EP3419658A1 - Method of manufacturing a vaccine composition - Google Patents

Method of manufacturing a vaccine composition

Info

Publication number
EP3419658A1
EP3419658A1 EP17708325.0A EP17708325A EP3419658A1 EP 3419658 A1 EP3419658 A1 EP 3419658A1 EP 17708325 A EP17708325 A EP 17708325A EP 3419658 A1 EP3419658 A1 EP 3419658A1
Authority
EP
European Patent Office
Prior art keywords
virus
influenza
amount
vaccine
segments
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP17708325.0A
Other languages
German (de)
French (fr)
Inventor
Nigel J. DIMMOCK
Andrew J. EASTON
Philip S. GOULD
Jeffrey W. Almond
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Warwick
Original Assignee
University of Warwick
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Warwick filed Critical University of Warwick
Publication of EP3419658A1 publication Critical patent/EP3419658A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/145—Orthomyxoviridae, e.g. influenza virus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16151—Methods of production or purification of viral material

Definitions

  • the present invention relates to methods of live influenza vaccine manufacture, and in particular, methods to improve the infectivity, potency, consistency of manufacture, and/or yield of the vaccine composition.
  • the invention also relates to methods for monitoring the infectivity, potency or consistency of manufacture of a live attenuated viral vaccine.
  • Influenza occurs mainly as a seasonal winter-time respiratory infection in Northern and Southern hemispheres, with both influenza A and B viruses being responsible.
  • the major antigens of influenza viruses are the haemagglutinin (HA) and neuraminidase (NA) proteins that determine the H and N subtypes of influenza A viruses.
  • the A and B viruses both undergo antigenic drift, a continuous mutation of the genes encoding the HA and NA proteins that results in antigenic changes which, over a period of approximately 4 years, render previously acquired immunity ineffective (Wilson and Cox 1990).
  • influenza A viruses undergo antigenic shift, a property that stems from the ability of two strains infecting a single cell to exchange genomic segments through RNA reassortment. This results in the formation of novel chimeric viruses derived from human and non- human strains which can cause pandemics of influenza.
  • Vaccines are the main public health measure used to prevent influenza A and B viruses in global circulation, although the antivirals oseltamivir and zanamivir are employed to treat infections.
  • the first vaccine established was an inactivated virus preparation.
  • the killed vaccines typically contain whole or split inactivated viruses derived from currently circulating strains. Such vaccines may also contain separated or purified HA and NA proteins of currently circulating viruses.
  • Inactivated vaccine compositions are typically injected intramuscularly.
  • FluMistTM (Cimons 2003). Now more than 13 million doses are manufactured and distributed worldwide each year.
  • a tetravalent preparation was introduced that contains 2 recombinant influenza A and 2 B viruses, which have the HA and NA proteins of the strains predicted by the World Health Organization to be circulating in the upcoming influenza season (Table 1).
  • FluMistTM is licenced in the USA for those aged 2 to 49 years.
  • FluenzTM Tetra is used to prevent influenza in those aged 2 to 18 years.
  • FluenzTM contains the genomic RNAs encoding the HA and NA proteins of selected circulating A or B strains and 6 other genomic RNAs from an attenuated influenza AJ Ann Arbor/6/1960 or influenza B/Ann Arbor/1/1966 master donor strain respectively.
  • the master donor strains were made by adaption to growth in cell culture at
  • DI viruses Defective interfering viruses commonly occur in influenza virus A and B preparations grown in vivo (von Magnus 1954), and in vitro (Frensing et al. 2013; Frensing et al. 2014), and in natural human infections (Saira et al. 2013).
  • the rate of generation and accumulation of DI virus depends on the virus strain, the host cell, and the manner of propagation, with their appearance being more frequent when the virus is propagated at a high multiplicity of infection (Dimmock 1996; von Magnus 1954).
  • DI viruses are defective through having a major deletion in the genome, and interfering as the DI genome has the ability to inhibit the production of infectious virus (Huang 1973).
  • Influenza A DI RNAs all have a major deletion (around 80%) from the central region of the cognate full- length RNA segment and typically comprise 300-600 nucleotides (Duhaut and Dimmock 1998; Jennings et al. 1983; Nayak et al. 1985). The termini of the genomic RNA are always conserved. Most DI RNAs arise from RNAs 1, 2 and 3 which encode the proteins that make up the virion RNA-dependent RNA polymerase (comprising the virus PB2, PB 1 and PA proteins) (Lamb and Krug 1996). The DI RNA has a growth advantage over its cognate full-length segment and is preferentially packaged (Dimmock and Easton 2014).
  • DI influenza virus attenuates the virulence of the standard virus, so that a lethal dose of virulent virus no longer has any observable clinical effect on the animal, although that animal is infected in the normal target tissue and mounts a conventional immune response that protects it from any subsequent infection by the same virulent virus.
  • the presence of DI virus can convert a virulent virus into a live attenuated vaccine.
  • the present inventors have identified that commercial preparations of live attenuated influenza vaccines contain substantial amounts of influenza A and influenza B DI RNAs. Accordingly, the inventors propose methods for improving the infectivity, potency, consistency of manufacture and/or yield of a live influenza vaccine composition. In particular, preparations having a high DI virus content will have a low
  • infectivity:particle ratio By reducing the amount of DI virus, the infectivity:particle ratio can be improved so that a smaller number of influenza particles can provide the desired level of infectivity and potency for an effective vaccine.
  • the inventors' findings can also be used to monitor infectivity during the manufacturing process, in particular, to monitor for DI virus present during the manufacturing process. DI RNAs of influenza B have not previously been described.
  • references to manufacturing and/or commercial preparations relate to the production of live attenuated influenza vaccines in bulk. Typically, such manufacturing is set up to generate at least 10,000, more preferably at least 100,000 vaccine units per day.
  • a manufacturing process for a live attenuated influenza vaccine may comprise inoculation of at least 10,000 eggs, such as 100,000 eggs up to 1,000,000 eggs to produce the attenuated virus for harvesting.
  • a method of improving the infectivity, potency, consistency of manufacture and/or yield of a live attenuated influenza viral vaccine composition comprising the step of reducing the amount of at least one defective interfering virus in the composition.
  • the live viral vaccine is produced by propagation of a seed inoculum in eggs. We also describe production in cell culture.
  • the seed inoculum is produced by passage in cell culture or by harvesting virus particles from culture of cells transfected with one or more plasmid-encoding proteins required to produce the viral vaccine particles, and wherein the harvest of virus particles is conducted to reduce the amount of DI virus in the harvested particles, for example by reducing the amount of time for culture of the cells prior to harvest to reduce the amount of DI virus present in the harvested particles.
  • the method comprises the step of diluting the seed inoculum prior to introduction into the egg or cell culture and/or wherein the propagation conditions are adapted to reduce the amount of defective interfering virus that is produced in the composition during manufacture.
  • a method of monitoring the infectivity and/or potency of a live influenza vaccine during its manufacture comprising determining the presence or amount of one or more defective interfering viruses in a sample taken during the manufacturing process.
  • the amount DI virus is determined in a sample of seed inoculum and/or the amount of defective interfering virus is determined in a sample obtained during or after propagation of the inoculum in an egg or cell culture.
  • the presence of defective interfering virus present in the sample can be determined using any suitable technique, for example the presence of DI virus can be determined by conducting a reverse transcriptase amplification reaction and determining the size of the amplification products so produced or the amount of a defective interfering virus present in the sample is determined by a method comprising:
  • influenza vaccine preferably comprises attenuated influenza A, attenuated influenza B or a mixture thereof.
  • Figure 1 A Diagram of the general genetic organisation of influenza virus DI RNAs. The central deletion between positions labelled x and y is highly variable in length but the 5' and 3' termini (solid) are retained.
  • Figure IB Representative analysis of the products of RT-PCR using primers specific for each of segments 1, 2 and 3 of the influenza A and influenza B strains present in the FluenzTM Tetra vaccine (batch CH2020). Products representing full-length influenza segments are indicated by arrows; boxed areas indicate the regions excised for gel extraction for putative DI RNAs. Influenza A segment 1 (lanes 1-2), segment 2 (lanes 3- 4), segment 3 (lanes 5-8). Influenza B segment 1 (lanes 9-10), segment 2 (lanes 11-12), segment 3 : (lanes 13-14). Products were amplified for 30 cycles except for lanes 7-8 which required 35 cycles to visualise a faint full-length segment 3 RNA. Odd numbers show the products of a reaction mix containing reverse transcriptase (RT) while even numbers lack reverse transcriptase.
  • RT reverse transcriptase
  • Figure 1C Reverse transcriptase-PCR of the vaccine passaged once at limiting dilution in embryonated hen's eggs showing full-length segments Al-3.
  • the expected sizes of the PCR fragments derived from the full-length RNAs are: Al 2239 nts, A2 2318 nts, A3 2184 nts, Bl 2235 nts, B2 2306 nts, and B3 2235 nts.
  • L a ladder of markers with the size indicated in nucleotides.
  • the present invention is directed to methods for improving infectivity, potency, consistency of manufacture and/or yield, and/or for monitoring infectivity, potency, consistency of manufacture and/or yield of influenza viral vaccines.
  • the methods of the invention allow the monitoring and reduction of defective interfering (DI) virus present in a live influenza virus preparation.
  • DI defective interfering
  • Live attenuated influenza virus vaccines typically contain the genomic RNAs encoding the HA and NA proteins of selected circulating A or B strains and 6 other genomic RNAs from an attenuated influenza A or influenza B donor strain. There are multiple nucleotide substitutions spread over most of the 6 RNAs of the donor strains, protecting against reversion to wild-type.
  • each of the vaccine strains is grown in eggs and then pooled at the desired concentration to form the vaccine.
  • Each or either of the vaccine strains may also be grown in cell culture.
  • a DI influenza virus contains at least one defective RNA segment which has been formed as a result of an internal deletion in the one of the genomic segments. The DI vims genome is therefore a deleted form of the genome of the infectious virus that gives rise to it.
  • the DI virus is only able to replicate and propagate when its genome is present in a cell which has been infected by a virus with a complementing complete genome.
  • the concentration of DI virus genome is rapidly increased to high levels compared to that of the genome of the infectious virus in the presence of DI RNA, for example (Dimmock et al. 2012; Frensing et al. 2013; Frensing et al. 2014).
  • DI RNAs arise from segments 1, 2 and 3 which encode the proteins that make up the virion RNA-dependent RNA polymerase (PB2, PB 1 and PA).
  • a virus preparation may contain many DI viruses each containing a different deletion in one or more genome RNA segment (Duhaut and Dimmock, 1998). While DI influenza A RNAs are well known, there are no published data on influenza B DI RNAs, although defective influenza B viruses have been described. The present inventors show that such DI influenza B viruses also contain defective RNAs derived from segments 1, 2 and 3.
  • a DI virus RNA segment typically comprises the 5' terminal region and a variable number of contiguous nucleotides and the 3' terminal region and a variable number of contiguous nucleotides of the segment, and having a deletion in the central portion of the segment.
  • the sequences from the 5' and 3' regions are typically intact, that is the sequences represent a contiguous sequence from each of the 5' and 3' regions.
  • the cis-acting signals required for replication and packaging of the RNA into virus particles are present.
  • the DI virus RNA segment can be derived from influenza A or influenza B, and is typically derived from segment 1, 2 or 3.
  • the DI virus RNA segment comprises a deletion of the central portion of the segment from which it is derived.
  • the deletion is typically between 1,000 and 2,000 nucleotides in length being up to approximately 80% of the full-length segment.
  • the DI virus RNA typically has a total length between 300 and 600 nucleotides.
  • the presence of DI virus in a virus sample can be detected and quantified using any suitable technique.
  • suitable primers can be developed to amplify DI virus segments.
  • primers can be designed to anneal to the 5' and 3' ends of DI virus segments for subsequent amplification, for example by using the reverse-transcriptase polymerase chain reaction (RT-PCR).
  • RT-PCR reverse-transcriptase polymerase chain reaction
  • Amplified products can then be detected, for example by the use of suitable probes, or by size separation techniques.
  • the amplified products are separated, for example by gel electrophoresis to analyse the size of the amplified products.
  • the presence of DI virus segments, which contain deletions compared to genomic counterparts can readily be detected based on the size of the amplified products.
  • detection of DI virus can be determined through the use of suitable sequencing technology.
  • next generation or deep sequencing techniques can be used to determine the presence and quantity of DI virus, see for example (Killip et al. 2013).
  • sequencing techniques can be used to determine the relative amounts of terminal regions of each RNA segment, relative to the amounts of internal sequences from each segment.
  • the presence of DI virus derived from an RNA segment can be understood based on an increase in terminal segment sequences relative to the internal sequence for that segment.
  • analysis of the relative increase in the number of terminal sequence compared to internal sequence can provide an indication of the quantity of DI virus present, and also, the relative amount of DI virus to whole virus.
  • suitable primers and/or sequencing techniques can be used in order to assess DI virus associated with any RNA segment, and associated with one or more or all of the components used in the vaccine composition.
  • Live attenuated influenza virus vaccines are typically made up of component influenza virus strains, which are manufactured separately and combined to form the final vaccine product. DI viruses may be present in each of the components.
  • Live attenuated influenza virus vaccines are typically produced by transfecting cells with one or more plasmids encoding the 6 genomic segments of the donor strains and two further genomic segments encoding the selected HA and NA proteins. Virus is collected from the cells, either by harvesting at selected time, or by monitoring for virus production, and collection of virus from the culture supernatant. The collected virus is then propagated by introduction into eggs or cells to scale up production, and subsequently harvested for incorporation into the viral vaccine.
  • virus particles are inoculated into an embryonated egg or into cell culture.
  • the egg or cell culture is cultured for a period, and virus particles are recovered from the egg or cell culture.
  • the recovered material may be diluted and inoculated into further eggs or cells, prior to culture and collection of viral particles, a number of passages through the eggs or cells being conducted to produce viral particles for incorporation into the vaccine composition.
  • seed inoculums are typically prepared by culturing virus in cells in vitro, providing a premaster, master, optional sub-master and working seed inoculum. Such seed inoculums are prepared by passaging through cells. An ampule of working seed inoculum is then used to produce bulk lots for inoculation in eggs for passage through eggs, typically multiple passages through eggs for harvesting to produce the final vaccine composition.
  • the screening or monitoring methods of the present invention can be conducted at any stage in the manufacture of the viral vaccine, for example, by testing an aliquot of the initial inoculum obtained from the first cell culture of transfected plasmid(s), to determine the presence of DI virus in the initial inoculum, or during the propagation process, for example by taking a sample of virus particles from an egg or cell, or after harvesting from the egg or cell culture. Monitoring may take place at more than one stage, or at each stage in the process.
  • Monitoring methods described below can be used to detect the presence or increase in amount of DI virus in the sample, the presence or increase in DI virus being associated with a decrease in the yield of the attenuated influenza virus vaccine, or decreased infectivity or potency per virus particle.
  • the manufacturing process can be modified to reduce the amount of DI virus present.
  • the amount of DI virus in the vaccine is reduced in order to improve the infectivity (that is the ratio of the number of infectious units to the total number of virus particles present).
  • the presence of DI virus particles reduces the overall infectivity of the composition, since the DI virus particles are not independently infectious, but contribute to the overall number of particles.
  • Infectivity can be determined by comparing the number of infectious units to the total number of particles.
  • the infectivity can be determined by standard methods.
  • the particle number can be determined by measuring the number of haemagglutinating units or HAU with red blood cells from an appropriate species. Alternatively particle number can be determined by various immunological techniques, such as ELISA. Specific infectivity (described herein as infectivity) is expressed as the infectious units (IU): HAU ratio.
  • infectivity can be increased by at least
  • the infectivity can be increased at least 2-fold, 3-fold, 4-fold, 5-fold, up to 10-fold, or even up to 20 fold, 50 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, up to 1,000 fold, up to 10,000 fold, even up to 100,000 fold.
  • the vaccine composition can be formulated with a reduced number of virus particles per dose to provide the same effective dose as a composition comprising a higher number of virus particles, in which DI virus is present.
  • the amount of DI virus can be reduced by a number of different methods.
  • DI virus cannot replicate in a cell unless the cell is co-infected with an infectious viral particle.
  • DI virus can be reduced by seeking to avoid co- infection of DI and infectious virus together in the same cell or egg.
  • cells can be transfected with a low concentration of plasmid, in an effort to minimize the production of DI virus in the cells.
  • plasmids can be subject to limiting dilution, and cells transfected to identify the lowest concentration available to achieve transfection of cells and production of virus particles.
  • the cells can be cultured for a minimum time possible, to optimize infectious virus production and to minimize DI virus production. Also some cell types are more susceptible to production of DI virus, and so the cell type can be selected to reduce DI virus production.
  • An appropriate time for culture can readily be determined for a particular cell type and virus strain by routine experimentation, in particular by monitoring for the production of DI virus, to establish the optimum culture time to minimize DI virus production with an acceptable level of infectious virus production.
  • Eggs or cell culture can be inoculated with the lowest virus dose possible. Passage in eggs should be limited to the shortest available time, to optimize infectious virus production and to minimize DI virus production. The total number of passages in eggs or cell culture can also be kept to a minimum.
  • DI virus production by cells, in the inoculum or following passage in eggs can be monitored.
  • Preparations obtained from cells and/or eggs producing the least amount of DI virus can be selected for further inoculation of eggs or cells.
  • the present invention also relates to a live attenuated influenza viral vaccine obtained by the methods of the present invention, as described herein.
  • Such an attenuated live viral vaccine has a reduced amount of DI virus compared to attenuated viral vaccines produced by current methods, and/or demonstrate improved infectivity.
  • An attenuated live viral vaccine produced by current methods may contain more than 99% DI.
  • an attenuated influenza virus vaccine according to the present invention has less than 95%), typically less than 90%, such as less than 80%>, less than 70%, less than 60% or less than 50% DI.
  • such an attenuated influenza virus vaccine has between 90- 30%) DI, such as between 80-50%> DI.
  • a particularly preferred infectivity is in the range of 10 4 : 1-10 6 : 1, such as 10 5 : 1 to 10 6 : 1. Examples
  • influenza A DI RNAs retain the terminal sequences of the full-length RNA but lack most of its internal sequence
  • our strategy was to use primers designed to anneal at the termini of the genome segments and RT-PCR to amplify the relevant viral RNAs. This encompassed full-length segment 1, 2 or 3 RNAs and subgenomic RNAs derived therefrom. To discriminate between products originating from each of the three segments it was necessary to design primers that annealed to unique sequences adjacent to the conserved termini.
  • influenza B DI viruses are well known, no influenza B DI RNA sequence has been reported, but we assumed that they had the same general structure as influenza A DI RNAs and used the same strategy. This was vindicated. All
  • cDNA was made using reverse transcriptase Superscript III (Invitrogen) with 60 minutes extension at 55°C and the post extraction RNaseH option, using general segment-specific primers for type A
  • RNA1 forward primer (AlFor)
  • the number of the 5' terminal nucleotide refers to the nucleotide position in the genome segment to which the primer anneals.
  • the primers for the B/Ann Arbor/1/1966 master donor strain were: BlFor ( 32 ATCCTTATTTTCTCTTCATAGATG) (SEQ ID NO: 9), Blrev
  • PCR products were analysed by gel electrophoresis (Figure IB).
  • the CH2065 vaccine batch gave very similar data (not shown).
  • the full-length RNAs, with the exception of influenza A segment 3, were clearly visible.
  • Full length segment A3 could only be seen as a faint band when the PCR was extended for an additional 5 cycles.
  • PCR of the allantoic fluid from one such egg shows PCR products derived from the full length segments Al, A2 and A3 ( Figure 1C), and confirms the validity of the PCRs in Figure IB.
  • PCR products representing putative DI RNAs in the 200-800nt size range can be seen on some tracks as smears or fuzzy bands, as expected from the variable nature of the deletion and the heterogeneity of the resulting RNAs. These were most intense in the influenza A RNA segment 3 track where the PCR product of the full-length A3 RNA was very faint. Bands representing PCR products derived from full-length RNAs and putative DI RNAs were extracted from the gel, cloned using the Zero Blunt PCR cloning kit (Invitrogen) and sequenced. Sequencing of PCR products from full-length A and B RNAs 1-3 confirmed that they were derived from the relevant Ann Arbor master donor strain (Cox et al.
  • RNAs were aligned to RNAs 1-3 of the parental strains (A/ Ann Arbor/6/1960 and B/Ann Arbor/1/1966) (Cox et al. 1988; DeBorde et al. 1988) using DNASTAR software. Data show that subgenomic RNAs from all three segments of A and B viruses have the terminal sequences and large central deletions typical of an influenza DI RNA (Table 1). Over 80 DI RNAs from both batches of vaccine were sequenced. Most had a single central deletion but a majority of A2 DI RNAs (61.5%) had a more complex deletion pattern. Only one DI RNA sequence was isolated on more than one occasion (Table 1). These are the first sequences of influenza B DI RNA to be demonstrated, and confirm that they have a structure similar to influenza A DI RNAs.
  • DI RNAs have a single central deletion with two breakpoints; others indicated here have one or more additional breakpoints (not shown) but all retain the terminal sequences of the full-length segment
  • the infectiveness of an influenza virus preparation is determined by comparing the infectivity itself (infectious units or IU) with the total number of particles present.
  • Infectious and non-infectious virus particles agglutinate red blood cells equally, so the total particle count can be conveniently measured by haemagglutination (haemagglutinating units or HAU) with chicken red blood cells. Infectiveness is expressed as an IU: HAU ratio, with the most infectious preparations having a ratio of 10 6 .
  • the haemagglutinin titre of FluenzTM was determined as 2 x 10 3 HAU/0.2 ml.
  • the infectivity of FluenzTM is 10 7 infectious units/0.2 ml for each of the four virus strains (manufacture's specification), giving an IU: HAU ratio of 5 x 10 3 for at least one of the four components of the vaccine.
  • Such a low ratio over 99% below the optimum value, is consistent with the presence of substantial amounts of DI RNA and, by implication, of DI virus.
  • influenza viruses origin, structure, expression and interference. Current Topics in Microbiology and Immunology 114: 103-151.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Pulmonology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention is directed to methods of improving the infectivity, potency, consistency of manufacture and/or yield of a live virusvaccine composition, preferably an influenza virus vaccine composition. The methods comprise the step of reducing the amount of defective interfering virus in the composition. The present invention also provides methods for monitoring the infectivity,potency, consistency of manufacture and/or yield of the composition, for example, by detecting DI virus in the composition.

Description

METHOD OF MANUFACTURING A VACCINE COMPOSITION
Field of the Invention
The present invention relates to methods of live influenza vaccine manufacture, and in particular, methods to improve the infectivity, potency, consistency of manufacture, and/or yield of the vaccine composition. The invention also relates to methods for monitoring the infectivity, potency or consistency of manufacture of a live attenuated viral vaccine. Background to the Invention
Influenza occurs mainly as a seasonal winter-time respiratory infection in Northern and Southern hemispheres, with both influenza A and B viruses being responsible. The major antigens of influenza viruses are the haemagglutinin (HA) and neuraminidase (NA) proteins that determine the H and N subtypes of influenza A viruses. The A and B viruses both undergo antigenic drift, a continuous mutation of the genes encoding the HA and NA proteins that results in antigenic changes which, over a period of approximately 4 years, render previously acquired immunity ineffective (Wilson and Cox 1990). In addition influenza A viruses undergo antigenic shift, a property that stems from the ability of two strains infecting a single cell to exchange genomic segments through RNA reassortment. This results in the formation of novel chimeric viruses derived from human and non- human strains which can cause pandemics of influenza.
Although shifts are fortunately rare events, documented for 1918 (HlNl), 1957 (H2N2), 1968 (H3N2), 1977 (HlNl) and 2009 (HlNl), the introduction of a new virus into the human population can be catastrophic. 1918 was the worst pandemic of modern times, with an estimated death toll of 50 million. The drain on national economies is similarly ferocious and is estimated to cost the USA at least $90 billion per year (Dobson 2007). In addition to the major shift viruses listed above, other shift viruses have appeared, e.g. H1N2 in 2001, but have not become established globally (Nicholson 2003). In 1918 and 1957 the antigenic shift virus displaced the incumbent global strain, but the HlNl shift variants of 1977 and 2009 appeared and then continued to co-circulate with the entrenched H3N2. Influenza B viruses undergo antigenic drift but not shift, but drift has given rise to two antigenically distinct lineages that currently co-circulate.
Vaccines are the main public health measure used to prevent influenza A and B viruses in global circulation, although the antivirals oseltamivir and zanamivir are employed to treat infections. The first vaccine established was an inactivated virus preparation. The killed vaccines typically contain whole or split inactivated viruses derived from currently circulating strains. Such vaccines may also contain separated or purified HA and NA proteins of currently circulating viruses. Inactivated vaccine compositions are typically injected intramuscularly. In 2003 an intranasally administered live attenuated vaccine comprising representatives of three circulating viruses, was introduced under the name FluMist™ (Cimons 2003). Now more than 13 million doses are manufactured and distributed worldwide each year. In 2013 a tetravalent preparation was introduced that contains 2 recombinant influenza A and 2 B viruses, which have the HA and NA proteins of the strains predicted by the World Health Organization to be circulating in the upcoming influenza season (Table 1). FluMist™ is licenced in the USA for those aged 2 to 49 years. In Europe, the same vaccine is marketed as Fluenz™ Tetra and is used to prevent influenza in those aged 2 to 18 years.
Fluenz™ contains the genomic RNAs encoding the HA and NA proteins of selected circulating A or B strains and 6 other genomic RNAs from an attenuated influenza AJ Ann Arbor/6/1960 or influenza B/Ann Arbor/1/1966 master donor strain respectively. The master donor strains were made by adaption to growth in cell culture at
subphysiological temperatures, and both have the phenotypic characteristics of cold adaption (ca) (efficient growth at 25°C), temperature sensitivity (ts) in cell culture of influenza A at 39°C and influenza B at 37°C, and attenuation (att) or restricted growth in the lower respiratory tract of ferrets (Murphy and Coelingh 2002). There are multiple nucleotide substitutions spread over most of the 6 RNAs, protecting against reversion to wild-type. Each of the four vaccine strains is grown in eggs and then pooled at the desired concentration to form the vaccine.
Defective interfering (DI) viruses commonly occur in influenza virus A and B preparations grown in vivo (von Magnus 1954), and in vitro (Frensing et al. 2013; Frensing et al. 2014), and in natural human infections (Saira et al. 2013). The rate of generation and accumulation of DI virus depends on the virus strain, the host cell, and the manner of propagation, with their appearance being more frequent when the virus is propagated at a high multiplicity of infection (Dimmock 1996; von Magnus 1954). DI viruses are defective through having a major deletion in the genome, and interfering as the DI genome has the ability to inhibit the production of infectious virus (Huang 1973). Influenza A DI RNAs all have a major deletion (around 80%) from the central region of the cognate full- length RNA segment and typically comprise 300-600 nucleotides (Duhaut and Dimmock 1998; Jennings et al. 1983; Nayak et al. 1985). The termini of the genomic RNA are always conserved. Most DI RNAs arise from RNAs 1, 2 and 3 which encode the proteins that make up the virion RNA-dependent RNA polymerase (comprising the virus PB2, PB 1 and PA proteins) (Lamb and Krug 1996). The DI RNA has a growth advantage over its cognate full-length segment and is preferentially packaged (Dimmock and Easton 2014).
We have shown in vivo that when DI influenza virus and standard influenza virus are mixed together the DI virus attenuates the virulence of the standard virus, so that a lethal dose of virulent virus no longer has any observable clinical effect on the animal, although that animal is infected in the normal target tissue and mounts a conventional immune response that protects it from any subsequent infection by the same virulent virus. Thus the presence of DI virus can convert a virulent virus into a live attenuated vaccine.
Summary of the Invention
The present inventors have identified that commercial preparations of live attenuated influenza vaccines contain substantial amounts of influenza A and influenza B DI RNAs. Accordingly, the inventors propose methods for improving the infectivity, potency, consistency of manufacture and/or yield of a live influenza vaccine composition. In particular, preparations having a high DI virus content will have a low
infectivity:particle ratio. By reducing the amount of DI virus, the infectivity:particle ratio can be improved so that a smaller number of influenza particles can provide the desired level of infectivity and potency for an effective vaccine. The inventors' findings can also be used to monitor infectivity during the manufacturing process, in particular, to monitor for DI virus present during the manufacturing process. DI RNAs of influenza B have not previously been described.
References to manufacturing and/or commercial preparations relate to the production of live attenuated influenza vaccines in bulk. Typically, such manufacturing is set up to generate at least 10,000, more preferably at least 100,000 vaccine units per day. A manufacturing process for a live attenuated influenza vaccine may comprise inoculation of at least 10,000 eggs, such as 100,000 eggs up to 1,000,000 eggs to produce the attenuated virus for harvesting.
In accordance with the present invention, there is provided a method of improving the infectivity, potency, consistency of manufacture and/or yield of a live attenuated influenza viral vaccine composition, comprising the step of reducing the amount of at least one defective interfering virus in the composition. In a preferred aspect of the invention, the live viral vaccine is produced by propagation of a seed inoculum in eggs. We also describe production in cell culture.
Preferably, the seed inoculum is produced by passage in cell culture or by harvesting virus particles from culture of cells transfected with one or more plasmid-encoding proteins required to produce the viral vaccine particles, and wherein the harvest of virus particles is conducted to reduce the amount of DI virus in the harvested particles, for example by reducing the amount of time for culture of the cells prior to harvest to reduce the amount of DI virus present in the harvested particles. Additionally or alternatively, the method comprises the step of diluting the seed inoculum prior to introduction into the egg or cell culture and/or wherein the propagation conditions are adapted to reduce the amount of defective interfering virus that is produced in the composition during manufacture.
In another aspect of the present invention, there is provided a method of monitoring the infectivity and/or potency of a live influenza vaccine during its manufacture comprising determining the presence or amount of one or more defective interfering viruses in a sample taken during the manufacturing process.
In accordance with this aspect of the invention, preferably, the amount DI virus is determined in a sample of seed inoculum and/or the amount of defective interfering virus is determined in a sample obtained during or after propagation of the inoculum in an egg or cell culture.
The presence of defective interfering virus present in the sample can be determined using any suitable technique, for example the presence of DI virus can be determined by conducting a reverse transcriptase amplification reaction and determining the size of the amplification products so produced or the amount of a defective interfering virus present in the sample is determined by a method comprising:
(a) sequencing a portion of the 5' or 3' terminal region of a virus segment;
(b) sequencing a portion from the internal region of a virus segment;
(c) determining the ratio of terminal region sequences to internal region sequences to determine thereby the ratio of DI virus present in the sample.
In accordance with the present invention the influenza vaccine preferably comprises attenuated influenza A, attenuated influenza B or a mixture thereof. Detailed Description of the Invention
Description of the Figures
Figure 1 A. Diagram of the general genetic organisation of influenza virus DI RNAs. The central deletion between positions labelled x and y is highly variable in length but the 5' and 3' termini (solid) are retained.
Figure IB. Representative analysis of the products of RT-PCR using primers specific for each of segments 1, 2 and 3 of the influenza A and influenza B strains present in the Fluenz™ Tetra vaccine (batch CH2020). Products representing full-length influenza segments are indicated by arrows; boxed areas indicate the regions excised for gel extraction for putative DI RNAs. Influenza A segment 1 (lanes 1-2), segment 2 (lanes 3- 4), segment 3 (lanes 5-8). Influenza B segment 1 (lanes 9-10), segment 2 (lanes 11-12), segment 3 : (lanes 13-14). Products were amplified for 30 cycles except for lanes 7-8 which required 35 cycles to visualise a faint full-length segment 3 RNA. Odd numbers show the products of a reaction mix containing reverse transcriptase (RT) while even numbers lack reverse transcriptase.
Figure 1C. Reverse transcriptase-PCR of the vaccine passaged once at limiting dilution in embryonated hen's eggs showing full-length segments Al-3. The expected sizes of the PCR fragments derived from the full-length RNAs are: Al 2239 nts, A2 2318 nts, A3 2184 nts, Bl 2235 nts, B2 2306 nts, and B3 2235 nts. L, a ladder of markers with the size indicated in nucleotides.
The present invention is directed to methods for improving infectivity, potency, consistency of manufacture and/or yield, and/or for monitoring infectivity, potency, consistency of manufacture and/or yield of influenza viral vaccines. The methods of the invention allow the monitoring and reduction of defective interfering (DI) virus present in a live influenza virus preparation.
Live attenuated influenza virus vaccines typically contain the genomic RNAs encoding the HA and NA proteins of selected circulating A or B strains and 6 other genomic RNAs from an attenuated influenza A or influenza B donor strain. There are multiple nucleotide substitutions spread over most of the 6 RNAs of the donor strains, protecting against reversion to wild-type. Typically, each of the vaccine strains is grown in eggs and then pooled at the desired concentration to form the vaccine. Each or either of the vaccine strains may also be grown in cell culture. A DI influenza virus contains at least one defective RNA segment which has been formed as a result of an internal deletion in the one of the genomic segments. The DI vims genome is therefore a deleted form of the genome of the infectious virus that gives rise to it. The DI virus is only able to replicate and propagate when its genome is present in a cell which has been infected by a virus with a complementing complete genome. The concentration of DI virus genome is rapidly increased to high levels compared to that of the genome of the infectious virus in the presence of DI RNA, for example (Dimmock et al. 2012; Frensing et al. 2013; Frensing et al. 2014).
Most DI RNAs arise from segments 1, 2 and 3 which encode the proteins that make up the virion RNA-dependent RNA polymerase (PB2, PB 1 and PA). A virus preparation may contain many DI viruses each containing a different deletion in one or more genome RNA segment (Duhaut and Dimmock, 1998). While DI influenza A RNAs are well known, there are no published data on influenza B DI RNAs, although defective influenza B viruses have been described. The present inventors show that such DI influenza B viruses also contain defective RNAs derived from segments 1, 2 and 3.
A DI virus RNA segment typically comprises the 5' terminal region and a variable number of contiguous nucleotides and the 3' terminal region and a variable number of contiguous nucleotides of the segment, and having a deletion in the central portion of the segment. The sequences from the 5' and 3' regions are typically intact, that is the sequences represent a contiguous sequence from each of the 5' and 3' regions. Typically the cis-acting signals required for replication and packaging of the RNA into virus particles are present. The DI virus RNA segment can be derived from influenza A or influenza B, and is typically derived from segment 1, 2 or 3.
The DI virus RNA segment comprises a deletion of the central portion of the segment from which it is derived. The deletion is typically between 1,000 and 2,000 nucleotides in length being up to approximately 80% of the full-length segment. The DI virus RNA typically has a total length between 300 and 600 nucleotides.
The presence of DI virus in a virus sample can be detected and quantified using any suitable technique. Given that the DI virus RNA segments comprise conserved sequences from the 5' and 3' ends of influenza genomic segments, suitable primers can be developed to amplify DI virus segments. For example, primers can be designed to anneal to the 5' and 3' ends of DI virus segments for subsequent amplification, for example by using the reverse-transcriptase polymerase chain reaction (RT-PCR). Amplified products can then be detected, for example by the use of suitable probes, or by size separation techniques. In a preferred embodiment, after amplification the amplified products are separated, for example by gel electrophoresis to analyse the size of the amplified products. The presence of DI virus segments, which contain deletions compared to genomic counterparts can readily be detected based on the size of the amplified products.
In an alternative embodiment, detection of DI virus can be determined through the use of suitable sequencing technology. For example, next generation or deep sequencing techniques can be used to determine the presence and quantity of DI virus, see for example (Killip et al. 2013). In particular, sequencing techniques can be used to determine the relative amounts of terminal regions of each RNA segment, relative to the amounts of internal sequences from each segment. The presence of DI virus derived from an RNA segment can be understood based on an increase in terminal segment sequences relative to the internal sequence for that segment. Thus, analysis of the relative increase in the number of terminal sequence compared to internal sequence can provide an indication of the quantity of DI virus present, and also, the relative amount of DI virus to whole virus.
In any of the detection methods described herein, suitable primers and/or sequencing techniques can be used in order to assess DI virus associated with any RNA segment, and associated with one or more or all of the components used in the vaccine composition.
When using quantitative techniques to determine the amount of DI virus present, the ratio of DI virus to whole virus can be determined to provide an indication of the infectivity and/or potency of the virus vaccine. In particular, increasing the quantity of DI virus in the composition for a fixed number of virus particles will decrease the infectivity and/or potency of the composition. Quantitative techniques can also be used to determine the amount of DI virus present at a particular stage in the manufacturing process. The methods of the invention can be used to compare changes in the amount of DI virus relative to another batch at the same stage in the process and/or changes in the amount of DI virus as the batch goes through the manufacturing process.
Live attenuated influenza virus vaccines are typically made up of component influenza virus strains, which are manufactured separately and combined to form the final vaccine product. DI viruses may be present in each of the components. Live attenuated influenza virus vaccines are typically produced by transfecting cells with one or more plasmids encoding the 6 genomic segments of the donor strains and two further genomic segments encoding the selected HA and NA proteins. Virus is collected from the cells, either by harvesting at selected time, or by monitoring for virus production, and collection of virus from the culture supernatant. The collected virus is then propagated by introduction into eggs or cells to scale up production, and subsequently harvested for incorporation into the viral vaccine.
In particular, virus particles are inoculated into an embryonated egg or into cell culture. The egg or cell culture is cultured for a period, and virus particles are recovered from the egg or cell culture. The recovered material may be diluted and inoculated into further eggs or cells, prior to culture and collection of viral particles, a number of passages through the eggs or cells being conducted to produce viral particles for incorporation into the vaccine composition.
In more detail, typically, production of a live attenuated influenza virus vaccine in eggs is conducted using a seed inoculum. Seed inoculums are typically prepared by culturing virus in cells in vitro, providing a premaster, master, optional sub-master and working seed inoculum. Such seed inoculums are prepared by passaging through cells. An ampule of working seed inoculum is then used to produce bulk lots for inoculation in eggs for passage through eggs, typically multiple passages through eggs for harvesting to produce the final vaccine composition.
The screening or monitoring methods of the present invention can be conducted at any stage in the manufacture of the viral vaccine, for example, by testing an aliquot of the initial inoculum obtained from the first cell culture of transfected plasmid(s), to determine the presence of DI virus in the initial inoculum, or during the propagation process, for example by taking a sample of virus particles from an egg or cell, or after harvesting from the egg or cell culture. Monitoring may take place at more than one stage, or at each stage in the process.
Monitoring methods described below can be used to detect the presence or increase in amount of DI virus in the sample, the presence or increase in DI virus being associated with a decrease in the yield of the attenuated influenza virus vaccine, or decreased infectivity or potency per virus particle.
In accordance with the present invention, the manufacturing process can be modified to reduce the amount of DI virus present. In particular, the amount of DI virus in the vaccine is reduced in order to improve the infectivity (that is the ratio of the number of infectious units to the total number of virus particles present). The presence of DI virus particles reduces the overall infectivity of the composition, since the DI virus particles are not independently infectious, but contribute to the overall number of particles.
Infectivity can be determined by comparing the number of infectious units to the total number of particles. The infectivity can be determined by standard methods. The particle number can be determined by measuring the number of haemagglutinating units or HAU with red blood cells from an appropriate species. Alternatively particle number can be determined by various immunological techniques, such as ELISA. Specific infectivity (described herein as infectivity) is expressed as the infectious units (IU): HAU ratio.
In accordance with the present invention, infectivity can be increased by at least
10%, at least 20%, at least 30, 40, 50, 60, 70, 80 or 90%, or by more than 100% or more. For example, the infectivity can be increased at least 2-fold, 3-fold, 4-fold, 5-fold, up to 10-fold, or even up to 20 fold, 50 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, up to 1,000 fold, up to 10,000 fold, even up to 100,000 fold.
If the infectivity of the vaccine for a given number of virus particles is increased, then a reduced dosage in terms of the number of virus particles can be given to provide the same effective dose of vaccine. Accordingly, by reducing DI virus, the vaccine composition can be formulated with a reduced number of virus particles per dose to provide the same effective dose as a composition comprising a higher number of virus particles, in which DI virus is present.
The amount of DI virus can be reduced by a number of different methods. In particular, DI virus cannot replicate in a cell unless the cell is co-infected with an infectious viral particle. Accordingly, DI virus can be reduced by seeking to avoid co- infection of DI and infectious virus together in the same cell or egg. For example, cells can be transfected with a low concentration of plasmid, in an effort to minimize the production of DI virus in the cells. For example, plasmids can be subject to limiting dilution, and cells transfected to identify the lowest concentration available to achieve transfection of cells and production of virus particles.
Following transfection of the cells, the cells can be cultured for a minimum time possible, to optimize infectious virus production and to minimize DI virus production. Also some cell types are more susceptible to production of DI virus, and so the cell type can be selected to reduce DI virus production. An appropriate time for culture can readily be determined for a particular cell type and virus strain by routine experimentation, in particular by monitoring for the production of DI virus, to establish the optimum culture time to minimize DI virus production with an acceptable level of infectious virus production.
Eggs or cell culture can be inoculated with the lowest virus dose possible. Passage in eggs should be limited to the shortest available time, to optimize infectious virus production and to minimize DI virus production. The total number of passages in eggs or cell culture can also be kept to a minimum.
By monitoring for the presence and amount of DI virus throughout the process, then DI virus production by cells, in the inoculum or following passage in eggs can be monitored. Preparations obtained from cells and/or eggs producing the least amount of DI virus can be selected for further inoculation of eggs or cells.
These steps can be conducted for each component of the vaccine.
The present invention also relates to a live attenuated influenza viral vaccine obtained by the methods of the present invention, as described herein. Such an attenuated live viral vaccine has a reduced amount of DI virus compared to attenuated viral vaccines produced by current methods, and/or demonstrate improved infectivity. An attenuated live viral vaccine produced by current methods may contain more than 99% DI. Thus, typically, an attenuated influenza virus vaccine according to the present invention has less than 95%), typically less than 90%, such as less than 80%>, less than 70%, less than 60% or less than 50% DI. Typically, such an attenuated influenza virus vaccine has between 90- 30%) DI, such as between 80-50%> DI. Typically, the infectivity to total number of particles as expressed as haemagglutination units of at least 104: 1, preferably 105: 1 up to 106: 1. A particularly preferred infectivity is in the range of 104: 1-106: 1, such as 105: 1 to 106: 1. Examples
Methods and Results
As all influenza A DI RNAs retain the terminal sequences of the full-length RNA but lack most of its internal sequence, our strategy was to use primers designed to anneal at the termini of the genome segments and RT-PCR to amplify the relevant viral RNAs. This encompassed full-length segment 1, 2 or 3 RNAs and subgenomic RNAs derived therefrom. To discriminate between products originating from each of the three segments it was necessary to design primers that annealed to unique sequences adjacent to the conserved termini. Although influenza B DI viruses are well known, no influenza B DI RNA sequence has been reported, but we assumed that they had the same general structure as influenza A DI RNAs and used the same strategy. This was vindicated. All
methodologies followed the manufacturers' recommendations unless stated. RNA was isolated from Fluenz™ Tetra from the 2014-2015 vaccine season (batches CH2020 and
CH2065) using Trizol LS (Thermo Fisher Scientific). cDNA was made using reverse transcriptase Superscript III (Invitrogen) with 60 minutes extension at 55°C and the post extraction RNaseH option, using general segment-specific primers for type A
(NNNAGCAAAAGCAGG) (SEQ ID NO: 1) and type B (AGCAGAAGCGGWGCGTTT) (SEQ ID NO: 2). Each segment was amplified with Pfu DNA polymerase (Promega) for 30 seconds at 94°C and then 30 cycles of 30 seconds at 94°C, 30 seconds at 55°C, 5 minutes at 68°C, and a final extension for 10 minutes at 72°C. The primers for the A/ Ann Arbor/6/1960 (H2N2) master donor strain were: RNA1 forward primer (AlFor)
(60GTCGCAGTCCCGCACTCGCGAG) (SEQ ID NO: 3) and RNA1 reverse primer (AlRev) (2298GGCCATCCGAATTCTTTTGG) (SEQ ID NO: 4); A2For
(12GCAAACCATTTGAATGGATG) (SEQ ID NO: 5) and A2Rev
(2329CATTTTTTCATGAAGGACAAG) (SEQ ID NO: 6); A3 For
(28GAAGACTTTGTGCGACAATGC) (SEQ ID NO: 7) and A3 Rev
(2211GGACAGTACGGATAACAAATAG) (SEQ ID NO: 8). The number of the 5' terminal nucleotide refers to the nucleotide position in the genome segment to which the primer anneals. The primers for the B/Ann Arbor/1/1966 master donor strain were: BlFor (32ATCCTTATTTTCTCTTCATAGATG) (SEQ ID NO: 9), Blrev
(2266TCTCACCAAGGTGAGCCATTGC) (SEQ ID NO: 10); B2For
(33GCCAAAATTGAATTGTTAAAACAAC) (SEQ ID NO: 11), B2Rev
(2338TATTAGCTCAAGGCCCACCC) (SEQ ID NO: 12); B3For
(32GGATACTTTTATTACAAGAAAC) (SEQ ID NO: 13) and B3Rev
(2266GATGTTTAGATACATAATGAAC) (SEQ ID NO: 14).
PCR products were analysed by gel electrophoresis (Figure IB). The CH2065 vaccine batch gave very similar data (not shown). The full-length RNAs, with the exception of influenza A segment 3, were clearly visible. Full length segment A3 could only be seen as a faint band when the PCR was extended for an additional 5 cycles. To verify that this was a genuine finding and not a failure of the RT-PCR, we passaged the vaccine once at limiting dilution in embryonated chicken's eggs, a procedure known to minimise the amount of DI RNA present (von Magnus 1954). PCR of the allantoic fluid from one such egg shows PCR products derived from the full length segments Al, A2 and A3 (Figure 1C), and confirms the validity of the PCRs in Figure IB. In Figure IB PCR products representing putative DI RNAs in the 200-800nt size range can be seen on some tracks as smears or fuzzy bands, as expected from the variable nature of the deletion and the heterogeneity of the resulting RNAs. These were most intense in the influenza A RNA segment 3 track where the PCR product of the full-length A3 RNA was very faint. Bands representing PCR products derived from full-length RNAs and putative DI RNAs were extracted from the gel, cloned using the Zero Blunt PCR cloning kit (Invitrogen) and sequenced. Sequencing of PCR products from full-length A and B RNAs 1-3 confirmed that they were derived from the relevant Ann Arbor master donor strain (Cox et al. 1988; DeBorde et al. 1988). Amplified DNA derived from putative DI RNAs obtained from influenza A segment 2, and influenza B segments 1 and 3 were weak or non-existent, but gel extraction of the anticipated region (200-800nts) was still carried out and DI RNA sequences were found in all samples (Figure IB, Table 1).
Sequenced RNAs were aligned to RNAs 1-3 of the parental strains (A/ Ann Arbor/6/1960 and B/Ann Arbor/1/1966) (Cox et al. 1988; DeBorde et al. 1988) using DNASTAR software. Data show that subgenomic RNAs from all three segments of A and B viruses have the terminal sequences and large central deletions typical of an influenza DI RNA (Table 1). Over 80 DI RNAs from both batches of vaccine were sequenced. Most had a single central deletion but a majority of A2 DI RNAs (61.5%) had a more complex deletion pattern. Only one DI RNA sequence was isolated on more than one occasion (Table 1). These are the first sequences of influenza B DI RNA to be demonstrated, and confirm that they have a structure similar to influenza A DI RNAs.
Table 1. Summary of DI RNA sequences isolated directly from Fluenz Tetra vaccine
a Most DI RNAs have a single central deletion with two breakpoints; others indicated here have one or more additional breakpoints (not shown) but all retain the terminal sequences of the full-length segment
b in nucleotides from 3'-5' of virion sense RNA
c One DI RNA sequence (single central deletion) was found twice in the A 1 -derived DI RNAs and was discounted for further calculations
The infectiveness of an influenza virus preparation is determined by comparing the infectivity itself (infectious units or IU) with the total number of particles present.
Infectious and non-infectious virus particles agglutinate red blood cells equally, so the total particle count can be conveniently measured by haemagglutination (haemagglutinating units or HAU) with chicken red blood cells. Infectiveness is expressed as an IU: HAU ratio, with the most infectious preparations having a ratio of 106. The haemagglutinin titre of Fluenz™ was determined as 2 x 103 HAU/0.2 ml. The infectivity of Fluenz™ is 107 infectious units/0.2 ml for each of the four virus strains (manufacture's specification), giving an IU: HAU ratio of 5 x 103 for at least one of the four components of the vaccine. Such a low ratio, over 99% below the optimum value, is consistent with the presence of substantial amounts of DI RNA and, by implication, of DI virus.
References
Cimons M. 2003. FDA okays live-attenuated nasal spray form of flu vaccine. American
Society for Microbiology News 69: 426-427.
Cox NJ, Kitame F, Kendal AP, Maassab FIF, Naeve C. 1988. Identification of Sequence Changes in the Cold- Adapted, Live Attenuated Influenza Vaccine Strain, A/ Ann
Arbor/6/60 (H2N2). Virology 167: 554-567.
DeBorde DC, Donabedian AM, Herlocher ML, Naeve CW, Maasab HF. 1988. Sequence
Comparison of Wild-Type and Cold- Adapted B/Ann Arbor/1/66 Influenza Virus
Genes. Virology 163: 429-443.
Dimmock NJ 1996 Antiviral activity of defective interfering influenza virus in vivo. In:
Myint S, Taylor-Robinson D, editors. Viral and Other Infections of the Respiratory
Tract. London: Chapman and Hall. pp. 421-445.
Dimmock NJ, Dove BK, Meng B, Scott PD, Taylor I, Cheung L, Hallis B, Marriott AC,
Carroll MW, Easton AJ. 2012. Comparison of the protection of ferrets against pandemic 2009 influenza A virus (H1N1) by 244 DI virus and oseltamivir.
Antiviral Research 96: 376-385.
Dimmock NJ, Easton AJ. 2014. Defective interfering influenza virus RNAs: time to reevaluate their clinical potential as broad spectrum antivirals? Journal of Virology
88: 5217-5227.
Dobson R. 2007. Flu costs the United States $90bn a year. British Medical Journal 334:
1134.
Duhaut SD, Dimmock NJ. 1998. Heterologous protection against a lethal human H1N1 influenza virus infection of mice by a H3N8 equine defective interfering virus: comparison of defective RNA sequences isolated from the DI inoculum and mouse lung. Virology 248: 241-253.
Frensing T, Heldt FS, Pflugmacher A, Behrendt I, Jordan I, Flockerzi D, Genzel Y, Reichl U. 2013. Continuous influenza virus production in cell culture shows a periodic accumulation of defective interfering particles. PLoS ONE 8: e72288.
Frensing T, Pflugmacher A, Bachmann M, Peschel B, Reichl U. 2014. Impact of defective interfering particles on virus replication and antiviral host response in cell culture- based influenza vaccine production. Applied Microbiology and Biotechnology 98: 8999-9008.
Huang AS. 1973. Defective interfering viruses. Annual Review of Microbiology 27: 101- 117. Jennings PA, Finch JT, Winter G, Robertson JS. 1983. Does the higher order of the influenza virus ribonucleoprotein guide sequence rearrangements in influenza viral RNA. Cell 34: 619-627.
Killip MJ, D. F. Young, D. Gatherer, C. S. Ross, J. A. L. Short, A. J. Davison, S.
Goodbourn, Randall RE. 2013. Deep sequencing analysis of defective genomes of parainfluenza virus 5 and their role in interferon induction. Journal of Virology 87: 4798-4807.
Lamb RA, Krug RM 1996 Orthomyxoviridae: the viruses and their replication. In: Fields
BN, Knipe DM, Howley PM, editors. Fields Virology. 3 ed. Philadelphia:
Lippincott-Raven Publishers, pp. 1353-1395.
Murphy BR, Coelingh K. 2002. Principles underlying the development and use of live attenuated cold-adapted influenza A and B virus vaccines. Viral Immunology 15:
295-323.
Nayak DP, Chambers TM, Akkina RK. 1985. Defective-interfering (DI) RNAs of
influenza viruses: origin, structure, expression and interference. Current Topics in Microbiology and Immunology 114: 103-151.
Nicholson KG, et al. 2003. Influenza. Lancet 362: 1733-1745.
Saira K, Lin X, DePasse JV, Halpin R, Twaddle A, Stockwell T, Angus B, Cozzi-Lepri A, Delfino M, Dugan V, et al. 2013. Sequence analysis of in vivo defective interfering-like RNA of influenza A H1N1 pandemic virus. Journal of Virology 87: 8064-8074.
von Magnus P. 1954. Incomplete forms of influenza virus. Advances in Virus Research 21:
59-79.
Wilson IA, Cox NJ. 1990. Structural basis of immune recognition of influenza virus
hemagglutinin. Annual Review of Immunology 8: 737-771.

Claims

1. A method of improving the infectivity, potency, consistency of manufacture and/or yield of a live attenuated influenza viral vaccine composition, comprising the step of reducing the amount of at least one defective interfering virus in the composition.
2. The method according to claim 1, wherein the live viral vaccine is produced by propagation in eggs of a seed inoculum.
3. The method according to claim 2 wherein the seed inoculum is produced by passage in cell culture or by harvesting virus particles from culture of cells transfected with one or more plasmid-encoding proteins required to produce the viral vaccine particle, and wherein the harvest of virus particles is conducted to reduce the amount of DI virus in the harvested particles.
4. The method according to claim 3, wherein the amount of time for culture of the cells prior to harvest is reduced to reduce the amount of DI virus present in the harvested particles.
5. The method according to any one of claims 2, 3 or 4, wherein the method comprises the step of diluting the seed inoculum prior to introduction into the egg.
6. The method according to any one of the preceding claims, wherein the propagation conditions are adapted to reduce the amount of defective interfering virus that is produced in the composition during manufacture.
7. A method of monitoring the infectivity, potency, consistency of manufacture and/or yield of a live attenuated influenza vaccine during its manufacture comprising determining the presence or amount of one or more defective interfering viruses in one or more samples obtained at one or more steps of the manufacturing process.
8. A method according to claim 7, wherein the amount DI virus is determined in a sample of seed inoculum.
9. A method according to claim 7 or 8, wherein the amount of defective interfering virus is determined in a sample during and/or after propagation of the inoculum in an egg or cell culture.
10. A method according to any one of claims 7 to 9, wherein the presence of defective interfering virus present in the sample is determined by conducting a reverse transcriptase amplification reaction and determining the size of the amplification products so produced.
11. A method according to any one of claims 7 to 9, wherein the amount of a defective interfering virus present in the sample is determined by a method comprising:
(a) sequencing a portion of the 5' or 3' terminal region of a virus segment;
(b) sequencing a portion from the internal region of a virus segment;
(c) determining the ratio of terminal region sequences to internal region sequences to determine thereby the ratio of DI virus present in the sample.
12. A method according to any one of the preceding claims wherein the influenza vaccine comprises attenuated influenza A, attenuated influenza B or a mixture thereof.
13. A method according to any one of the preceding claims wherein one or more of the DI viruses comprises a DI virus derived from segments 1, 2 or 3 of influenza A and/or derived from segments 1, 2 or 3 of influenza B.
14. The method according to claim 10, wherein the method comprises conducting an amplification reaction using primers which anneal to the 5' and 3' region of segments 1, 2 and/or 3 of influenza A and/or derived from segments 1, 2 and/or 3 of influenza B, and determining the size of the amplification products to detect the presence of one or more DI viruses derived from segments 1, 2 or 3 of influenza A and/or derived from segments 1, 2 or 3 of influenza B.
15. A live attenuated influenza viral vaccine composition obtained by the method of any one of claims 1 to 6.
16. An attenuated live viral vaccine composition according to claim 15, wherein the composition comprises less than 90% DI virus particles.
EP17708325.0A 2016-02-24 2017-02-24 Method of manufacturing a vaccine composition Withdrawn EP3419658A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB1603192.4A GB201603192D0 (en) 2016-02-24 2016-02-24 Method
PCT/GB2017/050497 WO2017144908A1 (en) 2016-02-24 2017-02-24 Method of manufacturing a vaccine composition

Publications (1)

Publication Number Publication Date
EP3419658A1 true EP3419658A1 (en) 2019-01-02

Family

ID=55753111

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17708325.0A Withdrawn EP3419658A1 (en) 2016-02-24 2017-02-24 Method of manufacturing a vaccine composition

Country Status (3)

Country Link
EP (1) EP3419658A1 (en)
GB (1) GB201603192D0 (en)
WO (1) WO2017144908A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5549896A (en) * 1991-05-08 1996-08-27 Schweiz. Serum- & Impfinstitut Bern Hepatitis a virus strain, method for the isolation of new hepatitis a virus strains and hepatitis a vaccines
US5646033A (en) * 1994-11-30 1997-07-08 Dyncorp African green monkey kidney cell lines useful for maintaining viruses and for preparation of viral vaccines
US9149508B1 (en) * 2011-10-26 2015-10-06 Sigmovir Biosystems, Inc. Vaccination by circumventing preexistent immunity
US20130156733A1 (en) * 2011-12-20 2013-06-20 Philip I. Marcus Influenza virus populations, methods of use and methods of making thereof

Also Published As

Publication number Publication date
GB201603192D0 (en) 2016-04-06
WO2017144908A1 (en) 2017-08-31

Similar Documents

Publication Publication Date Title
US12410409B2 (en) Influenza viruses with mutant PB2 gene segment as live attenuated vaccines
Bello et al. Diagnostic and vaccination approaches for Newcastle disease virus in poultry: The current and emerging perspectives
Nerome et al. Evolutionary characteristics of influenza B virus since its first isolation in 1940: dynamic circulation of deletion and insertion mechanism
Kumar et al. RETRACTED: Evaluation of the Newcastle Disease Virus F and HN Proteins in Protective Immunity by Using a Recombinant Avian Paramyxovirus Type 3 Vector in Chickens
AU2005303817B8 (en) Defective influenza virus particles
CN110305898A (en) Rescue of non-susceptible H9N2 subtype cold-adapted avian influenza virus from mammalian cells
Buonagurio et al. Genetic and phenotypic stability of cold-adapted influenza viruses in a trivalent vaccine administered to children in a day care setting
Shi et al. Cross-clade protective immune responses of NS1-truncated live attenuated H5N1 avian influenza vaccines
Zhao et al. An influenza virus vector candidate vaccine stably expressing SARS-CoV-2 receptor-binding domain produces high and long-lasting neutralizing antibodies in mice
Yi et al. Molecular characterization of a virulent genotype VIId strain of Newcastle disease virus from farmed chickens in Shanghai
Zhang et al. Sensitive, semi-nested RT-PCR amplification of fusion gene sequences for the rapid detection and differentiation of Newcastle disease virus
Shohaimi et al. Sequence and phylogenetic analysis of Newcastle disease virus genotype VII isolated in Malaysia during 1999-2012
CN103923886A (en) Screening of influenza virus temperature-sensitive strain key sites, and mutation strains and mechanism discussion thereof
JP2025502236A (en) Methods for attenuating influenza viruses and attenuated influenza virus strains, and uses thereof
CN114381439B (en) A method for weakening influenza viruses combined with synonymous mutations and deletion mutations, as well as weakened influenza virus strains and applications
WO2017144908A1 (en) Method of manufacturing a vaccine composition
CN104195113B (en) H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof
He Evaluation of a New Viral Vaccine Vector in Mice and Rhesus Macaques: J Paramyxovirus Expressing Hemagglutinin of Influenza A Virus H5N1
Hussein et al. Genetic diversity of avian influenza H5N1 Subclade 2.2. 1/C in commercial poultry in Egypt during 2013
CN102234636B (en) Preparation and application of recombinant influenza A (H1N1) virus cold-adapted attenuated live vaccine strain (SC/AAca)
CN108103097A (en) Measles virus mRNA transmethylase defect attenuated vaccine strains and its application
Walz Generation and evaluation of universal influenza vaccine candidates
Powell et al. A single cycle influenza virus coated in H7 hemagglutinin provides heterotypic protection and neutralising antibody responses to both glycoproteins
Beck et al. Human Parainfluenza Virus Infections
HK1153225A (en) Defective influenza virus particles

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20180913

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200305

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20230606