EP3004389A1 - Kits and methods for detecting drug-induced deafness susceptibility - Google Patents

Kits and methods for detecting drug-induced deafness susceptibility

Info

Publication number
EP3004389A1
EP3004389A1 EP14804634.5A EP14804634A EP3004389A1 EP 3004389 A1 EP3004389 A1 EP 3004389A1 EP 14804634 A EP14804634 A EP 14804634A EP 3004389 A1 EP3004389 A1 EP 3004389A1
Authority
EP
European Patent Office
Prior art keywords
probe
seq
genetic marker
sequence
pair
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP14804634.5A
Other languages
German (de)
French (fr)
Other versions
EP3004389A4 (en
Inventor
Yanling Kong
Guangxin Xiang
Xiaogang Zhang
Shujian LIANG
Wanli Xing
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tsinghua University
CapitalBio Technology Co Ltd
Original Assignee
Tsinghua University
CapitalBio Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tsinghua University, CapitalBio Corp filed Critical Tsinghua University
Publication of EP3004389A1 publication Critical patent/EP3004389A1/en
Publication of EP3004389A4 publication Critical patent/EP3004389A4/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present disclosure generally relates to the field of genetic testing and detection.
  • the present disclosure provides primer pairs, probe pairs, compositions, kits, and methods for detecting susceptibility to a disease and/or condition, for example, due to genetic predisposition to the disease or condition.
  • the disease or condition is inherited or induced, for example, drug-induced or induced by aminoglycoside antibiotics, derivatives, or analogues thereof.
  • the primer pairs, probe pairs, compositions, kits, and methods disclosed herein can be used for diagnosis, providing guidance during treatment, and prognosis of diseases or conditions.
  • Base mutation is a very important type of mutation in the human genome. Many base mutations are closely related to disease occurrence. Therefore, detection of base mutations is important in disease diagnosis, treatment, and prognosis.
  • Aminoglycoside antibiotics including streptomycin, gentamycin, kanamycin, amikacin, tobramycin, and micronomicin etc, are particularly effective for the treatment of Gram-negative bacterial infections, in addition to having a synergistic antibacterial effect for some Gram-positive bacterial infections. Aminoglycoside antibiotics are therefore widely used.
  • mitochondrial ribosome in the cochlea is the most likely target of aminoglycoside ototoxicity
  • mtDNA mitochondrial DNA
  • bp basepairs
  • the human mitochondrial genome is shown in SEQ ID NO: 8.
  • the mtDNA encodes the large and small ribosomai RNAs and 22 transfer RNAs, which are necessary for the translation of the 13 messenger RN As encoded by the mtDNA. Replication, transcription, and translation of the mtDNA occurs within the mitochondrion.
  • the messenger RNAs are translated on mitochondrion-specific ribosomes, using a mitochondrion-specific genetic code, into 13 proteins. These proteins interact with approximately sixty nuclear encoded proteins to form the five enzyme complexes required for oxidative phosphorylation.
  • aminoglycosides appear to stabilize mismatched aminoacyl-tRNAs in the 70S ribosome, allowing misreading of the mRNA during translation (Hornig, et al.,
  • the mitochondrial r NA genes are candidates for the site of the mtDNA mutation in aminoglycosi de-induced deafness.
  • sensorineural deafness either in conjunction with neuromuscular diseases or with diabetes, has been associated with
  • Non-syndromic deafness may also be correlated with mtDNA mutations.
  • a composition comprising a primer pair for detecting at least two genetic markers, and a probe pair for detecting the at least two genetic markers.
  • the primer pair comprises a forward primer based on an upstream sequence distal to the first genetic marker, and a reverse primer based on a downstream sequence distal to the second genetic marker, wherein the first genetic marker is upstream of the second genetic marker.
  • PGR polymerase chain reaction
  • an amplicon comprising the loci of the at least two genetic markers can be produced.
  • the amplicon comprising the loci of the at least two genetic markers is specifically recognized by the first and/or the second probe.
  • the first probe is based on the first genetic marker
  • the second probe is based on the second genetic marker.
  • the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker
  • the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker.
  • a counterpart sequence is otherwise identical to the sequence comprising the first and/ or second genetic marker (e.g., in terms of length of the sequences and nucleic acid identity at each position), except that the counterpart sequence does not have the first and/or second genetic marker.
  • the genetic marker is a point mutation
  • a counterpart sequence is otherwise identical to the sequence comprising the point mutation, except that the counterpart sequence has a nucleotide different from that of the point mutation at the position corresponding to the point mutation.
  • the forward primer can be hybridizable to a sequence complementary to the upstream sequence distal to the first genetic marker.
  • the reverse primer can be hybridizable to the downstream sequence distal to the second genetic marker.
  • the forward primer can be substantially homologous to the upstream sequence distal to the first genetic marker.
  • the reverse primer can be substantially complementary to the downstream sequence distal to the second genetic marker.
  • the first and second genetic markers can be selected from the group consisting of mutations, genetic variations, single nucleotide
  • SNPs polymorphisms
  • deletions deletions
  • insertions amplifications
  • repeats allelic variations
  • point mutations epigenetic modifications
  • methyiation methyiation
  • demethylatioii and combinations thereof.
  • the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
  • the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss.
  • the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced, for example, drug-induced or aminoglycoside-induced.
  • presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker.
  • presence of the second genetic marker in a subject can be indicative of increased susceptibility to drag-induced or aminoglycoside-induced deafness compared to a subject without the second genetic marker.
  • the first and second genetic markers can be mutations in the mitochondrial 12S rRNA gene, for example, a mammalian mitochondrial 12S rRNA gene.
  • the first geneti marker can comprise a CI 494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or can be a C1494T mutation of the human mitochondrial I2S rRNA gene.
  • the second genetic marker can comprise an Al 555 mutation or an A1555G mutation of the human mitochondrial 32S rRNA gene, or can be an Al 555G mutation of the human mitochondrial 12S rRNA gene.
  • a CI 494 mutation for example, includes a C1494A mutation, C1494T mutation, C1494G mutation, or a CI 494 mutation in which the nucleotide at position 1494 is substituted with a nucleotide other than C or modified or disrupted in a way that prevents the nucleotide at position 1494 from base-pairing with a G.
  • An A1555 mutation for example, includes an A1555T mutation, Al 555C mutation, A1555G mutation, or an A1555 mutation in which the nucleotide at position i 555 is substituted with a nucleotide other than A or modified or disrupted in a way that prevents the nucleotide at position 1555 from base-pairing with a T or U.
  • the forward primer comprises the sequence set forth in SEQ ID NO: 1
  • the reverse primer comprises the sequence set forth in SEQ ID NO: 2.
  • the forward primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 1.
  • the reverse primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 2.
  • the probe pair can be a quantitative TaqMan MGB probe pair. In any of the preceding embodiments, the primer pair can be used for real-time quantitative PGR.
  • a primer pair for detecting at least two genetic markers comprising: a forward primer between about 15 and about 25 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO: 8; and a reverse primer between about 15 and about 25 base pairs in length, which is substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO: 8.
  • the at least two genetic markers comprise a C1494 and/or an A! 555 mutation of the human mitochondrial 12S rRNA gene.
  • an ampl icon comprising the loci of nucleic acid residues 1494 and 1555 of a human mitochondrial 12S rRNA gene is produced.
  • the forward primer can be hybridizable to a sequence complementary to a sequence between nucleic acid residues 1-50, 51 -100, 101 -150, 151- 200, 201-250, 251-300, 301 -350, 351-400, 401-450, 451 -500, 501 -550, 551-600, 601-650, 651 -700, 701 -750, 751 -800, 801-850, 851-900, 901 -950, 951 -1000, 1001-1050, 1051 -1 100, 1 101-1 150, 1 151-1200, 1201-1250, 1251 -1300, 1301-1350, 1351-1400, 1401 -1450, 1451-1493, 1401-1420, 1421-1440, 1441-1460, 1461-1480, or 1481-1493 of SEQ ID NO: 8.
  • the reverse primer can be hybridizable to a sequence between nucleic acid residues 1556-1580, 1581-1600, 1601-1620, 1621-1640, 1641-1660, 1661-1680, 1681-1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400, 2401-2450, 2451-2500, 2501-2600, 2601-2650, 2651-2700, 2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901 -2950, 2951-3000, 3001-3050, 3051-3100, 3101 -3150, 3151-3200, 3201-4200, 4201-5200, 5201-6200, 6201-7200, 7201-8200, 8201-9200, 9201-10200, 10201 -1 1200, 11201-12200, 12
  • the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
  • the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss, which can be inherited or induced.
  • the induced partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
  • presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker.
  • presence of the second genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the second genetic marker.
  • the first genetic marker can be a C I 494T mutation of the human mitochondrial 12S rRNA gene
  • the second genetic marker can be an A! 555G mutation of the human mitochondrial 12S rRNA gene.
  • the forward primer can comprise the sequence set forth in SEQ ID NO: 1
  • the reverse primer can comprise the sequence set forth in SEQ ID NO: 2.
  • the forward primer can consist essentially of or consist of the sequence set forth in SEQ ID NO: 1
  • the reverse primer can consist essentially of or consist of the sequence set forth in SEQ ID NO: 2.
  • the primer pair can be used with a quantitative TaqMan MGB probe in the PGR reaction, or can be primers for real-time quantitative PCR.
  • a probe pair for detecting at least two genetic markers comprises a first probe based on a first genetic marker and a second probe based on a second genetic marker, and the first genetic marker is upstream of the second genetic marker.
  • the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker.
  • the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker.
  • the first probe can specifically recognize an amplicon comprising the first genetic marker, for example, an amplicon produced in a PCR reaction.
  • the second probe can specifically recognize an amplicon comprising the second genetic marker, for example, an amplicon produced in a PCR reaction.
  • the first and second genetic markers can be selected from the group consisting of mutations, genetic variations, SNPs, deletions, insertions, amplifications, repeats, allelic variations, point mutations, epigenetic modifications, methylation, demethylation, and combinations thereof.
  • the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
  • the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss.
  • the partial or complete deafness, hearing impairment, or hearing loss can be inherited or induced (e.g., drug-induced or aminoglycoside- induced) according to some embodiments of the present disclosure.
  • presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or ammoglycoside-induced deafness compared to a subject without the first genetic marker
  • presence of the second genetic marker in a subject can be indicative of increased susceptibility to drug-induced or ammoglycoside- induced deafness compared to a subject without the second genetic marker.
  • the first and second genetic markers can be mutations in the mitochondrial 12S rRNA gene.
  • the first genetic marker can comprise a C1494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or can be a C1494T mutation of the human mitochondrial 12S rRNA gene.
  • the second genetic marker can comprise an A1555 mutation or an A1555G mutation of the human
  • mitochondrial 12S rRNA gene or can be an A1555G mutation of the human mitochondrial 12S rRNA gene.
  • the first probe can specifically recognize a sequence comprising a C1494T mutation of the human mitochondrial 12S rRNA gene but not a counterpart sequence comprising residue C at the 1494 position of the human mitochondrial 12S rRN A gene.
  • the second probe can specifically recognize a sequence comprising an A1555G mutation of the human mitochondrial 12S rRNA gene hut not a counterpart sequence comprising residue A at the 1555 position of the human mitochondrial 12S rRNA gene.
  • the first probe can comprise the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise the sequence set forth in SEQ ID NO: 4.
  • the first probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 4.
  • the probe pair can be quantitative TaqMan MGB probes, or used in real-time quantitative PGR.
  • the 5' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non-fluorescent quenching group and a minor groove binder (MGB).
  • MGB minor groove binder
  • the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB.
  • the first and second fluorescent reporter groups can be selected from the group consisting of FAM, VIC, H EX, or N ED.
  • the first or second non-fluorescent quenching group can be the same or different, including for example, FQ.
  • a probe pair for detecting at least two genetic markers comprising: a first probe between about 13 and about 30 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8 and comprises residue T at the position corresponding to the 1494 position of SEQ ID NO: 8: and a second probe between about 13 and about 30 base pairs in length, which is substantially
  • the at least two genetic markers comprise a C1494T and'or an A1555G mutation of the human mitochondrial 12S rRNA gene.
  • the first probe specifically recognizes the C3494T mutation but not C1494, and the second probe specifically recognizes the Al 555G mutation but not A 1555.
  • the first probe can specifically recognize an amplicon comprising the C1494T mutation but not an amplicon comprising CI 494 (i.e., C at a position corresponding to nucleotide position 1494 of SEQ ID NO: 8 or the human mitochondrial 12S rRNA gene).
  • the amplicons can be produced in a PGR reaction.
  • the second probe can specifically recognize an amplicon comprising the A1555G mutation but not an amplicon comprising A1555.
  • the amplicons can be produced in a PGR reaction.
  • amplicons comprising C1494T and amplicons comprising CI 494 are produced in the same PCR reaction.
  • A1555G and amplicons comprising A 1555 are produced in the same PCR reaction.
  • probes specific for C1494T bind and recognize C 1494T-containg amplicons, but not CI 494- containg amplicons.
  • probes specific for A3555G bind and recognize A.1555G- containg amplicons, but not Al 555-containg amplicons.
  • the first and second genetic markers can be associated with partial or complete deafiiess, hearing impairment, or hearing loss, either inherited or induced (e.g., drug-induced or aminoglycoside-induced).
  • presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug- induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker, and/or presence of the second genetic marker in a subject can be indicative of increased
  • the first probe can comprise the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise the sequence set forth in SEQ ID NO: 4.
  • the first probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 4.
  • the probe pair can be quantitative TaqMan MGB probes, or can be used in real-time quantitative PCR.
  • the 5' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non- fluorescent quenching group and MGB.
  • the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB.
  • the first and second fluorescent reporter groups can be different, and can be selected from the group consisting of FAM, VIC, HEX, and NED.
  • the first and/or second non-fluorescent quenching group can be NFQ.
  • kits comprising the composition according to any of the preceding embodiments.
  • a kit comprising the primer pair and/or the probe pair according to any of the preceding embodiments is also disclosed.
  • the kit can comprise a primer pair according to any of the preceding embodiments, and/or a probe pair according to any of the preceding embodiments.
  • the kit may comprise other reagents or components necessary for a PGR reaction.
  • the kit may further comprise a control primer pair and/or a control probe.
  • the control primer pair can comprise control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
  • control probe can comprise a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ) ID NO: 7.
  • 5' end of the control probe can be labeled with a fluorescent reporter group, and/or the 3' end of the control probe can be labeled with a non- fluorescent quenching group and MGB.
  • a PGR kit comprising: a first primer comprising the sequence set forth in SEQ ID NO: 1 ; a second primer comprising the sequence set forth in SEQ ID NO: 2; a first probe comprising the sequence set forth in SEQ ID NO: 3; and a second probe comprising the sequence set forth in SEQ ID NO: 4.
  • the 5' ends of the first and second probes are labeled with different fluorescent reporter groups.
  • the 3' ends of the first and second probes are labeled with a non-fluorescent quenching group and MGB.
  • the PGR kit can further comprise a third primer comprising the sequence set forth in SEQ ID NO: 5.
  • the PGR kit can further comprise a fourth primer comprising the sequence set forth in SEQ ID NO: 6.
  • the PGR kit can further comprise a third probe comprising the sequence set forth in SEQ ID NO: 7.
  • the 5' ends of the first, second, and third probes are each labeled with a different fluorescent reporter group.
  • the 3' ends of the first, second, and third probes are labeled with a non-fluorescent quenching group and MGB.
  • the method comprises admixing in a PCR reaction volume: a sample comprising a template; a primer pair comprising a forward primer based on an upstream sequence distal to a first genetic marker, and a reverse primer based on a downstream sequence distal to a second genetic marker; other reagents necessary for the PGR reaction; and optionally, a probe pair comprising a first probe based on the first genetic marker and a second probe based on the second genetic marker.
  • the method further comprises incubating the admixed PCR reaction volume under conditions suitable to produce amplico s comprising the loci of the at least two genetic markers, wherein the admixed PCR reaction volume before the incubating step comprises a probe pair comprising a first probe based on the first genetic marker and a second probe based on the second genetic marker, or wherein the probe pair is added to the admixed PCR reaction during or after the incubating step.
  • the method further comprises detecting binding of the probe pair to the amplicons produced in the incubating step.
  • the first genetic marker is upstream of the second genetic marker on the template.
  • the first probe specifically binds to a first amplicon comprising the first genetic marker
  • the second probe specifically binds to a second amplicon comprising the second genetic marker.
  • detection of specific binding of the first or second probe to the first or second amplicon, respectively indicates presence of the first or second genetic marker in the sample.
  • the presence or absence of the at least two genetic markers in the sample can be indicated simultaneously.
  • the forward primer can be between about 15 and about 25 base pairs in length and substantially homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO; 8.
  • the reverse primer can be between about 15 and about 25 base pairs in length and substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO; 8.
  • the forward primer can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 1
  • the reverse primer can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO; 2
  • the first probe can be between about 13 and about 30 base pairs in length, be substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8, and comprise residue T at the position corresponding to the 1494 position of SEQ ID NO; 8.
  • the second probe can be between about 13 and about 30 base pairs in length, be substantially complementary to a sequence between nucleic acid residues 1526-1584 of SEQ ID NO: 8, and comprise residue C at the position corresponding to the 1555 position of SEQ ID NO: 8.
  • the first probe can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 4.
  • the 5 ' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non- fluorescent quenching group and MGB.
  • the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB.
  • the 5' ends of the first and second probes are labeled with different fluorescent reporter groups.
  • the method can further comprise, in the admixing step, admixing in the PGR reaction volume a control primer pair and/or a control probe.
  • the control primer pair can comprise control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 6.
  • the control probe can comprise a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7.
  • the 5' end of the control probe can be labeled with a fluorescent reporter group, and/or the 3' end of the control probe can be labeled with a non-fluorescent quenching group and a minor groove binder.
  • the 5' ends of the first, second, and control probes can be each labeled with a different fluorescent reporter group.
  • the 3' ends of the first, second, and control probes can be labeled with a non-fluorescent quenching group and a minor groove binder.
  • the first and second genetic markers can be associated wit the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition, for example, the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss.
  • the partial or complete deafness, hearing impairment, or hearing loss can be inherited, induced, drug-induced, or aminoglycoside-induced.
  • presence of th e first genetic marker in a sample from a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject in which the first genetic marker is absent, and/or presence of the second genetic marker in a sample from a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject in which the second genetic marker is absent.
  • the at least two genetic markers indicated by the method can comprise a C1494 and/or an A1555 mutation of the human mitochondrial 12S r NA gene, for example, the first genetic marker can be a C1494T mutation and/or the second genetic marker can be an A1555G mutation of the human mitochondrial 12S rRNA gene.
  • the sample comprising the template can be a blood sample, from a patient suffering from drug-induced deafness, a patient suspected of suffering from drug-induced deafness, a normal control individual, or an individual whose susceptibility to drug- induced deafness is to be assessed before, during, or after drug treatment, including treatment with an aminoglycoside or analogue or derivative thereof.
  • the PGR reaction in the method can be a real-time quantitative PGR using an MGB probe, for example, a TaqMan® MGB probe.
  • the admixing step can comprise admixing the probe pair in the PGR reaction volume before the incubating step.
  • Figure 1 shows the sequencing results of the templates of three genotypes, according to some embodiments of the present disclosure.
  • the underlined bases within the sequences in the block diagrams are the target detection sites detectable by the sequence-specific probes.
  • Figure 2 is the PCR testing result using human genomic DNA with the mitochondrial 12S rRNA gene carrying the C1494T mutation as the template.
  • the curve labeled “a” represents mutant probe 1494 FAM fluorescent amplification curve
  • the curve labeled “b” represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled "c” represents quantity control probe NED fluorescent amplification curve.
  • Figure 3 is the PCR testing result using human genomic DNA with the mitochondrial 12S rRNA gene carrying the A1555G mutation as the template.
  • the curve labeled “a” represents mutant probe 1494 FAM fluorescent amplification curve
  • the curve labeled “b” represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled “c” represents quantity control probe NED fluorescent amplification curve.
  • Figure 4 is the PCR testing result using human genomic DNA with the wild-type mitochondrial 12S rRNA gene.
  • the wild-type mitochondrial 12S rRNA gene has a C at position 1494 and an A at position 1555.
  • the curve labeled "a” represents mutant probe 1494 FAM fluorescent amplification curve
  • the curve labeled "b” represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled "c” represents quantity control probe NED fluorescent amplification curve.
  • Figure 5 is the PCR testing result using ddH 2 0 as the template.
  • the curve labeled “a” represents mutant probe 1494 FAM fluorescent amplification curve
  • the curve labeled “b” represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled “c” represents quantity control probe NED fluorescent amplification curve.
  • an individual or a subject includes any living organism, such as humans and other mammals.
  • An individual or a subject as used herein includes an organism to which the provided compositions, methods, or kits can be administered or applied.
  • Mammals include, but are not limited to, humans, and non-human animals, including farm animals, sport animals, rodents and pets.
  • a biological sample or material can be obtained and used, and can refer to any sample or material obtained from a living or viral (or prion) source or other source of macromolecules and bioinolecules, and includes any cell type or tissue of a subject from which nucleic acid or protein or other macromolecule can be obtained.
  • the biological sample can be a sample obtained directly from a biological source or a sample that is processed.
  • isolated nucleic acids that are amplified constitute a biological sample.
  • a template for the PGR reaction disclosed herein can he comprised in and/or obtained from a biological sample, for example, a sample from a patient or a subject suspected of carrying a mutation.
  • Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples from animals and plants and processed samples derived therefrom.
  • gene refers to the unit of inheritance that occupies a specific locus on a chromosome, the existence of which can be confirmed by the occurrence of different allelic forms. Given the occurrence of split genes, gene also encompasses the set of DNA sequences (exons) that are required to produce a single polypeptide.
  • composition can be any mixture of two or more products or compounds. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.
  • a sample of the present disclosure encompasses a sample in the form of a solution, a suspension, a liquid, a powder, a paste, an aqueous sample, or a non-aqueous sample.
  • polynucleotide oligonucleotide
  • nucleic acid deoxyribonucleotides, and analogs or mixtures thereof.
  • the terms include triple-, double- and single-stranded deoxyribonucleic acid (“DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RJSJA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide examples include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D- ribose), including tRNA, rRNA, hRNA, and rnRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidme base, and other polymers containing nonnucleotidic backbones, for example, polvamide (e.g., peptide nucleic acids (“PNAs”)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, OR, as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration
  • PNAs peptide nucleic acids
  • these terras include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' to P5' phosphoramidates, 2'-0-alkyl-substituted RNA, hybrids between DNA and RNA or between PNAs and DNA or RNA, and also include known types of modifications, for ex ample, labels, alkylation, "caps," substitution of one or more of the nucleotides with an analog, inter-nucleotide modifications such as, for example, those with uncharged linkages (e.g. , methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g.
  • linkages e.g. , aminoalkylphosphoramidates, aminoalkvlphosphotriesters
  • those containing pendant moieties such as, for example, proteins (including enzymes (e.g. nucleases), toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g. , acridine, psoralen, etc.), those containing chelates (of, e.g. , metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g.
  • nucleic acid generall y will contain phosphodiester bonds, although in some cases nucleic acid analogs may be included that have alternative backbones such as phosphoramidite, phosphorodithioate, or methylphophoroamidite linkages; or peptide nucleic acid backbones and linkages.
  • Other analog nucleic acids include those with bicyciic structures including locked nucleic acids, positive backbones, non-ionic backbones and non-ribose backbones.
  • M odifications of the ribose-phosphate backbone may be done to increase the stability of the molecules; for example, PNA;DNA hybrids can exhibit higher stability in some environments.
  • the terms "polynucleotide,” “oligonucleotide,” “nucleic acid” and “nucleic acid molecule” can comprise any suitable length, such as at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1 ,000 or more nucleotides.
  • Exemplary nucleic acids that can be assayed for detection of genetic markers according to the present disclosure include genomic DNA of various conformations (e.g. , A-DNA, B-DNA, Z- DNA), mitochondria DNA (mtDNA), in RNA. tRNA, rRNA, hRNA, miRNA, and pi R N A .
  • nucleoside and nucleotide include those moieties which contain not only the known purine and pyrimidine bases, but also other heterocyclic bases which have been modified. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, or other heterocycles. Modified nucleosides or nucleotides can also include modifications on the sugar moiety, e.g. , wherein one or more of the hydroxyl groups are replaced with halogen, aliphatic groups, or are functionalized as ethers, amines, or the like.
  • the term “nucleoli die unit” is intended to encompass nucleosides and nucleotides.
  • polymers of amino acids of any length e.g., at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1 ,000 or more amino acids.
  • the polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by
  • binding refers to an attractive interaction between two molecules which results in a stable association in which the molecules are in close proximity to each other.
  • Molecular binding can be classified into the following types; non-covalent, reversible covending and irreversible covalent.
  • Molecules that can participate in molecular binding include proteins, nucleic acids, carbohydrates, lipids, and small organic molecules such as pharmaceutical compounds.
  • proteins that form stable complexes with other molecules are often referred to as receptors while their binding partners are called ligands.
  • Nucleic acids can also form stable complex with themselves or others, for example, DNA-protein complex, DNA-DNA complex, DNA-RNA complex.
  • binding refers to the specificity of a binder, e.g., an antibody, such that it preferentially binds to a target, such as a polypeptide antigen.
  • a binding partner e.g., protein, nucleic acid, antibody or other affinity capture agent, etc.
  • “specifi binding” can include a binding reaction of two or more binding partners with high affinity and/or complementarity to ensure selective hybridization under designated assay conditions.
  • binding partner binds to its particular target molecule and does not bind in a significant amount to other molecules present in the sample.
  • Recognition by a binder of a particular target in the presence of other potential interfering substances is one characteristic of such binding.
  • binders that are specific for or bind specifically to a target bind to the target with higher affinity than binding to other non-target substances.
  • binders that are specific for or bind specifically to a target avoid binding to a significant percentage of non-target substances, e.g., non-target substances present in a testing sample.
  • binders of the present disclosure avoid binding greater than about 90% of non-target substances, although higher percentages are clearly contemplated and preferred.
  • binders of the present disclosure a void binding about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, and about 99% or more of non-target substances.
  • binders of the present disclosure avoid binding greater than about 10%, 20%, 30%, 40%, 50%, 60%, or 70%, or greater than about 75%, or greater than about 80%, or greater than about 85% of non-target substances.
  • a sequence-specific probe disclosed herein is a specific binder to a target sequence, for example, a target sequence comprising one or more genetic markers.
  • nucleotides or nucleic acids for instance, between the two strands of a double-stranded DNA molecule or between an
  • oligonucleotide primer and a primer binding site on a single-stranded nucleic acid are, generally, A and T (or A and U), or C and G.
  • Two single-stranded RNA or DNA molecules are said to be substantial! ⁇ ' complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the other strand, usually at least about 90% to about 95%, and even about 98% to about 100%.
  • two complementary sequences of nucleotides are capable of hybridizing, preferably with less than 25%, more preferably with less than 15%, even more preferably with less than 5%, most preferably with no mismatches between opposed nucleotides.
  • the two molecules will hybridize under conditions of high stringency.
  • Hybridization as used herein may refer to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide.
  • the resulting double-stranded polynucleotide can be a "hybrid” or “duplex.”
  • “Hybridization conditions” typically include salt concentrations of approximately less than 1 M, often less than about 500 mM and may be less than about 200 niM.
  • a “hybridization buffer” includes a buffered salt solution such as 5% SSPE, or other such buffers known in the art.
  • Hybridization temperatures can be as low r as 5°C, but are typically greater than 22°C, and more typically greater than about 30°C, and typically in excess of 37°C.
  • Hybridizations are often performed under stringent conditions, i.e., conditions under which a sequence will hybridize to its target sequence but will not hybridize to other, non-complementary sequences.
  • Stringent conditions are sequence-dependent and are different in different circumstances. For example, longer fragments may require higher hybridization temperatures for specific hybridization than short fragments.
  • the combination of parameters is more important than the absolute measure of any one parameter alone.
  • stringent conditions are selected to be about 5°C lower than the T, rinse for the specific sequence at a defined ionic strength and pH.
  • the melting temperature T m can be the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • T m the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • the stability of a hybrid is a function of the ion concentration and temperature.
  • a hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency.
  • Exemplary stringent conditions include a salt concentration of at least 0,01 M to no more than 1 M sodium ion concentration (or other salt) at a pH of about 7.0 to about 8.3 and a temperature of at least 25°C.
  • stringency of hybridization in determining percentage mismatch can be as follows; 1) high stringency: 0.1 ⁇
  • moderately stringent hybridization can refer to conditions that permit a nucleic acid molecule such as a probe to bind a complementary nucleic acid molecule.
  • the hybridized nucleic acid molecules generally have at least 60% identity, including for example at least any of 70%, 75%, 80%, 85%, 90%), or 95% identity.
  • Moderately stringent conditions can be conditions equivalent to hybridization in 50% formamide, 5 x Denhardt's solution, 5x SSPE, 0.2%) SDS at 42°C, followed by washing in 0.2 x SSPE, 0.2% SDS, at 42°C.
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5 x Denhardt's solution, 5 x SSPE, 0.2% SDS at 42°C, followed by washing in 0.1 x SSPE, and 0.1% SDS at 65°C.
  • Low stringency hybridization can refer to conditions equivalent to hybridization in 10% formamide, 5 x Denhardt's solution, 6 ⁇ SSPE, 0.2% SDS at 22°C, followed by washing in Ix SSPE, 0.2% SDS, at 37°C.
  • Denhardt's solution contains 1% Ficoli, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al , Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Piainview, N.Y. ( 1989); and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons (1999).
  • RNA or DNA strand will hybridize under selective hybridization conditions to its complement.
  • selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90%
  • identity is well known to skilled artisans (Carrillo, H. & Lipman, D., SIAMJ Applied Math 48: 1013 (1988)). Sequence identity or complementarity compared along the full length of two polynucleotides refers to the percentage of identical or complementary nucleotide residues along the full-length of the molecule.
  • polynucleotide A has 100 nucleotide and polynucleotide B has 95 nucleotides, which are identical to nucleotides 1-95 of polynucleotide A, then polynucleotide B has 95% identity when sequence identity is compared along the full length of a polynucleotide A compared to full length of polynucleotide B.
  • sequence identity between polynucleotide A and polynucleotide B can be compared along a region, such as a 20 nucleotide analogous region, of each nucleotide. In this case, if polynucleotide A and B have 20 identical nucleotides along that region, the sequence identity for the regions would be 100 %.
  • sequence identity can be compared along the length of a molecule, compared to a region of another molecule. As discussed below, and known to those of skill in the art, various programs and methods for assessing identity are known to those of skill in the art. High levels of identity, such as 90% or 95% identity, readily can be determined without software.
  • nucleic acid molecules Whether any two nucleic acid molecules have sequences that contain, or contain at least, a certain percent (e.g. 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%) sequence identity or complementarity can be determined using known computer algorithms such as the "FASTA" program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci.
  • DNAStar “MegAlign” program (Madison, WI) and the University of Wisconsin Genetics Computer Group (UWG) "Gap” program (Madison WI)).
  • UWG University of Wisconsin Genetics Computer Group
  • Gap Garnier-Gap program
  • sequence identity identity and complementarity may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2. or FASTA version 3.0t78, with the default parameters. It is understood that for the purposes of determining sequence identity among DNA and RNA sequences thymidine nucleotide is equivalent to (represents identity with) a uracil nucleotide.
  • Percent identity' further can be determined, for example, by comparing sequence information using a GAP computer program (e.g., Needleman et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2:482). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids), which are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Niicl. Acids Res.
  • a GAP computer program e.g., Needleman et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2:482).
  • a "primer” used herein can be an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed.
  • the sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide.
  • Primers usually are extended by a polymerase, for example, a DNA polymerase.
  • a template or template polynucleotide refers to a polynucleotide that contains a nucleic acid sequence that can bind to a corresponding primer, such as the target polynucleotide, and serve as a template for extension of the primer by a polymerase.
  • the polynucleotide region of a template polynucleotide may be composed of DNA , RNA, and/or synthetic nucleotide analogs.
  • Sequence determination and the like include determination of information relating to the nucleotide base sequence of a nucleic acid. Such information may include the identification or determination of partial as well as full sequence information of the nucleic acid.
  • Sequence information may be determined with varying degrees of statistical reliability or confidence.
  • the term includes the determination of the identity and ordering of a plurality of contiguous nucleotides in a nucleic acid.
  • "High throughput sequencing” or “next generation sequencing” includes sequence determination using methods that determine many (typically thousands to billions) of nucleic acid sequences in an intrinsically parallel manner, i.e. where DNA templates are prepared for sequencing not one at a time, but in a bulk process, and where many sequences are read out preferably in parallel , or alternatively using an ultra-high throughput serial process that itself may be parallelized.
  • Such methods include but are not limited to pyrosequencing (for example, as commercialized by 454 Life Sciences, Inc., Branford, CT); sequencing by ligation (for example, as commercialized in the SOLIDTM technology, Life Technologies, Inc., Carlsbad, CA); sequencing by synthesis using modified nucleotides (such as commercialized in TruSeqTM and HiSeqTM
  • SNP single nucleotide polymorphism
  • SNPs single nucleotide polymorphism
  • SNPs for use in the present disclosure and their respective alleles may be derived from any number of sources, such as public databases (LLC. Santa Cruz Human Genome Browser Gateway
  • a bialielic genetic variation is one that has two polymorphic forms, or alleles.
  • bialielic polymorphism that is associated with a trait
  • the associated allele the allele that is more abundant in the genetic composition of a case group as compared to a control group
  • the other allele can be referred to as the "unassociated allele.”
  • bialielic polymorphism that is associated with a given trait (e.g. , a disease or drug response)
  • bialielic polymorphisms that may be used or detected by the methods presented herein include, but are not limited to, multinucleotide changes, insertions, deletions, repeats, translocations, and epigenetic changes such as gene hypermethylation.
  • the polymorphi loci that are screened in an association study may be in a diploid or a haploid state and, ideally, would be from sites across the genome.
  • genetic or genomic variations include those in genomic DNA, mitochondrial DNA, episoraal DNA, and/or derivatives of DNA such as amplicons, RNA transcripts, cDNA, DNA analogs, etc.
  • Genetic or genomic changes that can be detected by a method of the present disclosure can be any types of DNA alterations including base change, deletion, duplication, amplification, polymorphism, microsatellite instability, loss of heterozygosity (LOH), epigenetic modification, and any combination thereof.
  • a genetic marker of the present disclosure encompasses any of the genetic or genomic variations described above and combinations thereof.
  • genetic markers includes genetic and epigenetic markers, including, but not limited to mutations, SNPs, insertions, allelic differences, alleles, including mutant and wild- type alleles, genes or portions thereof, deletions, methylation, and demethylation.
  • the genetic marker is a wild-type allele, sequence, or residue.
  • Real-time PGR is often used in detecting A1555G and/or C1494T. According to the principle of quantitative fluorescence, real-time PGR can be divided into two categories listed below.
  • Fluorescent dye based method The principle of this type of method is the use of specific PGR primers, with different binding abilities to wild-type and mutant templates. The different primer specificities will result in different PGR amplification efficiencies, thereby distinguishing the genotypes of the templates at the detection sites. Due to the relatively low specificity of the primers and the DNA binding fluorescent dye, this method is prone to form nonspecific melting peak, which will affect the interpretation of the results. Fluorescent dye method requires a secondary analysis to the melting curve after PGR amplification, so it takes a long time. Typically, the whole process takes about 2.5 hours.
  • the present disclosure aims to address the problems of current methods.
  • current methods based on TaqMan fluorescent probes often have problems such as high cost, complicated operation, and low detection efficiency.
  • the present disclosure in one aspect, provides a simple and efficient method that can detect two mutation sites simultaneously, for example, two mutation sites related to drug-induced hearing loss.
  • the present disclosure provides two pairs of primers which can detect at least two mutations simultaneously, including primer F (forward primer or upstream primer) and primer R (reverse primer or downstream primer).
  • primer F is designed based on the upstream sequence that is closest to mutation site
  • primer R is designed based on the downstream sequence that is closest to mutation site.
  • primer F and primer R can be designed to flank the at least two genetic markers, e.g., primer F based on the upstream sequence distal to the most upstream genetic marker of the at least two genetic markers, and primer R based on the downstream sequence distal to the most downstream genetic marker of the at least two genetic markers.
  • the genetic marker (e.g., a mutation or mutations) to be detected by a method of the present disclosure is a deafness associated genetic marker, for example, a genetic marker associated with drug-induced deafness.
  • the genetic marker is a human or mammalian genetic marker. Mammals include, but are not limited to, humans, and non-human animals, including farm animals, sport animals, rodents and pets.
  • a human genetic marker such as a point mutation may have one or more corresponding genetic markers in a non-human species.
  • the genetic markers (e.g., mutations) to be detected comprise 1) C1494T in a mitochondrial I 2S rRNA gene; and/or 2) AI555G in a mitochondrial I2S rRNA gene.
  • primer F comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 1.
  • primer R comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.
  • kits for detection of one or more genetic markers can include a primer pair according to any one of the embodiments disclosed herein.
  • the kit can include probes, for example, probes designed according to the mutant nucleotide sequence.
  • the number of probes is the same as the number of mutation sites. For example, if there are two mutation sites to be detected simultaneously and/or in one reaction, two probes (e.g. TaqMan® MGB probes) each specific for one of the mutation sites can be designed and used. In another example, if there are four mutation sites to be detected simultaneously and/or in one reaction, four probes (e.g. TaqMan® MGB probes) each specific for one of the four mutation sites can be designed and used. In another aspect, the sequence of each probe exactly matches the
  • a probe pair can comprise the probes shown in (1 ) and (2): (1) nucleotide sequence shown in SEQ ID NO: 3, and (2) nucleotide sequence shown in SEQ ID NO: 4.
  • a probe of the probe pair comprises, consists essentially of, or consists of the sequence set forth in SEQ ) ID NO: 3.
  • a probe of the probe pair comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 4.
  • the 5 ' end of the probe is labeled with a fluorescent reporter group.
  • the 3 ' end of the probe is labeled with a non-fluorescent quencher and minor groove binder (MGB ).
  • the 5 'ends of the probes are labeled with different fluorescent reporter groups, for example, the fluorescent reporter group can be selected from FAM, VIC, and NED.
  • the non-fluorescent quencher comprises NFQ.
  • the kit further comprises one or more quality conixol primer pairs and/or one or more quality control probes.
  • the quality control primers have the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the quality conixol probe has the sequence shown in SEQ ID NO: 7.
  • a quality control primer of the quality control primer pairs comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 5.
  • a quality control primer of the quality control primer pairs comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 6.
  • a quality control probe comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 7.
  • the 5' end of the quality control probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a non- fluorescent quencher and MGB.
  • the genetic marker to be detected e.g., mutation or mutations
  • a kit of the present disclosure is associated with deafness or hearing loss, for example, drug-induced deafness.
  • the mutations comprise 1) and/or 2): I) C1494T in a mitochondrial 12S rRNA gene; and 2) A1555G in a mitochondrial 12S rRNA gene.
  • composition for PCR for detecting genetic markers such as mutations.
  • the composition for PCR comprises a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 1 , a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 2, a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 5, a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 6, a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 3, a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 4, and/or a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7.
  • the 5' ends of the probes comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 7 are labeled with different fluorescent reporter groups.
  • the 3' ends of the probes are each labeled with the same or different non-fluorescent quencher, and MGB.
  • the composition for PCR disclosed herein further comprises a PCR buffer and/or a polymerase, for example, a DNA polymerase.
  • the genetic marker to be detected (e.g., mutation or mutations) by a composition for PCR of the present disclosure is associated with deafness or hearing loss, for example, drug-induced deafness.
  • the mutations comprise 1 ) and/or 2): 1) C1494T in a mitochondrial 12S rRNA gene; and 2) A1555G in a mitochondrial 12S rRNA gene.
  • the primer pair, probe pair, composition for PGR, or kit is used in detecting one or more genetic markers, including detecting at least two genetic markers at the same time and/or in the same reaction run and/or in the same reaction volume.
  • the at least two genetic markers to be detected at the same time are associated with deafness or hearing loss, for example, drug-induced deafness.
  • the genetic markers comprise the C1494T mutation in a mitochondrial 12S rRNA gene, and/or the A1555G mutation in a
  • the present disclosure provides a sequence specific TaqMan MGB probe. Compared to other detection methods that depend on the use of sequence-specific primers for the genetic markers, the present disclosure provides a method with higher detection specificity.
  • the procedure to detect a genetic marker can be completed in about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours.
  • the detection and interpretation process can be completed in about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours.
  • at least two mutant probes are hydrolyzed in one PGR reaction system, so it can be used to detect at least two mutation sites in one reaction system and condition.
  • the detection process disclosed herein is simple, highly efficient and inexpensive.
  • the primer pair, probe pair, composition for PGR, kit, or method disclosed herein has the following advantages: [00112] (1 )
  • the present disclosure uses a method based on a sequence specific probe to detect two deafness-related mutation sites.
  • the mutant probe matches with the mutant template but not the wild-type template.
  • the mutant probe can be 100% complementary to the mutant template but not to the wild-type template.
  • the probes are hydrolyzed to release the corresponding fluorophore, thus the mutant and wild-type templates can be distinguished. Since the sequence-specific probes used in this method can bind to the template only when they are complementary to the template, the detection method has a high specificity and is not prone to non-specific amplification.
  • a PGR reaction based on sequence-specific probes disclosed herein takes about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours.
  • a PCR reaction disclosed herein saves about 1 hour when compared to a dye-based method.
  • a method disclosed herein takes a shorter time, and the detection is convenient.
  • At least two drug-induced deafness related mutation sites can be detected in one tube simultaneously, according to the present disclosure.
  • only mutant probes are necessary to differentiate the C3494T and A3555G mutations, without the need to design and synthesize wild-type probes. The present method therefore costs less and achieves a higher detection efficiency.
  • the present disclosure utilizes the TaqMan® MGB probe technology to detect two mutation sites through the detection of signal types specific for each of the mutations (e.g. FAM for the C1494T mutation, versus VIC for the A1555G mutation) during the PCR amplification process. The corresponding Ct values are then analyzed.
  • the present method therefore has a low requirement for instruments, short reaction time, and simple operation, without restriction enzyme digestion, electrophoresis, or sequencing.
  • there is no need to open the lid except for adding a template This could effectively prevent contamination, and achieve the detection of at least two mutation sites simultaneously in a simple and fast process with accurate assay readout.
  • the genetic markers can include an epigenetic or genetic marker, such as a sequence including one or more genetic variations and/or genetic/epigenetic changes in genomic DNA, mtDNA, episomal DNA, RNA transcripts, tRNA, ncRNA, rRNA, hRNA, and/or derivatives of DNA such as ampiicons, cDNA, DNA analogs, etc.
  • an epigenetic or genetic marker such as a sequence including one or more genetic variations and/or genetic/epigenetic changes in genomic DNA, mtDNA, episomal DNA, RNA transcripts, tRNA, ncRNA, rRNA, hRNA, and/or derivatives of DNA such as ampiicons, cDNA, DNA analogs, etc.
  • the genetic marker is or includes ail or part of a genetic locus having one or more genetic variations between individuals, e.g., one or more SNPs, where the presence of one or more such genetic variations is or are the genetic markers.
  • the genetic marker can include one or more biallelic or multi-ailelic genetic varia tions.
  • the genetic marker can rela te to the associated allele or the unassociated allele.
  • the associated allele of a biallelic genetic variation is more abundant in the geneti composition of a case group as compared to a control group, therefore detection of the associated allele ⁇ e.g., with no or less unassociated allele detected) in a sample firom a subject can be indicative of the associated trait in the subject.
  • the genetic marker includes one or more biallelic polymorphisms or genetic/epigenetic changes, including single or multi -nucleotide changes, based modifications, translocations, insertions, deletions, duplication, amplification, repeats, microsatellite instability, loss of heterozygosity, epigenetic raodification, and any combinations thereof.
  • Exemplar ⁇ ' base modifications include, but are not limited to methylation, uracil substitution, antibody conjugation, substitution with synthetic base, or substitution with synthetic sugar.
  • the genetic, markers are or include cancer-associated mutations of oncogenes or tumor suppressor genes, including point mutation, insertions, deletions, and translocations, such as those contained in broken pieces of polynucleotides (e.g., DNA or RNA), for example, as shed from disintegrated cells, e.g., abnormal cells including cancer cells, such as those shed into the bloodstream.
  • Exemplary cancer genetic markers include all or part of the BRAF gene and/or BAFF mutations or all eles, for exampl e, for analysis in the blood. Detection of the BRAF mutations, such as the BRAF point mutations, in the extracellular BRAF fragments or tumor cell genomic DNA can be used as an indicator of human cancer.
  • the point mutation can be the V600E or V600D mutations of human BRAF. Similar to the mitochondrial 32S rRNA mutations described above, these BRAF mutations can be detected at the same time in the same reaction system, using a PCR kit comprising: 1) a primer pair flanking the V600 site of BRAF, and capable of generating an ampiicon comprising position 600 of BRAF when used together in a PCR reaction; and 2) a sequence-specific MGB probe pair, the probes capable of specific binding to the V 600E mutant sequence and the V600D mutant sequence, respective! ⁇ '.
  • the V60GE-specific probe can be labeled with FAM, for example, and the V600D-specific probe can be labeled with a different fluorescent group such as VIC or NED.
  • the kit can further comprise a control primer pair and/or a control probe.
  • other cancer genetic markers such as those associated with tumor suppressor genes (e.g. p53, BRCA1 , BRCA2, APC, and RBI etc.) or oncogenes (Ras, MEN2, RET, KIT, and MET etc.), can be easily adopted for detection by a method of the present disclosure.
  • the genetic markers to be detected according to the present disclosure can be associated with a disease or condition or stage or state thereof, including but not limited to malignancies, infections, autoimmune and inflammatory diseases and conditions, and pregnancy, such as fetal DNA or RNA in maternal blood, which may be used to determine gender identity, detect genetic predisposition to diseases or conditions, assess chromosomal abnormalities, and monitor pregnancy-associated complications.
  • the genetic markers can comprise pathogen nucleic acids such as viral or bacterial nucleic acids. Such pathogenic nucleic acid may or may not be integrated into the genome of a cell of the subject from which the test sample is obtained.
  • Embodiment I A primer pair which can detect more than two mutation sites
  • primer F is designed based on the upstream DNA sequence that is closest to mutation site
  • primer R is designed based on the downstream DNA sequence that is closest to mutation site
  • the mutations mentioned are deafness associated mutations, mutations associated with drug-induced deafness, a C1494T mutation in mitochondrial I2S rRNA gene, and/or a Al 555G mutation in mitochondrial 12S rRNA gene.
  • Embodiment 2 The primer pair of Embodiment 1 , wherein the primer pair is characterized in that: the primer F sequence is shown in SEQ ID NO: 1 , and the primer R is shown in SEO ID NO: 2.
  • Embodiment 3 A gene mutation detect kit, characterized in that: the kit comprises the primer pair of Embodiment 1 and/or Embodiment 2.
  • Embodiment 4 The kit according to Embodiment 3, characterized in that: the kit includes probes designed according to the mutant nucleotide sequence, wherein the number of probes is the same with the number of mutation sites, and the sequence of each probe exactly matches the corresponding mutant nucleotide sequence.
  • Embodiment 5 The kit according to Embodiment 4, characterized in that: the probes include the probes shown in (1 ) and/or (2):
  • Embodiment 6 The kit according to any one of Embodiments 3-5, characterized in that: the 5' end of the probe is labeled with a fluorescent reporter group, the 3 ' end is labeled non- fluorescent quencher and minor groove binder (MGB), wherein optionally, the 5 'ends of different probes are labeled different fluorescent reporter groups, and wherein optionally, the fluorescent reporter groups are selected from the group consisting of FAM, VIC, and NED, and wherein optionally, the non-fluorescent quencher is NFQ.
  • MGB minor groove binder
  • Embodiment 7 The kit according to any one of Embodiments 3-6, further comprising quality control primer pairs and/or a quality control probe, wherein optionally, the quality control primers have the sequence shown in SEQ ID NO: 5 and SEQ ID NO: 6, and wherein optionally the quality control probe has the sequence shown in SEQ ID NO: 7, and wherein optionally the 5 'end of the probe is labeled with a fluorescent reporter group, and wherein optionall y the 3' end is labeled with a non-fluorescent quencher and MGB.
  • Embodiment 8 According to claim 3-7, wherein the kit, characterized in that; the mutations mentioned is deafness associated mutations; Specifically drug-induced deafness. More specifically, the mutations mentioned are as follows 1) and/or 2): 1) C1494T in mitochondrial 12S rRNA gene; 2) A1555G in mitochondrial 12S rRNA gene.
  • Embodiment 9 PCR reagents for detecting gene mutations, comprising a primer shown in SEQ ID NO: 1, a primer shown in SEQ ID NO: 2, a primer shown in SEQ ID NO: 5, a primer shown in SEQ ID NO: 6, a probe shown in SEQ ID NO: 3, a probe shown in SEQ ID NO: 4, and/or a probe shown in SEQ ID NO: 7, wherein optionally, the 5' ends of probes shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 7 are labeled with different fluorescent reporter groups, and wherein optionally the 3' end is labeled with a non-fluorescent quencher and MGB,
  • Embodiment 10 A primer pair according to Embodiment 1 or 2, a kit according to any one of Embodiments 3-8, or PCR reagents according to Embodiment 9 for use in developing a detection kit, vvherein the detection kit is optionally used for detecting a gene mutation.
  • Example 1 Screening the C1494T and A1555G Mutations of the Human Mitochondrial 12S rRNA
  • C1494T mutant probe 5' CCGTCACTCTCCTCA A 3' (SEQ ID NO: 3). The 5' end of the probe is labeled with FAM fluorescent reporter group and the 3' end is labeled with a non-fluorescent quenching group NFQ and MGB. This probe is to detect whether the C base at position 1494 is substituted with T; and
  • A1555G mutation probe 5 ' ACGACTTGCCTCCT 3' (SEQ ID NO: 4). The 5' end of probe is labeled with VIC fluorescent reporter group and the 3' end is labeled with a non-fluorescent quenching group NFQ and MGB. This probe is to detect whether the A base at position 1555 is substituted w r ith G.
  • the quality-control (QC) primers and probe are designed according to a conservative region of the mitochondrial genome DNA. Their sequences are as follows:
  • QC primer F 5' AGCCATTTACCGTACATAGCACATT 3' (SEQ ID NO: 5);
  • QC primer R 5' GGGATATTGATTTCACGGAGGAT 3' (SEQ ID NO: 6);
  • QC probe 5 ' CCATGGATGACCC 3 ' (SEQ ID JYe: 7). The 5' end is labeled with NED fluorescent reporter group and the 3' end is labeled with non-fluorescent quenching group NFQ and MGB.
  • the templates of the PGR are the human genomic DNA with or without the 1494 C ⁇ T or 3555 A-*G mutations of the mitochondrial 12S rRNA gene.
  • the genome DNA samples bearing the 1494 C ⁇ *T or 1555 A-*T mutations of the mitochondrial 12S rRNA gene were extracted from the blood samples or blood spots provided by cooperating hospitals. All the sample donors have provided informed consent.
  • the genomic DNAs were extracted using conventional nucleic acid extraction kits, and the sequences of the regions including the nucleotide 1494 and 1555 were determined by DNA sequencing.
  • Figure 1 is the sequencing results of the templates.
  • the sequences with the underl ined bases in the block d iagram are the target sequences and sites.
  • Figure 1 demonstrated that, in the wild-type genomic DNAs, the 1494th and 1555th nucleotides of the mitochondrial 12S rRNA gene are C and A, respectively.
  • the sequences of the above regions remain identical to the wild-type genomic DNAs except for the correspondi g nucleotide substitution at position 1494 and 1555.
  • PGR buffer 4.64 ⁇ 1, ROX (50 x) 0.5 ⁇ 1, Taq DNA polymerase 0.4 ⁇ 1, uracil-N-glycosylase (UNG) 0.03 ⁇ 1, forward primer upstream of the 1494th nucleotide ( ⁇ /L) ⁇ , reserve primer downstream of the 1555th nucleotide ( ⁇ /L) 1.75 ⁇ 1, QC primer F ( ⁇ /L) 2.5 ⁇ 1, QC primer R ( ⁇ /L) 2.5 ⁇ 1, C1494T mutant probe ( ⁇ /L) 0.75 ⁇ , A1555G mutation probe ( ⁇ /L) 0.75 ⁇ 1, QC probe ( ⁇ /L) 2.5 ⁇ 1, genomic DNA (as templates) 5 ⁇ 1, and ddH?0 2.68 ⁇ 1.
  • Reaction tube 3 2ng ⁇ ul wild-type genomic DNA.
  • Reaction tube 4 equal volume of ddH 2 0.
  • a FAM amplification curve with Ct less than 40 indicates the genomic DNA sample bear the 1494 C— ->T mutation of the mitochondrial 12S rRNA gene, and A VIC amplification curve with Ct less than 40 indicates the existence of the 1555 A ⁇ G mutation.
  • Figures 2-5 show the results of the above 4 reaction tubes.
  • Figure 2 is the PGR testing result in which the mitochondrial 12S rRNA gene carried C1494T mutation in the human genomic DNA template.
  • Figure 3 is the PGR testing result in which the mitochondrial 12S rRNA gene carried A1555G mutation in the human genomic DNA template.
  • Figure 4 is the PGR testing result in which the wild-type mitochondrial 12S rRNA gene in human genomic DNA was used as the template.
  • the curve labeled a represents mutant probe 1494 F AM fluorescent amplification curve
  • the curve labeled b represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled c represents quantity control probe NED fluorescent amplification curve.
  • Figure 5 is the PGR testing result in which ddH 2 0 was used as the template.
  • the curve labeled “a” represents mutant probe 1494 FAM fluorescent amplification curve
  • the curve labeled “b” represents mutant probe 1555 VIC fluorescent amplification curve
  • the curve labeled “c” represents quantity control probe NED fluorescent amplification curve.
  • Tube 1 used the C1494T mutant genomic DNA as the template, and the FAM and NED signals were detected ( Figure 2).
  • Tube 2 used the A1555G mutant genomic DNA as the template, and the VIC and NED signals were detected ( Figure 3).
  • Tube 3 used wild-type genomic DNA as the template, and only the NED signals were obtained ( Figure 4).
  • Tube 4 used ddH 2 0 as the template, and no fluorescent signal was detected ( Figure 5).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a detection kit for detecting the mitochondrial gene C1494T and A1555G mutations associated with maternally inherited aminoglycoside-induced deafness. The kit comprises 2 pairs of primers with the nucleotide sequences set forth in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:5, and SEQ ID NO:6, and 3 TaqMan-MGB probes with the nucleotide sequences set forth in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:7.

Description

KITS AND METHODS FOR DETECTING DRUG-INDUCED DEAFNESS
SUSCEPTIBILITY
Cross-reference to Related Applications
[0001] This application claims priority from Chinese Patent Application No. CN
201310208559.9, filed May 30, 2013, published as CN103276082 A on September 4, 2013, the disclosure of which is incorporated herein by reference in its entirety for all purposes.
Technical Field
[0002] The present disclosure generally relates to the field of genetic testing and detection. In particular embodiments, the present disclosure provides primer pairs, probe pairs, compositions, kits, and methods for detecting susceptibility to a disease and/or condition, for example, due to genetic predisposition to the disease or condition. In certain aspects, the disease or condition is inherited or induced, for example, drug-induced or induced by aminoglycoside antibiotics, derivatives, or analogues thereof. The primer pairs, probe pairs, compositions, kits, and methods disclosed herein can be used for diagnosis, providing guidance during treatment, and prognosis of diseases or conditions.
Background
[0003] In the following discussion, certain articles and methods are described for background and introductory purposes. Nothing contained herein is to be construed as an "admission" of prior art. Applicant expressly reserves the right to demonstrate, where appropriate, that the articles and methods referenced herein do not constitute prior art under the applicable statutory provisions.
[0004] Base mutation is a very important type of mutation in the human genome. Many base mutations are closely related to disease occurrence. Therefore, detection of base mutations is important in disease diagnosis, treatment, and prognosis. [0005] Aminoglycoside antibiotics, including streptomycin, gentamycin, kanamycin, amikacin, tobramycin, and micronomicin etc, are particularly effective for the treatment of Gram-negative bacterial infections, in addition to having a synergistic antibacterial effect for some Gram-positive bacterial infections. Aminoglycoside antibiotics are therefore widely used. However, these drugs often have serious side effects of ototoxicity which may cause irreversible hearing damage or deafness (Sande, et ai., Antimicrobial agents, in: Goodman and Oilman's The Pharmacological Basis of Therapeutics, 8th edition, eds, Oilman, et al., Pergamon Press, Inc., Elmsford, N.Y., ρρ 1098-11 16, 1990).
[0006] Since aminoglycosides target bacterial ribosomes, the evolutionarily-related
mitochondrial ribosome in the cochlea is the most likely target of aminoglycoside ototoxicity
(Sande, et al., supra). There are hundreds of mitochondria in each cell and they serve a variety of metabolic functions, the most important being the synthesis of ATP by oxidative phosphorylation. Each mitochondrion contains several mitochondrial DNA (mtDNA) chromosomes, which in humans are -16,568 basepairs (bp) double-stranded circles. The human mitochondrial genome is shown in SEQ ID NO: 8. The mtDNA encodes the large and small ribosomai RNAs and 22 transfer RNAs, which are necessary for the translation of the 13 messenger RN As encoded by the mtDNA. Replication, transcription, and translation of the mtDNA occurs within the mitochondrion. The messenger RNAs are translated on mitochondrion-specific ribosomes, using a mitochondrion- specific genetic code, into 13 proteins. These proteins interact with approximately sixty nuclear encoded proteins to form the five enzyme complexes required for oxidative phosphorylation.
[0007] In bacterial studies, aminoglycosides appear to stabilize mismatched aminoacyl-tRNAs in the 70S ribosome, allowing misreading of the mRNA during translation (Hornig, et al.,
Bioehimie, 69:803-813, 1987). In addition to their interactions with ribosomai proteins, aminoglycosides bind to the E. coli 16S rRNA (Moazed, et al., Nature, 327:389-394, 1987; Gravel, et al, Biochemistry, 26:6227-6232, 1987). These physical experiments predict regions of the small rRNA which are important in translationai fidelity. Aminoglycoside-resistance mutations in bacteria, yeast mitochondria, Tetrahymena, and chloroplasts map to the predicted regions of the evolutionarily conserved small rRNA (Tzagaloff, et al., J. Biol. Chem., 257:5921-5928, 1982; Spangler, et al., J, Biol. Chera., 260: 6334-6340, 1985; Gauthier, et al., Mol. Gen. Genet., 214: 192- 197, 1988; Melancon, et al, Nucl. Acids Res., 16:9631 -9639, 1988). Thus, the mitochondrial r NA genes, and especially the corresponding 12S rRNA gene, are candidates for the site of the mtDNA mutation in aminoglycosi de-induced deafness. In addition, sensorineural deafness, either in conjunction with neuromuscular diseases or with diabetes, has been associated with
heteroplasmic mtDNA mutations (Shoffher, et al., Adv. Human Genet., 19:267-330, 1990;
Baliinger, et al., Nature Genet., 1 : 1 1- 15, 1992; van den Ouweland, et al., Nature Genet, 1 :368-371 , 1992; Reardon, et al., Lancet, 34: 1376- 1379, 1992). Non-syndromic deafness may also be correlated with mtDNA mutations.
[0008] Physicians ha ve been faced with the d ilemma of choosing between the use of the antibiotic and the potential irreversible loss of hearing which might occur in the patient. In one aspect, the present disclosure addresses this problem by providing compositions and methods which can be used to identify individuals at risk for ototoxic deafness.
Summary [0009] The summary is not intended to be used to limit the scope of the claimed subject matter. Other features, details, utilities, and advantages of the claimed subject matter will be apparent from the detailed description including those aspects disclosed in the accompanying drawings and in the appended claims.
[0010] In one aspect, disclosed herein is a composition comprising a primer pair for detecting at least two genetic markers, and a probe pair for detecting the at least two genetic markers. In one embodiment, the primer pair comprises a forward primer based on an upstream sequence distal to the first genetic marker, and a reverse primer based on a downstream sequence distal to the second genetic marker, wherein the first genetic marker is upstream of the second genetic marker. In certain aspects, when the forward primer and reverse primer are used together in a polymerase chain reaction (PGR), an amplicon comprising the loci of the at least two genetic markers can be produced. In one aspect, the amplicon comprising the loci of the at least two genetic markers is specifically recognized by the first and/or the second probe. In one embodiment, the first probe is based on the first genetic marker, and the second probe is based on the second genetic marker. For example, the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker, and the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker. In certain aspects, a counterpart sequence is otherwise identical to the sequence comprising the first and/ or second genetic marker (e.g., in terms of length of the sequences and nucleic acid identity at each position), except that the counterpart sequence does not have the first and/or second genetic marker. In cases where the genetic marker is a point mutation, for example, a counterpart sequence is otherwise identical to the sequence comprising the point mutation, except that the counterpart sequence has a nucleotide different from that of the point mutation at the position corresponding to the point mutation.
[0011] In any of the preceding embodiments, the forward primer can be hybridizable to a sequence complementary to the upstream sequence distal to the first genetic marker. In any of the preceding embodiments, the reverse primer can be hybridizable to the downstream sequence distal to the second genetic marker.
[0012] In any of the preceding embodiments, the forward primer can be substantially homologous to the upstream sequence distal to the first genetic marker. In any of the preceding embodiments, the reverse primer can be substantially complementary to the downstream sequence distal to the second genetic marker.
[0013] In any of the preceding embodiments, the first and second genetic markers can be selected from the group consisting of mutations, genetic variations, single nucleotide
polymorphisms (SNPs), deletions, insertions, amplifications, repeats, allelic variations, point mutations, epigenetic modifications, methyiation, demethylatioii, and combinations thereof.
[0014] In any of the preceding embodiments, the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
[0015] In any of the preceding embodiments, the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss. In one aspect, the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced, for example, drug-induced or aminoglycoside-induced.
[0016] In any of the preceding embodiments, presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker. In any of the preceding embodiments, presence of the second genetic marker in a subject can be indicative of increased susceptibility to drag-induced or aminoglycoside-induced deafness compared to a subject without the second genetic marker.
[0017] In any of the preceding embodiments, the first and second genetic markers can be mutations in the mitochondrial 12S rRNA gene, for example, a mammalian mitochondrial 12S rRNA gene. In any of the preceding embodiments, the first geneti marker can comprise a CI 494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or can be a C1494T mutation of the human mitochondrial I2S rRNA gene. In any of the preceding embodiments, the second genetic marker can comprise an Al 555 mutation or an A1555G mutation of the human mitochondrial 32S rRNA gene, or can be an Al 555G mutation of the human mitochondrial 12S rRNA gene. A CI 494 mutation, for example, includes a C1494A mutation, C1494T mutation, C1494G mutation, or a CI 494 mutation in which the nucleotide at position 1494 is substituted with a nucleotide other than C or modified or disrupted in a way that prevents the nucleotide at position 1494 from base-pairing with a G. An A1555 mutation, for example, includes an A1555T mutation, Al 555C mutation, A1555G mutation, or an A1555 mutation in which the nucleotide at position i 555 is substituted with a nucleotide other than A or modified or disrupted in a way that prevents the nucleotide at position 1555 from base-pairing with a T or U.
[0018] In certain aspects, the forward primer comprises the sequence set forth in SEQ ID NO: 1, and/or the reverse primer comprises the sequence set forth in SEQ ID NO: 2. In other embodiments, the forward primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 1. In yet other embodiments, the reverse primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 2. [0019] In any of the preceding embodiments, the probe pair can be a quantitative TaqMan MGB probe pair. In any of the preceding embodiments, the primer pair can be used for real-time quantitative PGR.
[0020] In one embodiment, disclosed herein is a primer pair for detecting at least two genetic markers, comprising: a forward primer between about 15 and about 25 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO: 8; and a reverse primer between about 15 and about 25 base pairs in length, which is substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO: 8. In one aspect, the at least two genetic markers comprise a C1494 and/or an A! 555 mutation of the human mitochondrial 12S rRNA gene. In other aspects, when the forward primer and reverse primer are used together in a PGR reaction, an ampl icon comprising the loci of nucleic acid residues 1494 and 1555 of a human mitochondrial 12S rRNA gene is produced.
[0021 ] In any of the preceding embodiments, the forward primer can be hybridizable to a sequence complementary to a sequence between nucleic acid residues 1-50, 51 -100, 101 -150, 151- 200, 201-250, 251-300, 301 -350, 351-400, 401-450, 451 -500, 501 -550, 551-600, 601-650, 651 -700, 701 -750, 751 -800, 801-850, 851-900, 901 -950, 951 -1000, 1001-1050, 1051 -1 100, 1 101-1 150, 1 151-1200, 1201-1250, 1251 -1300, 1301-1350, 1351-1400, 1401 -1450, 1451-1493, 1401-1420, 1421-1440, 1441-1460, 1461-1480, or 1481-1493 of SEQ ID NO: 8. In any of the preceding embodiments, the reverse primer can be hybridizable to a sequence between nucleic acid residues 1556-1580, 1581-1600, 1601-1620, 1621-1640, 1641-1660, 1661-1680, 1681-1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101-2150, 2151-2200, 2201-2250, 2251-2300, 2301-2350, 2351-2400, 2401-2450, 2451-2500, 2501-2600, 2601-2650, 2651-2700, 2701-2750, 2751-2800, 2801-2850, 2851-2900, 2901 -2950, 2951-3000, 3001-3050, 3051-3100, 3101 -3150, 3151-3200, 3201-4200, 4201-5200, 5201-6200, 6201-7200, 7201-8200, 8201-9200, 9201-10200, 10201 -1 1200, 11201-12200, 12201-13200, 13201-14200, 14201-15200, or 15201-16568 of SEQ ID NO: 8.
[0022] In any of the preceding embodiments, the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition. In some aspects, the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss, which can be inherited or induced. In other aspects, the induced partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced. In any of the preceding embodiments, presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker. In any of the preceding embodiments, presence of the second genetic marker in a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the second genetic marker.
[0023] In any of the preceding embodiments, the first genetic marker can be a C I 494T mutation of the human mitochondrial 12S rRNA gene, and/or the second genetic marker can be an A! 555G mutation of the human mitochondrial 12S rRNA gene.
[0024] In any of the preceding embodiments, the forward primer can comprise the sequence set forth in SEQ ID NO: 1 , and/or the reverse primer can comprise the sequence set forth in SEQ ID NO: 2. In any of the preceding embodiments, the forward primer can consist essentially of or consist of the sequence set forth in SEQ ID NO: 1 , and/or the reverse primer can consist essentially of or consist of the sequence set forth in SEQ ID NO: 2.
[0025] In any of the preceding embodiments, the primer pair can be used with a quantitative TaqMan MGB probe in the PGR reaction, or can be primers for real-time quantitative PCR.
[0026] In another aspect, a probe pair for detecting at least two genetic markers is disclosed. In one embodiment, the probe pair comprises a first probe based on a first genetic marker and a second probe based on a second genetic marker, and the first genetic marker is upstream of the second genetic marker. In one aspect, the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker. In other aspect, the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker.
[0027] In any of the preceding embodiments, the first probe can specifically recognize an amplicon comprising the first genetic marker, for example, an amplicon produced in a PCR reaction. in any of the preceding embodiments, the second probe can specifically recognize an amplicon comprising the second genetic marker, for example, an amplicon produced in a PCR reaction.
[0028] In any of the preceding embodiments, the first and second genetic markers can be selected from the group consisting of mutations, genetic variations, SNPs, deletions, insertions, amplifications, repeats, allelic variations, point mutations, epigenetic modifications, methylation, demethylation, and combinations thereof. In any of the preceding embodiments, the first and second genetic markers can be associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition. For example, the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss. The partial or complete deafness, hearing impairment, or hearing loss can be inherited or induced (e.g., drug-induced or aminoglycoside- induced) according to some embodiments of the present disclosure.
[0029] In any of the preceding embodiments, presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug-induced or ammoglycoside-induced deafness compared to a subject without the first genetic marker, and/or presence of the second genetic marker in a subject can be indicative of increased susceptibility to drug-induced or ammoglycoside- induced deafness compared to a subject without the second genetic marker.
[0030] In any of the preceding embodiments, the first and second genetic markers can be mutations in the mitochondrial 12S rRNA gene. For example, the first genetic marker can comprise a C1494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or can be a C1494T mutation of the human mitochondrial 12S rRNA gene. In other examples, the second genetic marker can comprise an A1555 mutation or an A1555G mutation of the human
mitochondrial 12S rRNA gene, or can be an A1555G mutation of the human mitochondrial 12S rRNA gene.
[0031] In any of the preceding embodiments, the first probe can specifically recognize a sequence comprising a C1494T mutation of the human mitochondrial 12S rRNA gene but not a counterpart sequence comprising residue C at the 1494 position of the human mitochondrial 12S rRN A gene. In any of the preceding embodiments, the second probe can specifically recognize a sequence comprising an A1555G mutation of the human mitochondrial 12S rRNA gene hut not a counterpart sequence comprising residue A at the 1555 position of the human mitochondrial 12S rRNA gene.
[0032] in any of the preceding embodiments, the first probe can comprise the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise the sequence set forth in SEQ ID NO: 4. In any of the preceding embodiments, the first probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 4.
[0033] In any of the preceding embodiments, the probe pair can be quantitative TaqMan MGB probes, or used in real-time quantitative PGR. In any of the preceding embodiments, the 5' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non-fluorescent quenching group and a minor groove binder (MGB). in any of the preceding embodiments, the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB. In any of the preceding embodiments, the first and second fluorescent reporter groups can be selected from the group consisting of FAM, VIC, H EX, or N ED. In any of the preceding embodiments, the first or second non-fluorescent quenching group can be the same or different, including for example, FQ.
[0034] In one embodiment, disclosed herein is a probe pair for detecting at least two genetic markers, comprising: a first probe between about 13 and about 30 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8 and comprises residue T at the position corresponding to the 1494 position of SEQ ID NO: 8: and a second probe between about 13 and about 30 base pairs in length, which is substantially
complementary to a sequence between nucleic acid residues 1526-1584 of SEQ ID NO: 8 and comprises residue C at the position corresponding to the 1555 position of SEQ ID NO: 8. In one aspect, the at least two genetic markers comprise a C1494T and'or an A1555G mutation of the human mitochondrial 12S rRNA gene. In another aspect, the first probe specifically recognizes the C3494T mutation but not C1494, and the second probe specifically recognizes the Al 555G mutation but not A 1555.
[0035] In any of the preceding embodiments, the first probe can specifically recognize an amplicon comprising the C1494T mutation but not an amplicon comprising CI 494 (i.e., C at a position corresponding to nucleotide position 1494 of SEQ ID NO: 8 or the human mitochondrial 12S rRNA gene). For example, the amplicons can be produced in a PGR reaction. In any of the preceding embodiments, the second probe can specifically recognize an amplicon comprising the A1555G mutation but not an amplicon comprising A1555. For instance, the amplicons can be produced in a PGR reaction. In one aspect, amplicons comprising C1494T and amplicons comprising CI 494 are produced in the same PCR reaction. Similarly, amplicons comprising
A1555G and amplicons comprising A 1555 are produced in the same PCR reaction. In one aspect, probes specific for C1494T bind and recognize C 1494T-containg amplicons, but not CI 494- containg amplicons. In another aspect, probes specific for A3555G bind and recognize A.1555G- containg amplicons, but not Al 555-containg amplicons.
|0036f In anY of the preceding embodiments, the first and second genetic markers can be associated with partial or complete deafiiess, hearing impairment, or hearing loss, either inherited or induced (e.g., drug-induced or aminoglycoside-induced). In any of the preceding embodiments, presence of the first genetic marker in a subject can be indicative of increased susceptibility to drug- induced or aminoglycoside-induced deafness compared to a subject without the first genetic marker, and/or presence of the second genetic marker in a subject can be indicative of increased
susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject without the second genetic marker.
[0037] In any of the preceding embodiments, the first probe can comprise the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise the sequence set forth in SEQ ID NO: 4. In any of the preceding embodiments, the first probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can consist essentially of or consist of the sequence set forth in SEQ ID NO: 4. In any of the preceding embodiments, the probe pair can be quantitative TaqMan MGB probes, or can be used in real-time quantitative PCR. [0038] In any of the preceding embodiments, the 5' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non- fluorescent quenching group and MGB. In any of the preceding embodiments, the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB. In any of the preceding embodiments, the first and second fluorescent reporter groups can be different, and can be selected from the group consisting of FAM, VIC, HEX, and NED. In any of the preceding embodiments, the first and/or second non-fluorescent quenching group can be NFQ.
[0039] Al so disclosed herein is a kit comprising the composition according to any of the preceding embodiments. A kit comprising the primer pair and/or the probe pair according to any of the preceding embodiments is also disclosed. For example, the kit can comprise a primer pair according to any of the preceding embodiments, and/or a probe pair according to any of the preceding embodiments. The kit may comprise other reagents or components necessary for a PGR reaction. In any of the preceding embodiments, the kit may further comprise a control primer pair and/or a control probe. For instance, the control primer pair can comprise control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 6, respectively. In any of the preceding embodiments, the control probe can comprise a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ) ID NO: 7. In any of the preceding embodiments, the 5' end of the control probe can be labeled with a fluorescent reporter group, and/or the 3' end of the control probe can be labeled with a non- fluorescent quenching group and MGB.
[0040] In yet another aspect, disclosed herein is a PGR kit comprising: a first primer comprising the sequence set forth in SEQ ID NO: 1 ; a second primer comprising the sequence set forth in SEQ ID NO: 2; a first probe comprising the sequence set forth in SEQ ID NO: 3; and a second probe comprising the sequence set forth in SEQ ID NO: 4. In one aspect, the 5' ends of the first and second probes are labeled with different fluorescent reporter groups. In another aspect, the 3' ends of the first and second probes are labeled with a non-fluorescent quenching group and MGB. In any of the preceding embodiments, the PGR kit can further comprise a third primer comprising the sequence set forth in SEQ ID NO: 5. In any of the preceding embodiments, the PGR kit can further comprise a fourth primer comprising the sequence set forth in SEQ ID NO: 6. In any of the preceding embodiments, the PGR kit can further comprise a third probe comprising the sequence set forth in SEQ ID NO: 7. In one aspect, the 5' ends of the first, second, and third probes are each labeled with a different fluorescent reporter group. In another aspect, the 3' ends of the first, second, and third probes are labeled with a non-fluorescent quenching group and MGB.
[0041] In still another aspect, disclosed herein is a method of indicating the presence or absence of at least two genetic markers in a sample. In one embodiment, the method comprises admixing in a PCR reaction volume: a sample comprising a template; a primer pair comprising a forward primer based on an upstream sequence distal to a first genetic marker, and a reverse primer based on a downstream sequence distal to a second genetic marker; other reagents necessary for the PGR reaction; and optionally, a probe pair comprising a first probe based on the first genetic marker and a second probe based on the second genetic marker. In one embodiment, the method further comprises incubating the admixed PCR reaction volume under conditions suitable to produce amplico s comprising the loci of the at least two genetic markers, wherein the admixed PCR reaction volume before the incubating step comprises a probe pair comprising a first probe based on the first genetic marker and a second probe based on the second genetic marker, or wherein the probe pair is added to the admixed PCR reaction during or after the incubating step. In another embodiment, the method further comprises detecting binding of the probe pair to the amplicons produced in the incubating step. In one aspect, the first genetic marker is upstream of the second genetic marker on the template. In another aspect, the first probe specifically binds to a first amplicon comprising the first genetic marker, and the second probe specifically binds to a second amplicon comprising the second genetic marker. In yet another aspect, detection of specific binding of the first or second probe to the first or second amplicon, respectively, indicates presence of the first or second genetic marker in the sample.
[0042] In any of the preceding embodiments, the presence or absence of the at least two genetic markers in the sample can be indicated simultaneously. In any of the preceding embodiments, the forward primer can be between about 15 and about 25 base pairs in length and substantially homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO; 8. In any of the preceding embodiments, the reverse primer can be between about 15 and about 25 base pairs in length and substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO; 8.
[0043] In any of the preceding embodiments, the forward primer can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 1 , and/or the reverse primer can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO; 2,
[0044] In any of the preceding embodiments, the first probe can be between about 13 and about 30 base pairs in length, be substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8, and comprise residue T at the position corresponding to the 1494 position of SEQ ID NO; 8. In any of the preceding embodiments, the second probe can be between about 13 and about 30 base pairs in length, be substantially complementary to a sequence between nucleic acid residues 1526-1584 of SEQ ID NO: 8, and comprise residue C at the position corresponding to the 1555 position of SEQ ID NO: 8.
[0045] In any of the preceding embodiments, the first probe can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 3, and/or the second probe can comprise or consist essentially of or consist of the sequence set forth in SEQ ID NO: 4. In any of the preceding embodiments, the 5 ' end of the first probe can be labeled with a first fluorescent reporter group, and/or the 3' end of the first probe can be labeled with a first non- fluorescent quenching group and MGB. In any of the preceding embodiments, the 5' end of the second probe can be labeled with a second fluorescent reporter group, and/or the 3' end of the second probe can be labeled with a second non-fluorescent quenching group and MGB. In one aspect, the 5' ends of the first and second probes are labeled with different fluorescent reporter groups.
[0046] In any of the preceding embodiments, the method can further comprise, in the admixing step, admixing in the PGR reaction volume a control primer pair and/or a control probe. In one aspect, the control primer pair can comprise control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 6. In one aspect, the control probe can comprise a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7. In any of the preceding embodiments, the 5' end of the control probe can be labeled with a fluorescent reporter group, and/or the 3' end of the control probe can be labeled with a non-fluorescent quenching group and a minor groove binder. In any of the preceding embodiments, the 5' ends of the first, second, and control probes can be each labeled with a different fluorescent reporter group. In any of the preceding embodiments, the 3' ends of the first, second, and control probes can be labeled with a non-fluorescent quenching group and a minor groove binder.
|O047f In any of the preceding embodiments, the first and second genetic markers can be associated wit the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition, for example, the first and second genetic markers can be associated with partial or complete deafness, hearing impairment, or hearing loss. The partial or complete deafness, hearing impairment, or hearing loss can be inherited, induced, drug-induced, or aminoglycoside-induced.
[0048] In any of the preceding embodiments, presence of th e first genetic marker in a sample from a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject in which the first genetic marker is absent, and/or presence of the second genetic marker in a sample from a subject can be indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject in which the second genetic marker is absent.
[0049] In any of the preceding embodiments, the at least two genetic markers indicated by the method can comprise a C1494 and/or an A1555 mutation of the human mitochondrial 12S r NA gene, for example, the first genetic marker can be a C1494T mutation and/or the second genetic marker can be an A1555G mutation of the human mitochondrial 12S rRNA gene.
[0050] In any of the preceding embodiments, the sample comprising the template can be a blood sample, from a patient suffering from drug-induced deafness, a patient suspected of suffering from drug-induced deafness, a normal control individual, or an individual whose susceptibility to drug- induced deafness is to be assessed before, during, or after drug treatment, including treatment with an aminoglycoside or analogue or derivative thereof. [0051] In any of the preceding embodiments, the PGR reaction in the method can be a real-time quantitative PGR using an MGB probe, for example, a TaqMan® MGB probe. In any of the preceding embodiments of the method, the admixing step can comprise admixing the probe pair in the PGR reaction volume before the incubating step. Brief Description of the Drawings
[0052] Figure 1 shows the sequencing results of the templates of three genotypes, according to some embodiments of the present disclosure. The underlined bases within the sequences in the block diagrams are the target detection sites detectable by the sequence-specific probes.
[0053] Figure 2 is the PCR testing result using human genomic DNA with the mitochondrial 12S rRNA gene carrying the C1494T mutation as the template. The curve labeled "a" represents mutant probe 1494 FAM fluorescent amplification curve, the curve labeled "b" represents mutant probe 1555 VIC fluorescent amplification curve, and the curve labeled "c" represents quantity control probe NED fluorescent amplification curve.
[0054] Figure 3 is the PCR testing result using human genomic DNA with the mitochondrial 12S rRNA gene carrying the A1555G mutation as the template. The curve labeled "a" represents mutant probe 1494 FAM fluorescent amplification curve, the curve labeled "b" represents mutant probe 1555 VIC fluorescent amplification curve, and the curve labeled "c" represents quantity control probe NED fluorescent amplification curve.
[0055] Figure 4 is the PCR testing result using human genomic DNA with the wild-type mitochondrial 12S rRNA gene. The wild-type mitochondrial 12S rRNA gene has a C at position 1494 and an A at position 1555. The curve labeled "a" represents mutant probe 1494 FAM fluorescent amplification curve, the curve labeled "b" represents mutant probe 1555 VIC fluorescent amplification curve, and the curve labeled "c" represents quantity control probe NED fluorescent amplification curve.
[0056] Figure 5 is the PCR testing result using ddH20 as the template. The curve labeled "a" represents mutant probe 1494 FAM fluorescent amplification curve, the curve labeled "b" represents mutant probe 1555 VIC fluorescent amplification curve, and the curve labeled "c" represents quantity control probe NED fluorescent amplification curve. Detailed Description
|0057f A detailed description of one or more embodiments of the claimed subject matter is provided along with accompanying figures that illustrate certain principles of the claimed subject matter. The claimed subject matter is described in connection with such embodiments, but is not limited to any embodiment. It is to be understood that the claimed subject matter may be embodied in various forms, and encompasses numerous alternatives, modifications and equivalents.
Therefore, specific details disclosed herein are not to be interpreted as limiting. The claimed subject matter may be practiced according to the claims without some or ail of these specific details. It is to be understood that other embodiments can be used and structural changes can be made without departing from the scope of the claimed subject matter. For the purpose of clarity, technical material that is known in the technical fields related to the claimed subject matter has not been described in detail so that the claimed subject matter is not unnecessarily obscured.
[00581 Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terras with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art.
[0059j All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for ail purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.
[0060] All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
[0061] The practice of the provided embodiments will employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and sequencing technology, which are within the skill of those who practice in the art. Specific illustrations of suitable techniques can be had by reference to the examples herein. Such conventional techniques include polynucleotide sequencing, hybridization and ligation of polynucleotides, and detection of hybridization. However, other equivalent techniques and procedures can also be used, including those found in standard laboratory manuals such as Green, et al. , Eds., Genome Analysis; A
Laboratory Manual Series (Vols. I-IV) (1999); Weiner, Gabriel, Stephens, Eds., Genetic Variation; A Laboratory Manual (2007); Dieffenbach, Dveksler, Eds., PGR Primer: A Laboratory Manual (2003); Bowtell and Sambrook, DNA Microarrays: A Molecular Cloning Manual (2003); Mount, Bioinformatics: Sequence and Genome Anazvsis (2004); Sambrook and Russell, Condensed
Protocols from Molecular Cloning: A Laboratory Manual (2006); and Sambrook and Russell, Molecular Cloning: A Laboratory Manual (2002) (all from Cold Spring Harbor Laboratory Press); Ausubel et al. eds., Current Protocols in Molecular Biology (1987); T. Brown ed., Essential Molecular Biology (1991 ), IRL Press; Goeddel ed., Gene Expression Technology ( 1991), Academic Press; A. Bothwell et al. eds., Methods for Cloning and Analysis of Eukaryotic Genes (1990),
Bartlett Publ.; M. riegler, Gene Transfer and Expression (1990), Stockton Press; R. Wu et al. eds., Recombinant DNA Methodology (1989), Academic Press; M. McPherson et al., PCR: A Practical Approach (1991), IRL Press at Oxford University Press; Stryer, Biochemistry (4th Ed.) (1995), W.
H. Freeman, New York N.Y.; Gait, Oligonucleotide Synthesis: A Practical Approach (2002), IRL Press, London; Nelson and Cox, Lehninger, Principles of Biochemistry (2000) 3rd Ed., W. H.
Freeman Pub., New York, N.Y.; and Berg, et al,, Biochemistry (2002) 5th Ed., W. H. Freeman Pub., New York, N.Y., all of which are herein incorporated in their entirety by reference for all purposes.
I. Definitions
[0062] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, "a" or "an" means "at least one" or "one or more." Thus, reference to "a genetic marker" refers to one or more genetic markers, and reference to "the method" includes reference to equi valent steps and methods disclosed herein and/or known to those skilled in the art, and so forth. [0063] Throughout this disclosure, various aspects of the claimed subject matter are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the claimed subject matter. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, where a range of values is provided, it is understood that each intervening value, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the claimed subject matter. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also
encompassed within the claimed subject matter, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the claimed subject matter. This applies regardless of the breadth of the range.
[0064] The term "about" as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to "about" a value or parameter herein includes (arid describes) embodiments that are directed to that value or parameter per se,
[0065] As used herein, an individual or a subject includes any living organism, such as humans and other mammals. An individual or a subject as used herein includes an organism to which the provided compositions, methods, or kits can be administered or applied. Mammals include, but are not limited to, humans, and non-human animals, including farm animals, sport animals, rodents and pets.
[0066] In certain aspects of the present disclosure, a biological sample or material can be obtained and used, and can refer to any sample or material obtained from a living or viral (or prion) source or other source of macromolecules and bioinolecules, and includes any cell type or tissue of a subject from which nucleic acid or protein or other macromolecule can be obtained. The biological sample can be a sample obtained directly from a biological source or a sample that is processed. For example, isolated nucleic acids that are amplified constitute a biological sample. A template for the PGR reaction disclosed herein can he comprised in and/or obtained from a biological sample, for example, a sample from a patient or a subject suspected of carrying a mutation. Biological samples include, but are not limited to, body fluids, such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine and sweat, tissue and organ samples from animals and plants and processed samples derived therefrom.
|O067f As used herein, "gene" refers to the unit of inheritance that occupies a specific locus on a chromosome, the existence of which can be confirmed by the occurrence of different allelic forms. Given the occurrence of split genes, gene also encompasses the set of DNA sequences (exons) that are required to produce a single polypeptide.
[0068] As used herein, a "composition" can be any mixture of two or more products or compounds. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof. A sample of the present disclosure encompasses a sample in the form of a solution, a suspension, a liquid, a powder, a paste, an aqueous sample, or a non-aqueous sample.
[0069] The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" are used interchangeably herein to refer to a polymeric form of nucleotides of any length, and comprise ribonucleotides, deoxyribonucleotides, and analogs or mixtures thereof. The terms include triple-, double- and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RJSJA"). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms "polynucleotide," "oligonucleotide," "nucleic acid," and "nucleic acid molecule" include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D- ribose), including tRNA, rRNA, hRNA, and rnRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidme base, and other polymers containing nonnucleotidic backbones, for example, polvamide (e.g., peptide nucleic acids ("PNAs")) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, OR, as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. Thus, these terras include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' to P5' phosphoramidates, 2'-0-alkyl-substituted RNA, hybrids between DNA and RNA or between PNAs and DNA or RNA, and also include known types of modifications, for ex ample, labels, alkylation, "caps," substitution of one or more of the nucleotides with an analog, inter-nucleotide modifications such as, for example, those with uncharged linkages (e.g. , methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g. , phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g. , aminoalkylphosphoramidates, aminoalkvlphosphotriesters), those containing pendant moieties, such as, for example, proteins (including enzymes (e.g. nucleases), toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g. , acridine, psoralen, etc.), those containing chelates (of, e.g. , metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g. , alpha anomeric nucleic acids, etc.), as well as unmodifi ed forms of the polynucleotide or oligonucleotide. A nucleic acid generall y will contain phosphodiester bonds, although in some cases nucleic acid analogs may be included that have alternative backbones such as phosphoramidite, phosphorodithioate, or methylphophoroamidite linkages; or peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with bicyciic structures including locked nucleic acids, positive backbones, non-ionic backbones and non-ribose backbones. M odifications of the ribose-phosphate backbone may be done to increase the stability of the molecules; for example, PNA;DNA hybrids can exhibit higher stability in some environments. The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" can comprise any suitable length, such as at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1 ,000 or more nucleotides.
[0070] Exemplary nucleic acids that can be assayed for detection of genetic markers according to the present disclosure include genomic DNA of various conformations (e.g. , A-DNA, B-DNA, Z- DNA), mitochondria DNA (mtDNA), in RNA. tRNA, rRNA, hRNA, miRNA, and pi R N A .
[0071] It will be appreciated that, as used herein, the terms "nucleoside" and "nucleotide" include those moieties which contain not only the known purine and pyrimidine bases, but also other heterocyclic bases which have been modified. Such modifications include methylated purines or pyrimidines, acylated purines or pyrimidines, or other heterocycles. Modified nucleosides or nucleotides can also include modifications on the sugar moiety, e.g. , wherein one or more of the hydroxyl groups are replaced with halogen, aliphatic groups, or are functionalized as ethers, amines, or the like. The term "nucleoli die unit" is intended to encompass nucleosides and nucleotides.
[0072] The terms "polypeptide," "oligopeptide," "peptide," and "protein" are used
interchangeably herein to refer to polymers of amino acids of any length, e.g., at least 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 1 ,000 or more amino acids. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by
intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.
[0073] As used herein, the term "binding" refers to an attractive interaction between two molecules which results in a stable association in which the molecules are in close proximity to each other. Molecular binding can be classified into the following types; non-covalent, reversible covaient and irreversible covalent. Molecules that can participate in molecular binding include proteins, nucleic acids, carbohydrates, lipids, and small organic molecules such as pharmaceutical compounds. For example, proteins that form stable complexes with other molecules are often referred to as receptors while their binding partners are called ligands. Nucleic acids can also form stable complex with themselves or others, for example, DNA-protein complex, DNA-DNA complex, DNA-RNA complex.
[0074] As used herein, the term "specific binding" refers to the specificity of a binder, e.g., an antibody, such that it preferentially binds to a target, such as a polypeptide antigen. When referring to a binding partner, e.g., protein, nucleic acid, antibody or other affinity capture agent, etc., "specifi binding" can include a binding reaction of two or more binding partners with high affinity and/or complementarity to ensure selective hybridization under designated assay conditions.
Typically, specific binding will be at least three times the standard deviation of the background signal. Thus, under designated conditions the binding partner binds to its particular target molecule and does not bind in a significant amount to other molecules present in the sample. Recognition by a binder of a particular target in the presence of other potential interfering substances is one characteristic of such binding. Preferably, binders that are specific for or bind specifically to a target bind to the target with higher affinity than binding to other non-target substances. Also preferably, binders that are specific for or bind specifically to a target avoid binding to a significant percentage of non-target substances, e.g., non-target substances present in a testing sample. In some embodiments, binders of the present disclosure avoid binding greater than about 90% of non-target substances, although higher percentages are clearly contemplated and preferred. For example, binders of the present disclosure a void binding about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, and about 99% or more of non-target substances. In other embodiments, binders of the present disclosure avoid binding greater than about 10%, 20%, 30%, 40%, 50%, 60%, or 70%, or greater than about 75%, or greater than about 80%, or greater than about 85% of non-target substances.
|0075f In some aspects, a sequence-specific probe disclosed herein is a specific binder to a target sequence, for example, a target sequence comprising one or more genetic markers.
[00761 The terms "complementary" and "substantially complementary" include the
hybridization or base pairing or the formation of a duplex between nucleotides or nucleic acids, for instance, between the two strands of a double-stranded DNA molecule or between an
oligonucleotide primer and a primer binding site on a single-stranded nucleic acid. Complementary nucleotides are, generally, A and T (or A and U), or C and G. Two single-stranded RNA or DNA molecules are said to be substantial!}' complementary when the nucleotides of one strand, optimally aligned and compared and with appropriate nucleotide insertions or deletions, pair with at least about 80% of the other strand, usually at least about 90% to about 95%, and even about 98% to about 100%. In one aspect, two complementary sequences of nucleotides are capable of hybridizing, preferably with less than 25%, more preferably with less than 15%, even more preferably with less than 5%, most preferably with no mismatches between opposed nucleotides. Preferably the two molecules will hybridize under conditions of high stringency. [0077] "Hybridization" as used herein may refer to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide. In one aspect, the resulting double-stranded polynucleotide can be a "hybrid" or "duplex." "Hybridization conditions" typically include salt concentrations of approximately less than 1 M, often less than about 500 mM and may be less than about 200 niM. A "hybridization buffer" includes a buffered salt solution such as 5% SSPE, or other such buffers known in the art. Hybridization temperatures can be as lowr as 5°C, but are typically greater than 22°C, and more typically greater than about 30°C, and typically in excess of 37°C. Hybridizations are often performed under stringent conditions, i.e., conditions under which a sequence will hybridize to its target sequence but will not hybridize to other, non-complementary sequences. Stringent conditions are sequence-dependent and are different in different circumstances. For example, longer fragments may require higher hybridization temperatures for specific hybridization than short fragments. As other factors ma - affect the stringency of hybridization, including base composition and length of the complementary strands, presence of organic solvents, and the extent of base mismatching, the combination of parameters is more important than the absolute measure of any one parameter alone. Generally stringent conditions are selected to be about 5°C lower than the T,„ for the specific sequence at a defined ionic strength and pH. The melting temperature Tm can be the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are wrell known in the art. As indicated by standard references, a simple estimate of the T,„ value may be calculated by the equation, Tm =81.5 + 0.41 (% G + C), when a nucleic acid is in aqueous solution at 1 M NaCl {see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985 )). Other references {e.g., Allawi and SantaLucia, Jr., Biochemistry, 36: 10581-94 (1997)) include alternative methods of computation which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.
[0078] In general, the stability of a hybrid is a function of the ion concentration and temperature. Typically, a hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Exemplary stringent conditions include a salt concentration of at least 0,01 M to no more than 1 M sodium ion concentration (or other salt) at a pH of about 7.0 to about 8.3 and a temperature of at least 25°C. For example, conditions of 5 x SSPE (750 mM NaCl, 50 mM sodium phosphate, 5 mM EDTA at pH 7.4) and a temperature of approximately 30°C are suitable for allele-specific hybridizations, though a suitable temperature depends on the length and/or GC content of the region hybridized. In one aspect, "stringency of hybridization" in determining percentage mismatch can be as follows; 1) high stringency: 0.1 χ
SSPE, 0.1% SDS, 65°C: 2) medium stringency: 0.2 χ SSPE, 0.1%, SDS, 50°C (also referred to as moderate stringency); and 3) low stringency: 1.0 x SSPE, 0.1% SDS, 50°C. It is understood that equivalent stringencies may be achieved using alternative buffers, salts and temperatures. For example, moderately stringent hybridization can refer to conditions that permit a nucleic acid molecule such as a probe to bind a complementary nucleic acid molecule. The hybridized nucleic acid molecules generally have at least 60% identity, including for example at least any of 70%, 75%, 80%, 85%, 90%), or 95% identity. Moderately stringent conditions can be conditions equivalent to hybridization in 50% formamide, 5 x Denhardt's solution, 5x SSPE, 0.2%) SDS at 42°C, followed by washing in 0.2 x SSPE, 0.2% SDS, at 42°C. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5 x Denhardt's solution, 5 x SSPE, 0.2% SDS at 42°C, followed by washing in 0.1 x SSPE, and 0.1% SDS at 65°C. Low stringency hybridization can refer to conditions equivalent to hybridization in 10% formamide, 5 x Denhardt's solution, 6 χ SSPE, 0.2% SDS at 22°C, followed by washing in Ix SSPE, 0.2% SDS, at 37°C. Denhardt's solution contains 1% Ficoli, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20 χ SSPE (sodium chloride, sodium phosphate, EDTA) contains 3 M sodium chloride, 0.2 M sodium phosphate, and 0.025 M EDT A. Other suitable moderate stringency and high stringency
hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al , Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Piainview, N.Y. ( 1989); and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons (1999).
[0079] Alternatively, substantial complementarity exists when an RNA or DNA strand will hybridize under selective hybridization conditions to its complement. Typically, selective hybridization will occur when there is at least about 65% complementary over a stretch of at least 14 to 25 nucleotides, preferably at least about 75%, more preferably at least about 90%
complementary. See M. Kanehisa, Nucleic Acids Res. 12:203 (1984).
[0080] While there exists a number of methods to measure identity or complementarity between two polynucleotides, the term "identity" is well known to skilled artisans (Carrillo, H. & Lipman, D., SIAMJ Applied Math 48: 1013 (1988)). Sequence identity or complementarity compared along the full length of two polynucleotides refers to the percentage of identical or complementary nucleotide residues along the full-length of the molecule. For example, if a polynucleotide A has 100 nucleotide and polynucleotide B has 95 nucleotides, which are identical to nucleotides 1-95 of polynucleotide A, then polynucleotide B has 95% identity when sequence identity is compared along the full length of a polynucleotide A compared to full length of polynucleotide B.
Alternatively, sequence identity between polynucleotide A and polynucleotide B can be compared along a region, such as a 20 nucleotide analogous region, of each nucleotide. In this case, if polynucleotide A and B have 20 identical nucleotides along that region, the sequence identity for the regions would be 100 %. Alternatively, sequence identity can be compared along the length of a molecule, compared to a region of another molecule. As discussed below, and known to those of skill in the art, various programs and methods for assessing identity are known to those of skill in the art. High levels of identity, such as 90% or 95% identity, readily can be determined without software.
[0081] Whether any two nucleic acid molecules have sequences that contain, or contain at least, a certain percent (e.g. 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99%) sequence identity or complementarity can be determined using known computer algorithms such as the "FASTA" program, using for example, the default parameters as in Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 55:2444 (other programs include the GCG program package (Devereux, J., et al., Nucleic Acids Research 120:387 (1984)), BLASTN, FASTA (Altschul, S.F., et al., J Molec Biol 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carrillo et al. (1988) SIAMJ Applied Math 48: 1013). For example, the BLAST function of the National Center for Biotechnology Information database can be used to determine identity. Other commercially or publicly available programs include DNAStar "MegAlign" program (Madison, WI) and the University of Wisconsin Genetics Computer Group (UWG) "Gap" program (Madison WI)). The extent of sequence identity (homology) and complementarity may be determined using any computer program and associated parameters, including those described herein, such as BLAST 2.2.2. or FASTA version 3.0t78, with the default parameters. It is understood that for the purposes of determining sequence identity among DNA and RNA sequences thymidine nucleotide is equivalent to (represents identity with) a uracil nucleotide. Percent identity' further can be determined, for example, by comparing sequence information using a GAP computer program (e.g., Needleman et al. (1970) J. Mol. Biol. 48:443, as revised by Smith and Waterman ((1981) Adv. Appl. Math. 2:482). Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids), which are similar, divided by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a unary comparison matrix (containing a value of 1 for identities and 0 for non-identities) and the weighted comparison matrix of Gribskov et al. (1986) Niicl. Acids Res. 14:6745, as described by Schwartz and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap; and (3 ) no penalty for end gaps.
[0082] A "primer" used herein can be an oligonucleotide, either natural or synthetic, that is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed. The sequence of nucleotides added during the extension process is determined by the sequence of the template polynucleotide. Primers usually are extended by a polymerase, for example, a DNA polymerase.
[0083] A template or template polynucleotide refers to a polynucleotide that contains a nucleic acid sequence that can bind to a corresponding primer, such as the target polynucleotide, and serve as a template for extension of the primer by a polymerase. The polynucleotide region of a template polynucleotide may be composed of DNA , RNA, and/or synthetic nucleotide analogs. [0084] "Sequence determination" and the like include determination of information relating to the nucleotide base sequence of a nucleic acid. Such information may include the identification or determination of partial as well as full sequence information of the nucleic acid. Sequence information may be determined with varying degrees of statistical reliability or confidence. In one aspect, the term includes the determination of the identity and ordering of a plurality of contiguous nucleotides in a nucleic acid. "High throughput sequencing" or "next generation sequencing" includes sequence determination using methods that determine many (typically thousands to billions) of nucleic acid sequences in an intrinsically parallel manner, i.e. where DNA templates are prepared for sequencing not one at a time, but in a bulk process, and where many sequences are read out preferably in parallel , or alternatively using an ultra-high throughput serial process that itself may be parallelized. Such methods include but are not limited to pyrosequencing (for example, as commercialized by 454 Life Sciences, Inc., Branford, CT); sequencing by ligation (for example, as commercialized in the SOLID™ technology, Life Technologies, Inc., Carlsbad, CA); sequencing by synthesis using modified nucleotides (such as commercialized in TruSeq™ and HiSeq™
technology by Iliurnina, Inc., San Diego, CA; HeliScope™ by Helicos Biosciences Corporation, Cambridge, MA; and PacBio RS by Pacific Biosciences of California, Inc., Menio Park, CA), sequencing by ion detection technologies (such as Ion Torrent™ technology, Life Technologies, Carlsbad, CA); sequencing of DNA nanoballs (Complete Genomics, Inc., Mountain View, CA); nanopore-based sequencing technologies (for example, as developed by Oxford Nanopore
Technologies, LTD, Oxford, UK), and like highly parallelized sequencing methods.
[00851 SNP (single nucleotide polymorphism) refers to a genetic variation between individuals, e.g., a single nitrogenous base position in the DNA of organisms that is variable. SNPs are found across the genome. Much of the genetic variation between individuals is due to variation at SNP loci, and this genetic variation can result in phenotypic variation between individuals. SNPs for use in the present disclosure and their respective alleles may be derived from any number of sources, such as public databases (LLC. Santa Cruz Human Genome Browser Gateway
(genome.ucsc.edu/cgi-bin/hgGateway) or the NCBI dbSNP website (ncbi.nlm.nih gov/SNP/), or may be experimentally determined as described in U.S. Patent No. 6,969,589 and U.S. Patent Application Publication No. US2006/0188875, Although the use of SNPs is described in some of the embodiments presented herein, it will be understood that other bialielic or multi-allelic genetic variations may also be used or detected by the a method of the present disclosure. A bialielic genetic variation is one that has two polymorphic forms, or alleles. As mentioned above, for a bialielic genetic variation that is associated with a trait, the allele that is more abundant in the genetic composition of a case group as compared to a control group is termed the "associated allele," and the other allele can be referred to as the "unassociated allele." Thus, for each bialielic polymorphism that is associated with a given trait (e.g. , a disease or drug response), there is a corresponding associated allele. Other bialielic polymorphisms that may be used or detected by the methods presented herein include, but are not limited to, multinucleotide changes, insertions, deletions, repeats, translocations, and epigenetic changes such as gene hypermethylation. The polymorphi loci that are screened in an association study may be in a diploid or a haploid state and, ideally, would be from sites across the genome.
[0086] It will be further appreciated that genetic or genomic variations include those in genomic DNA, mitochondrial DNA, episoraal DNA, and/or derivatives of DNA such as amplicons, RNA transcripts, cDNA, DNA analogs, etc. Genetic or genomic changes that can be detected by a method of the present disclosure can be any types of DNA alterations including base change, deletion, duplication, amplification, polymorphism, microsatellite instability, loss of heterozygosity (LOH), epigenetic modification, and any combination thereof. A genetic marker of the present disclosure encompasses any of the genetic or genomic variations described above and combinations thereof.
[0087] As used herein, genetic markers includes genetic and epigenetic markers, including, but not limited to mutations, SNPs, insertions, allelic differences, alleles, including mutant and wild- type alleles, genes or portions thereof, deletions, methylation, and demethylation. In some aspects, the genetic marker is a wild-type allele, sequence, or residue.
2. Primer pairs, probe pairs, compositions, kits, and methods [0088] Method for detection of susceptibility mutations for ototoxic deafness has been described, for example, in US 5,506,101, US 2009/031 1679, and CN 103451302 A, the disclosures of which are incorporated herein by reference in their entireties for all purposes.
[0089] Mutations in mitochondrial DNA(mtDNA), especially in the 12S rRNA gene, are one of the important causes of aminoglycoside-induced and non-syndromic hearing loss. Of these, the A1555G and C1494T mutations in the highly conserved A-site of the 12S rRNA have been associated with hearing loss in many patients after the use of aminoglycoside antibiotics. The A1555G or C1494T mutation is expected to form a new 1494C-G1555 or 1494U-A1555 base pair at the highly conserved A-site of the 12S rRN A gene, which makes the secondary structure of the 12S rRNA similar to the corresponding region of the E.coli 16S rRNA. The 1494C-G1555 or
1494U-A1555 base pair thus facilitates the binding and sensitivity to aminoglycosides. This is the reason, at least in one aspect, why people who carry these mutations experience hearing loss, deafness, or worsening of existing deadness after using aminoglycosides. As a result, the detection of these two point mutations has important clinical significance for the prevention of
aminoglycoside-induced deafness or hearing loss.
[0090] Currently, Real-time PGR is often used in detecting A1555G and/or C1494T. According to the principle of quantitative fluorescence, real-time PGR can be divided into two categories listed below.
[ 0091] (1) Fluorescent dye based method. The principle of this type of method is the use of specific PGR primers, with different binding abilities to wild-type and mutant templates. The different primer specificities will result in different PGR amplification efficiencies, thereby distinguishing the genotypes of the templates at the detection sites. Due to the relatively low specificity of the primers and the DNA binding fluorescent dye, this method is prone to form nonspecific melting peak, which will affect the interpretation of the results. Fluorescent dye method requires a secondary analysis to the melting curve after PGR amplification, so it takes a long time. Typically, the whole process takes about 2.5 hours.
[0092] (2) TaqMan fluorescent probe method. There are only a few technologies that can detect one individual mutation site each time. Therefore, the existing methods typically require construction of a separate detection system for each mutation site. These methods often come with high costs, complicated operation procedures, and lowr detection efficiency.
[0093] Currently, most of the methods which can detect two mutation sites simultaneously are dye-based methods. Existing methods based fluorescent probes can only detect one deafness associated mutation each time.
[0094] In one aspect, the present disclosure aims to address the problems of current methods. For example, current methods based on TaqMan fluorescent probes often have problems such as high cost, complicated operation, and low detection efficiency. The present disclosure, in one aspect, provides a simple and efficient method that can detect two mutation sites simultaneously, for example, two mutation sites related to drug-induced hearing loss.
[0095] In one embodiment, the present disclosure provides two pairs of primers which can detect at least two mutations simultaneously, including primer F (forward primer or upstream primer) and primer R (reverse primer or downstream primer). In one aspect, primer F is designed based on the upstream sequence that is closest to mutation site, and primer R is designed based on the downstream sequence that is closest to mutation site. In cases where there are at least two genetic markers (such as two mutations), primer F and primer R can be designed to flank the at least two genetic markers, e.g., primer F based on the upstream sequence distal to the most upstream genetic marker of the at least two genetic markers, and primer R based on the downstream sequence distal to the most downstream genetic marker of the at least two genetic markers.
[0096] In certain embodiments, the genetic marker (e.g., a mutation or mutations) to be detected by a method of the present disclosure is a deafness associated genetic marker, for example, a genetic marker associated with drug-induced deafness. In one aspect, the genetic marker is a human or mammalian genetic marker. Mammals include, but are not limited to, humans, and non-human animals, including farm animals, sport animals, rodents and pets. In certain aspects, a human genetic marker such as a point mutation may have one or more corresponding genetic markers in a non-human species.
[0097] In certain embodiments, the genetic markers (e.g., mutations) to be detected comprise 1) C1494T in a mitochondrial I 2S rRNA gene; and/or 2) AI555G in a mitochondrial I2S rRNA gene. [0098] In some embodiments, primer F comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 1. In other embodiments, primer R comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 2.
[0099] In some embodiments, provided herein is a kit for detection of one or more genetic markers, such as gene mutations. In one aspect, a kit provided herein can include a primer pair according to any one of the embodiments disclosed herein. In another aspect, the kit can include probes, for example, probes designed according to the mutant nucleotide sequence. In one aspect, the number of probes is the same as the number of mutation sites. For example, if there are two mutation sites to be detected simultaneously and/or in one reaction, two probes (e.g. TaqMan® MGB probes) each specific for one of the mutation sites can be designed and used. In another example, if there are four mutation sites to be detected simultaneously and/or in one reaction, four probes (e.g. TaqMan® MGB probes) each specific for one of the four mutation sites can be designed and used. In another aspect, the sequence of each probe exactly matches the
corresponding mutant nucleotide sequence.
[00100] In one aspect, a probe pair can comprise the probes shown in (1 ) and (2): (1) nucleotide sequence shown in SEQ ID NO: 3, and (2) nucleotide sequence shown in SEQ ID NO: 4. In some embodiments, a probe of the probe pair comprises, consists essentially of, or consists of the sequence set forth in SEQ) ID NO: 3. In other embodiments, a probe of the probe pair comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 4.
[00101] In one aspect, the 5 ' end of the probe is labeled with a fluorescent reporter group. In another aspect, the 3 ' end of the probe is labeled with a non-fluorescent quencher and minor groove binder (MGB ). In another aspect, the 5 'ends of the probes are labeled with different fluorescent reporter groups, for example, the fluorescent reporter group can be selected from FAM, VIC, and NED. In one aspect, the non-fluorescent quencher comprises NFQ.
[00102] In certain embodiments, the kit further comprises one or more quality conixol primer pairs and/or one or more quality control probes. In certain embodiments, the quality control primers have the sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6, and the quality conixol probe has the sequence shown in SEQ ID NO: 7. In other embodiments, a quality control primer of the quality control primer pairs comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 5. In other embodiments, a quality control primer of the quality control primer pairs comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 6. In other embodiments, a quality control probe comprises, consists essentially of, or consists of the sequence set forth in SEQ ID NO: 7.
[001031 In certain aspects, the 5' end of the quality control probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a non- fluorescent quencher and MGB.
[00104] In some aspects, the genetic marker to be detected (e.g., mutation or mutations) by a kit of the present disclosure is associated with deafness or hearing loss, for example, drug-induced deafness. In particular embodiments, the mutations comprise 1) and/or 2): I) C1494T in a mitochondrial 12S rRNA gene; and 2) A1555G in a mitochondrial 12S rRNA gene.
[00105] In yet another aspect, provided herein is composition for PCR for detecting genetic markers such as mutations. In one aspect, the composition for PCR comprises a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 1 , a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 2, a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 5, a primer comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 6, a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 3, a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 4, and/or a probe comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7.
[00106] In one aspect, the 5' ends of the probes comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 7 are labeled with different fluorescent reporter groups. In another aspect, the 3' ends of the probes are each labeled with the same or different non-fluorescent quencher, and MGB.
[00107] In one aspect, the composition for PCR disclosed herein further comprises a PCR buffer and/or a polymerase, for example, a DNA polymerase. In some aspects, the genetic marker to be detected (e.g., mutation or mutations) by a composition for PCR of the present disclosure is associated with deafness or hearing loss, for example, drug-induced deafness. In particular embodiments, the mutations comprise 1 ) and/or 2): 1) C1494T in a mitochondrial 12S rRNA gene; and 2) A1555G in a mitochondrial 12S rRNA gene.
[OOlOSj A primer pair, probe pair, composition for PGR, or kit according to any one of the embodiments disclosed herein should be regarded as belonging to the scope of the present invention. In one aspect, the primer pair, probe pair, composition for PGR, or kit is used in detecting one or more genetic markers, including detecting at least two genetic markers at the same time and/or in the same reaction run and/or in the same reaction volume. In particular embodiments, the at least two genetic markers to be detected at the same time are associated with deafness or hearing loss, for example, drug-induced deafness. In particular embodiments, the genetic markers comprise the C1494T mutation in a mitochondrial 12S rRNA gene, and/or the A1555G mutation in a
mitochondrial 12S rRNA gene.
[0 109] In one aspect, the present disclosure provides a sequence specific TaqMan MGB probe. Compared to other detection methods that depend on the use of sequence-specific primers for the genetic markers, the present disclosure provides a method with higher detection specificity.
[00110] Compared to methods based on fluorescent dye, because in one aspect no melting curve analysis is necessaiy in the present disclosure, readability of the assay results is increased, and the analysis process is simple. In certain aspects, the procedure to detect a genetic marker can be completed in about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours. In other aspects, the detection and interpretation process can be completed in about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours. In one aspect, at the same time, at least two mutant probes are hydrolyzed in one PGR reaction system, so it can be used to detect at least two mutation sites in one reaction system and condition. Compared to the existing TaqMan® fluorescence probe methods, the detection process disclosed herein is simple, highly efficient and inexpensive.
[00111] In one aspect, compared to the existing detection technologies, the primer pair, probe pair, composition for PGR, kit, or method disclosed herein has the following advantages: [00112] (1 ) In one embodiment, the present disclosure uses a method based on a sequence specific probe to detect two deafness-related mutation sites. In some aspects, the mutant probe matches with the mutant template but not the wild-type template. For example, the mutant probe can be 100% complementary to the mutant template but not to the wild-type template. In certain aspects, the probes are hydrolyzed to release the corresponding fluorophore, thus the mutant and wild-type templates can be distinguished. Since the sequence-specific probes used in this method can bind to the template only when they are complementary to the template, the detection method has a high specificity and is not prone to non-specific amplification.
[00113] (2) In one aspect, a PGR reaction based on sequence-specific probes disclosed herein takes about 20 minutes, about 30 minutes, about 45 minutes, about 60 minutes, about 1.5 hours, or about 2 hours. Typically, a PCR reaction disclosed herein saves about 1 hour when compared to a dye-based method. Thus, a method disclosed herein takes a shorter time, and the detection is convenient.
[00114] (3) In one aspect, at least two drug-induced deafness related mutation sites can be detected in one tube simultaneously, according to the present disclosure. In one aspect, only mutant probes are necessary to differentiate the C3494T and A3555G mutations, without the need to design and synthesize wild-type probes. The present method therefore costs less and achieves a higher detection efficiency.
[00115] (4) In yet another aspect, the present disclosure utilizes the TaqMan® MGB probe technology to detect two mutation sites through the detection of signal types specific for each of the mutations (e.g. FAM for the C1494T mutation, versus VIC for the A1555G mutation) during the PCR amplification process. The corresponding Ct values are then analyzed. In one aspect, the present method therefore has a low requirement for instruments, short reaction time, and simple operation, without restriction enzyme digestion, electrophoresis, or sequencing. In other aspects, during the entire process, there is no need to open the lid except for adding a template. This could effectively prevent contamination, and achieve the detection of at least two mutation sites simultaneously in a simple and fast process with accurate assay readout. [00116] The genetic markers can include an epigenetic or genetic marker, such as a sequence including one or more genetic variations and/or genetic/epigenetic changes in genomic DNA, mtDNA, episomal DNA, RNA transcripts, tRNA, ncRNA, rRNA, hRNA, and/or derivatives of DNA such as ampiicons, cDNA, DNA analogs, etc.
[00117] In certain embodiments, the genetic marker is or includes ail or part of a genetic locus having one or more genetic variations between individuals, e.g., one or more SNPs, where the presence of one or more such genetic variations is or are the genetic markers. In certain
embodiments, the genetic marker can include one or more biallelic or multi-ailelic genetic varia tions. In the case of a biallelic genetic v ariation, the genetic marker can rela te to the associated allele or the unassociated allele. For example, the associated allele of a biallelic genetic variation is more abundant in the geneti composition of a case group as compared to a control group, therefore detection of the associated allele {e.g., with no or less unassociated allele detected) in a sample firom a subject can be indicative of the associated trait in the subject. In some aspects, the genetic marker includes one or more biallelic polymorphisms or genetic/epigenetic changes, including single or multi -nucleotide changes, based modifications, translocations, insertions, deletions, duplication, amplification, repeats, microsatellite instability, loss of heterozygosity, epigenetic raodification, and any combinations thereof. Exemplar}' base modifications include, but are not limited to methylation, uracil substitution, antibody conjugation, substitution with synthetic base, or substitution with synthetic sugar.
[00118] In some embodiments, the genetic, markers are or include cancer-associated mutations of oncogenes or tumor suppressor genes, including point mutation, insertions, deletions, and translocations, such as those contained in broken pieces of polynucleotides (e.g., DNA or RNA), for example, as shed from disintegrated cells, e.g., abnormal cells including cancer cells, such as those shed into the bloodstream. Exemplary cancer genetic markers include all or part of the BRAF gene and/or BAFF mutations or all eles, for exampl e, for analysis in the blood. Detection of the BRAF mutations, such as the BRAF point mutations, in the extracellular BRAF fragments or tumor cell genomic DNA can be used as an indicator of human cancer. The point mutation, for exampl e, can be the V600E or V600D mutations of human BRAF. Similar to the mitochondrial 32S rRNA mutations described above, these BRAF mutations can be detected at the same time in the same reaction system, using a PCR kit comprising: 1) a primer pair flanking the V600 site of BRAF, and capable of generating an ampiicon comprising position 600 of BRAF when used together in a PCR reaction; and 2) a sequence-specific MGB probe pair, the probes capable of specific binding to the V 600E mutant sequence and the V600D mutant sequence, respective!}'. The V60GE-specific probe can be labeled with FAM, for example, and the V600D-specific probe can be labeled with a different fluorescent group such as VIC or NED. The kit can further comprise a control primer pair and/or a control probe. It is to be appreciated that other cancer genetic markers, such as those associated with tumor suppressor genes (e.g. p53, BRCA1 , BRCA2, APC, and RBI etc.) or oncogenes (Ras, MEN2, RET, KIT, and MET etc.), can be easily adopted for detection by a method of the present disclosure.
[00119] In some aspects, the genetic markers to be detected according to the present disclosure can be associated with a disease or condition or stage or state thereof, including but not limited to malignancies, infections, autoimmune and inflammatory diseases and conditions, and pregnancy, such as fetal DNA or RNA in maternal blood, which may be used to determine gender identity, detect genetic predisposition to diseases or conditions, assess chromosomal abnormalities, and monitor pregnancy-associated complications. In other aspects, the genetic markers can comprise pathogen nucleic acids such as viral or bacterial nucleic acids. Such pathogenic nucleic acid may or may not be integrated into the genome of a cell of the subject from which the test sample is obtained.
[00120] The following examples are intended to further describe and illustrate various aspects of the present disclosure, but not to limit, the scope of the present disclosure in any manner, shape, or form, either explicitly or implicitly.
[00121] The present disclosure is further illustrated by the following exemplar}' embodiments:
[00122] Embodiment I : A primer pair which can detect more than two mutation sites
simultaneously, including primer F and primer R, wherein Primer F is designed based on the upstream DNA sequence that is closest to mutation site, primer R is designed based on the downstream DNA sequence that is closest to mutation site, wherein the mutations mentioned are deafness associated mutations, mutations associated with drug-induced deafness, a C1494T mutation in mitochondrial I2S rRNA gene, and/or a Al 555G mutation in mitochondrial 12S rRNA gene.
[00123] Embodiment 2; The primer pair of Embodiment 1 , wherein the primer pair is characterized in that: the primer F sequence is shown in SEQ ID NO: 1 , and the primer R is shown in SEO ID NO: 2.
[00124] Embodiment 3: A gene mutation detect kit, characterized in that: the kit comprises the primer pair of Embodiment 1 and/or Embodiment 2.
[00125] Embodiment 4: The kit according to Embodiment 3, characterized in that: the kit includes probes designed according to the mutant nucleotide sequence, wherein the number of probes is the same with the number of mutation sites, and the sequence of each probe exactly matches the corresponding mutant nucleotide sequence.
[00126] Embodiment 5: The kit according to Embodiment 4, characterized in that: the probes include the probes shown in (1 ) and/or (2):
(! ) Nucleotide sequence shown in EQ ID NO: 3; and
(2) Nucleotide sequence shown in EQ ID NO: 4.
[00127] Embodiment 6: The kit according to any one of Embodiments 3-5, characterized in that: the 5' end of the probe is labeled with a fluorescent reporter group, the 3 ' end is labeled non- fluorescent quencher and minor groove binder (MGB), wherein optionally, the 5 'ends of different probes are labeled different fluorescent reporter groups, and wherein optionally, the fluorescent reporter groups are selected from the group consisting of FAM, VIC, and NED, and wherein optionally, the non-fluorescent quencher is NFQ.
[00128] Embodiment 7: The kit according to any one of Embodiments 3-6, further comprising quality control primer pairs and/or a quality control probe, wherein optionally, the quality control primers have the sequence shown in SEQ ID NO: 5 and SEQ ID NO: 6, and wherein optionally the quality control probe has the sequence shown in SEQ ID NO: 7, and wherein optionally the 5 'end of the probe is labeled with a fluorescent reporter group, and wherein optionall y the 3' end is labeled with a non-fluorescent quencher and MGB. [00129] Embodiment 8: According to claim 3-7, wherein the kit, characterized in that; the mutations mentioned is deafness associated mutations; Specifically drug-induced deafness. More specifically, the mutations mentioned are as follows 1) and/or 2): 1) C1494T in mitochondrial 12S rRNA gene; 2) A1555G in mitochondrial 12S rRNA gene.
[00130] Embodiment 9; PCR reagents for detecting gene mutations, comprising a primer shown in SEQ ID NO: 1, a primer shown in SEQ ID NO: 2, a primer shown in SEQ ID NO: 5, a primer shown in SEQ ID NO: 6, a probe shown in SEQ ID NO: 3, a probe shown in SEQ ID NO: 4, and/or a probe shown in SEQ ID NO: 7, wherein optionally, the 5' ends of probes shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 7 are labeled with different fluorescent reporter groups, and wherein optionally the 3' end is labeled with a non-fluorescent quencher and MGB,
[00131] Embodiment 10: A primer pair according to Embodiment 1 or 2, a kit according to any one of Embodiments 3-8, or PCR reagents according to Embodiment 9 for use in developing a detection kit, vvherein the detection kit is optionally used for detecting a gene mutation.
Example 1 : Screening the C1494T and A1555G Mutations of the Human Mitochondrial 12S rRNA
Gene
[00132] This example demonstrates detection of the C1494T and A1555G mutations of the human mitochondrial 12S rRNA gene.
[00133] L Primer and Probe Design:
[00134] The sequences of the primers are as follows:
Forward primer upstream of the 1494th nucleotide: 5 ' CCCTGAAGCGCGTACACA 3' (SEQ ID NO: i in the Sequence Listing): and
Reverse primer downstream of the 1555th Nucleotide: 5'GCTACACTCTGGTTCGTCCAAGT 3 ' (SEQ ID NO: 2).
[00135] The sequences of the probes are as follows:
C1494T mutant probe: 5' CCGTCACTCTCCTCA A 3' (SEQ ID NO: 3). The 5' end of the probe is labeled with FAM fluorescent reporter group and the 3' end is labeled with a non-fluorescent quenching group NFQ and MGB. This probe is to detect whether the C base at position 1494 is substituted with T; and
A1555G mutation probe: 5 ' ACGACTTGCCTCCT 3' (SEQ ID NO: 4). The 5' end of probe is labeled with VIC fluorescent reporter group and the 3' end is labeled with a non-fluorescent quenching group NFQ and MGB. This probe is to detect whether the A base at position 1555 is substituted writh G.
[00136] The quality-control (QC) primers and probe are designed according to a conservative region of the mitochondrial genome DNA. Their sequences are as follows:
QC primer F: 5' AGCCATTTACCGTACATAGCACATT 3' (SEQ ID NO: 5);
QC primer R: 5' GGGATATTGATTTCACGGAGGAT 3' (SEQ ID NO: 6); and
QC probe: 5 ' CCATGGATGACCC 3 ' (SEQ ID JYe: 7). The 5' end is labeled with NED fluorescent reporter group and the 3' end is labeled with non-fluorescent quenching group NFQ and MGB.
[00137] 2, The PGR procedure:
[00138] The templates of the PGR are the human genomic DNA with or without the 1494 CT or 3555 A-*G mutations of the mitochondrial 12S rRNA gene. [00139] The genome DNA samples bearing the 1494 C~*T or 1555 A-*T mutations of the mitochondrial 12S rRNA gene were extracted from the blood samples or blood spots provided by cooperating hospitals. All the sample donors have provided informed consent. The genomic DNAs were extracted using conventional nucleic acid extraction kits, and the sequences of the regions including the nucleotide 1494 and 1555 were determined by DNA sequencing. Figure 1 is the sequencing results of the templates. The sequences with the underl ined bases in the block d iagram are the target sequences and sites. Figure 1 demonstrated that, in the wild-type genomic DNAs, the 1494th and 1555th nucleotides of the mitochondrial 12S rRNA gene are C and A, respectively. In the C1494T mutant genomic DN As and the A1555G mutant genomic DNAs, the sequences of the above regions remain identical to the wild-type genomic DNAs except for the correspondi g nucleotide substitution at position 1494 and 1555.
[001401 The PGR mixtures were prepared according to the following formula: PGR buffer 4.64μ1, ROX (50 x) 0.5μ1, Taq DNA polymerase 0.4μ1, uracil-N-glycosylase (UNG) 0.03μ1, forward primer upstream of the 1494th nucleotide (ΙΟμιηοΙ/L) Ιμΐ, reserve primer downstream of the 1555th nucleotide (ΙΟμιηοΙ/L) 1.75μ1, QC primer F (ΙΟμηιοΙ/L) 2.5μ1, QC primer R (ΙΟμηιοΙ/L) 2.5μ1, C1494T mutant probe (ΙΟμηιοΙ/L) 0.75 μΐ, A1555G mutation probe (ΙΟμιηοΙ/L) 0.75μ1, QC probe (ΙΟμηιοΙ/L) 2.5μ1, genomic DNA (as templates) 5μ1, and ddH?0 2.68μ1.
[00141] Four PGR reactions were set up in parallel, using the following as the template:
[00142 J Reaction tube 1, 2ng/ul genomic DNA bearing mitochondrial 12S rRNA gene 1494 C T mutation.
[001431 Reaction tube 2, 2τ¾/μ1 genomic DNA bearing mitochondrial 12S rRNA gene 1555 A G mutation.
[001441 Reaction tube 3, 2ng^ul wild-type genomic DNA.
[00145] Reaction tube 4, equal volume of ddH20.
[00146] All the reactions were performed with ABI 7500 real-time PGR system according to the following cycling parameters: pre-incubation, 37°C 5min; initialization, 95°C 3min; denaturation, 95°C 15sec; annealing/extension (fluorescence acquisition step) , 62°C Imin; 40 cycles.
[00147] 3. Interpretation of the Results: [00148] A FAM amplification curve with Ct less than 40 indicates the genomic DNA sample bear the 1494 C— ->T mutation of the mitochondrial 12S rRNA gene, and A VIC amplification curve with Ct less than 40 indicates the existence of the 1555 A→G mutation.
[00149] Figures 2-5 show the results of the above 4 reaction tubes. Figure 2 is the PGR testing result in which the mitochondrial 12S rRNA gene carried C1494T mutation in the human genomic DNA template. Figure 3 is the PGR testing result in which the mitochondrial 12S rRNA gene carried A1555G mutation in the human genomic DNA template. Figure 4 is the PGR testing result in which the wild-type mitochondrial 12S rRNA gene in human genomic DNA was used as the template. Wherein the curve labeled a represents mutant probe 1494 F AM fluorescent amplification curve, the curve labeled b represents mutant probe 1555 VIC fluorescent amplification curve, the curve labeled c represents quantity control probe NED fluorescent amplification curve. Figure 5 is the PGR testing result in which ddH20 was used as the template. In all of Figures 2-5, the curve labeled "a" represents mutant probe 1494 FAM fluorescent amplification curve, the curve labeled "b" represents mutant probe 1555 VIC fluorescent amplification curve, and the curve labeled "c" represents quantity control probe NED fluorescent amplification curve.
[00150] Tube 1 used the C1494T mutant genomic DNA as the template, and the FAM and NED signals were detected (Figure 2). Tube 2 used the A1555G mutant genomic DNA as the template, and the VIC and NED signals were detected (Figure 3). Tube 3 used wild-type genomic DNA as the template, and only the NED signals were obtained (Figure 4). Tube 4 used ddH20 as the template, and no fluorescent signal was detected (Figure 5).
[00151] These results indicate that, using the present detection kit, the mitochondrial DNA C1494T and A1555G mutations can be screened in a single PGR reaction with easy-to-apply procedure and easy-to-read results.

Claims

Claims
1. A composition comprising;
(a) a primer pair for detecting at least two genetic markers, comprising:
a forward primer based on an upstream sequence distal to a first genetic marker; and a reverse primer based on a downstream sequence distal to a second genetic marker, wherein the first genetic marker is upstream of the second genetic marker, and
wherein the forward primer and reverse primer, when used together in a polymerase chain reaction (PGR), produce an amplicon comprising the loci of the at least two genetic markers: and
(b) a probe pair for detecting the at least two genetic markers, comprising:
a first probe based on the first genetic marker; and
a second probe based on the second genetic marker,
wherein the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker, and
wherein the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker.
2. The composition of claim 1 , wherein the forward primer is hybridizable to a sequence complementary to the upstream sequence distal to the first genetic marker, and/or wherein the reverse primer is hybridizable to the downstream sequence distal to the second genetic marker,
3. The composition of claim 1 or claim 2, wherein the forward primer is substantially homologous to the upstream sequence distal to the first genetic marker, and/or the reverse primer is substantially complementary to the downstream sequence distal to the second genetic marker,
4. The composition of any one of claims 3 -3, wherein the first and second genetic markers are selected from the group consisting of mutations, genetic variations, single nucleotide polymorphisms (SNPs), deletions, insertions, amplifications, repeats, allelic variations, point mutations, epigenetic modifications, methylation, demethylation, and combinations thereof.
5. The composition of any one of claims 1-4, wherein the first and second genetic markers are associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
6. The composition of any one of claims 1-5, wherein the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss.
7. The composition of claim 6, wherein the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced.
8. The composition of claim 7, wherein the partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
9. The composition of any one of claims 1-8, wherein presence of the first genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the first genetic marker.
10. The composition of any one of claims 1-8, wherein presence of the second genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the second genetic marker.
1 1. The composition of any one of claims 1-10, wherein the first and second genetic markers are mutations in the mitochondrial 12S rRNA gene.
12. The composition of any one of claims 1-11 , wherein the first genetic marker comprises a CI 494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or is a C1494T mutation of the human mitochondrial 12S rRNA gene.
13. The composition of any one of claims 1-12, wherein the second genetic marker comprises an A1555 mutation or an A1555G mutation of the human mitochondrial 12S rRN A gene, or is an A1555G mutation of the human mitochondrial 12S rRNA gene.
14. The composition of any one of claims 1-13, wherein the forward primer comprises the sequence set forth in SEQ ID NO: 1 , and/or wherein the reverse primer comprises the sequence set forth in SEQ ID NO: 2.
15. The composition of any one of claims 1-13, wherein the forward primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 1 , and/or wherein the reverse primer consists essentially of or consists of the sequence set forth in SEQ ID NO: 2.
16. The composition of any one of claims 1-15, wherein the probe pair is a quantitative TaqMan MGB probe pair.
17. The composition of any one of claims 1-16, wherein the primer pair is for real-time quantitative PGR,
18. A primer pair for detecting at least two genetic markers, comprising:
a forward primer between about 15 and about 25 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO: 8; and
a reverse primer between about i 5 and about 25 base pairs in length, which is substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO: 8,
wherein the at least two genetic markers comprise a CI 494 and/or an A1555 mutation of the human mitochondrial 12S rRNA gene, and
wherein the forward primer and reverse primer, when used together in a polymerase chain reaction (PGR), produce an amplicon comprising the l oci of nucl eic acid residues 1494 and 1555 of a human mitochondrial 12S rRNA gene.
19. The primer pair of claim 18, wherein the forward primer is hybridizable to a sequence complementary to a sequence between nucleic acid residues 1-50, 51 -100, 101 -150, 151- 200, 201-250, 251-300, 301 -350, 351-400, 401-450, 451 -500, 501 -550, 551-600, 601-650, 651 -700, 701 -750, 751 -800, 801-850, 851-900, 901 -950, 951 -1000, 1001-1050, 1051 -1 100, 1 101-1 150, 1 151 -1200, 1201-1250, 1251 -1300, 1301 -1350, 1351-1400, 1401 -1450, 1451-1493, 1401-1420, 1421 -1440, 1441 -1460, 1461-1480, or 1481-1493 of SEQ ID NO; 8, and/or wherein the reverse primer is hybridizable to a sequence between nucleic acid residues 1556-1580, 1581-1600, 1601- 1620, 1621 -1640, 1641-1660, 1661-1680, 1681 -1700, 1701-1750, 1751-1800, 1801-1850, 1851- 1900, 1901-1950, 1951-2000, 2001-2050, 2051-2100, 2101 -2150, 2151-2200, 2201-2250, 2251 - 2300, 2301-2350, 2351-2400, 2401-2450, 2451-2500, 2501-2600, 2601-2650, 2651-2700, 2701- 2750, 2751-2800, 2801-2850, 2851-2900, 2901-2950, 2951-3000, 3001-3050, 3051-3100, 3101- 3150, 3151-3200, 3201-4200, 4201-5200, 5201-6200, 6201-7200, 7201-8200, 8201-9200, 9201- 10200, 10201-11200, 1 1201-12200, 12201-13200, 13201-14200, 14201-15200, or 15201-16568 of SEQ ID NO: 8.
20. The primer pair of claim 18 or claim 19, wherein the first and second genetic markers are associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
21, The primer pair of any one of claims 18-20, wherein the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss.
22, The primer pair of claim 21 , wherein the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced.
23. The primer pair of claim 22, wherein the partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
24. The primer pair of any one of claims 18-23, wherein presence of the first genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the first geneti marker,
25. The primer pair of any one of claims 18-23, wherein presence of the second genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the second genetic marker.
26. The primer pair of any one of claims 18-25, wherein the first genetic marker is a C1494T mutation of the human mitochondrial 12S rRNA gene, and/or the second genetic marker is an A1555G mutation of the human mitochondrial 12S rRNA gene.
27. The primer pair of any one of claims 18-26, wherein the forward primer comprises the sequence set forth in SEQ ID NO; 1 , and/or wherein the reverse primer comprises the sequence set forth in SEQ ID NO: 2.
28. The primer pair of any one of claims 18-26, wherein the forward primer consists essentially of or consists of the sequence set forth in SEQ) ID N O: 1 , and/or wherein the reverse primer consists essentially of or consists of the sequence set forth in SEQ) ID N O: 2.
29. The primer pair of any one of claims 18-28, which are used with a quantitative
TaqMan MGB probe in the PGR reaction.
30. The primer pair of any one of claims 18-29, which are primers for real-time quantitative PGR.
31. A probe pair for detecting at least two genetic markers, comprising:
a first probe based on a first genetic marker; and
a second probe based on a second genetic marker,
wherein the first genetic marker is upstream of the second genetic marker,
wherein the first probe specifically recognizes a sequence comprising the first genetic marker but not a counterpart sequence without the first genetic marker, and
wherein the second probe specifically recognizes a sequence comprising the second genetic marker but not a counterpart sequence without the second genetic marker.
32. The probe pair of claim 31 , wherein the first probe specifically recognizes an amplicon comprising the first genetic marker, wherein the amplicon is produced in a polymerase chain reaction (PGR).
33. The probe pair of claim 31 or claim 32, wherein the second probe specifically recognizes an amplicon comprising the second genetic marker, wherein the ampiicon is produced a polymerase chain reaction (PGR).
34. The probe pair of any one of claims 31 -33, wherein the first and second genetic markers are selected from the group consisting of mutations, genetic variations, single nucleotide polymorphisms (SNPs), deletions, insertions, amplifications, repeats, allelic variations, point mutations, epigenetic modifications, methylation, demethyiation, and combinations thereof.
35. The probe pair of any one of claims 31 -34, wherein the first and second genetic markers are associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
36. The probe pair of any one of claims 31-35, wherein the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss.
37. The probe pair of claim 36, wherein the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced.
38. The probe pair of claim 37, wherein the partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
39. The probe pair of any one of claims 31-38, wherein presence of the first genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the first genetic marker.
40. The probe pair of any one of claims 31-38, wherein presence of the second genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the second genetic marker.
41. The probe pair of any one of claims 31-40, wherein the first and second genetic markers are mutations in the mitochondrial 12S rR A gene.
42. The probe pair of any o e of claims 31-41 , wherein the first genetic marker comprises a CI 494 mutation or a C1494T mutation of the human mitochondrial 12S rRNA gene, or is a C1494T mutation of the human mitochondrial 12S rRNA gene,
43. The probe pair of any one of claims 31-42, wherein the second genetic marker comprises an A1555 mutation or an A1555G mutation of the human mitochondrial 12S rRNA gene, or is an A1555G mutation of the human mitochondrial 12S rRNA gene.
44. The probe pair of any one of claims 31-43, wherein the first probe specifically recognizes a sequence comprising a C1494T mutation of the human mitochondrial 12S rRNA gene but not a counterpart sequence comprising residue C at the 1494 position of the human
mitochondrial 12S rRNA gene.
45. The probe pair of any one of claims 31 -44, wherein the second probe specifically recognizes a sequence comprising an Al 555G mutation of the human mitochondrial 12S rRNA gene but not a counterpart sequence comprising residue A at the 1555 position of the human mitochondrial 12S rRNA gene.
46. The probe pair of any one of claims 31 -45 , wherein the first probe comprises the sequence set forth in SEQ ID NO: 3, and/or wherein the second probe comprises the sequence set forth in SEQ ID NO: 4.
47. The probe pair of any one of claims 31 -45, wherein the first probe consists essentially of or consists of the sequence set forth in SEQ ID NO: 3, and/or wherein the second probe consists essentially of or consists of the sequence set forth in SEQ ID NO: 4.
48 The probe pair of any one of claims 31-47, which are quantitative TaqMan MGB probes.
49 The probe pair of any one of claims 31-48, which are used in real-time quantitative
PGR
50. The probe pair of any one of claims 31-49, wherein the 5' end of the first probe is labeled with a first fluorescent reporter group, and the 3' end of the first probe is labeled with a first non-fluorescent quenching group and a minor groove binder (MGB), and/or
wherein the 5! end of the second probe is labeled with a second fluorescent reporter group, the 3' end of the second probe is labeled with a second non-fluorescent quenching group and a minor groove binder (MGB).
51. The probe pair of claim 50, wherein the first and second fluorescent reporter groups are selected from the group consisting of FAM, VIC, HEX, or NED, and wherein the first or second non-fluorescent quenching group is NFQ.
52. A probe pair for detecting at least two genetic markers, comprising:
a first probe between about 13 and about 30 base pairs in length, which is substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8 and comprises residue T at the position corresponding to the 1494 position of SEQ ID NO: 8; and
a second probe between about 13 and about 30 base pairs in length, which is substantially complementary to a sequence between nucleic acid residues 1526-1584 of SEQ ID NO: 8 and comprises residue C at the position corresponding to the 1555 position of SEQ ID NO: 8,
wherein the at least two genetic markers comprise a C3494T and/or an A1555G mutation of the human mitochondrial 12S rRNA gene, and
wherein the first probe specifically recognizes the CI 494T mutation but riot CI 494, and the second probe specifically recognizes the A3555G mutation but not A3555.
53. The probe pair of claim 52, wherein the first probe specifically recognizes an amplicon comprising the C1494T mutation but not an amplicon comprising C1494, wherein the ampiicons are produced in a polymerase chain reaction (PGR).
54. The probe pair of claim 52 or claim 53, wherein the second probe specifically recognizes an amplicon comprising the A1555G mutation but not an amplicon comprising A1555, wherein the ampiicons are produced in a polymerase chain reaction (PCR).
55. The probe pair of any one of claims 52-54, wherein the first and second genetic markers are associated with partial or complete deaf ess, hearing impairment, or hearing loss.
56. The probe pair of claim 55, wherein the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced.
57. The probe pair of claim 56, wherein the partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
58. The probe pair of any one of claims 52-57, wherein presence of the first genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafhess compared to a subject without the first genetic marker.
59. The probe pair of any one of claims 52-58, wherein presence of the second genetic marker in a subject is indicative of increased susceptibility to drug-induced or aminoglycoside- induced deafness compared to a subject without the second genetic marker.
60. The probe pair of any one of claims 52-59, wherein the first probe comprises the sequence set forth in SEQ ID NO: 3, and/or wherein the second probe comprises the sequence set forth in SEQ ID NO: 4.
61. The probe pair of any one of claims 52-60, wherein the first probe consists essentially of or consists of the sequence set forth in SEQ ID NO: 3, and/or wherein the second probe consists essentially of or consists of the sequence set forth in SEQ ID NO: 4.
62. The probe pair of any one of claims 52-61 , which are quantitative TaqMan MGB probes.
63. The probe pair of any one of claims 52-62, which are used in real-time quantitativ
64. The probe pair of any one of claims 52-63, wherein the 5' end of the first probe is labeled with a first fluorescent reporter group, and the 3' end of the first probe is labeled with a first non-fluorescent quenching group and a minor groove binder (MGB), and/or
wherein the 5 ! end of the second probe is labeled with a second fluorescent reporter group, the 3' end of the second probe is labeled with a second non-fluorescent quenching group and a minor groove binder (MGB).
65. The probe pair of claim 64, wherein the first and second fluorescent reporter groups are selected from the group consisting of FAM, VIC, HEX, or NED, and wherein the first or second non-fluorescent quenching group is NFQ.
66. A kit comprising the composition of any one of claims 1-17, the primer pair of any one of claims 18-30, and/or the probe pair of any one of claims 31-65.
67. The kit of claim 66, further comprising a control primer pair and/or a control probe.
68. The kit of claim 67, wherein the control primer pair comprises control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.
69. The kit of claim 67 or 68, wherein the control probe comprises a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7.
70. The kit of any one of claims 67-69, wherein the 5' end of the control probe is labeled with a fluorescent reporter group, and the 3' end of the control probe is labeled with a non- fluorescent quenching group and a minor groove binder (MGB).
71. A polymerase chain reaction (PCR) kit comprising:
a first primer comprising the sequence set forth in SEQ ID NO: 1:
a second primer comprising the sequence set forth in SEQ ID NO: 2;
a first probe comprising the sequence set forth in SEQ ID NO: 3; and a second probe comprising the sequence set forth in SEQ ID NO: 4,
wherein the 5 ' ends of the first and second probes are labeled with different fluorescent reporter groups, and the 3' ends of the first and second probes are labeled with a non-fluorescent quenching group and a minor groove binder (MGB).
72. The PGR kit of claim 71 , further comprising:
a third primer comprising the sequence set forth in SEQ ID NO: 5;
a fourth primer comprising the sequence set forth in SEQ ID NO: 6; and
a third probe comprising the sequence set forth in SEQ ID NO: 7,
wherein the 5' ends of the first, second, and third probes are each labeled with a different fluorescent reporter group, and the 3' ends of the first, second, and third probes are labeled with a non-fluorescent quenching group and a minor groove binder (MGB).
73. A method of indicating the presence or absence of at least two genetic markers in a sample, comprising:
(a) admixing in a polymerase chain reaction (PCR) volume:
a sample comprising a template;
a primer pair comprising a forward primer based on an upstream sequence distal to a first genetic marker, and a reverse primer based on a downstream sequence distal to a second genetic marker; arid
other reagents necessary for the PCR reaction;
(b) incubating the admixed PCR reaction volume under conditions suitable to produce ampiicons comprising the loci of the at least two genetic markers, wherein the admixed PCR reaction volume before the incubating step comprises a probe pair comprising a first probe based on the first genetic marker and a second probe based on the second genetic marker, or wherein the probe pair is added to the admixed PCR reaction during or after the incubating step; and
(c) detecting binding of the probe pair to the ampiicons produced in step (b),
wherein the first genetic marker is upstream of the second genetic marker on the template, wherein the first probe specifically binds to a first amplicon comprising the first genetic marker, and the second probe specifically binds to a second amplicon comprising the second genetic marker, and
wherein detection of specific binding of the first or second probe to the first or second amplicon, respectively, indicates presence of the first or second genetic marker in the sample.
74. The method of claim 73, wherein the presence or absence of the at least two genetic markers in the sample is indicated simultaneously.
75. The method of claim 73 or 74, wherein:
the forward primer is between about 15 and about 25 base pairs in length and is substantial!}' homologous to a sequence between nucleic acid residues 1-1493 of SEQ ID NO: 8: and
the reverse primer is between about 15 and about 25 base pairs in length and is substantially complementary to a sequence between nucleic acid residues 1556-16568 of SEQ ID NO: 8.
76. The method of any one of claims 73-75, wherein the forward primer comprises or consists essentially of or consists of the sequence set forth in SEQ ID NO: i, and/or wherein the reverse primer comprises or consists essentially of or consists of the sequence set forth in SEQ ID NO: 2.
77. The method of any one of claims 73-76, wherein:
the first probe is between about 13 and about 30 base pairs in length, is substantially homologous to a sequence between nucleic acid residues 1465-1523 of SEQ ID NO: 8, and comprises residue T at the position corresponding to the 1494 position of SEQ ID NO: 8; and
the second probe is between about 13 and about 30 base pairs in length, is substantially complementary to a sequence between nucleic acid residues 1526-1584 of SEQ ID NO: 8, and comprises residue C at the position corresponding to the 1555 position of SEQ ID NO: 8.
78. The method of any one of claims 73-77, wherein the first probe comprises or consists essentially of or consists of the sequence set forth in SEQ ID NO: 3, and/or wherein the second probe comprises or consists essentially of or consists of the sequence set forth in SEQ ID NO: 4.
79. The method of any one of claims 73-78, wherein the 5' end of the first probe is labeled with a first fluorescent reporter group, and the 3' end of the first probe is labeled with a first non-fluorescent quenching group and a minor groove binder (MGB), and/or
wherein the 5' end of the second probe is labeled with a second fluorescent reporter group, the 3' end of the second probe is labeled with a second non-fluorescent quenching group and a minor groove binder (MGB).
80. The method of claim 79, wherein the 5' ends of the first and second probes are labeled with different fluorescent reporter groups.
81. The method of any one of claims 73-80, wherein the admixing step further comprises admixing in the PCR reaction volume a control primer pair and/ or a control probe.
82. The method of claim 81 , wherein the control primer pair comprises control primers comprising, consisting essentially of, or consisting of the sequences set forth in SEQ ID NO: 5 and
SEQ ID NO: 6.
83. The method of claim 81 or 82, wherein the control probe comprises a sequence comprising, consisting essentially of, or consisting of the sequence set forth in SEQ ID NO: 7.
84. The method of any one of claims 81-83, wherein the 5' end of the control probe is labeled with a fluorescent reporter group, and the 3 ' end of the control probe is labeled with a non- fluorescent quenching group and a minor groove binder (MGB).
85. The method of any one of claims 81-84, wherein the 5' ends of the first, second, and control probes are each labeled with a different fluorescent reporter group, and the 3' ends of the first, second, and control probes are labeled with a non- fluorescent quenching group and a minor groove binder (MGB).
86. The method of any one of claims 73-85, wherein the first and second genetic markers are associated with the same disease or condition, associated with related diseases or conditions, or each associated with a different disease or condition.
87. The method of any one of claims 73-86, wherein the first and second genetic markers are associated with partial or complete deafness, hearing impairment, or hearing loss.
88. The method of claim 87, wherein the partial or complete deafness, hearing impairment, or hearing loss is inherited or induced.
89. The method of claim 88, wherein the partial or complete deafness, hearing impairment, or hearing loss is drug-induced or aminoglycoside-induced.
90. The method of any one of claims 73-89, wherein presence of the first genetic marker in a sample from a subject is indicative of increased susceptibility to drug-induced or
aminoglycoside-induced deafness compared to a subject in which the first genetic marker is absent.
91. The method of any one of claims 73-89, wherein presence of the second genetic marker in a sample from a subject is indicative of increased susceptibility to drug-induced or aminoglycoside-induced deafness compared to a subject in which the second genetic marker is absent.
92. The method of any one of claims 73-91 , wherein the at least two genetic markers comprise a C1494 and/or an A1555 mutation of the human mitochondrial 12S rR A gene.
93. The method of any one of claims 73-92, wherein the first genetic marker is a C1494T mutation and the second genetic marker is an A 1555 G mutation of the human
mitochondrial 12S rRNA gene.
94. The method of any one of claims 73-93, wherein the sample comprising the template is a blood sample.
95. The method of any one of claims 73-94, wherein the PCR reaction is a real-time quantitative PCR using an MGB probe.
96. The method of any one of claims 73-95, wherein the admixing step comprises admixing the probe pair in the PCR reaction volume before the incubating step.
EP14804634.5A 2013-05-30 2014-05-30 Kits and methods for detecting drug-induced deafness susceptibility Ceased EP3004389A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2013102085599A CN103276082A (en) 2013-05-30 2013-05-30 Kit for detecting mutation sites of drug-induced deafness susceptible gene
PCT/CN2014/000548 WO2014190762A1 (en) 2013-05-30 2014-05-30 Kits and methods for detecting drug-induced deafness susceptibility

Publications (2)

Publication Number Publication Date
EP3004389A1 true EP3004389A1 (en) 2016-04-13
EP3004389A4 EP3004389A4 (en) 2017-02-01

Family

ID=49058697

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14804634.5A Ceased EP3004389A4 (en) 2013-05-30 2014-05-30 Kits and methods for detecting drug-induced deafness susceptibility

Country Status (4)

Country Link
EP (1) EP3004389A4 (en)
CN (1) CN103276082A (en)
HK (1) HK1222683A1 (en)
WO (1) WO2014190762A1 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103451302A (en) * 2013-09-11 2013-12-18 步迅 Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit
CN103436625B (en) * 2013-09-11 2016-03-30 步迅 6 deaf sick susceptibility loci somatotype/mutant proportion detection kit
CN105506120B (en) * 2016-01-05 2019-10-18 石玉玲 The multiple Taqman fluorescence detection reagent kit of mitochondrial mutations deafness
CN106399553B (en) * 2016-11-09 2020-10-23 上海添音生物科技有限公司 A high-throughput sequencing method for the whole genome of human mitochondria based on multiplex PCR
CN107287303A (en) * 2017-06-28 2017-10-24 浙江大学 The fluorescent quantificationally PCR detecting kit of chondriosome deafness A1555G mutation and its application
CN112538524A (en) * 2019-12-31 2021-03-23 北京毅新博创生物科技有限公司 Detection product for detecting gene SNP related to deafness
CN112538523A (en) * 2019-12-31 2021-03-23 北京毅新博创生物科技有限公司 Primer group for detecting gene SNP (Single nucleotide polymorphism) related to deafness
CN117512095B (en) * 2023-11-13 2024-07-30 广州达安临床检验中心有限公司 Deafness related gene detection primer set, kit and application thereof

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060288444A1 (en) * 2004-08-13 2006-12-21 Mccarroll Robert Soybean polymorphisms and methods of genotyping
CN1987463B (en) * 2006-12-26 2015-04-01 金政策 Real-time quantitative Taq ManMGB probe kit
CN101684497B (en) * 2008-09-23 2011-09-28 中国人民解放军总医院 Deafness susceptibility gene screen test kit
CN101768637B (en) * 2009-11-20 2012-01-04 温州医学院 Kit for simultaneously detecting mutations in mitochondria DNA A1555G and C1494T and using method thereof
CN102154481B (en) * 2011-02-11 2013-01-02 智海生物工程(北京)有限公司 Method for detecting mitochondrial mutations and kit thereof
CN102787169B (en) * 2012-08-22 2014-08-27 兰州美伯生物医药技术有限公司 Mixed liquor, kit and detection system for detecting A1555G and C1494T mutation of mitochondria DNA (deoxyribonucleic acid)
CN103451302A (en) * 2013-09-11 2013-12-18 步迅 Deafness susceptible gene mitochondrion 12SrDNA 1555A>G and 1494C>T mutant ratio detection kit

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2014190762A1 *

Also Published As

Publication number Publication date
WO2014190762A1 (en) 2014-12-04
CN103276082A (en) 2013-09-04
EP3004389A4 (en) 2017-02-01
HK1222683A1 (en) 2017-07-07

Similar Documents

Publication Publication Date Title
WO2014190762A1 (en) Kits and methods for detecting drug-induced deafness susceptibility
AU2014299322B2 (en) Sepsis biomarkers and uses thereof
TWI541507B (en) Method for assessing liver lesions
EP3460073A1 (en) Materials and method for identifying spinal muscular atrophy carriers
US20100099083A1 (en) Crohn disease susceptibility gene
KR101157526B1 (en) Snp for diagnosing adhd, microarray and kit comprising the same, and method of diagnosing adhd using thereof
WO2014181107A9 (en) Genetic method of aiding the diagnosis and treatment of familial hypercholesterolaemia
KR20250091153A (en) Method for providing information for metabolic syndrome disease and kits using the same
US9045554B2 (en) Ribonucleic acid binding motif protein 20 sequence variants
KR20130043107A (en) Genetic marker for the diagnosis of dementia with lewy bodies
US10519507B2 (en) Method for detecting T-cell lymphoma
KR102115948B1 (en) Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof
AU2016351311B9 (en) SCAP gene mutant and the application thereof
KR102115941B1 (en) Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof
KR102039529B1 (en) Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof
KR102254341B1 (en) methods for diagnosing the high risk group of Diabetes based on Genetic Risk Score
CN101676404B (en) Reagent for predicting susceptibility of type 2 diabetes by SNP of mitochondrial ND2 gene
KR102115938B1 (en) Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof
EP1679370B1 (en) Method of evaluating cancerization degree
KR102115911B1 (en) Single nucleotide polymorphism for predicting metabolic syndrome with nonalcoholic fatty liver disease and the use thereof
KR102115933B1 (en) Single nucleotide polymorphism for predicting the risk factor of metabolic syndrome and the use thereof
JP5644009B2 (en) Determination method of inflammatory disease using single nucleotide polymorphism
KR101141546B1 (en) Polynucleotides derived from ANKRD15, HPD, PSMD9, WDR66, GPC6, PAX9, LRRC28, TNS4, AXL, and HNRPUL1 genes comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods using the same
KR20100137907A (en) Single base polymorphic marker for personal identification and use thereof
AU2017265006A1 (en) Methods of analysis of polymorphisms and uses thereof

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20151222

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: C12Q 1/68 20060101AFI20161221BHEP

Ipc: C12N 15/11 20060101ALI20161221BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20170105

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1222683

Country of ref document: HK

17Q First examination report despatched

Effective date: 20170926

RIC1 Information provided on ipc code assigned before grant

Ipc: C12Q 1/6883 20180101AFI20180323BHEP

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: TSINGHUA UNIVERSITY

Owner name: CAPITALBIO TECHNOLOGY CORPORATION

REG Reference to a national code

Ref country code: DE

Ref legal event code: R003

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20190519

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1222683

Country of ref document: HK