaa cactta   16
    • <210> 441
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 441
      atgctacaga gaacact   17
    • <210> 442
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 442
      ataaatgcta cagagaaca   19
    • <210> 443
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 443
      agataaatgc tacagaga   18
    • <210> 444
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 444
      tagagataaa tgctaca   17
    • <210> 445
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 445
      tagatagaga taaatgct   18
    • <210> 446
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 446
      caatatacta gatagaga   18
    • <210> 447
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 447
      tacacaatat actagatag   19
    • <210> 448
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 448
      ctacacaata tactag   16
    • <210> 449
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 449
      gctacacaat atacta   16
    • <210> 450
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 450
      atatgctaca caatatac   18
    • <210> 451
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 451
      tgatatgcta cacaat   16
    • <210> 452
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 452
      atgatatgat atgctac   17
    • <210> 453
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 453
      gaggagagag acaataaa   18
    • <210> 454
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 454
      ctaggaggag agagaca   17
    • <210> 455
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 455
      tattctagga ggagaga   17
    • <210> 456
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 456
      ttatattcta ggaggag   17
    • <210> 457
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 457
      gtttatattc taggag   16
    • <210> 458
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 458
      tggagtttat attctagg   18
    • <210> 459
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 459
      cgtaccacca ctctgc   16
    • <210> 460
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 460
      tgaggaaatc attcattc   18
    • <210> 461
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 461
      tttgaggaaa tcattcat   18
    • <210> 462
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 462
      aggctaatcc tatttg   16
    • <210> 463
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 463
      tttaggctaa tcctat   16
    • <210> 464
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 464
      tgctccagtg taccct   16
    • <210> 465
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 465
      tagtagtact cgatag   16
    • <210> 466
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 466
      ctaattgtag tagtactc   18
    • <210> 467
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 467
      tgctaattgt agtagt   16
    • <210> 468
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 468
      agtgctaatt gtagta   16
    • <210> 469
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 469
      gcaagtgcta attgta   16
    • <210> 470
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 470
      gaggaaatga actaattta   19
    • <210> 471
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 471
      caggaggaaa tgaacta   17
    • <210> 472
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 472
      ccctagagtc atttcc   16
    • <210> 473
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 473
      atcttacatg atgaagc   17
    • <210> 474
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 474
      gacacactca gatttcag   18
    • <210> 475
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 475
      agacacactc agatttcag   19
    • <210> 476
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 476
      aagacacact cagatttcag   20
    • <210> 477
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 477
      agacacactc agatttca   18
    • <210> 478
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 478
      aagacacact cagatttca   19
    • <210> 479
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 479
      aaagacacac tcagatttca   20
    • <210> 480
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 480
      gaaagacaca ctcagatttc   20
    • <210> 481
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 481
      aagacacact cagatttc   18
    • <210> 482
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 482
      aaagacacac tcagatttc   19
    • <210> 483
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 483
      tgaaagacac actcagattt   20
    • <210> 484
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 484
      tgaaagacac actcagatt   19
    • <210> 485
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 485
      tgaaagacac actcagat   18
    • <210> 486
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 486
      attgaaagac acactca   17
    • <210> 487
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 487
      tcattgaaag acacact   17
    • <210> 488
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 488
      ttccatcatt gaaaga   16
    • <210> 489
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 489
      ataataccac ttatcat   17
    • <210> 490
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 490
      ttacttaatt tctttgga   18
    • <210> 491
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 491
      ttagaactag ctttatca   18
    • <210> 492
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 492
      gaggtacaaa tatagg   16
    • <210> 493
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 493
      cttatgatac aactta   16
    • <210> 494
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 494
      tcttatgata caactt   16
    • <210> 495
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 495
      ttcttatgat acaact   16
    • <210> 496
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 496
      cagtttctta tgatac   16
    • <210> 497
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 497
      gcagtttctt atgata   16
    • <210> 498
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 498
      tacaaatgtc tattaggtt   19
    • <210> 499
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 499
      tgtacaaatg tctattag   18
    • <210> 500
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 500
      agcatcacaa ttagta   16
    • <210> 501
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 501
      ctaatgatag tgaagc   16
    • <210> 502
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 502
      agctaatgat agtgaa   16
    • <210> 503
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 503
      atgccttgac atatta   16
    • <210> 504
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 504
      ctcaagatta ttgacac   17
    • <210> 505
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 505
      acctcaagat tattga   16
    • <210> 506
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 506
      aacctcaaga ttattg   16
    • <210> 507
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 507
      cacaaacctc aagattatt   19
    • <210> 508
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 508
      gtacttaatt agacct   16
    • <210> 509
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 509
      agtacttaat tagacc   16
    • <210> 510
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 510
      gtatgaggtg gtaaac   16
    • <210> 511
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 511
      aggaaacagc agaagtg   17
    • <210> 512
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 512
      gcacaaccca gaggaa   16
    • <210> 513
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 513
      caagcacaac ccagag   16
    • <210> 514
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 514
      ttcaagcaca acccag   16
    • <210> 515
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 515
      aattcaagca caaccc   16
    • <210> 516
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 516
      taataattca agcacaacc   19
    • <210> 517
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 517
      actaataatt caagcac   17
    • <210> 518
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 518
      ataatactaa taattcaagc   20
    • <210> 519
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 519
      tagatttgtg aggtaa   16
    • <210> 520
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 520
      agccttaatt ctccat   16
    • <210> 521
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 521
      aatgatctag agcctta   17
    • <210> 522
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 522
      ctaatgatct agagcc   16
    • <210> 523
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 523
      actaatgatc tagagc   16
    • <210> 524
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 524
      cattaacatg ttcttatt   18
    • <210> 525
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 525
      acaagtacat taacatgttc   20
    • <210> 526
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 526
      ttacaagtac attaacatg   19
    • <210> 527
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 527
      gctttattca tgtttat   17
    • <210> 528
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 528
      gctttattca tgttta   16
    • <210> 529
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 529
      agagctttat tcatgttt   18
    • <210> 530
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 530
      ataagagctt tattcatg   18
    • <210> 531
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 531
      cataagagct ttattca   17
    • <210> 532
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 532
      agcataagag ctttat   16
    • <210> 533
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 533
      tagattgttt agtgca   16
    • <210> 534
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 534
      gtagattgtt tagtgc   16
    • <210> 535
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 535
      gacaattcta gtagatt   17
    • <210> 536
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 536
      ctgacaattc tagtag   16
    • <210> 537
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 537
      gctgacaatt ctagta   16
    • <210> 538
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 538
      aggattaaga tacgta   16
    • <210> 539
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 539
      caggattaag atacgt   16
    • <210> 540
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 540
      tcaggattaa gatacg   16
    • <210> 541
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> a41
      ttcaggatta agatac   16
    • <210> 542
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 542
      aggaagaaag tttgattc   18
    • <210> 543
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 543
      tcaaggaaga aagtttga   18
    • <210> 544
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 544
      ctcaaggaag aaagtttg   18
    • <210> 545
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 545
      tgctcaagga agaaagt   17
    • <210> 546
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 546
      aattatgctc aaggaaga   18
    • <210> 547
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 547
      taggatacca cattatga   18
    • <210> 548
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 548
      cataatttat tccattcctc   20
    • <210> 549
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 549
      tgcataattt attccat   17
    • <210> 550
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 550
      actgcataat ttattcc   17
    • <210> 551
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 551
      ctaaactgca taatttatt   19
    • <210> 552
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 552
      ataactaaac tgcata   16
    • <210> 553
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 553
      ttattaataa ctaaactgc   19
    • <210> 554
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 554
      tagtacatta ttaataact   19
    • <210> 555
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 555
      cataactaag gacgtt   16
    • <210> 556
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 556
      tcataactaa ggacgt   16
    • <210> 557
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 557
      cgtcataact aaggac   16
    • <210> 558
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 558
      tcgtcataac taagga   16
    • <210> 559
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 559
      atcgtcataa ctaagg   16
    • <210> 560
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 560
      gttagtatct tacatt   16
    • <210> 561
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 561
      ctctattgtt agtatc   16
    • <210> 562
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 562
      agtatagagt tactgt   16
    • <210> 563
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 563
      ttcctggtga tacttt   16
    • <210> 564
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 564
      gttcctggtg atactt   16
    • <210> 565
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 565
      tgttcctggt gatact   16
    • <210> 566
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 566
      ataaacatga atctctcc   18
    • <210> 567
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 567
      ctttataaac atgaatctc   19
    • <210> 568
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 568
      ctgtctttat aaacatg   17
    • <210> 569
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 569
      ttgttataaa tctgtctt   18
    • <210> 570
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 570
      ttaaatttat tcttggata   19
    • <210> 571
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 571
      cttaaattta ttcttgga   18
    • <210> 572
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 572
      cttcttaaat ttattcttg   19
    • <210> 573
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 573
      tatgtttctc agtaaag   17
    • <210> 574
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 574
      gaattatctt taaacca   17
    • <210> 575
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 575
      cccttaaatt tctaca   16
    • <210> 576
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 576
      acactgctct tgtacc   16
    • <210> 577
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 577
      tgacaacact gctctt   16
    • <210> 578
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 578
      tacatttatt gggctc   16
    • <210> 579
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 579
      gtacatttat tgggct   16
    • <210> 580
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 580
      ttggtacatt tattgg   16
    • <210> 581
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 581
      catgttggta catttat   17
    • <210> 582
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 582
      aatcatgttg gtacat   16
    • <210> 583
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 583
      aaatcatgtt ggtaca   16
    • <210> 584
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 584
      gacaagtttg gattaa   16
    • <210> 585
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 585
      aatgttcaga tgcctc   16
    • <210> 586
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 586
      gcttaatgtt cagatg   16
    • <210> 587
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 587
      cgtacatagc ttgatg   16
    • <210> 588
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 588
      gtgaggaatt aggata   16
    • <210> 589
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 589
      gtaacaatat ggtttg   16
    • <210> 590
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 590
      gaaatattgt agacta   16
    • <210> 591
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 591
      ttgaaatatt gtagac   16
    • <210> 592
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 592
      aagtctagta atttgc   16
    • <210> 593
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 593
      gctcagtaga ttataa   16
    • <210> 594
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 594
      catacactgt tgctaa   16
    • <210> 595
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 595
      atggtctcaa atcatt   16
    • <210> 596
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 596
      caatggtctc aaatca   16
    • <210> 597
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 597
      ttcctattga ttgact   16
    • <210> 598
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 598
      tttctgttca caacac   16
    • <210> 599
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 599
      aggaacccac taatct   16
    • <210> 600
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 600
      taaatggcag gaaccc   16
    • <210> 601
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 601
      gtaaatggca ggaacc   16
    • <210> 602
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 602
      ttgtaaatgg caggaa   16
    • <210> 603
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 603
      ttatgagtta ggcatg   16
    • <210> 604
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 604
      ccaggtgaaa ctttaa   16
    • <210> 605
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 605
      cccttagtca gctcct   16
    • <210> 606
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 606
      acccttagtc agctcc   16
    • <210> 607
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 607
      cacccttagt cagctc   16
    • <210> 608
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 608
      tctcttacta ggctcc   16
    • <210> 609
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 609
      cctatctgtc atcatg   16
    • <210> 610
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 610
      tcctatctgt catcat   16
    • <210> 611
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 611
      gagaagtgtg agaagc   16
    • <210> 612
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 612
      catccttgaa gtttag   16
    • <210> 613
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 613
      taataagatg gctccc   16
    • <210> 614
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 614
      caaggcataa taagat   16
    • <210> 615
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 615
      ccaaggcata ataaga   16
    • <210> 616
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 616
      tgatccaatt ctcacc   16
    • <210> 617
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 617
      atgatccaat tctcac   16
    • <210> 618
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 618
      cgcttcatct tcaccc   16
    • <210> 619
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 619
      tatgacactg catctt   16
    • <210> 620
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 620
      gtatgacact gcatct   16
    • <210> 621
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 621
      tgtatgacac tgcatc   16
    • <210> 622
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 622
      ttctcttctg taagtc   16
    • <210> 623
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 623
      ttctacagag gaacta   16
    • <210> 624
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 624
      actacagttc tacaga   16
    • <210> 625
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 625
      ttcccacagg taaatg   16
    • <210> 626
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 626
      attatttgaa tatactcatt   20
    • <210> 627
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 627
      tgggaggaaa ttatttg   17
    • <210> 628
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 628
      tgactcatct taaatg   16
    • <210> 629
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 629
      ctgactcatc ttaaat   16
    • <210> 630
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 630
      tttactctga ctcatc   16
    • <210> 631
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 631
      tattggagga attatt   16
    • <210> 632
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 632
      gtattggagg aattat   16
    • <210> 633
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 633
      tggtatactt ctctaagtat   20
    • <210> 634
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 634
      gatctcttgg tatact   16
    • <210> 635
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 635
      cagacaactc tatacc   16
    • <210> 636
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 636
      aacatcagac aactcta   17
    • <210> 637
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 637
      tttaacatca gacaactc   18
    • <210> 638
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 638
      taacatcaga caactc   16
    • <210> 639
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 639
      atttaacatc agacaa   16
    • <210> 640
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 640
      cctatttaac atcagac   17
    • <210> 641
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 641
      tccctattta acatca   16
    • <210> 642
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 642
      tcaacgacta ttggaat   17
    • <210> 643
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 643
      cttatattct ggctat   16
    • <210> 644
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 644
      atccttatat tctggc   16
    • <210> 645
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 645
      gatccttata ttctgg   16
    • <210> 646
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 646
      tgatccttat attctg   16
    • <210> 647
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 647
      attgaaactt gatcct   16
    • <210> 648
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 648
      actgtcattg aaactt   16
    • <210> 649
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 649
      tcttactgtc attgaa   16
    • <210> 650
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 650
      aggatcttac tgtcatt   17
    • <210> 651
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 651
      gcaaatcaac tccatc   16
    • <210> 652
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 652
      gtgcaaatca actcca   16
    • <210> 653
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 653
      caattatttc tttgtgc   17
    • <210> 654
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 654
      tggcaacaat tatttctt   18
    • <210> 655
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 655
      gctggcaaca attatt   16
    • <210> 656
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 656
      atccatttct actgcc   16
    • <210> 657
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 657
      taatatctat tgatttcta   19
    • <210> 658
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 658
      tcaatagtgt agggca   16
    • <210> 659
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 659
      ttcaatagtg tagggc   16
    • <210> 660
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 660
      aggttaatta attcaatag   19
    • <210> 661
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 661
      catttgtaat ccctag   16
    • <210> 662
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 662
      acatttgtaa tcccta   16
    • <210> 663
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 663
      aacatttgta atccct   16
    • <210> 664
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 664
      taaatttcaa gttctg   16
    • <210> 665
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 665
      gtttaaattt caagttct   18
    • <210> 666
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 666
      ccaagtttaa atttcaag   18
    • <210> 667
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 667
      acccaagttt aaatttc   17
    • <210> 668
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 668
      catacagtga cccaagttt   19
    • <210> 669
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 669
      acatcccata cagtga   16
    • <210> 670
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 670
      agcacagctc tacatc   16
    • <210> 671
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 671
      atatagcaca gctcta   16
    • <210> 672
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 672
      tccatatagc acagct   16
    • <210> 673
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 673
      atttccatat agcaca   16
    • <210> 674
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 674
      tttatttcca tatagca   17
    • <210> 675
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 675
      tttatttcca tatagc   16
    • <210> 676
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 676
      aaggagagga gattatg   17
    • <210> 677
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 677
      agttcttgtg ttagct   16
    • <210> 678
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 678
      gagttcttgt gttagc   16
    • <210> 679
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 679
      attaattatc catccac   17
    • <210> 680
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 680
      atcaattaat tatccatc   18
    • <210> 681
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 681
      agaatcaatt aattatcc   18
    • <210> 682
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 682
      tgagataccg tgcatg   16
    • <210> 683
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 683
      aatgagatac cgtgca   16
    • <210> 684
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 684
      ctgtggttag gctaat   16
    • <210> 685
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 685
      aagagtaagg gtctgtggtt   20
    • <210> 686
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 686
      gatgggttaa gagtaa   16
    • <210> 687
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 687
      agcagatggg ttaaga   16
    • <210> 688
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 688
      tgtaaacatt tgtagc   16
    • <210> 689
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 689
      cctgcttata aatgta   16
    • <210> 690
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 690
      tgccctgctt ataaat   16
    • <210> 691
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 691
      tcttcttagt tcaata   16
    • <210> 692
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 692
      tggtttctaa ctacat   16
    • <210> 693
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 693
      agtttggttt ctaacta   17
    • <210> 694
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 694
      gaatgaaact tgcctg   16
    • <210> 695
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 695
      attatcctta catgat   16
    • <210> 696
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 696
      gtacccaatt atcctt   16
    • <210> 697
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 697
      tgtacccaat tatcct   16
    • <210> 698
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 698
      ttgtacccaa ttatcc   16
    • <210> 699
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 699
      tttgtaccca attatc   16
    • <210> 700
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 700
      agcagcaggt tatatt   16
    • <210> 701
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 701
      tgggaagtgg tctggg   16
    • <210> 702
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 702
      ctggagagtg ataata   16
    • <210> 703
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 703
      aatgctggat tacgtc   16
    • <210> 704
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 704
      caatgctgga ttacgt   16
    • <210> 705
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 705
      ttgttcagaa gtatcc   16
    • <210> 706
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 706
      gatgatttgc ttggag   16
    • <210> 707
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 707
      gaaatcattc acaacc   16
    • <210> 708
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 708
      ttgtaacatc tactac   16
    • <210> 709
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 709
      cattaagcag caagtt   16
    • <210> 710
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 710
      ttactagatg tgagca   16
    • <210> 711
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 711
      tttactagat gtgagc   16
    • <210> 712
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 712
      gaccaagcac cttaca   16
    • <210> 713
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 713
      agaccaagca ccttac   16
    • <210> 714
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 714
      atgggttaaa taaagg   16
    • <210> 715
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 715
      tcaaccagag tattaa   16
    • <210> 716
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 716
      gtcaaccaga gtatta   16
    • <210> 717
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 717
      attgtaaagc tgatat   16
    • <210> 718
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 718
      cacataattg taaagc   16
    • <210> 719
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 719
      gaggtctgct atttac   16
    • <210> 720
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 720
      tgtagattca atgcct   16
    • <210> 721
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 721
      cctcattata ctatga   16
    • <210> 722
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 722
      ccttatgcta tgacac   16
    • <210> 723
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 723
      tccttatgct atgaca   16
    • <210> 724
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 724
      aagatgttta agtata   16
    • <210> 725
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 725
      ctgattatta agatgt   16
    • <210> 726
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 726
      tggaaaggta tgaatt   16
    • <210> 727
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 727
      acttgaatgg cttgga   16
    • <210> 728
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 728
      aacttgaatg gcttgg   16
    • <210> 729
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 729
      caatgtgtta ctattt   16
    • <210> 730
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 730
      acaatgtgtt actatt   16
    • <210> 731
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 731
      catctgctat ataaga   16
    • <210> 732
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 732
      cctagagcaa atactt   16
    • <210> 733
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 733
      cagagttaat aataag   16
    • <210> 734
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 734
      gttcaagcac aacgaa   16
    • <210> 735
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 735
      agggttcaag cacaac   16
    • <210> 736
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 736
      tgttggagac actgtt   16
    • <210> 737
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 737
      aaggaggagt taggac   16
    • <210> 738
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 738
      ctatgccatt tacgat   16
    • <210> 739
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 739
      tcaaatgcag aattag   16
    • <210> 740
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 740
      agtgacaatc aaatgc   16
    • <210> 741
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 741
      aagtgacaat caaatg   16
    • <210> 742
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 742
      gtgtaccaag taacaa   16
    • <210> 743
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 743
      tgggatgtta aactga   16
    • <210> 744
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 744
      agtttacatt ttctgc   16
    • <210> 745
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 745
      tatgtgaaga ggagag   16
    • <210> 746
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 746
      cacctttaaa acccca   16
    • <210> 747
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 747
      tcctttataa tcacac   16
    • <210> 748
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 748
      acggtatttt cacagg   16
    • <210> 749
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 749
      gacactacaa tgagga   16
    • <210> 750
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 750
      tggtttttag gactgt   16
    • <210> 751
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 751
      cgacaaattc tatcct   16
    • <210> 752
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 752
      tgatatacaa tgctac   16
    • <210> 753
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 753
      tcgttgggta aattta   16
    • <210> 754
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 754
      tgctttataa atggtg   16
    • <210> 755
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 755
      caagtttaca ttttctgc   18
    • <210> 756
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 756
      catatgtgaa gaggagag   18
    • <210> 757
      <211> 16
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 757
      cacctttaaa acccca   16
    • <210> 758
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 758
      catcctttat aatcacac   18
    • <210> 759
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 759
      caacggtatt ttcacagg   18
    • <210> 760
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 760
      cagacactac aatgagga   18
    • <210> 761
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 761
      catggttttt aggactgt   18
    • <210> 762
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 762
      cacgacaaat tctatcct   18
    • <210> 763
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 763
      catgatatac aatgctac   18
    • <210> 764
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 764
      catcgttggg taaattta   18
    • <210> 765
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 765
      catgctttat aaatggtg   18
    • <210> 766
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 766
      caacaaataa tggttactct   20
    • <210> 767
      <211> 18
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 767
      cacagattga tggtagtt   18
    • <210> 768
      <211> 19
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 768
      cacctattta acatcagac   19
    • <210> 769
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 769
      cactaattgt agtagtactc   20
    • <210> 770
      <211> 20
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 770
      caataaacat gaatctctcc   20
    • <210> 771
      <211> 17
      <212> DNA
      <213> Artificial Sequence
    • <220>
      <223> Oligonucleotide motif
    • <400> 771
      tgatttaatt ctagtca   17
    • <210> 772
      <211> 16
      <212> DNA
      <213> artificial sequence
    • <220>
      <223> Target sequence
    • <400> 772
      gcagtagagc caatta   16
    • <210> 773
      <211> 10
      <212> PRT
      <213> artificial
    • <220>
      <223> HBV epitope
    • <400> 773
      Figure imgb0052
    • <210> 774
      <211> 15
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 774
      Figure imgb0053
    • <210> 775
      <211> 15
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 775
      Figure imgb0054
    • <210> 776
      <211> 16
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 776
      Figure imgb0055
    • <210> 777
      <211> 9
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 777
      Figure imgb0056
    • <210> 778
      <211> 15
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 778
      Figure imgb0057
    • <210> 779
      <211> 9
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 779
      Figure imgb0058
    • <210> 780
      <211> 9
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 780
      Figure imgb0059
    • <210> 781
      <211> 21
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 781
      Figure imgb0060
    • <210> 782
      <211> 10
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 782
      Figure imgb0061
    • <210> 783
      <211> 10
      <212> PRT
      <213> Artificial
    • <220>
      <223> HBV epitope
    • <400> 783
      Figure imgb0062
    • <210> 784
      <211> 19
      <212> DNA
      <213> Artificial
    • <220>
      <223> Primer
    • <400> 784
      ctgtgccttg ggtggcttt   19
    • <210> 785
      <211> 24
      <212> DNA
      <213> Artificial
    • <220>
      <223> Primer
    • <400> 785
      aaggaaagaa gtcagaaggc aaaa   24
    • <210> 786
      <211> 25
      <212> DNA
      <213> Artificial
    • <220>
      <223> primer
    • <400> 786
      ttctttataa gggtcgatgt ccatg   25

Claims (20)

  1. An antisense oligonucleotide of formula CCtatttaacatcAGAC, wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C are 5-methyl cytosine and all internucleoside linkages are phosphorothioate internucleoside linkages.
  2. An antisense oligonucleotide conjugate comprising the oligonucleotide of claim 1 and a conjugate moiety covalently attached to said oligonucleotide.
  3. The antisense oligonucleotide conjugate of claim 2, wherein a linker is present between the oligonucleotide and the conjugate moiety.
  4. The antisense oligonucleotide conjugate of claim 2 or claim 3, wherein the conjugate moiety is a asialoglycoprotein receptor targeting moiety.
  5. The antisense oligonucleotide conjugate of claim 4, wherein the asialoglycoprotein receptor targeting moiety is a tri-valent N-acetylgalactosamine (GaINAc) moiety.
  6. The antisense oligonucleotide conjugate of any one of claims 3 to 5, wherein the linker is a physiologically labile linker.
  7. The antisense oligonucleotide conjugate of claim 6, wherein the physiologically labile linker is a nuclease susceptible linker.
  8. The antisense oligonucleotide conjugate of claim 6 or claim 7, wherein the physiologically labile linker comprises a cytidine-adenosine dinucleotide.
  9. The antisense oligonucleotide conjugate of claim 2 wherein a linker is present between the oligonucleotide and the conjugate moiety; further wherein the conjugate moiety comprises an asialoglycoprotein receptor targeting moiety that is a tri-valent N-acetylgalactosamine (GaINAc) moiety; wherein the linker is a physiologically labile linker; further wherein the physiologically labile linker comprises a cytidine-adenosine dinucleotide.
  10. A pharmaceutical composition comprising the antisense oligonucleotide of claim 1 or the antisense oligonucleotide conjugate of any one of claims 2 to 9 and a pharmaceutically acceptable diluent, solvent, carrier, salt and/or adjuvant.
  11. The pharmaceutical composition according to claim 10 wherein the pharmaceutically acceptable diluent is sterile phosphate buffered saline.
  12. The pharmaceutical composition according to claim 10 or claim 11 wherein the pharmaceutically acceptable salt is sodium.
  13. The pharmaceutical composition according to claim 10 or claim 11 wherein the pharmaceutically acceptable salt is potassium.
  14. An in vitro method for modulating PD-L1 expression in a target cell which is expressing PD-L1, said method comprising administering the antisense oligonucleotide of claim 1, the antisense oligonucleotide conjugate of any one of claims 2 to 9 or the pharmaceutical composition of any one of claims 10 to 13 in an effective amount to said cell.
  15. The antisense oligonucleotide of claim 1, the antisense oligonucleotide conjugate of any one of claims 2 to 9 or the pharmaceutical composition of any one of claims 10 to 13 for use in restoration of immune response against a virus.
  16. The antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition for use according to claim 15, wherein the virus is HBV.
  17. The antisense oligonucleotide of claim 1, the antisense oligonucleotide conjugate of any one of claims 2 to 9 or the pharmaceutical composition of any one of claims 10 to 13 for use in restoration of immune response against a parasite.
  18. The antisense oligonucleotide, antisense oligonucleotide conjugate or pharmaceutical composition for use of any one of claims 15 to 16, wherein the restoration of the immune response is an increase in the liver of CD8+ T cells specific to one or more HBV antigens when compared to a control.
  19. The antisense oligonucleotide of claim 1, antisense oligonucleotide conjugate of any one of claims 2 to 9 or the pharmaceutical composition of any one of claims 10 to 13 for use as a medicament.
  20. The antisense oligonucleotide of claim 1, the antisense oligonucleotide conjugate of any one of claims 2 to 9 or the pharmaceutical composition of claims 10 to 13 for use in the treatment of HBV infection.
EP17710874.3A 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression Active EP3430141B1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
EP20201780.2A EP3786297A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
SI201730645T SI3430141T1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
PL17710874T PL3430141T3 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
RS20210240A RS61528B1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
HRP20210315TT HRP20210315T1 (en) 2016-03-14 2021-02-25 Oligonucleotides for reduction of pd-l1 expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP16160149 2016-03-14
PCT/EP2017/055925 WO2017157899A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression

Related Child Applications (2)

Application Number Title Priority Date Filing Date
EP20201780.2A Division-Into EP3786297A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
EP20201780.2A Division EP3786297A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression

Publications (2)

Publication Number Publication Date
EP3430141A1 EP3430141A1 (en) 2019-01-23
EP3430141B1 true EP3430141B1 (en) 2020-12-30

Family

ID=58314191

Family Applications (2)

Application Number Title Priority Date Filing Date
EP17710874.3A Active EP3430141B1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression
EP20201780.2A Pending EP3786297A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP20201780.2A Pending EP3786297A1 (en) 2016-03-14 2017-03-14 Oligonucleotides for reduction of pd-l1 expression

Country Status (31)

Country Link
US (5) US20170283496A1 (en)
EP (2) EP3430141B1 (en)
JP (4) JP6748219B2 (en)
KR (4) KR102417646B1 (en)
CN (5) CN114085836B (en)
AR (2) AR108038A1 (en)
AU (3) AU2017235278C1 (en)
BR (1) BR112018068410A2 (en)
CA (2) CA3013683C (en)
CL (4) CL2018002570A1 (en)
CO (1) CO2018007761A2 (en)
CR (2) CR20200119A (en)
DK (1) DK3430141T3 (en)
ES (1) ES2857702T3 (en)
HR (1) HRP20210315T1 (en)
HU (1) HUE053172T2 (en)
IL (4) IL296483B2 (en)
LT (1) LT3430141T (en)
MX (2) MX2018010830A (en)
MY (1) MY194912A (en)
PE (3) PE20230157A1 (en)
PH (1) PH12018501964A1 (en)
PL (1) PL3430141T3 (en)
PT (1) PT3430141T (en)
RS (1) RS61528B1 (en)
RU (1) RU2747822C2 (en)
SG (1) SG11201807854SA (en)
SI (1) SI3430141T1 (en)
TW (3) TWI790485B (en)
UA (1) UA127432C2 (en)
WO (1) WO2017157899A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11466081B2 (en) 2016-03-14 2022-10-11 Hoffmann-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2616051T3 (en) 2008-12-02 2017-06-09 Wave Life Sciences Japan, Inc. Method for the synthesis of modified nucleic acids in the phosphorus atom
US9744183B2 (en) 2009-07-06 2017-08-29 Wave Life Sciences Ltd. Nucleic acid prodrugs and methods of use thereof
JP5868324B2 (en) 2010-09-24 2016-02-24 株式会社Ｗａｖｅ Ｌｉｆｅ Ｓｃｉｅｎｃｅｓ Ｊａｐａｎ Asymmetric auxiliary group
SG10201700554VA (en) 2011-07-19 2017-03-30 Wave Life Sciences Pte Ltd Methods for the synthesis of functionalized nucleic acids
CA2878945A1 (en) 2012-07-13 2014-01-16 Wave Life Sciences Pte. Ltd. Chiral control
AU2013288048A1 (en) 2012-07-13 2015-01-22 Wave Life Sciences Ltd. Asymmetric auxiliary group
WO2015108047A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
JPWO2015108048A1 (en) 2014-01-15 2017-03-23 株式会社新日本科学 Chiral nucleic acid adjuvant and antitumor agent having antitumor activity
KR20220106232A (en) 2014-01-16 2022-07-28 웨이브 라이프 사이언시스 리미티드 Chiral design
CA2993201A1 (en) 2015-07-21 2017-01-26 The Children's Medical Center Corporation Pd-l1 expressing hematopoietic stem cells and uses
WO2018024849A1 (en) * 2016-08-03 2018-02-08 Aalborg Universitet ANTISENSE OLIGONUCLEOTIDES (ASOs) DESIGNED TO INHIBIT IMMUNE CHECKPOINT PROTEINS
JP7288854B2 (en) 2016-10-07 2023-06-08 セカルナ・ファーマシューティカルズ・ゲーエムベーハー・ウント・コ・カーゲー A novel approach to treat cancer
WO2019060708A1 (en) 2017-09-22 2019-03-28 The Children's Medical Center Corporation Treatment of type 1 diabetes and autoimmune diseases or disorders
TWI816066B (en) * 2017-10-16 2023-09-21 瑞士商赫孚孟拉羅股份公司 NUCLEIC ACID MOLECULE FOR REDUCTION OF PAPD5 AND PAPD7 mRNA FOR TREATING HEPATITIS B INFECTION
CA3087966A1 (en) * 2018-01-12 2019-07-18 Bristol-Myers Squibb Company Antisense oligonucleotides targeting alpha-synuclein and uses thereof
WO2020007772A1 (en) * 2018-07-02 2020-01-09 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting gbp-1
WO2020011653A1 (en) * 2018-07-09 2020-01-16 Roche Innovation Center Copenhagen A/S Antisense oligonucleotides targeting kynu
WO2020081585A1 (en) * 2018-10-15 2020-04-23 The Brigham And Women's Hospital, Inc. The long non-coding rna inca1 and homo sapiens heterogeneous nuclear ribonucleoprotein h1 (hnrnph1) as therapeutic targets for immunotherapy
JP2022522898A (en) * 2019-03-05 2022-04-20 エフ．ホフマン－ラ ロシュ アーゲー Intracellular targeting of molecules
WO2020201144A1 (en) 2019-04-02 2020-10-08 Proqr Therapeutics Ii B.V. Antisense oligonucleotides for immunotherapy
JP2022531415A (en) 2019-05-03 2022-07-06 セカルナ・ファーマシューティカルズ・ゲーエムベーハー・ウント・コ・カーゲー PD-L1 antisense oligonucleotide for use in tumor treatment
CN114901821A (en) * 2019-12-19 2022-08-12 豪夫迈·罗氏有限公司 Use of SEPT9 inhibitors for treating hepatitis B virus infection
JP2023506550A (en) * 2019-12-19 2023-02-16 エフ． ホフマン－ラ ロシュ エージー． Use of SBDS inhibitors to treat hepatitis B virus infection
CN114829603A (en) * 2019-12-20 2022-07-29 豪夫迈·罗氏有限公司 Enhancer oligonucleotides for inhibiting expression of SCN9A
WO2021173812A1 (en) * 2020-02-28 2021-09-02 Aligos Therapeutics, Inc. Methods and compositions for targeting pd-l1
EP4192955A1 (en) 2020-08-05 2023-06-14 F. Hoffmann-La Roche AG Oligonucleotide treatment of hepatitis b patients
CN117836006A (en) * 2021-08-04 2024-04-05 和博医药有限公司 Ligand conjugates for delivery of therapeutically active agents
CN113789324B (en) * 2021-08-17 2023-08-25 广东省大湾区华南理工大学聚集诱导发光高等研究院 AIE probe, preparation method thereof and application thereof in fluorescent quantitative PCR (polymerase chain reaction) method
AU2022384619A1 (en) 2021-11-11 2024-04-11 F. Hoffmann-La Roche Ag Pharmaceutical combinations for treatment of hbv

Family Cites Families (98)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS5927900A (en) 1982-08-09 1984-02-14 Wakunaga Seiyaku Kk Oligonucleotide derivative and its preparation
US4948882A (en) 1983-02-22 1990-08-14 Syngene, Inc. Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5525465A (en) 1987-10-28 1996-06-11 Howard Florey Institute Of Experimental Physiology And Medicine Oligonucleotide-polyamide conjugates and methods of production and applications of the same
DE3738460A1 (en) 1987-11-12 1989-05-24 Max Planck Gesellschaft MODIFIED OLIGONUCLEOTIDS
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5254469A (en) 1989-09-12 1993-10-19 Eastman Kodak Company Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
RU2123528C1 (en) * 1990-11-08 1998-12-20 Чирон Корпорейшн Method of preparing hcv proteins useful for using in vaccine or immune analysis, asialoglycoprotein (variants), composition for using in vaccine or in immune analysis (variants), method of asialoglycoprotein purification and a method of hcv content decrease or elimination
ATE198598T1 (en) 1990-11-08 2001-01-15 Hybridon Inc CONNECTION OF MULTIPLE REPORTER GROUPS ON SYNTHETIC OLIGONUCLEOTIDES
DE69233046T2 (en) 1991-10-24 2004-03-04 Isis Pharmaceuticals, Inc., Carlsfeld DERIVATIZED OLIGONUCLEOTIDS WITH IMPROVED CAPACITY
NL9201440A (en) 1992-08-11 1994-03-01 Univ Leiden Triantennary cluster glycosides, their preparation and application.
US5574142A (en) 1992-12-15 1996-11-12 Microprobe Corporation Peptide linkers for improved oligonucleotide delivery
US5580731A (en) 1994-08-25 1996-12-03 Chiron Corporation N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith
PT804456E (en) 1994-10-06 2003-01-31 Peter Eigil Nielsen CONJUGATES OF NUCLEIC ACIDS OF PEPTIDES
US5684142A (en) 1995-06-07 1997-11-04 Oncor, Inc. Modified nucleotides for nucleic acid labeling
AU1039397A (en) 1995-11-22 1997-06-27 Johns Hopkins University, The Ligands to enhance cellular uptake of biomolecules
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
US5770716A (en) 1997-04-10 1998-06-23 The Perkin-Elmer Corporation Substituted propargylethoxyamido nucleosides, oligonucleotides and methods for using same
DE69818987T2 (en) 1997-05-21 2004-07-29 The Board Of Trustees Of The Leland Stanford Junior University, Stanford COMPOSITION AND METHOD FOR DELAYING THE TRANSPORT BY BIOLOGICAL MEMBRANES
JP4236812B2 (en) 1997-09-12 2009-03-11 エクシコン エ／エス Oligonucleotide analogues
US6096875A (en) 1998-05-29 2000-08-01 The Perlein-Elmer Corporation Nucleotide compounds including a rigid linker
US6300319B1 (en) 1998-06-16 2001-10-09 Isis Pharmaceuticals, Inc. Targeted oligonucleotide conjugates
US6335432B1 (en) 1998-08-07 2002-01-01 Bio-Red Laboratories, Inc. Structural analogs of amine bases and nucleosides
US6335437B1 (en) 1998-09-07 2002-01-01 Isis Pharmaceuticals, Inc. Methods for the preparation of conjugated oligomers
ES2234563T5 (en) 1999-02-12 2018-01-17 Daiichi Sankyo Company, Limited New nucleoside and oligonucleotide analogs
CA2372085C (en) 1999-05-04 2009-10-27 Exiqon A/S L-ribo-lna analogues
US6617442B1 (en) 1999-09-30 2003-09-09 Isis Pharmaceuticals, Inc. Human Rnase H1 and oligonucleotide compositions thereof
WO2005007855A2 (en) 2003-07-14 2005-01-27 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF B7-H1 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20060276422A1 (en) 2001-05-18 2006-12-07 Nassim Usman RNA interference mediated inhibition of B7-H1 gene expression using short interfering nucleic acid (siNA)
US20040142325A1 (en) 2001-09-14 2004-07-22 Liat Mintz Methods and systems for annotating biomolecular sequences
DE10161767T1 (en) * 2002-07-03 2018-06-07 Honjo Tasuku Immunopotentiating compositions containing an anti-PD-L1 antibody
EP2752488B1 (en) 2002-11-18 2020-02-12 Roche Innovation Center Copenhagen A/S Antisense design
CA3040025C (en) 2003-06-12 2023-01-10 Alnylam Pharmaceuticals, Inc. Conserved hbv and hcv sequences useful for gene silencing
DE60319354T2 (en) 2003-07-11 2009-03-26 Lbr Medbiotech B.V. Mannose-6-phosphate receptor mediated gene transfer to muscle cells
CA2943949C (en) 2004-10-06 2020-03-31 Mayo Foundation For Medical Education And Research B7-h1 and methods of diagnosis, prognosis, and treatment of cancer
ZA200703482B (en) * 2004-10-06 2008-09-25 Mayo Foundation B7-H1 and methods of diagnosis, prognosis, and treatment of cancer
US20120122801A1 (en) 2005-01-05 2012-05-17 Prosensa B.V. Mannose-6-phosphate receptor mediated gene transfer into muscle cells
SI1907000T2 (en) 2005-06-08 2020-07-31 Dana-Farber Cancer Institute Methods and compositions for the treatment of persistent HIV infections by inhibiting the programmed cell death 1 (PD-1) pathway
WO2007031091A2 (en) 2005-09-15 2007-03-22 Santaris Pharma A/S Rna antagonist compounds for the modulation of p21 ras expression
DK2314594T3 (en) 2006-01-27 2014-10-27 Isis Pharmaceuticals Inc 6-modified bicyclic nucleic acid analogues
CA3044969A1 (en) 2006-05-05 2007-12-21 Ionis Pharmaceuticals, Inc. Compounds and methods for modulating gene expression
CA2651453C (en) 2006-05-11 2014-10-14 Isis Pharmaceuticals, Inc. 5'-modified bicyclic nucleic acid analogs
US7666854B2 (en) 2006-05-11 2010-02-23 Isis Pharmaceuticals, Inc. Bis-modified bicyclic nucleic acid analogs
NZ704295A (en) * 2006-12-27 2016-06-24 Harvard College Compositions and methods for the treatment of infections and tumors
US8580756B2 (en) 2007-03-22 2013-11-12 Santaris Pharma A/S Short oligomer antagonist compounds for the modulation of target mRNA
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
WO2008154401A2 (en) 2007-06-08 2008-12-18 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
CA2692579C (en) 2007-07-05 2016-05-03 Isis Pharmaceuticals, Inc. 6-disubstituted bicyclic nucleic acid analogs
US8546556B2 (en) 2007-11-21 2013-10-01 Isis Pharmaceuticals, Inc Carbocyclic alpha-L-bicyclic nucleic acid analogs
WO2009090182A1 (en) 2008-01-14 2009-07-23 Santaris Pharma A/S C4'-substituted - dna nucleotide gapmer oligonucleotides
EP2285819B1 (en) 2008-04-04 2013-10-16 Isis Pharmaceuticals, Inc. Oligomeric compounds comprising neutrally linked terminal bicyclic nucleosides
WO2009126933A2 (en) 2008-04-11 2009-10-15 Alnylam Pharmaceuticals, Inc. Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
EP2356129B1 (en) 2008-09-24 2013-04-03 Isis Pharmaceuticals, Inc. Substituted alpha-l-bicyclic nucleosides
AU2009319701B2 (en) 2008-11-28 2014-10-09 Dana-Farber Cancer Institute, Inc. Methods for the treatment of infections and tumors
CN114835812A (en) * 2008-12-09 2022-08-02 霍夫曼-拉罗奇有限公司 anti-PD-L1 antibodies and their use for enhancing T cell function
EP2404997B1 (en) 2009-03-06 2017-10-18 Mie University Method for enhancing t cell function
CN103223177B (en) * 2009-05-06 2016-08-10 库尔纳公司 By suppression therapy lipid transfer and the metabolic gene relevant disease of the natural antisense transcript for lipid transfer and metabolic gene
CA2764683A1 (en) * 2009-05-28 2010-12-02 Joseph Collard Treatment of antiviral gene related diseases by inhibition of natural antisense transcript to an antiviral gene
EP2462153B1 (en) 2009-08-06 2015-07-29 Isis Pharmaceuticals, Inc. Bicyclic cyclohexose nucleic acid analogs
AU2011237630B2 (en) * 2010-04-06 2016-01-21 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of CD274/PD-L1 gene
CA2836315A1 (en) * 2010-05-18 2011-11-24 The Royal Institution For The Advancement Of Learning/Mcgill University Method for treating brain cancer
US8846637B2 (en) 2010-06-08 2014-09-30 Isis Pharmaceuticals, Inc. Substituted 2′-amino and 2′-thio-bicyclic nucleosides and oligomeric compounds prepared therefrom
HUE044815T2 (en) 2010-08-17 2019-11-28 Sirna Therapeutics Inc RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
DK3124610T3 (en) 2010-10-28 2019-06-11 Benitec Biopharma Ltd HBV TREATMENT
JP2014504295A (en) 2010-12-17 2014-02-20 アローヘッド リサーチ コーポレイション galactose cluster for siRNA-pharmacokinetic modulator targeting moiety
EP2658981B1 (en) 2010-12-29 2016-09-28 F.Hoffmann-La Roche Ag Small molecule conjugates for intracellular delivery of nucleic acids
CN111172162A (en) 2011-04-21 2020-05-19 葛兰素史克公司 Modulation of Hepatitis B Virus (HBV) expression
EA202191537A1 (en) 2011-06-30 2022-01-31 Эрроухэд Фармасьютикалс, Инк. COMPOSITIONS AND METHODS FOR INHIBITION OF HEPATITIS B VIRUS GENE EXPRESSION
SG10201700554VA (en) 2011-07-19 2017-03-30 Wave Life Sciences Pte Ltd Methods for the synthesis of functionalized nucleic acids
WO2013033230A1 (en) 2011-08-29 2013-03-07 Isis Pharmaceuticals, Inc. Oligomer-conjugate complexes and their use
SG11201401314PA (en) 2011-09-07 2014-09-26 Marina Biotech Inc Synthesis and uses of nucleic acid compounds with conformationally restricted monomers
WO2013049307A2 (en) 2011-09-30 2013-04-04 University Of Miami Enhanced immune memory development by aptamer targeted mtor inhibition of t cells
SI2768524T1 (en) * 2011-10-17 2022-09-30 Io Biotech Aps Pd-l1 based immunotherapy
US9221864B2 (en) 2012-04-09 2015-12-29 Isis Pharmaceuticals, Inc. Tricyclic nucleic acid analogs
WO2013159109A1 (en) 2012-04-20 2013-10-24 Isis Pharmaceuticals, Inc. Modulation of hepatitis b virus (hbv) expression
CA2873766A1 (en) * 2012-05-16 2013-11-21 Rana Therapeutics Inc. Compositions and methods for modulating atp2a2 expression
WO2013173635A1 (en) 2012-05-16 2013-11-21 Rana Therapeutics, Inc. Compositions and methods for modulating gene expression
AU2013288048A1 (en) 2012-07-13 2015-01-22 Wave Life Sciences Ltd. Asymmetric auxiliary group
CN117126846A (en) * 2012-11-15 2023-11-28 罗氏创新中心哥本哈根有限公司 Oligonucleotide conjugates
JP6998646B2 (en) 2012-11-30 2022-02-04 エフ・ホフマン－ラ・ロシュ・アクチェンゲゼルシャフト Identification of patients in need of PD-L1 inhibitor combination therapy
JP6580993B2 (en) * 2013-01-30 2019-09-25 エフ．ホフマン−ラ ロシュ アーゲーＦ． Ｈｏｆｆｍａｎｎ−Ｌａ Ｒｏｃｈｅ Ａｋｔｉｅｎｇｅｓｅｌｌｓｃｈａｆｔ LNA oligonucleotide carbohydrate conjugate
WO2014118272A1 (en) * 2013-01-30 2014-08-07 Santaris Pharma A/S Antimir-122 oligonucleotide carbohydrate conjugates
EP3633039A1 (en) 2013-05-01 2020-04-08 Ionis Pharmaceuticals, Inc. Compositions and methods
CN112263682A (en) 2013-06-27 2021-01-26 罗氏创新中心哥本哈根有限公司 Antisense oligomers and conjugates targeting PCSK9
EP3102697A1 (en) * 2014-02-03 2016-12-14 Myriad Genetics, Inc. Method for predicting the response to an anti-her2 containing therapy and/or chemotherapy in patients with breast cancer
WO2016025647A1 (en) 2014-08-12 2016-02-18 Massachusetts Institute Of Technology Synergistic tumor treatment with il-2, a therapeutic antibody, and a cancer vaccine
EP3204397A1 (en) 2014-10-10 2017-08-16 F. Hoffmann-La Roche AG Galnac phosphoramidites, nucleic acid conjugates thereof and their use
US9828601B2 (en) 2015-02-27 2017-11-28 Idera Pharmaceuticals, Inc. Compositions for inhibiting checkpoint gene expression and uses thereof
GB201507926D0 (en) 2015-05-08 2015-06-24 Proqr Therapeutics N V Improved treatments using oligonucleotides
WO2017055423A1 (en) * 2015-10-02 2017-04-06 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugation process
KR102117172B1 (en) 2015-11-16 2020-06-01 에프. 호프만-라 로슈 아게 GalNAc cluster phosphoramidite
EP3387131A4 (en) 2015-12-09 2019-08-07 Alnylam Pharmaceuticals, Inc. Polynucleotide agents targeting programmed cell death 1 ligand 1 (pd-l1) and methods of use thereof
ES2857702T3 (en) 2016-03-14 2021-09-29 Hoffmann La Roche Oligonucleotides for reduction of PD-L1 expression

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11466081B2 (en) 2016-03-14 2022-10-11 Hoffmann-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression

Also Published As

Publication number Publication date
CN108779465A (en) 2018-11-09
AU2017235278A8 (en) 2018-08-16
IL303077A (en) 2023-07-01
JP2022034059A (en) 2022-03-02
AU2021236439B2 (en) 2022-06-16
US11466081B2 (en) 2022-10-11
TWI794662B (en) 2023-03-01
SI3430141T1 (en) 2021-04-30
US20230331837A1 (en) 2023-10-19
IL290294B2 (en) 2023-02-01
KR20180120702A (en) 2018-11-06
SG11201807854SA (en) 2018-10-30
KR20220100095A (en) 2022-07-14
CA3013683C (en) 2021-07-13
BR112018068410A2 (en) 2019-01-15
CN114736901A (en) 2022-07-12
MX2018010830A (en) 2019-02-07
AR108038A1 (en) 2018-07-11
RU2747822C2 (en) 2021-05-14
JP7447073B2 (en) 2024-03-11
JP2020172488A (en) 2020-10-22
CA3013683A1 (en) 2017-09-21
US10745480B2 (en) 2020-08-18
UA127432C2 (en) 2023-08-23
KR102417646B1 (en) 2022-07-07
CN114085836A (en) 2022-02-25
PH12018501964A1 (en) 2019-06-24
IL296483B2 (en) 2023-10-01
IL260759B (en) 2022-03-01
PE20201499A1 (en) 2020-12-29
JP7002603B2 (en) 2022-02-10
MX2022012221A (en) 2022-10-27
TWI721128B (en) 2021-03-11
CR20200119A (en) 2021-04-19
US20200247884A1 (en) 2020-08-06
TW202328448A (en) 2023-07-16
CL2018002570A1 (en) 2018-12-28
IL296483A (en) 2022-11-01
WO2017157899A1 (en) 2017-09-21
KR20230136689A (en) 2023-09-26
KR102580776B1 (en) 2023-09-20
PL3430141T3 (en) 2022-02-28
AU2017235278C1 (en) 2022-03-10
CO2018007761A2 (en) 2018-08-10
CL2020000865A1 (en) 2020-08-28
JP6748219B2 (en) 2020-08-26
TWI790485B (en) 2023-01-21
JP2019512498A (en) 2019-05-16
IL296483B1 (en) 2023-06-01
CN108779465B (en) 2022-05-13
AU2017235278B2 (en) 2021-11-11
JP2024029180A (en) 2024-03-05
CN114717235A (en) 2022-07-08
RS61528B1 (en) 2021-04-29
AU2022202479A1 (en) 2022-05-12
CL2020001126A1 (en) 2020-08-28
IL290294A (en) 2022-04-01
EP3786297A1 (en) 2021-03-03
CR20180432A (en) 2018-11-21
AU2017235278A1 (en) 2018-08-09
MY194912A (en) 2022-12-22
IL290294B (en) 2022-10-01
CN114736900A (en) 2022-07-12
RU2018134379A (en) 2020-04-15
ES2857702T3 (en) 2021-09-29
AU2021236439A1 (en) 2021-10-14
AR118719A2 (en) 2021-10-27
CN114085836B (en) 2024-01-26
DK3430141T3 (en) 2021-03-01
KR20210120131A (en) 2021-10-06
US20210147535A1 (en) 2021-05-20
CL2020001127A1 (en) 2020-08-28
LT3430141T (en) 2021-03-25
US20200048344A1 (en) 2020-02-13
PT3430141T (en) 2021-02-25
EP3430141A1 (en) 2019-01-23
US20170283496A1 (en) 2017-10-05
HRP20210315T1 (en) 2021-04-16
RU2018134379A3 (en) 2020-06-23
CA3120687A1 (en) 2017-09-21
TW202128997A (en) 2021-08-01
PE20181892A1 (en) 2018-12-11
TW202128998A (en) 2021-08-01
TW201734209A (en) 2017-10-01
KR102306797B1 (en) 2021-10-05
HUE053172T2 (en) 2021-06-28
US10829555B2 (en) 2020-11-10
PE20230157A1 (en) 2023-02-01

Similar Documents

Publication Publication Date Title
EP3430141B1 (en) Oligonucleotides for reduction of pd-l1 expression
NZ785334A (en) Oligonucleotides for reduction of pd-l1 expression
NZ785335A (en) Oligonucleotides for reduction of pd-l1 expression

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20181015

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200122

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20200623

GRAJ Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted

Free format text: ORIGINAL CODE: EPIDOSDIGR1

GRAL Information related to payment of fee for publishing/printing deleted

Free format text: ORIGINAL CODE: EPIDOSDIGR3

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

GRAR Information related to intention to grant a patent recorded

Free format text: ORIGINAL CODE: EPIDOSNIGR71

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

INTC Intention to grant announced (deleted)
AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

INTG Intention to grant announced

Effective date: 20201124

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: AT

Ref legal event code: REF

Ref document number: 1349953

Country of ref document: AT

Kind code of ref document: T

Effective date: 20210115

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602017030425

Country of ref document: DE

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: RO

Ref legal event code: EPE

REG Reference to a national code

Ref country code: HR

Ref legal event code: TUEP

Ref document number: P20210315

Country of ref document: HR

Ref country code: PT

Ref legal event code: SC4A

Ref document number: 3430141

Country of ref document: PT

Date of ref document: 20210225

Kind code of ref document: T

Free format text: AVAILABILITY OF NATIONAL TRANSLATION

Effective date: 20210218

REG Reference to a national code

Ref country code: FI

Ref legal event code: FGE

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

Effective date: 20210226

REG Reference to a national code

Ref country code: NO

Ref legal event code: T2

Effective date: 20201230

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: HR

Ref legal event code: ODRP

Ref document number: P20210315

Country of ref document: HR

Payment date: 20210226

Year of fee payment: 5

REG Reference to a national code

Ref country code: SK

Ref legal event code: T3

Ref document number: E 36572

Country of ref document: SK

REG Reference to a national code

Ref country code: HR

Ref legal event code: T1PR

Ref document number: P20210315

Country of ref document: HR

REG Reference to a national code

Ref country code: GR

Ref legal event code: EP

Ref document number: 20210400519

Country of ref document: GR

Effective date: 20210416

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

REG Reference to a national code

Ref country code: HU

Ref legal event code: AG4A

Ref document number: E053172

Country of ref document: HU

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2857702

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20210929

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210430

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602017030425

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20211001

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20210314

REG Reference to a national code

Ref country code: HR

Ref legal event code: ODRP

Ref document number: P20210315

Country of ref document: HR

Payment date: 20220308

Year of fee payment: 6

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20210430

REG Reference to a national code

Ref country code: AT

Ref legal event code: UEP

Ref document number: 1349953

Country of ref document: AT

Kind code of ref document: T

Effective date: 20201230

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: RS

Payment date: 20221226

Year of fee payment: 7

Ref country code: BG

Payment date: 20221229

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: PL

Payment date: 20221220

Year of fee payment: 7

Ref country code: HR

Payment date: 20221230

Year of fee payment: 7

REG Reference to a national code

Ref country code: HR

Ref legal event code: ODRP

Ref document number: P20210315

Country of ref document: HR

Payment date: 20221230

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20230215

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: RO

Payment date: 20230228

Year of fee payment: 7

Ref country code: NO

Payment date: 20230223

Year of fee payment: 7

Ref country code: LT

Payment date: 20230302

Year of fee payment: 7

Ref country code: IE

Payment date: 20230223

Year of fee payment: 7

Ref country code: FR

Payment date: 20230209

Year of fee payment: 7

Ref country code: FI

Payment date: 20230228

Year of fee payment: 7

Ref country code: DK

Payment date: 20230227

Year of fee payment: 7

Ref country code: CZ

Payment date: 20230223

Year of fee payment: 7

Ref country code: AT

Payment date: 20230223

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: TR

Payment date: 20230313

Year of fee payment: 7

Ref country code: SK

Payment date: 20230215

Year of fee payment: 7

Ref country code: SI

Payment date: 20230214

Year of fee payment: 7

Ref country code: SE

Payment date: 20230307

Year of fee payment: 7

Ref country code: PT

Payment date: 20230223

Year of fee payment: 7

Ref country code: IT

Payment date: 20230310

Year of fee payment: 7

Ref country code: HU

Payment date: 20230215

Year of fee payment: 7

Ref country code: GR

Payment date: 20230223

Year of fee payment: 7

Ref country code: GB

Payment date: 20230208

Year of fee payment: 7

Ref country code: DE

Payment date: 20230210

Year of fee payment: 7

Ref country code: BE

Payment date: 20230213

Year of fee payment: 7

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20230321

P02 Opt-out of the competence of the unified patent court (upc) changed

Effective date: 20230322

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20201230

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: ES

Payment date: 20230403

Year of fee payment: 7

Ref country code: CH

Payment date: 20230401

Year of fee payment: 7

REG Reference to a national code

Ref country code: DE

Ref legal event code: R082

Ref document number: 602017030425

Country of ref document: DE

Representative=s name: KRAUS & LEDERER PARTGMBB, DE

REG Reference to a national code

Ref country code: HR

Ref legal event code: ODRP

Ref document number: P20210315

Country of ref document: HR

Payment date: 20240228

Year of fee payment: 8

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GR

Payment date: 20240222

Year of fee payment: 8

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: LT

Payment date: 20240220

Year of fee payment: 8

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: IE

Payment date: 20240222

Year of fee payment: 8

Ref country code: NL

Payment date: 20240220

Year of fee payment: 8