WO2013159109A1 - Modulation of hepatitis b virus (hbv) expression - Google Patents

Modulation of hepatitis b virus (hbv) expression Download PDF

Info

Publication number
WO2013159109A1
WO2013159109A1 PCT/US2013/037642 US2013037642W WO2013159109A1 WO 2013159109 A1 WO2013159109 A1 WO 2013159109A1 US 2013037642 W US2013037642 W US 2013037642W WO 2013159109 A1 WO2013159109 A1 WO 2013159109A1
Authority
WO
WIPO (PCT)
Prior art keywords
compound
modified
hbv
uro
cro
Prior art date
Application number
PCT/US2013/037642
Other languages
French (fr)
Inventor
Eric E. Swayze
Original Assignee
Isis Pharmaceuticals, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Isis Pharmaceuticals, Inc. filed Critical Isis Pharmaceuticals, Inc.
Publication of WO2013159109A1 publication Critical patent/WO2013159109A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Definitions

  • HBV The virus, HBV, is a double-stranded hepatotropic virus which infects only humans and non-human primates. Viral replication takes place predominantly in the liver and, to a lesser extent, in the kidneys, pancreas, bone marrow and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and immune markers are detectable in blood and characteristic antigen-antibody patterns evolve over time. The first detectable viral marker is hepatitis B s antigen (HBsAg), followed by hepatitis B e antigen (HBeAg) and HBV DNA.
  • HBsAg hepatitis B s antigen
  • HBV DNA hepatitis B e antigen
  • PCT applications have been published that relate to the RNAi phenomenon. These include: PCT publication WO 00/44895; PCT publication WO 00/49035; PCT publication WO 00/63364; PCT publication WO 01/36641 ; PCT publication WO 01/36646; PCT publication WO 99/32619; PCT publication WO 00/44914; PCT publication WO 01/29058; and PCT publication WO 01/75164.
  • oligonucleotide consisting of 8 to 35 linked nucleosides per strand and having a nucleobase sequence comprising at least 5 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125.
  • oligonucleotide consisting of 8 to 35 linked nucleosides per strand, wherein the double- stranded oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56- 76, 58-78, 194-214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659,
  • one strand of the oligonucleotide is modified.
  • Alkyl refers to a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms.
  • Bicyclic sugar means a furanose ring modified by the bridging of two non-geminal carbon atoms.
  • a bicyclic sugar is a modified sugar.
  • Bicyclic sugar modified nucleoside refers to nucleosides having a second ring formed from the bridging of 2 atoms of the ribose ring.
  • Designing or “Designed to” refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
  • Double-stranded oligonucleotide Double-stranded oligonucleotide, double-stranded compound”, and “double-stranded composition” as used herein encompass the terms “ short interfering nucleic acid”, “short interfering RNA”, “siRNA”, “short interfering nucleic acid molecule”, “short interfering oligonucleotide molecule”, or “chemically modified short interfering nucleic acid molecule” as defined below.
  • double-stranded oligonucleotides are formed from only one strand, for example by taking the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplex.
  • Duration means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.
  • Effective amount in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of active ingredient to a subject in need of such modulation, treatment or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition.
  • the effective amount will vary depending upon the health and physical condition of the subject to be treated, the taxonomic group of subjects to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors.
  • “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid.
  • a first nucleic acid is a siRNA compound and a target nucleic acid is a second nucleic acid.
  • “Fully modified motif” refers to a siRNA compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.
  • Halo and halogen refer to an atom selected from fluorine, chlorine, bromine and iodine.
  • HBV protein means any protein secreted by hepatitis B virus The term encompasses various HBV antigens, including core proteins such as “Hepatitis E antigen”, “HBeAg” or “HBeAG” and envelope proteins such as "HBV surface antigen", or "HBsAg”.
  • injection site reaction means inflammation or abnormal redness of skin at a site of injection in an individual.
  • Intravenous administration means administration into a vein.
  • Non-complementary nucleobase refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
  • Olemeric compound means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • Parenteral administration means administration through injection (e.g., bolus injection) or infusion.
  • Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.
  • Prodrug means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • Protecting group refers to a labile chemical moiety which is known in the art to protect reactive groups including without limitation, hydroxyl, amino and thiol groups, against undesired reactions during synthetic procedures.
  • Side effects means physiological responses attributable to a treatment other than desired effects.
  • side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies.
  • increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality.
  • increased bilirubin may indicate liver toxicity or liver function abnormality.
  • “Therapeutically effective amount” means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
  • the compounds or compositions comprise a modified double- stranded oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV.
  • the HBV target can have a sequence recited in SEQ ID NO: 1 or a portion thereof or a variant thereof.
  • such compounds or oligonucleotides target the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245- 265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262- 282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381- 401, 383-403 , 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457- 477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687- 707, 1253-1273, 1255
  • the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).
  • Certain embodiments provide a method for treating an animal with a HBV related disease, disorder or condition comprising: a) identifying said animal with the HBV related disease, disorder or condition, and b) administering to said animal a therapeutically effective amount of a compound or composition comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1, as measured over the entirety of said modified oligonucleotide.
  • the therapeutically effective amount of the compound or composition administered to the animal treats or reduces the HBV related disease, disorder or condition, or a symptom thereof, in the animal.
  • the one or more second agents are an HBV agent.
  • the HBV agent can include, but is not limited to, interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).
  • a method for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 75% compared to the amount before administration of the double- stranded compound.
  • a method for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 80% compared to the amount before administration of the modified double-stranded compound.
  • a method for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 95% compared to the amount before administration of the double-stranded compound.
  • the HBV antigen may be HBsAg or may be HBeAg, and more particularly, the amount of HBV antigen may be sufficiently reduced to result in seroconversion, defined as serum HBeAg absence plus serum HBeAb presence if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems.
  • Certain embodiments provide the use of a compound or composition as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing liver disease in an animal.
  • kits for treating, preventing, or ameliorating an HBV- related disease, disorder or condition, or a symptom thereof as described herein wherein the kit comprises: a) a compound or compositions as described herein; and optionally b) an additional agent or therapy as described herein.
  • the kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate the HBV-related disease, disorder or condition. Double-stranded Oligonucleotides
  • the double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non- nucleotides.
  • the short interfering nucleic acid molecules lack 2'- hydroxy (2'-OH) containing nucleotides.
  • short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group).
  • double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups.
  • double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • sequence specific RNA interference such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • double- stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level.
  • RNAi mechanism including, e.g., "hairpin” or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA.
  • RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
  • an antisense strand or region e g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid
  • RNA strand or region that is a sense strand or region e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid
  • the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
  • a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell.
  • any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364.
  • multiple anti-HBV and/or anti-HCV dsRNA effector molecules of the invention are transcribed in a mammalian cell from one or more expression constructs each comprising multiple polymerase III promoter expression cassettes as described in more detail in U. S. Pat. No. 60/603622; U.S. Pat. No. 60/629942; and PCT7US05/29976; "Multiple Polymerase III Promoter Expression Constructs".
  • siRNA compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase.
  • siRNA compounds described by Isis Numbers (Isis No) indicate a combination of nucleobase sequence and motif.
  • the compounds, or portions thereof are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the double-stranded compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
  • the compounds disclosed herein may comprise of alkyl groups.
  • the compounds disclosed herein may comprise of aryl or aromatic groups.
  • aryl groups include, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like.
  • Aryl groups as used herein may optionally include further substituent groups.
  • the compounds disclosed herein may comprise of protecting group.
  • protecting groups are typically used selectively and/or orthogonally to protect sites during reactions at other reactive sites and can then be removed to leave the unprotected group as is or available for further reactions.
  • Protecting groups as known in the art are described generally in Greene and Wuts, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons, New York (1999).
  • any carbon-carbon double bond appearing herein is selected for convenience only and is not intended to designate a particular configuration unless the text so states; thus a carbon-carbon double bond or carbon-heteroatom double bond depicted arbitrarily herein as trans may be cis, trans, or a mixture of the two in any proportion.
  • each sugar modified nucleoside is selected from 2'-modified nucleosides, 4'-thio modified nucleosides, 4'-thio-2'-modified nucleosides and nucleosides having bicyclic sugar moieties.
  • chemically modified double-stranded compounds comprise a 2'-modified nucleoside such as 2'-OCH 3 , 2'-F, or 2'-OCH 3 sugar modifications.
  • chemically modified double-stranded compounds comprise ⁇ -D-ribonucleoside For example using 2'-MOE (2'-0-(CH 2 ) 2 -OCH 3 ) modifications in the wings of the sense strand increases the efficiency of the antisense strand.
  • the compounds disclosed herein may comprise of universal base moieties.
  • the universal base need not contribute to hybridization, but should not significantly detract from hybridization and typically refers to a monomer in a first sequence that can pair with a naturally occuring base, i.e A, C, G, T or U at a corresponding position in a second sequence of a duplex in which one or more of the following is true: (1) there is essentially no pairing (hybridization) between the two; or (2) the pairing between them occurs non- discriminant with the universal base hybridizing one or more of the the naturally occurring bases and without significant destabilization of the duplex.
  • Exemplary universal bases include, without limitation, inosine, 5-nitroindole and 4-nitrobenzimidazole.
  • G-clamps examples include substituted phenoxazine cytidine (e.g. 9-(2- aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one) and pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one).
  • substituted phenoxazine cytidine e.g. 9-(2- aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one
  • carbazole cytidine 2H- pyrimido[4,5-b]indol-2-one
  • pyridoindole cytidine H-pyrido[3'
  • Representative cytosine analogs that make 3 hydrogen bonds with a guanosine in a second oligonucleotide include l,3-diazaphenoxazine-2-one (Kurchavov et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846), l,3-diazaphenothiazine-2-one (Lin et al., J. Am. Chem. Soc. 1995, 117, 3873-3874) and 6,7,8,9-tetrafluoro-l,3-diazaphenoxazine-2-one (Wang et al., Tetrahedron Lett. 1998, 39, 8385-8388).
  • these base modifications hybridized with complementary guanine (the latter also hybridized with adenine) and enhanced helical thermal stability by extended stacking interactions (see U. S. Serial Number 10/013,295).
  • Exemplary cycloalkylene groups include C3-C12 cycloalkylene groups, such as cyclopropylene, cyclobutylene, cyclopentanyl-l,3-ene, cyclohexyl- 1,4-ene, etc.
  • Exemplary arylene linking moietys include, but are not limited to, mono- or bicyclic arylene groups having from 6 to about 14 carbon atoms, e.g. phenyl- 1,2-ene, naphthyl-l,6-ene, napthyl- 2,7-ene, anthracenyl, etc.
  • heteroaryl groups that may be mentioned as being within the scope of the embodiments include: pyrrolidinyl, piperidinyl (e.g. 2,5-piperidinyl, 3,5-piperidinyl), piperazinyl, tetrahydrothiophenyl, tetrahydrofuranyl, tetrahydro quinolinyl, tetrahydro isoquinolinyl, tetrahydroquinazolinyl, tetrahydroquinoxalinyl, etc.
  • Exemplary heteroarylene groups include mono- or bicyclic aryl groups having from about 4 to about 12 carbon atoms and about 1 to about 4 hetero atoms, such as N, O and S.
  • the compounds disclosed herein may comprise of modified internucleoside linkages.
  • modified linkages include those that have a phosphorus atom and those that do not have a phosphorus atom.
  • Internucleoside linkages containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosp hates having normal 3 '-5' linkages, 2'-5' link
  • Phosphonomonoester nucleic acids have useful physical, biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.
  • double-stranded oligonucleotides can comprise nucleosides that are joined by internucleoside linkages that do not have phosphorus atoms.
  • Non-phosphorus containing internucleoside linkages include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic and one or more short chain heterocyclic.
  • patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5, 166,315; 5, 185,444; 5,214, 134; 5,216, 141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439.
  • the MMI type and amide internucleoside linkages are disclosed in the below referenced U. S. patents 5,489,677 and 5,602,240, respectively.
  • Conjugate groups include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem.
  • lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-10
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651- 3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
  • Double-stranded compounds used in the compositions of the present embodiments can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of double-stranded compounds to enhance properties such as for example nuclease stability. Included in stabilizing groups are cap structures.
  • the terms "cap structure” or “terminal cap moiety,” as used herein, refer to chemical modifications, which can be attached to one or both of the termini of an oligomeric compound. These terminal modifications protect the oligomeric compounds having terminal nucleic acid moieties from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • Particularly suitable 3 '-cap structures of the present embodiments include, for example 4', 5 '-methylene nucleotide; 1 -(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2-propyl phosphate, 3- aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4-dihydroxybutyl nucle
  • 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an oligomeric compound to impart nuclease stability include those disclosed in WO 03/004602.
  • the double-stranded compounds of several embodiments include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon admini- stration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the embodiments, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. For oligonucleotides, examples of pharmaceutically acceptable salts and their uses are further described in U. S. Patent 6,287,860.
  • the compounds and compositions provided herein may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, PEG (e.g. PEG-C-DMA, PEG-DMG), cholesterol, lipids, albumin, nucleic-acid-lipid particles, lipid nanoparticles, micelles, virosomes, or virus like particles (VLP) for assisting in uptake, distribution and/or absorption.
  • PEG e.g. PEG-C-DMA, PEG-DMG
  • cholesterol lipids
  • albumin lipids
  • nucleic-acid-lipid particles lipid nanoparticles
  • micelles virosomes
  • VLP virus like particles
  • compositions provided herein may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • compositions provided herein include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations.
  • the pharmaceutical compositions and formulations of the present embodiments may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
  • formulations are routinely designed according to their intended use, i.e. route of administration.
  • Suitable formulations for topical administration include those in which the compounds of the embodiments are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Suitable lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g.
  • compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable.
  • Suitable oral formulations are those in which oligonucleotides of the embodiments are administered in conjunction with one or more penetration enhancers surfactants and chelators.
  • Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts and fatty acids and their uses are further described in U.
  • Transfection reagents commonly used to introduce double- stranded oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN, LIPOFECTAMINE, LIPOFECTAMINE in OPTI-MEM 1, and by the electroporation method.
  • Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
  • Quantitation of target DNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
  • Probes and primers are designed to hybridize to a HBV nucleic acid.
  • Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
  • Double-stranded compounds are tested in animals to assess their ability to inhibit expression of HBV and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models.
  • siRNA oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline.
  • Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, intrathecal, and intracerebroventricular. Calculation of double-stranded oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight.
  • RNA is isolated from liver tissue and changes in HBV nucleic acid expression are measured. Changes in HBV DNA levels are also measured. Changes in HBV protein levels are also measured. Changes in HBV HBeAg levels are also measured. Changes in HBV HBsAg levels are also measured.
  • the individual has been identified as in need of treatment for an HBV-related condition.
  • methods for prophylactically reducing HBV expression in an individual Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid.
  • HBV hepatitis C
  • interferons e.g., interferon alpha-2b, interferon alpha-2a, and interferon alphacon- 1.
  • interferon alpha-2b interferon alpha-2b
  • interferon alpha-2a interferon alpha-2a
  • interferon alphacon- 1 interferon alphacon- 1.
  • pegylated interferon interferon attached to a polyethylene glycol moiety which improves its pharmacokinetic profile.
  • administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV S antigen (HBsAg) levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound.
  • administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV E antigen (HBeAg) levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound.
  • An individual's response to administration of the siRNA compound is used by a physician to determine the amount and duration of therapeutic intervention.
  • administration of a double-stranded compound targeted to an HBV nucleic acid results in reduction of HBV expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
  • administration of a siRNA compound targeted to an HBV nucleic acid results in reduced symptoms associated with the HBV-related condition and reduced HBV- related markers in the blood.
  • compositions comprising a double-stranded compound targeted to HBV are used for the preparation of a medicament for treating a patient suffering or susceptible to an HBV-related condition.
  • the double- stranded compounds disclosed are administered in combination with an HCV agent.
  • the HCV compound is administered simultaneously as the siRNA compound; in other embodiments, the HCV compound is administered separately; so that a dose of each of the HCV agent and the siRNA compound overlap, in time, within the patient's body.
  • Each double-stranded siRNA compound listed in Table 1 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1).
  • SEQ ID NO: 1 GenBANK Accession No. U95551.1
  • Each antisense strand has two mismatched nucleosides inserted at the 3 ' end, as indicated by the asterisk above the relevant nucleoside in the Chemistry column; the remaining nucleosides have 100% complementarity to the target region.
  • Each sense strand has two nucleosides inserted at the 5' end, as indicated by the asterisk above the relevant nucleoside in the Chemistry column; the remaining nucleosides have 100% complementarity to the target region.

Abstract

Disclosed herein are compounds, compositions, and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions. Several embodiments are drawn to compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125.

Description

MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0200WOSEQ.txt created April 22, 2013, which is approximately 28 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
Field
In certain embodiments, methods, compounds, and compositions for inhibiting expression of hepatitis B virus (HBV) mRNA and protein in an animal are provided. In one embodiment, such modulation is via the RNA interference pathway. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases and disorders.
Background Hepatitis B is a viral disease transmitted parenterally by contaminated material such as blood and blood products, contaminated needles, sexually and vertically from infected or carrier mothers to their offspring. It is estimated by the World Health Organization that more than 2 billion people have been infected worldwide, with about 4 million acute cases per year, 1 million deaths per year, and 350-400 million chronic carriers (World Health Organization: Geographic Prevalence of Hepatitis B Prevalence, 2004. http://www.who.int/vaccines- surveillance/graphics/htmls/hepbprev.htm).
The virus, HBV, is a double-stranded hepatotropic virus which infects only humans and non-human primates. Viral replication takes place predominantly in the liver and, to a lesser extent, in the kidneys, pancreas, bone marrow and spleen (Hepatitis B virus biology. Microbiol Mol Biol Rev. 64: 2000; 51-68.). Viral and immune markers are detectable in blood and characteristic antigen-antibody patterns evolve over time. The first detectable viral marker is hepatitis B s antigen (HBsAg), followed by hepatitis B e antigen (HBeAg) and HBV DNA. Titers may be high during the incubation period, but HBV DNA and HBeAg levels begin to fall at the onset of illness and may be undetectable at the time of peak clinical illness (Hepatitis B virus infection— natural history and clinical consequences. N Engl J Med. 350: 2004; 11 18- 1 129). HBeAg is a viral marker detectable in blood and correlates with active viral replication, and therefore high viral load and infectivity (Hepatitis B e antigen— the dangerous end game of hepatitis B. N Engl J Med. 347: 2002; 208-210). The presence of anti-HBsAb and anti-HBcAb (IgG) indicates recovery and immunity in a previously infected individual.
Currently the recommended therapies for chronic HBV infection by the American Association for the Study of Liver Diseases (AASLD) and the European Association for the Study of the Liver (EASL) include interferon alpha (INFa), pegylated interferon alpha-2a (Peg- IFN2a), entecavir, and tenofovir. The nucleoside and nucleotide therapies, entecavir and tenofovir, are successful at reducing viral load, but the rates of HBeAg seroconversion and HBsAg loss are even lower than those obtained using IFNa therapy. Other similar therapies, including lamivudine (3TC), telbivudine (LdT), and adefovir are also used, but for nucleoside/nucleotide therapies in general, the emergence of resistance limits therapeutic efficacy. Thus, there is a need in the art to discover and develop new anti-viral therapies.
R A interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806; Hamilton et al., 1999, Science, 286, 950-951). The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2',5'-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
Several publications have described the structural requirements for the dsRNA trigger required for RNAi activity. Recent reports have indicated that ideal dsRNA sequences are 21 nucleotides in length containing two nucleotide 3 '-end overhangs (Elbashir et al, EMBO (2001), 20, 6877-6887, Sabine Brantl, Biochimica et Biophysica Acta, 2002, 1575, 15-25.) In this system, substitution of the 4 nucleosides from the 3 '-end with 2'-deoxynucleosides has been demonstrated to not affect activity. On the other hand, substitution with 2 -deoxynucleosides or 2'-OMe-nucleosides throughout the sequence (sense or antisense) was shown to be deleterious to RNAi activity.
Tuschl et al, using the Drosophila in vitro system, demonstrated that 21 - and 22-nt RNA fragments are the sequence-specific mediators of RNAi. These fragments, which they termed short interfering RNAs (siRNAs) were shown to be generated by an RNase Ill-like processing reaction from long dsRNA. They also showed that chemically synthesized siRNA duplexes with overhanging 3' ends mediate efficient target RNA cleavage in the Drosophila lysate, and that the cleavage site is located near the center of the region spanned by the guiding siRNA. In addition, they suggest that the direction of dsRNA processing determines whether sense or antisense target RNA can be cleaved by the siRNA-protein complex (Elbashir et al., Genes Dev., 2001, 15, 188- 200). Further characterization of the suppression of expression of endogenous and heterologous genes caused by the 21-23 nucleotide siRNAs have been investigated in several mammalian cell lines, including human embryonic kidney (293) and HeLa cells (Elbashir et al., Nature, 2001, 411, 494-498).
A number of PCT applications have been published that relate to the RNAi phenomenon. These include: PCT publication WO 00/44895; PCT publication WO 00/49035; PCT publication WO 00/63364; PCT publication WO 01/36641 ; PCT publication WO 01/36646; PCT publication WO 99/32619; PCT publication WO 00/44914; PCT publication WO 01/29058; and PCT publication WO 01/75164.
Summary
Several embodiments are drawn to compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125.
Several embodiments are drawn to compounds comprising a modified double-stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand and having a nucleobase sequence comprising at least 5 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125.
Certain embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125, wherein at least one strand of the said oligonucleotide is modified.
Certain embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand and having a nucleobase sequence comprising at least 5 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125, wherein at least one strand of the said oligonucleotide is modified.
Various embodiments are directed to compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein one strand of said oligonucleotide is complementary to SEQ ID NO: 1 and at least one strand of said oligonucleotide is modified.
Various embodiments are directed to compounds comprising a modified double-stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand, wherein one strand of said oligonucleotide is complementary to SEQ ID NO: 1 and at least one strand of said oligonucleotide is modified.
Certain embodiments relate to compounds comprising a modified double- stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein said modified oligonucleotide is complementary to SEQ ID NO: 1.
Certain embodiments relate to compounds comprising a modified double- stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand, wherein said modified oligonucleotide is complementary to SEQ ID NO: 1.
Several embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein the double-stranded oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56- 76, 58-78, 194-214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260- 1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579- 1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588- 1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865- 1885, 1867-1887, 1869-1889, and 1871-1891.
Several embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand, wherein the double- stranded oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56- 76, 58-78, 194-214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260- 1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579- 1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588- 1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865- 1885, 1867-1887, 1869-1889, and 1871-1891.
Several embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein at least one strand of said oligonucleotide is modified and one strand of said oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245- 265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262- 282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381- 401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457- 477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687- 707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265- 1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582- 1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780- 1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871-1891.
Several embodiments provide compounds comprising a modified double-stranded oligonucleotide consisting of 8 to 35 linked nucleosides per strand, wherein at least one strand of said oligonucleotide is modified and one strand of said oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871- 1891.
In certain aspects of any of the aforementioned compounds, one strand of the oligonucleotide is modified.
In certain aspects of any of the aforementioned compounds, two strands of the oligonucleotide are modified.
In some aspects of any of the aforementioned compounds, the modified double-stranded oligonucleotide is at least 96%, 97%, 98%, or 99% complementary to SEQ ID NO: 1. In some aspects, the modified double-stranded oligonucleotide is 100% complementary to SEQ ID NO: 1.
In some aspects of the aforementioned compounds, at least one internucleoside linkage is a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage.
In some aspects of the aforementioned compounds, at least one nucleoside of the modified double-stranded oligonucleotide comprises a modified sugar, such as a bicyclic sugar, a 2'-0-methoxyethyl group, a 2'-0(CH2)2-OCH3 group, or a 4'-CH(CH3)-0-2' group.
In some aspects of the aforementioned compounds, at least one nucleoside of the modified double-stranded oligonucleotide comprises a modified sugar selected from the group consisting of 2'LNA, 2'MOE (2'-0-(CH2)2-OCH3), 4'-thio, 2'-0-methyl, 2'-fluoro, 2'-chloro, 2'- azido, 2'-deoxy-2'- fluoroarabino (FANA), 2'-0-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, 2'- O- difluoromethoxy-ethoxy, 2 '-O-trifluoro methyl, 2'-0-ethyl-trifluoromethoxy, 2 -0- difluoromethoxy-ethoxy, 2' -O-DNP (dinitrophenyl), ENA, UNA (unlocked nucleic acid), HM (4'-C-hydroxymethyl), ADA (2'-N-adamantylmethylcarbonyl-2'-amino-LNA), PYR (2'-N- pyren-l-ylmethyl-2'-amino-LNA), EA (2'-aminoethyl), GE (2'-guanidinoethyl), CE (2'- cyanoethyl), AP (2 -aminopropyl), OXE (oxetane-LNA), CLNA (2',4'-carbocyclic-LNA-locked nucleic acid), CENA (2',4'-carbocyclic-ENA-locked nucleic acid), AENA (2'-deoxy-2'-N,4'-C- ethylene-LNA), ANA (altritol nucleic acid), UNA (hexitol nucleic acid), AEM (2'- aminoethoxymethyl), and APM (2'-aminopropoxymethyl).
In some aspects of the aforementioned compounds, at least one nucleoside comprises a modified nucleobase, such as a 5-methylcytosine. In some aspects of the aforementioned compounds, the compounds further comprise a liposome, polyethylene glycol (PEG), cholesterol, lipid, albumin, nucleic-acid-lipid particle, lipid nanoparticles, or micelle associated with the compound or conjugated to the compound.
Certain embodiments are drawn to a composition comprising any one of the aforementioned compounds or a salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
Several embodiments relate to methods comprising administering to an animal any one of the aforementioned compounds or compositions. In some aspects, the animal is a human. In some aspects, administering the compound prevents, treats, ameliorates, or slows progression of a HBV-related disease, disorder or condition, such as liver disease, jaundice, liver inflammation, liver fibrosis, inflammation, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related transplantation. In some aspecst, the disease or condition is a hyperproliferative condition, such as liver cancer.
Various embodiments relate to methods of reducing antigen levels in an animal comprising administering to said animal any one of the aforementioned compounds or compositions. In some aspects, HBsAG levels or HBeAG levels are reduced. In some aspects, the animal is human. In certain aspects, such methods comprise co-administering the compound or composition and a second agent. In some aspects, the compound or composition and the second agent are administered concomitantly.
Detailed Description
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and/or" unless stated otherwise. Furthermore, the use of the term "including" as well as other forms, such as "includes" and "included", is not limiting. Also, terms such as "element" or "component" encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Definitions
Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GE BANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
Unless otherwise indicated, the following terms have the following meanings:
"2'-modified nucleoside" refers to all nucleosides having a 2'-substituent group that is other than H and OH.
"2'-0-methoxyethyl" (also 2'-MOE and 2'-0(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2' position of a furanose ring. A 2'-0-methoxyethyl modified sugar is a modified sugar.
"2'-MOE nucleoside" (also 2'-0-methoxyethyl nucleoside) means a nucleoside comprising a 2'-M0E modified sugar moiety.
"2 '-substituted nucleoside" means a nucleoside comprising a substituent at the 2'- position of the furanosyl ring other than H or OH. In certain embodiments, 2' substituted nucleosides include nucleosides with bicyclic sugar modifications.
"3 ' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 3 '-most nucleotide of a particular siRNA compound.
"4'-thio modified nucleoside" refers to β-D-ribonucleosides having the 4'-0 replaced with
4*-S.
"4'-thio-2'-modified nucleoside" refers to 4'-thio modified nucleosides having the 2 -OH replaced with a 2'-substituent group. "5' target site" refers to the nucleotide of a target nucleic acid which is complementary to the 5 '-most nucleotide of a particular siRNA compound.
"5-methylcytosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase.
"About" means within ±7% of a value. For example, if it is stated, "the compounds affected at least about 70% inhibition of HBV", it is implied that the HBV levels are inhibited within a range of 63% and 77%.
"Acceptable safety profile" means a pattern of side effects that is within clinically acceptable limits.
"Active pharmaceutical agent" means the substance or substances in a pharmaceutical composition that provide a therapeutic benefit when administered to an individual. For example, in certain embodiments, a siRNA compound targeted to FIBV is an active pharmaceutical agent.
"Active target region" means a target region to which one or more active siRNA compounds is targeted. "Active siRNA compounds" means siRNA compounds that reduce target nucleic acid levels or protein levels.
"Acute hepatitis B infection" results when a person exposed to the hepatitis B virus begins to develop the signs and symptoms of viral hepatitis. This period of time, called the incubation period, is an average of 90 days, but could be as short as 45 days or as long as 6 months. For most people this infection will cause mild to moderate discomfort but will go away by itself because of the body's immune response succeeds in fighting the virus. However, some people, particularly those with compromised immune systems, such as persons suffering from AIDS, undergoing chemotherapy, taking immunosuppressant drugs, or taking steroids, have very serious problems as a result of the acute HBV infection, and go on to more severe conditions such as fulminant liver failure.
"Administered concomitantly" refers to the co-administration of two agents in any manner in which the pharmacological effects of both are manifest in the patient at the same time. Concomitant administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both agents need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive.
"Administering" means providing a pharmaceutical agent to an individual, and includes, but is not limited to administering by a medical professional and self-administering.
"Agent" means an active substance that can provide a therapeutic benefit when administered to an animal. "First Agent" means a therapeutic compound described herein. For example, a first agent can be a siRNA compound targeting HBV. "Second agent" means a second therapeutic compound described herein (e.g. a second siRNA compound targeting HBV) and/or a non- HBV therapeutic compound.
"Aliphatic" refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms wherein the saturation between any two carbon atoms is a single, double or triple bond.
"Alkenyl" refers to a straight or branched hydrocarbon chain radical containing up to twenty four carbon atoms having at least one carbon-carbon double bond.
"Alkoxy" refers to a radical formed between an alkyl group and an oxygen atom wherein the oxygen atom is used to attach the alkoxy group to a parent molecule.
"Alkyl" refers to a saturated straight or branched hydrocarbon radical containing up to twenty four carbon atoms.
"Alkynyl" refers to a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond.
"Amelioration" refers to a lessening of at least one indicator of the severity of a condition or disease. The severity of indicators may be determined by subjective or objective measures which are known to those skilled in the art.
"Animal" refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
"Aryl" and "aromatic" refer to a mono- or polycyclic carbocyclic ring system radical having one or more aromatic rings.
"Base complementarity" refers to the capacity for the precise base pairing of nucleobases of a siRNA compound with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen binding between corresponding nucleobases.
"Bicyclic sugar" means a furanose ring modified by the bridging of two non-geminal carbon atoms. A bicyclic sugar is a modified sugar. "Bicyclic sugar modified nucleoside" refers to nucleosides having a second ring formed from the bridging of 2 atoms of the ribose ring.
"Canonical siRNA" is defined as a double-stranded oligomeric compound having a first strand and a second strand each strand being 21 nucleobases in length with the strands being complementary over 19 nucleobases and having on each 3 ' termini of each strand a deoxy thymidine dimer (dTdT) which in the double-stranded compound acts as a 3 ' overhang.
"Cap structure" or "terminal cap moiety" means chemical modifications, which have been incorporated at either terminus of each strand of a siRNA compound.
"dsRNA" or "dsRNA effector molecule" means a nucleic acid containing a region of two or more nucleotides that are in a double-stranded conformation.
"Chemically distinct region" refers to a region of a siRNA compound that is in some way chemically different than another region of the same siRNA compound.
"Chronic hepatitis B infection" occurs when a person initially suffers from an acute infection but is then unable to fight off the infection. Whether the disease becomes chronic or completely resolves depends mostly on the age of the infected person. About 90% of infants infected at birth will progress to chronic disease. However, as a person ages, the risk of chronic infection decreases such that between 20%-50% of children and less than 10% of older children or adults will progress from acute to chronic infection. Chronic HBV infections are the primary treatment goal for embodiments of the present invention, although ASO compositions of the present invention are also capable of treating HBV-related conditions, such as inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, and more.
"Co-administration" means administration of two or more pharmaceutical agents to an individual. The two or more pharmaceutical agents may be in a single pharmaceutical composition, or may be in separate pharmaceutical compositions. Each of the two or more pharmaceutical agents may be administered through the same or different routes of administration. Co-administration encompasses administration in parallel or sequentially.
"Complementarity" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.
"Comply" means the adherence with a recommended therapy by an individual.
"Comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
"Contiguous nucleobases" means nucleobases immediately adjacent to each other.
"Cure" means a method or course that restores health or a prescribed treatment for an illness.
"Deoxyribonucleotide" means a nucleotide having a hydrogen at the 2' position of the sugar portion of the nucleotide. Deoxyribonucleotides may be modified with any of a variety of substituents.
"Designing" or "Designed to" refer to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
"Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in drugs that are injected, the diluent may be a liquid, e.g. saline solution.
"Dosage unit" means a form in which a pharmaceutical agent is provided, e.g. pill, tablet, or other dosage unit known in the art.
"Dose" means a specified quantity of a pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or inj ections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose requires a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in an individual. In other embodiments, the pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month.
"Dosing regimen" is a combination of doses designed to achieve one or more desired effects.
"Double-stranded oligonucleotide", "double-stranded compound", and "double-stranded composition" as used herein encompass the terms " short interfering nucleic acid", "short interfering RNA", "siRNA", "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", or "chemically modified short interfering nucleic acid molecule" as defined below. In certain embodiments, it is contemplated that double-stranded oligonucleotides are formed from only one strand, for example by taking the form of a self-complementary hairpin-type molecule that doubles back on itself to form a duplex. Thus, the double-stranded oligonucleotides can be fully or partially double-stranded. For example, when formed from two strands, or a single strand that takes the form of a self-complementary hairpin-type molecule doubled back on itself to form a duplex, the two strands (or duplex-forming regions of a single strand) are complementary strands that base pair in Watson-Crick fashion.
"Duration" means the period of time during which an activity or event continues. In certain embodiments, the duration of treatment is the period of time during which doses of a pharmaceutical agent are administered.
"Effective amount" in the context of modulating an activity or of treating or preventing a condition means the administration of that amount of active ingredient to a subject in need of such modulation, treatment or prophylaxis, either in a single dose or as part of a series, that is effective for modulation of that effect, or for treatment or prophylaxis or improvement of that condition. The effective amount will vary depending upon the health and physical condition of the subject to be treated, the taxonomic group of subjects to be treated, the formulation of the composition, the assessment of the medical situation, and other relevant factors.
"Efficacy" means the ability to produce a desired effect.
"Expression" includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.
"Fully complementary" or "100% complementary" means each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, a first nucleic acid is a siRNA compound and a target nucleic acid is a second nucleic acid.
"Fully modified motif refers to a siRNA compound comprising a contiguous sequence of nucleosides wherein essentially each nucleoside is a sugar modified nucleoside having uniform modification.
"Halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine and iodine.
"HBV" means mammalian hepatitis B virus, including human hepatitis B virus. The term encompasses geographical genotypes of hepatitis B virus, particularly human hepatitis B virus, as well as variant strains of geographical genotypes of hepatitis B virus. "HBV antigen" means any hepatitis B virus antigen or protein, including core proteins such as "hepatitis B core antigen" or "HBcAG" and "hepatitis B E antigen" or "HBeAG" and envelope proteins such as "HBV surface antigen", or "HBsAg" or "HBsAG".
"Hepatitis B E antigen" or "HBeAg" or "HBeAG" is a secreted, non-particulate form of HBV core protein. HBV antigens HBeAg and HBcAg share primary amino acid sequences, so show cross-reactivity at the T cell level. HBeAg is not required for viral assembly or replication, although studies suggest they may be required for establishment of chronic infection. Neonatal infection with HBeAg-negative mutant often results in fulminant acute rather than chronic HBV infection (Terezawa et al (1991) Pediatr. Res. 29:5), whereas infection of young woodchucks with WHeAg-negative mutant results in a much lower rate of chronic WHV infection (Cote et al (2000) Hepatology 31 : 190). HBeAg may possibly function as a toleragen by inactivating core specific T cells through deletion or clonal anergy (Milich et al (1998) J. Immunol. 160:8102). There is a positive correlation between reduction of HBV viral load and antigens, and a decrease of expression, by T cells, of the inhibitory receptor programmed death- 1 (PD-1 ; also known as PDCD1), a negative regulator of activated T cells, upon antiviral therapy and HBeAg seroconversion (Evans et al (2008) Hepatology 48:759).
"HBV mRNA" means any messenger RNA expressed by hepatitis B virus.
"HBV nucleic acid" or 'HBV DNA" means any nucleic acid encoding HBV. For example, in certain embodiments, a HBV nucleic acid includes, without limitation, any viral DNA sequence encoding a HBV genome or portion thereof, any RNA sequence transcribed from a viral DNA including any mRNA sequence encoding a HBV protein.
"HBV protein" means any protein secreted by hepatitis B virus The term encompasses various HBV antigens, including core proteins such as "Hepatitis E antigen", "HBeAg" or "HBeAG" and envelope proteins such as "HBV surface antigen", or "HBsAg".
"HBV surface antigen", or "HBsAg", or "HBsAG" is the envelope protein of infectious
HBV viral particles but is also secreted as a non- infectious particle with serum levels 1000-fold higher than HBV viral particles. The serum levels of HBsAg in an infected person or animal can be as high as 1000 μg/mL (Kann and Gehrlich (1998) Topley & Wilson' s Microbiology and Microbial Infections, 9th ed. 745). In acute HBV infections, the half-life of HBsAg in the serum, or serum t½, is 8.3 days (Chulanov et al (2003) J. Med. Virol. 69: 313). Internalization of HBsAg by myeloid dendritic cells inhibits up-regulation of co- stimulatory molecules (i.e. B7) and inhibits T cell stimulatory capacity (den Brouw et al (2008) Immunology 126:280), and dendritic cells from chronically infected patients also show deficits in expression of co-stimulatory molecules, secretion of IL-12, and stimulation of T cells in the presence of HBsAg (Zheng et al (2004) J. Viral Hepatitis 1 1 :217). HBsAg specific CD 8 cells from CHB patients show altered tetramer binding. These CD8 cells are not anergic but may have TCR topology that confers partial tolerance or ignorance (Reignat et al (2002) J. Exp. Med. 195: 1089). Moreover, reduction in serum HBsAg > 1 log at week 24 has a high predictive value (92%) for sustained virological response (SVR - defined as nondetectable HBV DNA by PCR at 1 year after treatment) during Peg-IFN 2a therapy (Moucari et al (2009) Hepatology 49: 1151).
"Hemimer motif is meant to include a sequence of nucleosides that have uniform sugar moieties (identical sugars, modified or unmodified) and wherein one of the 5'-end or the 3'-end has a sequence of from 2 to 12 nucleosides that are nucleosides that are different from the other nucleosides in the hemimer modified oligomeric compound. For example, a typical hemimer is an oligomeric compound comprising β-D-ribonucleosides that have a sequence of deoxyribonucleosides at one of the termini.
"Hepatitis B-related condition" or "HBV-related condition" means any disease, biological condition, medical condition, or event which is exacerbated, caused by, related to, associated with, or traceable to a hepatitis B infection, exposure, or illness. The term hepatitis B- related condition includes chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, liver disease related to transplantation, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey- colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen.
"Heterocyclic" refers to a radical mono-, or poly-cyclic ring system that includes at least one heteroatom and is unsaturated, partially saturated or fully saturated, thereby including heteroaryl groups. Heterocyclic is also meant to include fused ring systems wherein one or more of the fused rings contain no heteroatoms. "Hybridization" means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an siRNA compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, a siRNA compound and a nucleic acid target.
"Identifying an animal having an HBV infection" means identifying an animal having been diagnosed with an HBV; or, identifying an animal having any symptom of an HBV infection including, but not limited to chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, liver disease related to transplantation, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen.
"Immediately adjacent" means there are no intervening elements between the immediately adjacent elements.
"Individual" means a human or non-human animal selected for treatment or therapy.
"Individual compliance" means adherence to a recommended or prescribed therapy by an individual.
"Induce", "inhibit", "potentiate", "elevate", "increase", "decrease" or the like, generally denote quantitative differences between two states. For example, "an amount effective to inhibit the activity or expression of HBV" means that the level of activity or expression of HBV in a treated sample will quantitatively differ from the level of HBV activity or expression in untreated cells. Such terms are applied to, for example, levels of expression, and levels of activity.
"Inhibiting HBV" means reducing the level or expression of an HBV mRNA, DNA and/or protein. In certain embodiments, HBV is inhibited in the presence of an siRNA compound targeting HBV, as compared to expression of HBV mRNA, DNA and/or protein levels in the absence of a HBV siRNA compound. "Inhibiting the expression or activity" refers to a reduction, blockade of the expression or activity and does not necessarily indicate a total elimination of expression or activity.
"Injection site reaction" means inflammation or abnormal redness of skin at a site of injection in an individual.
"Internucleoside linkage" refers to the chemical bond between nucleosides.
"Intraperitoneal administration" means administration through infusion or injection into the peritoneum.
"Intravenous administration" means administration into a vein.
"Lengthened" siRNA oligonucleotides are those that have one or more additional nucleosides relative to an siRNA oligonucleotide disclosed herein.
"Linked deoxynucleoside" means a nucleic acid base (A, G, C, T, U) substituted by deoxyribose linked by a phosphate ester to form a nucleotide.
"Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.
"Linking moiety" is generally a bi-functional group, covalently binds the ultimate 3'- nucleoside (and thus the nascent oligonucleotide) to the solid support medium during synthesis, but which is cleaved under conditions orthogonal to the conditions under which the 5 '-protecting group, and if applicable any 2 '-protecting group, are removed
"Locked nucleic acid" or " LNA" or "LNA nucleosides" means nucleic acid monomers having a bridge connecting two carbon atoms between the 4' and 2'position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to A) a-L-Methyleneoxy (4'-CH2-0-2') LNA , (B) β-D-Methyleneoxy (4'-CH2-0- 2') LNA , (C) Ethyleneoxy (4'-(CH2)2-0-2') LNA , (D) Aminooxy (4'-CH2-0-N(R)-2') LNA and (E) Oxyamino (4'-CH2-N(R)-0-2') LNA, as depicted below.
Figure imgf000018_0001
As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and the 2' position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from -[C(Ri)(R2)]„-, -C(R =C(R2)-, -C(R =N-, -C(=NRi)-, -C(=0)-, -C(=S)-, -0-, -Si(Ri)2-, -S(=0)x- and -N(Ri)-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ri and R2 is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOL, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0)2-Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group.
Examples of 4'- 2' bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: -[C(Ri)(R2)]„-, -[C(Ri)(R2)]„-0-, -C(RiR2)-N(Ri)-0- or - C(RiR2)-0-N(Ri)-. Furthermore, other bridging groups encompassed with the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-0-2', 4'-(CH2)2-0-2', 4'-CH2-0-N(Ri)-2' and 4'- CH2-N(Ri)-0-2'- bridges, wherein each Ri and R2 is, independently, H, a protecting group or Ci- C12 alkyl.
Also included within the definition of LNA according to the invention are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-0-2') bridge to form the bicyclic sugar moiety. The bridge can also be a methylene (-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, for which the term methyleneoxy (4'-CH2-0-2') LNA is used. Furthermore; in the case of the bicylic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4'-CH2CH2-0-2') LNA is used, a -L- methyleneoxy (4'-CH2-0-2'), an isomer of methyleneoxy (4'-CH2-0-2') LNA is also encompassed within the definition of LNA, as used herein.
"Mismatch" or "non-complementary nucleobase" refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid.
"Modified internucleoside linkage" refers to a substitution or any change from a naturally occurring internucleoside bond (i.e. a phosphodiester internucleoside bond). "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An "unmodified nucleobase" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
"Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
"Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, modified internucleoside linkage, or modified nucleobase.
"Modified oligonucleotide" means an oligonucleotide comprising at least one modified internucleoside linkage, a modified sugar, and/or a modified nucleobase.
"Modified sugar" means substitution and/or any change from a natural sugar moiety.
"Monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occuring or modified.
"Motif means the pattern of unmodified and modified nucleosides in a siRNA compound.
"Natural sugar moiety" means a sugar moiety found in DNA (2'-H) or RNA (2'-OH).
"Naturally occurring internucleoside linkage" means a 3 ' to 5' phosphodiester linkage. "Non-complementary nucleobase" refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
"Nucleic acid" refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single- stranded nucleic acids, double- stranded nucleic acids, siRNA, and microRNAs (miRNA).
"Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.
"Nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of a siRNA compound that is capable of base pairing with a nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of a siRNA compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the siRNA and the target nucleic acid is considered to be complementary at that nucleobase pair. "Nucleobase sequence" means the order of contiguous nucleobases independent of any sugar, linkage, and/or nucleobase modification.
"Nucleoside" means a nucleobase linked to a sugar.
"Nucleoside mimetic" includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo or tricyclo sugar mimetics, e.g., non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=0)-0- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for a sugar, a nucleobase, and/ or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
"Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
"Off-target effect" refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.
"Oligomeric compound" means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
"Oligonucleoside" means an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.
"Oligonucleotide" means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another.
"Parenteral administration" means administration through injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g., intrathecal or intracerebroventricular administration.
"Patient" refers to a mammal that is afflicted with one or more disorders associated with expression or overexpression of one or more genes. It will be understood that the most suitable patient is a human. It is also understood that this invention relates specifically to the inhibition of mammalian expression or overexpression of one or more genes.
"Peptide" means a molecule formed by linking at least two amino acids by amide bonds. Without limitation, as used herein, "peptide" refers to polypeptides and proteins.
"Pharmaceutically acceptable carrier" means a medium or diluent that does not interfere with the structure of the oligonucleotide. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject.
"Pharmaceutically acceptable derivative" encompasses pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.
"Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of siRNA compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.
"Pharmaceutical agent" means a substance that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, a siRNA compound targeted to HBV is a pharmaceutical agent.
"Pharmaceutical composition" means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise a siRNA compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
"Phosphorothioate linkage" means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.
"Positionally modified motif refers to a sequence of β-D-ribonucleosides wherein the sequence is interrupted by two or more regions comprising from 1 to about 4 sugar modified nucleosides
"Portion" means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a siRNA compound.
"Prevention" or "preventing" refers to delaying or forestalling the onset or development of a condition or disease for a period of time from hours to days, preferably weeks to months.
"Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
"Promiscuous base" refers to a monomer in a first sequence that can pair with a naturally occuring base, i.e A, C, G, T or U at a corresponding position in a second sequence of a duplex in which the promiscuous base can pair non-discriminantly with more than one of the naturally occurring bases, i.e. A, C, G, T, U.
"Prophylactically effective amount" refers to an amount of a pharmaceutical agent that provides a prophylactic or preventative benefit to an animal.
"Protecting group" refers to a labile chemical moiety which is known in the art to protect reactive groups including without limitation, hydroxyl, amino and thiol groups, against undesired reactions during synthetic procedures.
"Recommended therapy" means a therapeutic regimen recommended by a medical professional for the treatment, amelioration, or prevention of a disease.
"Region" is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
"Ribonucleotide" means a nucleotide having a hydroxy at the 2' position of the sugar portion of the nucleotide. Ribonucleotides may be modified with any of a variety of substituents.
"Salts" mean a physiologically and pharmaceutically acceptable salts of siRNA compounds, i.e., salts that retain the desired biological activity of the parent siRNA and do not impart undesired toxicological effects thereto.
"Segments" are defined as smaller or sub-portions of regions within a target nucleic acid. "Seroconversion" is defined as serum HBeAg absence plus serum HBeAb presence, if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence, if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems.
"Short dsRNA" comprises a double-stranded region of at least 19 contiguous basepairs in length identical/complementary to a target sequence to be inhibited.
"Short interfering nucleic acid", "short interfering RNA", "siRNA", "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", or "chemically modified short interfering nucleic acid molecule" as used herein refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication; for example, by mediating RNA interference, "RNAi", or gene silencing in a sequence-specific manner. As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
"Shortened" or "truncated" versions of siRNA compounds taught herein have one, two or more nucleosides deleted.
"Side effects" means physiological responses attributable to a treatment other than desired effects. In certain embodiments, side effects include, without limitation, injection site reactions, liver function test abnormalities, renal function abnormalities, liver toxicity, renal toxicity, central nervous system abnormalities, and myopathies. For example, increased aminotransferase levels in serum may indicate liver toxicity or liver function abnormality. For example, increased bilirubin may indicate liver toxicity or liver function abnormality.
"Sites," as used herein, are defined as unique nucleobase positions within a target nucleic acid.
"Slows progression" means decrease in the development of the said disease.
"Specifically hybridizable" refers to a siRNA compound having a sufficient degree of complementarity between an one of the strands of the siRNA compound and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays and therapeutic treatments. "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to a minimal number of other sequences.
"Subcutaneous administration" means administration just below the skin.
"Subject" means a human or non-human animal selected for treatment or therapy.
"Substituent" and "substituent group" are meant to include groups that are typically added to other groups or parent compounds to enhance desired properties or give desired effects.
"Sugar modified nucleosides" as used in the present invention is intended to include all manner of sugar modifications known in the art. The sugar modified nucleosides can have any heterocyclic base moiety and internucleoside linkage and may include further groups independent from the sugar modification.
"Target" refers to a protein, the modulation of which is desired.
"Target gene" refers to a gene encoding a target.
"Targeting" means the process of design and selection of a siRNA compound that will specifically hybridize to a target nucleic acid and induce a desired effect.
"Target nucleic acid," "target RNA," "target R A transcript" and "nucleic acid target" all mean a nucleic acid capable of being targeted by siRNA compounds.
"Target region" means a portion of a target nucleic acid to which one or more siRNA compounds is targeted.
"Target segment" means the sequence of nucleotides of a target nucleic acid to which a siRNA compound is targeted. "5' target site" refers to the 5 '-most nucleotide of a target segment. "3' target site" refers to the 3 '-most nucleotide of a target segment.
"Therapeutically effective amount" means an amount of a pharmaceutical agent that provides a therapeutic benefit to an individual.
"Treatment" refers to administering a composition to effect an alteration or improvement of the disease or condition.
"Universal base" refers to a moiety that may be substituted for any base.
"Unmodified" nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
"Unmodified nucleotide" means a nucleotide composed of naturally occuring nucleobases, sugar moieties, and internucleoside linkages. In certain embodiments, an unmodified nucleotide is an RNA nucleotide (i.e. β-D-ribonucleosides) or a DNA nucleotide (i.e. β-D-deoxyribonucleoside). "Validated target segment" is defined as at least an 8-nucleobase portion (i.e. 8 consecutive nucleobases) of a target region to which an active oligomeric compound is targeted.
Certain Embodiments
Certain embodiments provide methods, compounds, and compositions for inhibiting
HBV mRNA expression.
Certain embodiments provide siRNA compounds targeted to a HBV nucleic acid. In certain embodiments, the HBV nucleic acid is the sequences set forth in GENBANK Accession No. U95551.1 (incorporated herein as SEQ ID NO: 1).
Certain embodiments provide methods, compounds, and compositions for inhibiting
HBV mRNA expression.
Certain embodiments provide compounds and compositions comprising double-stranded oligonucleotides targeted to a HBV nucleic acid. In certain embodiments, the HBV nucleic acid is the sequences set forth in GENBANK Accession No. U95551.1 (incorporated herein as SEQ ID O: l).
In certain embodiments, the compounds or compositions comprise a modified double- stranded oligonucleotide 10 to 30 linked nucleosides in length targeted to HBV. The HBV target can have a sequence recited in SEQ ID NO: 1 or a portion thereof or a variant thereof.
In certain embodiments, the compounds provided herein are double-stranded oligonucleotides 10 to 30 linked nucleosides in length and are targeted to HBV. In certain embodiments, the HBV target has the sequence recited in SEQ ID NO: 1. In certain embodiments, such compounds or oligonucleotides target one of the following nucleotide regions of HBV: CCTGCTGGTGGCTCCAGTTC (SEQ ID NO: 2 ); AGAGTCTAGACTCGTGGTGGACTTCTCTCA (SEQ ID NO: 3); CATCCTGCTGCTATGCCTCATCTTCTT (SEQ ID NO: 4); CAAGGTATGTTGCCCGT (SEQ ID NO: 5); CCTATGGGAGTGGGCCTCAG (SEQ ID NO: 6; TGGCTCAGTTTACTAGTGCCATTTGTTCAGTGGTTCG (SEQ ID NO: 7); TATATGGATGATGTGGT (SEQ ID NO: 8); TGCCAAGTGTTTGCTGA (SEQ ID NO: 9); TGCCGATCCATACTGCGGAACTCCT (SEQ ID NO: 10); CCGTGTGCACTTCGCTTCACCTCTGCACGT (SEQ ID NO: 11);
GGAGGCTGTAGGCATAAATTGGT (SEQ ID NO: 12); CTTTTTCACCTCTGCCTA (SEQ ID NO: 13); TTCAAGCCTCCAAGCTGTGCCTTGG (SEQ ID NO: 14); AGAGTCTAGACTCGTGGTGGACTTCTCTCAATTTTCTAGGGG (SEQ ID NO: 15); TGGATGTGTCTGCGGCGTTTTATCAT (SEQ ID NO: 16); TGTATTCCCATCCCATC (SEQ ID NO: 17); TGGCTCAGTTTACTAGTGC (SEQ ID NO: 18); GGGCTTTCCCCCACTGT (SEQ ID NO: 19); TCCTCTGCCGATCCATACTGCGGAACTCCT (SEQ ID NO: 20); CGCACCTCTCTTTACGCGG (SEQ ID NO: 21); GGAGTGTGGATTCGCAC (SEQ ID NO: 22); or GAAGAAGAACTCCCTCGCCT (SEQ ID NO: 23).
In certain embodiments, a double- stranded compound or oligonucleotide targeted to a HBV nucleic acid is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258- 278, 259-279, 260-280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301- 321, 303-323, 374-394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414- 434, 416-436, 418-438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670- 690, 677-697, 679-699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260- 1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579- 1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588- 1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865- 1885, 1867-1887, 1869-1889, and 1871-1891.
In certain embodiments, a double- stranded compound or oligonucleotide targeted to a HBV nucleic acid target the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194- 214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260- 280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374- 394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418- 438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679- 699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871-1891.
In certain embodiments, a double- stranded compound or oligonucleotide targets a region of a HBV nucleic acid. In certain embodiments, such compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotides target the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194- 214, 196-216, 245-265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260- 280, 261-281, 262-282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374- 394, 376-396, 381-401, 383-403, 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418- 438, 455-475, 457-477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679- 699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871-1891.
In certain embodiments, a modified double-stranded compound or oligonucleotide comprising one or more chemical modifications targets a region of a HBV nucleic acid. In certain embodiments, such modified compounds or oligonucleotides targeted to a region of a HBV nucleic acid have a contiguous nucleobase portion that is complementary to an equal length nucleobase portion of the region. For example, the portion can be at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleobases portion complementary to an equal length portion of a region recited herein. In certain embodiments, such compounds or oligonucleotides target the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245- 265, 247-267, 251-271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262- 282, 263-283, 264-284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381- 401, 383-403 , 409-429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457- 477, 463-483, 465-485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687- 707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265- 1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582- 1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780- 1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871-1891. Several embodiments relate to double-stranded compositions wherein each strand comprises a motif defined by the location of one or more modified or unmodified nucleosides. Compositions are provided comprising a first and a second oligomeric compound that are fully or at least partially hybridized to form a duplex region and further comprising a region that is complementary to and hybridizes to a nucleic acid target. It is suitable that such a composition comprise a first oligomeric compound that is an antisense strand having full or partial complementarity to a nucleic acid target and a second oligomeric compound that is a sense strand having one or more regions of complementarity to and forming at least one duplex region with the first oligomeric compound.
The compositions of several embodiments modulate gene expression by hybridizing to a nucleic acid target resulting in loss of its normal function. In some embodiments, the target nucleic acid is a messenger RNA. In another embodiment, the degradation of the targeted messenger RNA is facilitated by an activated RISC complex that is formed with compositions of the embodiments.
Several embodiments are directed to double-stranded compositions wherein one of the strands is useful in, for example, influencing the preferential loading of the opposite strand into the RISC (or cleavage) complex. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In some embodiments, the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.
Certain embodiments are drawn to double- stranded compositions wherein both the strands comprises a hemimer motif, a fully modified motif, a positionally modified motif or an alternating motif. Each strand of the compositions of the present embodiments can be modified to fulfil a particular role in for example the siRNA pathway. Using a different motif in each strand or the same motif with different chemical modifications in each strand permits targeting the antisense strand for the RISC complex while inhibiting the incorporation of the sense strand. Within this model, each strand can be independently modified such that it is enhanced for its particular role. The antisense strand can be modified at the 5'-end to enhance its role in one region of the RISC while the 3 '-end can be modified differentially to enhance its role in a different region of the RI S C .
Another embodiment provides a method for treating a HBV-related diseases, disorders, and conditions in a mammal, the method comprising administering a therapeutically effective amount of any pharmaceutical composition as described above to a mammal in need thereof, so as to treat the HBV-related diseases, disorders, and condition. In related embodiments, the mammal is a human and the HBV-related disease, disorder, and condition is a hepatitis B virus infection from a human hepatitis B virus. More particularly, the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).
Examples of HBV-related diseases, disorders or conditions include, but are not limited to chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, and conditions having symptoms which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen.
Certain embodiments provide a method for treating an animal with a HBV related disease, disorder or condition comprising: a) identifying said animal with the HBV related disease, disorder or condition, and b) administering to said animal a therapeutically effective amount of a compound or composition comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to any of SEQ ID NOs: 1-23, as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound or composition administered to the animal treats or reduces the HBV related disease, disorder or condition, or a symptom thereof, in the animal. In certain embodiments, the HBV related disease, disorder or condition is a liver disease. In certain embodiments, the related disease, disorder or condition is chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related to transplantation. Certain embodiments provide a method for treating an animal with a HBV related disease, disorder or condition comprising: a) identifying said animal with the HBV related disease, disorder or condition, and b) administering to said animal a therapeutically effective amount of a compound or composition comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides and having a nucleobase sequence at least 90% complementary to SEQ ID NO: 1, as measured over the entirety of said modified oligonucleotide. In certain embodiments, the therapeutically effective amount of the compound or composition administered to the animal treats or reduces the HBV related disease, disorder or condition, or a symptom thereof, in the animal. In certain embodiments, the HBV related disease, disorder or condition is a liver disease. In certain embodiments, the related disease, disorder or condition is chronic HBV infection, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related to transplantation.
In certain embodiments, HBV has the sequence as set forth in GenBank Accession Numbers U95551.1 (incorporated herein as SEQ ID NO: 1) or any variant or fragment thereof. In certain embodiments, HBV has truncated portions of the human sequence as set forth in SEQ ID NOs: 1-23.
In certain embodiments, the animal is a human.
In certain embodiments, the compounds or compositions are designated as a first agent. In certain embodiments, the methods comprise administering a first agent and one or more second agents. In certain embodiments, the methods comprise administering a first agent and one or more second agents. In certain embodiments, the first agent and one or more second agents are co-administered. In certain embodiments the first agent and one or more second agents are coadministered sequentially or concomitantly.
In certain embodiments, the one or more second agents are also a compound or composition described herein. In certain embodiments, the one or more second agents are different from a compound or composition described herein. Examples of one or more second agents include, but are not limited to, an anti-inflammatory agent, chemotherapeutic agent or anti-infection agent.
In other related embodiments, the additional therapeutic agent may be an HBV agent, an HCV agent, a chemotherapeutic agent, an antibiotic, an analgesic, a non-steroidal anti- inflammatory (NSAID) agent, an antifungal agent, an antiparasitic agent, an anti-nausea agent, an anti-diarrheal agent, or an immunosuppressant agent.
In certain embodiments, the one or more second agents are an HBV agent. In certain embodiments the HBV agent can include, but is not limited to, interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir (ETV); tenofovir diisoproxil fumarate (TDF); telbivudine (LdT); adefovir; or an HBV antibody therapy (monoclonal or polyclonal).
In certain embodiments, the one or more second agents are an HCV agent. In certain embodiments the HBV agent can include, but is not limited to interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; or an HCV monoclonal or polyclonal antibody therapy.
In certain embodiments, the one or more second agents are an anti-inflammatory agent
(i.e., an inflammation lowering therapy). In certain embodiments the inflammation lowering therapy can include, but is not limited to, a therapeutic lifestyle change, a steroid, a NSAID or a DMARD. The steroid can be a corticosteroid. The NSAID can be an aspirin, acetaminophen, ibuprofen, naproxen, COX inhibitors, indomethacin and the like. The DMARD can be a TNF inhibitor, purine synthesis inhibitor, calcineurin inhibitor, pyrimidine synthesis inhibitor, a sulfasalazine, methotrexate and the like.
In certain embodiments, the one or more second agents are a chemotherapeutic agent (i.e., a cancer treating agent). Chemotherapeutic agents can include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine (CA), 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FTJ), 5- fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide, trimetrexate, teniposide, cisplatin, gemcitabine and diethylstilbestrol (DES).
In certain embodiments, the one or more second agents are an anti-infection agent. Examples of anti-infection agents include, but are not limited to, antibiotics, antifungal drugs and antiviral drugs.
In certain embodiments, administration comprises parenteral administration.
Certain embodiment provides a method for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment. In some embodiments, the mammal may be human, and the hepatitis B virus may be a human hepatitis B virus. More particularly, the human hepatitis B virus may be any of the human geographical genotypes: A (Northwest Europe, North America, Central America); B (Indonesia, China, Vietnam); C (East Asia, Korea, China, Japan, Polynesia, Vietnam); D (Mediterranean area, Middle East, India); E (Africa); F (Native Americans, Polynesia); G (United States, France); or H (Central America).
In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 70% compared to the amount before administration of the double-stranded compound. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 75% compared to the amount before administration of the double- stranded compound. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 80% compared to the amount before administration of the modified double-stranded compound. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 85% compared to the amount before administration of the double-stranded compound. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 90% compared to the amount before administration of the double-stranded compound. In certain embodiments, a method is provided for reducing an amount of HBV mRNA, DNA, protein and/or an amount of HBV antigen in a mammal infected with a hepatitis B virus, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal in need thereof so as to reduce the hepatitis B virus infection and the hepatitis B antigen, compared to the amount of HBV mRNA, protein and an amount of HBV antigen in the mammal before treatment, wherein the amount of mRNA is reduced at least 95% compared to the amount before administration of the double-stranded compound. In related methods, the HBV antigen may be HBsAg or may be HBeAg, and more particularly, the amount of HBV antigen may be sufficiently reduced to result in seroconversion, defined as serum HBeAg absence plus serum HBeAb presence if monitoring HBeAg as the determinant for seroconversion, or defined as serum HBsAg absence if monitoring HBsAg as the determinant for seroconversion, as determined by currently available detection limits of commercial ELISA systems.
Certain embodiment provides a method for promoting seroconversion of a hepatitis B virus in a mammal infected with HBV, the method comprising administering a therapeutically effective amount of a pharmaceutical composition as described above to a mammal infected with hepatitis B; monitoring for presence of HBeAg plus HBeAb in a serum sample of the mammal, or monitoring for presence of HBsAg in a serum sample of the mammal, such that the absence of HBeAg plus the presence of HBeAb in the serum sample if monitoring HBeAg as the determinant for seroconversion, or the absence of HBsAg in the serum sample if monitoring HBsAg as the determinant for seroconversion, as determined by current detection limits of commercial ELISA systems, is indication of seroconversion in the mammal.
Certain embodiments provide the use of a compound or composition as described herein for preventing, ameliorating or treating liver disease, or symptom thereof, in an animal. In certain embodiments, the compound or composition comprises a modified double-stranded oligonucleotide 10 to 30 linked nucleosides in length per strand targeted to HBV. In certain embodiments, the modified double-stranded oligonucleotide has a nucleobase sequence comprising at least 10 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 1-23.
Certain embodiments provide the use of a compound or composition as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing an HBV- related disease, disorder or condition in an animal.
Certain embodiments provide the use of a compound or composition as described herein in the manufacture of a medicament for treating, ameliorating, delaying or preventing liver disease in an animal.
Certain embodiments provide a kit for treating, preventing, or ameliorating an HBV- related disease, disorder or condition, or a symptom thereof, as described herein wherein the kit comprises: a) a compound or compositions as described herein; and optionally b) an additional agent or therapy as described herein. The kit can further include instructions or a label for using the kit to treat, prevent, or ameliorate the HBV-related disease, disorder or condition. Double-stranded Oligonucleotides
The terms "double-stranded oligonucleotide", "chemically modified double-stranded oligonucleotide", "short interfering nucleic acid", "short interfering RNA", "siRNA", "short interfering nucleic acid molecule", "short interfering oligonucleotide molecule", or "chemically modified short interfering nucleic acid molecule" as used herein refer to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication; for example, by mediating RNA interference (RNAi) or gene silencing in a sequence-specific manner; see, for example, Zamore et al., 2000, Cell, 101, 25-33; Bass, 2001, Nature, 41 1, 428- 429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., International PCT Publication No. WO 00/44895; Zernicka-Goetz et al., International PCT Publication No. WO 01/36646; Fire, International PCT Publication No. WO 99/32619; Plaetinck et al., International PCT Publication No. WO 00/01846; Mello and Fire, International PCT Publication No. WO 01/29058; Deschamps-Depaillette, International PCT Publication No. WO 99/07409; and Li et al., International PCT Publication No. WO 00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; lenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene & Dev., 16, 1616-1626; and Reinhart & Battel, 2002, Science, 297, 1831).
Non limiting examples of double-stranded oligonucleotide molecules of the embodiments are shown in Table 1 herein. For example, the double-stranded oligonucleotide molecules can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double- stranded oligonucleotide molecules can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double-stranded structure, for example wherein the double-stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the double-stranded oligonucleotide molecule are complementary to the target nucleic acid or a portion thereof). Alternatively, the double-stranded oligonucleotide is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siRNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
The double-stranded oligonucleotide can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The double-stranded oligonucleotide can be a circular single- stranded polynucleotide having two or more loop structures and a stem comprising self- complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNAi.
In certain embodiments, the double-stranded oligonucleotide comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non- covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions. In certain embodiments, the double- stranded oligonucleotide comprises nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the double-stranded oligonucleotide interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
As used herein, double-stranded oligonucleotides need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non- nucleotides. In certain embodiments, the short interfering nucleic acid molecules lack 2'- hydroxy (2'-OH) containing nucleotides. In certain embodiments short interfering nucleic acids optionally do not include any ribonucleotides (e.g., nucleotides having a 2'-OH group). Such double-stranded oligonucleotides that do not require the presence of ribonucleotides within the molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2'-OH groups. Optionally, double-stranded oligonucleotides can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, double- stranded oligonucleotides can be used to epigenetically silence genes at both the post-transcriptional level and the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siRNA molecules of the embodiments can result from siRNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676, Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al, 2002, Science, 297, 2232-2237).
It is contemplated that compounds and compositions of several embodiments provided herein can target HBV by a dsRNA-mediated gene silencing or RNAi mechanism, including, e.g., "hairpin" or stem-loop double-stranded RNA effector molecules in which a single RNA strand with self-complementary sequences is capable of assuming a double-stranded conformation, or duplex dsRNA effector molecules comprising two separate strands of RNA. In various embodiments, the dsRNA consists entirely of ribonucleotides or consists of a mixture of ribonucleotides and deoxynucleotides, such as the RNA/DNA hybrids disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U. S. Ser. No. 60/130,377, filed Apr. 21, 1999. The dsRNA or dsRNA effector molecule may be a single molecule with a region of self-complementarity such that nucleotides in one segment of the molecule base pair with nucleotides in another segment of the molecule. In various embodiments, a dsRNA that consists of a single molecule consists entirely of ribonucleotides or includes a region of ribonucleotides that is complementary to a region of deoxyribonucleotides. Alternatively, the dsRNA may include two different strands that have a region of complementarity to each other.
In various embodiments, both strands consist entirely of ribonucleotides, one strand consists entirely of ribonucleotides and one strand consists entirely of deoxyribonucleotides, or one or both strands contain a mixture of ribonucleotides and deoxyribonucleotides. In certain embodiments, the regions of complementarity are at least 70, 80, 90, 95, 98, or 100% complementary to each other and to a target nucleic acid sequence. In certain embodiments, the region of the dsRNA that is present in a double-stranded conformation includes at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 50, 75, 100, 200, 500, 1000, 2000 or 5000 nucleotides or includes all of the nucleotides in a cDNA or other target nucleic acid sequence being represented in the dsRNA. In some embodiments, the dsRNA does not contain any single stranded regions, such as single stranded ends, or the dsRNA is a hairpin. In other embodiments, the dsRNA has one or more single stranded regions or overhangs. In certain embodiments, RNA/DNA hybrids include a DNA strand or region that is an antisense strand or region (e g, has at least 70, 80, 90, 95, 98, or 100% complementarity to a target nucleic acid) and an RNA strand or region that is a sense strand or region (e.g, has at least 70, 80, 90, 95, 98, or 100% identity to a target nucleic acid), and vice versa.
In various embodiments, the RNA/DNA hybrid is made in vitro using enzymatic or chemical synthetic methods such as those described herein or those described in WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999. In other embodiments, a DNA strand synthesized in vitro is complexed with an RNA strand made in vivo or in vitro before, after, or concurrent with the transformation of the DNA strand into the cell. In yet other embodiments, the dsRNA is a single circular nucleic acid containing a sense and an antisense region, or the dsRNA includes a circular nucleic acid and either a second circular nucleic acid or a linear nucleic acid (see, for example, WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.) Exemplary circular nucleic acids include lariat structures in which the free 5' phosphoryl group of a nucleotide becomes linked to the 2' hydroxyl group of another nucleotide in a loop back fashion.
In other embodiments, the dsRNA includes one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group) or contains an alkoxy group (such as a methoxy group) which increases the half-life of the dsRNA in vitro or in vivo compared to the corresponding dsRNA in which the corresponding 2' position contains a hydrogen or an hydroxyl group. In yet other embodiments, the dsRNA includes one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The dsRNAs may also be chemically modified nucleic acid molecules as taught in U. S. Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000, or U.S. Ser. No. 60/130,377, filed Apr. 21, 1999.
In other embodiments, the dsRNA contains coding sequence or non-coding sequence, for example, a regulatory sequence (e.g., a transcription factor binding site, a promoter, or a 5' or 3' untranslated region (UTR) of an mRNA). Additionally, the dsRNA can be any of the at least partially dsRNA molecules disclosed in WO 00/63364, as well as any of the dsRNA molecules described in U. S. Provisional Application 60/399,998; and U.S. Provisional Application 60/419,532, and PCT/US2003/033466, the teaching of which is hereby incorporated by reference. Any of the dsRNAs may be expressed in vitro or in vivo using the methods described herein or standard methods, such as those described in WO 00/63364. In some embodiments, multiple anti-HBV and/or anti-HCV dsRNA effector molecules of the invention are transcribed in a mammalian cell from one or more expression constructs each comprising multiple polymerase III promoter expression cassettes as described in more detail in U. S. Pat. No. 60/603622; U.S. Pat. No. 60/629942; and PCT7US05/29976; "Multiple Polymerase III Promoter Expression Constructs".
Target Nucleic Acids, Target Regions and Nucleotide Sequences
Nucleotide sequences that encode HBV include, without limitation, the following: GENBANK Accession U95551.1 (incorporated herein as SEQ ID NO: 1).
It is understood that the sequence set forth in each SEQ ID NO in the Examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, siRNA compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. siRNA compounds described by Isis Numbers (Isis No) indicate a combination of nucleobase sequence and motif.
Targeting includes determination of at least one target segment to which a siRNA compound hybridizes, such that a desired effect occurs. In certain embodiments, the desired effect is a reduction in mRNA target nucleic acid levels. In certain embodiments, the desired effect is reduction of levels of protein encoded by the target nucleic acid or a phenotypic change associated with the target nucleic acid.
A target region may contain one or more target segments. Multiple target segments within a target region may be overlapping. Alternatively, they may be non-overlapping. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain emodiments, target segments within a target region are separated by a number of nucleotides that is, is about, is no more than, is no more than about, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, or is a range defined by any two of the preceeding values. In certain embodiments, target segments within a target region are separated by no more than, or no more than about, 5 nucleotides on the target nucleic acid. In certain embodiments, target segments are contiguous. Contemplated are target regions defined by a range having a starting nucleic acid that is any of the 5' target sites or 3' target sites listed herein.
Suitable target segments may be found within a 5 ' UTR, a coding region, a 3 ' UTR, an intron, an exon, or an exon/intron junction. Target segments containing a start codon or a stop codon are also suitable target segments. A suitable target segment may specifcally exclude a certain structurally defined region such as the start codon or stop codon.
The determination of suitable target segments may include a comparison of the sequence of a target nucleic acid to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify regions of similarity amongst different nucleic acids. This comparison can prevent the selection of compound sequences that may hybridize in a non- specific manner to sequences other than a selected target nucleic acid (i.e., non-target or off- target sequences). There may be variation in activity (e.g., as defined by percent reduction of target nucleic acid levels) of the double-stranded compounds within an active target region. In certain embodiments, reductions in HBV mRNA levels are indicative of inhibition of HBV expression. Reductions in levels of a HBV protein are also indicative of inhibition of target mRNA expression. Further, phenotypic changes are indicative of inhibition of HBV expression. In certain embodiments, reduced fatigue, reduced flu-like symptoms, increase in appetite, reduced nausea, reduced joint pain, reduced jaundice, reduced pain in the abdomen, reduced weakness, reduced weight loss, reduction in breast enlargement in men, reduced rash on the palms, reduced difficulty with blood clotting, reduced cirrhosis, reduced spider-like blood vessels on the skin, increased Vitamins A and D absorption, reduced tumor growth, reduced tumor volume, reduced headache, reduced fever, reduced diarrhea, reduced pain over the liver area of the body, reduced clay- or grey-colored stool, reduced itching, reduced dark-colored urine, and reduced nausea and vomiting can be indicative of inhibition of HBV expression, In certain embodiments, amelioration of symptoms associated with HBV- related conditions, disease, and disorders can be indicative of inhibition of HBV expression. In certain embodiments, reduction of cirrhosis is indicative of inhibition of HBV expression. In certain embodiments, reduction of liver cancer markers can be indicative of inhibition of HBV expression.
Complementarity
One of the strands of a double- stranded compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of a strand of the double- stranded compound can hydrogen bond with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., inhibition of a target nucleic acid, such as a HBV nucleic acid).
Non-complementary nucleobases between one of the strands of the double-stranded compound and a HBV nucleic acid may be tolerated provided that one of the strands of the siRNA compound remains able to specifically hybridize to a target nucleic acid. Moreover, one of the strands of the double-stranded compound may hybridize over one or more segments of a HBV nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).
In certain embodiments, the double-stranded compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a HBV nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of the double- stranded compound with a target nucleic acid can be determined using routine methods.
For example, each strand of the double-stranded compound in which 18 of 30 nucleobases of the siRNA compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, each strand of the double- stranded compound which is 18 nucleobases in length having four noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present embodiments. Percent complementarity of a double-stranded compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al, J. Mol. Biol, 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482 489).
In certain embodiments, the double- stranded compounds provided herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof For example, a double-stranded compound may be fully complementary to a FIBV nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, "fully complementary" means each nucleobase of a siRNA compound is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 21 nucleobase double-stranded compound is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the double- stranded compound. Fully complementary can also be used in reference to a specified portion of the first and/or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase double-stranded compound can be "fully complementary" to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the double-stranded compound. At the same time, the entire 30 nucleobase double-stranded compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the double-stranded compound are also complementary to the target sequence.
The location of a non-complementary nucleobase may be at the 5' end or 3' end of the double-stranded compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the double-stranded compound. When two or more non- complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous.
In certain embodiments, each of the strands of the double- stranded compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a HBV nucleic acid, or specified portion thereof.
In certain embodiments, each of the strands of the double- stranded compounds that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a HBV nucleic acid, or specified portion thereof
The double-stranded compounds provided also include those which are complementary to a portion of a target nucleic acid. As used herein, "portion" refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a defined number of contiguous nucleobases of a siRNA compound. In certain embodiments, the double-stranded compounds, are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the double- stranded compounds are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the double-stranded compounds are complementary to at least a 15 nucleobase portion of a target segment. Also contemplated are double-stranded compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more nucleobase portion of a target segment, or a range defined by any two of these values. Identity
The compounds provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific Isis number, or portion thereof. As used herein, a compound is identical to the sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the siRNA compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the siRNA compound. Percent identity of an compound is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.
In certain embodiments, the compounds, or portions thereof, are at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the double-stranded compounds or SEQ ID NOs, or a portion thereof, disclosed herein.
In certain embodiments, a portion of the compound is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
In certain embodiments, a portion of the oligonucleotides of the double-stranded compounds is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid.
Chemical Modifications
In certain embodiments, the compounds disclosed herein may comprise sugar modified nucleosides. The sugar modified nucleosides can have any heterocyclic base moiety and internucleoside linkage and may include further groups independent from the sugar modification. A group of sugar modified nucleosides includes 2'-modified nucleosides, 4'-thio modified nucleosides, 4'-thio-2'-modified nucleosides, and bicyclic sugar modified nucleosides.
In certain embodiments, the compounds disclosed herein may comprise 4'-thio modified nucleosides. In certain embodiments, the compounds disclosed herein may comprise 4'-thio-2'-modified nucleoside. The preparation of 4'-thio modified nucleosides is disclosed in publications such as for example U. S. Patent 5,639,837 issued June 17, 1997 and PCT publication WO 2005/027962 published on March 31, 2005. The preparation of 4'-thio-2'- modified nucleosides and their incorporation into oligonucleotides is disclosed in the PCT publication WO 2005/027962 published on March 31, 2005. The 4'-thio-2'-modified nucleosides can be prepared with the same 2'-substituent groups previously mentioned with 2'-OCH3, 2 -0- (CH2)2-OCH3 and 2'-F are suitable groups.
In certain embodiments, the compounds disclosed herein may comprise bicyclic sugar modified nucleosides. Such bicyclic sugar modified nucleosides can incorporate a number of different bridging groups that form the second ring and can be formed from different ring carbon atoms on the furanose ring. Bicyclic sugar modified nucleosides wherein the bridge links the 4' and the 2'-carbons and has the formula 4'-(CH2)n-0-2' wherein n is 1 or 2 are suitable. The synthesis of bicyclic sugar modified nucleosides is disclosed in US patents 6,268,490, 6,794,499 and published U. S. application 20020147332.
In several embodiments, compounds provided herein may also contain one or more substituted sugar moieties such as the 2'-modified sugars discussed. A more comprehensive but not limiting list of sugar substituent groups includes: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N- alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to Cio alkyl or C2 to Cio alkenyl and alkynyl. Particularly suitable are 0((CH2)nO)mCH3, 0(CH2)„OCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nO H2, and 0(CH2)nON((CH2)nCH3)2, where n and m are from 1 to about 10. Some oligonucleotides comprise a sugar substituent group selected from: Ci to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
One modification includes 2'-methoxyethoxy (2 -O-CH2CH2OCH3, also known as 2 -0- (2-methoxyethyl) or 2 -MOE) (Martin et al., Helv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group. One modification includes 2'-dimethylaminooxyethoxy, i.e., a 0( Η2)20Ν(Ο¾)2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0-dimethyl-amino-ethoxy-ethyl or 2 -DMAEOE), i.e., 2'-0-CH2-0-CH2-N(CH3)2.
Other sugar substituent groups include methoxy (-O-CH3), aminopropoxy (-OCH2CH2CH2 H2), allyl (-CH2-CH=CH2), -O-allyl (-0-CH2-CH=CH2) and fluoro (F). 2'- Sugar substituent groups may be in the arabino (up) position or ribo (down) position. One 2'- arabino modification is 2'-F. Similar modifications may also be made at other positions on the oligomeric compound, particularly the 3' position of the sugar on the 3' terminal nucleoside or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Oligomeric compounds may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. : 4,981,957; 5, 118,800; 5,319,080; 5,359,044; 5,393,878; 5,446, 137; 5,466,786; 5,514,785; 5,519, 134; 5,567,81 1 ; 5,576,427; 5,591,722; 5,597,909, 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873, 5,670,633; 5,792,747; and 5,700,920.
Representative sugar substituent groups include groups of formula Ia or IIa:
Figure imgf000047_0001
wherein: Rb is O, S or H;
Rd is a single bond, O, S or C(=0);
Re is Ci-Cio alkyl, N(Rk)(Rm), N(Rk)(Rn), N=C(Rp)(Rq), N=C(Rp)(Rr) or has formula IIIa;
Figure imgf000048_0001
Ilia
Rp and Rq are each independently hydrogen or Ci-Cio alkyl;
R, is -Rx-Ry;
each Rs, Rt, Ru and Rv is, independently, hydrogen, C(0)Rw, substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, alkylsulfonyl, arylsulfonyl, a chemical functional group or a conjugate group, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl;
or optionally, Ru and Rv, together form a phthalimido moiety with the nitrogen atom to which they are attached;
each Rw is, independently, substituted or unsubstituted C1-C10 alkyl, trifluoromethyl, cyanoethyloxy, methoxy, ethoxy, t-butoxy, allyloxy, 9-fluorenylmethoxy, 2- (trimethylsilyl)-ethoxy, 2,2,2-trichloroethoxy, benzyloxy, butyryl, iso-butyryl, phenyl or aryl;
Rk is hydrogen, a nitrogen protecting group or -Rx-Ry;
Rp is hydrogen, a nitrogen protecting group or -Rx-Ry;
Rx is a bond or a linking moiety;
Ry is a chemical functional group, a conjugate group or a solid support medium; each Rm and R„ is, independently, H, a nitrogen protecting group, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, substituted or unsubstituted C2-C10 alkynyl, wherein the substituent groups are selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, alkynyl; ¼+, N(RU)(RV), guanidino and acyl where the acyl is an acid amide or an ester;
or Rm and Rn, together, are a nitrogen protecting group, are joined in a ring structure that optionally includes an additional heteroatom selected from N and O or are a chemical functional group;
Ri is ORz, SRz, or N(Rz)2;
each Rz is, independently, H, Ci-C8 alkyl, Ci-C8 haloalkyl, C(=NH)N(H)RU, C(=0)N(H)Ru or OC(=0)N(H)Ru;
R¾ Rg and Rh comprise a ring system having from about 4 to about 7 carbon atoms or having from about 3 to about 6 carbon atoms and 1 or 2 heteroatoms wherein the heteroatoms are selected from oxygen, nitrogen and sulfur and wherein the ring system is aliphatic, unsaturated aliphatic, aromatic, or saturated or unsaturated heterocyclic;
Rj is alkyl or haloalkyl having 1 to about 10 carbon atoms, alkenyl having 2 to about 10 carbon atoms, alkynyl having 2 to about 10 carbon atoms, aryl having 6 to about 14 carbon atoms, N(Rk)(Rm) ORk, halo, SRk or CN;
ma is 1 to about 10;
each mb is, independently, 0 or 1 ;
mc is 0 or an integer from 1 to 10;
md is an integer from 1 to 10;
me is from 0, 1 or 2; and
provided that when mc is 0, md is greater than 1.
Representative substituents groups of Formula I are disclosed in U.S. Serial No. 09/130,973, filed August 7, 1998, entitled "Capped 2'-Oxyethoxy Oligonucleotides."
Representative cyclic substituent groups of Formula II are disclosed in U.S. Serial No. 09/123,108, filed July 27, 1998, entitled "RNA Targeted 2'-01igomeric compounds that are Conformationally Preorganized".
Particular sugar substituent groups include 0((CH2)nO)mCH3, 0(CH2)nOCH3, 0(CH2)nNH2, 0(CH2)nCH3, 0(CH2)nONH2; and 0(CH2)nON((CH2)nCH3))2; where n and m are from 1 to about 10.
Representative guanidino substituent groups that are shown in formula III and IV are disclosed in U.S. Serial No. 09/349,040, entitled "Functionalized Oligomers", filed July 7, 1999.
Representative acetamido substituent groups are disclosed in U.S. Patent 6,147,200.
Representative dimethylaminoethyloxyethyl substituent groups are disclosed in International Patent Application PCT7US99/17895, entitled "2'-0-Dimethylaminoethyloxyethyl- Oligomeric compounds", filed August 6, 1999. In certain embodiments, the compounds disclosed herein may comprise 2'-modified nucleosides. Suitable 2'-substituent groups for 2'-modified nucleosides of the embodiments include, but are not limited to: halo, allyl, amino, azido, amino, SH, CN, OCN, CF3, OCF3, 0-, S-, or N(Rm)-alkyl; 0-, S-, or N(Rm)-alkenyl; 0-, S- or N(Rm)-alkynyl; O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, 0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(R„) or 0-CH2- C(=0)-N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl. These 2'-substituent groups can be further substituted with substituent groups selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (N02), thiol, thioalkoxy (S-alkyl), halogen, alkyl, aryl, alkenyl and alkynyl where each Rm is, independently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl.
A list of 2'-substituent groups includes F, -NH2, N3, OCF3; 0-CH3, 0(CH2)3NH2), CH2- CH=CH2, -0-CH2-CH=CH2, OCH2CH2OCH3, 2'-0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), - 0(CH2)20(CH2)2N(CH3)2, and N-substituted acetamide (0-CH2-C(=0)-N(Rm)(Rn) where each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl. Another list of 2 '-substituent groups includes F, OCF3, 0-CH3, OCH2CH2OCH3, 2'- 0(CH2)2SCH3, 0-(CH2)2-0-N(Rm)(Rn), -0(CH2)20(CH2)2N(CH3)2, and N-substituted acetamides (0-CH2-C(=0)-N(Rm)(Rn) where each Rm and Rn is, independently, H, an amino protecting group or substituted or unsubstituted Ci-Cio alkyl.
In certain embodiments, the compounds provided herein may comprise one or more of the following sugar modifications: 2'LNA, 2'MOE (2'-0-(CH2)2-OCH3), 4'-thio, 2'-0-methyl, 2'- fluoro, 2'-chloro, 2'-azido, 2'-deoxy-2'- fluoroarabino (FANA), 2'-0-trifluoromethyl, 2'-0-ethyl- trifluoromethoxy, 2'-0- difluoromethoxy-ethoxy, 2 '-O-trifluoro methyl, 2'-0-ethyl- trifluoromethoxy, 2'-0- difluoromethoxy-ethoxy, 2'-0-DNP (dinitrophenyl), ENA, UNA (unlocked nucleic acid), HM (4'-C-hydroxymethyl), ADA (2'-N-adamantylmethylcarbonyl-2'- amino-LNA), PYR (2'-N-pyren-l-ylmethyl-2 -amino-LNA), EA (2'-aminoethyl), GE (2 - guanidinoethyl), CE (2'-cyanoethyl), AP (2 -aminopropyl), OXE (oxetane-LNA), CLNA (2',4'- carbocyclic-LNA-locked nucleic acid), CENA (2',4'-carbocyclic-ENA-locked nucleic acid), AENA (2'-deoxy-2'-N,4'-C-ethylene-LNA), ANA (altritol nucleic acid), UNA (hexitol nucleic acid), AEM (2r-aminoethoxymethyl), or APM (2'-aminopropoxymethyl).
In certain embodiments, the compounds disclosed herein may comprise of alkyl groups.
Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl and the like. Alkyl groups typically include from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms are also suitable. Alkyl groups as used herein may optionally include one or more further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of alkenyl groups. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, l-methyl-2-buten-l-yl, dienes such as 1,3-butadiene and the like. Alkenyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms are also suitable. Alkenyl groups as used herein may optionally include one or more further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of alkynyl groups. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1- butynyl, and the like. Alkynyl groups typically include from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms with from 2 to about 6 carbon atoms are also suitable. Alkynyl groups as used herein may optionally include one or more further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of aliphatic groups. An aliphatic group can contain from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms with from 1 to about 6 carbon atoms being desired. The straight or branched chain of an aliphatic group may be interrupted with one or more heteroatoms that include nitrogen, oxygen, sulfur and phosphorus. Such aliphatic groups interrupted by heteroatoms include without limitation polyalkoxys, such as polyalkylene glycols, polyamines, and polyimines, for example. Aliphatic groups as used herein may optionally include further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of alkoxy groups. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, w-butoxy, sec-butoxy, fert-butoxy, n-pentoxy, neopentoxy, n-hexoxy and the like. Alkoxy groups as used herein may optionally include further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of halogen atoms. In further embodiments, the halogen atom is selected from fluorine, chlorine, bromine and iodine.
In certain embodiments, the compounds disclosed herein may comprise of aryl or aromatic groups. Examples of aryl groups include, but not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl and the like. Aryl groups as used herein may optionally include further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of heterocyclic groups. A heterocyclic group typically includes at least one atom selected from sulfur, nitrogen or oxygen. Examples of heterocyclic groups include, [l,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl and the like. Heterocyclic groups as used herein may optionally include further substituent groups.
In certain embodiments, the compounds disclosed herein may comprise of heterocyclic base moieties. Heterocyclic base moieties include unmodified nucleobases such as the native purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). The term is also intended to include all manner of modified or substitute nucleobases including but not limited to synthetic and natural nucleobases such as xanthine, hypoxanthine, 2-aminopyridine and 2-pyridone, 5-methylcytosine (5-me-C), 5- hydroxymethylenyl cytosine, 2-amino and 2-fluoroadenine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thio cytosine, uracil, thymine, 3-deaza guanine and adenine, 4- thiouracil, 5-uracil (pseudouracil), 5-propynyl (-C≡C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 6-methyl and other alkyl derivatives of adenine and guanine, 6- azo uracil, cytosine and thymine, 7-methyl adenine and guanine, 7-deaza adenine and guanine, 8- halo, 8-amino, 8-aza, 8-thio, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as phenoxazine cytidine(lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one) and phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one).
In certain embodiments, the compounds disclosed herein may comprise of substituent groups. Substituent groups can be protected or unprotected and can be added to one available site or to many available sites in a parent compound. Substituent groups may also be further substituted with other substituent groups and may be attached directly or via a linking group such as an alkyl or hydrocarbyl group to the parent compound. Such substituent groups include without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(0)Ra), carboxyl (-C(O)O- Ra), aliphatic, alicyclic, alkoxy, substituted oxo (-0-Ra), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino(- RbRc), imino(= Rb), amido (-C(0)NRbRc or -N(Rb)C(0)Ra), azido (- N3), nitro (-N02), cyano (-CN), carbamido (-OC(0) RbRc or -N(Rb)C(0)ORa), ureido (-N(Rb)C(0)NRbRc), thioureido (-N(Rb)C(S)NRbRc), guanidinyl (-N(Rb)C(= Rb) RbRc), amidinyl (-C(=NRb)NRbRc or -N(Rb)C(NRb)Ra), thiol (-SRb), sulfinyl (-S(0)Rb), sulfonyl (- S(0)2Rb) and sulfonamidyl (-S(0)2NRbRc or -N(R )S(0)2R ). Wherein each Ra, Rb and Rc is a further substituent group which can be without limitation alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic and heteroarylalkyl.
In certain embodiments, the compounds disclosed herein may comprise of protecting group. Protecting groups are typically used selectively and/or orthogonally to protect sites during reactions at other reactive sites and can then be removed to leave the unprotected group as is or available for further reactions. Protecting groups as known in the art are described generally in Greene and Wuts, Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons, New York (1999).
Examples of hydroxyl protecting groups include, but are not limited to, benzyloxy- carbonyl, 4-nitrobenzyloxycarbonyl, 4-bromobenzyloxycarbonyl, 4-methoxybenzyloxycarbonyl, methoxycarbonyl, tert-butoxycarbonyl (BOC), isopropoxycarbonyl, diphenylmethoxycarbonyl, 2,2,2-trichloroethoxycarbonyl, 2-(trimethylsilyl)ethoxycarbonyl, 2-furfuryloxycarbonyl, allyloxycarbonyl (Alloc), acetyl (Ac), formyl, chloroacetyl, trifluoroacetyl, methoxyacetyl, phenoxyacetyl, benzoyl (Bz), methyl, t-butyl, 2,2,2-trichloroethyl, 2-trimethylsilyl ethyl, 1, 1- dimethyl-2-propenyl, 3-methyl-3-butenyl, allyl, benzyl (Bn), para- methoxybenzyldiphenylmethyl, triphenylmethyl (trityl), 4,4'-dimethoxytriphenylmethyl (DMT), substituted or unsubstituted 9-(9-phenyl)xanthenyl (pixyl), tetrahydrofuryl, methoxymethyl, methylthiomethyl, benzyloxymethyl, 2,2,2-trichloroethoxymethyl, 2-
(trimethylsilyl)ethoxymethyl, methanesulfonyl, para-toluenesulfonyl, trimethylsilyl, triethylsilyl, triisopropylsilyl, and the like. Suitable hydroxyl protecting groups for the present embodiments are DMT and substituted or unsubstituted pixyl.
Examples of amino protecting groups include, but are not limited to, /-butoxycarbonyl (BOC), 9-fluorenylmethoxycarbonyl (Fmoc), benzyloxycarbonyl, and the like. Examples of thiol protecting groups include, but are not limited to, triphenylmethyl (Trt), benzyl (Bn), and the like.
The compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)-, or as (D)- or (L)- for amino acids. The present embodiments are meant to include all such possible isomers, as well as their racemic and optically pure forms. Optical isomers may be prepared from their respective optically active precursors by the procedures described above, or by resolving the racemic mixtures. The resolution can be carried out in the presence of a resolving agent, by chromatography or by repeated crystallization or by some combination of these techniques which are known to those skilled in the art. Further details regarding resolutions can be found in Jacques, et al., Enantiomers, Racemates, and Resolutions (John Wiley & Sons, 1981). When the compounds described herein contain olefinic double bonds, other unsaturation, or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers or cis- and trans-isomers. Likewise, all tautomeric forms are also intended to be included. The configuration of any carbon-carbon double bond appearing herein is selected for convenience only and is not intended to designate a particular configuration unless the text so states; thus a carbon-carbon double bond or carbon-heteroatom double bond depicted arbitrarily herein as trans may be cis, trans, or a mixture of the two in any proportion.
In one embodiment, each sugar modified nucleoside is selected from 2'-modified nucleosides, 4'-thio modified nucleosides, 4'-thio-2'-modified nucleosides and nucleosides having bicyclic sugar moieties. In another embodiment, chemically modified double-stranded compounds comprise a 2'-modified nucleoside such as 2'-OCH3, 2'-F, or 2'-OCH3 sugar modifications. In another embodiment, chemically modified double-stranded compounds comprise β-D-ribonucleoside For example using 2'-MOE (2'-0-(CH2)2-OCH3) modifications in the wings of the sense strand increases the efficiency of the antisense strand. It is believed that the bulky wings of a MOE gapmer inhibits its incorporation into the RISC complex thereby allowing preferential loading of the antisense strand resulting in a reduction of off target effects and increased potency of the antisense strand. LNA modified nucleosides have also been used to inhibit the uptake of the sense strand in compositions of the embodiments.
In certain embodiments, the compounds disclosed herein may comprise of positionally modified motifs. The positionally modified motif includes internal regions of sugar modified nucleoside and can also include one or both termini. Each particular sugar modification within a region of sugar modified nucleosides is variable with uniform modification desired. The sugar modified regions can have the same sugar modification or can vary such that one region may have a different sugar modification than another region. Positionally modified strands comprise at least two sugar modified regions and at least three when both the 3' and 5'-termini comprise sugar modified regions. Positionally modified oligomeric compounds are distinguished from gapped motifs, hemimer motifs, blockmer motifs and alternating motifs because the pattern of regional substitution defined by any positional motif is not defined by these other motifs. Positionally modified motifs are not determined by the nucleobase sequence or the location or types of internucleoside linkages. The term positionally modified oligomeric compound includes many different specific substitution patterns. A number of these substitution patterns have been prepared and tested in compositions.
Further modifications can be made to the double- stranded compounds and may include conjugate groups attached to one or more of the termini, selected nucleobase positions, sugar positions or to one of the internucleoside linkages. Alternatively, the two strands can be linked via a non-nucleic acid moiety or linker group.
Further nucleobases (and nucleosides comprising the nucleobases) include those disclosed in US Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, those disclosed in Limbach et al, Nucleic Acids Research, 1994, 22(12), 2183-2196, and those disclosed by Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B. , ed., CRC Press, 1993.
Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the embodiments. These include 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyl-adenine, 5- propynyluracil and 5-propynylcytosine. 5 -methyl cytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y.S., Crooke, S.T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are especially useful when combined with 2'-0-methoxyethyl (2 -MOE) sugar modifications.
Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. 3,687,808, as well as U.S. : 4,845,205; 5, 130,302; 5, 134,066; 5, 175,273; 5,367,066; 5,432,272; 5,457, 187; 5,459,255; 5,484,908; 5,502, 177; 5,525,71 1 ; 5,552,540; 5,587,469; 5,594, 121, 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,681,941, and 5,750,692.
In certain embodiments, the compounds disclosed herein may comprise of universal base moieties. The universal base need not contribute to hybridization, but should not significantly detract from hybridization and typically refers to a monomer in a first sequence that can pair with a naturally occuring base, i.e A, C, G, T or U at a corresponding position in a second sequence of a duplex in which one or more of the following is true: (1) there is essentially no pairing (hybridization) between the two; or (2) the pairing between them occurs non- discriminant with the universal base hybridizing one or more of the the naturally occurring bases and without significant destabilization of the duplex. Exemplary universal bases include, without limitation, inosine, 5-nitroindole and 4-nitrobenzimidazole. For further examples and descriptions of universal bases see Survey and summary: the applications of universal DNA base analogs. Loakes, Nucleic Acids Research, 2001, 29, 12, 2437-2447.
In certain embodiments, the compounds disclosed herein may comprise of promiscuous base moieties. Non-limiting examples of promiscuous bases are 6H,8H-3,4-dihydropyrimido- [4,5-c][l,2]oxazin-7-one and N6-methoxy-2,6-diaminopurine, shown below. For further information, see Polymerase recognition of synthetic oligodeoxyribonucleotides incorporating degenerate pyrimidine and purine bases. Hill, et al., Proc. Natl. Acad. Sci., 1998, 95, 4258-4263.
Examples of G-clamps include substituted phenoxazine cytidine (e.g. 9-(2- aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one) and pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one).
Representative cytosine analogs that make 3 hydrogen bonds with a guanosine in a second oligonucleotide include l,3-diazaphenoxazine-2-one (Kurchavov et al., Nucleosides and Nucleotides, 1997, 16, 1837-1846), l,3-diazaphenothiazine-2-one (Lin et al., J. Am. Chem. Soc. 1995, 117, 3873-3874) and 6,7,8,9-tetrafluoro-l,3-diazaphenoxazine-2-one (Wang et al., Tetrahedron Lett. 1998, 39, 8385-8388). When incorporated into oligonucleotides these base modifications hybridized with complementary guanine (the latter also hybridized with adenine) and enhanced helical thermal stability by extended stacking interactions (see U. S. Serial Number 10/013,295).
In certain embodiments, the compounds disclosed herein may comprise of linking moieties. Suitable linking moieties include, but are not limited to, a divalent group such as alkylene, cycloalkylene, arylene, heterocyclyl, heteroarylene, and the other variables are as described above.
Exemplary alkylene linking moietys include, but are not limited to, C1-C12 alkylene (e.g. methylene, ethylene (e.g. ethyl- 1,2-ene), propylene (e.g. propyl- 1,2-ene, propyl- 1, 3 -ene), butylene, (e.g. butyl- 1,4-ene, 2-methylpropyl-l,3-ene), pentylene, hexylene, heptylene, octylene, decylene, dodecylene), etc. Exemplary cycloalkylene groups include C3-C12 cycloalkylene groups, such as cyclopropylene, cyclobutylene, cyclopentanyl-l,3-ene, cyclohexyl- 1,4-ene, etc. Exemplary arylene linking moietys include, but are not limited to, mono- or bicyclic arylene groups having from 6 to about 14 carbon atoms, e.g. phenyl- 1,2-ene, naphthyl-l,6-ene, napthyl- 2,7-ene, anthracenyl, etc. Exemplary heterocyclyl groups within the scope of the embodiments include mono- or bicyclic aryl groups having from about 4 to about 12 carbon atoms and about 1 to about 4 hetero atoms, such as N, O and S, where the cyclic moieties may be partially dehydrogenated.
Certain heteroaryl groups that may be mentioned as being within the scope of the embodiments include: pyrrolidinyl, piperidinyl (e.g. 2,5-piperidinyl, 3,5-piperidinyl), piperazinyl, tetrahydrothiophenyl, tetrahydrofuranyl, tetrahydro quinolinyl, tetrahydro isoquinolinyl, tetrahydroquinazolinyl, tetrahydroquinoxalinyl, etc. Exemplary heteroarylene groups include mono- or bicyclic aryl groups having from about 4 to about 12 carbon atoms and about 1 to about 4 hetero atoms, such as N, O and S. Certain heteroaryl groups that may be mentioned as being within the scope of the embodiments include: pyridylene (e.g. pyridyl-2,5- ene, pyridyl-3,5-ene), pyrimidinyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, quinazolinyl, quinoxalinyl, etc.
In certain embodiments, the compounds disclosed herein may comprise of modified internucleoside linkages. Such modified linkages include those that have a phosphorus atom and those that do not have a phosphorus atom. Internucleoside linkages containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosp hates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or 2' to 2' linkage. Oligonucleotides having inverted polarity can comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof). Various salts, mixed salts and free acid forms are also included. Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. : 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5, 177, 196; 5, 188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321, 131 ; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519, 126; 5,536,821 ; 5,541,306; 5,550, 111 ; 5,563,253; 5,571,799; 5,587,361 ; 5, 194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050.
Another phosphorus-containing modified internucleoside linkage is the phosphono- monoester (see U. S. Patents 5,874,553 and 6, 127,346). Phosphonomonoester nucleic acids have useful physical, biological and pharmacological properties in the areas of inhibiting gene expression (antisense oligonucleotides, ribozymes, sense oligonucleotides and triplex-forming oligonucleotides), as probes for the detection of nucleic acids and as auxiliaries for use in molecular biology.
In certain embodiments, double-stranded oligonucleotides can comprise nucleosides that are joined by internucleoside linkages that do not have phosphorus atoms. Non-phosphorus containing internucleoside linkages include short chain alkyl, cycloalkyl, mixed heteroatom alkyl, mixed heteroatom cycloalkyl, one or more short chain heteroatomic and one or more short chain heterocyclic. These internucleoside linkages include but are not limited to siloxane, sulfide, sulfoxide, sulfone, acetyl, formacetyl, thioformacetyl, methylene formacetyl, thioformacetyl, alkeneyl, sulfamate; methyleneimino, methylenehydrazino, sulfonate, sulfonamide, amide and others having mixed N, O, S and CH2 component parts. Representative U. S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5, 166,315; 5, 185,444; 5,214, 134; 5,216, 141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439.
Some additional examples of modified internucleoside linkages that do not contain a phosphorus atom therein include, -CH2-NH-O-CH2-, -CH2-N(CH3)-0-CH2- (known as a methylene (methylimino) or MMI backbone), -CH2-0-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)- CH2- and -0-N(CH3)-CH2-CH2- (wherein the native phosphodiester internucleotide linkage is represented as -0-P(=0)(OH)-0-CH2-). The MMI type and amide internucleoside linkages are disclosed in the below referenced U. S. patents 5,489,677 and 5,602,240, respectively.
Conjugates
Another modification that can enhance the properties of double-stranded compounds or can be used to track the oligomeric compound or its metabolites is the attachment of one or more moieties or conjugates. Properties that are typically enhanced include without limitation activity, cellular distribution and cellular uptake. In one embodiment, such modified oligomeric compounds are prepared by covalently attaching conjugate groups to functional groups available on an oligomeric compound such as hydroxyl or amino functional groups. Conjugate groups of the embodiments include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this embodiments, include groups that improve properties including but not limited to oligomer uptake, enhance oligomer resistance to degradation, and/or strengthen sequence-specific hybridization with RNA. Groups that enhance the pharmacokinetic properties, in the context of this embodiments, include groups that improve properties including but not limited to oligomer uptake, distribution, metabolism and excretion. Representative conjugate groups are disclosed in International Patent Application PCT US92/09196.
Conjugate groups include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S- tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison- Behmoaras et al., EMBO J., 1991, 10, 1 1 11-11 18; Kabanov et al., FEBS Lett., 1990, 259, 327- 330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651- 3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).
Representative U. S. patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S. : 4,828,979; 4,948,882; 5,218, 105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5, 109, 124; 5, 1 18,802; 5, 138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5, 112,963; 5,214, 136; 5,082,830; 5, 1 12,963; 5,214, 136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463, 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810, 5,574, 142; 5,585,481 ; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, which are fully incorporated by reference in their entireties. Cap structures
Double-stranded compounds used in the compositions of the present embodiments can also be modified to have one or more stabilizing groups that are generally attached to one or both termini of double-stranded compounds to enhance properties such as for example nuclease stability. Included in stabilizing groups are cap structures. The terms "cap structure" or "terminal cap moiety," as used herein, refer to chemical modifications, which can be attached to one or both of the termini of an oligomeric compound. These terminal modifications protect the oligomeric compounds having terminal nucleic acid moieties from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5'-terminus (5 '-cap) or at the 3 '-terminus (3 -cap) or can be present on both termini. In non-limiting examples, the 5'-cap includes inverted abasic residue (moiety), 4',5'-methylene nucleotide; 1- (beta-D-erythrofuranosyl) nucleotide, 4'-thio nucleotide, carbocyclic nucleotide; 1,5- anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3 '-3 '-inverted nucleotide moiety; 3 '-3 '-inverted abasic moiety; 3'-2'-inverted nucleotide moiety; 3'-2'-inverted abasic moiety; 1,4-butanediol phosphate; 3'-phosphoramidate; hexylphosphate; amino hexyl phosphate; 3 '-phosphate; 3'-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety (for more details see Wincott et al., International PCT publication No. WO 97/26270).
Particularly suitable 3 '-cap structures of the present embodiments include, for example 4', 5 '-methylene nucleotide; 1 -(beta-D-erythrofuranosyl) nucleotide; 4'-thio nucleotide, carbocyclic nucleotide; 5'-amino-alkyl phosphate; l,3-diamino-2-propyl phosphate, 3- aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3',4'-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5'-5'-inverted nucleotide moiety; 5'-5'-inverted abasic moiety; 5'-phosphoramidate; 5'-phosphorothioate; 1,4-butanediol phosphate; 5'-amino; bridging and/or non-bridging 5'-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5'-mercapto moieties (for more details see Beaucage and Tyer, 1993, Tetrahedron 49, 1925 and Published U. S. Patent Application Publication No. US 2005/0020525 published on January 27, 2005).
Further 3' and 5 '-stabilizing groups that can be used to cap one or both ends of an oligomeric compound to impart nuclease stability include those disclosed in WO 03/004602.
Formulations
The double-stranded compounds of several embodiments include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon admini- stration to an animal including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the embodiments, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. For oligonucleotides, examples of pharmaceutically acceptable salts and their uses are further described in U. S. Patent 6,287,860.
The compounds and compositions provided herein may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, PEG (e.g. PEG-C-DMA, PEG-DMG), cholesterol, lipids, albumin, nucleic-acid-lipid particles, lipid nanoparticles, micelles, virosomes, or virus like particles (VLP) for assisting in uptake, distribution and/or absorption.
Representative U.S. patents that teach the preparation of such uptake, distribution and/or absorption-assisting formulations include, but are not limited to, U.S. : 5, 108,921 ; 5,354,844; 5,416,016; 5,459, 127; 5,521,291; 5,543, 158; 5,547,932; 5,583,020; 5,591,721 ; 4,426,330; 4,534,899; 5,013,556; 5, 108,921; 5,213,804; 5,227, 170; 5,264,221 ; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543, 152; 5,556,948; 5,580,575; and 5,595,756, which are fully incorporated by reference in their entireties.
The pharmaceutical compositions provided herein may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like can be used.
Pharmaceutical compositions provided herein include, but are not limited to, solutions, emulsions, foams and liposome-containing formulations. The pharmaceutical compositions and formulations of the present embodiments may comprise one or more penetration enhancers, carriers, excipients or other active or inactive ingredients.
One of skill in the art will recognize that formulations are routinely designed according to their intended use, i.e. route of administration.
Suitable formulations for topical administration include those in which the compounds of the embodiments are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Suitable lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). Penetration enhancers and their uses are further described in U. S. Patent 6,287,860. Surfactants and their uses are further described in U. S. Patent 6,287,860.
Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Suitable oral formulations are those in which oligonucleotides of the embodiments are administered in conjunction with one or more penetration enhancers surfactants and chelators. Suitable surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Suitable bile acids/salts and fatty acids and their uses are further described in U. S. Patent 6,287,860. Also suitable are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly suitable combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. Double-stranded oligonucleotides described herein may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Oligonucleotide complexing agents and their uses are further described in U. S. Patent 6,287,860.
Cell culture and treatment
The effects of double-stranded compounds on the level, activity or expression of HBV nucleic acids can be tested in vitro in a variety of cell types. Cell types used for such analyses are available from commerical vendors {e.g. American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured according to the vendor's instructions using commercially available reagents (e.g. Invitrogen Life Technologies, Carlsbad, CA). Illustrative cell types include, but are not limited to, HuVEC cells, b.END cells, HepG2 cells, Hep3B cells, and primary hepatocytes.
In vitro testing of siRNA oligonucleotides
Described herein are methods for treatment of cells with double-stranded oligonucleotides, which can be modified appropriately for treatment with other siRNA compounds.
Cells may be treated with double-stranded oligonucleotides when the cells reach approximately 60-80% confluency in culture.
Transfection reagents commonly used to introduce double- stranded oligonucleotides into cultured cells includes the cationic lipid transfection reagent LIPOFECTIN, LIPOFECTAMINE, LIPOFECTAMINE in OPTI-MEM 1, and by the electroporation method. RNA Isolation
RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TRIZOL Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocols.
Analysis of inhibition of target levels or expression
Inhibition of levels or expression of a HBV nucleic acid can be assayed in a variety of ways known in the art. For example, target nucleic acid levels can be quantitated by, e.g., Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitaive real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently accomplished using the commercially available ABI PRISM 7600, 7700, or 7900 Sequence Detection System, available from PE-Applied Biosystems, Foster City, CA and used according to manufacturer's instructions. Quantitative Real-Time PCR Analysis of Target RNA Levels
Quantitation of target RNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which produces complementary DNA (cDNA) that is then used as the substrate for the real-time PCR amplification. The RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents may be obtained from Invitrogen (Carlsbad, CA). RT real-time-PCR reactions are carried out by methods well known to those skilled in the art.
Gene (or RNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of RNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
Probes and primers are designed to hybridize to a HBV nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
Quantitative Real-Time PCR Analysis of Target DNA Levels
Quantitation of target DNA levels may be accomplished by quantitative real-time PCR using the ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Methods of quantitative real-time PCR are well known in the art.
Gene (or DNA) target quantities obtained by real time PCR are normalized using either the expression level of a gene whose expression is constant, such as cyclophilin A, or by quantifying total DNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real time PCR, by being run simultaneously with the target, multiplexing, or separately. Total DNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc. Eugene, OR). Methods of DNA quantification by RIBOGREEN are taught in Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.
Probes and primers are designed to hybridize to a HBV nucleic acid. Methods for designing real-time PCR probes and primers are well known in the art, and may include the use of software such as PRIMER EXPRESS Software (Applied Biosystems, Foster City, CA).
Analysis of Protein Levels
RNAi inhibition of HBV nucleic acids can be assessed by measuring HBV protein levels. Protein levels of HBV can be evaluated or quantitated in a variety of ways well known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (for example, caspase activity assays), immunohistochemistry, immunocytochemistry or fluorescence-activated cell sorting (FACS). Antibodies directed to a target can be identified and obtained from a variety of sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MI), or can be prepared via conventional monoclonal or polyclonal antibody generation methods well known in the art. In vivo testing of siRNA compounds
Double-stranded compounds are tested in animals to assess their ability to inhibit expression of HBV and produce phenotypic changes. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, siRNA oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, subcutaneous, intrathecal, and intracerebroventricular. Calculation of double-stranded oligonucleotide dosage and dosing frequency is within the abilities of those skilled in the art, and depends upon factors such as route of administration and animal body weight. Following a period of treatment with double-stranded oligonucleotides, RNA is isolated from liver tissue and changes in HBV nucleic acid expression are measured. Changes in HBV DNA levels are also measured. Changes in HBV protein levels are also measured. Changes in HBV HBeAg levels are also measured. Changes in HBV HBsAg levels are also measured.
Certain Indications
In certain embodiments, provided herein are methods, compounds, and compositions of treating an individual comprising administering one or more pharmaceutical compositions provided herein. In certain embodiments, the individual has an HBV-related condition. In certain embodiments, chronic HBV infection, inflammation, fibrosis, cirrhosis, liver cancer, serum hepatitis, jaundice, liver cancer, liver inflammation, liver fibrosis, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, and HBV viremia. In certain embodiments, the HBV-related condition may have which may include any or all of the following: flu-like illness, weakness, aches, headache, fever, loss of appetite, diarrhea, jaundice, nausea and vomiting, pain over the liver area of the body, clay- or grey-colored stool, itching all over, and dark-colored urine, when coupled with a positive test for presence of a hepatitis B virus, a hepatitis B viral antigen, or a positive test for the presence of an antibody specific for a hepatitis B viral antigen. In certain embodiments, the individual is at risk for an HBV-related condition. This includes individuals having one or more risk factors for developing an HBV-related condition, including sexual exposure to an individual infected with Hepatitis B virus, living in the same house as an individual with a lifelong hepatitis B virus infection, exposure to human blood infected with the hepatitis B virus, injection of illicit drugs, being a person who has hemophilia, and visiting an area where hepatitis B is common. In certain embodiments, the individual has been identified as in need of treatment for an HBV-related condition. In certain embodiments provided herein are methods for prophylactically reducing HBV expression in an individual. Certain embodiments include treating an individual in need thereof by administering to an individual a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid.
Due to overlapping transmission routes, many people have been exposed to both hepatitis B virus (HBV) and hepatitis C virus (HCV), and a smaller proportion are chronically infected with both viruses, especially in regions such as Asia where HBV is endemic. Estimates suggest that up to 10% of people with HCV may also have HBV, while perhaps 20% of people with HBV are co-infected with HCV. However, treatment of hepatitis B or hepatitis B in HBV- HCV co-infected individuals has not been well studied. Treatment is complicated by the fact that HCV and HBV appear to inhibit each other's replication (though not all studied have observed this interaction). Therefore, treatment that fully suppresses HBV could potentially allow HCV to re-emerge, or vice versa. Therefore, the compounds and compositions described herein may advantageously be used for treating patients infected with both HBV and HCV. Exemplary treatment options for hepatitis C (HCV) include interferons, e.g., interferon alpha-2b, interferon alpha-2a, and interferon alphacon- 1. Less frequent interferon dosing can be achieved using pegylated interferon (interferon attached to a polyethylene glycol moiety which improves its pharmacokinetic profile). Combination therapy with interferon alpha-2b (pegylated and unpegylated) and ribavirin has also been shown to be efficacious for some patient populations. Other agents currently being developed include HCV RNA replication inhibitors (e.g., ViroPharma's VP50406 series), HCV antisense agents, HCV therapeutic vaccines, HCV protease inhibitors, HCV helicase inhibitors and HCV antibody therapy (monoclonal or polyclonal).
In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing an HBV-related condition associated with the presence of the hepatitis B virus. In certain embodiments, treatment with the methods, compounds, and compositions described herein is useful for preventing an HBV-related condition.
In one embodiment, administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV mRNA levels in the serum of an individual to determine an individual's response to administration of the siRNA compound. In certain embodiments, administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV DNA levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound. In certain embodiments, administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV protein levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound. In certain embodiments, administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV S antigen (HBsAg) levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound. In certain embodiments, administration of a therapeutically effective amount of a siRNA compound targeted to an HBV nucleic acid is accompanied by monitoring of HBV E antigen (HBeAg) levels in the serum of an individual to determine an individual' s response to administration of the siRNA compound. An individual's response to administration of the siRNA compound is used by a physician to determine the amount and duration of therapeutic intervention.
In certain embodiments, administration of a double-stranded compound targeted to an HBV nucleic acid results in reduction of HBV expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values. In certain embodiments, administration of a siRNA compound targeted to an HBV nucleic acid results in reduced symptoms associated with the HBV-related condition and reduced HBV- related markers in the blood. In certain embodiments, administration of an HBV siRNA compound decreases HBV RNA levels, HBV DNA levels, HBV protein levels, HBsAg levels, or HBeAg levels by at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99%, or a range defined by any two of these values.
In certain embodiments, pharmaceutical compositions comprising a double-stranded compound targeted to HBV are used for the preparation of a medicament for treating a patient suffering or susceptible to an HBV-related condition.
Certain Combination Therapies
In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with one or more other pharmaceutical agents. In certain embodiments, such one or more other pharmaceutical agents are designed to treat the same disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat a different disease, disorder, or condition as the one or more pharmaceutical compositions provided herein. In certain embodiments, such one or more other pharmaceutical agents are designed to treat an undesired side effect of one or more pharmaceutical compositions provided herein. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to treat an undesired effect of that other pharmaceutical agent. In certain embodiments, one or more pharmaceutical compositions provided herein are coadministered with another pharmaceutical agent to produce a combinational effect. In certain embodiments, one or more pharmaceutical compositions provided herein are co-administered with another pharmaceutical agent to produce a synergistic effect. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at the same time. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are administered at different times. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared together in a single formulation. In certain embodiments, one or more pharmaceutical compositions provided herein and one or more other pharmaceutical agents are prepared separately. In certain embodiments, the double- stranded compounds disclosed are administered in combination with an HCV agent. In further embodiments, the HCV compound is administered simultaneously as the siRNA compound; in other embodiments, the HCV compound is administered separately; so that a dose of each of the HCV agent and the siRNA compound overlap, in time, within the patient's body. In related embodiments, the HCV agent may be selected from interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated); ribavirin; an HCV RNA replication inhibitor (e.g., ViroPharma's VP50406 series); an HCV antisense agent; an HCV therapeutic vaccine; an HCV protease inhibitor; an HCV helicase inhibitor; and an HCV antibody therapy (monoclonal or polyclonal).
In other embodiments, an HBV double-stranded compound may be administered to a patient infected with HBV, in combination with one or more HBV therapeutic agents, wherein the one or more HBV therapeutic agents may be administered in the same drug formulation as the HBV double-stranded compound, or may be administered in a separate formulation. The one or more HBV therapeutic agents may be administered simultaneously with the double-stranded compound, or may be administered separately, so that a dose of each of the double-stranded compound and the HBV therapeutic agent overlap, in time, within the patient's body. In related embodiments, the one or more HBV therapeutic agent may be selected from interferon alpha-2b, interferon alpha-2a, and interferon alphacon-1 (pegylated and unpegylated), ribavirin; an HBV RNA replication inhibitor; a HBV antisense compound; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir; tenofovir; telbivudine (LdT); adefovir; and an HBV antibody therapy (monoclonal or polyclonal). EXAMPLES
Non-limiting disclosure and incorporation by reference
While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1: Inhibition of HBV viral mRNA in HepG2 cells by siRNA
Short interfering RNA (siRNA) double-stranded copounds were designed targeting a HBV viral nucleic acid and were tested for their effects on HBV mRNA in vitro. Cultured HepG2 cells at a density of 28,000 cells per well were transfected using LipofectAMINE2000® with 100 nM of siRNA. After a treatment period of approximately 24 hours, RNA was isolated from the cells and HBV mRNA levels were measured by quantitative real-time PCR. Viral primer probe sets RTS3370 (forward sequence CTTGGTCATGGGCCATCAG, designated herein as SEQ ID NO: 24; reverse sequence CGGCTAGGAGTTCCGCAGTA, designated herein as SEQ ID NO: 25; probe sequence TGCGTGGAACCTTTTCGGCTCC, designated herein as SEQ ID NO: 26) and RTS3371 (forward sequence CCAAACCTTCGGACGGAAA, designated herein as SEQ ID NO: 27; reverse sequence TGAGGCCCACTCCCATAGG, designated herein as SEQ ID NO: 28; probe sequence CCCATCATCCTGGGCTTTCGGAAAAT, designated herein as SEQ ID NO: 29) and were used to separately measure mRNA levels. HBV mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are presented as percent inhibition of HBV, relative to untreated control cells.
The newly designed modified double-stranded siRNA compounds in Table 1 below were designed consisting of two oligonucleotide strands. Each strand is 21 nucleosides in length with 19 RNA nucleosides linked to two DNA nucleosides. The internucleoside linkages throughout each gapmer are phosphate linkages. All sugar residues throughout the RNA nucleosides are ribose sugars; all sugar residues throughout the DNA nucleosides are deoxyribose sugars. The 'Chemistry' column describes the sugar residues and linkages of each nucleoside: 'r' indicates ribose sugar, 'd' indicates deoxyribose sugar; Ό' indicates phosphate linkage; A, U, T, G, C are the standard nomenclature for the nucleosides, adenine, uracil, thymine, guanine, and cytosine. "Viral Target start site" indicates the 5'-most nucleotide to which the double- stranded siRNA compound is targeted in the viral gene sequence. "Viral Target stop site" indicates the 3 '-most nucleotide to which the double- stranded siRNA compound is targeted viral gene sequence. Each double-stranded siRNA compound listed in Table 1 is targeted to the viral genomic sequence, designated herein as SEQ ID NO: 1 (GENBANK Accession No. U95551.1). Each antisense strand has two mismatched nucleosides inserted at the 3 ' end, as indicated by the asterisk above the relevant nucleoside in the Chemistry column; the remaining nucleosides have 100% complementarity to the target region. Each sense strand has two nucleosides inserted at the 5' end, as indicated by the asterisk above the relevant nucleoside in the Chemistry column; the remaining nucleosides have 100% complementarity to the target region.
Table 1
Inhibition of viral HBV mRNA levels by siRNA measured with RTS3370 or RTS3371
Figure imgf000072_0001
Figure imgf000073_0001
Gro* Aro*
Cro Uro
Cro Gro
Uro Gro GACTCGT Gro Uro GGT
253 273 582255 sense 37
Gro Gro GGACTTC Aro Cro TCTT
Uro Uro
Cro Uro
Cro Tdo Td
Uro Gro
Aro Gro
Aro Gro
Aro Aro
TGAGAG
Gro Uro
AAGT
254 274 582208 antisense Cro Cro 38
CCACCA
Aro Cro
CGATT
Cro Aro
Cro Gro
Aro Tdo*
582208 Td*
75 74
582256 Uro* Cro*
Gro Uro
Gro Gro
Uro Gro
TCGTGGT
Gro Aro
GGA
256 276 582256 sense Cro Uro 39
CTTCTCT
Uro Cro
CATT
Uro Cro
Uro Cro
Aro Tdo
Td
Aro Uro
Uro Gro
Aro Gro
Aro Gro
ATTGAG
Aro Aro
AGAA
256 276 582209 antisense Gro Uro 40
GTCCACC
Cro Cro
ACTT
Aro Cro
Cro Aro
Cro Tdo*
582209 Td*
77 70
582257 Gro Uro*
Gro* Gro
Uro Gro
Gro Aro
GTGGTG
Cro Uro
GACT
258 278 582257 sense Uro Cro 41
TCTCTCA
Uro Cro
ATTT
Uro Cro
Aro Aro
Uro Tdo
Td
Figure imgf000075_0001
Uro* Gro*
Gro Aro
Cro Uro
Uro Cro TGGACTT Uro Cro CTCT
262 282 582260 sense 47
Uro Cro CAATTTT Aro Aro CTT
Uro Uro
Uro Uro
Cro Tdo Td
Aro Gro
Aro Aro
Aro Aro
Uro Uro
AGAAAA
Gro Aro
TTGA
261 281 582213 antisense Gro Aro 48
GAGAAG
Gro Aro
TCCTT
Aro Gro
Uro Cro
Cro Tdo*
582213 Td*
74 73
582261 Gro Gro*
Aro* Cro
Uro Uro
Cro Uro
GGACTTC
Cro Uro
TCTC
263 283 582261 sense Cro Aro 49
AATTTTC
Aro Uro
TTT
Uro Uro
Uro Cro
Uro Tdo
Td
Uro Aro
Gro Aro
Aro Aro
Aro Uro
TAGAAA
Uro Gro
ATTGAG
262 282 582214 antisense Aro Gro 50
AGAAGT
Aro Gro
CTT
Aro Aro
Gro Uro
Cro Tdo*
582214 Td*
66 65
582262 Gro* Aro*
Cro Uro
Uro Cro
Uro Cro
Uro Cro GACTTCT
264 284 582262 sense Aro Aro CTCAATT 51
Uro Uro TTCTATT Uro Uro
Cro Uro
Aro Tdo
Td
Figure imgf000077_0001
Uro* Cro*
Uro Cro
Uro Cro
Aro Aro
TCTCTCA
Uro Uro
ATTT
268 288 582265 sense Uro Uro 57
TCTAGG
Cro Uro
GGTT
Aro Gro
Gro Gro
Gro Tdo
Td
Gro Gro
Aro Cro
Uro Gro
Cro Gro
GGACTG
Aro Aro
CGAA
301 321 582218 antisense Uro Uro 58
TTTTGGC
Uro Uro
CATT
Gro Gro
Cro Cro
Aro Tdo*
582218
Td* 51 45
582266
Uro* Gro*
Gro Cro
Cro Aro
Aro Aro TGGCCA
Aro Uro AAAT
303 323 582266 sense 59
Uro Cro TCGCAGT Gro Cro CCTT
Aro Gro
Uro Cro
Cro Tdo Td
Aro Aro
Cro Gro
Cro Cro
Gro Cro
AACGCC
Aro Gro
GCAG
374 394 582219 antisense Aro Cro 60
ACACAT
Aro Cro
CCATT
Aro Uro
Cro Cro
Aro Tdo*
582219 Td*
82 78
582267 Uro Gro*
Gro* Aro
Uro Gro
Uro Gro
TGGATGT
Uro Cro
GTC
376 396 582267 sense Uro Gro 61
TGCGGC
Cro Gro
GTTTT
Gro Cro
Gro Uro
Uro Tdo
Td
Figure imgf000079_0001
Cro* Cro*
Uro Gro
Cro Uro
Gro Cro CCTGCTG Uro Aro CTA
414 434 582270 sense 67
Uro Gro TGCCTCA Cro Cro TCTT
Uro Cro
Aro Uro
Cro Tdo Td
Aro Aro
Gro Aro
Uro Gro
Aro Gro
AAGATG
Gro Cro
AGGC
414 434 582223 antisense Aro Uro 68
ATAGCA
Aro Gro
GCATT
Cro Aro
Gro Cro
Aro Tdo*
582223 Td*
79 80
582271 Uro Gro*
Cro* Uro
Gro Cro
Uro Aro
TGCTGCT
Uro Gro
ATG
416 436 582271 sense Cro Cro 69
CCTCATC
Uro Cro
TTTT
Aro Uro
Cro Uro
Uro Tdo
Td
Aro Gro
Aro Aro
Gro Aro
Uro Gro
AGAAGA
Aro Gro
TGAG
416 436 582224 antisense Gro Cro 70
GCATAG
Aro Uro
CAGTT
Aro Gro
Cro Aro
Gro Tdo*
582224 Td*
86 86
582272 Cro Uro*
Gro* Cro
Uro Aro
Uro Gro
CTGCTAT
Cro Cro
GCC
418 438 582272 sense Uro Cro 71
TCATCTT
Aro Uro
CTTT
Cro Uro
Uro Cro
Uro Tdo
Td
Figure imgf000081_0001
Cro* Cro*
Uro Aro
Uro Gro
Gro Gro
CCTATGG
Aro Gro
GAG
639 659 582275 sense Uro Gro 77
TGGGCCT
Gro Gro
CATT
Cro Cro
Uro Cro
Aro Tdo
Td
Gro Cro
Aro Cro
Uro Aro
Gro Uro
GCACTA
Aro Aro
GTAA
668 688 582228 antisense Aro Cro 78
ACTGAG
Uro Gro
CCATT
Aro Gro
Cro Cro
Aro Tdo*
582228
Td* 60 59
582276
Uro* Gro*
Gro Cro
Uro Cro
Aro Gro
TGGCTCA
Uro Uro
670 690 582276 sense GTTTACT 79
Uro Aro
AGTGCTT
Cro Uro
Aro Gro
Uro Gro
Cro Tdo Td
Gro Aro
Aro Cro
Aro Aro
Aro Uro
GAACAA
Gro Gro
ATGG
677 697 582229 antisense Cro Aro 80
CACTAGT
Cro Uro
AATT
Aro Gro
Uro Aro
Aro Tdo*
582229
Td* 35 38
582277
Uro* Uro*
Aro Cro
Uro Aro
Gro Uro TTACTAG
Gro Cro TGC
679 699 582277 sense 81
Cro Aro CATTTGT Uro Uro TCTT
Uro Gro
Uro Uro
Cro Tdo Td
Figure imgf000083_0001
Uro* Cro*
Uro Gro
Cro Cro
Gro Aro
Uro Cro TCTGCCG
1259 1279 582280 sense Cro Aro ATCCATA 87
Uro Aro CTGCGTT Cro Uro
Gro Cro
Gro Tdo
Td
Uro Uro
Cro Cro
Gro Cro
Aro Gro
TTCCGCA
Uro Aro
GTA
1260 1280 582233 antisense Uro Gro 88
TGGATC
Gro Aro
GGCTT
Uro Cro
Gro Gro
Cro Tdo*
582233 Td*
89 83
582281 Gro* Cro*
Cro Gro
Aro Uro
Cro Cro
GCCGAT
Aro Uro
CCAT
1262 1282 582281 sense Aro Cro 89
ACTGCG
Uro Gro
GAATT
Cro Gro
Gro Aro
Aro Tdo
Td
Aro Gro
Uro Uro
Cro Cro
Gro Cro
AGTTCCG
Aro Gro
CAG
1262 1282 582234 antisense Uro Aro 90
TATGGAT
Uro Gro
CGTT
Gro Aro
Uro Cro
Gro Tdo*
582234 Td*
85 77
582282 Cro Gro*
Aro* Uro
Cro Cro
Aro Uro
CGATCC
Aro Cro
ATAC
1264 1284 582282 sense Uro Gro 91
TGCGGA
Cro Gro
ACTTT
Gro Aro
Aro Cro
Uro Tdo
Td
Figure imgf000085_0001
Uro Gro*
Uro* Gro
Cro Aro
Cro Uro
TGTGCAC
Uro Cro
TTC
1580 1600 582285 sense Gro Cro 97
GCTTCAC
Uro Uro
CTTT
Cro Aro
Cro Cro
Uro Tdo
Td
Gro Aro
Gro Gro
Uro Gro
Aro Aro
GAGGTG
Gro Cro
AAGC
1579 1599 582238 antisense Gro Aro 98
GAAGTG
Aro Gro
CACTT
Uro Gro
Cro Aro
Cro Tdo*
582238
Td* 92 91
582286
Gro* Uro*
Gro Cro
Aro Cro
Uro Uro GTGCACT Cro Gro TCG
1581 1601 582286 sense 99
Cro Uro CTTCACC Uro Cro TCTT
Aro Cro
Cro Uro
Cro Tdo Td
Aro Gro
Aro Gro
Gro Uro
Gro Aro
AGAGGT
Aro Gro
GAAG
1580 1600 582239 antisense Cro Gro 100
CGAAGT
Aro Aro
GCATT
Gro Uro
Gro Cro
Aro Tdo*
582239 Td*
84 82
582287 Uro Gro*
Cro* Aro
Cro Uro
Uro Cro
TGCACTT
Gro Cro
CGC
1582 1602 582287 sense Uro Uro 101
TTCACCT
Cro Aro
CTTT
Cro Cro
Uro Cro
Uro Tdo
Td
Figure imgf000087_0001
Aro* Cro*
Uro Uro
Cro Gro
Cro Uro
Uro Cro ACTTCGC
1585 1605 582290 sense Aro Cro TTCACCT 107
Cro Uro CTGCATT Cro Uro
Gro Cro
Aro Tdo
Td
Gro Uro
Gro Cro
Aro Gro
Aro Gro
GTGCAG
Gro Uro
AGGTGA
1584 1604 582243 antisense Gro Aro 108
AGCGAA
Aro Gro
GTT
Cro Gro
Aro Aro
Gro Tdo*
582243
Td* 81 80
582291
Cro* Uro*
Uro Cro
Gro Cro
Uro Uro CTTCGCT Cro Aro TCA
1586 1606 582291 sense 109
Cro Cro CCTCTGC Uro Cro ACTT
Uro Gro
Cro Aro
Cro Tdo Td
Aro Cro
Gro Uro
Gro Cro
Aro Gro
ACGTGC
Aro Gro
AGAG
1586 1606 582244 antisense Gro Uro 110
GTGAAG
Gro Aro
CGATT
Aro Gro
Cro Gro
Aro Tdo*
582244 Td*
74 76
582292 Uro Cro*
Gro* Cro
Uro Uro
Cro Aro
TCGCTTC
Cro Cro
ACC
1588 1608 582292 sense Uro Cro 111
TCTGCAC
Uro Gro
GTTT
Cro Aro
Cro Gro
Uro Tdo
Td
Figure imgf000089_0001
Gro Cro
Uro* Gro
Uro Aro
Gro Gro
GCTGTA
Cro Aro
GGCA
1782 1802 582295 sense Uro Aro 117
TAAATTG
Aro Aro
GTTT
Uro Uro
Gro Gro
Uro Tdo
Td
Uro Aro
Gro Gro
Cro Aro
Gro Aro
TAGGCA
Gro Gro
GAGG
1819 1839 582248 antisense Uro Gro 118
TGAAAA
Aro Aro
AGTTT
Aro Aro
Aro Gro
Uro Tdo*
582248_ Td*
61 67
582296 Aro Cro
Uro Uro
Uro Uro
Uro Cro
Aro Cro
CACC
1821 1841 582296 sense Cro Uro 119
TCTGCCT
Cro Uro
ATT
Gro Cro
Cro Uro
Aro Tdo
Td
Cro Aro
Cro Aro
Gro Cro
Uro Uro
CACAGC
Gro Gro
TTGG
1863 1883 582249 antisense Aro Gro 120
AGGCTT
Gro Cro
GAATT
Uro Uro
Gro Aro
Aro Tdo*
582249_ Td*
17 17
582297 Uro Uro
Cro Aro
Aro Gro
Cro Cro
TTCAAGC
Uro Cro
CTC
1865 1885 582297 sense Cro Aro 121
CAAGCT
Aro Gro
GTGTT
Cro Uro
Gro Uro
Gro Tdo
Td
Figure imgf000091_0001

Claims

CLAIMS What is claimed is:
1. A compound, comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand and having a nucleobase sequence comprising at least 8 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-125, wherein at least one strand of the said oligonucleotide is modified.
2. A compound, comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein one strand of said oligonucleotide is complementary to SEQ ID NO: 1 and at least one strand of said oligonucleotide is modified.
3. A compound, comprising a modified double-stranded oligonucleotide consisting of 10 to 30 linked nucleosides per strand, wherein at least one strand of said oligonucleotide is modified and one strand of said oligonucleotide is complementary within the following nucleotide regions of SEQ ID NO: 1 : 56-76, 58-78, 194-214, 196-216, 245-265, 247-267, 251- 271, 253-273, 254-274, 256-276, 258-278, 259-279, 260-280, 261-281, 262-282, 263-283, 264- 284, 265-285, 266-286, 268-288, 301-321, 303-323, 374-394, 376-396, 381-401, 383-403, 409- 429, 411-431, 412-432, 414-434, 414-434, 416-436, 418-438, 455-475, 457-477, 463-483, 465- 485, 637-657, 639-659, 668-688, 670-690, 677-697, 679-699, 685-705, 687-707, 1253-1273, 1255-1275, 1257-1277, 1259-1279, 1260-1280, 1262-1282, 1264-1284, 1265-1285, 1267-1287, 1575-1595, 1577-1597, 1578-1598, 1579-1599, 1580-1600, 1581-1601, 1582-1602, 1583-1603, 1584-1604, 1585-1605, 1586-1606, 1588-1608, 1776-1796, 1778-1798, 1780-1800, 1782-1802, 1819-1839, 1821-1841, 1863-1883, 1865-1885, 1867-1887, 1869-1889, and 1871-1891.
4. The compound of any one of claims 1-3, wherein two strands of the oligonucleotide are modified.
5. The compound of any one of claims 1-4, wherein said modified oligonucleotide is at least 96% complementary to SEQ ID NO: 1.
6. The compound of any one of claims 1-4, wherein said modified oligonucleotide is at least 97% complementary to SEQ ID NO: 1.
7. The compound of any one of claims 1-4, wherein said modified oligonucleotide is at least 98% complementary to SEQ ID NO: 1.
8. The compound of any one of claims 1-4, wherein said modified oligonucleotide is at least 99% complementary to SEQ ID NO: 1.
9. The compound of any one of claims 1-4, wherein said modified oligonucleotide is 100% complementary to SEQ ID NO : 1.
10. The compound of any one of claims 1-9, wherein at least one internucleoside linkage is a modified internucleoside linkage.
11. The compound of claim 10, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.
12. The compound of any one of claims 1-11, wherein at least one nucleoside of the modified double-stranded oligonucleotide comprises a modified sugar.
13. The compound of claim 12, wherein the at least one modified sugar is a bicyclic sugar.
14. The compound of claim 12, wherein at least one modified sugar comprises a 2'-0- methoxy ethyl group.
15. The compound of claim 12, wherein the modified sugar comprises a 2'-0(CH2)2- OCH3 group.
16. The compound of claim 12, wherein the modified sugar comprises a 4'-CH(CH3)-0- 2' group.
17. The compound of claim 12, wherein the modified sugar is selected from the group consisting of 2'LNA, 2'MOE (2'-0-(CH2)2-OCH3), 4'-thio, 2'-0-methyl, 2'-fluoro, 2'-chloro, 2'- azido, 2'-deoxy-2'- fluoroarabino (FANA), 2'-0-trifluoromethyl, 2'-0-ethyl-trifluoromethoxy, 2'- O- difluoromethoxy-ethoxy, 2 '-O-trifluoro methyl, 2'-0-ethyl-trifluoromethoxy, 2'-0- difluoromethoxy-ethoxy, 2'-0-DNP (dinitrophenyl), ENA, UNA (unlocked nucleic acid), HM (4'-C-hydroxymethyl), ADA (2'-N-adamantylmethylcarbonyl-2'-amino-LNA), PYR (2'-N- pyren-l-ylmethyl-2'-amino-LNA), EA (2'-aminoethyl), GE (2'-guanidinoethyl), CE (2'- cyanoethyl), AP (2'-aminopropyl), OXE (oxetane-LNA), CLNA (2',4'-carbocyclic-LNA-locked nucleic acid), CENA (2',4'-carbocyclic-ENA-locked nucleic acid), AENA (2'-deoxy-2'-N,4'-C- ethylene-L A), ANA (altritol nucleic acid), HNA (hexitol nucleic acid), AEM (2'- aminoethoxymethyl), and APM (2'-aminopropoxymethyl).
18. The compound of any one of claims 1-17, wherein at least one nucleoside comprises a modified nucleobase.
19. The compound of claim 18, wherein the modified nucleobase is a 5 -methyl cytosine.
20. The compound of any one of claims 1-19, further comprising a liposome, polyethylene glycol (PEG), cholesterol, lipid, albumin, nucleic-acid-lipid particle, lipid nanoparticles, or micelle associated with the compound or conjugated to the compound.
21. A composition comprising the compound of any one of claims 1-19 or a salt thereof and at least one of a pharmaceutically acceptable carrier or diluent.
22. A method comprising administering to an animal the compound or composition of any one of claims 1-21.
23. The method of claim 22, wherein the animal is a human.
24. The method of claim 23, wherein administering the compound prevents, treats, ameliorates, or slows progression of a HBV-related disease, disorder or condition.
25. The method of claim 24, wherein the disease, disorder or condition is liver disease.
26. The method of claim 25, wherein the disease, disorder or condition is jaundice, liver inflammation, liver fibrosis, inflammation, liver cirrhosis, liver failure, diffuse hepatocellular inflammatory disease, hemophagocytic syndrome, serum hepatitis, HBV viremia, or liver disease-related transplantation.
27. The method of claim 26, wherein the disease or condition is a hyperproliferative condition.
28. The method of claim 27, wherein the hyperproliferative condition is liver cancer.
29. A method of reducing antigen levels in an animal comprising administering to said animal the compound or composition of any of claims 1-21.
30. The method of claim 29, wherein HBsAG levels are reduced.
31. The method of claim 29, wherein HBeAG levels are reduced.
32. The method of claim 29, wherein the animal is human.
33. The method of claim 29, comprising co-administering the compound or composition and a second agent.
34. The method of claim 33, wherein the compound or composition and the second agent are administered concomitantly.
PCT/US2013/037642 2012-04-20 2013-04-22 Modulation of hepatitis b virus (hbv) expression WO2013159109A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261636544P 2012-04-20 2012-04-20
US61/636,544 2012-04-20

Publications (1)

Publication Number Publication Date
WO2013159109A1 true WO2013159109A1 (en) 2013-10-24

Family

ID=49384152

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/037642 WO2013159109A1 (en) 2012-04-20 2013-04-22 Modulation of hepatitis b virus (hbv) expression

Country Status (1)

Country Link
WO (1) WO2013159109A1 (en)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014076195A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014118267A1 (en) 2013-01-30 2014-08-07 Santaris Pharma A/S Lna oligonucleotide carbohydrate conjugates
WO2016054421A1 (en) * 2014-10-02 2016-04-07 Protiva Biotherapeutics, Inc Compositions and methods for silencing hepatitis b virus gene expression
WO2017157899A1 (en) 2016-03-14 2017-09-21 F. Hoffmann-La Roche Ag Oligonucleotides for reduction of pd-l1 expression
WO2017216391A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Papd5 and papd7 inhibitors for treating a hepatitis b infection
JP2018515136A (en) * 2015-05-06 2018-06-14 ベニテック バイオファーマ リミテッド Reagent for use in treating hepatitis B virus (HBV) infection and use thereof
WO2019076842A1 (en) 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR REDUCTION OF PAPD5 AND PAPD7 mRNA FOR TREATING HEPATITIS B INFECTION
EP3524680A1 (en) 2013-05-01 2019-08-14 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ttr expression
WO2019193165A1 (en) 2018-04-05 2019-10-10 F. Hoffmann-La Roche Ag Use of fubp1 inhibitors for treating hepatitis b virus infection
WO2019200247A1 (en) * 2018-04-12 2019-10-17 Precision Biosciences, Inc. Optimized engineered meganucleases having specificity for a recognition sequence in the hepatitis b virus genome
WO2020011902A1 (en) 2018-07-13 2020-01-16 F. Hoffmann-La Roche Ag Oligonucleotides for modulating rtel1 expression
US10662416B2 (en) 2016-10-14 2020-05-26 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the hepatitis B virus genome
US10780108B2 (en) 2016-08-04 2020-09-22 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
USRE48345E1 (en) 2011-06-30 2020-12-08 Arrowhead Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
US10961535B2 (en) 2015-07-17 2021-03-30 Arcturus Therapeutics, Inc. Compositions and agents against hepatitis B virus and uses thereof
WO2021107097A1 (en) * 2019-11-28 2021-06-03 株式会社ボナック Nucleic acid molecule for hepatitis b treatment use
WO2021122910A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sbds inhibitors for treating hepatitis b virus infection
WO2021122869A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of scamp3 inhibitors for treating hepatitis b virus infection
WO2021122993A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
WO2021122921A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of cops3 inhibitors for treating hepatitis b virus infection
WO2021122735A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sept9 inhibitors for treating hepatitis b virus infection
WO2022038211A2 (en) 2020-08-21 2022-02-24 F. Hoffmann-La Roche Ag Use of a1cf inhibitors for treating hepatitis b virus infection
US11279929B2 (en) 2018-07-03 2022-03-22 Hoffmann-La Roche, Inc. Oligonucleotides for modulating Tau expression
WO2022167456A1 (en) 2021-02-02 2022-08-11 F. Hoffmann-La Roche Ag Enhanced oligonucleotides for inhibiting rtel1 expression
US11534453B2 (en) 2015-08-07 2022-12-27 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
US11535851B2 (en) 2016-05-05 2022-12-27 Benitec IP Holdings Inc. Reagents for treatment of hepatitis B virus (HBV) infection and use thereof
WO2023111210A1 (en) 2021-12-17 2023-06-22 F. Hoffmann-La Roche Ag Combination of oligonucleotides for modulating rtel1 and fubp1
US11685921B2 (en) 2015-07-17 2023-06-27 Arcturus Therapeutics, Inc. Molecules and agents for treating hepatitis B virus

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093797A2 (en) * 2002-05-02 2003-11-13 Abbott Laboratories Polynucleotides for the detection and quantification of hepatitis b virus nucleic acids
WO2006069064A2 (en) * 2004-12-22 2006-06-29 Nucleonics, Inc. Conserved hbv and hcv sequences useful for gene silencing
US20110098200A1 (en) * 2002-09-04 2011-04-28 Johnson & Johnson Research Pty Ltd Methods using dsdna to mediate rna interference (rnai)

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003093797A2 (en) * 2002-05-02 2003-11-13 Abbott Laboratories Polynucleotides for the detection and quantification of hepatitis b virus nucleic acids
US20110098200A1 (en) * 2002-09-04 2011-04-28 Johnson & Johnson Research Pty Ltd Methods using dsdna to mediate rna interference (rnai)
WO2006069064A2 (en) * 2004-12-22 2006-06-29 Nucleonics, Inc. Conserved hbv and hcv sequences useful for gene silencing

Cited By (55)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
USRE48345E1 (en) 2011-06-30 2020-12-08 Arrowhead Pharmaceuticals Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
US11155816B2 (en) 2012-11-15 2021-10-26 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
US10077443B2 (en) 2012-11-15 2018-09-18 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
EP3406718A1 (en) 2012-11-15 2018-11-28 Roche Innovation Center Copenhagen A/S Oligonucleotide conjugates
WO2014076195A1 (en) 2012-11-15 2014-05-22 Santaris Pharma A/S Oligonucleotide conjugates
WO2014118267A1 (en) 2013-01-30 2014-08-07 Santaris Pharma A/S Lna oligonucleotide carbohydrate conjugates
EP3828275A1 (en) 2013-05-01 2021-06-02 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ttr expression
EP3524680A1 (en) 2013-05-01 2019-08-14 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating ttr expression
CN107208095B (en) * 2014-10-02 2021-11-16 阿布特斯生物制药公司 Compositions and methods for silencing hepatitis b virus gene expression
WO2016054421A1 (en) * 2014-10-02 2016-04-07 Protiva Biotherapeutics, Inc Compositions and methods for silencing hepatitis b virus gene expression
CN107208095A (en) * 2014-10-02 2017-09-26 普洛体维生物治疗公司 Composition and method for making hepatitis B virogene expression silencing
US10415037B2 (en) 2014-10-02 2019-09-17 Arbutus Biopharma Corporation Compositions and methods for silencing hepatitis B virus gene expression
JP2018515136A (en) * 2015-05-06 2018-06-14 ベニテック バイオファーマ リミテッド Reagent for use in treating hepatitis B virus (HBV) infection and use thereof
US10898505B2 (en) 2015-05-06 2021-01-26 Benitec Biopharma Limited Reagents for treatment of hepatitis B virus (HBV) infection and use thereof
JP7191690B2 (en) 2015-05-06 2022-12-19 ベニテック バイオファーマ リミテッド Reagents and uses thereof for treating hepatitis B virus (HBV) infection
US10961535B2 (en) 2015-07-17 2021-03-30 Arcturus Therapeutics, Inc. Compositions and agents against hepatitis B virus and uses thereof
US11685921B2 (en) 2015-07-17 2023-06-27 Arcturus Therapeutics, Inc. Molecules and agents for treating hepatitis B virus
US11534453B2 (en) 2015-08-07 2022-12-27 Arrowhead Pharmaceuticals, Inc. RNAi therapy for hepatitis B virus infection
WO2017157899A1 (en) 2016-03-14 2017-09-21 F. Hoffmann-La Roche Ag Oligonucleotides for reduction of pd-l1 expression
US10829555B2 (en) 2016-03-14 2020-11-10 Hoffman-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression
US10745480B2 (en) 2016-03-14 2020-08-18 Hoffmann-La Roche, Inc. Oligonucleotides for reduction of PD-L1 expression
EP3786297A1 (en) 2016-03-14 2021-03-03 F. Hoffmann-La Roche AG Oligonucleotides for reduction of pd-l1 expression
US11466081B2 (en) 2016-03-14 2022-10-11 Hoffmann-La Roche Inc. Oligonucleotides for reduction of PD-L1 expression
US11535851B2 (en) 2016-05-05 2022-12-27 Benitec IP Holdings Inc. Reagents for treatment of hepatitis B virus (HBV) infection and use thereof
WO2017216390A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Nucleic acid molecules for reduction of papd5 or papd7 mrna for treating hepatitis b infection
EP4219767A1 (en) 2016-06-17 2023-08-02 F. Hoffmann-La Roche AG Papd5 and papd7 inhibitors for treating a hepatitis b infection
US11534452B2 (en) 2016-06-17 2022-12-27 Hoffmann-La Roche Inc. Nucleic acid molecules for reduction of PAPD5 or PAPD7 mRNA for treating hepatitis B infection
WO2017216391A1 (en) 2016-06-17 2017-12-21 F. Hoffmann-La Roche Ag Papd5 and papd7 inhibitors for treating a hepatitis b infection
US11191775B2 (en) 2016-06-17 2021-12-07 Hoffmann-La Roche Inc. PAPD5 and PAPD7 inhibitors for treating a hepatitis B infection
US10780108B2 (en) 2016-08-04 2020-09-22 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
US11590156B2 (en) 2016-08-04 2023-02-28 Arrowhead Pharmaceuticals, Inc. RNAi agents for hepatitis B virus infection
US11517584B2 (en) 2016-08-04 2022-12-06 Arrowhead Pharmaceuticals, Inc. RNAi agents for Hepatitis B virus infection
US10662416B2 (en) 2016-10-14 2020-05-26 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the hepatitis B virus genome
US11274285B2 (en) 2016-10-14 2022-03-15 Precision Biosciences, Inc. Engineered meganucleases specific for recognition sequences in the Hepatitis B virus genome
US11484546B2 (en) 2017-10-16 2022-11-01 Hoffman-La Roche Inc. Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
WO2019076842A1 (en) 2017-10-16 2019-04-25 F. Hoffmann-La Roche Ag NUCLEIC ACID MOLECULE FOR REDUCTION OF PAPD5 AND PAPD7 mRNA FOR TREATING HEPATITIS B INFECTION
US10953034B2 (en) 2017-10-16 2021-03-23 Hoffmann-La Roche Inc. Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
WO2019193165A1 (en) 2018-04-05 2019-10-10 F. Hoffmann-La Roche Ag Use of fubp1 inhibitors for treating hepatitis b virus infection
US11732262B2 (en) 2018-04-05 2023-08-22 Hoffmann—La Roche, Inc. Use of FUBP1 inhibitors for treating hepatitis B virus infection
WO2019200247A1 (en) * 2018-04-12 2019-10-17 Precision Biosciences, Inc. Optimized engineered meganucleases having specificity for a recognition sequence in the hepatitis b virus genome
US11788077B2 (en) 2018-04-12 2023-10-17 Precision Biosciences, Inc. Polynucleotides encoding optimized engineered meganucleases having specificity for a recognition sequence in the Hepatitis B virus genome
US11142750B2 (en) 2018-04-12 2021-10-12 Precision Biosciences, Inc. Optimized engineered meganucleases having specificity for a recognition sequence in the Hepatitis B virus genome
US11279929B2 (en) 2018-07-03 2022-03-22 Hoffmann-La Roche, Inc. Oligonucleotides for modulating Tau expression
US11753640B2 (en) 2018-07-03 2023-09-12 Hoffmann-La Roche Inc. Oligonucleotides for modulating Tau expression
WO2020011902A1 (en) 2018-07-13 2020-01-16 F. Hoffmann-La Roche Ag Oligonucleotides for modulating rtel1 expression
WO2021107097A1 (en) * 2019-11-28 2021-06-03 株式会社ボナック Nucleic acid molecule for hepatitis b treatment use
WO2021122735A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sept9 inhibitors for treating hepatitis b virus infection
WO2021122921A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of cops3 inhibitors for treating hepatitis b virus infection
WO2021122993A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of saraf inhibitors for treating hepatitis b virus infection
WO2021122869A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of scamp3 inhibitors for treating hepatitis b virus infection
WO2021122910A1 (en) 2019-12-19 2021-06-24 F. Hoffmann-La Roche Ag Use of sbds inhibitors for treating hepatitis b virus infection
WO2022038211A2 (en) 2020-08-21 2022-02-24 F. Hoffmann-La Roche Ag Use of a1cf inhibitors for treating hepatitis b virus infection
WO2022167456A1 (en) 2021-02-02 2022-08-11 F. Hoffmann-La Roche Ag Enhanced oligonucleotides for inhibiting rtel1 expression
US11898145B2 (en) 2021-02-02 2024-02-13 Hoffmann-La Roche Inc. Enhanced oligonucleotides for inhibiting RTEL1 expression
WO2023111210A1 (en) 2021-12-17 2023-06-22 F. Hoffmann-La Roche Ag Combination of oligonucleotides for modulating rtel1 and fubp1

Similar Documents

Publication Publication Date Title
WO2013159109A1 (en) Modulation of hepatitis b virus (hbv) expression
JP7198298B2 (en) Compositions for modulating SOD-1 expression
ES2856266T3 (en) Modulation of Hepatitis B Virus (HBV) Expression
AU2005252662B2 (en) Double strand compositions comprising differentially modified strands for use in gene modulation
ES2895099T3 (en) Compounds and Methods for Modulating Dystrophy Myotonic Protein Kinase (DMPK) Expression
US9605259B2 (en) Compounds and methods for modulating protein expression
JP7054672B2 (en) Regulator of diacylglycerol acyltransferase 2 (DGAT2)
EP2992095B1 (en) Microrna compounds and methods for modulating mir-122
JP6280045B2 (en) Method for regulating expression of metastasis associated with metastasis in lung adenocarcinoma 1 (METASTASIS-ASSOCIATED-IN-LUN-ADENOCARCINOMA-TRANSCRIPT-1: MALAT-1)
ES2747260T3 (en) Methods for modulating expression of C9ORF72 antisense transcript
US20140378533A1 (en) Modulation of rna by repeat targeting
US20110171287A1 (en) Use of Oligonucleotides with Modified Bases as Antiviral Agents
US20120295961A1 (en) Modulation of hepatitis b virus (hbv) expression
BR112018005223B1 (en) COMPOUNDS, USE OF THEM, AND PHARMACEUTICAL COMPOSITION
JP2022132548A (en) Modulators of PNPLA3 expression
TW201923080A (en) Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection
WO2021067744A1 (en) Chemical modifications of small interfering rna with minimal fluorine content
ES2909308T3 (en) Methods for modulating MECP2 expression
CN114828852A (en) HBV-targeted antiviral and/or immunomodulatory agent pharmaceutical combinations for the treatment of HBV
CN114846140A (en) Pharmaceutical combination of a therapeutic oligonucleotide targeting HBV and a TLR7 agonist for the treatment of HBV
JP2023536974A (en) Compositions and methods for inhibiting LPA expression
EP4077670A1 (en) Use of cops3 inhibitors for treating hepatitis b virus infection
CN111201319A (en) Modulation of expression of nucleic acid molecules
WO2009144365A1 (en) Use of oligonucleotides with modified bases as antiviral agents
NZ715151A (en) Modulators of growth hormone receptor

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13778156

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13778156

Country of ref document: EP

Kind code of ref document: A1