EP2951310A1 - Microorganism and method for production of amino acids by fermentation - Google Patents

Abstract

The invention relates to a microorganism which produces and/or secretes an organic chemical compound, wherein the microorganism has an increased expression, in comparison with the respective starting strain, of a polypeptide LpdA having the activity of a transhydrogenase; and also a method for producing an organic chemical compound, using the microorganism according to the invention.

Description

Microorganism and process for the fermentative production of amino acids

The invention relates to a microorganism which produces an organochemical compound and / or

excreted, the microorganism increased

Activity of a transhydrogenase (LpdA protein, gene product of the lpdA gene); as well as a method for

Preparation of an organic-chemical compound using the microorganism according to the invention.

The present invention is within the scope of a

Federal Ministry of Education and Research (BMBF)

funded project (grant number 0313917A)

come about .

State of the art

Organic chemical compounds, which include in particular amino acids, organic acids, vitamins, nucleosides and nucleotides, are used in human medicine, in the pharmaceutical industry, in the food industry and especially in animal nutrition.

Many of these compounds, such as L-lysine, are obtained by fermentation of strains of coryneform bacteria, in particular Corynebacterium glutamicum, or of strains of the family Enterobacteriaceae,

especially Escherichia coli. Because of the great economic importance is constantly on the

Improvement of the manufacturing process worked.

Process improvements may include fermentation measures such as stirring and supply with

Oxygen, or the composition of the nutrient media, such as the sugar concentration during the

Fermentation, or the work-up to the product form by, for example, ion exchange chromatography or the

concern intrinsic performance properties of the microorganism itself. Biosynthetic pathways of amino acids are subject to stringent metabolic control in wild-type strains, ensuring that the amino acids are produced only to the extent necessary for the cell's own needs. An important prerequisite for efficient production processes is therefore that suitable microorganisms are available, which, in contrast to wild-type organisms, have an excessively increased production capacity (overproduction) for the production of the desired amino acid beyond their own requirements.

To improve the performance characteristics of this

Microorganisms are used methods of mutagenesis, selection and mutant selection. In this way, one obtains strains that are resistant to antimetabolites or auxotrophic for regulatory metabolites and produce the L-amino acids. One known antimetabolite is the lysine analog S- (2-aminoethyl) -L-cysteine (AEC).

For some years now also methods of

Recombinant DNA technology for strain improvement of L-amino acid producing strains of the genus

 Corynebacterium, in particular Corynebacterium glutamicum, or the genus Escherichia, in particular Escherichia coli, by modifying or strengthening or attenuating individual amino acid biosynthesis genes and the effect on amino acid production

examined.

The nucleotide sequences of the chromosomes of numerous

Bacteria are known.

The nucleotide sequence of the genome of Corynebacterium

glutamicum ATCC13032 is available from Ikeda and Nakagawa (Applied Microbiology and Biotechnology 62, 99-109 (2003)), EP 1 108 790 and Kalinowski et al. (Journal of

Biotechnolgy 104 (1-3), (2003)). The nucleotide sequence of the genome of Corynebacterium

glutamicum R is in Yukawa et al. (Microbiology

153 (4): 1042-1058 (2007)).

The nucleotide sequence of the genome of Corynebacterium

efficiens is described by Nishio et al (Genome Research., 13 (7), 1572-1579 (2003)).

The nucleotide sequence of the genome of Corynebacterium

diphteriae NCTC 13129 was described by Cerdeno-Tarraga et al.

(Nucleic Acids Research 31 (22), 6516-6523 (2003))

described.

The nucleotide sequence of the genome of Corynebacterium

jeikeium has been described by Tauch et al. (Journal of Bacteriology 187 (13), 4671-4682 (2005)).

The nucleotide sequences of the genome of Corynebacterium glutamicum are also in the National Library of Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, MD, USA), in the DNA Data Bank of Japan (DDBJ, Mishima, Japan) or in of the

Nucleotide sequence database available from European Molecular Biology Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK).

A summary of various aspects of fermentative production of L-amino acids can be found in R. Faurie and J. Thommel in Advances in Biochemical Engineering Biotechnology, Volume 79 (Springer-Verlag,

Berlin, Heidelberg (Germany) 2003).

In the preparation of the above organic chemical compounds using microorganisms, each of these compounds is produced in a biosynthetic pathway in the cell of a microorganism. One of the important coenzymes essential for the function of essential enzymes in the biosynthetic system is reduced

Nicotinamide adenine dinucleotide phosphate (hereinafter referred to as NADPH). The relationship between NADPH and the production of organic chemical compounds using

Microorganisms are described, for example, in EP0733712B

explained. Nicotinamide dinucleotide transhydrogenase (hereinafter simply referred to as "transhydrogenase") is known as one of the enzymes responsible for the production of NADPH. It is known that this enzyme is present in various organisms, including in microorganisms of the genus Escherichia. In Escherichia coli, a typical

 Microorganism of the genus Escherichia, the purification of transhydrogenase (David M. Clarke and Philip D. Bragg, Eur. J. Biochem., 149, 517-523 (1985)), the cloning of a gene coding therefor (David M. Clarke and Philip D. Bragg, J. Bacteriology., 162, 367-373 (1985)) and the determination of the nucleotide sequence of the gene (David M. Clarke, Tip W. Loo,

Shirley Gillam, and Philip D. Bragg, Eur. J. Biochem. 158, 647-653 (1986)), and the presence of the enzyme was demonstrated. However, a physiological function of the enzyme is so far almost unknown. This is typically demonstrated by the fact that variants lacking the enzyme show no phenotypic expression.

Makoto Ishimoto "Metabolic Maps, July 25, 1971 (Kyoritsu Suppan Co., Ltd.), pages ¹ 30-32, discloses that the reducing activity of NADH or NADPH for the biosynthesis of several

Amino acids is required. However, this document does not disclose the conversion of NADH into NADPH for the biosynthesis of a target substance.

Bunji Maruo, Nobuo Tamiya (authors) "Enzyme Handbook", March 1, 1983 (01.03.83), Asakura Shoten), pp. 132-133 and Arch. Biochem. Biophys. Vol. 176, No. 1, 1976, Wermuth B et al. "Pyridine nucleotide transhydrogenase from Pseudomonas aeruginosa purification by affinity chromatography and physiochemical properties", pp. 136-143, each disclose an enzyme capable of converting NADH to NADPH and vice versa. None of these documents concerns the Producing a target substance or an elevated one

Productivity for NADPH that could be used to make a target substance.

E. coli contains both a soluble and a

membrane bound pyridine nucleotide transhydrogenase. The soluble pyridine nucleotide transhydrogenase is the

Gene product SthA (Sth, UdhA); its primary physiological role seems to be reoxidation of NADPH. The

membrane-bound proton-transferring pyridine nucleotide transhydrogenase is the PntAB gene product; PntAB is an important source of NADPH (Sauer et al., The Journal of Biological Chemistry 279 (8) (2004)).

Anderlund et al. (Applied and Environmental Microbiology 56 (6) (1999)) investigated the physiological effect of expression of the membrane-bound transhydrogenase (pntA and pntB genes) from Escherichia coli in recombinant

Saccharomyces cerevisiae.

Against this background, the object underlying the present invention is to provide a microorganism improved over the microorganisms described in the prior art, processes for producing such a microorganism, and processes using such a microorganism for overproduction of organic chemical compounds Factors such as the intracellular concentration of the overproduced compound, the yield of the overproduced compound after treatment of the culture, the growth characteristics of the microorganism and the time and number of processing steps required for the overproduction and preparation of the compound, as well as the resource requirements of the process, for example with respect to time , Energy and amount of strains and starting materials used. These and other objects are achieved by the subject matter of the present application and in particular by the

The subject matter of the independent claims, wherein embodiments result from the subclaims.

In a first aspect, the object underlying the application is achieved by a method for

fermentative production of an organic chemical

Compound using a microorganism

containing the steps: a. Fermentation of an organic chemical compound producing microorganism,

wherein in the microorganism, a polynucleotide encoding a polypeptide whose amino acid sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the

Amino acid sequence of SEQ ID NO: 2, is overexpressed and wherein the fermentation in a suitable

Fermentation medium proceeds to form a fermentation broth and b. Enrich (accumulate) the organic chemical

Compound in the fermentation broth from a).

In the context of the present invention is under an organic-chemical compound producing

Microorganism to understand a microorganism that produces the organic chemical compound beyond the needs required to maintain the viability of the microorganism.

In the context of the present invention is under the

Enrich, or accumulate the organic chemical compound in the fermentation broth both the

Enrichment / accumulation of organic chemical

Compounds in the microorganism cells as well as the

Excretion of the organochemical compound into the nutrient medium surrounding the microorganism, i. in the

Fermentation broth, to understand. The object underlying the application is achieved in a further aspect by a microorganism which produces an organochemical compound, wherein in the microorganism a polynucleotide which is suitable for a

Polypeptide whose amino acid sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the

Amino acid sequence of SEQ ID NO: 2, is overexpressed. In one embodiment of the method according to the invention, for producing an organochemical compound, or the microorganism according to the invention, the encoded polypeptide whose amino acid sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% is identical to the

 Amino acid sequence of SEQ ID NO: 2, the activity of a transhydrogenase on.

The activity of a transhydrogenase is over the

Enzyme assay according to Argyrou et al. (2004). This is purified transhydrogenase in terms of

 NAD (P) H-dependent reduction of 5-HNQ, an artificial electron acceptor.

The microorganisms or strains (parent strains) used for the measures of overexpression of the claimed polypeptide polypeptide preferably already have the

Ability to enrich the desired organic chemical compound in the cell or to secrete it into the surrounding nutrient medium and accumulate there.

The advantage of the present invention is that the product yield in biotechnological

Production processes, such as amino acid production, is further increased. With the method according to the invention, or with the use of the microorganisms according to the invention can the microbial production of organic chemical

Compounds are further increased.

Therefore, the inventive method for producing an organic-chemical compound also characterized by the fact that the preparation of the organic chemical compound over the fermentation of a

A microorganism in which the polynucleotide coding for a polypeptide whose amino acid sequence is at least 80% identical to the amino acid sequence of SEQ ID NO: 2, is not overexpressed, by at least 0.5%,

at least 1%, at least 1.5% or at least 2%. Surprisingly, has a high

Sequence identity to a protein with the activity of a transhydrogenase (LpdA protein) in Mycobacterium

tuberculosis a transhydrogenase in C. glutamicum

identified. The amplification of the expression of

Transhydrogenase resulted in increased production of an organochemical compound using a corresponding production strain. In a preferred embodiment of the method / microorganism according to the invention, the polynucleotide encoding a polypeptide is derived

Amino acid sequence at least 80%, at least 85%,

at least 90%, at least 95%, at least 98% or

at least 99%, or 100% identical to the

 Amino acid sequence of SEQ ID NO: 2 from Corynebacterium glutamicum. Particularly preferred, this coded

Polypeptide on the activity of a transhydrogenase.

The microorganism according to the invention has an im

Compared to the respective parent strain, increased expression of a polynucleotide encoding a polypeptide having an amino acid sequence exhibiting an identity of 80% or more to the amino acid sequence shown in SEQ ID NO: 2.

In preferred embodiments, variants are included which are at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%

are identical to the amino acid sequence shown in SEQ ID NO: 2, i. wherein at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% of the amino acid positions are identical to the amino acid sequence shown in SEQ ID NO: 2. The percent identity is preferably calculated over the entire length of the amino acid or nucleic acid region.

In a preferred embodiment, the

Microorganism one compared to the respective one

Starting strain increased expression of a polynucleotide encoding a polypeptide having an amino acid sequence according to SEQ ID NO: 2.

As for the biosynthesis of organic-chemical

Compounds reducing equivalents needed in the form of NADPH is the improved supply of

Reduction equivalents advantageous.

By an organochemical compound is meant for the measures of the invention a vitamin such as e.g.

Thiamine (vitamin B1), riboflavin (vitamin B2),

 Cyanocobalamin (vitamin B12), folic acid (vitamin M),

Tocopherol (vitamin E) or nicotinic acid / nicotinamide, a nucleoside or nucleotide such as S-adenosyl-methionine, inosine-5 ^" -monophosphoric acid and guanosine 5 ^" - monophosphoric acid, L-amino acids, organic acids or an amine such as cadaverine , Preferably prepared are L-amino acids and products containing them.

The organo-chemical compound used by the

microorganism according to the invention is produced and / or excreted, is preferably selected from the group vitamin, nucleoside or nucleotide, L-amino acids,

organic acids and amine.

The term L-amino acids includes the proteinogenic ones

Amino acids, as well as L-ornithine and L-homoserine. Proteinogenic L-amino acids are the L-amino acids which occur in natural proteins, that is in proteins of microorganisms, plants, animals and humans. Proteinogenic amino acids include L-aspartic acid, L-asparagine, L-threonine, L-serine, L-glutamic acid, L-glutamine, L-glycine, L-alanine, L-cysteine, L-valine, L-methionine, L Isoleucine, L-leucine, L-tyrosine, L-phenylalanine, L-histidine, L-lysine, L-tryptophan, L-arginine, L-proline and optionally L-selenocysteine and L-pyrrolysine. The term organic acid includes keto acids,

in particular a keto acid selected from the group ketoisocaproic acid, keto-valeric acid and keto-β-methylvaleric acid.

In a particularly preferred manner, the organochemical compound is selected from the group of proteinogenic L-amino acid, L-ornithine and L-homoserine and - ketoisocaproic acid, -Ketovaleriansäure and -Keto-ß- methylvalerianic acid. Particularly preferred is the

proteinogenic L-amino acid selected from the group L-threonine, L-lysine, L-methionine, L-valine, L-proline, L-

Glutamate, L-leucine and L-isoleucine, especially L-lysine, L-methionine and L-valine, especially L-lysine and L-methionine.

If amino acids or L-amino acids are mentioned below, the term also includes their salts, for example the lysine monohydrochloride or lysine sulfate in the case of

Amino acid L-lysine. Likewise, the term keto acid also includes their salts, as in the case of ketoisocaproic acid (KIC), the calcium KIC, the potassium KIC or the sodium KIC. The microorganism is preferably selected from the group bacteria, yeast and fungi, among the bacteria particularly preferably from the family Corynebacteriaceae or the family Enterobacteriaceae, wherein the genus

Corynebacterium or the genus Escherichia very particularly preferred and of the genera mentioned the species Corynebacterium glutamicum or the species Escherichia coli is particularly preferred.

In a further preferred embodiment, the expression of the polynucleotide encoding a polypeptide whose amino acid sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or

at least 99%, or 100% identical to the

Amino acid sequence of SEQ ID NO: 2 and preferably increased with the activity of a transhydrogenase by one or more measures selected from the following group: a) the expression of the gene is under the control of a promoter used in the method used for the method

Microorganism is stronger than the native, or the original promoter of the gene; examples for

Promoters which can preferably be used according to the invention in Corynebacterium glutamicum are described, for example, in FIG. 1 of the review article by Patek et al. (Journal of

Biotechnology 104 (1-3), 311-323 (2003)). In the same way, the methods described by Vasicova et al. (Journal of Bacteriology 181, 6188-6191 (1999)) described variants of the dapA promoter, for example the promoter A25

be used. Furthermore, the gap promoter of Corynebacterium glutamicum (EP 06007373) can be used. Finally, the well-known Amann et al. (Gene 69 (2), 301-315 (1988)) and Amann and Brosius

(Gene 40 (2-3), 183-190 (1985)) promoters T3, T7, SP6, M13, lac, tac and trc. b) increasing the copy number of the gene coding for a

Polypeptide having the activity of a transhydrogenase;

preferably by inserting the gene in plasmids with increased copy number and / or by integration of the gene into the chromosome of the microorganism in at least one

Copy ; c) the expression of the gene is carried out using a ribosome binding site, which is in the for the process used microorganism is stronger than the original ribosome binding site of the gene; d) the expression of the gene is carried out by optimizing the codon usage of the microorganism used for the method; e) the expression of the gene takes place by reducing secondary mRNA structures in the mRNA transcribed from the gene; f) the expression of the gene takes place with elimination of RNA polymerase terminators in the mRNA transcribed from the gene; g) the expression of the gene is carried out using mRNA-stabilizing sequences in the transcribed from the gene mRNA. The said measures for increasing the expression can be suitably combined with one another.

 The expression of the polynucleotide encoding a polypeptide having the activity of a transhydrogenase is preferably increased by the combination of at least two of the measures selected from the group a), b) and c), particularly preferably by the combination of the measures a) and b).

As mentioned above, the present invention comprises a microorganism and a process for the fermentative production of an organic chemical compound

 comprising the steps of: a) cultivating the above-described microorganism according to the present invention in a suitable medium to obtain a fermentation broth, and b) concentrating the organochemical compound in the

 Fermentation broth from a).

It is preferred that one produces from the fermentation broth a product in liquid or solid form. As mentioned above, the term includes microorganism

Bacteria, yeasts and fungi. Among the bacteria are in particular the genus Corynebacterium and the genus Escherichia mentioned.

Within the genus Corynebacterium are strains

preferred, which are based on the following types:

Corynebacterium efficiens, such as the

 Type strain DSM44549,

Corynebacterium glutamicum, such as the

 Type strain ATCC13032 or strain R, and

Corynebacterium ammoniagenes, such as

 strain ATCC6871, with the strains of the species Corynebacterium glutamicum being most preferred.

Some strains of the species Corynebacterium glutamicum are also known in the prior art under other names, including, for example:

Strain ATCC13870, which was named Corynebacterium acetoacidophilum,

Strain DSM20137 of the as Corynebacterium lilium

was designated

Strain ATCC17965, which was called Corynebacterium molassecola,

Strain ATCC14067 as the Brevibacterium flavum

was designated

Strain ATCC13869, which has been designated as Brevibacterium lactofermentum, and

Strain ATCC14020, designated Brevibacterium divaricatum. The term "Micrococcus glutamicus" for Corynebacterium glutamicum was also common.

Some strains of the species Corynebacterium efficiens have also been referred to in the art as Corynebacterium thermoaminogenes, such as strain FERM BP-1539.

The representatives of Enterobacteriaceae are preferably selected from the genera Escherichia, Erwinia,

Providencia and Serratia. The genera Escherichia and Serratia are particularly preferred. In the genus

Escherichia is in particular the species Escherichia coli and in the genus Serratia in particular the species Serratia marcescens.

The microorganisms or strains (parent strains) used for the measures of overexpression of the claimed disclosed polypeptide preferably already have the ability of the desired (organic) chemical

To enrich compounds in the cell or excrete them in the surrounding nutrient medium and there to

accumulate. For this purpose, the term "produce" is also used in the following: In particular, the strains used for the overexpression measures have the ability> (at least)> 0.10 g / l, 0.25 g / l,> 0.5 g / l ,> 1.0 g / 1,> 1.5 g / 1,> 2.0 g / 1,> 4 g / 1 or> 10 g / 1 of the desired compound in <(maximum) 120 hours, <96 hours <48 hours, <36 hours, <24 hours or <12 hours in the cell or in the nutrient medium to accumulate or accumulate.) The parent strains are preferably strains obtained by mutagenesis and selection, by recombinant DNA techniques or by a

Combination of both methods were produced.

It is understood by those skilled in the art that you can get to a suitable for the purposes of the invention microorganism also characterized by first in a wild strain, such as in the Corynebacterium glutamicum type strain ATCC 13032 or in the strain ATCC 14067, first Trans-overexpressing transhydrogenase and then causing the microorganism to produce the desired L-amino acid (s) by further genetic engineering as described in the prior art. The transformation of the wild-type alone with said polynucleotide is not a measure according to the invention.

Strains of the species Corynebacterium glutamicum which dissociate or produce L-lysine and which can serve as starting strain for the microorganisms overexpressing the transhydrogenase according to the invention are, for example:

Corynebacterium glutamicum DSM13994 described in US

6,783,967, and

Corynebacterium glutamicum DM1933 described in Blombach et al. (Appl Environ Microbiol. 2009 Jan; 75 (2): 419-27). An L-lysine secreting or producing strain of the species Corynebacterium efficiens is for example:

Corynebacterium thermoaminogenes AJ12521 (= FERM BP-3304) described in US 5,250,423.

Possess L-lysine-producing microorganisms

typically a "feed back" resistant or

desensitized aspartate kinase. Under "feed back"

Resistant aspartate kinases are understood as meaning aspartate kinases (LysC), which have a lower susceptibility to inhibition than wild type (wild type)

Mixtures of lysine and threonine or mixtures of AEC

(Aminoethylcysteine) and threonine or lysine alone or AEC alone. The genes or alleles coding for these aspartate kinases, which are desensitized in comparison with the wild type, are also referred to as lysC ^FBR alleles. In the case of aspartate kinases of the species Corynebacterium glutamicum, strain ATCC13032 is the appropriate wild-type. Numerous lysC ^FBR alleles encoding aspartate kinase variants are described in the prior art

Amino acid exchanges compared to the wild-type protein have. In bacteria of the genus Corynebacterium, the lysC gene is also referred to as ask gene. at

Enterobacteriaceae will be encoded by the lysC gene

Aspartate kinase also known as aspartokinase III. A detailed list with details of which

 Amino acid exchanges in the Aspatatkinaseprotein of

Corynebacterium glutamicum lead to desensitization is contained inter alia in WO2009141330. Preferred are aspartate kinase variants which carry the following amino acid substitutions selected from the group: at position 380 of the amino acid sequence L-isoleucine instead of L-threonine and optionally at position 381 L-phenylalanine instead of L-serine, at position 311 L-isoleucine instead of L-threonine and at position 279 L-threonine instead of L-alanine.

A L-methionine secreting or producing strain of the species Corynebacterium glutamicum, as the starting strain for the present invention, the transhydrogenase

is overexpressing microorganisms, is

for example

Corynebacterium glutamicum DSM 17322 described in WO 2007/011939.

Known representatives L-tryptophan producing or

segregating strains of coryneform bacteria, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example:

Corynebacterium glutamicum K76 (= Ferm BP-1847) described in US 5,563,052, Corynebacterium glutamicum BPS13 (= Ferm BP-1777) described in US 5,605,818, and

Corynebacterium glutamicum Ferm BP-3055

described in US 5,235,940. Known representatives producing L-valine or

segregating strains of coryneform bacteria, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example:

Brevibacterium lactofermentum FERM BP-1763

 described in US 5,188,948,

Brevibacterium lactofermentum FERM BP-3007

 described in US 5,521,074, Corynebacterium glutamicum FERM BP-3006

 described in US 5,521,074, and

Corynebacterium glutamicum FERM BP-1764

 described in US 5,188,948.

Known representatives producing L-isoleucine or

segregating strains of coryneformer bacteria, called as

Starting strain for the transhydrogenase overexpressing microorganisms according to the invention can serve, for example:

Brevibacterium flavum FERM BP-760

described in US 4,656,135,

Brevibacterium flavum FERM BP-2215

described in US 5,294,547, and

Corynebacterium glutamicum FERM BP-758

described in US 4,656,135. Known representatives L-Homoserin producing or

segregating strains of coryneform bacteria, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example: Micrococcus glutamicus ATCC 14296

described in US 3,189,526 and Micrococcus glutamicus ATCC 14297

described in US 3,189,526.

Cadaverine producing or excretory microorganisms are described for example in WO 2007/113127. Known representatives producing L-threonine or

segregating strains of the genus Escherichia, in particular of the species Escherichia coli, which can serve as a starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example: Escherichia coli H4581 (EP 0 301 572)

Escherichia coli KY10935 (Bioscience Biotechnology and Biochemistry 61 (11): 1877-1882 (1997)

Escherichia coli VNIIgenetika MG442 (US-A-4, 278, 765)

Escherichia coli VNIIgenetics Ml (US Pat. No. 4,321,325) Escherichia coli VNIIgenetika 472T23 (US Pat. No. 5,631,157)

Escherichia coli BKIIM B-3996 (US-A-5, 175, 107)

Escherichia coli kat 13 (WO 98/04715)

Escherichia coli KCCM-10132 (WO 00/09660)

Known representatives producing L-threonine or

segregating strains of the genus Serratia, in particular of the species Serratia marcescens, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example:

Serratia marcescens HNr21 (Applied and Environmental Microbiology 38 (6): 1045-1051 (1979))

Serratia marcescens TLrl56 (Gene 57 (2-3): 151-158

 (1987))

Serratia marcescens T-2000 (Applied Biochemistry and Biotechnology 37 (3): 255-265 (1992)). Known representatives producing L-tryptophan or

segregating strains of the genus Escherichia, in particular of the species Escherichia coli, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example:

Escherichia coli JP4735 / pMU3028 (US5,756,345)

Escherichia coli JP6015 / pMU91 (US5,756,345)

Escherichia coli SV164 (pGH5)

 (WO94 / 08031) - E. coli AGX17 (pGX44) (NRRL B-12263) (US 4,371,614)

E. coli AGX6 (pGX50) aroP (NRRL B-12264) (US 4,371,614)

Escherichia coli AGX17 / pGX50, pACKG4-pps (WO97 / 08333)

Escherichia coli ATCC 31743

 (CA1182409) - E. coli C534 / pD2310, pDM136 (ATCC 39795) (WO87 / 01130)

Escherichia coli JB102 / p5LRPS2 (US Pat. No. 5,939,295).

Known representative L-Homoserin producing or

segregating strains of the genus Escherichia, in particular of the species Escherichia coli, which can serve as a starting strain for the transhydrogenase overexpressing microorganisms according to the invention, is, for example:

 Escherichia coli NZ10rhtA23 / pAL4 (US

6, 960, 455).

Known representatives producing L-lysine or

segregating strains of the genus Escherichia, in particular of the species Escherichia coli, which can serve as starting strain for the transhydrogenase overexpressing microorganisms according to the invention, are, for example: Escherichia coli pDA1 / TOC21R (= CNCM 1-167) (FR-A-2511032),

Escherichia coli NRRL B-12199 (US4,346,170)

Escherichia coli NRRL B-12185 (US4,346,170). A detailed list with details of which

 Amino acid exchanges in the aspartate kinase III protein of Escherichia coli lead to a desensitization to the inhibition by L-lysine is contained in, inter alia, EP 0 834 559 A1 on page 3 (lines 29 to 41).

An aspartkinase variant which is preferred is preferred

Position 323 of the amino acid sequence L-aspartic acid

instead of glycine and / or at position 318 contains L-isoleucine instead of L-methionine.

Known representative L-valine producing or

segregating strains of the genus Escherichia, in particular of the species Escherichia coli, which can serve as a starting strain for the transhydrogenase overexpressing microorganisms according to the invention, is, for example:

Escherichia coli AJ11502 (NRRL B-12288) (US-A-4391907).

Under a polypeptide with the activity of a

Transhydrogenase is an enzyme capable of converting NADH to NADPH and vice versa, i. E. Under the term "transhydrogenase" is part of the

present invention a

 Nicotinamide dinucleotide transhydrogenase to understand.

In the public databases, such as the database UniProtKB (Universal Protein Resource

Knowledgebase), transhydrogenases of various organisms are described. The database UniProtKB is maintained by the UniProt consortium, which is the European Bioinformatics Institute (EBI, Wellcome Trust, Hinxton Cambridge, United Kingdom), the Swiss Institute of

Bioinformatics (SIB, Center Medical Universitaire, Geneva, Switzerland) and the Protein Information Resource (PIR,

Georgetown University, Washington, DC, US).

The genes for a transhydrogenase can be extracted from the

Organisms can be isolated using the polymerase chain reaction (PCR) using suitable primers.

Guides can be found in the laboratory manual "PCR" by Newton and Graham (Spektrum Akademischer Verlag,

 Heidelberg, Germany, 1994) and in WO 2006/100211 on pages 14 to 17.

For the measures of the invention are preferably used for the transhydrogenase from Corynebacteria encoding genes. Particular preference is given to using genes which code for polypeptides having a transhydrogenase activity whose amino acid sequence is> (at least) ^ 80%,> 90%,> 92%,> 94%,> 96%,> 97%,> 98% 99% identical to the amino acid sequence selected from SEQ ID NO: 2. During the investigations leading to the present invention, the transhydrogenase-encoding polynucleotide of Corynebacterium glutamicum was identified.

The sequence of the gene is deposited under Seq ID No .1.

A gene is chemically a polynucleotide. One

Polynucleotide encoding a protein / polypeptide is used synonymously with the term "gene".

In a preferred embodiment of the method according to the invention or of the microorganism according to the invention, the latter overexpresses a gene coding for a polypeptide selected from the following i) to vi): i) a polypeptide consisting of or containing the amino acid sequence shown in SEQ ID NO: 2; ii) a polypeptide having an amino acid sequence which is at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of i), ie wherein at least 80%, at least 85% %, at least 90%, at least 95%, at least 98% or at least 99% of the amino acid positions are identical to those of SEQ ID NO: 2; iii) a polypeptide as described under i) or ii), wherein the polypeptide has the activity of a transhydrogenase; iv) a polypeptide having an amino acid sequence containing a deletion, substitution, insertion and / or addition of 1 to 90, 1 to 45, 1 to 23, 1 to 12, 1 to 6

Having amino acid residues with respect to the amino acid sequence shown in SEQ ID NO: 2; v) a polypeptide as described under iv), wherein the polypeptide has the activity of a transhydrogenase; vi) a polypeptide as described under v), wherein the polypeptide has the activity of a transhydrogenase and the deletion, substitution, insertion and / or addition of amino acid residues does not substantially affect the activity;

The percent identity is preferably calculated over the entire length of the amino acid or nucleic acid region. A set of programs on one

 Variety of algorithms are available to those skilled in the sequence comparison available. In this context, the algorithms of Needleman and Wunsch or Smith and Waterman give particularly reliable results. For the alignment of the sequences are the program PileUp (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit

[Needleman and Wunsch (J. Mol. Biol. 48: 443-453 (1970)) and Smith and Waterman (Adv. Appl. Math. 2: 482-489

(1981))], which belong to the software package GCG [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)]. The above listed

Sequence identity percentages are preferably used with the GAP program over the entire sequence region

calculated.

Optionally, conservative amino acid substitutions are preferred. The aromatic amino acids are called conservative exchanges when phenylalanine, tryptophan and tyrosine are interchanged. The hydrophobic amino acids are called conservative ones

Replace when leucine, isoleucine and valine are exchanged. The polar amino acids are called conservative exchanges when glutamine and

Asparagin be exchanged for each other. The basic amino acids are called conservative ones

Replace when arginine, lysine and histidine are exchanged. The acidic amino acids are called conservative exchanges when aspartic acid and glutamic acid are exchanged. The hydroxyl group-containing amino acids are called conservative substitutions when serine and threonine

be exchanged for each other.

Particularly preferred embodiments of the method according to the invention therefore relate to the fermentative production of L-lysine or L-methionine using a

Microorganism of the genus Corynebacterium or

Escherichia, characterized in that one carries out the following steps

Fermentation of an organic-chemical

 A compound-producing microorganism, wherein in the microorganism, a polynucleotide is overexpressed, wherein the polynucleotide for a polypeptide according to SEQ ID NO: 2

including 1 to 12, 1 to 6 encoded deletions, substitutions, insertions and / or additions, and wherein the fermentation in a Fermentation medium to form a

 Fermentation broth expires; b) enriching the organic chemical compound in the fermentation broth from a).

Particularly preferred embodiments of the method according to the invention further relate to the fermentative production of L-lysine or L-methionine using a

Microorganism of the genus Corynebacterium or

Escherichia, characterized in that one carries out the following steps a) fermentation of an organic chemical

 A compound-producing microorganism, wherein in the microorganism, a polynucleotide is overexpressed, wherein the polynucleotide for a polypeptide according to SEQ ID NO: 2 including 1 to 12, 1 to 6 deletions, substitutions, insertions and / or

 Encodes additions,

 wherein the polypeptide has the activity of a

 Transhydrogenase and wherein the fermentation in a fermentation medium to form a

 Fermentation broth expires; b) enriching the organic chemical compound in the fermentation broth from a).

Furthermore, polynucleotides can be used which hybridize with the nucleotide sequence which is complementary to SEQ ID NO: 1, preferably the coding region of SEQ ID NO: 1, under stringent conditions and encode a polypeptide which has the activity of a transhydrogenase.

Instructions for hybridization of nucleic acids

or polynucleotides, the skilled person finds, inter alia, in the manual "The DIG System Users Guide for Filter Hybridization "the company Boehringer Mannheim GmbH

(Mannheim, Germany, 1993) and Liebl et al.

(International Journal of Systematic Bacteriology 41: 255-260 (1991)). Hybridization takes place under stringent conditions, that is, only hybrids become

formed in which the probe i. a polynucleotide comprising the nucleotide sequence complementary to SEQ ID NO: 1, preferably the coding region of SEQ ID NO: 1, and the target sequence, d. H. those treated with the probe

or identified polynucleotides, at least 80% are identical. It is known that the stringency of hybridization including the washing steps by

Varying the buffer composition, the temperature and the salt concentration is influenced or determined. The

Hybridization reaction is generally performed at relatively low stringency as compared to the washing steps (Hybaid Hybridization Guide, Hybaid Limited, Teddington, UK, 1996).

For the hybridization reaction, for example, a buffer corresponding to 5x SSC buffer at a temperature of about 50 ° C - 68 ° C can be used. In this case, probes can also hybridize with polynucleotides which have less than 70% identity to the nucleotide sequence of the probe used. Such hybrids are less stable and are removed by washing under stringent conditions. This can be achieved, for example, by lowering the salt concentration to 2 × SSC or 1 × SSC and, if appropriate, subsequently 0.5 × SSC (The DIG System User ^'s Guide for Filter Hybridization, Boehringer Mannheim, Mannheim, Germany, 1995), a temperature of approx. 50 ° C - 68 ° C, about 52 ° C

54 ° C - 68 ° C, about 56 ° C - 68 ° C, about 58 ° C - 68 ° C, about 60 ° C - 68 ° C, about 62 ° C - 68 ° C, about 64 ° C - 68 ° C, about 66 ° C

- 68 ° C is set. Temperature ranges of about 64 ° C - 68 ° C or about 66 ° C - 68 ° C are preferred. It is

optionally possible to lower the salt concentration to a concentration corresponding to 0.2x SSC or 0.1x SSC. Optionally, it contains the SSC buffer Sodium dodecyl sulfate (SDS) at a concentration of 0.1%. By gradually increasing the hybridization temperature in steps of about 1 - 2 ° C from 50 ° C to 68 ° C can

Polynucleotide fragments are isolated which have at least 80%, at least 90%, at least 92%, at least 94%, at least 96%, at least 97%, at least 98% or at least 99%, optionally 100% identity to the sequence or complementary sequence of the probe used and for polypeptide which has the activity of a

Transhydrogenase encode. Further instructions for hybridization are available in the form of so-called kits (e.g., DIG Easy Hyb from Roche

Diagnostics GmbH, Mannheim, Germany, Catalog No.

1603558). For the measures of the invention is a for a

 Transhydrogenase encoding gene in a desired amino acid (s) producing microorganism or parent or parent strain overexpressed.

Overexpression is generally understood as an increase in the intracellular concentration or activity of a patient

Ribonucleic acid, a protein (polypeptide) or an enzyme compared to the parent strain (parent strain) or wild-type strain, if this is the parent strain. A parent strain is the strain on which the overexpression was performed.

In overexpression, the methods of

recombinant overexpression is preferred. These are all methods in which a microorganism is prepared using a DNA molecule provided in vitro. Such DNA molecules include, for example, promoters, expression cassettes, genes, alleles, coding regions, etc .. These are by methods of transformation, conjugation, transduction or

similar methods in the desired microorganism transferred. By the measures of overexpression, the activity (total activity in the cell) or concentration of the corresponding polypeptide is generally increased by at least 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%. or 500%, preferably at most up to 1000%, 2000%, 4000%, 10000% or 20,000%, based on the activity or concentration of the polypeptide in the strain prior to the measure leading to overexpression.

To achieve overexpression, a variety of methods are available in the prior art. These include increasing the copy number and modifying the nucleotide sequences that control the expression of the gene. The transcription of a gene is controlled inter alia by the promoter and optionally by proteins that suppress transcription

 (Repressor proteins) or promote (activator proteins). The translation of the RNA formed will inter alia

controlled by the ribosome binding site and the start codon. Polynucleotides or DNA molecules which contain a promoter and a ribosome binding site and

optionally comprising a start codon are also referred to as expression cassette.

The increase in copy number can be made by plasmids that replicate in the cytoplasm of the microorganism. For this purpose, a wealth of plasmids for the most diverse groups of microorganisms are described in the prior art, with which one can set the desired increase in the copy number of the gene. Suitable plasmids for the genus Escherichia are described, for example, in the handbook Molecular

Biology, Labfax (Ed .: T.A. Brown, Bios Scientific, Oxford, UK, 1991). Suitable plasmids for the genus Corynebacterium are described, for example, in Tauch et al.

(Journal of Biotechnology 104 (1-3), 27-40, (2003)), or in Stansen et al. (Applied and Environmental Microbiology 71, 5920-5928 (2005)). The increase in the number of copies by at least one (1) copy can continue by inserting more copies in the

Chromosome of the microorganism done. Suitable methods for the genus Corynebacterium are described for example in the patent WO 03/014330, WO 03/040373 and WO 04/069996. Examples of suitable methods for the genus Escherichia are the incorporation of a gene copy into the site of the phage (Yu and Court, Gene 223, 77-81 (1998)), the chromosomal amplification with the aid of the phage Mu, as described in EP 0 332 448, or Hamilton et al. (Journal of Bacteriology 174, 4617-4622 (1989)) or Link et al. (Journal of Bacteriology 179, 6228-6237 (1997)) methods of gene replacement using

conditionally replicating plasmids. The increase in gene expression can continue through

 Use of a strong promoter can be achieved, which is functionally linked to the gene to be expressed. Preferably, a promoter is used which is stronger than the natural, d. H. the promoter present in the wild type or parent strain. For this purpose, a wealth of methods are available in the prior art.

In this context, a "functional link" is understood to mean the sequential arrangement of a

Promoter with a gene that leads to the expression of the gene and its control.

Suitable promoters for the genus Corynebacterium can be found inter alia in Morinaga et al. (Journal of

Biotechnology 5, 305-312, (1987)), in the patents EP 0 629 699 A2, US 2007/0259408 Al, WO 2006/069711, EP 1 881 076 Al and EP 1 918 378 Al and in summary representations such as " Handbook of Corynebacterium

glutamicum "(Eds .: Lothar Eggeling and Michael Bott, CRC Press, Boca Raton, US (2005)) or the book

"Corynebacteria, Genomics and Molecular Biology"

(Ed.: Andreas Burkovski, Caister Academic Press, Norfolk, UK (2008)). Applicable promoters are also shown in FIG Review article by Patek et al. (Journal of

Biotechnology 104 (1-3), 311-323 (2003)). In the same way, the methods described by Vasicova et al. (Journal of Bacteriology 181, 6188-6191 (1999)) variants of the dapA promoter, for example, the promoter A25 can be used. Furthermore, the gap promoter of Corynebacterium glutamicum (EP 06007373, EP 2386650) or variants of the gap promoter (WO 2013000827) can be used. Finally, the well-known Amann et al. (Gene 69 (2), 301-315 (1988)) and Amann and Brosius (Gene 40 (2-3), 183-190 (1985))

Promoters T3, T7, SP6, M13, lac, tac and trc are used. Examples of promoters which permit controlled, that is to say inducible or repressible expression are described, for example, in Tsuchiya and Morinaga (Bio / Technology 6, 428-430 (1988)).

Such promoters or expression cassettes are typically employed at intervals of 1 to 1000, preferably 1 to 500, nucleotides upstream of the first nucleotide of the start codon of the coding region of the gene.

It is also possible to position several promoters in front of the desired gene or to link them functionally with the gene to be expressed and in this way to achieve increased expression. Examples of this are described in the patent WO 2006/069711.

The structure of promoters of Escherichia coli is well known. It is therefore possible to alter the strength of a promoter by modifying its sequence by means of one or more exchanges and / or one or more

Insertion (s) and / or one or more deletions of nucleotides. Examples of this can be found, inter alia, in "Herder Encyclopedia of Biology" (Spektrum

Academic Publishing House, Heidelberg, Germany (1994)).

Examples of the change of promoters to increase expression in coryneform bacteria can be found in US Pat US 6,962,805 B2 and in a publication by Vasicova et al. (Bacteriol 1999 Oct; 181 (19): 6188-91.) · The

 Reinforcement of one target gene by adding or replacing a homologous promoter can be found, for example, in EP 1 697 526 B1.

The structure of the ribosome binding site Corynebacterium glutamicum is also well known and is described, for example, in Amador (Microbiology 145, 915-924 (1999)) and in handbooks and textbooks of genetics, such as "genes and

Klone "(Winnacker, Verlag Chemie, Weinheim, Germany (1990)) or" Molecular Genetics of Bacteria "(Dale and Park, Wiley and Sons Ltd., Chichester, UK (2004)).

described.

It is also for overexpression

possible to increase the expression of activator proteins or to reduce or eliminate the expression of repressor proteins.

The said measures for overexpression can be suitably combined with each other. For example, the use of a suitable

 Expression cassette with the increase in copy number and preferably the use of a suitable promoter with the increase in copy number can be combined.

Guidance on handling DNA, digestion and ligation of DNA, transformation and selection of transformants can be found, inter alia, in the well-known Sambrook et al. "Molecular Cloning: A Laboratory Manual, Second Edition (Cold Spring Harbor Laboratory Press, 1989).

The extent of expression or overexpression can be determined by measuring the amount of mRNA transcribed from the gene, by determining the amount of the polypeptide and by determining the enzyme activity.

For the determination of the amount of mRNA, among others, the method of "Northern Blotting's" and the quantitative RT-PCR can be used. In quantitative RT-PCR, the polymerase chain reaction is preceded by reverse transcription. For this purpose, the LightCycler ™ system from Roche Diagnostics (Boehringer Mannheim GmbH, Roche Molecular Biochemicals, Mannheim, Germany) can be used, as described, for example, in Jungwirth et al. (FEMS Microbiology Letters 281, 190-197 (2008)). The concentration of the protein can be over 1- and 2-dimensional protein gel separation and subsequent optical

Identification of the protein concentration with appropriate evaluation software to be determined in the gel. A common method for preparing the protein gels in coryneform bacteria and for identifying the proteins is that described by Hermann et al. (Electrophoresis, 22: 1712-23 (2001)). Protein concentration can also be assessed by Western blot hybridization with an antibody specific for the protein to be detected

(Sambrook et al, Molecular cloning: a. Laboratory manual 2 ^nd Ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989..) And subsequent optical evaluation using appropriate concentration determination software (Lohaus and Meyer (1998) biospectrum 5: 32-39; Lottspeich, Angewandte Chemie 321: 2630-2647 (1999)).

The method according to the invention, or the microorganisms according to the invention can / can continuously - as

for example, in WO 05/021772 described or discontinuously in the batch process (sentence cultivation or set method) or in the fed batch (feed process) or repeated fed batch process (repetitive

 Feed process) are operated / cultured for the purpose of producing the desired organic chemical compound. A general summary of known cultivation methods is in the textbook by Chmiel

(Bioprocessing Technology 1. Introduction to the

Biochemical Engineering (Gustav Fischer Verlag, Stuttgart, 1991)) or in the textbook by Storhas (bioreactors and peripheral facilities (Vieweg Verlag,

Braunschweig / Wiesbaden, 1994)).

The culture medium to be used or

Fermentation medium must suitably meet the requirements of the respective strains. Descriptions of

 Culture media of various microorganisms are included in the Manual of Methods for General Bacteriology of the American Society for Bacteriology (Washington D.C., USA, 1981). The terms culture medium and

Fermentation medium or medium are mutually exchangeable.

No special medium is required to practice the present invention.

As the carbon source, sugars and carbohydrates such as e.g. Glucose, sucrose, lactose, fructose, maltose,

Molasses, sucrose-containing solutions from sugar beet or cane ^¬ processing, starch, starch and cellulose, oils and fats, such as soybean oil,

Sunflower oil, peanut oil and coconut fat, fatty acids such as palmitic acid, stearic acid and linoleic acid,

 Alcohols such as glycerin, methanol and ethanol and organic acids such as acetic acid or lactic acid can be used.

As the nitrogen source, organic nitrogen-containing compounds such as peptones, yeast extract, meat extract,

Malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulphate,

Ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate can be used. The nitrogen sources can be used singly or as a mixture.

As phosphorus source can phosphoric acid,

Potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. The culture medium must further contain salts, for example, in the form of chlorides or sulfates of metals such as sodium, potassium, magnesium, calcium and iron, such as magnesium sulfate or ferric sulfate, necessary for growth. Finally, essential growth substances such as amino acids such as homoserine and vitamins such as thiamine, biotin or pantothenic acid in addition to the above substances can be used.

The said feedstocks may be added to the culture in the form of a one-time batch or fed in a suitable manner during the cultivation.

For pH control of the culture, basic compounds such as sodium hydroxide, potassium hydroxide, ammonia

or ammonia water or acidic compounds such as phosphoric acid or sulfuric acid used in a suitable manner. The pH is generally adjusted to a value of 6.0 to 8.5, preferably 6.5 to 8. to

Foam control can be used with antifoams, such as fatty acid polyglycol esters. In order to maintain the stability of plasmids, suitable, selectively acting substances, such as antibiotics, may be added to the medium. The

Fermentation is preferably carried out under aerobic conditions. To uphold this, will be

Oxygen or oxygen-containing gas mixtures, such as

Example air entered into the culture. The use of liquids enriched with hydrogen peroxide is also possible. If necessary, the

Fermentation at overpressure, for example at a

Overpressure of 0.03 to 0.2 MPa, driven. The temperature of the culture is usually from 20 ° C to 45 ° C and preferably from 25 ° C to 40 ° C, more preferably from 30 ° to 37 ° C. In batch process is the cultivation

preferably continued until one for the

Measure of obtaining the desired organic chemical compound sufficient amount, has formed. This goal will normally be within 10 hours to 160 hours reached. In continuous processes are longer

Cultivation times possible. Through the activity of

Microorganisms accumulate

(Accumulation) of the organic chemical compound in the

Fermentation medium and / or in the cells of

Microorganisms.

Examples of suitable fermentation media can be found inter alia in the patents 5,770,409, US

5,990,350, US 5,275,940, WO 2007/012078, US 5,827,698, WO 2009/043803, US 5,756,345 or US 7,138,266.

The analysis of L-amino acids for the determination of

Concentration at one or more times in the

Course of the fermentation can be carried out by separation of the L-amino acids by means of ion exchange chromatography

preferably cation exchange chromatography with

subsequent post-column derivatization using ninhydrin, as described by Spackman et al.

(Analytical Chemistry 30: 1190-1206 (1958)). Instead of ninhydrin and ortho-Phtadialdehyd can be used for Nachsäulenderivatisierung. a

 Review articles on ion exchange chromatography can be found in Pickering (LC-GC (Magazine of Chromatography Science) 7 (6), 484-487 (1989)).

It is likewise possible to carry out a pre-column derivatization using, for example, ortho-phtadialdehyde or phenylisothiocyanate and to separate the resulting amino acid derivatives by reversed-phase chromatography (RP), preferably in the form of high-performance liquid chromatography (HPLC). Such a method is described, for example, in Lindroth et al. (Analytical

Chemistry 51: 1167-1174 (1979)).

The detection is carried out photometrically (absorption,

Fluorescence).

A summary of the amino acid analysis can be found in the textbook "Bioanalytik" of Lottspeich and Zorbas (Spektrum Akademischer Verlag,

Heidelberg, Germany 1998).

The analysis of keto acids such as KIC to determine the concentration at one or more times in the

Course of the fermentation can be achieved by separation of the keto acids and other excretion products

Ion exchange chromatography, preferably

Cation Exchange Chromatography on a Sulfonated Styrene-Divinylbenzene Polymer in the H + form, e.g.

by means of 0.025 N sulfuric acid followed by UV

Detection at 215nm (alternatively at 230 or 275 nm) done. Preferably, a REZEX RFQ Fast Fruit H + column (Phenomenex) may be used, other suppliers for the separation phase (e.g., Aminex from BioRad) are possible. Analogous separations are in corresponding

 Application examples of suppliers described.

The performance of the method or

Fermentation processes relating to one or more of the parameters selected from the group of concentration

(compound formed per volume), the yield (compound formed per carbon source consumed),

Formation (compound formed per volume and time) and specific formation (compound formed per

Cell dry mass or dry biomass and time or

compound formed per cell protein and time) or other process parameters and combinations thereof is increased by at least 0.5%, at least 1%, at least 1.5% or at least 2%, based on method or

Fermentation processes with microorganisms in which the activity of a transhydrogenase is increased.

By the measures of the fermentation one receives one

Fermentation broth containing the desired organic

chemical compound, preferably L-amino acid. This is followed by the provision or production or production of a product containing the organic chemical compound in liquid or solid form.

A fermentation broth is understood to mean a

Fermentation medium or nutrient medium in which a

 Microorganism for a while and at one

was cultivated at a certain temperature. The

Fermentation medium or during the

Fermentation used media contains / contain

all substances or components which ensure production of the desired compound and typically proliferation or viability.

At the conclusion of the fermentation, the resulting fermentation broth contains accordingly a) due to the proliferation of the cells of the

 Microorganism produced biomass (cell mass) of the

Microorganism, b) the desired organic chemical compound formed during the fermentation, c) the organic by-products formed during the fermentation, and d) those not consumed by the fermentation

Components of the fermentation medium used

or the starting materials such as

Vitamins such as biotin or salts such as magnesium sulfate.

The organic by-products include substances produced by the microorganisms used in the fermentation in addition to the respective desired compound and

optionally excreted. These include sugars such as trehalose.

The fermentation broth is removed from the culture vessel or the fermentation container, optionally collected, and used to a organic chemical Compound-containing product, preferably to provide an L-amino acid-containing product in liquid or solid form. For this purpose, the term "recovery of the L-amino acid-containing product" is used

 The simplest case is the fermentation tank

 withdrawn L-amino acid-containing fermentation broth itself is the recovered product.

By one or more of the measures selected from the group a $ 0 partially (> 0% to <80%) to complete (100%) or almost complete (> 80%,> 90%,> 95%,> 96%,> 97 %,> 98%,> 99%) removal of water, b) partial (> 0% to <80%) to complete (100%) or almost complete (> 80%,> 90%,> 95%,> 96 %,>

15 97%,> 98%, ^ 99%) removal of the biomass, optionally inactivating it before removal, c) partially (> 0% to <80%) to complete (100%) or almost complete (> 80%) ,> 90%,> 95%,> 96%,> 97%,> 98%,> 99%,> 99.3%,> 99.7%) Removal of im

20 during the fermentation formed organic

 By-products, and d) partially (> 0%) to complete (100%) or almost complete (> 80%,> 90%,> 95%,> 96%,> 97%,> 98%,> 99%,> 99.3%,> 99.7%) Removal by the

 25 fermentation unused constituents of the

 used fermentation medium or the starting materials, from the fermentation broth to achieve a concentration or purification of the desired organic chemical

30 connection. In this way, products are isolated which have a desired content of the compound. The partial (> 0% to <80%) to complete (100%) or nearly complete 80% to <100%) removal of the

Water (measure a)) is also referred to as drying.

In a variant of the method, one can go through

complete or near complete removal of the

 Water, biomass, organic by-products and unused components of the used

Fermentation medium to give pure ((> 80 wt .-%,> 90 wt .-%) or high purity (> 95 wt .-%,> 97 wt .-%,> 99% wt .-%) product forms of the desired organic For the measures according to a), b), c) or d) a wealth of technical instructions are available in the prior art.

In processes for producing organic acids or L-valine, L-leucine and L-isoleucine using bacteria of the genus Corynebacterium, such

Preferred are methods in which products are obtained which do not contain any constituents of the fermentation broth. These are used in particular in human medicine, in the pharmaceutical industry and in the food industry.

In the case of the amino acid L-lysine, essentially four different product forms are known in the prior art.

A group of L-lysine containing products

concentrated, aqueous, alkaline solutions of

purified L-lysine (EP-B-0534865). Another group, as described, for example, in US Pat. Nos. 6,340,486 and 6,465,025, comprises aqueous, acidic, biomass-containing concentrates of L-lysine-containing fermentation broths. The most common group of solid products comprises powdered or crystalline forms of purified or pure L-lysine, which is typically in the form of a salt such as L-lysine monohydrochloride. Another group of solid product forms is described for example in EP-B-0533039. The one described there In addition to L-lysine, the product form contains most of the starting materials used and not consumed during the fermentative production and, if appropriate, the biomass of the microorganism used with a proportion of> 0% to 100%.

According to the different product forms one knows most diverse procedures, with which from the

Fermentation broth the L-lysine-containing product or the purified L-lysine is produced. For the production of solid, pure L-lysine in the

Substantial methods of ion exchange chromatography, where appropriate, using activated carbon and methods of crystallization applied. In this way, the corresponding base or a corresponding salt is obtained, for example the monohydrochloride (Lys-HCl) or the lysine sulfate (Lys ₂ -H ₂ S0 ₄ ).

EP-B-0534865 discloses a process for preparing aqueous, basic L-lysine-containing solutions

Fermentation broths described. In the process described there, the biomass is separated from the fermentation broth and discarded. By means of a base like

For example, sodium, potassium or ammonium hydroxide, a pH between 9 to 11 is set. The

Mineral constituents (inorganic salts) are separated from the broth after concentration and cooling by crystallization and either used as fertilizer or discarded.

In processes for producing lysine using bacteria of the genus Corynebacterium, preference is given to those processes which yield products which contain constituents of the fermentation broth. These are used in particular as animal feed additives.

Depending on the requirement, the biomass may be wholly or partly by separation methods such as centrifugation, filtration, decantation or a combination thereof removed from the fermentation broth or left completely in it. If necessary, the biomass

or the biomass-containing fermentation broth during a suitable process step inactivated, for example, by thermal treatment (heating) or by acid addition.

In one procedure, the biomass is completely or almost completely removed so that no (0%) or at most 30%, at most 20%, at most 10%, at most 5%, at most 1% or at most 0.1% biomass remains in the product produced. In a further procedure, the biomass is not removed or only in minor proportions, so that all (100%) or more than 70%, 80%, 90%, 95%, 99% or 99.9% biomass remains in the product produced. Accordingly, in a method according to the invention, the biomass is removed in proportions of> 0% to - 100%.

Finally, the obtained after fermentation

Fermentation broth before or after the complete or partial removal of the biomass with an inorganic acid such as hydrochloric acid, sulfuric acid or phosphoric acid or organic acid such as propionic acid are adjusted to an acidic pH (GB 1,439,728 or EP 1 331 220). It is also possible, the fermentation broth with the complete

acidify contained biomass. Finally, the broth can also be prepared by adding sodium bisulfite (NaHSC> 3, GB

1,439,728) or another salt, for example ammonium, alkali metal or alkaline earth metal salt of sulfurous acid

be stabilized.

In the separation of the biomass optionally contained in the fermentation broth or organic

inorganic solids partially or completely removed. The dissolved in the fermentation broth organic

By-products and dissolved unused

Components of the fermentation medium (starting materials) stay at least partially (> 0%), preferably too

at least 25%, more preferably at least 50%, and most preferably at least 75% in the product.

Optionally, these also remain complete (100%) or nearly complete, that is> 95% or> 98% or greater than 99%, in the product. Contains a product in this sense

at least part of the components of the

Fermentation broth, this is also described by the term "fermentation broth-based product." The broth is then treated by known methods, such as by means of a rotary evaporator,

Thin-film evaporator, falling film evaporator, by

Reverse osmosis or by nanofiltration water extracted or thickened or concentrated. These

Concentrated fermentation broth may then be prepared by freeze-drying, spray-drying, spray granulation or other methods such as, for example, in the circulating fluidized bed

PCT / EP2004 / 006655, be worked up into free-flowing products, in particular to a finely divided powder or preferably coarse-grained granules. Optionally, from the resulting granules by sieving or

Dust separation a desired product isolated.

It is also possible to add the fermentation broth directly, i. H. without prior concentration by spray drying or spray granulation, to dry.

The term "free-flowing" refers to powders that consist of a series of glass discharge vessels of different sizes

Outlet openings leak at least from the vessel with the opening 5 mm (millimeters) unhindered (small: soaps, oils, fats, waxes 94, 12 (1968)).

By "finely divided" is a powder with a predominant proportion (> 50%) of a particle size of 20 to 200 pm diameter

meant . By "coarse grained" is a product with a predominant proportion (> 50%) of a particle size of 200 to 2000 pm

Meant diameter.

The particle size can be determined by methods of

Laser diffraction spectrometry are performed. The

appropriate methods are in the textbook for

 "Particle Size Measurement in Laboratory Practice" by R. H. Müller and R. Schuhmann, Wissenschaftliche Verlagsgesellschaft Stuttgart (1996) or in the textbook "Introduction to Particle Technology" by M. Rhodes, published by Wiley & Sons (1998).

The free-flowing, finely divided powder, in turn, by suitable compacting or granulation process in a coarse-grained, free-flowing, storable and

largely dust-free product to be transferred.

The term "dust-free" means that the product only small proportions (<5%) of particle sizes below 100 pm

Diameter contains.

"Storable", for the purposes of this invention, means a

Product which can be stored in a dry and cool environment for at least one (1) year or more, preferably at least 1.5 years or more, more preferably two (2) years or more, without substantial loss (maximum 5%) of the product respective amino acid occurs. Another object of the invention is a method which in its basic features in WO 2007/042363 AI

is described. For this purpose, using the

According to the invention obtained fermentation broth, from which the biomass was optionally completely or partially separated, carried out a process comprising the following steps: a) the pH by addition of sulfuric acid to 4.0 to 5.2, in particular 4.9 to 5, 1, and a molar sulfate / L-lysine ratio of 0.85 to 1.2, preferably 0.9 to 1.0, particularly preferably> 0.9 to <0.95, in the broth, optionally by adding a further or more sulfate-containing compound (s) and b) the resulting mixture by removal of water

concentrated and optionally granulated, wherein if appropriate before step a) one or both of the following measures is / are carried out: c) measurement of the molar ratio of sulfate / L-lysine to determine the required amount of sulfate-containing compound (s) d) additive a sulfate-containing compound selected from the group of ammonium sulfate, ammonium bisulfate and

Sulfuric acid in appropriate proportions.

Optionally, before step b), a salt of the sulfurous acid, preferably alkali metal hydrogen sulfite,

particularly preferably sodium hydrogen sulfite in one

Concentration of 0.01 to 0.5 wt .-%, preferably 0.1 to 0.3 wt .-%, particularly preferably 0.1 to 0.2 wt .-% based on the fermentation broth added. Preferred sulfate-containing compounds in the sense of the abovementioned process steps are in particular

Ammonium sulfate and / or ammonium hydrogen sulfate or corresponding mixtures of ammonia and sulfuric acid and sulfuric acid itself. The molar sulfate / L-lysine ratio V is calculated according to the

Formula: V = 2 x [S0 ₄ ^{2 ~} ] / [L-lysine] calculated. This formula takes into account the fact that the S0 ₄ ^{2 ~} anion or the sulfuric acid is divalent. A ratio V = 1

means that a stoichiometrically composed Lys ₂ - H ₂ S0 ₄ ) is present, while at a ratio of V = 0.9 a 10% sulfate deficiency and at a ratio of V = 1.1 a 10% sulfate excess is found. The advantage of granulation or compacting is the use of customary organic or inorganic

Excipients, or carriers such as starch, gelatin, cellulose derivatives or similar substances, such as

commonly used in food or feed processing as binding, gelling, or thickening agents, or of other materials such as, for example

Silicas, silicates (EP0743016A) and stearates.

Furthermore, it is advantageous to treat the surface of the resulting granules with oils or fats as described in WO 04/054381. As oils can

Mineral oils, vegetable oils or mixtures of vegetable oils. Examples of such oils are soybean oil, olive oil, so aöl / Lecithingemische. In the same way, silicone oils, polyethylene glycols or

 Hydroxyethylcellulose suitable. The treatment of the surfaces with the oils mentioned achieves an increased abrasion resistance of the product and a reduction in the dust content. The content of oil in the product is 0.02 to 2.0 wt .-%, preferably 0.02 to 1.0 wt .-%, and completely

particularly preferably 0.2 to 1.0 wt .-% based on the total amount of the feed additive.

Preference is given to products with a proportion of> 97 wt .-% of a particle size of 100 to 1800 pm or a proportion of> 95 wt .-% of a particle size of 300 to 1800 pm diameter. The proportion of dust, d. H. Particles with a particle size <100 pm, is preferably> 0 to 1 wt .-%, more preferably at most 0.5 wt .-%.

Alternatively, however, the product can also be applied to a conventional and customary organic or inorganic carrier in animal feed processing, such as, for example

Silicas, silicates, grits, bran, flours, starches, sugars or other grown up and / or with usual

Thickening or binding agents are mixed and stabilized. Application examples and methods for this are in of the literature (The Mill + Mischfuttertechnik 132 (1995) 49, page 817).

Finally, the product can also be through

 Coating with film formers such as metal carbonates, silicas, silicates, alginates, stearates, starches, gums and cellulose ethers, as described in DE-C-4100920, be brought into a state in which it is stable to the digestion by Animal stomachs, especially the stomach of ruminants, is.

To set a desired L-lysine concentration in the product, depending on the requirements, the L-lysine can be added during the process in the form of a concentrate or optionally a substantially pure substance or its salt in liquid or solid form.

These can be used individually or as mixtures with the resulting or concentrated fermentation broth, or else during the drying or granulation process,

to be added. Another object of the invention is a process for the preparation of a solid lysine-containing product, which is described in its basic features in US 20050220933. This is done using the invention

a fermentation broth is obtained, comprising the following steps: a) filtration of the fermentation broth, preferably with a membrane filter, so that a biomass-containing sludge and a filtrate are obtained, b) concentration of the filtrate, preferably such that a solids content of 48 to C) granulation of the concentrate obtained in step b), preferably at a temperature of 50 ° C to 62 ° C, and d) coating of the granules obtained in c) with one or more of the coating agents (coating agent (s))

The concentration of the filtrate in step b) can also be such that a solids content of 52 to 55 wt .-%, from 55 to 58 wt .-% or 58 to 61 wt .-%

is obtained.

For coating in step d) are preferred

Coating agent used, which are selected from the group consisting of dl) of the biomass obtained in step a), d2) an L-lysine-containing compound, is preferred

selected from the group L-lysine hydrochloride or L-lysine sulfate, d3) a substantially L-lysine-free substance with L-lysine content <1 wt .-%, preferably <0.5 wt .-%, preferably selected from the group starch , Karageenan, Agar,

Silicas, silicates, shot, brans and flours, and d4) a water-repellent substance, preferably selected from the group of oils, polyethylene glycols and liquid

Paraffins.

By the measures according to the steps dl) to d4), in particular dl) to d3), the content of L-lysine is adjusted to a desired value.

In the preparation of L-lysine-containing products, the ratio of the ions is preferably adjusted so that the molar ion ratio according to the following formula

2x [S0 ₄ ^{2 ~} ] + [Cl ^~ ] - [NH ₄ ⁺ ] - [Na ⁺ ] - [K ⁺ ] -2x [Mg ²⁺ ] -2x [Ca ²⁺ ] / [L-Lys]

0.68 to 0.95, preferably 0.68 to 0.90, more preferably 0.68 to 0.86, as described by Kushiki et al. described in US 20030152633. In the case of L-lysine, the fermentation broth-based solid product thus prepared has a lysine content (as lysine base) of 10% to 70% by weight or 20% to 70% by weight, preferably 30% by weight .-% to 70 wt .-% and most preferably from 40 wt .-% to 70 wt .-% based on the dry mass of the product. Maximum contents

Lysine base of 71 wt .-%, 72 wt .-%, 73 wt .-% are

also possible.

The water content of the L-lysine-containing solid product is up to 5 wt .-%, preferably up to 4 wt .-%, and particularly preferably less than 3 wt .-%.

The strain DM1547 was deposited on January 16, 2001 with the German Collection of Microorganisms and Cell Cultures under the accession number DSM13994.

Description of the figures

Figure 1 shows plasmid pK18msb_Pg3_lpdA.

Figure 2 shows plasmid pZ8-l :: lpdA.

Examples

Example 1 :

The gene product of the lpdA gene (cg0790) from Corynebacterium glutamicum became as in the case of the LpdA protein

Mycobacterium tuberculosis (Argyrou et al., 2004) in a predominantly automatic genome annotation as possible

Dihydroliponamide dehydrogenase belonging to the flavoprotein disulfide reductase (FDR) family, whose members, despite their variety of catalyzed redox reactions have a generally high homology at the sequence and structural level to each other classified. By the

bioinformatic analysis of C. glutamicum LpdA with help the blastp function of the BLAST program (Basic Local

Alignment Search Tool), the homology of this protein to the already characterized LpdA from Mycobacterium tuberculosis and other flavoprotein disulfide reductases from C. glutamicum and various other organisms was determined.

Example 2:

Construction of the replacement vector pKl 8msb_Pg3_lpdA The nucleotide sequence of the genome of Corynebacterium

glutamicum ATCC13032 is available from Ikeda and Nakagawa (Applied Microbiology and Biotechnology 62, 99-109 (2003)), EP 1 108 790 and Kalinowski et al. (Journal of

Biotechnolgy 104 (1-3), (2003)). The nucleotide sequence of the genome of Corynebacterium

glutamicum is also in the National Center for Biotechnology Information (NCBI) database of the National Library of Medicine (Bethesda, MD, USA), in the DNA Data Bank of Japan (DDBJ, Mishima, Japan) or in the

Nucleotide sequence database available from the European Molecular Biology Laboratories (EMBL, Heidelberg, Germany and Cambridge, UK).

Starting from the genome sequence of Corynebacterium

glutamicum ATCC13032, a DNA fragment of approximately 1.7 kb was synthesized by GeneArt (Regensburg, Germany) (SEQ ID NO: 3) which, in addition to the Pgap3 promoter (DE102011118019.6), provided the flanking sequences for insertion of the Promoter before the native lpdA gene carries. The fragment was introduced via the terminal

Interfaces Xmal and XbaI cut by Xmal and XbaI cleavage and then in the also Xmal / XbaI - cut Schäfer et al. (Gene, 145, 69-73 (1994)), mobilizable vector pK18mobsacB. The plasmid is called pKl 8msb_Pg3_lpdA and is shown in FIG.

Example 3 Construction of the Vector pZ8-l_lpdA

The lpdA gene from C. glutamicum (cg0790) was amplified by means of two primers, by which the gene was provided upstream with an EcoRI and downstream with a Sall interface. Due to the sequence of the lpdA gene known for C. glutamicum, the following oligonucleotides were used as primers: lpdA_pZ8-l-1 (SEQ ID NO: 4):

5 ^" GGTGGTGAATTCAAAGGAGGACAACCATGGCAAAGAGGATCGTAAT 3 ^" lpdA_pZ8-l-2 (SEQ ID NO: 5):

5 ^" GGTGGTGTCGACTTAGCCTAGATCATCATGTT 3 ^"

The primers shown were synthesized by the company MWG Biotech (Ebersberg, Germany).

They allow the amplification of a 1448 bp DNA segment as shown in SEQ ID NO: 6. The PCR product was purified with the Nucleospin® Extract II Kit. The fragment was over the terminal

cut through EcoRI and Sali cleavage sites by EcoRI and Sali cleavage and then into the

also EcoRI / Sali-cut vector pZ8-l

E. coli DH5 / pZ8-l was obtained from Deutsche

Strain collection for microorganisms under the number DSM 4939 deposited) using T4 DNA ligase cloned. The

Plasmid is called pZ8-l :: lpdA and is shown in FIG. Example 4:

Preparation of strain DM1547_Pg3_lpdA

The mutation Pg3_lpdA is to be introduced into the strain Corynebacterium glutamicum DM1547. Strain DM1547 is an aminoethylcysteine-resistant mutant of

 Corynebacterium glutamicum ATCC13032. It is under the name DSM13994 on January 16, 2001 at the German

Collection of Microorganisms and Cell Cultures (DSMZ,

Braunschweig, Germany). The vector pKI 8msb_Pg3_lpdA described in Example 2 was analyzed by the electroporation method of Liebl et al. (FEMS Microbiological Letters, 53: 299-303 (1989))

Corynebacterium glutamicum DM1547 electroporated. The

Selection of plasmid-carrying cells was carried out by

Plating the Elektroporationsansat zes on LB agar

(Sambrook et al, Molecular cloning:... A laboratory manual 2 ^nd Ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), with the 25 mg / 1 kanamycin

Had been supplemented. The vector can not self-replicate in DM1547 and is retained in the cell only if it is integrated into the chromosome as a result of a recombination event. The selection of

Transcon gants, i. of clones with integrated

pKl 8msb_Pg3_lpdA was done by plating out the

Conjugation to LB agar supplemented with 25 mg / l kanamycin and 50 mg / l nalidixic acid.

Kanamycin-resistant transcon gants were then streaked on kanamycin (25 mg / l) supplemented LB agar plates and incubated for 24 hours at 33 ° C. For selection of mutants which had excised the plasmid as a result of a second recombination event, the clones were cultured unsupported in LB liquid medium for 30 hours, then streaked on LB agar supplemented with 10% sucrose and incubated for 24 hours Incubated at 33 ° C. The plasmid pKI 8msb_Pg3_lpdA contains as well as the

Starting plasmid pK18mobsacB next to the kanamycin resistance gene a copy of the levan sucrase from

Bacillus subtilis encoding sacB gene. The sucrose-inducible expression of the sacB gene results in the formation of levan sucrase, which catalyzes the synthesis of the C. glutamicum toxic product levan.

On sucrose-supplemented LB agar, therefore, only those clones grow in which the integrated pKI has excised 8msb_Pg3_lpdA as a consequence of a second recombination event. Depending on the location of the second

Recombination event with respect to the site of mutation takes place in the excision of Allelaustausch or the incorporation of the mutation or the original copy remains in the chromosome of the host.

Subsequently, a clone was searched in each case in which the desired exchange, d. H. the incorporation of the mutation

Pg3_lpdA was done.

For this purpose, 20 clones each with the phenotype "growth in the presence of sucrose" and "non-growth in the presence of kanamycin" were examined for integration of the mutation Pg3_lpdA using the polymerase chain reaction (PCR).

For this purpose, the following synthetic oligonucleotides were used

(Primer) uses: lpdA_l.p (SEQ ID NO: 8):

5 ^" AACACGTCCCAGGATCAATG 3 ^" lpdA_2.p (SEQ ID NO: 9):

5 ^" TTTCGCAAGGTCCTTCACAC 3 ^"

The primers shown were synthesized by the company MWG Biotech (Ebersberg, Germany). The PCR reactions were carried out with the Taq PCR Core Kit from Quiagen (Hilden,

Germany), containing the Taq DNA polymerase from Thermus aquaticus, in a Mastercycler Eppendorf (Hamburg, Germany). The conditions in the reaction mixture were according to the manufacturer

set. The PCR approach was first subjected to preliminary denaturation at 94 ° C for 2 minutes. This was followed 35 times by repetition of a denaturation step at 94 ° C for 30 seconds, a step of binding the primers to the DNA at 57 ° C for 30 seconds, and the extension step of extending the primers at 72 ° C for 60 seconds.

After the final extension step for 5 min at 72 ° C, the PCR was subjected to agarose gel electrophoresis (0.8% agarose). The identification of a DNA fragment of 1080 bp length indicates the integration of the promoter Pg3 before lpdA, whereas a DNA fragment of 591 bp length, the wild-type status of the

Indicating initial strain.

In this way, mutants were identified which have the mutation Pg3_lpdA in the form of an integration, one of the strains obtained being called C. glutamicum DM1547_Pg3_lpdA.

Example 5:

Preparation of Strains DM1547 / pZ8-l, DM1547 / pZ8-1 :: lpdA, DM1933 / pZ8-l and DM1933 / pZ8-l :: lpdA

Plasmids pZ8-l and pZ8-l :: lpdA (Example 3) were analyzed by the electroporation method of Liebl et al. (FEMS

Microbiological Letters, 53: 299-303 (1989)) in

Corynebacterium glutamicum DM1547 and DM1933

electroporated. The selection of plasmid-carrying cells was carried out by plating the Elektroporationsansat ZES on LB agar (Sambrook et al., Molecular cloning: a

laboratory manual. 2 ^nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) supplemented with 25 mg / l kanamycin. Plasmid DNA was made by the usual methods from each one transformant (Peters-Wendisch et al., 1998, Microbiology, 144, 915-927) and checked by restriction cleavage followed by agarose gel electrophoresis.

The strains obtained were named DM1547 / pZ8-l and DM1547 / pZ8-l :: lpdA as well as DM1933 / pZ8-l and DM1933 / pZ8-l :: lpdA.

Example 6:

Preparation of L-lysine with strains DM1547_Pg3_lpdA and DM1547 The C. glutamicum strain obtained in Example 4

 DM1547_Pg3_lpdA and the starting strain DM1547 were cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.

For this purpose, the clones were first propagated on brain Her z agar plates (Merck, Darmstadt, Germany) for 24 hours at 33 ° C. Starting from these agar plate cultures, a preculture was in each case inoculated (10 ml of medium in 100 ml

Erlenmeyer flask) . The medium MM was used as medium for the preculture. The preculture was incubated for 24 hours at 33 ° C and 240 rpm on a shaker. From this preculture, a major culture was inoculated so that the initial OD (660 nm) of the major culture was 0.1 OD. The medium MM was also used for the main culture.

Table 1 gives an overview of the composition of the cultivation medium used.

Table 1: Medium MM

CSL (Corn Steep Liquor) 5g / 1

MOPS (morpholinopropanesulfonic acid) 20 g / l

Glucose (separately autoclaved) 50 g / l Salts:

(NH ₄ ) ₂ S0 ₄ ) 25 g / 1

KH ₂ PO ₄ 0.1 g / 1

MgS0 ₄ * 7H ₂ 0 1.0 g / 1

CaCl ₂ * 2 H ₂ 0 10 mg / l

FeS0 ₄ * 7H ₂ 0 10 mg / 1

MnS0 ₄ * H ₂ 0 5, 0 mg / 1

Biotin (sterile filtered) 0.3 mg / l

Thiamine * HCl (sterile filtered) 0.2 mg / l

CaC0 ₃ 25 g / 1

CSL (Corn Steep Liquor), MOPS (morpholinopropanesulfonic acid) and the saline solution were adjusted to pH 7 with ammonia water and autoclaved. Subsequently, the sterile substrate and vitamin solutions as well as the dry autoclaved CaCC> 3 were added.

Culturing was done in volumes of 10 ml contained in 100 ml baffled Erlenmeyer flasks. The temperature was 33 ° C, the number of revolutions was 250 rpm and the humidity was 80%.

After 40 hours, the optical density (OD) at a measuring wavelength of 660 nm was determined with the Biomek 1000 (Beckmann Instruments GmbH, Munich). The educated

Lysine was with an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by

 Ion exchange chromatography and post-column derivatization with ninhydrin detection.

Table 2 shows the result of the experiment. Table 2: Preparation of L-lysine

 All values are mean of 3 independent experiments with the named strains

The result shows that the yield of the desired

 Product (L-lysine) is significantly increased.

Example 7:

Preparation of L-lysine with the strains DM1547 / pZ8-1 :: lpdA, DM1547 / pZ8-1, DM1933 / pZ8-1 and DM1933 / pZ8-1: lpdA

The C. glutamicum strains DM1547 / pZ8-l :: lpdA and DM1933 / pZ8-l :: lpdA obtained in Example 5 and the

 Control strains DM1547 / pZ8-l and DM1933 / pZ8-l were cultured in a nutrient medium suitable for the production of lysine and the lysine content in the culture supernatant was determined.

For this purpose, the strains were first incubated on agar plate with the appropriate antibiotic (brain-heart agar with kanamycin (25 mg / 1)) for 24 hours at 33 ° C. Starting from these agar plate cultures was ever a preculture

 inoculated (10 ml of medium in 100 ml Erlenmeyer flask). When

Medium for the preculture, the medium MM (Table 1 from Example 6) was used which was mixed with kanamycin (25 mg / 1). The preculture was incubated for 24 hours at 33 ° C and 240 rpm on a shaker. From this preculture, a major culture was inoculated so that the initial OD

(660 nm) of the main culture was 0.1 OD. The medium MM was also used for the main culture. Culturing was done in volumes of 10 ml contained in 100 ml baffled Erlenmeyer flasks. The temperature was 33 ° C, the number of revolutions was 250 rpm and the humidity was 80%. After 40 hours, the optical density (OD) at a measuring wavelength of 660 nm was determined with the Biomek 1000 (Beckmann Instruments GmbH, Munich). The educated

 Lysine was with an amino acid analyzer from Eppendorf-BioTronik (Hamburg, Germany) by

 Ion exchange chromatography and post-column derivatization with ninhydrin detection.

Table 3 shows the result of the experiment.

Table 3: Preparation of L-lysine

 All values are mean of 3 independent experiments with the named strains

The result shows that the yield of the desired

 Product (L-lysine) is significantly increased.

Example 8:

 Transformation of the strain ECM3 with the plasmids pZ8-l and pZ8-l_lpdA

The L-methionine-producing E. coli strain ECM3 is based on the wild-type K12 strain MG1655. The strain ECM3 as described in EP2205754A2, EP2326724A1 and EP12156052.8 describes a feedback-resistant metA allele, a deletion of the genes metJ, yncA, pykA, pykF and purU, a variant of the spoT gene, and in each case a promoter enhancement in front of the genes metH, metF, gcvT , cysP and cysJ.

 The strain ECM3 was transformed with the plasmids pZ8-l and pZ8-l_lpdA from example 3 and the transformants were selected with 20 mg / l kanamycin. The resulting strains were designated ECM3 / pZ8-l and ECM3 / pZ8-l_lpdA.

Example 9:

 Production of L-methionine with the strains ECM3 and ECM3 / pZ8-l_lpdA

The performance of the E. coli L-methionine production strains ECM3 and ECM3 / pZ8-l_lpdA was evaluated by production trials in 100 ml Erlenmeyer flasks. As precultures, in each case 10 ml of preculture medium (10% LB medium with 2.5 g / 1 glucose and 90% minimal medium PCI (Table 4)) were inoculated with ΙΟΟμΙ cell culture and cultured at 37 ° C. for 10 hours. In each case 10 ml of PCI minimal medium were then inoculated to an OD 600 nm of 0.2 (Eppendorf Bio-Photometer, Eppendorf AG, Hamburg, Germany) and cultured for 24 hours at 37 ° C. The extracellular L-methionine concentration was measured with a

Amino acid analyzer (Sykam GmbH, Eresing, Germany) determined by ion exchange chromatography and Nach ^¬ säulenderivatisierung with ninhydrin detection. The extracellular glucose concentration was determined with a YSI 2700 Select Glucose Analyzer (YSI Life Sciences, Yellow Springs, Ohio, USA). The results are shown in Table 5. After 48 hours, glucose was completely consumed in both cultures. Table 4: Minimal Medium PCI

 Substance concentration

 ZnSO4 * 7H20 4 mg / 1

 CuC12 * 2H20 2 mg / 1

 MnSO 4 * H 2 O 20 mg / 1

 H3B03 1 mg / 1

 Na2Mo04 * 2H20 0, 4 mg / 1

 MgSO 4 .7H 2 O 1 g / i

 Citric acid * 1 H20 6.56 g / 1

 CaC12 * 2H20 40 mg / 1

 K2HP04 8.02 g / 1

 Na 2 HPO 2 g / 1

 (NH4) 2HPO4 8 g / l

 NH 4 Cl 0.13 g / l

 (NH 4) 2 SO 3 5.6 g / l

 MOPS 5g / 1

 NaOH 10M adjusted to pH 6.8

FeSO 4 * 7 H 2 O 40 mg / 1

 Thiamine hydrochloride 10 mg / l

 Vitamin B12 10 mg / 1

 Glucose 10 g / l

Kanamycin 50 mg / l Table 5: L-methionine concentrations in the

 Fermentation broths of the investigated E. coli strains

 All values are mean of 3 independent experiments with the strains mentioned. The result shows that the yield of the desired

 Product (L-methionine) is significantly increased.

FIG. 1: Map of the plasmid pKI 8msb_Pg3_lpdA

The abbreviations and terms used have

 following meaning. The base pair numbers are approximations that are used in the context of the

 Reproducibility of measurements are obtained.

KanR: kanamycin resistance gene

Xmal restriction enzyme Xmal site

EcoRI site of the restriction enzyme EcoRI

Xbal restriction enzyme site Xbal sacB: sacB gene oriV: origin of replication V FIG. 2: Map of the plasmid pZ8-l :: lpdA

The abbreviations and designations used have the following meaning. The base pair numbers are approximations obtained as part of the reproducibility of measurements.

Km kanamycin resistance gene

EcoRI site of the restriction enzyme EcoRI

SalI interface of the restriction enzyme Sali

Ptac tac promoter rep replication origin Escherichia coli

TrnnB rrnB Terminator

Claims

claims

1. A process for the fermentative production of an organic chemical compound using a

 Microorganism, characterized in that one carries out the following steps: a) fermentation of an organic chemical

 A compound-producing microorganism, wherein in the microorganism, a polynucleotide encoding a polypeptide whose amino acid sequence is at least 80% identical to the

 Amino acid sequence of SEQ ID NO: 2, is overexpressed and wherein the fermentation takes place in a fermentation medium to form a fermentation broth, b) enriching the organic chemical compound in the fermentation broth from a).

2. Process for the preparation of an organic chemical

 A compound according to claim 1, characterized in that in the microorganism a polynucleotide suitable for a

Polypeptide whose amino acid sequence is at least 95% identical to the amino acid sequence of SEQ ID NO: 2, is present overexpressed

3. Process for the preparation of an organic chemical

 A compound according to claim 1 or 2, characterized

 characterized in that the encoded polypeptide is the

 Activity of a transhydrogenase.

4. Process for the preparation of an organic chemical

 Compound according to one of claims 1 to 3, characterized in that the encoded polypeptide is the

Amino acid sequence of SEQ ID NO: 2 comprises. A process for producing an organic chemical compound according to claim 1, characterized in that the preparation of the organic chemical compound is opposite to the fermentation of a microorganism in which the polynucleotide encoding a polypeptide its amino acid sequence is at least 80% identical to the amino acid sequence of SEQ ID NO: 2, not overexpressed, is increased by at least 0.5%.

The process for producing an organic chemical compound according to any one of claims 1 to 5, characterized in that the overexpression is achieved by one or more of the measures selected from the group a) the expression of the gene is under the control of a promoter which in for the procedure

used microorganism is stronger than the native promoter of the gene; b) increasing the copy number of the gene encoding a polypeptide having the activity of a transhydrogenase; preferably by inserting the gene in plasmids with increased copy number and / or by integration of the gene into the chromosome of the microorganism in at least one copy; c) the expression of the gene is carried out using a ribosome binding site, which in the for the

Method used microorganism is stronger than the original ribosome binding site of the gene; d) the expression of the gene is carried out by optimizing the codon usage of the microorganism used for the method; e) the expression of the gene takes place by reducing secondary mRNA structures in the mRNA transcribed from the gene; f) the expression of the gene takes place with elimination of RNA polymerase terminators in the gene

transcribed mRNA; g) the expression of the gene is carried out using mRNA-stabilizing sequences in the gene

transcribed mRNA.

A process for preparing an organic-chemical compound according to any one of claims 1 to 6, characterized in that it is in the organic ^¬ chemical compound is a L-amino acid selected from the group L-threonine, L-isoleucine, L-lysine, L - Methionine, L-ornithine, L-proline, L-valine, L-leucine and L-tryptophan acts.

The method for producing an organic-chemical compound according to any one of claims 1 to 7, characterized in that it is a withdrawing an organic ^¬ chemical compound microorganism of the genus Corynebacterium or Escherichia.

The method for producing an organic-chemical compound according to any one of claims 1 to 8, characterized in that it is a withdrawing an organic ^¬ chemical compound microorganism of the species Corynebacterium glutamicum or the species Escherichia coli.

 The process for producing an organic chemical compound according to any one of claims 1 to 6, characterized in that it is a process selected from the group of typesetting process,

Feed process, repetitive feed process and

continuous process is. The process according to claim 7, characterized in that the organic-chemical compound or a liquid or solid organic-chemical compound-containing product is obtained from the organic-chemical compound-containing fermentation broth.

12. microorganism that is an organic chemical

 In which a polynucleotide coding for a polypeptide whose amino acid sequence is> 80% identical to the amino acid sequence of SEQ ID NO: 2 is overexpressed.

 13. microorganism according to claim 12 characterized

 characterized in that the amino acid sequence of

 coded polypeptide ^ 95% is identical to the

 Amino acid sequence of SEQ ID NO: 2. The microorganism of claim 12 characterized

 characterized in that the encoded polypeptide is the

 Amino acid sequence of SEQ ID NO: 2 comprises.

15. Microorganism according to one of claims 12 to 14,

 selected from the group of the genus Corynebacterium and the bacteria of the family Enterobacteriacae, with the species Corynebacterium glutamicum being preferred.

Microorganism according to one of claims 12 to 15, characterized in that the overexpressed

 Polynucleotide the activity of a transhydrogenase