CN104195113B - H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof - Google Patents
H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof Download PDFInfo
- Publication number
- CN104195113B CN104195113B CN201410387974.XA CN201410387974A CN104195113B CN 104195113 B CN104195113 B CN 104195113B CN 201410387974 A CN201410387974 A CN 201410387974A CN 104195113 B CN104195113 B CN 104195113B
- Authority
- CN
- China
- Prior art keywords
- strain
- vaccine
- candidate strain
- vaccine candidate
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention relates to an H5-subtype avian influenza vaccine (AIV) candidate strain as well as a construction method and an application thereof. The vaccine candidate strain is obtained by modifying glycosylation sites on HA protein by adopting an A/mallard/Huadong/S/2005 (SY) strain as a female parent and screening, and particularly, the vaccine candidate strain is HA-protein-deleted rS-156-/170+/181- modified by glycosylation at 181st position. The vaccine candidate strain has the advantage of good serum cross-neutralizing capacity and can be used for preparing broad-spectrum H5-subtype AIV vaccines.
Description
Technical field
The present invention relates to a kind of Reverse Genetics that pass through are to H5 subtype avian influenza virus (AIV) HA protein glycosylations site
Carry out modifying the method for building broad spectrum activity H5 hypotype AIV vaccines, the AIV for relating generally to is distributed in 2.3.4 branches, 2.3.2.1 point
In branch and 7.2 branches.
Background technology
H5N1 subtype highly pathogenic avian influenzas can cause the high incidence of poultry and high case fatality rate, in China, Vietnam, India
Nicaea, India, Bangladesh and Egypt are in endemicity (FAO (Food and Agriculture Organization of the United Nation), http://www.fao.org), give
Aviculture brings huge economic loss.From reported first AIV in 1997 can since direct infection people, successively have H5N1,
H9N2, H7N7 and H7N9 hypotype AIV infects the report of the mankind.Till 8 days October in 2013 of cut-off, World Health Organization (WHO) (WHO)
(http://www.who.int) existing 641 people infection H5N1 hypotypes AIV in the report whole world, wherein 380 death, mortality rate
Close 60%.Therefore, highly pathogenic H5 hypotypes AIV had both endangered the development of aviculture, and human health is endangered again, were very important
Amphixenosises.
Vaccination is prevention and control influenza virus (Influenza virus, IV) maximally effective means, but IV is segmented
RNA viruses, because the duplication fidelity of RNA polymerase is relatively low, therefore viral genome variation is very fast, needs using matching epidemic strain
Vaccine carry out control and prevention of disease.Currently, the inactivated virus vaccine that Reverse Genetics build mostly is what China commonly used,
Such as Re-4, Re-5 and Re-6.Using Reverse Genetics can quick replacement current popular strain surface glycoprotein construct vaccine wait
Roguing, carries out the upgrading of vaccine strain to deal with bird flu epidemic situation.Because the vaccine of Reverse Genetics structure is mostly with PR8
For skeleton, therefore vaccine strain virus can be in a large number produced with mdck cell in the period of being very popular, to alleviate the pressure of Embryo Gallus domesticus supply.
At present H5N1 hypotypes AIV popular in China poultry are distributed mainly in 2.3.4 the and 2.3.2 branches in 2.3 branches and 7 branches
7.2 branches, intersecting protective is poor between different branches virus.And the popular virus of these advantages further evolves the 4th
Level branch, antigenicity and immunogenicity are further change in, and existing vaccine can not be provided and protected completely.Obviously, by matching
The vaccine development speed of epidemic strain does not catch up with the speed of virus variation forever.Therefore, broad spectrum activity vaccine can provide intersection because of it
Protectiveness and receive significant attention.2008, Chen etc. was prepared for a kind of DNA vaccination based on one section of HA conserved sequence, and counteracting toxic substances are protected
Shield test shows that the vaccine can provide 1 branch, 2.2 branches and 2.1 branch infecting mouses preferably protection.2012,
The extracellular region based on HA2 albumen such as Janulikova and fusion peptide fragment are prepared for coupled peptide Seedling, and this vaccine can be supported on mice
The attack of gear H3 or H7 subtype influenza virus.As can be seen here, most researcheres are devoted to excavate general epitope, and will
It is prepared into vaccine.By literature survey it is found that the glycosylation modified antigenicity and immunogenicity that can affect AIV.Wang
Used as immunogen, its counteracting toxic substances protective value is substantially better than wild type HA albumen to the HA albumen modified using deglycosylation Deng (2009),
And its serum shows stronger cross-neutralization ability.
The content of the invention
Highly pathogenic H5 hypotypes AIV bring huge harm to aviculture, virus variation compared with frequently and genotype is more,
Intersecting protective is poor between different genotype.Therefore, it is badly in need of developing the preferable New-type wide-spectrum vaccine of intersecting protective to tackle
H5 subtype avian influenza epidemic situations.
The present invention with A/mallard/Huadong/S/2005 (SY) strains of 2.3.4 branches for female parent, maternal viral sugar
Base site is S-156-/170+/181+, main glycosylation modified by increasing HA protein 15s 6, lacks its HA protein 17 0
It is glycosylation modified with 181, various combination pattern is formed, save out 6 plants of H5 hypotype AIV vaccine candidates using Reverse Genetics
Strain.Oil-adjuvant vaccine immunity SPF chickens are made after inactivation of virus and prepares serum, evaluate it in different branch H5 hypotypes AIV intersection
And property, filter out the good vaccine candidate strain of cross-neutralization ability.Inactivated vaccine immune animal is prepared, is surveyed by protest test
Fixed its immanoprotection action.
One plant of H5 subtype avian influenza vaccine candidate strains of the present invention, are rS-156-/170+/181-, and its structure is
With A/mallard/Huadong/S/2005 strains as maternal skeleton, disappearance HA protein 18s 1 are glycosylation modified.
The construction method of the H5 subtype avian influenzas vaccine candidate strain rS-156-/170+/181-, is with A/mallard/
Huadong/S/2005 strains are maternal skeleton, disappearance HA protein 18s 1 are glycosylation modified and obtain.
The invention also discloses the H5 subtype avian influenzas vaccine candidate strain rS-156-/170+/181- is preparing broad spectrum activity
Application in H5 hypotype AIV vaccines.
Virus SY strains are represented in be highly pathogenic H5N1 hypotype AIV 2.3.4 branches to chicken and duck as female parent,
The restructuring AIV [156 of the glycosylation modified disappearance combination of HA albumen different locis is built by point mutation technology and Reverse Genetics
+/170-/181-, 156-/170+/181-, 156-/170-/181+, 156+/170+/181-, 156+/170-/181+, 156+/
170+/181+ and 156-/170+/181+ (WT)].Using maternal virus as control, immunity SPF chickens after each recombinant viruses are inactivated
Serum is prepared, each serum is determined and the blood clotting of maternal virus and different branch H5N1 hypotypes AIV is suppressed and NAT, and
Using the high restructuring AIV of its blood clotting suppression and NAT as inactivated vaccine, its immunity is determined by protest test
Protective effect, filters out the recombinant viruses rS- that one plant of AIV to H5N1 hypotypes difference branch has extensive cross reactivity
156-/170+/181-, the vaccine can provide the immune chicken of various H5N1 hypotypes AIV counteracting toxic substances protection and suppress body detoxification, gram
Clinically existing vaccine can only protect the poor problem of term single gene type and cross protection to clothes, be H5N1 subtype highly pathogenic AIV
Anti- system provides new method.
Description of the drawings
Fig. 1 segmented-PCR amplifications
M, Marker；1,156 mutation leading portion；2,156 mutation back segments；3,170 mutation leading portions；4,170 mutation back segments；5,
181 mutation leading portions；6,181 mutation back segments.
Fig. 2 total length PCR amplifications
M, Marker；1,156 mutation total length；2,170 mutation total lengths；3,181 mutation total lengths.
Specific embodiment
Involved biomaterial is as follows in the present invention：
A/mallard/Huadong/S/2005 (SY) strain (Tang Y, Wu P, Peng D, Wang X, Wan H, Zhang
P,Long J,Zhang W,Li Y,Wang W,Zhang X,Liu X.Characterization of duck H5N1
influenza viruses with differing pathogenicity in mallard(Anas platyrhynchos)
ducks.Avian Pathol.2009 Dec；38(6):457-67.Yanfang Li,Sujuan Chen,Xiaojian
Zhang,Qiang Fu,Zhiye Zhang,Shaohua Shi,Yinbiao Zhu,Min Gu,Daxin Peng*,Xiufan
Liu*.A 20-amino-acid deletion in the neuraminidase stalk and a five-amino-
acid deletion in the NS1 protein both contribute to the pathogenicity of H5N1
avian influenza.Plos one.2014)。
The concrete technical scheme of the present invention is as follows：
1. point mutation and the rescue of vaccine strain
1.1 design of primers
According to A/mallard/Huadong/S/2005 (SY) strain virus HA sequences (Genebank serial numbers：
EU195392.1, Tang, Y., Wu, P., Sun, Q., Peng, D., Zhang, W., Li, Y., Wang, W., Long, J., Zhang,
P.,Liu,X.,2008,Role of amino acid residues at positions 322 and 329 of
hemagglutinin in virulence of H5N1 avian influenza virus.Chinese journal of
Virology 24,340-344.) design point mutation primer (table 1), 3 mutational sites are related to altogether：TPS 156 NSS, NNT
The 170 NNA and NNA of NNT 181.
The design of primers of table 1
| Primer | Primer sequence (5 ' -3 ') |
| HA-1b | TATTGGTCTCAGGGAGCAAAAGCAGGGGTT(SEQ ID NO.1) |
| HA-2b | ATATGGTCTCGTATTAGTAGAAACAAGGGTG(SEQ ID NO.2) |
| 156-F | CCTTACCAGGGAAACTCCTCCTTTTTCACa(SEQ ID NO.3) |
| 156-R | GTGAAAAAGGAGGAGTTTCCCTGGTAAGGa(SEQ ID NO.4) |
| 170-F | AAAAGAACAATGCATACCCAACAATAAAGAGAAGCa(SEQ ID NO.5) |
| 170-R | TTGTTGGGTATGCATTGTTCTTTTTGATAAGCCATAa(SEQ ID NO.6) |
| 181-F | CAATAAAGAGAAGCTACAATAATGCCAACCAGGAAGa(SEQ ID NO.7) |
| 181-R | CTTCCTGGTTGGCATTATTGTAGCTTCTCTTTATTGa(SEQ ID NO.8) |
aMutating alkali yl is marked with underscore.bSY strain HA full length gene pcr amplification primer thing upstream and downstreams.
1.2 Overlapping-PCR rite-directed mutagenesises
With SY strain totiviruss nucleic acid (Tang, Y., Wu, P., Sun, Q., Peng, D., Zhang, W., Li, Y., Wang, W.,
Long,J.,Zhang,P.,Liu,X.,2008,Role of amino acid residues at positions 322 and
329 of hemagglutinin in virulence of H5N1 avian influenza virus.Chinese
Journal of virology 24,340-344.) be template, total length primer (HA-1 and HA-2) reverse transcriptional PCR (RT-PCR)
Amplification HA genes, using 25 μ L systems：10 × Buffer2.5 μ L, Mg2+The μ L of 1.5 μ L, dNTP 0.2, primer HA-1 and 156-R,
156-F and HA-2, HA-1 and 170-R, 170-F and HA-2, HA-1 and 181-R, (concentration is 25 to each 0.5 μ L of 181-F and HA-2
μm ol/ μ L), Taq DNA polymerase (1U/ μ L) 1.5 μ L, the μ L of DNA profiling 2, with aseptic ultra-pure water polishing to 25 μ L.Reaction interval
Sequence：94 DEG C of denaturations 4min, 94 DEG C of degeneration 45s, 58 DEG C of annealing 45s, 72 DEG C of extension 45s, 30 circulations, 72 DEG C of extension 7min.
To be added in 1% agarose gel after PCR primer plus sample-loading buffer, with 1000bp marker as standard reference, use 80 volts
Voltage is run after 1h, and result is observed after dyeing, and SY strain HA genetic fragments total length is 1704bp (base).PCR primer band is cut
Afterwards, PCR primer is reclaimed with gel-purified QIAquick Gel Extraction Kit, determines concentration, and be cloned intoVector (is purchased from
Invitrogen companies), connection product transformed competence colibacillus escherichia coli choose the little upgrading grain of speckle, and plasmid send Jin Sirui biological engineering
Company limited's sequence verification, positive plasmid is named as pCR2.1-SY-HA.
With pCR2.1-SY-HA as template, total length primer distinguishes the two sections that PCR expands HA after combining with mutant primer,
Wherein 156 mutation amplify the band of 480bp and 1320bp, and 170 mutation amplify the band of 568bp and 1260bp, 181 mutation
Amplify the band (Fig. 1) of 600bp and 1200bp.
Jing gel-purifieds QIAquick Gel Extraction Kit reclaims PCR primer, determines concentration, and 1 is pressed for two sections by before and after:As mould after 1 mixing
Plate PCR expands HA full-length genes.All samples amplify the band (Fig. 2) of 1800bp.
After PCR primer band is cut, PCR primer is reclaimed with gel-purified QIAquick Gel Extraction Kit, determine concentration, and by its gram
It is grand extremelyVector, connection product transformed competence colibacillus escherichia coli choose the little upgrading grain of speckle, and plasmid send Jin Sirui biological
Engineering Co., Ltd's sequence verification, positive plasmid is respectively designated as pCR2.1-156+/170-/181-, pCR2.1-156-/170
+/181-、pCR2.1-156-/170-/181+、pCR2.1-156+/170+/181-、pCR2.1-156+/170-/181+、
PCR2.1-156-/170+/181+, pCR2.1-156+/170+/181+, -20 DEG C save backup.
1.3 expression plasmids build
With restricted enzyme Bsa I (be purchased from NEB companies) by HA fragments from positive plasmid (pCR2.1-156+/170-/
181-、pCR2.1-156-/170+/181-、pCR2.1-156-/170-/181+、pCR2.1-156+/170+/181-、
PCR2.1-156+/170-/181+, pCR2.1-156-/170+/181+, pCR2.1-156+/170+/181+) on digest,
With the pHW2000 of BsmB I (be purchased from NEB companies) digestion (Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom,
G.,Webster,R.G.,2000,A DNA transfection system for generation of influenza A
Virus from eight plasmids.Proc.Natl.Acad.Sci.U.S.A.97,6108-6113.) connection, connection product
Thing converts DH5 α competent cells and screens recon on ammonia benzyl flat board.Identify that correct recombiant plasmid is respectively designated as pHW-
156+/170-/181-、pHW-156-/170+/181-、pHW-156-/170-/181+、pHW-156+/170+/181-、pHW-
156+/170-/181+, pHW-156-/170+/181+, pHW-156+/170+/181+, qiagen plasmid is used Jing after amplification culture
Purification kit extracts high-purity positive recombinant plasmid, the transcription with other 7 genes of strain containing S/expression plasmid (pHW251-
PB2,pHW252-PB1,pHW253-PA,pHW254-HA,pHW255-NP,pHW256-NA,pHW257-M,and pHW258-
NS)(Tang,Y.,Wu,P.,Sun,Q.,Peng,D.,Zhang,W.,Li,Y.,Wang,W.,Long,J.,Zhang,P.,Liu,
X.,2008,Role of amino acid residues at positions 322 and 329 of hemagglutinin
in virulence of H5N1 avian influenza virus.Chinese journal of virology 24,
340-344.) be used to transfect together.The respective concentration of plasmid is determined, and is adjusted to 200ng/ μ L for transfection.
1.4 virus rescue
Virus rescue is carried out with reference to methods such as Hoffmann.Day before transfection, takes the 293T and mdck cell mixing of equivalent
After add 6 porocyte culture plates, transfected when cell area coverage is up to 80%.Take each 1 μ L of 8 kinds of plasmids and be added to 50 μ L nonreactives
Mix in raw element plasma-free DMEM medium and gently.Lipofectamine is gently mixed using frontTM2000 (are purchased from
Invitrogen companies), take 10 μ L and be diluted in 50 μ L antibiotic-free plasma-free DMEM mediums and gently mix.Plasmid is dilute
Release liquid and LipofectamineTM2000 (being purchased from Invitrogen companies) diluent mixing, and gently mix, make at room temperature
Use 20min.Effect is finished, and mixed liquor is added dropwise to into cell surface, and 72h collects cell conditioned medium after transfection, is inoculated with 10 ages in days
SPF Embryo Gallus domesticus, daily observation chicken embryo death situation, collecting chick embryo allantoic liquid carries out hemagglutination test, and positive chick embryo allantoic liquid is placed in -70
Save backup in DEG C refrigerator.Reverse genetic rescue recombinant viruses be respectively designated as rS-156-/170+/181+ (wild-type,
WT)、rS-156-/170-/181+、rS-156-/170+/181-、rS-156+/170+/181+、rS-156+/170-/181+、
rS-156+/170+/181-、rS-156+/170-/181-。
2. prepared by inactivation of virus and serum
Take out recombinant viruses (rS-156-/170+/181+ (wild-type, WT), rS-156-/170-/181+, rS-
156-/170+/181-、rS-156+/170+/181+、rS-156+/170-/181+、rS-156+/170+/181-、rS-156+/
170-/181-) allantoic fluid, first each viral hemoagglutination potency (HA) is determined to take supernatant after 8000rpm centrifugation 5min, then with 43:7
Ratio adds 1/50 prediluted formalin in allantoic fluid, and this process need to be added dropwise over inactivating liquid, and constantly mix anti-
Only inactivate not exclusively, virus is moved to 4 DEG C of placements by inactivation liquid after adding, and is mixed once every two hours, and at 4 DEG C total times are inactivated
More than 24h.Take out the viral allantoic fluid of inactivation, determine its hemagglutinative titer (>24Just meet and require).
By the viral allantoic fluid of inactivation and Freund's complete adjuvant 1:It is fully emulsified after 1 mixing to make vaccine, take 0.2mL vaccines
Injection 4w SPF chickens, every kind of inactivated vaccine injects 4 SPF chickens.Once, two exempt from rear 21d collections chicken to 14d booster immunizations after immunity
Blood, separates serum and determines its potency.
3. serum cross reactivity
Cross-hemagglutination inhibition test：Each viral allantoic fluid HA potency is determined, viral HA valencys are adjusted to into 22(4 units virus),
With PBS by each serum doubling dilution, the 4 units virus adjusted is added, 15min is acted under the conditions of 37 DEG C, effect is finished
1% chicken red blood cell is added, and result is observed after effect 15min under the conditions of being transferred to 37 DEG C.Cross-hemagglutination inhibition test is determined not
With H5 hypotypes AIV and the sero-fast reactivity of recombinant viruses of branch.
Cross neutralization test：Different branch Frozen tissue cell median infective dose (TCID are determined on CEF cells50), in
With test the previous day CEF cells are taped against in 96 orifice plates, treat that cell is paved with whole bottom hole and can use, using it is front by cell with nothing
Bacterium PBS cell is twice.Each mutated viruses antiserum is made by doubling dilution in 96 orifice plates with maintaining liquid, and with 100
The virus of TCID50 acts on 10min under the conditions of 37 DEG C, and effect finishes and neutralized reaction product is transferred on CEF cells, and cell continues
In 37 DEG C of 5% CO2Under the conditions of cultivate 4d, then count each serum can neutralize virus greatest dilution be neutralization titer, take
The meansigma methodss of per group of 4 parts of serum neutralization titers are end product.
According to the current bird flu popularity of China, we have chosen 4 plants of H5 subtype avian influenza virus and carry out cross reaction
Property test.Viral SY be wild skeleton virus and belong to 2.3.4 branches (Tang Y, Wu P, Peng D, Wang X, Wan H,
Zhang P,Long J,Zhang W,Li Y,Wang W,Zhang X,Liu X.Characterization of duck
H5N1 influenza viruses with differing pathogenicity in mallard(Anas
platyrhynchos)ducks.Avian Pathol.2009Dec；38(6):457-67.), DT belong to 7.2 branches (Zhang,
W.,Xue,T.,Wu,X.,Zhang,P.,Zhao,G.,Peng,D.,Hu,S.,Wang,X.,Liu,X.,Liu,W.,2011,
Increase in viral yield in eggs and MDCK cells of reassortant H5N1 vaccine
candidate viruses caused by insertion of 38 amino acids into the NA
Stalk.Vaccine 29,8032-8041.), WXD belongs to 2.3.2.1 branches, ZJC be 2.3.4.6 branches (Gu, M., Zhao,
G.,Zhao,K.,Zhong,L.,Huang,J.,Wan,H.,Wang,X.,Liu,W.,Liu,H.,Peng,D.,Liu,X.,
2013,Novel variants of clade 2.3.4 highly pathogenic avian influenza A(H5N1)
viruses,China.Emerg.Infect.Dis.19,2021-2024.).(table 2) is it will be seen that wild from result
Type virus rS-156-/170+/181+ immune serums have higher neutralization titer and blood clotting suppression potency to SY strains, to other points
The neutralization titer and blood clotting of branch virus suppresses potency relatively low.And recombinant viruses rS-156-/170+/181- immune serums are to SY strains
Neutralization titer and blood clotting suppress potency similar to SY immune serums, and suppress potency to other branch virus neutralization titers and blood clotting
It is all remarkably higher than SY immune serums.Therefore, recombinant viruses rS-156-/170+/181- is chosen as vaccine candidate strain, and with open country
Raw type virus rS-156-/170+/181+ is control, carries out immune protective test.
The Candidate Strain serum cross reactivity of table 2
aViral WXD belongs to 2.3.2.1 branches, and SY is wild skeleton virus and belongs to 2.3.4 branches, and ZJC is 2.3.4 point
Branch variant viral, DT belongs to 7.2 branches.
4. immune protective test
4 week old SPF chickens are randomly divided into 3 big groups, and per 30 chickens of group greatly, one of which is used for immune wild-type virus rS-
156-/170+/181+, another group is used for vaccine candidate vaccine strain rS-156-/170+/181-, and also one group is that PBS immunity is right
According to group.Route of inoculation is cervical region subcutaneous injection, and dosage is 0.2mL/, the 21d collections serum after immunity, and is suppressed with blood clotting
Test (HI) determines its antibody titer, while with the maternal strain SY and 7.2 branch AIV DT strain counteracting toxic substances of wild type, counteracting toxic substances dosage
For 106EID50/ chicken, Infection route is collunarium eye dripping, and sets blank control group.After counteracting toxic substances, total Test chicken Continuous Observation
14d, and record its morbidity and death condition.Respectively 1,3,5 and 7d after counteracting toxic substances gather throat swabs and cloacal swab, with chicken
Embryo titration wherein viral level, counts toxin expelling situation.There is typical bird flu after counteracting toxic substances in all counteracting toxic substances matched group SPF chickens
Symptom, and it is all dead.After SY and DT strain influenza virus counteracting toxic substances, as a result such as table 3, two immune group can have preferably protection
(100%), and for wild type rS-156-/170+/181+ immune group, rS-156-/170+/181- immune functions
Preferably suppress toxin expelling, particularly in DT strain influenza virus counteracting toxic substances groups, two immune group are after counteracting toxic substances in 7d cloacas toxin expelling rate
There is significant difference (P<0.05).
The SPF chicken immune protection tests of table 3
Note：O, throat swab；C, cloacal swab.
aSignificant difference, P<0.05.
Claims (3)
1. one plant of H5 subtype avian influenza vaccine candidate strain rS-156-/170+/181-, it is characterised in that it is with A/mallard/
Huadong/S/2005 strains are maternal skeleton, and disappearance HA protein 18s 1 are glycosylation modified.
2. the construction method of H5 subtype avian influenzas vaccine candidate strain rS-156-/170+/181- described in claim 1, its feature exists
In being with A/mallard/Huadong/S/2005 strains as maternal skeleton that disappearance HA protein 18s 1 are glycosylation modified and obtain.
3. H5 subtype avian influenzas vaccine candidate strain rS-156-/170+/181- is preparing broad spectrum activity H5 hypotypes described in claim 1
Application in AIV vaccines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410387974.XA CN104195113B (en) | 2014-08-07 | 2014-08-07 | H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410387974.XA CN104195113B (en) | 2014-08-07 | 2014-08-07 | H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104195113A CN104195113A (en) | 2014-12-10 |
| CN104195113B true CN104195113B (en) | 2017-05-03 |
Family
ID=52080483
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410387974.XA Active CN104195113B (en) | 2014-08-07 | 2014-08-07 | H5-subtype avian influenza vaccine candidate strain rS-156-/170+/181- as well as construction method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104195113B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019076218A1 (en) * | 2017-10-18 | 2019-04-25 | 厦门大学 | Mutant of h3n2 subtype influenza virus hemagglutinin protein and use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103200961A (en) * | 2009-03-27 | 2013-07-10 | 中央研究院 | Methods and compositions for immunization against virus |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2011348160A1 (en) * | 2010-12-22 | 2013-04-04 | Novavax Inc. | Modified influenza hemagglutinin proteins and uses thereof |
-
2014
- 2014-08-07 CN CN201410387974.XA patent/CN104195113B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103200961A (en) * | 2009-03-27 | 2013-07-10 | 中央研究院 | Methods and compositions for immunization against virus |
Non-Patent Citations (1)
| Title |
|---|
| "Characterization of duck H5N1 influenza viruses with differing pathogenicity in mallard (Anas platyrhynchos) ducks";Yinghua Tang 等;《Avian Pathology》;20091231;第6卷(第38期);第462页右栏最后一段-第466页左栏第一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104195113A (en) | 2014-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tian et al. | Protective efficacy in chickens, geese and ducks of an H5N1-inactivated vaccine developed by reverse genetics | |
| Park et al. | Rapid evolution of low-pathogenic H9N2 avian influenza viruses following poultry vaccination programmes | |
| Lee et al. | Isolation and genetic characterization of H5N2 influenza viruses from pigs in Korea | |
| Chen et al. | The impact of key amino acid substitutions in the hemagglutinin of influenza A (H3N2) viruses on vaccine production and antibody response | |
| Wu et al. | Novel reassortant highly pathogenic H5N6 avian influenza viruses in poultry in China | |
| Liu et al. | Emerging multiple reassortant H5N5 avian influenza viruses in ducks, China, 2008 | |
| Baz et al. | Nonreplicating influenza A virus vaccines confer broad protection against lethal challenge | |
| Zhang et al. | Hemagglutinin glycosylation modulates the pathogenicity and antigenicity of the H5N1 avian influenza virus | |
| CN104017775A (en) | Influenza virus capable of infecting canids and use thereof | |
| Watanabe et al. | Antigenic analysis of highly pathogenic avian influenza virus H5N1 sublineages co-circulating in Egypt | |
| Woodward et al. | Using epidemics to map H3 equine influenza virus determinants of antigenicity | |
| Muñoz-Medina et al. | In silico identification of highly conserved epitopes of influenza A H1N1, H2N2, H3N2, and H5N1 with diagnostic and vaccination potential | |
| Molesti et al. | Comparative serological assays for the study of H5 and H7 avian influenza viruses | |
| Cui et al. | Phylogeny, pathogenicity, and transmission of H5N1 avian influenza viruses in chickens | |
| Moon et al. | Active reassortment of H9 influenza viruses between wild birds and live-poultry markets in Korea | |
| Lee et al. | Genetic evolution of H5 highly pathogenic avian influenza virus in domestic poultry in Vietnam between 2011 and 2013 | |
| Sitaras et al. | Selection and antigenic characterization of immune-escape mutants of H7N2 low pathogenic avian influenza virus using homologous polyclonal sera | |
| Choi et al. | Development of a dual-protective live attenuated vaccine against H5N1 and H9N2 avian influenza viruses by modifying the NS1 gene | |
| Zhou et al. | High-yield production of a stable Vero cell-based vaccine candidate against the highly pathogenic avian influenza virus H5N1 | |
| Wang et al. | Enhanced cross-lineage protection induced by recombinant H9N2 avian influenza virus inactivated vaccine | |
| Lin et al. | Analysis of the phylogeny of Chinese H9N2 avian influenza viruses and their pathogenicity in mice | |
| Wu et al. | Characterization of novel reassortant influenza A (H5N2) viruses isolated from poultry in Eastern China, 2015 | |
| ŠANTAK | Old and new ways to combat human influenza virus | |
| Wu et al. | Molecular characterization of novel reassortant H6N2 subtype avian influenza viruses isolated from poultry in Eastern China, in 2014 | |
| Park et al. | Evaluation of heterosubtypic cross-protection against highly pathogenic H5N1 by active infection with human seasonal influenza A virus or trivalent inactivated vaccine immunization in ferret models |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |