EP2812451A2 - Methods and compositions relating to fusions of ros1 for diagnosing and treating cancer - Google Patents

Abstract

Disclosed are methods and compositions for detecting the presence of a cancer in a subject and assessing the efficacy of treatments for the same. The disclosed method use real-time polymerase chain reaction, reverse transcription polymerase chain reaction (RT-PCR), in situ hybridization and/or multiplex polymerase chain reaction techniques to detect the presence of point mutations, truncations, or fusions of ROS1.

Description

METHODS AND COMPOSITIONS RELATING TO FUSIONS OF ROS1 FOR DIAGNOSING AND TREATING CANCER

This application claims the benefit of U.S. Provisional Application No. 61/596,720, filed on February 8, 2012, which is incorporated herein by reference in its entirety.

BACKGROUND

Oncogenic fusions of the ROS 1 tyrosine kinase have recently been reported to occur in subsets of several human cancers including non-small cell lung carcinoma (NSCLC), glioblastoma multiforme (GBM) brain tumors, and cholangiocarcinomas (biliary tract tumors). Cancer cells that express ROS1 fusions are "addicted" to the aberrant signaling associated with the constitutively active chimeric forms of the kinase for their proliferation and survival. In keeping with this dependence upon abnormal ROS1 signaling, preclinical studies have demonstrated ROS1 -driven cancers to be exquisitely sensitive to

pharmacologic inhibitors of the mutant kinase. Small-molecule inhibitors are now under development for the treatment of patients with ROS1 -driven cancers but no commercial diagnostic tests are available to reliably and efficiently diagnose ROS1 fusion-positive cancers. Therefore, what is needed are ROS1 fusion diagnostic tests that meet this need.

BRIEF SUMMARY

The methods and compositions disclosed herein relate to the field of detection or diagnosis of a disease or condition such as cancer; assessing the susceptibility or risk for a disease or condition associated with a nucleic acid variation, truncation, or gene fusion; the monitoring disease progression; and the determination of susceptibility or resistance to therapeutic treatment. In one aspect, the method of detection and diagnosis disclosed herein relate to the detection and/or diagnosis of ROS l-fusion related cancers.

In accordance with the purpose(s) of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to methods of detecting the presence of a ROS 1 related cancer by detecting a nucleotide variation, such as a fusion, within a nucleic acid of interest comprising conducting, real-time polymerase chain reaction, reverse transcription polymerase chain reaction (RT-PCR), and or real-time RT-PCR on extracted from a tissue sample mRNA from a subject with a cancer or PCR on cDNA synthesized from the RNA extracted from a subject with a cancer; wherein the presence of amplification product or an increase in amplification product relative to a control indicates the presence of nucleotide variation, truncation, or excessive expression, thereby detecting the presence of a cancer.

In another aspect, disclosed herein are methods of methods of diagnosing a subject with a cancer as having a ROSl related cancer further comprising determining the cycle thresholds (Ct) values for wild-type ROSl and wild-type ROSl kinase; wherein a high (Ct) value for wild-type ROSl relative to ROSl kinase indicates the presence of a fusion.

In another aspect, disclosed herein are methods of methods of diagnosing a subject with a cancer as having a ROSl related cancer, comprising a forward primer which binds to a ROS l fusion partner 5' to the fusion breakpoint and a reverse primer which binds to ROSl 3' to the fusion breakpoint, wherein said primers extend through the fusion, wherein detection of the presence of an amplicon having both ROSl and fusion partner nucleic acids indicates the presence of a fusion.

In another aspect, disclosed herein are methods of methods of diagnosing a subject with a cancer as having a ROSl related cancer, comprising a) a first amplification reaction using a forward primer which binds to a ROSl fusion partner; wherein the amplicon from the first reaction is used as a template for a second amplification reaction; b) a second amplification reaction following the first reaction, wherein primers specific for a ROSl sequence 3' of the fusion breakpoint are used in the second amplification reaction; and c) detecting the presence of ROS l in the amplicon from the second reaction; wherein detection of ROSl in the amplicon from the second reaction indicates the presence of a ROSl fusion.

In another aspect disclosed herein are methods of detecting the presence of a ROS l related cancer by detecting a nucleotide variation, such as a fusion, within a nucleic acid of interest comprising conducting fluorescence in situ hybridization (FISH) on a tissue sample from a subject with cancer, wherein the probes used for the hybridization flank the breakpoint for ROS l fusions, wherein the probes are differently labeled, and wherein the separation of the probes indicates the presence of a ROS 1 related cancer. In the case of a FISH based method of detection, closely placed hybridized probes indicate wild-type RTK, such as, for example, ROS l.

In another aspect, disclosed herein are kits for diagnosing an ROS l related cancer comprising (a) a first primer labeled with a first detection reagent, wherein said first primer is a reverse primer, wherein said reverse primer is one or more polynucleotide(s) that hybridizes, to a first polynucleotide encoding the amino acid sequence of SEQ ID NO 1 or the complement thereof; and (b) at least one second primer, wherein said second primer is a forward primer, wherein said forward primer is one or more polynucleotide(s) that hybridizes to a second polynucleotide encoding wild-type ROS1.

Additional advantages of the disclosed methods and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed methods and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed method and compositions and together with the description, serve to explain the principles of the disclosed method and compositions.

Figure 1 shows a schematic representation of receptor tyrosine kinases (RTKs) that are involved in oncogenesis due to the generation of fusion kinases. The drawings illustrate the normal, membrane-spanning RTKs. The proteins shown in red underneath each RTK form constitutively active, oncogenic fusions with the kinase.

Figure 2 shows representative ROS1 fusion kinase, the CD74-ROS1 fusion kinase.

(A) Chromosomal locations of the human CD74 (5q32) and ROS 1 (6q22) genes. In NSCLC, a reciprocal balanced rearrangement involving chromosomes 5 and 6 occurs following breakage within the two genes to form the CD74-ROS1 fusion. (B) Schematic representation of the normal CD74 and ROS1 proteins, and the CD74-ROS1 fusion protein created by the t(5; 6)(q32; q22) chromosomal rearrangement.

Figure 3 shows ROS 1 fusions in NSCLC. Schematic of transcripts created by chromosomal translocations with the ROS1 gene. Exon locations are indicated to demonstrate diversity of fusion configurations.

Figure 4 shows a ROS1 breakapart FISH assay. Genomic DNA clones flanking the breakpoint location within the ROS1 gene at which chromosomal rearrangements occur to create ROS1 fusion genes in human cancers (upper schematic) were differentially labeled with green or red fluorochromes, then hybridized to interphase nuclei and metaphase chromosomes from normal peripheral blood lymphocytes (lower left panel) or an

SLC34A2-ROS 1 -positive NSCLC cell line (right lower panel). Figure 5 shows the Insight ROS 1 Fusion Screen Methodology. The assay uses fusion-specific reverse transcription (FS-RT) at high temperature to prevent promiscuity of the reverse transcriptase to prime cDNA synthesis from stem-loop structures located within the RNA transcripts. By performing the assay at high temperatures these structures are minimized during the elongation process and restrict production of the first-strand cDNA to ROS1 fusions only. The first-strand reaction is then subject to RNase digestion in order to remove all RNA which may allow for non-specific amplification in the downstream PCR detection phase. The fusion-specific cDNA is then used as a template for the universal downstream ROS1 kinase quantitative PCR (qPCR) assay. Multiple ROS1 fusions can be targeted by multiplexing numerous FS-RT primers during the reverse transcription phase. This FS-RT primer cocktail can be readily modified to capture newly identified oncogenic fusions without increasing the number of primers used for detection maintaining specificity of the reaction and high-throughput capability.

Figure 6 shows the Insight ROS1 Fusion Screen™. Schematic representation of the ROS1 cDNA, the location of the breakpoints in cancer-associated ROS 1 fusions, and the approximate locations of the PCR primer sets employed in the real-time qPCR assay. The Ct values indicative of normal levels of wild-type ROS1 expression, wild-type ROS1 overexpression, or the presence of a ROS 1 fusion are shown in the lower panels.

Figure 7 shows the Insight ROS1 Screen™ v2. Schematic representation of the ROS1 RNA, the location of the breakpoints in cancer-associated ROS1 fusions, and the approximate locations of the primers used for cDNA synthesis. The position of the ROS1 template specific kinase reaction is also shown for the post cDNA synthesis qPCR detection phase of the reaction. Blue arrows indicate the relative position of the SLC34A2 cDNA primer and the red arrow indicates the relative position the CD74 specific cDNA primer in approximation to the actual ROS1 translocation.

DETAILED DESCRIPTION

Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

Ranges can be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed that "less than or equal to" the value, "greater than or equal to the value" and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value "10" is disclosed then "less than or equal to 10"as well as "greater than or equal to 10" is also disclosed. It is also understood that throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15.

In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:

"Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

An "increase" can refer to any change that results in a larger amount of a composition or compound, such as an amplification product relative to a control. Thus, for example, an increase in the amount in amplification products can include but is not limited to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase. It is further contemplated herein that the detection an increase in expression or abundance of a DNA, mR A, or protein relative to a control necessarily includes detection of the presence of the DNA, mRNA, or protein in situations where the DNA, mRNA, or protein is not present in the control. "Obtaining a tissue sample" or "obtain a tissue sample" means to collect a sample of tissue from a subject or measure a tissue in a subject. It is understood and herein contemplated that tissue samples can be obtained by any means known in the art including invasive and non-invasive techniques. It is also understood that methods of measurement can be direct or indirect. Examples of methods of obtaining or measuring a tissue sample can include but are not limited to tissue biopsy, tissue lavage, aspiration, tissue swab, spinal tap, magnetic resonance imaging (MRI), Computed Tomography (CT) scan, Positron Emission Tomography (PET) scan, and X-ray (with and without contrast media).

The sensitive detection of a mutation at a known site in DNA is readily done with existing technologies. Allele specific primers can be designed to target a mutation at a known location such that its signal can be preferentially amplified over wild-type DNA. Unfortunately, this is not possible with unknown mutations that may occur at any position (base) in the target sequence.

It is understood and herein contemplated, that the tissue sample can come from any tissue in a body. Thus, as used herein, "tissue" refers to blood, neural tissue (e.g., brain tissue or spinal cord tissue), lymphatic tissue, hepatic tissue, splenic tissue, pulmonary tissue, cardiac tissue, gastric tissue, intestinal tissue, pancreatic tissue, tissue from the thyroid gland, salivary glands, joints, and the skin. It is understood that a tissue sample can comprise as little as a single cell or fraction from the target tissue, for example, the tissue sample can be Peripheral Blood Mononuclear Cells, B cells, T cells, Macrophage,

Erythrocyte, Platelet or other blood cell. Similarly, the cell could be an epithelial cell, hypatocyte, neuron, or other cell.

Methods of detecting an ROSl-related cancer

The disclosed methods in one aspect related to methods of detection or diagnosis of the presence of a disease or condition such as a ROS 1 related cancer (such as, for example, Non-small cell lung carcinoma (NSCLC), glioblastoma or cholangiocarcinomas), assessing the susceptibility or risk for a disease or condition such as a ROS1 related cancer (such as, for example, NSCLC, glioblastoma or cholangiocarcinomas), the monitoring of the progression of a disease or condition such as a ROS1 related cancer (such as, for example, NSCLC, glioblastoma or cholangiocarcinomas), and the determination of susceptibility or resistance to therapeutic treatment for a disease or condition such as a ROS 1 related cancer (such as, for example, NSCLC, glioblastoma or cholangiocarcinomas) in a subject previously diagnosed with a cancer comprising obtaining a tissue sample, detecting the presence or measuring the expression level of ROS 1 mRNA from a tissue sample from the subject; wherein an increase in the amount of amplification product relative to a control or mere detection of amplicon indicates the presence of a cancer, and wherein the cancer is associated with a nucleic acid variation, truncation, or gene fusion of ROS1 (i.e., a ROS 1 related cancer). In another embodiment the detection or diagnosis of the presence of a disease or condition such as a ROS 1 related cancer can be accomplished using in situ hybridization, wherein the separation of probes flanking the breakpoint of a gene that is site of fusion to another gene in cancers indicates the presence of a ROS 1 related cancer. In another embodiment,

Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS1)

Receptor tyrosine kinases (RTKs) are important regulators of cellular signal transduction pathways that play crucial roles in normal development by regulating cellular proliferation, differentiation, migration and death. Perturbations in RTK signaling through various genetic alterations can result in deregulated kinase activity and ensuing malignant transformation (Figure 1).

Phylogenic relationship analysis of the kinase domains of all 58 known human

RTKs demonstrates that ROS1 is a distinct receptor which is distantly related to the Anaplastic Lymphoma Kinase/Leukocyte Tyrosine Kinase (ALK/LTK) and Insulin Receptor (INSR) families. ROS 1 is the orphan (i.e., for which a ligand has yet to be determined) vertebrate counterpart of the Drosophila sevenless receptor tyrosine kinase (receptor of sevenless a.k.a., ROS), which when activated by its ligand BOSS (bride of sevenless) is responsible for the differentiation of the R7 photoreceptors in the developing fly compound eye. The functions of mammalian ROS appear to be largely dispensable given that the only abnormality observed in Ros 1 -null mice involves infertility of the males due to defective sperm function associated with an inability of the epithelium of the epididymis (where ROS is expressed) to support spermatocyte differentiation. Other than leukocyte tyrosine kinase (LTK), ROS is the most highly related receptor tyrosine kinase to ALK.

Recently, three spontaneously occurring oncogenic versions of ROS 1 have been described. In 2003, an interstitial micro-deletion on chromosome 6q21 that results in a fusion event between a novel gene called FIG (/used m glioblastoma) and sequences coding for the intracellular portion of ROS 1 was discovered in human glioblastoma cell lines. The experimentally enforced expression of FIG-ROS1 in the CNS of genetically engineered adult mice results in the formation of glioblastoma multiforme tumors, confirming the oncogenic activity of this fused kinase. Detailed clinical studies have yet to be reported describing the exact incidence of the FIG-ROS 1 fusion in glioblastoma brain tumors. FIG- ROS1 fusions are not restricted only to glioblastoma; in 201 1, this chimeric kinase was shown to be expressed in cholangiocarcinomas (biliary tract cancers) as well, being present in 8.7% (2 of 23) primary tumor specimens. Like glioblastoma and NSCLC, the prognosis of patients with cholangiocarcinoma - which is the second most common primary hepatic carcinoma - is quite poor, the median survival being less than two years.

In 2007, two novel ROSl fusions were first reported in NSCLC; inter-chromosomal translocations were shown to result in the fusion of the SLC34A2 and CD74 genes to the extracellular juxtamembrane portion oiROSl in both NSCLC cell lines and patient tumors (as an example, the CD74-ROS1 fusion is shown in Figure 2). The fusion of the N-terminal portions of FIG, CD74, SLC34A2, TPM3, SDC4, EZR, and LRIG3 to the ROSl kinase domain in glioblastoma, cholangiocarcinoma and NSCLC results in constitutive kinase activity that drives tumor growth (Figure 3). Consistent with the role of these ROSl fusions as oncogenic driver mutations, siRNA-mediated downregulation of SLC34A2-ROS1 induced the apoptotic death of human NSCLC cells. Similarly, treatment of cells

experimentally rendered tumorigenic by FIG-ROS1 expression with a ROSl small-molecule inhibitor is associated with robust tumor cell killing.

Although not quite as common as EGFR or ALK RTK mutations in NSCLC, ROS fusions are clearly recurrent - in a recent study, 2.6% (17/656) of NSCLC specimens were shown to be ROS l fusion-positive by immunohistochemistry and FISH, and ALK and ROSl fusions were never observed in the same tumor. In addition, several independent analyses of tumor specimens have revealed significantly elevated expression of ROSl in 20-30% of NSCLCs, supporting an even broader role for the kinase in lung cancer pathogenesis. Yet additional malignancies may be driven by aberrant ROS l signaling; for instance, high levels of ROS l expression are found in 30-40% of glioblastoma surgical tumors and ROSl mutations have been identified in colorectal and renal carcinoma cell lines. Commercial availability of efficient and reliable diagnostic tests to detect the presence of ROSl fusions in tumors would both greatly facilitate translational research to profile other cancers for these mutations while also providing for a more effective and less costly diagnosis of a particular cancer and enabling more effective and less costly personalized therapy of patients with ROSl fusion-positive tumors using inhibitors of this mutant kinase.

Accordingly, although known ROSl fusions do not represent the most common mutation of this tyrosine kinase they remain a significant proportion of tyrosine kinase fusion related cancers the significance of which increases with the identification of additional fusion partners. Such fusions include but are not limited to Fused in

glioblastoma (FIG)-ROS l, SLC34A2-ROS 1, , TPM3-ROS1, SDC4-ROS1, EZR-ROS 1, LRIG3-ROS1, and CD74-ROS1. All three fusions have been found in cholangiocarcinoma, non-small cell lung carcinoma ( SCLC), and glioblastomas. Therefore, in one aspect, disclosed herein are methods of detection or diagnosis of a disease or condition such as ROSl -related cancer; assessing the susceptibility or risk for developing a disease or condition such as ROSl-related cancer; the monitoring disease progression of a ROS1- related cancer; and the determination of susceptibility or resistance to therapeutic treatment ROSl-related cancer in a subject with a cancer comprising detecting the presence of or measuring the amount of ROSl amplicon in a tissue sample from a subject, wherein the presence of a nucleic acid or an increase in a nucleic acid relative to a control indicated the presence of a ROSl related cancer such as a cancer with a ROS l fusion. As used herein, a "ROS-1 related cancer" refers to any cancer where ROSl is dysregulated through the presence of a ROSl fusion, overexpression, mutation, or other mechanism.

In one aspect, the disclosed methods can be accomplished through quantitative PCR

(qPCR) assays. Thus, disclosed herein, in one aspect, are methods of detecting the presence (i.e., diagnosing the presence) of an ROS l related fusion in a subject with a cancer comprising obtaining a tissue sample, isolating nucleic acid form the sample, performing PCR on the nucleic acid isolated form the tissue sample from a subject, wherein the primers for the qPCR assay comprise a primer pair specific for a ROSl kinase and a primer pair specific for wt ROSl 5' of the fusion breakpoint; and wherein cycle thresholds (Ct) values are determined; and wherein a high (Ct) value for wild-type ROSl (e.g., the extracellular domain (ECD) of ROS l) relative to ROSl kinase indicates the presence of a fusion and therefore a ROSl related-cancer. Alternatively, disclosed herein are methods involving qPCR that do not involve measuring Ct values, but comprise a forward primer which binds to a ROSl fusion partner 5' to the fusion breakpoint, a reverse primer which binds to ROSl 3' to the fusion breakpoint, wherein said primers extend through the fusion, wherein detection of the presence of an amplicon having both ROSl and fusion partner nucleic acids indicates the presence of a fusion and therefore a ROSl related-cancer. Thus, the disclosed method can be used to diagnose a ROSl related cancer.

It is understood and herein contemplated that after a tissue sample is removed from a subject, nucleic acid (e.g., DNA or RNA such as mRNA) can be isolated from the cells of the tissue. Thus, in a further aspect, the disclosed methods comprise obtaining a tissue sample and isolating nucleic acid from the tissue sample. For example, the methods can comprise taking a pulmonary tissue biopsy or sputum sample and isolating mRNA from the sample. It is further understood that where mRNA is isolated from the tissue sample, cDNA can be synthesized from the mRNA and PCR performed on the cDNA (for example, as part of an RT-PCR reaction). Thus, in one aspect, disclosed herein are methods of diagnosing a ROS1 related cancer in a subject with a cancer, comprising obtaining a tissue sample from the subject, isolating nucleic acid (e.g., mRNA) from the tissue sample, conducting RT- PCR, real-time PCR, or real-time RT-PCR on the nucleic acid, and detecting the presence of or measuring the amount of nucleic acid associated with one of or a combination of wild- type ROS1 (such as , for example the ECD oiROSl) and ROS1 kinase domain in the tissue sample, wherein the PCR, RT-PCR, real-time PCR, or real-time RT-PCR reaction comprises the use of a forward and reverse primer pair that specifically hybridizes to a wild- type ROS1 sequence (such as, for example, primers that hybridize to the extracellular domain (ECD) oiROSl, such as SEQ ID NOs: 13, 14, 20, and 21) and/or a forward and reverse primer pair that specifically hybridizes to a wild-type ROS1 kinase domain sequence (such as, for example, SEQ ID NOs: 4, 5, 7, 8, 15, 16, 17, and 18), and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROS1 and ROS1 kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS1 related cancer. Also disclosed are methods of diagnosing a ROS1 related cancer in a subject with a cancer, comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, wherein the nucleic acid from the tissue sample is RNA, wherein the method further comprises synthesizing cDNA from the RNA sample, conducting PCR on the cDNA; and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROS1 (such as , for example the ECD oiROSl) and ROS1 kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS 1 related cancer. It is also disclosed that the disclosed methods can further comprise determining cycle thresholds (Ct) values, wherein a high (Ct) value for wild-type ROS1 relative to ROS1 kinase indicates the presence of a fusion and therefore a ROS1 related-cancer or contacting the amplicon with a labeled probe that is complementary to a sequence of the amplicon for detecting and measuring the amount of amplicon.

In a further alternative method, ROS 1 fusions are detected by qPCR methodology using a two-step detection where the wherein only a forward primer which binds to a ROS 1 fusion partner is used in a first reaction and wherein in a second reaction following the first reaction the amplicon from the first reaction is used as a template for a second

amplification, a probe based detection, or a sequencing reaction, wherein the probes or primers used are specific for ROSl 3' to a fusion breakpoint, and wherein detection of ROSl in the amplicon from the second reaction indicates a fusion. Also, disclosed are methods of diagnosing a ROS l related cancer in a subject with a cancer, comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting a first amplification reaction using a forward primer which binds to a ROSl fusion partner; wherein the amplicon from the first reaction is used as a template for a second amplification reaction; conducting a second amplification reaction following the first reaction, wherein primers specific for a ROSl sequence 3 ' of the fusion breakpoint are used in the second amplification reaction; and c) detecting the presence of ROSl in the amplicon from the second reaction; wherein detection of ROSl in the amplicon from the second reaction indicates the presence of a ROSl fusion; and detecting the presence of nucleic acid associated with ROSl kinase domain in the tissue sample, wherein the presence of an amplicon indicates the that the subject has a ROSl related cancer. As with the methods described above, this two-step detection can further comprise the determination of C(t) values or contacting the amplicon with a labeled probe that is complementary to the amplicon.

It is understood and herein contemplated that additional qPCR assay methods can be employed to arrive at the same information. For example, in one aspect disclosed herein is an allele specific method of detecting the presence of an ROSl related fusion comprising performing qPCR on a tissue sample from a subject, wherein the primers for the qPCR assay comprise a reverse primer specific for a ROSl kinase and a forward primer which binds 5' to the fusion breakpoint of a ROSl fusion partner; and wherein the presence of amplicon that reads across the fusion break point indicates the presence of a fusion and therefore indicates a ROS l related cancer. It is understood that in such a method amplicon resulting from the reverse primer or forward primer will be present, but as such

amplifications will only result from a single directional primer, the signal will be significantly less than the signal from a fusion event. Moreover, the size of such amplicons would be different from the size of fusion amplicon as the forward primer would only amplify the remaining portion of the fusion partner and the reverse primer would only amplify the portion oiROSl 5' of the reverse ROSl kinase primer being used. In yet another aspect, disclosed herein are methods of detecting the presence of a ROSl related cancer by detecting a nucleotide variation, such as a fusion, within a nucleic acid of interest comprising conducting fluorescence in situ hybridization (FISH) on a tissue sample from a subject with cancer, wherein the probes used for the hybridization flank the breakpoint for ROSl fusions, wherein the probes are differently labeled, and wherein the separation of the probes indicates the presence of a ROS 1 related cancer. In the case of a FISH based method of detection, closely placed hybridized probes indicate wild-type RTK, such as, for example, ROS l.

ROSl fusions are associated with several known cancer types. It is understood that one or more ROSl fusions can be associated with a particular cancer. It is further understood that there are several types of cancer associated with ROSl fusions including but not limited to anaplastic large-cell lymphoma (ALCL), neuroblastoma, breast cancer, ovarian cancer, colorectal carcinoma, renal carcinoma, hepatic carcinoma,

cholangiocarcinomas, non-small cell lung carcinoma (NSCLC), diffuse large B-cell lymphoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, inflammatory myofibroblastic tumors, malignant histiocytosis, and glioblastomas. Thus, in one aspect disclosed herein are methods of diagnosing a ROS-1 related cancer wherein the cancer is NSCLC, a glioblastoma, or cholangiocarcinoma. Also disclosed are methods of determining the susceptibility or resistance to therapeutic treatment with a ROSl inhibitor for a ROSl -related cancer wherein the cancer is NSCLC, a glioblastoma, or cholangiocarcinoma. In one aspect, the subject it is understood to have been previously diagnosed with a cancer such as, for example, a NSCLC, a glioblastoma, or cholangiocarcinoma.

Recent studies demonstrate that inhibition of these mutant forms of receptor tyrosine kinases (RTK) with small molecule drug candidates abrogates this abnormal cell proliferation and promotes apoptosis in neuroblastoma and other RTK-driven tumor cell lines. These discoveries highlight the need for a specialized diagnostic test for RTK mutations ...a test that would have multiple clinical applications. For example, such an assay could be used to screen children in families affected with hereditary neuroblastoma to help facilitate the detection of tumors at an earlier stage when they are more amenable to treatment. Early detection and diagnosis of RTK-mediated cancers dramatically increases survival rates within the patient population. In one aspect disclosed herein are methods of detection or diagnosis of the presence of a disease or condition such as cancer, for example an ROSl related cancer comprising detecting the presence of or measuring the level or DNA, cDNA, or the expression level of mRNA associated with a wild-type ROSl nucleic acid or variation, truncation, or fusions thereof from a tissue sample from the subject;

wherein an increase in the amount of amplification product of ROSl kinase relative to a control absent a corresponding increase in wild-type ROSl indicates the presence of an ROSl related cancer.

Thus, in one aspect, the detection of ROSl kinase sequence without the

corresponding ROSl wild-type sequence or an abundance relative to the ROSl wild-type sequence indicates the presence of a ROSl fusion sequences and therefore the presence of a cancer. Therefore, disclosed herein are methods of diagnosing an ROS l related cancer in a subject comprising detecting the presence or measuring the expression level of mRNA from a tissue sample from the subject; wherein the mRNA is specific to an ROSl fusion; and wherein an increase in the amount of mRNA relative to a control indicates the presence of an ROSl related cancer.

It is understood and herein contemplated that the disclosed methods of diagnosis and determination of susceptibility or resistance to ROS 1 inhibitor treatment can be used not only on subjects that have not previously been diagnosed with a cancer to identify that the subject has cancer, but specifically on subjects having been previously diagnosed with a cancer and the method used to diagnose that the cancer is specifically ROs 1 related or susceptible to treatment and thus not to diagnose a cancer but to determine if a known cancer in a subject is ROS l related or susceptible to treatment with a ROSl inhibitor.

It is also understood and herein contemplated that the cause of an ROSl related cancer can be due not only dysregulation of wild-type ROSl or known ROSl fusions, but one or more unidentified ROS l fusions. Methods that are only able to detect known fusions would be unable to detect previously unknown fusions or mutations of ROSl . By detecting not only the presence of a truncation, nucleic acid variation of ROSl, an ROSl fusion, and/or wild-type ROSl, but also detecting ROSl kinase activity or the presence of ROSl kinase amplicon, the skilled artisan can determine if the cancer is due to dysregulated wild- type ROSl, a known ROSl fusion, or a previously unidentified ROS l fusion or mutation of ROSl . Accordingly, disclosed herein are methods for diagnosing a ROSl related cancer, assessing the susceptibility or risk of a cancer, or detecting the presence of dysregulation of ROSl and/or presence of wild-type ROSl and further comprising detecting the presence of ROSl kinase activity. Thus, for example, disclosed herein are methods of diagnosing an ROSl related cancer in a subject with a cancer comprising detecting the presence of nucleic acid associated with an ROSl fusion, wild-type ROS l and/or a ROSl kinase domain from a tissue sample in a subject. It is understood and herein contemplated that in one aspect of the methods disclosed herein, the presence or increase of wild-type ROSl and ROSl kinase alone can be tested. In such an aspect, the presence of the wild-type ROS l and ROSl kinase or increase in amplification thereof relative to a control can indicate dysregulation of ROSl which can be involved in ROS-1 related cancers not due to a fusion event. No change relative to the control indicates that ROSl is not involved in the cancer. By contrast, the presence or amplification relative to a control of only the ROSl kinase indicates a ROS l fusion. For example, in assays measuring cycle threshold (Ct) values, it is understood that cycle threshold is a relative value based on internal controls and a high Ct indicates a low expression level. Thus, it is understood that wherein the Ct value for both the wild-type ROSl primer pair and the ROSl kinase primer pair are high relative to internal controls and not statistically significantly different than each other, normal ROSl expression is observed. Wherein both the wild-type and ROSl kinase Ct values are low (i.e., expression level is high), but there is no statistically significant difference between the kinase and wild-type primer pairs, ROSl is being overexpressed. In assays where ROSl Ct values are high (i.e., low expression) relative to ROSl kinase Ct values, a ROS l fusion is present.

In an alternative method of diagnosing an ROSl related cancer, the method can comprise a first amplification reaction wherein only a forward primer that binds to a ROSl fusion partner 5' to the fusion break point is used generating an amplicon. The amplicon is used as a template for sequencing, amplification, or probe-based detection using primers or probes specific for ROSl 3 ' of the fusion breakpoint. The presence of ROSl in an amplicon indicates the presence of a ROSl fusion, and therefore a ROSl related cancer.

Accordingly, as disclosed above, disclosed herein are methods of diagnosing a ROSl related cancer in a subject with a cancer comprising performing a first PCR based reaction on nucleic acid from the subject, and performing a second PCR based reaction, sequencing reaction, or probe based detection on the amplicon from the first reaction, wherein the primer from the first PCR reaction is a forward primer which binds to a ROSl fusion partner 5' of the fusion breakpoint, wherein any primers or probes used in the second PCR reaction or detection are specific for ROSl in 3 ' of the fusion breakpoint (e.g., SEQ ID NOs: 4, 5, 7, 8, 15, 16, 17, and 18), and wherein the presence of ROS l in the amplicon from the first reaction indicates the presence of a ROSl fusion and therefore a ROSl related cancer. In another aspect, disclosed herein are methods of diagnosing a ROSl related cancer in a subject with a cancer comprising performing a PCR based reaction on nucleic acid from the subject wherein the forward primer is specific for a ROSl fusion partner and binds 5' to the fusion breakpoint and the reverse primer is specific for ROSl and binds 3 ' to the fusion breakpoint, wherein detection of amplicon containing ROSl and ROS 1 fusion partner indicates the presence of a ROSl related cancer.

Alternatively, where FISH is used as the detection assay, the presence of separately spaced probes which hybridize to sequences flanking the breakpoint of ROSl indicates the presence of a fusion event and therefore a cancer.

It is understood and herein contemplated that once a ROSl related cancer is detected or its presence diagnosed using any of the aforementioned methods of diagnosis, the methods may then further comprise administering to the subject with an ROSl related cancer a ROSl inhibitor.

In one aspect, disclosed herein are methods for diagnosing a ROSl -related cancer in a subject with a cancer comprising detecting the presence of ROSl kinase activity. Thus, for example, disclosed herein are methods of diagnosing a ROSl related cancer in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting RT-PCR, real-time PCR, or real-time RT-PCR on the nucleic acid, and detecting the presence of or measuring the amount of nucleic acid associated with wild-type ROSl and ROSl kinase domain in the tissue sample, wherein the RT-PCR or real-time PCR reaction comprises the use of one or a combination of a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl sequence (e.g., SEQ ID NOs: 13, 14, 20 and 21) and a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl kinase domain sequence (e.g., SEQ ID SOs: 4, 5, 7, 8, 15, 16, 17, and 18), and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROSl and ROSl kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS 1 related cancer. Absence of amplicon or amplicon levels equivalent to normal controls indicates that the cancer is a ROSl related cancer. Also disclosed are methods for diagnosing a ROS l -related cancer in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, wherein the nucleic acid from the tissue sample is RNA, wherein the method further comprises synthesizing cDNA from the RNA sample, conducting PCR on the cDNA; and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROSl and ROSl kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS l related cancer. In a further aspect, the disclosed methods can utilize a probe that is complementary to a sequence with the product of the real-time RT-PCR (e.g., SEQ DI NOs: 6, 8, 19, and 22) or the method can comprise determining the cycle thresholds (Ct) values for wild-type ROSl and wild-type ROSl kinase; wherein a high (Ct) value for wild-type ROSl relative to ROSl kinase indicates the presence of a fusion. When a cancer is determined to be a ROS l related cancer also disclosed are methods further comprising administering to a subject with a cancer susceptible to ROSl inhibitor treatment, a ROSl inhibitor. Conversely, where the cancer is not a rOS l related cancer, the method can further comprise treating the subject with the cancer using a form of treatment other than a ROS l inhibitor.

In a further alternative method for diagnosing a ROSl-related cancer in a subject with a cancer, ROSl fusions are detected by qPCR methodology using a two-step detection where the wherein only a forward primer which binds to a ROSl fusion partner is used in a first reaction and wherein in a second reaction following the first reaction the amplicon from the first reaction is used as a template for a second amplification, a probe based detection, or a sequencing reaction, wherein the probes or primers used are specific for ROSl 3 ' to a fusion breakpoint, and wherein detection of ROSl in the amplicon from the second reaction indicates a fusion and thus a ROSl related cancer. Also, disclosed are methods for diagnosing a ROSl-related cancer in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting a first amplification reaction using a forward primer which binds to a ROSl fusion partner; wherein the amplicon from the first reaction is used as a template for a second amplification reaction; conducting a second amplification reaction following the first reaction, wherein primers specific for a ROSl sequence 3 ' of the fusion breakpoint are used in the second amplification reaction (e.g., SEQ ID NOs: 4, 5, 7, 8, 15, 16, 17, and 18); and detecting the presence of ROSl in the amplicon from the second reaction; wherein detection of ROS l in the amplicon from the second reaction indicates the presence of a ROSl fusion and therefore a ROSl related cancer. When a cancer is determined to be a ROSl related cancer also disclosed are methods further comprising administering to a subject with a cancer susceptible to ROSl inhibitor treatment, a ROSl inhibitor.

Conversely, where the cancer is not a rOSl related cancer, the method can further comprise treating the subject with the cancer using a form of treatment other than a ROS l inhibitor. Also disclosed herein are methods of diagnosing a ROSl related cancer in a subject comprising contacting nucleic acid in a cell with a first probe that hybridizes to a ROSl kinase and a second probe that hybridizes to a ROSl sequence 3' to the fusion breakpoint of ROSl ; wherein the probes a differently labeled; wherein detection of a disrupted gene locus indicated by separated probes indicates the presence of an ROSl fusion which indicates the presence of a ROSl related cancer. In one aspect, it is disclosed herein that probe comprises a sequence complementary to a sequence with the product of the real-time RT- PCR, and wherein the probe has a reporter dye on the end thereof and a quencher dye on the another end thereof. It is further understood that the probe can be selected from any of the probes in Table 7 including, but not limited to SEQ ID NOs: 6, 8, 19, and 22.

mRNA detection and quantification

The methods disclosed herein relate to the detection of nucleic acid variation in the form of, for example, point mutations and truncations, or the detection of expression of ROSl fusions, aberrant wild-type ROSl expression, wild-type ROSl expression, or expression of ROSl truncation mutants. For these latter expression level detections, the methods comprise detecting either the abundance or presence of mRNA, or both. Thus, disclosed herein are methods and compositions for diagnosing an ROSl related cancer in a subject comprising measuring the presence or level of mRNA from a tissue sample from the subject; wherein an increase in the amount of mRNA relative to a control indicates the presence of an ROS 1 related cancer.

A number of widely used procedures exist for detecting and determining the abundance of a particular mRNA in a total or poly(A) RNA sample. For example, specific mRNAs can be detected using Northern blot analysis, nuclease protection assays (NPA), in situ hybridization (e.g., fluorescence in situ hybridization), real-time PCR reaction, or reverse transcription-polymerase chain reaction (RT-PCR), and microarray.

Each of these techniques can be used to detect specific RNAs and to precisely determine their expression level. In general, Northern analysis is the only method that provides information about transcript size, whereas NPAs are the easiest way to

simultaneously examine multiple messages. In situ hybridization is used to localize expression of a particular gene within a tissue or cell type, and RT-PCR is the most sensitive method for detecting and quantitating gene expression.

Real-time PCR, RT-PCR, and real-time RT-PCR allow for the detection of the RNA transcript of any gene, regardless of the scarcity of the starting material or relative abundance of the specific mRNA. In RT-PCR, an RNA template is copied into a complementary DNA (cDNA) using a retroviral reverse transcriptase. The cDNA is then amplified exponentially by PCR using a DNA polymerase. The reverse transcription and PCR reactions can occur in the same or difference tubes. RT-PCR is somewhat tolerant of degraded RNA. As long as the RNA is intact within the region spanned by the primers, the target will be amplified.

Relative quantitative RT-PCR involves amplifying an internal control

simultaneously with the gene of interest. The internal control is used to normalize the samples. Once normalized, direct comparisons of relative abundance of a specific mRNA can be made across the samples. It is crucial to choose an internal control with a constant level of expression across all experimental samples (i.e., not affected by experimental treatment). Commonly used internal controls (e.g., GAPDH, β-actin, cyclophilin) often vary in expression and, therefore, may not be appropriate internal controls. Additionally, most common internal controls are expressed at much higher levels than the mRNA being studied. For relative RT-PCR results to be meaningful, all products of the PCR reaction must be analyzed in the linear range of amplification. This becomes difficult for transcripts of widely different levels of abundance.

Competitive RT-PCR is used for absolute quantitation. This technique involves designing, synthesizing, and accurately quantitating a competitor RNA that can be distinguished from the endogenous target by a small difference in size or sequence. Known amounts of the competitor RNA are added to experimental samples and RT-PCR is performed. Signals from the endogenous target are compared with signals from the competitor to determine the amount of target present in the sample.

Disclosed herein in one aspect are methods of diagnosing an ROSl related cancer in a subject comprising conducting real-time PCR, RT-PCR, or other PCR reaction on nucleic acid such as, for example, mRNA or DNA from a tissue sample from the subject; wherein the polymerase chain reaction comprises a reverse primer capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROS l related cancer. Also disclosed herein are methods of diagnosing an ROSl related cancer in a subject comprising conducting FISH on a tissue sample from the subject; wherein the polymerase chain reaction comprises probes capable of specifically hybridizing to one or more ROSl sequences on separate sides of a ROS l fusion breakpoint; and wherein a disrupted gene locus indicated by separated probes indicates the presence of an ROSl related cancer. Examples of probes for use in this assay include those found on Table 7.

As the disclosed methods can be used to detect wild-type ROS l, ROSl fusions, and ROSl kinase domain activity, also disclosed herein are methods of diagnosing an ROSl related cancer or detecting the dysregulation of an ROSl kinase in a subject comprising conducting a first RT-PCR reaction on mRNA from a tissue sample from the subject;

wherein the reverse transcription polymerase chain reaction (RT-PCR) comprises one primer pair capable of specifically hybridizing to a ROSl kinase sequences (such as, for example SEQ ID NOs: 4, 5, 7, 8, 15, 16, 17, and 18) and at least one primer pair capable of specifically hybridizing to ROSl 5' of any fusion breakpoint (i.e., an external wild-type

ROSl site such as, for example, SEQ ID NOs: 13, 14, 20, and 21) and determining the cycle threshold for the amplicons from each primer pair; and wherein a cycle threshold of the wild-type primer pair amplicon is higher than the cycle threshold for the ROSl kinase by a statistically significant amount indicates the presence of a fusion or mutated ROSl. Also disclosed are methods of diagnosing an ROSl related cancer or detecting the dysregulation of an ROSl kinase in a subject comprising conducting a first RT-PCR reaction on mRNA from a tissue sample from the subject; wherein the reverse transcription polymerase chain reaction (RT-PCR) comprises one primer pair capable of specifically hybridizing to a ROSl fusion partner 5' of any fusion breakpoint and amplifying only in the forward direction; wherein the method further comprises detecting the presence of or amplifying the amplicon from the first reaction using one or more primers that specifically hybridize to ROSl sequences 3 ' of the fusion breakpoint, wherein the presence of ROSl sequences in the amplicon from the first reaction indicates that presence of a ROSl fusion.

Northern analysis is the easiest method for determining transcript size, and for identifying alternatively spliced transcripts and multigene family members. It can also be used to directly compare the relative abundance of a given message between all the samples on a blot. The Northern blotting procedure is straightforward and provides opportunities to evaluate progress at various points (e.g., intactness of the RNA sample and how efficiently it has transferred to the membrane). RNA samples are first separated by size via electrophoresis in an agarose gel under denaturing conditions. The RNA is then transferred to a membrane, crosslinked and hybridized with a labeled probe. Nonisotopic or high specific activity radiolabeled probes can be used including random-primed, nick-translated, or PCR-generated DNA probes, in vitro transcribed RNA probes, and oligonucleotides. Additionally, sequences with only partial homology (e.g., cDNA from a different species or genomic DNA fragments that might contain an exon) may be used as probes.

The Nuclease Protection Assay (NPA) (including both ribonuclease protection assays and SI nuclease assays) is a sensitive method for the detection and quantitation of specific mRNAs. The basis of the NPA is solution hybridization of an antisense probe (radiolabeled or nonisotopic) to an RNA sample. After hybridization, single-stranded, unhybridized probe and RNA are degraded by nucleases. The remaining protected fragments are separated on an acrylamide gel. Solution hybridization is typically more efficient than membrane-based hybridization, and it can accommodate up to 100 μg of sample RNA, compared with the 20-30 μg maximum of blot hybridizations. NPAs are also less sensitive to RNA sample degradation than Northern analysis since cleavage is only detected in the region of overlap with the probe (probes are usually about 100-400 bases in length).

NPAs are the method of choice for the simultaneous detection of several RNA species. During solution hybridization and subsequent analysis, individual probe/target interactions are completely independent of one another. Thus, several RNA targets and appropriate controls can be assayed simultaneously (up to twelve have been used in the same reaction), provided that the individual probes are of different lengths. NPAs are also commonly used to precisely map mRNA termini and intron/exon junctions.

In situ hybridization (ISH) is a powerful and versatile tool for the localization of specific mRNAs in cells or tissues. Unlike Northern analysis and nuclease protection assays, ISH does not require the isolation or electrophoretic separation of RNA.

Hybridization of the probe takes place within the cell or tissue. Since cellular structure is maintained throughout the procedure, ISH provides information about the location of mRNA within the tissue sample. ISH can be combined with a fluorescent marker to arrive at fluorescence in situ hybridization (FISH).

The procedure begins by fixing samples in neutral-buffered formalin, and embedding the tissue in paraffin. The samples are then sliced into thin sections and mounted onto microscope slides. (Alternatively, tissue can be sectioned frozen and post-fixed in paraformaldehyde.) After a series of washes to de-wax and rehydrate the sections, a

Proteinase K digestion is performed to increase probe accessibility, and a labeled probe is then hybridized to the sample sections. Radiolabeled probes are visualized with liquid film dried onto the slides, while nonisotopically labeled probes are conveniently detected with colorimetric or fluorescent reagents.

DNA detection and quantification

The methods disclosed herein relate to the detection of nucleic acid variation in the form of, for example, point mutations and truncations, or the detection of expression of ROS1 fusions, aberrant wild-type ROS 1 expression, or expression of ROS1 truncation mutants. For these latter expression level detections, the methods comprise detecting either the abundance or presence of mRNA, or both. Alternatively, detection can be directed to the abundance or presence of DNA, for example, cDNA. Thus, disclosed herein are methods and compositions for diagnosing an ROS 1 related cancer in a subject comprising measuring the presence or level of DNA from a tissue sample from the subject; wherein an increase in the amount of DNA relative to a control indicates the presence of an ROS1 related cancer.

A number of widely used procedures exist for detecting and determining the abundance of a particular DNA in a sample. For example, the technology of PCR permits amplification and subsequent detection of minute quantities of a target nucleic acid. Details of PCR are well described in the art, including, for example, U.S. Pat. Nos. 4,683, 195 to Mullis et al., 4,683,202 to Mullis and 4,965,188 to Mullis et al. Generally, oligonucleotide primers are annealed to the denatured strands of a target nucleic acid, and primer extension products are formed by the polymerization of deoxynucleoside triphosphates by a polymerase. A typical PCR method involves repetitive cycles of template nucleic acid denaturation, primer annealing and extension of the annealed primers by the action of a thermostable polymerase. The process results in exponential amplification of the target nucleic acid, and thus allows the detection of targets existing in very low concentrations in a sample. It is understood and herein contemplated that there are variant PCR methods known in the art that may also be utilized in the disclosed methods, for example,

Quantitative PCR (QPCR); microarrays, real-time PCT; hot start PCR; nested PCR; allele- specific PCR; and Touchdown PCR.

Microarrays

An array is an orderly arrangement of samples, providing a medium for matching known and unknown DNA samples based on base-pairing rules and automating the process of identifying the unknowns. An array experiment can make use of common assay systems such as microplates or standard blotting membranes, and can be created by hand or make use of robotics to deposit the sample. In general, arrays are described as macroarrays or microarrays, the difference being the size of the sample spots. Macroarrays contain sample spot sizes of about 300 microns or larger and can be easily imaged by existing gel and blot scanners. The sample spot sizes in microarray can be 300 microns or less, but typically less than 200 microns in diameter and these arrays usually contains thousands of spots.

Microarrays require specialized robotics and/or imaging equipment that generally are not commercially available as a complete system. Terminologies that have been used in the literature to describe this technology include, but not limited to: biochip, DNA chip, DNA microarray, GENECHIP® (Affymetrix, Inc. which refers to its high density,

oligonucleotide-based DNA arrays), and gene array.

DNA microarrays, or DNA chips are fabricated by high-speed robotics, generally on glass or nylon substrates, for which probes with known identity are used to determine complementary binding, thus allowing massively parallel gene expression and gene discovery studies. An experiment with a single DNA chip can provide information on thousands of genes simultaneously. It is herein contemplated that the disclosed microarrays can be used to monitor gene expression, disease diagnosis, gene discovery, drug discovery (pharmacogenomics), and toxicological research or toxicogenomics.

There are two variants of the DNA microarray technology, in terms of the property of arrayed DNA sequence with known identity. Type I microarrays comprise a probe cDNA (500-5,000 bases long) that is immobilized to a solid surface such as glass using robot spotting and exposed to a set of targets either separately or in a mixture. This method is traditionally referred to as DNA microarray. With Type I microarrays, localized multiple copies of one or more polynucleotide sequences, preferably copies of a single

polynucleotide sequence are immobilized on a plurality of defined regions of the substrate's surface. A polynucleotide refers to a chain of nucleotides ranging from 5 to 10,000 nucleotides. These immobilized copies of a polynucleotide sequence are suitable for use as probes in hybridization experiments.

To prepare beads coated with immobilized probes, beads are immersed in a solution containing the desired probe sequence and then immobilized on the beads by covalent or noncovalent means. Alternatively, when the probes are immobilized on rods, a given probe can be spotted at defined regions of the rod. Typical dispensers include a micropipette delivering solution to the substrate with a robotic system to control the position of the micropipette with respect to the substrate. There can be a multiplicity of dispensers so that reagents can be delivered to the reaction regions simultaneously. In one embodiment, a microarray is formed by using ink-jet technology based on the piezoelectric effect, whereby a narrow tube containing a liquid of interest, such as oligonucleotide synthesis reagents, is encircled by an adapter. An electric charge sent across the adapter causes the adapter to expand at a different rate than the tube and forces a small drop of liquid onto a substrate.

Samples may be any sample containing polynucleotides (polynucleotide targets) of interest and obtained from any bodily fluid (blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations. DNA or R A can be isolated from the sample according to any of a number of methods well known to those of skill in the art. In one embodiment, total RNA is isolated using the TRIzol total RNA isolation reagent (Life Technologies, Inc., Rockville, Md.) and RNA is isolated using oligo d(T) column chromatography or glass beads. After hybridization and processing, the

hybridization signals obtained should reflect accurately the amounts of control target polynucleotide added to the sample.

The plurality of defined regions on the substrate can be arranged in a variety of formats. For example, the regions may be arranged perpendicular or in parallel to the length of the casing. Furthermore, the targets do not have to be directly bound to the substrate, but rather can be bound to the substrate through a linker group. The linker groups may typically vary from about 6 to 50 atoms long. Linker groups include ethylene glycol oligomers, diamines, diacids and the like. Reactive groups on the substrate surface react with one of the terminal portions of the linker to bind the linker to the substrate. The other terminal portion of the linker is then functionalized for binding the probes.

Sample polynucleotides may be labeled with one or more labeling moieties to allow for detection of hybridized probe/target polynucleotide complexes. The labeling moieties can include compositions that can be detected by spectroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means. The labeling moieties include radioisotopes, such as P, P or S, chemiluminescent compounds, labeled binding proteins, heavy metal atoms, spectroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, biotin, and the like.

Labeling can be carried out during an amplification reaction, such as polymerase chain reaction and in vitro or in vivo transcription reactions. Alternatively, the labeling moiety can be incorporated after hybridization once a probe-target complex his formed. In one embodiment, biotin is first incorporated during an amplification step as described above. After the hybridization reaction, unbound nucleic acids are rinsed away so that the only biotin remaining bound to the substrate is that attached to target polynucleotides that are hybridized to the polynucleotide probes. Then, an avidin-conjugated fluorophore, such as avidin-phycoerythrin, that binds with high affinity to biotin is added.

Hybridization causes a polynucleotide probe and a complementary target to form a stable duplex through base pairing. Hybridization methods are well known to those skilled in the art Stringent conditions for hybridization can be defined by salt concentration, temperature, and other chemicals and conditions. Varying additional parameters, such as hybridization time, the concentration of detergent (sodium dodecyl sulfate, SDS) or solvent (formamide), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Additional variations on these conditions will be readily apparent to those skilled in the art.

Methods for detecting complex formation are well known to those skilled in the art. In one embodiment, the polynucleotide probes are labeled with a fluorescent label and measurement of levels and patterns of complex formation is accomplished by fluorescence microscopy, preferably confocal fluorescence microscopy. An argon ion laser excites the fluorescent label, emissions are directed to a photomultiplier and the amount of emitted light detected and quantitated. The detected signal should be proportional to the amount of probe/target polynucleotide complex at each position of the microarray. The fluorescence microscope can be associated with a computer-driven scanner device to generate a quantitative two-dimensional image of hybridization intensities. The scanned image is examined to determine the abundance/expression level of each hybridized target polynucleotide.

In a differential hybridization experiment, polynucleotide targets from two or more different biological samples are labeled with two or more different fluorescent labels with different emission wavelengths. Fluorescent signals are detected separately with different photomultipliers set to detect specific wavelengths. The relative abundances/expression levels of the target polynucleotides in two or more samples is obtained. Typically, microarray fluorescence intensities can be normalized to take into account variations in hybridization intensities when more than one microarray is used under similar test conditions. In one embodiment, individual polynucleotide probe/target complex hybridization intensities are normalized using the intensities derived from internal normalization controls contained on each microarray.

Type II microarrays comprise an array of oligonucleotides (20~80-mer oligos) or peptide nucleic acid (PNA) probes that is synthesized either in situ (on-chip) or by conventional synthesis followed by on-chip immobilization. The array is exposed to labeled sample DNA, hybridized, and the identity/abundance of complementary sequences are determined. This method, "historically" called DNA chips, was developed at Affymetrix, Inc. , which sells its photolithographically fabricated products under the GENECHIP® trademark.

The basic concept behind the use of Type II arrays for gene expression is simple: labeled cDNA or cRNA targets derived from the mRNA of an experimental sample are hybridized to nucleic acid probes attached to the solid support. By monitoring the amount of label associated with each DNA location, it is possible to infer the abundance of each mRNA species represented. Although hybridization has been used for decades to detect and quantify nucleic acids, the combination of the miniaturization of the technology and the large and growing amounts of sequence information, have enormously expanded the scale at which gene expression can be studied.

Microarray manufacturing can begin with a 5 -inch square quartz wafer. Initially the quartz is washed to ensure uniform hydroxylation across its surface. Because quartz is naturally hydroxylated, it provides an excellent substrate for the attachment of chemicals, such as linker molecules, that are later used to position the probes on the arrays.

The wafer is placed in a bath of silane, which reacts with the hydroxyl groups of the quartz, and forms a matrix of covalently linked molecules. The distance between these silane molecules determines the probes' packing density, allowing arrays to hold over 500,000 probe locations, or features, within a mere 1.28 square centimeters. Each of these features harbors millions of identical DNA molecules. The silane film provides a uniform hydroxyl density to initiate probe assembly. Linker molecules, attached to the silane matrix, provide a surface that may be spatially activated by light.

Probe synthesis occurs in parallel, resulting in the addition of an A, C, T, or G nucleotide to multiple growing chains simultaneously. To define which oligonucleotide chains will receive a nucleotide in each step, photolithographic masks, carrying 18 to 20 square micron windows that correspond to the dimensions of individual features, are placed over the coated wafer. The windows are distributed over the mask based on the desired sequence of each probe. When ultraviolet light is shone over the mask in the first step of synthesis, the exposed linkers become deprotected and are available for nucleotide coupling.

Once the desired features have been activated, a solution containing a single type of deoxynucleotide with a removable protection group is flushed over the wafer's surface. The nucleotide attaches to the activated linkers, initiating the synthesis process. Although each position in the sequence of an oligonucleotide can be occupied by lof Nucleotides, resulting in an apparent need for 25 x 4, or 100, different masks per wafer, the synthesis process can be designed to significantly reduce this requirement. Algorithms that help minimize mask usage calculate how to best coordinate probe growth by adjusting synthesis rates of individual probes and identifying situations when the same mask can be used multiple times.

Some of the key elements of selection and design are common to the production of all microarrays, regardless of their intended application. Strategies to optimize probe hybridization, for example, are invariably included in the process of probe selection.

Hybridization under particular pH, salt, and temperature conditions can be optimized by taking into account melting temperatures and using empirical rules that correlate with desired hybridization behaviors.

To obtain a complete picture of a gene's activity, some probes are selected from regions shared by multiple splice or polyadenylation variants. In other cases, unique probes that distinguish between variants are favored. Inter-probe distance is also factored into the selection process.

A different set of strategies is used to select probes for genotyping arrays that rely on multiple probes to interrogate individual nucleotides in a sequence. The identity of a target base can be deduced using four identical probes that vary only in the target position, each containing one of the four possible bases.

Alternatively, the presence of a consensus sequence can be tested using one or two probes representing specific alleles. To genotype heterozygous or genetically mixed samples, arrays with many probes can be created to provide redundant information, resulting in unequivocal genotyping. In addition, generic probes can be used in some applications to maximize flexibility. Some probe arrays, for example, allow the separation and analysis of individual reaction products from complex mixtures, such as those used in some protocols to identify single nucleotide polymorphisms (SNPs).

Real-time PCR

In one aspect the disclosed diagnostic methods can be performed by Real-time PCR methods. For example, in one aspect, disclosed herein are methods of detecting the presence of an ROS 1 related fusion or methods of diagnosing an ROS1 related cancer or detecting the dysregulation of an ROS 1 kinase in a subject comprising conducting a first RT-PCR reaction on mRNA from a tissue sample from the subject; wherein the reverse transcription polymerase chain reaction (RT-PCR) comprises one primer pair capable of specifically hybridizing to a ROS1 kinase sequences and at least one primer pair capable of specifically hybridizing to ROS1 5' of any fusion breakpoint (i.e., an external wild-type ROS1 site) and determining the cycle threshold for the amplicons from each primer pair; and wherein a cycle threshold of the wild-type primer pair amplicon is higher than the cycle threshold for the ROS1 kinase by a statistically significant amount indicates the presence of a fusion or mutated ROS1.

Real-time PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle (i.e., in real time) as opposed to the endpoint detection. The real-time progress of the reaction can be viewed in some systems. Real-time PCR does not detect the size of the amplicon and thus does not allow the differentiation between DNA and cDNA amplification, however, it is not influenced by non-specific amplification unless SYBR Green is used. Real-time PCR quantitation eliminates post-PCR processing of PCR products. This helps to increase throughput and reduce the chances of carryover contamination. Real-time PCR also offers a wide dynamic range of up to 10⁷-fold. Dynamic range of any assay determines how much target concentration can vary and still be quantified. A wide dynamic range means that a wide range of ratios of target and normaliser can be assayed with equal sensitivity and specificity. It follows that the broader the dynamic range, the more accurate the quantitation. When combined with RT-PCR, a real-time RT- PCR reaction reduces the time needed for measuring the amount of amplicon by providing for the visualization of the amplicon as the amplification process is progressing.

The real-time PCR system is based on the detection and quantitation of a fluorescent reporter. This signal increases in direct proportion to the amount of PCR product in a reaction. By recording the amount of fluorescence emission at each cycle, it is possible to monitor the PCR reaction during exponential phase where the first significant increase in the amount of PCR product correlates to the initial amount of target template. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. A significant increase in fluorescence above the baseline value measured during the 3-15 cycles can indicate the detection of accumulated PCR product.

A fixed fluorescence threshold is set significantly above the baseline that can be altered by the operator. The parameter CT (threshold cycle) is defined as the cycle number at which the fluorescence emission exceeds the fixed threshold.

There are three main fluorescence-monitoring systems for DNA amplification: (1) hydrolysis probes; (2) hybridising probes; and (3) DNA-binding agents. Hydrolysis probes include TaqMan probes, molecular beacons and scorpions. They use the fluorogenic 5' exonuclease activity of Taq polymerase to measure the amount of target sequences in cDNA samples.

TaqMan probes are oligonucleotides longer than the primers (20-30 bases long with a Tm value of 10°C higher) that contain a fluorescent dye usually on the 5' base, and a quenching dye (usually TAMRA) typically on the 3' base. When irradiated, the excited fluorescent dye transfers energy to the nearby quenching dye molecule rather than fluorescing (this is called FRET = F5rster or fluorescence resonance energy transfer). Thus, the close proximity of the reporter and quencher prevents emission of any fluorescence while the probe is intact. TaqMan probes are designed to anneal to an internal region of a PCR product. When the polymerase replicates a template on which a TaqMan probe is bound, its 5' exonuclease activity cleaves the probe. This ends the activity of quencher (no FRET) and the reporter dye starts to emit fluorescence which increases in each cycle proportional to the rate of probe cleavage. Accumulation of PCR products is detected by monitoring the increase in fluorescence of the reporter dye (note that primers are not labelled). TaqMan assay uses universal thermal cycling parameters and PCR reaction conditions. Because the cleavage occurs only if the probe hybridises to the target, the origin of the detected fluorescence is specific amplification. The process of hybridisation and cleavage does not interfere with the exponential accumulation of the product. One specific requirement for fluorogenic probes is that there is no G at the 5' end. A 'G' adjacent to the reporter dye can quench reporter fluorescence even after cleavage.

Molecular beacons also contain fluorescent (FAM, TAMRA, TET, ROX) and quenching dyes (typically DABCYL) at either end but they are designed to adopt a hairpin structure while free in solution to bring the fluorescent dye and the quencher in close proximity for FRET to occur. They have two arms with complementary sequences that form a very stable hybrid or stem. The close proximity of the reporter and the quencher in this hairpin configuration suppresses reporter fluorescence. When the beacon hybridises to the target during the annealing step, the reporter dye is separated from the quencher and the reporter fluoresces (FRET does not occur). Molecular beacons remain intact during PCR and must rebind to target every cycle for fluorescence emission. This will correlate to the amount of PCR product available. All real-time PCR chemistries allow detection of multiple DNA species (multiplexing) by designing each probe/beacon with a spectrally unique fluor/quench pair as long as the platform is suitable for melting curve analysis if SYBR green is used. By multiplexing, the target(s) and endogenous control can be amplified in single tube. With Scorpion probes, sequence-specific priming and PCR product detection is achieved using a single oligonucleotide. The Scorpion probe maintains a stem-loop configuration in the unhybridised state. The fluorophore is attached to the 5' end and is quenched by a moiety coupled to the 3' end. The 3' portion of the stem also contains sequence that is complementary to the extension product of the primer. This sequence is linked to the 5' end of a specific primer via a non-amplifiable monomer. After extension of the Scorpion primer, the specific probe sequence is able to bind to its complement within the extended amplicon thus opening up the hairpin loop. This prevents the fluorescence from being quenched and a signal is observed.

Another alternative is the double-stranded DNA binding dye chemistry, which quantitates the amplicon production (including non-specific amplification and primer-dimer complex) by the use of a non-sequence specific fluorescent intercalating agent (SYBR- green I or ethidium bromide). It does not bind to ssDNA. SYBR green is a fluorogenic minor groove binding dye that exhibits little fluorescence when in solution but emits a strong fluorescent signal upon binding to double-stranded DNA. Disadvantages of SYBR green-based real-time PCR include the requirement for extensive optimisation. Furthermore, non-specific amplifications require follow-up assays (melting point curve or dissociation analysis) for amplicon identification. The method has been used in HFE-C282Y genotyping. Another controllable problem is that longer amplicons create a stronger signal (if combined with other factors, this may cause CDC camera saturation, see below). Normally SYBR green is used in singleplex reactions, however when coupled with melting point analysis, it can be used for multiplex reactions.

The threshold cycle or the CT value is the cycle at which a significant increase in ARn is first detected (for definition of ARn, see below). The threshold cycle is when the system begins to detect the increase in the signal associated with an exponential growth of PCR product during the log-linear phase. This phase provides the most useful information about the reaction (certainly more important than the end-point). The slope of the log-linear phase is a reflection of the amplification efficiency. The efficiency (Eff) of the reaction can be calculated by the formula: Eff=10^{( 1/slope)}-l . The efficiency of the PCR should be 90 - 100% (3.6 > slope > 3.1). A number of variables can affect the efficiency of the PCR. These factors include length of the amplicon, secondary structure and primer quality. Although valid data can be obtained that fall outside of the efficiency range, the qRT-PCR should be further optimised or alternative amplicons designed. For the slope to be an indicator of real amplification (rather than signal drift), there has to be an inflection point. This is the point on the growth curve when the log-linear phase begins. It also represents the greatest rate of change along the growth curve. (Signal drift is characterised by gradual increase or decrease in fluorescence without amplification of the product.) The important parameter for quantitation is the Or. The higher the initial amount of genomic DNA, the sooner accumulated product is detected in the PCR process, and the lower the CT value. The threshold should be placed above any baseline activity and within the exponential increase phase (which looks linear in the log transformation). Some software allows determination of the cycle threshold (CT) by a mathematical analysis of the growth curve. This provides better run-to-run reproducibility. A CT value of 40 means no amplification and this value cannot be included in the calculations. Besides being used for quantitation, the CT value can be used for qualitative analysis as a pass/fail measure.

Multiplex TaqMan assays can be performed using multiple dyes with distinct emission wavelengths. Available dyes for this purpose are FAM, TET, VIC and JOE (the most expensive). TAMRA is reserved as the quencher on the probe and ROX as the passive reference. For best results, the combination of FAM (target) and VIC (endogenous control) is recommended (they have the largest difference in emission maximum) whereas JOE and VIC should not be combined. It is important that if the dye layer has not been chosen correctly, the machine will still read the other dye's spectrum. For example, both VIC and FAM emit fluorescence in a similar range to each other and when doing a single dye, the wells should be labelled correctly. In the case of multiplexing, the spectral compensation for the post run analysis should be turned on (on ABI 7700: Instrument/Diagnostics/Advanced Options/Miscellaneous). Activating spectral compensation improves dye spectral resolution.

Nested PCR

The disclosed methods can further utilize nested PCR. Nested PCR increases the specificity of DNA amplification, by reducing background due to non-specific amplification of DNA. Two sets of primers are being used in two successive PCRs. In the first reaction, one pair of primers is used to generate DNA products, which besides the intended target, may still consist of non-specifically amplified DNA fragments. The product(s) are then used in a second PCR with a set of primers whose binding sites are completely or partially different from and located 3' of each of the primers used in the first reaction. Nested PCR is often more successful in specifically amplifying long DNA fragments than conventional PCR, but it requires more detailed knowledge of the target sequences.

Thus, disclosed herein in one aspect are methods of diagnosing an ROS1 related cancer in a subject comprising conducting a PCR reaction on DNA from a tissue sample from the subject; wherein the PCR reaction comprises a reverse primer capable of specifically hybridizing to one or more ROS1 sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROS1 related cancer.

Primers and Probes

As used herein, "primers" are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.

As used herein, "probes" are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art. AS used herein, the probes can comprise a reporter dye on the end thereof and a quencher dye on the another end thereof.

Disclosed are compositions including primers and probes, which are capable of interacting with the disclosed nucleic acids such as SEQ ID NO: 1 or its complement such as those listed in Table 7 (e.g., SEQ ID NOs: 4, 5, 7, 8, 12, 13, 14, 15, 16, 17, 18, 20, and 21 which are primers that interact with SEQ ID NO: 1 and SEQ ID NOs: 6, 8, 19, and 22 which are probes that interact with SEQ ID NO: 1). The disclosed primers and probes can be used in any of the disclosed methods for diagnosing a ROS1 related cancer disclosed herein as well as the methods for determining whether a cancer is susceptible or resistant to treatment with a ROS1 inhibitor. In certain embodiments the primers are used to support nucleic acid extension reactions, nucleic acid replication reactions, and/or nucleic acid amplification reactions. Typically the primers will be capable of being extended in a sequence specific manner. Extension of a primer in a sequence specific manner includes any methods wherein the sequence and/or composition of the nucleic acid molecule to which the primer is hybridized or otherwise associated directs or influences the composition or sequence of the product produced by the extension of the primer. Extension of the primer in a sequence specific manner therefore includes, but is not limited to, PCR, DNA sequencing, DNA extension, DNA polymerization, RNA transcription, or reverse transcription. Techniques and conditions that amplify the primer in a sequence specific manner are disclosed. In certain embodiments the primers are used for the DNA amplification reactions, such as PCR or direct sequencing. It is understood that in certain embodiments the primers can also be extended using non-enzymatic techniques, where for example, the nucleotides or oligonucleotides used to extend the primer are modified such that they will chemically react to extend the primer in a sequence specific manner. Typically the disclosed primers hybridize with the disclosed nucleic acids or region of the nucleic acids or they hybridize with the complement of the nucleic acids or complement of a region of the nucleic acids. As an example of the use of primers, one or more primers can be used to create extension products from and templated by a first nucleic acid.

The size of the primers or probes for interaction with the nucleic acids can be any size that supports the desired enzymatic manipulation of the primer, such as DNA amplification or the simple hybridization of the probe or primer. A typical primer or probe would be at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long.

In other embodiments a primer or probe can be less than or equal to 6, 7, 8, 9, 10, 11, 12 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long.

The primers for the nucleic acid of interest typically will be used to produce extension products and/or other replicated or amplified products that contain a region of the nucleic acid of interest. The size of the product can be such that the size can be accurately determined to within 3, or 2 or 1 nucleotides.

In certain embodiments the product can be, for example, at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long.

In other embodiments the product can be, for example, less than or equal to 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1250, 1500, 1750, 2000, 2250, 2500, 2750, 3000, 3500, or 4000 nucleotides long.

Thus, it is understood and herein contemplated that the disclosed RT-PCR and PCR reactions require at least one forward primer and/or at least one reverse primer to amplify target nucleic acid. Herein disclosed, the forward primer can be, for example, an intracellular (i.e., 3' to the ROSl breakpoint) ROSl primer or a ROSl kinase forward primer such as, for example, SEQ ID NO: 4, 7, 15, 17, or 20. The reverse primer can be, for example, ROSl kinase reverse primer such as, for example, SEQ ID NO: 5, 8, 12, 16, 18, or 21. It is understood that the methods can comprise at least one forward primer and a reverse primer. Thus, disclosed herein are methods of diagnosing a ROSl related cancer in a subject comprising conducting a real-time PCR, RT-PCR, or other PCR reaction on nucleic acid such as mRNA or DNA from a tissue sample from the subject; wherein the polymerase chain reaction (RT-PCR) comprises one or more reverse primers capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; wherein the forward primer can be, for example, a CD74-ROS1 primer (such as, for example, SEQ ID NO: 2 and 10), a FIG-ROS1 primer, a SLC34A2-ROS (short) primer, a SLC34A2-ROS (short and long) primer (such as, for example, SEQ ID NOs: 3 and 11), a SLC34A2-ROS (long) primer, a ROSl kinase primer (such as, for example, SEQ ID NOs: 4, 7, 15, or 17), and/or a wild-type ROSl primer including wild-type ROSl primers that bind 5' to the fusion breakpoint (such as, for example SEQ ID NO. 13 or 20); and wherein an increase in the amount of amplification product of the ROSl kinase relative to a control without a corresponding increase in wild-type ROSl indicates the presence of an ROSl related cancer. Where a primer that binds to a ROSl fusion partner is used, the presence of a known ROSl -fusion related cancer is indicated by an increase in the amount of

amplification product of the ROSl kinase and an increase in amplification of the fusion partner relative to a control. It is understood that amplification of the fusion partner can occur through the use of a primer pair comprising reverse primer that hybridizes ROS1 3 ' to the break point and a forward primer the hybridizes to the fusion partner 5' of the breakpoint or a forward primer that hybridizes to the fusion partner only. In methods using a primer pair consisting of a forward primer that binds to the fusion partner and a reverse primer that binds to ROS 1 3' of the fusion breakpoint, the detection of both ROS1 and the fusion partner in the amplicon, the detection of an amplicon of the appropriate size for a amplicon comprising a fusion between the primers, or detection of amplicon in an amount greater than controls using only the forward or reverse primer indicates a ROS1 fusion. Where a primer pair with a forward primer binding to the fusion partner is used a primer pair that hybridizes to ROS1 5' to the breakpoint serves as a control against

misidentification of a fusion event and determination of unknown fusions. Alternatively, in one aspect, the methods disclosed herein can comprise the use of only a forward primer that binds to the fusion partner to amplify a nucleic acid from the subject in a first reaction and a primer pair that binds to ROS1 3 ' of the fusion breakpoint to amplify the amplicon of the first reaction, where amplicon containing ROS1 sequences indicates the presence of an ROS1 related cancer.

In another aspect, also disclosed are methods of diagnosing a ROS1 related cancer in a subject comprising conducting a real-time PCR, RT-PCR, or other PCR reaction on nucleic acid such as mRNA or DNA from a tissue sample from the subject; wherein the polymerase chain reaction comprises one or more reverse primers capable of specifically hybridizing to one or more ROS1 sequences and at least one forward primer; wherein the forward primer is an external wild-type ROS1 primer (i.e., 5' to the fusion breakpoint), and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROS1 related cancer.

It is understood and herein contemplated that there are situations where it may be advantageous to utilize more than one primer pair to detect the presence of a fusion, truncation, or over expression mutation. Such real-time PCR, RT-PCR or other PCR reactions can be conducted separately, or in a single reaction. When multiple primer pairs are placed into a single reaction, this is referred to as "multiplex PCR." For example, the reaction can comprise a wild-type ROS1 primer paired with a reverse primer, as well as, an ROS1 kinase primer paired with the same reverse primer. Thus, disclosed herein are methods of diagnosing a ROSl related cancer in a subject comprising conducting an realtime or RT-PCR reaction on mRNA from a tissue sample from the subject; wherein the polymerase chain reaction comprises a reverse primer capable of specifically hybridizing to one or more ROS1 sequences and at least two forward primers; and wherein an increase in the amount of amplification product relative to a control for the ROS 1 kinase, but not both primers indicates the presence of an ROS1 related cancer. Similarly disclosed are methods comprising at least three forward primers. It is understood and herein contemplated that any combination of two or more or thee or more the forward primers disclosed herein can be used in the multiplex reaction. Thus, for example, disclosed herein are methods of diagnosing wherein the forward primers are a ROS1 fusion primer (such as, for example, CD74-ROS1, FIG-ROS1, or SLC34-ROS 1), a ROS1 kinase primer and a wild-type ROS1 primer.

Also disclosed herein are methods of diagnosing a ROS1 related cancer in a subject with a cancer, comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting a nucleic acid amplification process on the nucleic acid, and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROS1 and ROS1 kinase domain in the tissue sample, wherein the amplification process is PCR on cDNA or real-time PCR, RT-PCR, or real-time RT-PCR on mRNA, wherein the PCR, RT-PCR, real-time PCR, or real-time RT-PCR reaction comprises the use of a forward and reverse primer pair that specifically hybridizes to a wild-type ROS1 sequence (such as, for example, primers that bind to the extracellular domain of ROS1, such as the forward primers SEQ ID NOs: 13 and 20 and the reverse primers SEQ ID NOs: 14 and 21) and a forward and reverse primer pair that specifically hybridizes to a wild-type ROS1 kinase domain sequence (such as, for example, the forward primers SEQ ID NO: 4, 7, 13, 15, 17, or 20 and the reverse primers (SEQ ID NOs: 5, 8, 12, 14, 16, 18, or 21). It is understood that any combination of forward and reverse primer for a particular wild-type ROS1 or ROS1 kinase domain can be used. For example, the forward and reverse primer pair for the wild-type ROS 1 (e.g., the ECD of ROS 1) can be SEQ ID

NOs: 13 and 14; SEQ ID NOs: 13 and 21 ; SEQ ID NOs: 20 and 21; or SEQ ID NOs: 20 and 14. Similarly, the primers specific for the kinase domain of ROS 1 can be any combination of forward and reverse primers for the kinase domain such as, for example SEQ ID NOs: 4 and 5; SEQ ID NOs: 4 and 8; SEQ ID NOs: 4 and 14; SEQ ID NOs: 4 and 16; SEQ ID NOs: 4 and 18; SEQ ID NOs: 4 and 21 ; SEQ ID NOs: 7 and 5; SEQ ID NOs: 7 and 8; SEQ ID NOs: 7 and 14; SEQ ID NOs: 7 and 16; SEQ ID NOs: 7 and 18; SEQ ID NOs: 7 and 21; SEQ ID NOs: 13 and 5; SEQ ID NOs: 13 and 8; SEQ ID NOs: 13 and 14; SEQ ID NOs: 13 and 16; SEQ ID NOs: 13 and 18; SEQ ID NOs: 13 and 21 ; SEQ ID NOs: 15 and 5; SEQ ID NOs: 15 and 8; SEQ ID NOs: 15 and 14; SEQ ID NOs: 15 and 16; SEQ ID NOs: 15 and 18; SEQ ID NOs: 15 and 21 ; SEQ ID NOs: 17 and 5; SEQ ID NOs: 17 and 8; SEQ ID NOs: 17 and 14; SEQ ID NOs: 17 and 16; SEQ ID NOs: 17 and 18; SEQ ID NOs: 17 and 21 ; SEQ ID NOs: 20 and 5; SEQ ID NOs: 20 and 8; SEQ ID NOs: 20 and 14; SEQ ID NOs: 20 and 16; SEQ ID NOs: 20 and 18; and SEQ ID NOs: 20 and 21.

Fluorescent Change Probes and Primers

Fluorescent change probes and fluorescent change primers refer to all probes and primers that involve a change in fluorescence intensity or wavelength based on a change in the form or conformation of the probe or primer and nucleic acid to be detected, assayed or replicated. Examples of fluorescent change probes and primers include molecular beacons, Amplifluors, FRET probes, cleavable FRET probes, TaqMan probes, scorpion primers, fluorescent triplex oligos including but not limited to triplex molecular beacons or triplex FRET probes, fluorescent water-soluble conjugated polymers, PNA probes and QPNA probes.

Fluorescent change probes and primers can be classified according to their structure and/or function. Fluorescent change probes include hairpin quenched probes, cleavage quenched probes, cleavage activated probes, and fluorescent activated probes. Fluorescent change primers include stem quenched primers and hairpin quenched primers.

Hairpin quenched probes are probes that when not bound to a target sequence form a hairpin structure (and, typically, a loop) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched. When the probe binds to a target sequence, the stem is disrupted, the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. Examples of hairpin quenched probes are molecular beacons, fluorescent triplex oligos, triplex molecular beacons, triplex FRET probes, and QPNA probes.

Cleavage activated probes are probes where fluorescence is increased by cleavage of the probe. Cleavage activated probes can include a fluorescent label and a quenching moiety in proximity such that fluorescence from the label is quenched. When the probe is clipped or digested (typically by the 5'-3' exonuclease activity of a polymerase during amplification), the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. TaqMan probes are an example of cleavage activated probes.

Cleavage quenched probes are probes where fluorescence is decreased or altered by cleavage of the probe. Cleavage quenched probes can include an acceptor fluorescent label and a donor moiety such that, when the acceptor and donor are in proximity, fluorescence resonance energy transfer from the donor to the acceptor causes the acceptor to fluoresce. The probes are thus fluorescent, for example, when hybridized to a target sequence. When the probe is clipped or digested (typically by the 5'-3' exonuclease activity of a polymerase during amplification), the donor moiety is no longer in proximity to the acceptor fluorescent label and fluorescence from the acceptor decreases. If the donor moiety is itself a fluorescent label, it can release energy as fluorescence (typically at a different wavelength than the fluorescence of the acceptor) when not in proximity to an acceptor. The overall effect would then be a reduction of acceptor fluorescence and an increase in donor fluorescence. Donor fluorescence in the case of cleavage quenched probes is equivalent to fluorescence generated by cleavage activated probes with the acceptor being the quenching moiety and the donor being the fluorescent label. Cleavable FRET (fluorescence resonance energy transfer) probes are an example of cleavage quenched probes.

Fluorescent activated probes are probes or pairs of probes where fluorescence is increased or altered by hybridization of the probe to a target sequence. Fluorescent activated probes can include an acceptor fluorescent label and a donor moiety such that, when the acceptor and donor are in proximity (when the probes are hybridized to a target sequence), fluorescence resonance energy transfer from the donor to the acceptor causes the acceptor to fluoresce. Fluorescent activated probes are typically pairs of probes designed to hybridize to adjacent sequences such that the acceptor and donor are brought into proximity. Fluorescent activated probes can also be single probes containing both a donor and acceptor where, when the probe is not hybridized to a target sequence, the donor and acceptor are not in proximity but where the donor and acceptor are brought into proximity when the probe hybridized to a target sequence. This can be accomplished, for example, by placing the donor and acceptor on opposite ends of the probe and placing target complement sequences at each end of the probe where the target complement sequences are complementary to adjacent sequences in a target sequence. If the donor moiety of a fluorescent activated probe is itself a fluorescent label, it can release energy as fluorescence (typically at a different wavelength than the fluorescence of the acceptor) when not in proximity to an acceptor (that is, when the probes are not hybridized to the target sequence). When the probes hybridize to a target sequence, the overall effect would then be a reduction of donor fluorescence and an increase in acceptor fluorescence. FRET probes are an example of fluorescent activated probes.

Stem quenched primers are primers that when not hybridized to a complementary sequence form a stem structure (either an intramolecular stem structure or an intermolecular stem structure) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched. When the primer binds to a complementary sequence, the stem is disrupted, the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. In the disclosed method, stem quenched primers are used as primers for nucleic acid synthesis and thus become incorporated into the synthesized or amplified nucleic acid. Examples of stem quenched primers are peptide nucleic acid quenched primers and hairpin quenched primers.

Peptide nucleic acid quenched primers are primers associated with a peptide nucleic acid quencher or a peptide nucleic acid fluor to form a stem structure. The primer contains a fluorescent label or a quenching moiety and is associated with either a peptide nucleic acid quencher or a peptide nucleic acid fluor, respectively. This puts the fluorescent label in proximity to the quenching moiety. When the primer is replicated, the peptide nucleic acid is displaced, thus allowing the fluorescent label to produce a fluorescent signal.

Hairpin quenched primers are primers that when not hybridized to a complementary sequence form a hairpin structure (and, typically, a loop) that brings a fluorescent label and a quenching moiety into proximity such that fluorescence from the label is quenched. When the primer binds to a complementary sequence, the stem is disrupted, the quenching moiety is no longer in proximity to the fluorescent label and fluorescence increases. Hairpin quenched primers are typically used as primers for nucleic acid synthesis and thus become incorporated into the synthesized or amplified nucleic acid. Examples of hairpin quenched primers are Amplifluor primers and scorpion primers.

Cleavage activated primers are similar to cleavage activated probes except that they are primers that are incorporated into replicated strands and are then subsequently cleaved.

Labels

To aid in detection and quantitation of nucleic acids produced using the disclosed methods, labels can be directly incorporated into nucleotides and nucleic acids or can be coupled to detection molecules such as probes and primers. As used herein, a label is any molecule that can be associated with a nucleotide or nucleic acid, directly or indirectly, and which results in a measurable, detectable signal, either directly or indirectly. Many such labels for incorporation into nucleotides and nucleic acids or coupling to nucleic acid probes are known to those of skill in the art. Examples of labels suitable for use in the disclosed method are radioactive isotopes, fluorescent molecules, phosphorescent molecules, enzymes, antibodies, and ligands. Fluorescent labels, especially in the context of fluorescent change probes and primers, are useful for real-time detection of amplification. Examples of suitable fluorescent labels include fluorescein isothiocyanate (FITC), 5,6-carboxymethyl fluorescein, Texas red, nitrobenz-2-oxa-l,3-diazol-4-yl ( BD), coumarin, dansyl chloride, rhodamine, amino-methyl coumarin (AMCA), Eosin, Erythrosin, BODIPY^®, CASCADE BLUE^®, OREGON GREEN^®, pyrene, lissamine, xanthenes, acridines, oxazines, phycoerythrin, macrocyclic chelates of lanthanide ions such as quantum dye™, fluorescent energy transfer dyes, such as thiazole orange-ethidium heterodimer, and the cyanine dyes Cy3, Cy3.5, Cy5, Cy5.5 and Cy7. Examples of other specific fluorescent labels include 3-Hydroxypyrene 5,8,10-Tri Sulfonic acid, 5-Hydroxy Tryptamine (5-HT), Acid Fuchsin, Alizarin Complexon, Alizarin Red, Allophycocyanin, Aminocoumarin, Anthroyl Stearate, Astrazon Brilliant Red 4G, Astrazon Orange R, Astrazon Red 6B,

Astrazon Yellow 7 GLL, Atabrine, Auramine, Aurophosphine, Aurophosphine G, BAO 9 (Bisaminophenyloxadiazole), BCECF, Berberine Sulphate, Bisbenzamide, Blancophor FFG Solution, Blancophor SV, Bodipy Fl, Brilliant Sulpho flavin FF, Calcien Blue, Calcium Green, Calcofluor RW Solution, Calcofluor White, Calcophor White ABT Solution, Calcophor White Standard Solution, Carbostyryl, Cascade Yellow, Catecholamine,

Chinacrine, Coriphosphine O, Coumarin-Phalloidin, CY3.1 8, CY5.1 8, CY7, Dans (1- Dimethyl Amino Naphaline 5 Sulphonic Acid), Dansa (Diamino Naphtyl Sulphonic Acid), Dansyl NH-CH3, Diamino Phenyl Oxydiazole (DAO), Dimethylamino-5-Sulphonic acid, Dipyrrometheneboron Difluoride, Diphenyl Brilliant Flavine 7GFF, Dopamine, Erythrosin ITC, Euchrysin, FIF (Formaldehyde Induced Fluorescence), Flazo Orange, Fluo 3,

Fluorescamine, Fura-2, Genacryl Brilliant Red B, Genacryl Brilliant Yellow 10GF, Genacryl Pink 3G, Genacryl Yellow 5GF, Gloxalic Acid, Granular Blue,

Haematoporphyrin, Indo-1, Intrawhite Cf Liquid, Leucophor PAF, Leucophor SF,

Leucophor WS, Lissamine Rhodamine B200 (RD200), Lucifer Yellow CH, Lucifer Yellow VS, Magdala Red, Marina Blue, Maxilon Brilliant Flavin 10 GFF, Maxilon Brilliant Flavin 8 GFF, MPS (Methyl Green Pyronine Stilbene), Mithramycin, NBD Amine,

Nitrobenzoxadidole, Noradrenaline, Nuclear Fast Red, Nuclear Yellow, Nylosan Brilliant Flavin E8G, Oxadiazole, Pacific Blue, Pararosaniline (Feulgen), Phorwite AR Solution, Phorwite BKL, Phorwite Rev, Phorwite RPA, Phosphine 3R, Phthalocyanine,

Phycoerythrin R, Phycoerythrin B, Polyazaindacene Pontochrome Blue Black, Porphyrin, Primuline, Procion Yellow, Pyronine, Pyronine B, Pyrozal Brilliant Flavin 7GF, Quinacrine Mustard, Rhodamine 123, Rhodamine 5 GLD, Rhodamine 6G, Rhodamine B, Rhodamine B 200, Rhodamine B Extra, Rhodamine BB, Rhodamine BG, Rhodamine WT, Serotonin, Sevron Brilliant Red 2B, Sevron Brilliant Red 4G, Sevron Brilliant Red B, Sevron Orange, Sevron Yellow L, SITS (Primuline), SITS (Stilbene Isothiosulphonic acid), Stilbene, Snarf 1, sulpho Rhodamine B Can C, Sulpho Rhodamine G Extra, Tetracycline, Thiazine Red R, Thioflavin S, Thioflavin TCN, Thioflavin 5, Thiolyte, Thiozol Orange, Tinopol CBS, True Blue, Ultralite, Uranine B, Uvitex SFC, Xylene Orange, and XRITC.

The absorption and emission maxima, respectively, for some of these fluors are:

FITC (490 nm; 520 nm), Cy3 (554 nm; 568 nm), Cy3.5 (581 nm; 588 nm), Cy5 (652 nm: 672 nm), Cy5.5 (682 nm; 703 nm) and Cy7 (755 nm; 778 nm), thus allowing their simultaneous detection. Other examples of fluorescein dyes include 6-carboxyfluorescein (6-FAM), 2',4',1,4,-tetrachlorofluorescein (TET), 2',4',5',7',1,4-hexachlorofluorescein (HEX), 2',7'-dimethoxy-4', 5'-dichloro-6-carboxyrhodamine (JOE), 2'-chloro-5'-fluoro-7',8'- fused phenyl- l,4-dichloro-6-carboxyfluorescein (NED), and 2'-chloro-7'-phenyl-l,4- dichloro-6-carboxyfluorescein (VIC). Fluorescent labels can be obtained from a variety of commercial sources, including Amersham Pharmacia Biotech, Piscataway, NJ; Molecular Probes, Eugene, OR; and Research Organics, Cleveland, Ohio.

Additional labels of interest include those that provide for signal only when the probe with which they are associated is specifically bound to a target molecule, where such labels include: "molecular beacons" as described in Tyagi & Kramer, Nature Biotechnology (1996) 14:303 and EP 0 070 685 B l. Other labels of interest include those described in U.S. Pat. No. 5,563,037 which is incorporated herein by reference.

Labeled nucleotides are a form of label that can be directly incorporated into the amplification products during synthesis. Examples of labels that can be incorporated into amplified nucleic acids include nucleotide analogs such as BrdUrd, aminoallyldeoxyuridine, 5-methylcytosine, bromouridine, and nucleotides modified with biotin or with suitable haptens such as digoxygenin. Suitable fluorescence-labeled nucleotides are Fluorescein- isothiocyanate-dUTP, Cyanine-3-dUTP and Cyanine-5-dUTP. One example of a nucleotide analog label for DNA is BrdUrd (bromodeoxyuridine, BrdUrd, BrdU, BUdR, Sigma- Aldrich Co). Other examples of nucleotide analogs for incorporation of label into DNA are AA-dUTP (aminoallyl-deoxyuridine triphosphate, Sigma-Aldrich Co.), and 5-methyl-dCTP (Roche Molecular Biochemicals). One example of a nucleotide analog for incorporation of label into RNA is biotin- 16-UTP (biotin- 16-uridine-5'-triphosphate, Roche Molecular Biochemicals). Fluorescein, Cy3, and Cy5 can be linked to dUTP for direct labeling.

Cy3.5 and Cy7 are available as avidin or anti-digoxygenin conjugates for secondary detection of biotin- or digoxygenin-labeled probes. Labels that are incorporated into amplified nucleic acid, such as biotin, can be subsequently detected using sensitive methods well-known in the art. For example, biotin can be detected using streptavidin-alkaline phosphatase conjugate (Tropix, Inc.), which is bound to the biotin and subsequently detected by chemiluminescence of suitable substrates (for example, chemiluminescent substrate CSPD: disodium, 3-(4-methoxyspiro-[l,2,- dioxetane-3-2'-(5'-chloro)tricyclo [3.3.1.1³'⁷]decane]-4-yl) phenyl phosphate; Tropix, Inc.). Labels can also be enzymes, such as alkaline phosphatase, soybean peroxidase, horseradish peroxidase and polymerases, that can be detected, for example, with chemical signal amplification or by using a substrate to the enzyme which produces light (for example, a chemiluminescent 1 ,2-dioxetane substrate) or fluorescent signal.

Molecules that combine two or more of these labels are also considered labels. Any of the known labels can be used with the disclosed probes, tags, and method to label and detect nucleic acid amplified using the disclosed method. Methods for detecting and measuring signals generated by labels are also known to those of skill in the art. For example, radioactive isotopes can be detected by scintillation counting or direct visualization; fluorescent molecules can be detected with fluorescent spectrophotometers; phosphorescent molecules can be detected with a spectrophotometer or directly visualized with a camera; enzymes can be detected by detection or visualization of the product of a reaction catalyzed by the enzyme; antibodies can be detected by detecting a secondary label coupled to the antibody. As used herein, detection molecules are molecules which interact with amplified nucleic acid and to which one or more labels are coupled.

It is understood and herein contemplated that one method of assessing whether an increase in a particular mRNA or expression of mRNA has occurred or a particular mRNA is present is by comparison with a control sample. Therefore, contemplated herein are methods of diagnosing a cancer in a subject comprising conducting a real-time PCR, RT-

PCR, or other PCR reaction with mRNA from a tissue sample from the subject; wherein the polymerase chain reaction (RT-PCR) comprises at least one reverse primer capable of specifically hybridizing to one or more ROS1 sequences and at least one forward primer; wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROS1 related cancer; and wherein the control tissue is obtained is a noncancerous tissue. It is further understood that with respect to ROS 1 -related cancers, the use of a non-cancerous tissue control can be utilized but is not necessary as cancerous tissue from a non-ROSl related cancer may also be used. Thus, disclosed herein are diagnosing an ROS1 related cancer in a subject comprising conducting an real-time PCR or reverse transcription-PCR (RT-PCR) reaction on mRNA from a tissue sample from the subject; wherein the polymerase chain reaction comprises a reverse primer capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROSl related cancer; and wherein the control tissue is obtained from non- ROS1 related cancerous tissue.

The disclosed methods can be used to diagnose any disease where uncontrolled cellular proliferation occurs herein referred to as "cancer". A non-limiting list of different types of ROSl related cancers is as follows: lymphomas (Hodgkins and non-Hodgkins), leukemias, carcinomas, carcinomas of solid tissues, squamous cell carcinomas,

adenocarcinomas, sarcomas, gliomas, high grade gliomas, blastomas, neuroblastomas, plasmacytomas, histiocytomas, melanomas, adenomas, hypoxic tumors, myelomas, AIDS- related lymphomas or sarcomas, metastatic cancers, or cancers in general.

A representative but non-limiting list of cancers that the disclosed methods can be used to diagnose is the following: lymphoma, B cell lymphoma, T cell lymphoma, mycosis fungoides, Hodgkin's Disease, myeloid leukemia, bladder cancer, brain cancer, nervous system cancer, head and neck cancer, squamous cell carcinoma of head and neck, kidney cancer, lung cancers such as small cell lung cancer and non-small cell lung carcinoma, neuroblastoma/glioblastoma, ovarian cancer, pancreatic cancer, prostate cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx, and lung, colon cancer, cholangiocarcinoma, colorectal carcinoma, cervical cancer, cervical carcinoma, breast cancer, and epithelial cancer, renal cancer, genitourinary cancer, pulmonary cancer, esophageal carcinoma, head and neck carcinoma, large bowel cancer, hematopoietic cancers; testicular cancer; colon and rectal cancers, prostatic cancer, or pancreatic cancer.

Thus, disclosed herein are methods of diagnosing a cancer wherein the cancer is selected from the group consisting of non-small cell lung carcinoma, diffuse large B-cell lymphoma, , systemic histiocytosis, breast cancer, colorectal carcinoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma,

cholangiocarcinoma, renal carcinoma, colorectal carcinoma, glioblastoma, and

inflammatory myofibroblastic tumors (IMTs). For example, disclosed herein are methods of diagnosing an ROSl related cancer in a subject comprising conducting a real-time PCR, RT-PCR, or other PCR reaction on mRNA from a tissue sample from the subject; wherein the polymerase chain reaction comprises a reverse primer capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; wherein an increase in the amount of amplification product relative to a control indicates the presence of an ROSl related cancer, and wherein the cancer is selected from the group consisting of non-small cell lung carcinoma, diffuse large B-cell lymphoma, systemic histiocytosis, breast cancer, colorectal carcinoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, cholangiocarcinoma, renal carcinoma, colorectal carcinoma, glioblastoma, and inflammatory myofibroblastic tumors (IMTs).

Methods of assessing the suitability of ROSl directed treatments

Though not wishing to be bound by current theories, it is believed that inhibition of these forms oiRTK genes with small-molecule drug candidates abrogates related abnormal cell proliferation and promotes apoptosis in neuroblastoma and other RTK-related tumor cell lines; furthermore, both preclinical animal models and the early clinical experience with these inhibitors indicate that RTK small-molecule inhibitors not only possess marked antitumor activity against RTK-related cancers but are also very well tolerated with no limiting target-associated toxicities.

These discoveries highlight the need for a specialized diagnostic test for ROSl mutations. For example, such an assay may be used to screen children in families affected with hereditary neuroblastoma to help facilitate the detection of tumors at an earlier stage when the tumors are more amenable to treatment. Accordingly, disclosed herein are methods of assessing the suitability of an ROSl inhibitor treatment for a cancer in a subject comprising measuring nucleic acid from a tissue sample from the subject; wherein an increase in the amount oiROSl sequence mRNA relative to a control indicates a cancer that can be treated with an ROSl inhibitor.

It is understood and herein contemplated that any of the disclosed mRNA measuring techniques disclosed herein can be used in these methods. Thus, for example, disclosed herein are methods of assessing the suitability of an ROS 1 inhibitor treatment for a cancer in a subject comprising conducting a real-time PCR, RT-PCR, or other PCR reaction with mRNA or DNA from a tissue sample from the subject; wherein the PCR reaction comprises a reverse primer capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; and wherein an increase in the amount of amplification product relative to a control indicates a cancer that can be treated with an ROSl inhibitor. It is further understood that the disclosed methods can further comprise any of the primers disclosed herein and utilize the multiplexing PCR techniques disclosed. thus, in one aspect disclosed herein are methods of assessing the susceptibility or risk for a disease or condition, monitoring disease progression, determination of susceptibility or resistance of a cancer to therapeutic ROSl inhibitor treatment, or determination of suitability of a ROSl inhibitor treatment for a cancer associated with a nucleic acid variation, truncation, or ROSl fusion in a subject comprising detecting the presence or measuring the level or DNA, cDNA, or the expression level of mRNA from a tissue sample from the subject; wherein an increase in the amount of amplification product of ROSl kinase relative to a control absent a corresponding increase in a wild-type ROS l indicates the presence of an ROSl related cancer and therefore a cancer that is susceptible to ROSl inhibitor treatment. Such methods can be accomplished with amplification methods such as PCR, real-time PCR, RT-PCR, or real-time RT-PCR, or by conducting a in situ hybridization methods such as FISH.

In one aspect, disclosed herein are methods for determining the susceptibility or resistance to therapeutic treatment of a cancer to a ROSl inhibitor or suitability of a ROSl inhibitor treatment for a cancer in a subject with a cancer comprising detecting the presence of ROSl kinase activity. Thus, for example, disclosed herein are methods of determining the susceptibility or resistance to therapeutic treatment for an ROS l related cancer or suitability for a cancer to be treated with a ROSl inhibitor in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting RT-PCR, real-time PCR, or real-time RT-PCR on the nucleic acid, and detecting the presence of or measuring the amount of nucleic acid associated with wild-type ROSl and ROSl kinase domain in the tissue sample, wherein the RT-PCR or real-time PCR reaction comprises the use of a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl sequence (e.g., an extracellular domain sequence of ROSl, such as, SEQ ID NOs: 13, 14, 20 and 21) and/or a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl kinase domain sequence (e.g., SEQ ID SOs: 4, 5, 7, 8, 15, 16, 17, and 18), and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROSl and ROSl kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS 1 related cancer and is therefore susceptible to treatment with a ROS 1 inhibitor. Absence of amplicon or amplicon levels equivalent to normal controls indicates that the cancer is not susceptible to ROSl treatment and would be resistant to such treatment. Also disclosed are methods for determining the susceptibility or resistance to therapeutic treatment for a ROSl -related cancer or suitability for a cancer to be treated with a ROS1 inhibitor in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, wherein the nucleic acid from the tissue sample is RNA, wherein the method further comprises synthesizing cDNA from the RNA sample, conducting PCR on the cDNA; and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROS1 and ROS1 kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROS 1 related cancer. In a further aspect, the disclosed methods can utilize a probe that is complementary to a sequence with the product of the real-time RT-PCR (e.g., SEQ DI NOs: 6, 8, 19, and 22) or the method can comprise determining the cycle thresholds (Ct) values for wild-type ROS1 and wild-type ROS1 kinase; wherein a high (Ct) value for wild-type ROS1 relative to ROS1 kinase indicates the presence of a fusion and therefore indicates that the cancer is susceptible to treatment with a ROS1 inhibitor or that a ROS1 inhibitory treatment is suitable for that cancer. Where a probe is used, it is understood that the probe can comprise a reporter dye on the end thereof and a quencher dye on the another end thereof. When a cancer is determined to be susceptible to or suitable for treatment with ROS 1 inhibitors, also disclosed are methods further comprising administering to a subject with a cancer susceptible to ROS1 inhibitor treatment, a ROS1 inhibitor. Conversely, where the cancer is not susceptible to ROS1 inhibitors, the method can further comprise treating the subject with the cancer using a form of treatment other than a ROS 1 inhibitor.

In a further alternative method for determining the susceptibility or resistance to therapeutic treatment for a ROS1 -related cancer or suitability for a cancer to be treated with a ROS 1 inhibitor in a subject with a cancer, ROS 1 fusions are detected by qPCR methodology using a two-step detection where the wherein only a forward primer which binds to a ROS 1 fusion partner is used in a first reaction and wherein in a second reaction following the first reaction the amplicon from the first reaction is used as a template for a second amplification, a probe based detection, or a sequencing reaction, wherein the probes or primers used are specific for ROS1 3' to a fusion breakpoint, and wherein detection of ROS1 in the amplicon from the second reaction indicates a ROS1 fusion and therefore a

ROS1 related cancer susceptible to ROS1 inhibitor treatment. Also, disclosed are methods for determining the susceptibility or resistance to therapeutic treatment for a ROS1 -related cancer or suitability for a cancer to be treated with a ROS1 inhibitor in a subject with a cancer comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting a first amplification reaction using a forward primer which binds to a ROSl fusion partner; wherein the amplicon from the first reaction is used as a template for a second amplification reaction; conducting a second amplification reaction following the first reaction, wherein primers specific for a ROS l sequence 3' of the fusion breakpoint are used in the second amplification reaction (e.g., SEQ ID NOs: 4, 5, 7, 8, 15, 16, 17, and 18); and detecting the presence of ROSl in the amplicon from the second reaction; wherein detection of ROS l in the amplicon from the second reaction indicates the presence of a ROSl fusion; and detecting the presence of nucleic acid associated with ROSl kinase domain in the tissue sample, wherein the presence of an amplicon indicates the that the subject would be susceptible to treatment with a ROS l inhibitor and absence of the amplicon would indicate that the cancer is resistant or not susceptible to ROSl inhibitor treatment. When a cancer is determined to be susceptible to or suitable for treatment with ROSl inhibitors, also disclosed are methods further comprising administering to a subject with a cancer susceptible to ROSl inhibitor treatment, a ROSl inhibitor. Conversely, where the cancer is not susceptible to ROS l inhibitors, the method can further comprise treating the subject with the cancer using a form of treatment other than a ROS l inhibitor. Methods of Screening

The ROSl -fusions disclosed herein are targets for cancer treatments. Thus, disclosed herein are method of screening for an agent that inhibits an ROSl related cancer in a subject comprising

a) obtaining a tissue sample from a subject with an ROSl related cancer;

b) extracting mRNA from the tissue sample;

c) contacting the tissue sample with the agent;

d) conducting an real-time PCR, RT-PCR, or other PCR reaction on the mRNA from the tissue sample;

wherein the RT-PCR reaction comprises a reverse primer capable of specifically hybridizing to one or more ROSl sequences and at least one forward primer; and wherein a decrease in the amount of amplification product indicative of a ROSl fusion relative to an untreated control indicates an agent that can inhibit an ROS 1 related cancer. It is understood and herein contemplated that one measure of effective treatment by the agent is a decrease in Cycle threshold of an amplicon of ROSl 5' to a fusion breakpoint relative to untreated controls. It is understood and herein contemplated that the process of performing a RT-PCR reaction involves the synthesis of cDNA from the isolated RNA and performing PCR on the cDNA. Nucleic Acids

The disclosed method and compositions make use of various nucleic acids.

Generally, any nucleic acid can be used in the disclosed method. For example, the disclosed nucleic acids of interest and the disclosed reference nucleic acids can be chosen based on the desired analysis and information that is to be obtained or assessed. The disclosed methods also produce new and altered nucleic acids. The nature and structure of such nucleic acids will be established by the manner in which they are produced and manipulated in the methods. Thus, for example, extension products and hybridizing nucleic acids are produced in the disclosed methods. As used herein, hybridizing nucleic acids are hybrids of extension products and the second nucleic acid.

It is understood and contemplated herein that a nucleic acid of interest can be any nucleic acid to which the determination of the presence or absence of nucleotide variation is desired. Thus, for example, the nucleic acid of interest can comprise a sequence that corresponds to the wild-type sequence of the reference nucleic acid. It is further disclosed herein that the disclosed methods can be performed where the first nucleic acid is a reference nucleic acid and the second nucleic acid is a nucleic acid of interest or where the first nucleic acid is the nucleic acid of interest and the second nucleic acid is the reference nucleic acid.

It is understood and herein contemplated that a reference nucleic acid can be any nucleic acid against which a nucleic acid of interest is to be compared. Typically, the reference nucleic acid has a known sequence (and/or is known to have a sequence of interest as a reference). Although not required, it is useful if the reference sequence has a known or suspected close relationship to the nucleic acid of interest. For example, if a single nucleotide variation is desired to be detected, the reference sequence can be usefully chosen to be a sequence that is a homolog or close match to the nucleic acid of interest, such as a nucleic acid derived from the same gene or genetic element from the same or a related organism or individual. Thus, for example, it is contemplated herein that the reference nucleic acid can comprise a wild-type sequence or alternatively can comprise a known mutation including, for example, a mutation the presence or absence of which is associated with a disease or resistance to therapeutic treatment. Thus, for example, it is contemplated that the disclosed methods can be used to detect or diagnose the presence of known mutations in a nucleic acid of interest by comparing the nucleic acid of interest to a reference nucleic acid that comprises a wild-type sequence (i.e., is known not to possess the mutation) and examining for the presence or absence of variation in the nucleic acid of interest, where the absence of variation would indicate the absence of a mutation.

Alternatively, the reference nucleic acid can possess a known mutation. Thus, for example, it is contemplated that the disclosed methods can be used to detect susceptibility for a disease or condition by comparing the nucleic acid of interest to a reference nucleic acid comprising a known mutation that indicates susceptibility for a disease and examining for the presence or absence of the mutation, wherein the presence of the mutation indicates a disease.

Herein, the term "nucleotide variation" refers to any change or difference in the nucleotide sequence of a nucleic acid of interest relative to the nucleotide sequence of a reference nucleic acid. Thus, a nucleotide variation is said to occur when the sequences between the reference nucleic acid and the nucleic acid of interest (or its complement, as appropriate in context) differ. Thus, for example, a substitution of an adenine (A) to a guanine (G) at a particular position in a nucleic acid would be a nucleotide variation provided the reference nucleic acid comprised an A at the corresponding position. It is understood and herein contemplated that the determination of a variation is based upon the reference nucleic acid and does not indicate whether or not a sequence is wild-type. Thus, for example, when a nucleic acid with a known mutation is used as the reference nucleic acid, a nucleic acid not possessing the mutation (including a wild-type nucleic acid) would be considered to possess a nucleotide variation (relative to the reference nucleic acid). Nucleotides

The disclosed methods and compositions make use of various nucleotides.

Throughout this application and the methods disclosed herein reference is made to the type of base for a nucleotide. It is understood and contemplated herein that where reference is made to a type of base, this refers a base that in a nucleotide in a nucleic acid strand is capable of hybridizing (binding) to a defined set of one or more of the canonical bases.

Thus, for example, where reference is made to extension products extended in the presence of three types of nuclease resistant nucleotides and not in the presence of nucleotides that comprise the same type of base as the modified nucleotides, this means that if, for example, the base of the modified nucleotide was an adenine (A), the nuclease-resistant nucleotides can be, for example, guanine (G), thymine (T), and cytosine (C). Each of these bases

(which represent the four canonical bases) is capable of hybridizing to a different one of the four canonical bases and thus each qualify as a different type of base as defined herein. As another example, inosine base pairs primarily with adenine and cytosine (in DNA) and thus can be considered a different type of base from adenine and from cytosine- which base pair with thymine and guanine, respectively-but not a different type of base from guanine or thymine-which base pair with cytosine and adenine, respectively -because the base pairing of guanine and thymine overlaps (that is, is not different from) the hybridization pattern of inosine

Any type of modified or alternative base can be used in the disclosed methods and compositions, generally limited only by the capabilities of the enzymes used to use such bases. Many modified and alternative nucleotides and bases are known, some of which are described below and elsewhere herein. The type of base that such modified and alternative bases represent can be determined by the pattern of base pairing for that base as described herein. Thus for example, if the modified nucleotide was adenine, any analog, derivative, modified, or variant base that based pairs primarily with thymine would be considered the same type of base as adenine. In other words, so long as the analog, derivative, modified, or variant has the same pattern of base pairing as another base, it can be considered the same type of base. Modifications can be made to the sugar or phosphate groups of a nucleotide. Generally such modifications will not change the base pairing pattern of the base.

However, the base pairing pattern of a nucleotide in a nucleic acid strand determines the type of base of the base in the nucleotide.

Modified nucleotides to be incorporated into extension products and to be selectively removed by the disclosed agents in the disclosed methods can be any modified nucleotide that functions as needed in the disclosed method as is described elsewhere herein. Modified nucleotides can also be produced in existing nucleic acid strands, such as extension products, by, for example, chemical modification, enzymatic modification, or a combination.

Many types of nuclease-resistant nucleotides are known and can be used in the disclosed methods. For example, nucleotides have modified phosphate groups and/or modified sugar groups can be resistant to one or more nucleases. Nuclease-resistance is defined herein as resistance to removal from a nucleic acid by any one or more nucleases. Generally, nuclease resistance of a particular nucleotide can be defined in terms of a relevant nuclease. Thus, for example, if a particular nuclease is used in the disclosed method, the nuclease-resistant nucleotides need only be resistant to that particular nuclease. Examples of useful nuclease-resistant nucleotides include thio-modified nucleotides and borano-modified nucleotides.

There are a variety of molecules disclosed herein that are nucleic acid based. Non- limiting examples of these and other molecules are discussed herein. It is understood that for example, a nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage. The base moiety of a nucleotide can be adenine-9-yl (adenine, A), cytosine-l-yl (cytosine, C), guanine-9-yl (guanine, G), uracil- 1- yl (uracil, U), and thymin-l-yl (thymine, T). The sugar moiety of a nucleotide is a ribose or a deoxyribose. The phosphate moiety of a nucleotide is pentavalent phosphate. A non- limiting example of a nucleotide would be 3'-AMP (3'-adenosine monophosphate) or 5'- GMP (5'-guanosine monophosphate).

A nucleotide analog is a nucleotide which contains some type of modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (ψ), hypoxanthin-9-yl (inosine, I), and

2-aminoadenin-9-yl. A modified base includes but is not limited to 5-methylcytosine (5- me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3- deazaadenine. Additional base modifications can be found for example in U.S. Pat. No. 3,687,808, which is incorporated herein in its entirety for its teachings of base

modifications. Certain nucleotide analogs, such as 5-substituted pyrimidines, 6- azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine can increase the stability of duplex formation. Often time base modifications can be combined with for example a sugar modification, such as 2'-0-methoxyethyl, to achieve unique properties such as increased duplex stability.

Nucleotide analogs can also include modifications of the sugar moiety.

Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted CI to CIO, alkyl or C2 to CIO alkenyl and alkynyl. 2' sugar modifications also include but are not limited to -0[(CH2)n 0]m CH3, - 0(CH2)n OCH3, -0(CH2)n NH2, -0(CH2)n CH3, -0(CH2)n -ONH2, and - 0(CH2)nON[(CH2)n CH3)]2, where n and m are from 1 to about 10.

Other modifications at the 2' position include but are not limited to: CI to CIO lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, CI, Br, CN, CF3, OCF3, SOCH3, S02 CH3, ON02, N02, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties. Similar

modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. It is understood that these phosphate or modified phosphate linkage between two nucleotides can be through a 3 '-5' linkage or a 2 '-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3 ' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

It is understood that nucleotide analogs need only contain a single modification, but may also contain multiple modifications within one of the moieties or between different moieties.

Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson- Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.

Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones;

methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

It is also understood in a nucleotide substitute that both the sugar and the phosphate moieties of the nucleotide can be replaced, by for example an amide type linkage

(aminoethylglycine) (PNA). United States patents 5,539,082; 5,714,331 ; and 5,719,262 teach how to make and use PNA molecules, each of which is herein incorporated by reference.

It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an

octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

A Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute. The Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.

A Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA. The Hoogsteen face includes the N7 position and reactive groups ( H2 or O) at the C6 position of purine nucleotides.

Hybridization/Selective Hybridization

The term hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene. Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide. The hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.

Parameters for selective hybridization between two nucleic acid molecules are well known to those of skill in the art. For example, in some embodiments selective

hybridization conditions can be defined as stringent hybridization conditions. For example, stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps. For example, the conditions of

hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-R A and RNA-RNA

hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. A preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C. Stringency of hybridization and washing, if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for. Likewise, stringency of hybridization and washing, if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.

Another way to define selective hybridization is by looking at the amount

(percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65,

70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93,

94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid. Typically, the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their ka, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their ka.

Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70,

71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94,

95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended. Conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation.

Just as with homology, it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80%

hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.

It is understood that those of skill in the art understand that if a composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein. Kits

Disclosed herein are kits that are drawn to reagents that can be used in practicing the methods disclosed herein. In particular, the kits can include any reagent or combination of reagents discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods. For example, the kits could include one or more primers disclosed herein to perform the extension, replication and amplification reactions discussed in certain embodiments of the methods, as well as the buffers and enzymes required to use the primers as intended.

It is understood that to detect an ROS l related fusion, a reverse primer can be used that hybridizes with wild-type ROS 1. Thus, disclosed herein are kits that include at least one reverse primer wherein the reverse primer hybridizes to a portion of wild-type ROS l such as the kinase domain of wild-type ROSl . Additionally, it is understood that the kits disclosed herein can include one or more forward primers that specifically hybridize to a fusion partner of ROSl and/or wild-type ROSl . Thus, for example the forward primer can hybridize to wild-type ROSl, such as a ROSl sequence external to the breakpoint region of ROSl fusions (i.e., 3 ' to the fusion breakpoint), CD74, FIG, SLC34A2, or other fusion partner. One of skill in the art can appreciate that it is suitable to have a kit that comprises more than a singular primer or primer pair and could include, for example, a single reverse primer, such as SEQ ID NO: 5, 8, 12, 14, 15, 18, or 21, and multiple forward primers. Alternatively the kit can include a primer pair for wild-type ROSl external to the fusion breakpoint (i.e., 3 ' to the fusion breakpoint) and a primer pair for ROS l kinase. The kit can further comprise one or more forward primers and/or one or more reverse primers that specifically hybridizes to wild-type ROSl, CD74, FIG, SLC34A2.

Thus, in one aspect, disclosed herein are kits for diagnosing an ROSl related cancer or determining susceptibility of a cancer to a treatment or the suitability of a treatment for a cancer comprising (a) a first primer labeled with a first detection reagent, wherein said first primer is a reverse primer, wherein said reverse primer is one or more polynucleotide(s) that hybridizes, to a first polynucleotide encoding the amino acid sequence of SEQ ID NO 1 or the complement thereof; and (b) at least one second primer, wherein said second primer is a forward primer, wherein said forward primer is one or more polynucleotide(s) that hybridizes to a second polynucleotide encoding wild-type ROSl.

Also disclosed herein are kits comprising one or more forward primers that specifically binds to the ECD of ROS l (for example SEQ ID NOs: 13 and 20). Also disclosed are kits comprising one or more forward primers that specifically bind to the ROS1 kinase domain (for example SEQ ID NOS: 4, 7, 15, or 17). It is understood that kits can comprise one or more forward primers specific to the ECD and kinase domains of ROS1. Also disclosed are kits further comprising one or more reverse primers specific for the ECD of ROS1 (e.g., SEQ ID NOS: 14 and 21). Also are kits comprising one or more reverse primers that specifically bind to the ROS1 kinase domain (for example SEQ ID NOS: 5, 8, 12, 16, and 18). Also disclosed are kits comprising a combination of one or more reverse primers specific to the ECD and kinase domains of ROS 1. It is further understood that any one or more forward primers disclosed herein can be combined in a kit with one or more reverse primers. Thus, disclosed herein are kits comprising one or more forward primers, such as, for example the ROS1 specific forward primers SEQ ID NOS: 4, 7, 13, 15, 17, or 20) and/or one or more ROS 1 specific reverse primers SEQ ID NOs: 5, 8, 12, 14, 16, 18, and 21).

Also disclosed herein are kits comprising one or more polynucleotide probes, wherein said probe(s) are from about 20 to about 30 nucleotides in length and comprises a reporter dye on one end thereof and a quenching dye on another end thereof, such as, for example SEQ ID NO: 6, 9, 19, or 22.

It is understood that the disclosed kits can also include controls to insure the methods disclosed herein are properly functioning and to normalize results between assays. Thus, for example, disclosed herein are positive cDNA controls, negative cDNA controls, and control primer pairs. For example, the disclosed kits can include a control primer pairs for the detection of Homo sapiens ATP synthase, H+ transporting, mitochondrial F 1 complex, O subunit (ATP50), nuclear gene encoding mitochondrial protein mRNA; Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2, 8kDa (NDUFA2), mRNA; Homo sapiens glyceraldehyde-3 -phosphate dehydrogenase (GAPDH), mRNA; Homo sapiens H3 histone, family 3A (H3F3A), mRNA; Homo sapiens proteasome

(prosome, macropain) subunit, beta type, 4 (PSMB4), mRNA; Homo sapiens ribosomal protein S27a (RPS27A), transcript variant 1, mRNA; Homo sapiens eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2), mRNA; Homo sapiens ribosomal protein LI 8 (RPL18), mRNA; Homo sapiens adenosine deaminase, RNA-specific (ADAR), transcript variant 1, mRNA; or Homo sapiens cytochrome c oxidase subunit Vb (COX5B), mRNA. Examples of primers pairs include but are not limited to the primer pairs found in Table 1.

TABLE 1

Sequence Sense Primer Anti-Sense Primer

Name ATP 50 GCGTTTCTCTCTTCCCACTC (SEQ ID NO: 23) GGCATAGCGACCTTCAATACC (SEQ ID NO: 33)

NDUFA2 GCCTGAAGACCTGGAATTGG (SEQ ID NO: CTGACATAAGTGGATGCGAATC (SEQ ID NO:

24) 34)

GAPDH GGAAGGTGAAGGTCGGAGTC (SEQ ID NO: GCTGATGATCTTGAGGCTGTTG (SEQ ID NO:

25) 35)

H3F3A CCAGCCGAAGGAGAAGGG (SEQ ID NO: 26) AGGGAAGTTTGCGAATCAGAAG (SEQ ID NO:

36)

PSMB4 TACCGCATTCCGTCCACTC (SEQ ID NO: 27) GCTCCTCATCAATCACCATCTG (SEQ ID NO:

37)

RPS27A CGGCAGTCAGGCATTTGG (SEQ ID NO: 28) CCACCACGAAGTCTCAACAC (SEQ ID NO: 38)

EIF4A2 CTCTCCTTCGTGGCATCTATG (SEQ ID NO: GGTCTCCTTGAACTCAATCTCC (SEQ ID NO:

29) 39)

RPL18 GGACATCCGCCATAACAAGG (SEQ ID NO: ACAACCTCTTCAACACAACCTG (SEQ ID NO:

30) 40)

ADAR AGACGGTCATAGCCAAGGAG (SEQ ID NO: GCAGAGGAGTCAGACACATTG (SEQ ID NO:

31) 41)

COX5B ACGCAATGGCTTCAAGGTTAC (SEQ ID NO: CGCTGGTATTGTCCTCTTCAC (SEQ ID NO: 42)

32)

Additionally, it is understood that the disclosed kits can include such other reagents and material for performing the disclosed methods such as a enzymes (e.g., polymerases), buffers, sterile water, reaction tubes. Additionally the kits can also include modified nucleotides, nuclease-resistant nucleotides, and or labeled nucleotides. Additionally, the disclosed kits can include instructions for performing the methods disclosed herein and software for enable the calculation of the presence of an ROSl mutation.

In one aspect, the disclosed kits can comprise sufficient material in a single assay run simultaneously or separately to conduct the methods to determine if a sample contains a wild-type ROSl, a known ROSl fusion, or a previously unidentified ROS l fusion. The kits can also include sufficient material to run control reactions. Thus, disclosed herein, in one aspect, are kits comprising a positive cDNA control reaction tube, a negative cDNA control reaction tube, a control primer reaction tube, a reaction tube to detect known ROSl fusions and/or a reaction tube to detect wild-type ROSl, and a reaction tube to detect ROS l kinase activity.

In another configuration, the disclosed kit can be used to determine ROS l status - either wild-type expression, kinase domain overexpression, or fusion mutation

overexpression - on the basis of measurements made relative to internal control genes. The internal control genes, described elsewhere in this disclosure, are understood to be expressed stably and constitutively irrespective of cell cycle, development or environmental factors. Therefore, in one aspect, ROSl status can be determined via an equation of ROSl(numerator)/internal control (denominator) where the resulting quotient is a range of outcomes that indicate tested tissues, cell lines or other samples are either ROSl positive or ROSl negative. With an understanding that certain tissues express internal control transcripts at different levels, the ratio and quotient determined to indicate ROSl positive or negative status will be established separately for each tissue and specimen type.

The compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.

Nucleic Acid Synthesis

The disclosed nucleic acids, such as, the oligonucleotides to be used as primers can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation to purely synthetic methods, for example, by the cyanoethyl phosphoramidite method using a Milligen or Beckman System lPlus DNA synthesizer (for example, Model 8700 automated synthesizer of Milligen- Biosearch, Burlington, MA or ABI Model 380B).

Examples

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary and are not intended to limit the disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric.

Example 1: Development and validation of a FISH assay to detect ROSl fusions.

As noted above, three different ROSl partners - FIG, CD74 and SLC34A2 - have been identified thus far as being involved in cancer-associated ROSl fusions. While it is presently unknown, it is unlikely that these three partners of ROSl are the only genes that form fusions with the kinase in cancer based on the experience with other fusion kinases; for example, >15 different genes (some of which are shown in Figure 1) are now known to fuse with the truncated ALK receptor tyrosine kinase (RTK) to form chimeric kinases that drive cancer development. Although ROSl fusion FISH assays can be designed specifically for each of the three known fusion partners involved, such an approach risks the possibility of missing ROSl fusions involving yet to be identified fusion partners; furthermore, the clinical application of three different FISH assays to detect ROS l fusions in tumor specimens is extremely time- and labor-inefficient.

The ROSl fusion assay uses large genomic clones (typically BAC and/or PAC clones) that flank the location within the ROS l gene locus at which the breaks occur during cancer-associated chromosomal rearrangements. Such a "breakapart" FISH assay uses flanking genomic clones that are labeled with differently colored fluorochromes. In normal cells, the different colors (e.g., red and green, and sometimes appearing yellow when the colors overlap) are physically paired because the gene locus is intact; by contrast, in cancer cells containing a rearrangement of the gene of interest, the colors are physically separated. As shown in Figure 4, the ROS l breakapart FISH assay works as expected on normal and ROSl fusion-containing cells.

Example 2: Development of a PCR-based assay to detect ROSl fusions.

The ROSl breakapart FISH assay detects the majority of ROS l fusions regardless of the partner gene involved. However, an additional ROS 1 fusion clinical diagnostic is still significant because 1) some countries and certain situations may prefer diagnostic platforms other than FISH (which can be somewhat technically demanding), and 2) the FIG -ROSl fusion cannot be detected by FISH because it is generated by a micro-deletion within the

ROSl locus that does not result in a breakapart of flanking probes (the FIG gene is actually embedded within introns of the ROSl gene, and becomes juxtaposed adjacent to the ROSl exons encoding the portion of ROSl found in FIG -ROSl as a consequence of the micro- deletion within the locus). To address these issues, a PCR-based assay was developed as a complementary platform to FISH for the detection of ROSl fusion mutations.

The ROSl PCR diagnostic (to be branded Insight ROSl Screen™) is a real-time PCR diagnostic utilizing diverse RT primers to selectively amplify ROSl fusions in lung cancer specimens. The underlying design for Insight ROS l Screen is illustrated in Figures 5 and 6.

In contrast to oncogenic ALK expression in NSCLC, ROSl is basally expressed in both NSCLC and normal lung tissue. Therefore, an effective ROSl assay must distinguish normal expression from oncogenic expression. Traditional real-time RT-PCR strategies utilize allele-specific primer sets that target each fusion transcript in a one-step reaction. However, this method has drawbacks, such as fusion variability and recurring optimization for newly discovered fusion partners and variants using an ever-expanding mixture of detection primers. The Insight ROSl Fusion Screen avoids these issues by maintaining a universal PCR detection method of the ROSl kinase domain. Oncogenic ROS l -fusions are targeted in a first-strand synthesis step that selects against amplification of basal full-length ROSl expression in tumor lung tissue. In this way, the detection phase of the assay remains constant regardless of fusion partner.

The assay utilizes two separate PCR primer sets, one that amplifies a region of the ROSl gene encoding the ROSl extracellular domain found only in the normal RTK (not in ROSl fusions) while the other primer set amplifies a ROSl gene segment encoding the kinase domain, which is found both in normal and fused ROSl. This assay design can not only detect the presence of ROSl fusions but also overexpression of the intact ROS l gene (which most frequently is correlated with DNA amplification of the gene locus). Normal ROSl RTK mRNA expression is correlated with internal control standards; overexpression of normal ROSl is indicated by a threshold Ct value lower than the internal controls whereas the presence of a ROSl fusion is evident by a difference in threshold Ct values between the wild-type and kinase domain real-time PCR reactions (the kinase domain reaction Ct being lower than that of the wild-type reaction). As noted, this elegant and simple design identifies all ROSl fusions independent of the fusion partner involved; in addition, it identifies and quantifies overexpression of wild-type ROSl . Although the clinical incidence and significance of ROSl amplification/overexpression in cancers is not yet known, it is contemplated herein that ROSl amplification/overexpression follows the pattern of amplification/overexpression of other RTKs (e.g., ALK and EGFR) what are known to result in constitutive kinase activation that drives tumor growth when over a certain threshold level; importantly, tumors with such RTK amplification/overexpression are sensitive to pharmacologic inhibition of the driver kinase.

Example 3: Insight ROSl Fusion Screen Development

The methodology described above was established by testing different reverse transcriptase enzymes at different reaction temperatures primed with a fusion-specific oligonucleotide (to target ROSl fusions), a random hexamer mix (to estimate total ROSl), or no primer (to identify any false priming). These conditions were first optimized on templates from a SLC34A2-ROS1 fusion-expressing cell line or normal lung (Table 2). If signal was detected in the absence of a RT primer then the reaction conditions were deemed not stringent enough to prevent promiscuous RT activity (see Superscript III @ 56°C). To address this issue, a thermostable enzyme (Thermoscript, Invitrogen) was used which has activity at temperatures greater than 60°C. Performing the reaction at higher temperatures reduces RNA secondary structure, but also reduces specificity of the FS-RT primer. If signal is detected in normal lung using the FS-RT primer, the reaction is not specific in discriminating full-length ROS1 from ROS1 fusions (see Thermoscript with 57°C Tm primer). Loss of specificity was addressed by redesigning a series of primers with melt temperatures near the extension temperature (i.e. 63-65°C). A high melt temperature primer eliminated the non-specific cDNA synthesis of the full-length ROS1 transcripts in normal lung samples (Table 2).

Table 2. ROS1 Kinase Assay Results from Various RT Conditions.

Total RNA from a SLC34A2-ROS 1 fusion-expressing cell line (HCC78) or normal lung was subjected to first-strand cDNA synthesis using the Superscript III or Thermoscript reverse transcriptases along with a SLC34A2 FS-RT primer, random hexamer mix, or no primer. The products of these reactions were screened with a ROS1 kinase-specific qPCR assay with mean Ct values reported in the table.

The same design parameters from the SLC34A2-ROS 1 fusion assay were then applied to detection of an additional ROS1 fusion, the CD74-ROS1 fusion transcript, available in the Insight inventory. Another series of FS-RT primers were designed with a melt temperature above 63°C and used to prime first-strand synthesis with the Thermoscript enzyme on template RNA derived from a Ba/F3 cell line expressing the CD74-ROS1 fusion and lacking full length ROS1 expression. As shown in Table 3, specific detection of the ROS1 kinase domain was detected only in the fusion-expressing cell line using a FS-RT CD74-ROS1 fusion primer. Normal lung was again used as control to identify any nonspecific amplification of full length ROS 1 (Table 2). Table 3. ROS1 Kinase Assay Results from the CD74-ROS1 Fusion Cell Line.

Total RNA from a CD74-ROS1 fusion-expressing Ba/F3 c ell line or norma lung was subjected to first-strand cDNA synthesis using the Thermoscript reverse transcriptase along with a FS-RT CD74 primer, random hexamer mix, or no primer. The products of these reactions were screened with a ROS1 kinase-specific qPCR assay with mean Ct values reported in the table.

Routine PCR testing for ROS1 fusions is currently performed using allele-specific primers flanking the fusion breakpoints. The Insight ROSI Fusion Screen in contrast utilizes a universal PCR primer set for detection of the ROS 1 kinase domain following fusion-specific first strand synthesis. To compare and contrast the PCR efficiency of both methods, cDNA generated using a FS-RT primer and random hexamers was subjected individually to both types of subsequent detection methods. Table 4 shows that a ROS1 kinase-specific assay has similar crossing point (Ct) values when compared to an allele- specific primer set on a specified sample using identical concentrations of starting total RNA. In addition the ROS1 kinase-specific assay incorporates the ability to detect differences in fusion transcripts based on amplification/detection of a common genetic region across a variety of fusion inputs. The allele-specific assay, in contrast, requires additional template input for each reaction and/or complex multiplexing for the detection phase of the reaction.

Table 4. Comparison of Allele-Specific Detection Methods.

Total RNA from an SLC34A2-ROS1 -expressing cell line (HCC78), a CD74-ROS1- expressing cell line (Ba/F3), and normal lung was used as template for first-strand synthesis primed by a fusion-specific primer (FSP) or a random hexamer mix. The products of this reaction were screened by qPCR with primers specific for the ROSl kinase domain, the SLC34A2 -ROS l -long fusion, the SLC34A2-ROS1 -short fusion, or the CD74-ROS1 fusion (mean Ct values reported).

In order to assess the sensitivity of the FS-RT method, RNA from the CD74-ROS1- expressing Ba/F3 cell line was diluted into RNA extracted from normal lung. Since normal lung expresses full-length ROSl only and the Ba/F3 cell line solely expresses CD74-ROS 1 fusions, normal lung RNA can be used to dilute Ba/F3 RNA to extinction in order to determine the limit of detection. Each RNA dilution series was subjected to fusion-specific first strand synthesis and amplification with a ROSl kinase qPCR assay (i.e. the Insight

ROSl Fusion Screen). Results in Table 5 indicate that the sensitivity of this assay is 1 : 10 or has a 10% level of detection.

Table 5. Sensitivity Testing of Insight ROSl Screen.

Ί argcl Ba/FJ ( iiji μΙ) Normal l .n ng ( ng.-μΙ) m

100 0 36.98

100 100 36.74

ROS Kinase 10 100 38.85

100 ND

0 100 ND

Total RNA from Ba/F3 cells expressing the CD74-ROS1 fusion was diluted into total RNA from normal lung and used as template for the Insight ROSl Fusion Screen.

Example 4: Optimization of the Insight ROSl Screen in FFPEs

To identify ROSl fusions within the IGI Biobank repository, a traditional allele- specific detection method was used to screen 169 FFPE lung adenocarcinoma specimens for various ROSl fusions. Two ROSl fusions were detected (1.2% frequency rate), and one of these samples was identified as carrying the CD74-ROS1 fusion. Second-site RT-PCR and Sanger sequencing confirmed the presence of the CD74-ROS1 fusion in two independently isolated samples. The CD74-ROS1 positive FFPE was then tested with the in vitro validated Insight ROSl Fusion Screen. Results indicate that the high-temperature parameters for reverse transcription that were optimized in cell lines successfully translated to the FFPE sample. However, the PCR reaction to detect the ROSl kinase expression required a larger input of cDNA template than when tested in cell lines (Table 6). Finally, confirmation of CD74-ROS1 -specific amplification from the high-temperature RT reaction was determined by testing the cDNAs for expression of the ROSl ECD, which detects full-length ROSl expression (and promiscuous RT amplification). As seen in Table 6, full-length ROS l was undetected in these samples, confirming that the Insight ROSl Fusion Screen has been optimized to specifically detect ROSl fusions in FFPE samples.

Table 6. Specific detection of ROSl fusions in FFPEs requires higher input of cDNA into PCR reaction com ared to cell lines.

Example 5: Development of Insight ROSl Screen™ version 2

The high background levels of constitutively expressed wild-type ROSl in lung tissue may mask any detectable difference in threshold Ct value between the wild-type and kinase domain real-time PCR reactions described in the Insight ROSl Screen PCR based assay. When detectable differences are masked, an alternative qPCR approach is used for exclusive detection of the three ROSl fusions reported to date in NSCLC cell lines or patient tumors; SLC34A2-ROS (long form), SLC34A2-ROS (short form) & CD74-ROS. The qPCR assay utilizes two different primers in a multiplexed cDNA synthesis reaction; one cDNA primer can be specific for a region present in both the long and short form of SLC34A2 and another cDNA primer present exclusively in the CD74 gene. Both cDNA primers are strategically placed slightly 5 ' to each fusion break point for ease of cDNA extension through the translocation region of the three different ROSl fusions.

The second qPCR Insight ROSl Fusion Screen described herein is referred to as the Insight ROSl Fusion Screen™ v2 for the duration of this application. To recap to completion, the Insight ROS l Fusion Screen™ v2 consists of a cDNA synthesis phase that generates three potential cDNAs; a truncated wild-type SLC34A2, a truncated wild-type CD74 and potential extension and synthesis of the immediate translocation regions of SLC34A2-ROS1 or CD74-ROS 1 fusions if present in a particular patient specimen. To prevent carryover into the detection phase of the one step phase of the reaction, all cDNA primers have a low Tms (to prevent annealing during the higher temperatures of the real time reaction) and the reverse transcriptase is deactivated at 65°C for 20 minutes. The nascent cDNA can then be used in a qPCR detection reaction using primers specific for a ROSl region juxtaposed to the translocation point for both the SLC34A2 or CD74 ROSl fusions (Figure 7.). Again, the nucleotide distances separating the initiation sites of the cDNA synthesis and the locations of the primers mediating the actual qPCR detection reaction are kept minimal to circumvent problems with degraded FFPE RNA. The ROS l specific qPCR kinase reaction then amplifies a cDNA region of ROS l present only in a fused form translocated to either SLC34A2-ROS1 or CD74-ROS1. Wild-type ROS l kinase regions are not be present in each sample due to the lack of any ROS l specific cDNA primers present in the reverse transcription phase of the assay (Figure 7). Specific sequences are listed in Table 7.

Table 7. Oligonucleotide specifications for each primer & probe used in the Insight ROSl Screen version 2™

Example 6: Determination of the sensitivity and specificity of both the Insight ROSl FISH and qPCR based assays. Both the Insight ROS 1 FISH assay and a RT-qPCR assay can be assessed using various cancer cell lines or tissue samples. For example, Table 8 shows cell lines of two types: one cell line expressing the FIG-ROS fusion and one expressing both SLC34A2-ROS fusions (long and short) at varying expression levels. Normal lung total RNA consisting of wild- type levels only of full length ROS 1 can be used as a background control.

Table 8. ROS1 fusion status of each cell lines used in each validation.

RNA extraction and one step qPCR procedures follows well-established laboratory protocols.

References

Aquaviva J, Wong R, Charest A. The multifaceted roles of the receptor tyrosine kinase ROS in development and cancer. Biochimica et Biophysica Acta 1795: 37-52, 2009.

Bergethon K, Shaw AT, Ou SH, Katayama R, Lovly CM, McDonald NT, Massion PP,

Siwak-Tapp C, Gonzalez A, Fang R, Mark EJ, Batten JM, Chen H, Wilner KD, Kwak EL, Clark JW, Carbone DP, Ji H, Engelman JA, Mino-Kenudson M, Pao W, Iafrate AJ. ROS 1 rearrangements define a unique molecular class of lung cancers J Clin Oncol. 2012 Mar 10;30(8):863-70. Epub 2012 Jan 3.

Bilous M, Morey A, Armes J, Cummings M, Francis G. Chromogenic in situ hybridisation testing for HER2 gene amplification in breast cancer produces highly reproducible results concordant with fluorescence in situ hybridization and immunohistochemistry. Pathology 38: 120-124, 2006.

Bolzer A, Craig JM, Cremer T, Speicher MR. A complete set of repeat-depleted, PCR- amplifiable, human chromosome-specific painting probes. Cytogenet Cell Genet 84: 233- 240, 1999.

Camidge DR, Hirsch FR, Varella-Garcia M, Franklin WA. Finding ALK-positive lung cancer: what are we really looking for? J Thorac Oncol 6: 41 1-413, 201 1.

Camidge DR, Kono SA, Flacco A, Tan AC, Doebele RC, Zhou Q, Crino L, Franklin WA, Varella-Garcia M. Optimizing the detection of lung cancer patients harboring anaplastic lymphoma kinase (ALK) gene rearrangements potentially suitable for ALK inhibitor treatment. Clin Cancer Res 16: 5581 -5590, 2010. Carbone A, Botti G, Gloghini A, Simone G, Truini M, Curcio MP, Gasparini P, Mangia A, Perin T, Salvi S, Testi A, Verderio P. Delineation of HER2 gene status in breast carcinoma by silver in situ hybridization is reproducible among laboratories and pathologists. J Mol Diagn 10: 527-536, 2008.

Carlson RW, Moench SJ, Hammond ME, Perez EA, Burstein JH, Allred DC, Vogel CL, Goldstein LJ, Somlo G, Gradishar WJ, Hudis CA, Jahanzeb M, Stark A, Wolff AC, Press MF, Winer EP, Paik S, Ljung BM; NCCN HER2 Testing in Breast Cancer Task Force. HER2 testing in breast cancer: NCCN Task Force report and recommendations. J Natl Compr Cane Netw 4 Suppl 3: SI -22, 2006.

Charest A, Kheifets V, Park J, Lane K, McMahon K, Nutt CL, Housman D. Oncogenic targeting of an activated tyrosine kinase to the Golgi apparatus in a glioblastoma. Proc Natl Acad Sci USA 100: 916-921, 2003.

Charest A, Lane K, McMahon K, Park J, Preisinger E, Conroy H, Housman D. Fusion of FIG to the receptor tyrosine kinase ROS in a glioblastoma with an interstitial

del(6)(q21q21). Genes Chromosomes Cancer 37: 58-61, 2003.

Charest A, Wilker EW, McLaughlin ME, Lane K, Gowda R, Coven S, McMahon K, Kovach S, Feng Y, Yaffe MB, Jacks T, Housman D. ROS fusion tyrosine kinase activates a SH2 domain-containing phosphatase-2/phosphatidylinositol 3-kinase/mammalian target of rapamycin signaling axis to form glioblastoma in mice. Cancer Res 66: 7473-7481, 2006. Craig JM, Kraus J, Cremer T. Removal of repetitive sequences from FISH probes using PCR-assisted affinity chromatography. Hum Genet 100: 472-476, 1997.

Dandachi N, Dietze O, Hauser-Kronberger C. Chromogenic in situ hybridization: a novel approach to a practical and sensitive method for the detection of HER2 oncogene in archival human breast carcinoma. Lab Invest 82: 1007-1014, 2002.

Dugan LC, Pattee MS, Williams J, Eklund M, Sorensen K, Bedford JS, Christian AT.

Polymerase chain reaction-based suppression of repetitive sequences in whole chromosome painting probes for FISH. Chromosome Res 13: 27-32, 2005.

El-Deeb IM, Park BS, Jung SJ, Yoo KH, Oh CH, Cho SJ, Han DK, Lee JY, Lee SH.

Design, synthesis, screening and molecular modeling study of a new series of ROS 1 receptor tyrosine kinase inhibitors. Bioorg Med Chem Lett 19: 5622-5626, 2009.

El-Deeb IM, Yoo KH, Lee SH. ROS receptor tyrosine kinase: a new potential target for anticancer drugs. Med Res Rev (201 1) 31 : 794-818.

Francis GD, Jones MA, Beadle GF, Stein SR. Bright-field in situ hybridization for HER2 gene amplification in breast cancer using tissue microarrays: correlation between chromogenic (CISH) and automated silver-enhanced (SISH) methods with patient outcome. Diagn Mol Pathol 18: 88-95, 2009.

Gallegos Ruiz MI, Floor K, Vos W, Grunberg K, Meijer GA, Rodriquez JA, Giaccone G. Epidermal growth factor receptor (EGFR) gene copy number detection in non-small-cell lung cancer; a comparison of fluorescence in situ hybridization and chromogenic in situ hybridization. Histopathology 51 : 631-637, 2007. Garcia-Garcia E, Gomez -Martin C, Angulo B, Conde E, Suarez-Gauthier A, Adrados M, Perna C, Rodriguez-Peralto JL, Hidalgo M, Lopez-Rios F. Hybridization for human epidermal growth factor receptor 2 testing in gastric carcinoma: a comparison of fluorescence in-situ hybridization with a novel fully automated dual-colour silver in-situ hybridization method. Histopathology 59: 8-17, 2011.

Gruver AM, Peerwani Z, Tubbs RR. Out of the darkness and into the light: bright field in situ hybridisation for delineation of ERBB2 (HER2) status in breast carcinoma. J Clin Pathol 63 : 210-219, 2010.

Gu T-L, Deng X, Huang F, Tucker M, Crosby K, Rimkunas V, Wang Y, Deng G, Zhu L, Tan Z, Hu Y, Wu C, Nardone J, MacNeill J, Ren J, Reeves C, Innocenti G, Norris B, Yuan J, Yu J, Haack H, Shen B, Peng C, Li H, Zhou X, Liu X, Rush J, Comb MJ. Survey of tyrosine kinase signaling reveals ROS kinase fusions in human cholangiocarcinoma. PLoS ONE 6(1): el5640, 201 1.

Hirsch FR, Herbst RS, Olsen C, Chansky K, Crowley J, Kelly K, Franklin WA, Bunn PA Jr, Varella-Garcia M, Gandara DR. Increased EGFR gene copy number detected by fluorescent in situ hybridization predicts outcome in non-small-cell lung cancer patients treated with cetuximab and chemotherapy. J Clin Oncol 26: 3351-3357, 2008.

Hout D, Xue L, Choppa P, Handshoe J, Bouman D, Schmidt K, Bloom K, Ross D, Nickols J, Morris SW. Insight ALK Screen™, a highly sensitive and specific RT-qPCR first-line screening assay for the comprehensive detection of all oncogenic anaplastic lymphoma kinase fusions. AACR Annual Meeting 2011

Kim H, Yoo SB, Choe JY, Paik JH, Xu X, Nitta H, Zhang W, Grogan TM, Lee CT, Jheon S, Chung JH. Detection of ALK gene rearrangement in non-small cell lung cancer: a comparison of fluorescence in situ hybridization and chromogenic in situ hybridization with correlation of ALK protein expression. J Thorac Oncol 6: 1359-1366, 2011.

Kwak EL, Bang YJ, Camnidge DR, Shaw AT, Solomon B, Maki RG, Ou SH, Dezube BJ, Janne PA, Costa DB, Varella-Garcia M, Kim WH, Lynch TJ, Fidias P, Stubbs H, Engleman JA, Sequist LV, Tan W, Gandhi L, Mino-Kenudson M, Wei GC, Shreeve SM, Ratain MJ, Settleman J, Christensen JG, Haber DA, Wilner K, Slagia R, Shapiro GI, Clark JW, Iafrate AJ. Anaplastic lymphoma kinase inhibition in non-small-cell lung cancer. N Engl J Med 363: 1693-1703, 2010.

Lauter G, Soil I, Hauptmann G. Multicolor fluorescent in situ hybridization to define abutting and overlapping gene expression in the embryonic zebrafish brain. Neural Dev 6: 10, 201 1.

Lauter G, Soil I, Hauptmann G. Two-color fluorescent in situ hybridization in the embryonic zebra fish brain using differential detection systems. BMC Dev Biol 1 1 : 43, 2011.

Leong AS, Haffajee Z. Microwaves for chromogenic in situ hybridization. Methods Mol Biol 724: 79-89, 201 1. Linton K, Hey Y, Dibben S, Miller C, Freemont A, Radford J, Pepper S. Biotechniques. 2009 Jul;47(l):587-96. Methods comparison for high-resolution transcriptional analysis of archival material on Affymetrix Plus 2.0 and Exon 1.0 microarrays.

Lovly CM, Heuckmann JM, de Stanchina E, Chen H, Thomas RK, Liang C, Pao W.

Insights into ALK-driven cancers revealed through development of novel ALK tyrosine kinase inhibitors. Cancer Res 71(14): 4920-4931, 201 1.

Lucas ΓΝ, Wu X, Guo E, Chi LE, Chen Z. An efficient chemical method to generate repetitive sequences depleted DNA probes. Am J Med Genet 140: 2115-2120, 2006.

Mathew P, Sanger WG, Weisenburger DD, Valentine M, Valentine V, Pickering D, Higgins C, Hess M, Cui X, Srivastava DK, Morris SW. Detection of the t(2;5)(p23;q35) and NPM- ALK fusion in non-Hodgkin's lymphoma by two-color fluorescence in situ hybridization. Blood 89: 1678-1685, 1997.

Moison C, Arimondo PB, Guieysse-Peugeot AL. Commerical reverse transcriptase as a source of false-positive strand-specific RNA detection in human cells. Biochimie 93 : 1731- 1737, 201 1.

Mosquera J-M, Dal Cin P, Mertz KD, Perner S, Davis IJ, Fisher DE, Rubin MA, Hirsch MS. Validation of a TFE3 break-apart FISH assay for Xpl 1.2 translocation renal cell carcinomas. Diagn Mol Pathol 20: 129-137, 2011.

Newkirk HL, Knoll JH, Rogan PK. Distortion of quantitative genomic and expression hybridization by Cot-1 DNA: mitigation of this effect. Nucleic Acids Res 33 : el91, 2005.

Nitta H, Hauss-Wegrzyniak B, Lehrkamp M, Murillo AE, Gaire F, Farrell M, Walk E, Penault-Llorca F, Kurosumi M, Dietel M, Wang L, Loftus M, Pettay J, Tubbs RR, Grogan TM. Development of automated brightfield double in situ hybridization (BDISH) application for HER2 gene and chromosome 17 centromere (CEN 17) for breast carcinomas and an assay performance comparison to manual dual color HER2 fluorescence in situ hybridization (FISH). Diagn Pathol 3 : 41, 2008.

Passoni L, Longo L, Collini P, Coluccia AM, Bozzi F, Podda M, Gregorio A, Gambini C, Garaventa A, Pistoia V, Del Grosso F, Tonini GP, Cheng M, Gambacorti-Passerini C, Anichini A, Fossati-Bellani F, Di Nicola M, Luksch R. Mutation-independent anaplastic lymphoma kinase overexpression in poor prognosis neuroblastoma patients. Cancer Res 69: 7338-7346, 2009.

Pavlekovic M, Schmid MC, Schmider-Poignee N, Spring S, Pilhofer M, Gaul T, Fiandaca M, Loffler FE, Jetten M, Schleifer KH, Lee NM. Optimization of three FISH procedures for in situ detection of anaerobic ammonium oxidizing bacteria in biological wastewater treatment. J Microbiol Methods 78: 1 19-126, 2009.

Penault-Llorca F, Bilous M, Dowsett M, Hann W, Osamura RY, Ruschoff J, van de Vijver M. Emerging technologies for assessing HER2 amplification. Am J Clin Pathol 132: 539- 548, 2009. Petersen BL, Sorensen MC, Pedersen S, Rasmussen M. Fluorescence in situ hybridization on formalin-fixed and paraffin-embedded tissue: optimizing the method. Appl

Immunohistochem Mol Morphol 12: 259-265, 2004.

Powell RD, Pettay JD, Powell WC, Roche PC, Grogan TM, Hainfeld JF, Tubbs RR.

Metallographic in situ hybridization. Hum Pathol 38: 1145-1 149, 2007.

Qian X, Lloyd RV. Recent developments in signal amplification methods for in situ hybridization. Diagn Mol Pathol 12: 1-13, 2003.

Rauch J, Wolf D, Craig JM, Hausmann M, Cremer C. Quantitative microscopy after fluorescence in situ hybridization - a comparison between repeat-depleted and non-depleted DNA probes. J Biochem Biophys Methods 44: 59-72, 2000.

Rikova K, Guo A, Zeng Q, Possemato A, Yu J, Haack H, Nardone J, Lee K, Reeves C, Li Y, Hu Y, Tan Z, Stokes M, Sullivan L, Mitchell J, Wetzel R, Macneill J, Ren JM, Yuan J, Bakalarski CE, Villen J, Kornhauser JM, Smith B, Li D, Zhou X, Gygi SP, Gu TL, Polakiewicz RD, Rush J, Comb MJ. Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer. Cell 131 : 1190-1203, 2007.

Rimkunas V, Crosby K, Kelly M, Silver M, Hincman K, Polakiewicz R, Li D, Zhou X, Haack H. Frequencies of ALK and ROS in NSCLC FFPE tumor samples utilizing a highly specific immunohistochemistry-based assay and FISH analysis. J Clin Oncol 28: 15s (suppl; abstr 10536), 2010.

Rogan PK, Cazcarro PM, Knoll JH. Sequence-based design of single-copy genomic DNA probes for fluorescence in situ hybridization. Genome Res 11 : 1086-1094, 2001.

Ruhe JE, Streit S, Hart S, Wong CH, Specht K, Knyazev P, Knyazeva P, Knyazeva T, Tay LS, Loo HL, Foo P, Wong W, Pok S, Lim SJ, Ong H, Luo M, Ho HK, Peng K, Lee TC, Bezler M, Mann C, Gaertner S, Hoefler H, Iacobelli S, Peter S, Tay A, Brenner S,

Venkatesh B, Ullrich A. Genetic alterations in the tyrosine kinase transcriptome of human cancer cell lines. Cancer Res 67: 11368-1 1376, 2007.

Sasaki T, Okuda K, Zheng W, Butrynski J, Capelletti M, Wang L, Gray NS, Wilner K, Christensen JG, Demetri G, Shapiro GI, Rodig SJ, Eck MJ, Janne PA. The neuroblastoma- associated Fl 174L ALK mutation causes resistance to an ALK kinase inhibitor in ALK- translocated cancers. Cancer Res. 2010 Dec 15 ;70(24): 10038-43.

Sequist LV, Gettinger S, Senzer NN, Martins RG, Janne PA, Lilenbaum R, Gray JE, lafrate A J, Katayama R, Hafeez N, Sweeney J, Walker JR, Fritz C, Ross RW, Grayzel D, Engelman JA, Borger DR, Paez G, Natale R. Activity of IPI-504, a novel heat-shock protein 90 inhibitor, in patients with molecularly defined non-small-cell lung cancer. J Clin Oncol 28: 4953-4960, 2010.

Sholl LM, lafrate JA, Chou YP, Wu MT, Goan YG, Su L, Huang YT, Christiani DC, Chirieac LR. Validation of chromogenic in situ hybridization for detection of EGFR copy number amplification in nonsmall cell lung carcinoma. Mod Pathol 20: 1028-1035, 2007. Sonnenberg-Riethmacher E, Walter B, Riethmacher D, Godecke S, Birchmeier C. The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis. Genes Dev 10: 1184-1 193, 1996.

Takeuchi K, Soda M, Togashi Y, Suzuki R, Sakata S, Hatano S, Asaka R, Hamanaka W, Ninomiya H, Uehara H, Choi YL, Satoh Y, Okumura S, Nakagawa K, Mano H, Ishikawa Y. RET, ROS 1 and ALK fusions in lung cancer. Nat Medicine 18(3):378-381, 2012.

Terry J, Barry TS, Horsman DE, Hsu FD, Gown AM Huntsman DG, Nielsen TO.

Fluorescence in situ hybridization for the detection of t(X; 18)(pl 1.2;ql 1.2) in a synovial sarcoma tissue microarray using a breakapart-style probe. Diagn Mol Pathol 14: 77-82, 2005.

Van de Vijver M, Bilous M, Hanna W, Hofmann M, Kristel P, Penault-Llorca F, Ruschoff J. Chromogenic in situ hybridisation for the assessment of HER2 status in breast cancer: an international validation ring study. Breast Cancer Res 9: R68, 2007.

Ventura RA, Martin-Subero JI, Jones M, McParland J, Gesk S, Mason DY, Siebert R. FISH analysis for the detection of lymphoma-associated chromosome abnormalities in paraffin- embedded tissue. J Mol Diagn 8: 141-151, 2006.

Verrant JA. 2008. Methods and composition to generate unique sequence DNA probes labeling of DNA probes and the use of these probes. US 2009/0220955 Al, filed September 20, 2006.

Walter J, Joffe B, Bolzer A, Albiez H, Benedetti PA, Muller S, Speicher MR, Cremer T, Cremer M, Solovei I. Towards many colors in FISH on 3D-preserved interphase nuclei. Cytogenet Genome Res 1 14: 367-378, 2006.

Webb TR, Slavish J, George RE, Look AT, Xue L, Jiang Q, Cui X, Rentrop WB, Morris SW. Anaplastic lymphoma kinase: role in cancer pathogenesis and small-molecule inhibitor development for therapy. Expert Rev Anticancer Ther 9: 331-356, 2009.

Wlodarska I, De Wolf-Peeters C, Falini B, Verhoef G, Morris SW, Hagemeijer A, Van den Berghe H. The cryptic inv(2)(p23q35) defines a new molecular genetic subtype of ALK- positive anaplastic large-cell lymphoma. Blood 92: 2688-2695, 1998.

Yan J, Guilbault E, Masse J, Ronsard M, DeGrandpre P, Forest JC, Drouin R. Optimization of the fluorescence in situ hybridization (FISH) technique for high detection efficiency of very small proportions of target interphase nuclei. Clin Genet 58: 309-318, 2000.

Yoo SB, Lee HY, Park JO, Choe G, Chung DH, Seo JW, Chung JH. Reliability of chromogenic in situ hybridization for epidermal growth factor receptor gene copy number detection in non-small-cell lung carcinomas: a comparison with fluorescence in situ hybridization study. Lung Cancer 67: 301-305, 2010.

Yoshida A, Tsuta K, Nitta H, Hatanaka Y, Asamura H, Sekine I, Grogan TM, Fukayama M, Shibata T, Furuta K, Kohno T, Tsuda H. Bright- field dual-color chromogenic in situ hybridization for diagnosing echinoderm microtubule-associated protein-like 4 anaplastic lymphoma kinase-positive lung adenocarcinomas. J Thorac Oncol 6: 1677-1686, 2011. Zhang W, McElhinny A, Nielsen A, Wang M, Miller M, Singh S, Rueger R, Rubin BP, Wang Z, Tubbs RR, Nagle RB, Roche P, Wu P, Pestic-Dragovich L. Automated brightfield dual-color in situ hybridization for detection of mouse double minute 2 gene amplification in sarcomas. Appl Immunohistochem Mol Morphol 19: 54-61, 2011.

Zordan A. Fluorescence in situ hybridization on formalin-fixed, paraffin-embedded tissue sections. Methods Mol Biol 730: 189-202, 2011.

Claims

CLAIMS What is claimed is:

1. A method of diagnosing a ROS 1 related cancer in a subject with a cancer, comprising obtaining a tissue sample from the subject, isolating nucleic acid from the tissue sample, conducting a nucleic acid amplification process on the nucleic acid, and detecting the presence of or measuring the amount of nucleic acid associated with one or a combination of both wild-type ROSl and ROSl kinase domain in the tissue sample, wherein an increase in amplicon relative to a normal control or the presence of an amplicon indicates the that the subject has a ROSl related cancer.

2. The method of claim 1, wherein the nucleic acid from the tissue sample is RNA, wherein the method further comprises synthesizing cDNA from the RNA sample, and wherein the method comprises performing PCR on the cDNA.

3. The method of claim 1, wherein the nucleic acid amplification process is reverse transcription polymerase chain reaction (RT-PCR).

4. The method of claim 2, wherein the RT-PCR is real-time RT-PCR.

5. The method of claim 4, wherein the real-time RT-PCR employs a probe that is complementary to a sequence with the product of the real-time RT-PCR, and wherein the probe has a reporter dye on the end thereof and a quencher dye on the another end thereof.

6. The method of claim 5, wherein the probe is selected from the group consisting of SEQ ID NO: 6, 9, 19, or 22.

7. The method of claim 1, wherein the nucleic acid amplification process is real-time PCR.

8. The method of claim 2, 3, or 7, wherein the PCR, RT-PCR or real-time PCR reaction comprises the use of a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl sequence and a forward and reverse primer pair that specifically hybridizes to a wild-type ROSl kinase domain sequence.

9. The method of claim 8, wherein at least one reverse primer SEQ ID NO. 5, 8, 12, 14, 15, 18, or 21.

10. The method of claim 9, wherein at least one forward primer comprises SEQ ID NO: 4, 7, 13, 15, 17, or 20.

1 1. The method of claim 8, wherein at least one forward primer hybridizes to an extracellular region of wild-type ROSl.

12. The method of claim 12, wherein the forward primer is SEQ ID NO: 13 or 20.

13. The method of claim 8, wherein the RT-PCR or real-time PCR reaction comprises the use of a forward capable of specifically hybridizing to ROSl kinase domain.

14. The method of claim 13, wherein the forward primer is of SEQ ID NO: 4, 7, 15, or 17.

15. The method of claim 8, wherein the reverse primer or the wild-type ROSl and ROSl kinase is the same primer.

16. The method of claim 8 further comprising determining the cycle thresholds (Ct) values for wild-type ROSl and wild-type ROSl kinase; wherein a high (Ct) value for wild- type ROSl relative to ROSl kinase indicates the presence of a fusion.

17. The method of claim 1, comprising a forward primer which binds to a ROSl fusion partner 5' to the fusion breakpoint and a reverse primer which binds to ROSl 3 ' to the fusion breakpoint, wherein said primers extend through the fusion, wherein detection of the presence of an amplicon having both ROSl and fusion partner nucleic acids indicates the presence of a fusion.

18. The method of claim 1, comprising

a) a first amplification reaction using a forward primer which binds to a ROSl fusion partner; wherein the amplicon from the first reaction is used as a template for a second amplification reaction; b) a second amplification reaction following the first reaction, wherein primers specific for a ROSl sequence 3 ' of the fusion breakpoint are used in the second

amplification reaction; and

c) detecting the presence of ROSl in the amplicon from the second reaction;

wherein detection of ROSl in the amplicon from the second reaction indicates the presence of a ROS l fusion.

19. The method of claim 1, wherein the cancer is selected from the group consisting of neuroblastoma, breast cancer, ovarian cancer, colorectal carcinoma, non-small cell lung carcinoma, diffuse large B-cell lymphoma, esophageal squamous cell carcinoma, anaplastic large-cell lymphoma, neuroblastoma, inflammatory myofibroblastic tumors, malignant histiocytosis, cholangiocarcinoma, renal carcinoma, and glioblastomas.

20. The method of claim 1, further comprising subsequently treating a subject identified as having a ROS l related cancer by administering to the subject a ROSl inhibitor.

21. A method of diagnosing a ROS 1 related cancer in a subj ect comprising contacting nucleic acid in a cell with a first probe that hybridizes to a ROSl kinase and a second probe that hybridizes to a ROSl sequence 3' to the fusion breakpoint of ROSl; wherein the probes a differently labeled; wherein detection of a disrupted gene locus indicated by separated probes indicates the presence of an ROSl fusion which indicates the presence of a ROS 1 related cancer.

22. A kit for diagnosing an ROS 1 related cancer comprising (a) a first primer labeled with a first detection reagent, wherein said first primer is a reverse primer, wherein said reverse primer is one or more polynucleotide(s) that hybridizes, to a first polynucleotide encoding the amino acid sequence of SEQ ID NO 1 or the complement thereof; and (b) at least one second primer, wherein said second primer is a forward primer, wherein said forward primer is one or more polynucleotide(s) that hybridizes to a second polynucleotide encoding wild-type ROSl.

23. The kit of claim 22, wherein the forward primer that specifically hybridizes to an extracellular region of wild-type ROSl.

24. The kit of claim 23, wherein the forward primer is SEQ ID NO: 13

25. The kit of claim 22, wherein the forward primer that specifically hybridizes to the ROSl kinase domain.

26. The kit of claim 25, wherein the forward primer is of SEQ ID NO: 4, 7, 15, or 17.

27. The kit of claims 22 further comprising a second forward and reverse primer.

28. The kit of claim 22, wherein the reverse primer is SEQ ID NO: 5, 8, 12, 14, 16, 18, or 21.

29. The kit of claim 22, wherein the first forward and reverse primers specifically hybridize to the kinase domain of wild-type ROSl and the second forward and reverse primers specifically hybridize to wild-type ROSl .

30. The kit of claim 22, further comprising a control primer pair.

31. The kit of claim 30, wherein the control primer pair specifically hybridizes to COX5B.

32. The kit of claim 22, wherein the first and second primers are labeled with a first and second detection reagent, respectively.

33. The kit of claim 22, further comprising a polynucleotide probe, wherein said probe is from about 20 to about 30 nucleotides in length and comprises a reporter dye on one end thereof and a quenching dye on another end thereof.

34. The kit of claim 33, wherein the polynucleotide probe comprises the sequence as set forth in SEQ ID NO: 6, 9, 19, or 22.