EP2672963A2 - Methods for treatment of melanoma - Google Patents
Methods for treatment of melanomaInfo
- Publication number
- EP2672963A2 EP2672963A2 EP12745011.2A EP12745011A EP2672963A2 EP 2672963 A2 EP2672963 A2 EP 2672963A2 EP 12745011 A EP12745011 A EP 12745011A EP 2672963 A2 EP2672963 A2 EP 2672963A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- inhibitor
- braf
- melanoma
- dhodh
- leflunomide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/4353—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems
- A61K31/437—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom ortho- or peri-condensed with heterocyclic ring systems the heterocyclic ring system containing a five-membered ring having nitrogen as a ring hetero atom, e.g. indolizine, beta-carboline
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New breeds of animals
- A01K67/027—New breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/12—Ketones
- A61K31/122—Ketones having the oxygen directly attached to a ring, e.g. quinones, vitamin K1, anthralin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
- A61K31/167—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
- A61K31/19—Carboxylic acids, e.g. valproic acid
- A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
- A61K31/196—Carboxylic acids, e.g. valproic acid having an amino group the amino group being directly attached to a ring, e.g. anthranilic acid, mefenamic acid, diclofenac, chlorambucil
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/275—Nitriles; Isonitriles
- A61K31/277—Nitriles; Isonitriles having a ring, e.g. verapamil
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/42—Oxazoles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/44—Non condensed pyridines; Hydrogenated derivatives thereof
- A61K31/4427—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
- A61K31/4439—Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/435—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
- A61K31/47—Quinolines; Isoquinolines
- A61K31/4709—Non-condensed quinolines and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/517—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with carbocyclic ring systems, e.g. quinazoline, perimidine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/20—Animals treated with compounds which are neither proteins nor nucleic acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/40—Fish
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/0393—Animal model comprising a reporter system for screening tests
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to methods for treatment of melanoma using an inhibitor of dihydroorotate dehydrogenase (DHODH) and to combination therapies that involve administering to a subject an inhibitor of oncogenic BRAF (e.g. BRAF(V600E)), as well as an inhibitor of dihydroorotate dehydrogenase (DHODH).
- DHODH dihydroorotate dehydrogenase
- Assays for identifying compounds useful for the treatment of melanoma are also provided.
- the methods comprise screening for compounds or agents that inhibit neural crest progenitor formation in a zebra fish model of melanoma.
- Melanoma is a malignant tumor of melanocytes. Primarily melanoma is a skin tumor, but it is also seen, though less frequently, in the melanocytes of the eye (uveal melanoma). Even though it represents one of the rarer forms of skin cancer, melanoma underlies the majority of skin cancer-related deaths and despite many years of intensive laboratory and clinical research, there are still limited treatments for melanoma.
- melanoma Prior to metastasis
- One effective cure for melanoma is surgical resection of the primary tumor before it achieves a thickness of greater than 1 mm. If the tumor is more invasive, surgery can be combined with radiation and/or chemotherapy. Since these conventional modalities cannot cure patients of lethal metastasized tumors, efficacy of alternative treatments such as immunotherapy are being investigated in clinical trials.
- Oncogenic BRAF mutations are present in a majority of melanomas and have been implicated in malignant growth of melanoma cells.
- BRAF(V600E) mutation is the most common oncogenic BRAF mutation found in melanoma cells.
- Zelboraf 1 " 1 also known as Vemurafenb or PLX4032: Hoffman-La-Roche (Madison Wisconsin)/Daiichi Sankyo
- BRAF(V600E):p53 _/ ⁇ virtually all tumor cells, but no normal cells, are positive for crestin.
- suppressors of neural crest progenitors may have utility in the treatment of melanoma.
- Embodiments of the invention are based on the development of a screening assay for inhibitors of melanoma, and on the discovery of one class of compounds, i.e. inhibitors of dihydroorotate dehydrogenase (DHODH), that result in almost complete abrogation of neural crest development in zebrafish.
- DHODH dihydroorotate dehydrogenase
- BRAF(V600E) decrease melanoma growth both in vitro and in vivo in mouse xenograft studies.
- the combination therapy required only subclinical doses of each compound suggesting that there may be therapeutic synergy.
- метод ⁇ melanoma comprising administrating to a subject (diagnosed with, or at risk of having melanoma), an inhibitor of DHODH.
- a combination therapy for treatment of melanoma that involves administrating an effective amount of an inhibitor of DHODH and an effective amount of an inhibitor of oncogenic BRAF (e.g. BRAF(V600E) oncogene), where the inhibitors are administered simultaneously, or sequentially.
- BRAF(V600E) oncogene e.g. BRAF(V600E) oncogene
- a method for treating melanoma in a subject comprises administering to a subject in need thereof a therapeutically effective amount of an inhibitor of dihydroorotate dehydrogenase (DHODH) (e.g. a small molecule, a nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, or an antibody).
- DHODH dihydroorotate dehydrogenase
- the inhibitor of dihydroorotate dehydrogenase (DHODH) is selected from the group consisting of: leflunomide, teriflunomide, brequinar, dichloroallyl lawsone, maritimus, redoxal and
- NSC210627 or a derivative thereof.
- a combination therapy for treating melanoma comprises administering to a subject in need thereof a therapeutically effective amount of an inhibitor of dihydroorotate dehydrogenase (DHODH) and an effective amount of an inhibitor of oncogenic BRAF.
- DHODH dihydroorotate dehydrogenase
- the inhibitors may be a small molecule, a nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, or an antibody.
- each inhibitor may be administered simultaneously, or sequentially. In one embodiment, each inhibitor is administered within minutes, within hours, or within days, of one another.
- any oncogenic BRAF can be inhibited, e.g. in one embodiment, the oncogenic BRAF that is inhibited is BRAF(V600E). Alternative oncogenic BRAFs are described within the specification.
- the inhibitor may be specific for a particular oncogenic BRAF mutation or alternatively may generally inhibit multiple BRAF mutations, and/or wild type BRAF.
- Any inhibitor of dihydroorotate dehydrogenase (DHODH) may be used.
- the inhibitor of dihydroorotate dehydrogenase is selected from the group consisting of: leflunomide, teriflunomide, brequinar, dichloroallyl lawsone, maritimus, redoxal and NSC210627, or a derivative thereof.
- the inhibitor of oncogenic BRAF is selected from the group consisting of: Sorafenib, RAF265, XL281, AZ628, GSK2118436, GDC-0879, PLX4032, and PLX4720, or a derivative thereof.
- the inhibitor of oncogenic BRAF is PLX4032 and the inhibitor of dihydroorotate dehydrogenase (DHODH) is leflunomide, or a derivative thereof.
- DHODH dihydroorotate dehydrogenase
- the inhibitor of oncogenic BRAF is PLX4720 and the inhibitor of dihydroorotate dehydrogenase (DHODH) is leflunomide, or a derivative thereof.
- DHODH dihydroorotate dehydrogenase
- the methods of treatment described herein further comprise selecting a subject that has, or is at risk of having melanoma, e.g. a melanoma that expresses oncogenic BRAF.
- the subject has a melanoma that expresses an oncogenic BRAF comprising a mutation in BRAF selected from the group consisting of: VAL600GLU, ARG461ILE, ILE462SER, GLY463GLU, and LYS600GLU, GLY465VAL and LEU596ARG, and GLY468ARG, GLY468ALA and ASP593GLY.
- the methods of the present invention can be used either alone, or in conjunction with other treatment methods known to those of skill in the art.
- such methods may include, but are not limited to, chemotherapy, radiation therapy, or surgery.
- Administration of the inhibitors can be performed by intravenous, intramuscular, subcutaneous, intradermal, topical, intraperitoneal, intrathecal, intrapleural, intrauterine, rectal, vaginal, intrasynovial, intraocular/periocular, intratumor or parenteral administration.
- the subject is at risk for developing melanoma and the combination therapy, or DHODH inhibitor, is administered prophylactically.
- the risk can be determined genetically. Alternatively, the risk can be determined by measuring levels of marker proteins in the biological fluids (i.e. blood, urine) of a patient.
- the methods of treatment described herein further comprises the step of selecting a subject in need thereof of treatment, e.g. selecting a subject diagnosed with melanoma, or a subject at increased risk of melanoma (e.g. potential cancer relapse).
- screening methods for identifying agents that inhibit melanoma growth comprise, (a) contacting a zebrafish embryo with a test agent for a period of time, (b) rinsing the test agent from the embryos of step (a); and (c) assaying the number of neural crest progenitors as compared to a control zebrafish embryo that has not been contacted with the test agent, wherein a reduced number of neural crest progenitors (e.g. and their differentiation into melanocytes) indicates that the compound is capable of inhibiting melanoma.
- the zebrafish embryos may be wild type zebra fish embryos or transgenic zebrafish embryos.
- the number of neural crest progenitors is assayed by monitoring crestin expression, or soxlO expression, or dct expression, e.g. by quantitation of ISH studies.
- the transgenic zebrafish embryo expresses green fluorescent protein operably linked to the melanocyte mitfa promoter and melanocyte neural crest progenitors are monitored by GFP expression.
- FIG. la Transgenic zebrafish expressing BRAF V600E under the melanocyte specific mitfa promoter develop pigmentation abnormalities, and melanoma when crossed with p53 _/ ⁇ fish. Gross embryonic development is largely normal.
- Fig. lb Gene expression analysis reveals a unique gene signature at 72hpf in the BRAF v600E ;p53 "/" strain (left).
- GSEA Gene set enrichment analysis reveals an enrichment between the embryonic gene signature and the adult melanomas which form 4-12 months later (middle and right; see Methods for full GSEA methods).
- Embryo heat map columns represent average of 3 clutches (log 2 scale, range -2 to +2 fold); adult heat map columns represent individual fish (log 2 scale, range -10 to +10 fold).
- Fig. lc Sagittal section of WT and BRAF v600E ;p53 "/" adults reveal homogeneous crestin expression (blue staining, shown as dark grey) only within the dorsal melanoma, whereas it is absent in normal adult tissues.
- FIGs 2a to 2e show ISH staining in Zebrafish.
- Fig2a A chemical genetic screen to identify suppressors of the crestin + lineage during embryogenesis identified NSC210627, a compound which completely abrogates expression by ISH (Fig2a, left and middle).
- the Discovery gate chemoinformatic algorithm revealed structural similarity between NSC210627 and brequinar (see Figure 5), an inhibitor of dihydroorotate dehydrogenase (DHODH).
- DHODH dihydroorotate dehydrogenase
- Leflunomide Fig2a structurally distinct DHODH inhibitor, phenocopies the crestin phenotype of NSC210627 (Fig2a, right).
- Fig2b-Fig2d Leflunomide caused an absence of multiple neural crest derivatives, including pigmented melanocytes (Fig2b), mitf-GFP + melanocyte progenitors (cFig2), and mbp- mCherry + glial cells (Fig2d).
- Figures 3a to 3c show that DHODH inhibition modulates transcriptional elongation.
- Figures 3a The hypomorphic spt5 m806 mutant has only a mild pigment defect on its own (top). Treatment with low-dose leflunomide (3uM) leads to an almost complete absence of neural crest derived melanocytes in the mutant line. See Figure 7 for dose-response quantification of this effect.
- Figures 3b Metagene analysis of RNA pol II occupancy in A375 human melanoma cells after treatment with leflunomide. Pol II occupancy at the promoter region is unaffected, but diminished at the 3' end of the genes. Inset shows a higher magnification of the 3' region of the genes.
- Figures 3c Representative examples of myc target genes which demonstrate defects in transcriptional elongation after leflunomide treatment, along with a non-affected gene.
- FIGs 4a to 4c show graphs. DHODH blockade suppresses melanoma growth in concert with BRAF V600E inhibition.
- Fig4a Leflunomide causes a dose-dependent decrease in melanoma proliferation as measured by CellTiterGlo assay in 3 BRAF V600E melanoma cells lines tested (A375, RPMI7951, Hs.294T).
- Fig4b Fig4c Leflunomide cooperates with the BRAF V600E inhibitor PLX4720 in inhibiting melanoma cell proliferation in the A375 (Fig4b) and Hs.294T (Fig4) cell lines as well as the other tested lines (See Figure 8).
- Figure 5 shows chemical structures of DHODH inhibitors NSC210627, brequinar, leflunomide and A771726 (teriflunomide) and oncogenic BRAF inhibitor PXL4720.
- Figures 6a to 6c The effects the leflunomide derivative A771726, on rat neural crest stem cells.
- Fig6a The effects of A771726 on rat neural crest stem cell self-renewal (as described in Figure 2e, *,p ⁇ 0.05, compared to control, t-test).
- Figures 7a to7d show graphs of the effect of low-doses of leflunomide on pigmentation in the spt5m806 hypomorphic mutant. Quantification of the effect described in Figure 3a, in which 3, 4 or 5uM leflunomide was applied to a spt5 m806 hypomorphic incross.
- Fig7a Pigmentation scores in untreated embryonic offspring of an incross of the spt5 m806 hypomorphic mutant. There is a mild pigmentation defect only in homozygous embryos.
- Figures 8a to 8d show graphs.
- Fig8a, Fig8ab In vitro proliferation assay testing the effects of combined All 1126 and the BRAF inhibitor PLX4720 on RPMI7951 and 294T cells shows significant augmentation of the effects of the BRAF inhibitor alone.
- Fig8c PLX4720 is only effective in BRAF V600E melanoma cells.
- RPMI7951 is BRAF V600E , it is significantly less sensitive than the other tested cell lines.
- Fig9b shows marker staining of tumors, a representative tumor in which all 4 markers are expressed in different areas of the tumor.
- Figures 10a to 10b show cumulative results of the chemical screen described in the Methods section. 2000 chemicals were screened, and positive "hits" were those with a staining score of less than 2 (i.e. 3%). Representative examples of each score are shown on top. The percentage of chemicals resulting in a given score are shown below.
- Figures 11a to l ib show graphs depicting enzymatic inhibition.
- the effect of NSC210627 on purified human and malarial DHODH. This demonstrates a strong inhibition of both enzymes, at lower concentrations in the human versus malarial forms. Error bars are mean +/-SEM of n 3 replicates.
- Figure 12 shows in situ hybridization for neural crest and non-neural crest lineages in the presence of leflunomide. No significant difference is seen in intensity for the mesoderm marker ntl (although the pattern of expression is altered in some embryos) and blood marker gatal. A disruption in the pattern of foxd3 expression, and absence of soxlO and dct expression confirms broad defects in neural crest development in the presence of leflunomide.
- Figures 13a to 13c show in situ hybridization and graphs.
- Figl3a The spt5sk8-/- transcriptional elongation mutant phenocopies the absence of crestin+ progenitors in a manner analogous to leflunomide.
- Figl3b GSEA was used to compare the gene expression signature of leflunomide treated embryos and spt5sk8-/- embryos at 24hpf.
- Venn diagram shows the number of genes up or downregulated in the spt5sk8-/- mutant that are similarly up or downregulated after leflunomide treatment, (see Methods for full GSEA analysis methods)
- Figl3c qRT-PCR on whole embryos treated with DMSO or leflunomide was used to measure transcription elongation at the 5' or 3' end of the noted gene.
- Figures 14a to 14b show metagene analysis graphs. ChlP-seq results in melanoma MAMLE-3M cells. Data are the same as that described in Figure 3b, 3c (A375 melanoma cells).
- Fig 14a Metagene analysis of RNA polymerase II occupancy of the promoter and gene body in MAMLE-3M cells treated with DMSO (control) or leflunomide 50uM. Leflunomide causes no defect in promoter occupancy but significantly decreases pol II occupancy in the body of the gene, consistent with an inhibition of transcriptional elongation.
- Figl4b Representative examples of affected (left) and unaffected genes in this cell line.
- Figures 15a to 15c show a Western blot and graphs.
- Figl5a Western blot showing extent of DHODH knockdown induced by shRNA#877 as compared to scrambled (scr) control shRNA in A375 melanoma cells.
- Figl5b Cell counts measured over an 8 day period in A375-scr and A375-shRNA#877 cells shows a 57% decrease in cellular proliferation with DHODH knockdown.
- Figure 16 show mice after treatment with inhibitors. Representative examples of mice after treatment with DMSO, PLX alone, leflunomide alone or the combination. See Figure 4 for quantification.
- Figure 17 shows the chemical structures of Sorafenib (Bayer) and RAF265.
- Figure 18 shows the chemical structures of AZ628, and GSK2118463.
- Figure 19 shows the chemical structures of PLX4032 and GDC-0879.
- Figure 20 shows the chemical structures of dichlorallyl lawsone, maritumus (see U.S. Patent 7,256,008), and redoxal.
- the present invention relates generally to a method of treating melanoma in a subject having, or at risk of having, melanoma.
- the patient is preferably a human, but can also be a mammal in need of veterinary treatment.
- melanoma as used herein includes all types of melanoma, including, for example, melanoma skin cancer, ocular melanoma, and mucosal melanoma. Melanoma is caused by changes melanocytes that produce melanin.
- melanoma There are four major types of melanoma: 1) superficial spreading melanoma, which is usually flat and irregular in shape and color, with different shades of black and brown and is most common in Caucasians, 2) nodular melanoma, which usually starts as a raised area that is dark blackish-blue or bluish-red, but can be colorless, 3) Lentigo maligna melanoma, which usually occurs in the elderly and is most common in sun- damaged skin on the face, neck, and arms. The abnormal skin areas are usually large, flat, and tan with areas of brown, 4) Acral lentiginous melanoma, which is the least common form and usually occurs on the palms, soles, or under the nails and is more common in African Americans.
- Melanomas may also appear in the mouth, iris of the eye, or retina at the back of the eye and can be found during dental or eye examinations. Although very rare, melanoma can also develop in the vagina, esophagus, anus, urinary tract, and small intestine.
- melanoma can be determined by means well known to those of skill in the art, e.g. tissue biopsies and in situ assays in which malignant melanoma (malignant melanocytes scattered in all epidermal layers) show atrophic epidermis, prominent dermal solar elastosis and almost always lymphocytic infiltration. Invasion of the dermis by melanocytes may occur in lentigo maligna melanoma.
- melanoma may be detected by methods that include, but are not limited, immunohistochemistry using the melanoma specific antibody HMB- 45, or RT-PCR with different melanoma associated antigens (MAA) including, but not limited to tyrosinase, MART-l/Melan A, Pmel-17, TRP-1, and TRP-2 (see, e.g., Hatta N., et al., J Clin Pathol. 1998 Aug;51(8):597-601).
- Biomarkers for melanoma are also known and can be used for example to assess subjects at risk of melanoma.
- Non-limiting example biomarkers for melanoma are described in PCT Publications WO 2008/141275, WO 2009/073513, or in US patent
- Symptoms of melanoma include, but are not limited to, a mole, sore, lump, or growth on the skin that may bleed, or exhibit change in skin coloring. Often patients are told of an ABCDE system the can help them remember possible symptoms of melanoma to watch out for: Asymmetry: a mole where one half of the abnormal area is different from the other half; Borders, the edges of the growth are irregular; Color, the color changes from one area to another, with shades of tan, brown, or black, and sometimes white, red, or blue, e.g.
- treatment refers to inhibition of growth of a melanoma, inhibiting metastasis of melanoma, delaying or preventing the onset of melanoma, or reversing, alleviating, ameliorating, inhibiting, slowing down, or stopping the progression of melanoma.
- treatment as used herein is not intended encompass 100% cure of melanoma. However, in one embodiment, the therapeutic methods described herein may result in 100% reversal of disease.
- At least one symptom of melanoma is alleviated by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- the clinical signs and/or the symptoms associated with the melanoma are lessened as a result of the administration of the inhibitor/s.
- the signs or symptoms to be monitored are characteristic of a particular melanoma and are known to the skilled clinician, as well as the methods for monitoring the signs and conditions.
- the melanoma lesion size is reduced by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- melanoma cell proliferation, or melanoma growth is inhibited by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- the skilled clinician may monitor the size or rate of growth of a tumor using a diagnostic imaging method typically used for the particular tumor (e.g., using ultrasound or magnetic resonance image (MRI) to monitor a tumor).
- MRI magnetic resonance image
- the method for treatment of melanoma comprises administering to a subject in need thereof a therapeutically effective amount of an inhibitor of DHODH.
- DHODH dihydroorotate dehydrogenase
- AAA50163.1 SEQ ID NO:2
- gene SEQ ID NO:4
- Enzymatic activity of DHODH can be assessed using in vitro assays and monitoring the reduction in 2,6-dichloroindophenol (DCIP) (e.g. see Examples).
- DCIP 2,6-dichloroindophenol
- any inhibitor of DHODH can be used in methods of the invention.
- the phrase "inhibitor of DHODH” means a compound or agent that inhibits the biological activity of DHODH.
- the biological activity of DHODH can be inhibited using a compound or agent that inhibits the enzymatic activity of DHODH, or a compound or agent that down regulates expression or availability of DHODH in a cell or organism (e.g. siRNA, shRNA).
- siRNA e.g. siRNA, shRNA
- Many inhibitors of DHODH are known to those skilled in the art. For example, various inhibitors are described in: Leban et al. (2005) SAR, species specificity, and cellular activity of
- Various DHODH inhibitors have been disclosed for the treatment or prevention of autoimmune diseases, immune and inflammatory diseases, destructive bone disorders, malignant neoplastic diseases, angiogenic-related disorders, viral diseases, and infectious diseases. See for example WO2010083975; WO2011138665; WO200137081; WO2009133379; WO
- inhibitors include, but are not limited to, leflunomide, teriflunomide, brequinar (NSC 368390) (Cancer Research 1992, 52, 3521-3527), Dichloroallyl lawsone (The Journal of Biological Chemistry 1986, 261(32), 14891-14895; McKelvey et al. Clin Pharmacol Ther. 1979 May; 25(5 Pt l):586-90.), Maritimus (F 778) (Drugs of the Future 2002, 27(8), 733- 739) and Redoxal (The Journal of Biological Chemistry 2002, 277(44), 41827-41834). See also Example 1 and Figure 5, which describes a compound of previously unknown function,
- NSC210627 with similarity to brequinar, a known inhibitor of DHODH.
- Leflunomide is sold under the trade name Arava (EP 0 780 128, WO 97/34600), and was the first DHODH inhibitor that reached the market place.
- Leflunomide is the prodrug of teriflunomide (A771726), which is the active metabolite that inhibits human DHODH with a moderate potency.
- the inhibitor of DHODH is not leflonomide or its derivative A771726. In one embodiment, the inhibitor of DHODH is not maritumis.
- DHODH Dihydroorotate Dehydrogenase
- agent or “compound” as used herein and throughout the specification means any organic or inorganic molecule, including modified and unmodified nucleic acids such as antisense nucleic acids, RNAi, such as siRNA or shRNA, peptides, small molecules peptidomimetics, receptors, ligands, and antibodies, e.g. molecules and/or compositions that inhibit DHODH activity or inhibit BRAF activity.
- RNAi such as siRNA or shRNA
- peptides such as siRNA or shRNA
- peptides small molecules peptidomimetics
- receptors e.g. molecules and/or compositions that inhibit DHODH activity or inhibit BRAF activity.
- the compounds/agents include, but are not limited to, chemical compounds and mixtures of chemical compounds, e.g., small organic or inorganic molecules; saccharines; oligosaccharides; polysaccharides; biological macromolecules, e.g., peptides, proteins, and peptide analogs and derivatives; peptidomimetics; nucleic acids; nucleic acid analogs and derivatives; extracts made from biological materials such as bacteria, plants, fungi, or animal cells or tissues; naturally occurring or synthetic compositions; peptides; aptamers; and antibodies, or fragments thereof.
- a compound/agent can be a nucleic acid RNA or DNA, and can be either single or double stranded.
- Example nucleic acid compounds include, but are not limited to, a nucleic acid encoding a protein inhibitor (e.g. transcriptional inhibitors), oligonucleotides, nucleic acid analogues (e.g. peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acid (LNA) etc.), antisense molecules, ribozymes, small inhibitory or activating nucleic acid sequences (e.g. RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.)
- a protein and/or peptide agent can be any protein that modulates gene expression or protein activity.
- Non-limiting examples include mutated proteins; therapeutic proteins and truncated proteins, e.g. wherein the protein is normally absent or expressed at lower levels in the target cell.
- Proteins can also be selected from genetically engineered proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins, antibodies, midibodies, minibodies, triabodies, diabodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof.
- a compound or agent that increases expression of a gene or increases the activity of a protein encoded by a gene is known as an activator or activating compound.
- a compound or agent that decreases expression of a gene or decreases the activity of a protein encoded by a gene is also known as an inhibitor or inhibiting compound.
- polypeptide refers to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acids.
- the methods of the invention are directed to a combination therapy wherein one component is administration of an effective amount of an inhibitor of BRAF oncogene (e.g. BRAF(V006E)), and a second component is administration of an effective amount of an inhibitor of DHODH. .
- BRAF oncogene e.g. BRAF(V006E)
- DHODH e.g. DHODH
- BRAF refers to the serine/threonine kinase BRAF polypeptide as well as the gene encoding it.
- BRAF is known to transduce regulatory signals from RAS through MEK (MAPK kinase) to ERK. Sequences for BRAF genes and proteins are well known to those of skill in the art, e.g. the protein sequence for human wild type BRAF is found at GenBank accession no. NP_004324.2 (SEQ ID NO: 1).
- BRAF oncogenic mutations lead to constitutive activation of the RAS-RAF-mitogen activated protein kinase/ERK kinase (MEK)- extracellular signal regulated kinase (ERK) signaling pathway, which is essential for cell proliferation, differentiation and survival (Davies et al., Nature 417:949-54 (2002)); English et al., Trends Pharmacol. Sci. 23:40-5 (2002)).
- MEK protein kinase/ERK kinase
- ERK extracellular signal regulated kinase
- oncogenic BRAF refers to a BRAF gene/polypeptide that is aberrantly expressed or aberrantly active. This increase in expression or activity can result from a mutation(s) in BRAF, which constitutively activates the MEK/ERK or other pathways, or from a defect resulting in a detectable increase in BRAF expression or activity in cancer cell compared to a non-cancerous.
- such increased expression and/or activity may result from amplification of a wild-type BRAF nucleic acid, overexpression of a wild-type BRAF protein, e.g., by aberrant regulation of the BRAF regulatory region such as the promoter, overexpression or activation of BRAF due to aberrant regulation of an upstream regulator (e.g., RAS mutation, or inhibition of a BRAF inhibitor) or by stabilization of BRAF.
- an upstream regulator e.g., RAS mutation, or inhibition of a BRAF inhibitor
- Oncogenic BRAF mutations have been identified in about 70% of malignant melanomas (Davies et al., Nature 417:949-54 (2002)) and are implicated in the malignant growth of melanoma cells (Wellbrock et al., Cancer Res. 64:2338-42 (2004); Hingorani et al., Cancer Res. 63:5198-202 (2003)).
- the term "mutation” includes substitution, deletions, inversions, insertions, premature terminations and the like.
- the V600E mutation increases BRAF kinase activity (Davies et al., supra; Dong et al., Cancer Res. 2003; 63: 3883-3885).
- Additional mutations of the BRAF gene in human cancer include but are not limited to, ARG461ILE, ILE462SER, GLY463GLU, and LYS600GLU (Rajagopalan, H., et al.
- the oncogenic BRAF to be inhibited in the combination therapy of the invention has a mutation selected from the group consisting of VAL600GLU (also named as VAL599GLU) (Davies et al. Nature. Jun. 27, 2002; 417(6892):949-54), ARG461ILE, ILE462SER, GLY463GLU, and LYS600GLU (Rajagopalan, H., et al. (Letter) Nature 418: 934, 2002), GLY465VAL and LEU596ARG (Naoki, K., et al., Cancer Res.
- the inhibitor binds specifically to oncogenic BRAF polypeptide.
- any inhibitor of oncogenic BRAF can be used in methods of the invention.
- the phrase "inhibitor of oncogenic BRAF” means a compound or agent that inhibits the biological activity of a BRAF oncogene, mutated or aberrantly expressed wild type.
- Multiple BRAF inhibitors are well known to those of skill in the art.
- BRAF has been a target of small-molecule therapies to treat cancer (See e.g. Halilovic E, and Solit DB, Therapeutic strategies for inhibiting oncogenic BRAF signaling.
- Raf inhibitors such as BAY 43-9006 (sorafenib), are not selective for BRAF, with activity against multiple kinase targets (Wilhelm SM, et al. (2004) BAY 43-9006 exhibits broad spectrum oral antitumor activity and targets the RAF/MEK/ERK pathway and receptor tyrosine kinases involved in tumor progression and angiogenesis. Cancer Res ; 64:7099-109).
- Other small-molecule BRAF inhibitors include RAF265, XL281, AZ628, GSK2118436, and GDC- 0879: See ClinicalTrials.gov. A study to evaluate RAF265, an oral drug administered to subjects with locally advanced or metastatic melanoma.
- ClinicalTrials.gov identifier NCT00304525 Available at: http://ClinicalTrials.gov. Accessed January 21, 2010; Schwartz et al. (2008).
- BRAF inhibitors that have undergone clinical trials are described in Shepard et al. (2010) B-RAF Inhibitors: An Evolving Role in the Therapy of Malignant Melanoma Current Oncology Reports Volume 12, Number 3, which is herein incorporated by reference in its entirety.
- RG7204 (formerly PLX4032) is a small-molecule inhibitor that inhibits BRAFV600E with a IC50 of 30 nmol/L (Sala E, et al. (2008) BRAF silencing by short hairpin RNA or chemical blockade by PLX4032 leads to different responses in melanoma and thyroid carcinoma cells. Mol Cancer Res 6: 751-9).
- the inhibitor of oncogenic BRAF(V600E) is Vemurafenib (also known as PLX4032, RG7204 or R05185426, and marketed as Zelboraftm (Hoffman-La Roches (Madisin, Wisconsin)/Daiichi Sankyo (Parsippany, NJ)).
- Vemurafenib is a selective inhibitor of BRAF(V600E), and is described in U.S. patent 7,863,288, herein incorporated by reference in its entirety.
- the inhibitor is a specific inhibitor of oncogenic BRAF(V600E) that is PLX4720 (Plexxikon Inc., Berkeley, California, USA) (Tsai J, Lee JT, Wang W, et al. Discovery of a selective inhibitor of oncogenic B-Raf kinase with potent antimelanoma activity. Proc Natl Acad Sci U S A 2008;105:3041-3046), see Figure 5.
- compounds that inhibit oncogenic BRAF (BRAF or mutated BRAF) expression or activity may be readily identified using screening methods well known to those of skill in the art (e.g. see US 2008/0072337).
- compounds identified by the screening methods bind specifically to a BRAF nucleic acid or to BRAF polypeptide.
- the compounds or agents antagonize BRAF and inhibit a downstream biological effect (e.g., inhibit the phosphorylation of MEK and ERK) that is associated with constitutive BRAF activity.
- In vivo or cell culture assays may be used to determine whether a test compound functions as an antagonist to inhibit BRAF in cells.
- cell culture assays may be used to measure a test compound's ability to modulate an activity, such as detecting inhibition of endogenous phospho-MEK levels, or increase sensitivity to chemotherapy, in tumor cells treated with a test compound.
- Such assays generally comprise contacting a cell that expresses BRAF or mutated BRAF with a test compound and comparing it to control cells not contacted with the test compound.
- Cell assays include those utilizing conventional, reporter gene-based assays, among others.
- the inhibitor of oncogenic BRAF is selected from the group consisting of Sorafenib (Bayer), RAF265 (Novartis), XL281 (BMS-908662, Bristol-Myers Squibb; Exelixis), AZ628 (Montagut et al (2008) Cancer Res 68:4853-61), GSK2118436 (GlaxoSmithKline, ), GDC-0879 (Selleck Chemicals LLC, Houston, TX), PLX4032
- DHODH Difluorophenyl- sulfonamine, Plexxikon Inc., Berkeley, California, USA
- the inhibitor of DHODH is selected from the group consisting of : leflunomide, teriflunomide, brequinar, dichloroallyl lawsone, maritimus, redoxal and NSC210627.
- the combination therapy described herein comprises administration of an inhibitor of BRAF(V006E) that is PLX4720 and an inhibitor of DHODH that is leflunomide or teriflunomide. In another specific embodiment, the combination therapy described herein comprises administration of an inhibitor of BRAF(V006E) that is PLX4032 and an inhibitor of DHODH that is leflunomide or teriflunomide.
- the invention contemplates the practice of the method in conjunction with other therapies such as conventional chemotherapy, radiation therapy or surgery directed against solid tumors and for control of establishment of metastases.
- therapies such as conventional chemotherapy, radiation therapy or surgery directed against solid tumors and for control of establishment of metastases.
- the administration of angiogenesis-inhibiting amounts of combination therapy may be conducted before, during or after chemotherapy, radiation therapy or surgery.
- Embodiments of the invention comprise administering to a subject an inhibitor of oncogenic BRAF and/or and inhibitor of DHODH for the treatment of melanoma.
- the administration of the DHODH inhibitor, or combination therapy comprising administration of a DHODH and a BRAF inhibitor may be for either "prophylactic" or "therapeutic" purpose.
- therapy is provided in advance of any symptom.
- the prophylactic administration of the therapy serves to prevent formation of melanoma.
- Prophylactic administration may be given to a patient with, for example, a family history of cancer, or a patient that has had a melanoma removed surgically.
- administration of the combination therapy may be given to a patient with rising cancer marker protein levels, for example melanoma markers described in PCT Publications WO 2008/141275, WO
- the administration of the DHODH inhibitor, or combination therapy comprising administration of a DHODH inhibitor and a BRAF inhibitor is provided at (or after) the onset of a symptom, or indication of melanoma.
- the inhibitor of DHODH and the inhibitor of BRAF can be present in the same or different pharmaceutical composition.
- the inhibitor of DHODH and the inhibitor of BRAF can be administered within 5 minutes, 10 minutes, 20 minutes, 60 minutes, 2 hours, 3 hours, 4, hours, 8 hours, 12 hours, 24 hours of administration of the other.
- routes of administration can be different.
- the effective dosage range for the administration of the inhibitors depends upon the form of the inhibitor and its potency. It is an amount large enough to produce the desired effect in which symptoms of melanoma are ameliorated (e.g. inhibition of tumor growth).
- the phrase "therapeutically-effective amount” as used herein means that amount of inhibitory compound or composition comprising the inhibitor/s which is effective for producing the desired therapeutic effect, in at least a sub-population of cells, in a subject at a reasonable benefit/risk ratio applicable to any medical treatment. For example, an amount of a compound administered to a subject that is sufficient to produce a statistically significant, measurable change in at least one symptom of melanoma. Determination of a therapeutically effective amount is well within the capability of those skilled in the art.
- a therapeutically effective amount can vary with the subject's history, age, condition, sex, as well as the severity and type of the medical condition in the subject, and administration of other pharmaceutically active agents.
- preclinical melanoma models that are well known to those of skill in the art which can be used to determine therapeutically effective amounts of the compound or agents and to optimize administration regimes. See for example Yang et al. (2010) RG7204 (PLX4032), A selective BRAFV600E inhibitor, displays potent antitumor activity in preclinical melanoma models, Cancer Research, 70:5518-5527, which is herein incorporated by reference its entirety.
- a therapeutically effective amount of oncogenic BRAF inhibitor (e,g BRAF(V600E)) and/or DHODH inhibitor, inhibits melanoma tumor volume in a preclinical model by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and reduces at least one symptom of melanoma by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- oncogenic BRAF inhibitor e,g BRAF(V600E)
- DHODH inhibitor inhibits melanoma tumor volume in a preclinical model by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- tumor volumes in xenograft mice can be calculated using the following ellipsoid formula: [D x (d2)]/2, in which D represents the large diameter of the tumor, and d represents the small diameter.
- Tumor volumes of treated groups are presented as percentages of tumor volumes of the control groups (%T/C) using the following formula: 100 x [(T - T 0 )/(C - Co)], in which T represents mean tumor volume of a treated group on a specific day during the experiment, To represents mean tumor volume of the same treated group on the first day of treatment, C represents mean tumor volume of a control group on the specific day during the experiment, and Co represents mean tumor volume of the same treated group on the first day of treatment.
- Percent tumor growth inhibition can be calculated as 100 - %T/C, with >100% tumor growth inhibition representing regression. Survival can be calculated using a predefined cutoff volume of 2,000 mm as a surrogate for mortality (See e.g.Yang et al. (2010), Supra).
- a therapeutically effective amount of the DHODH inhibitor inhibits the enzymatic activity of DHODH by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% and reduces at least one symptom of melanoma by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- a therapeutically effective amount of the oncognic BRAF inhibitor and/or DHODH inhibitor inhibits cellular proliferation in a preclinical model by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% and reduces at least one symptom of melanoma by at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
- Inhibition of cellular proliferation may be evaluated by 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT; Sigma) assay.
- MTT 3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyl-2H-tetrazolium bromide
- cells can be plated in 96-well microtiter plates at a density of 1,000 to 5,000 cells per well in a volume of 180 uL. Twenty-four hours after cell plating, 20 uL of an appropriate compound/agent dilution can be added to plates in duplicate. The plates may then be assayed for proliferation 6 days after the cells were plated according to the procedure originally described by Mosmann, Rapid colomeric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol.
- Percent inhibition can then be calculated and the IC50 determined from the regression of a plot of the logarithm of the concentration versus percent inhibition by XLfit (version 4.2; IDBS) using a Dose-Response One-Site Model (#205) (see e.g. Yang et al. Supra)
- the therapeutically effective dose can be estimated initially from a suitable cell culture or enzymatic assays (e.g. melanoma cell growth assays, phosphorylation assays, or DHODH enzymatic activity assays) , then a dose of each compound and treatment regime may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 as determined in cell culture.
- a suitable cell culture or enzymatic assays e.g. melanoma cell growth assays, phosphorylation assays, or DHODH enzymatic activity assays
- the compounds or agents can be provided in pharmaceutically acceptable compositions.
- These pharmaceutically acceptable compositions comprise a therapeutically-effective amount of one or more of inhibitors, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents.
- compositions of the present invention can be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), lozenges, dragees, capsules, pills, tablets (e.g., those targeted for buccal, sublingual, and systemic absorption), boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; (3) topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin; (4) intravaginally or intrarectally, for example, as a pessary, cream or foam; (5) sublingually; (6) ocularly; (7) transdermally; (8) transmucosally (e.g.
- the term "pharmaceutically acceptable” refers to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- the term "pharmaceutically- acceptable carrier” means a
- composition or vehicle such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- a liquid or solid filler diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- manufacturing aid e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid
- solvent encapsulating material involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body.
- Each carrier
- materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, methylcellulose, ethyl cellulose, microcrystalline cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium stearate, sodium lauryl sulfate and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol (PEG); (12) esters, such as ethyl
- polyanhydrides (22) bulking agents, such as polypeptides and amino acids (23) serum
- the amount of compound which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect.
- this amount will range from about 0.1% to 99% of compound, preferably from about 5% to about 70%, most preferably from 10% to about 30%.
- Formulations suitable for parenteral administration conveniently include sterile aqueous preparation of the active compound which is preferably isotonic with the blood of the recipient.
- Such formulations may conveniently contain distilled water, 5% dextrose in distilled water or saline.
- Useful formulations also include concentrated solutions or solids containing the compound which upon dilution with an appropriate solvent give a solution suitable for parental administration above.
- a compound can be incorporated into an inert carrier in discrete units such as capsules, cachets, tablets or lozenges, each containing a predetermined amount of the active compound; as a powder or granules; or a suspension or solution in an aqueous liquid or non-aqueous liquid, e.g., a syrup, an elixir, an emulsion or a draught.
- Suitable carriers may be starches or sugars and include lubricants, flavorings, binders, and other materials of the same nature.
- a tablet may be made by compression or molding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active compound in a free-flowing form, e.g., a powder or granules, optionally mixed with accessory ingredients, e.g., binders, lubricants, inert diluents, surface active or dispersing agents.
- Molded tablets may be made by molding in a suitable machine, a mixture of the powdered active compound with any suitable carrier.
- a syrup or suspension may be made by adding the active compound to a
- accessory ingredients may include flavoring, an agent to retard crystallization of the sugar or an agent to increase the solubility of any other ingredient, e.g., as a polyhydric alcohol, for example, glycerol or sorbitol.
- Formulations for rectal administration may be presented as a suppository with a conventional carrier, e.g., cocoa butter or Witepsol S55 (trademark of Dynamite Nobel
- Formulations for oral administration may be presented with an enhancer.
- Orally- acceptable absorption enhancers include surfactants such as sodium lauryl sulfate, palmitoyl carnitine, Laureth-9, phosphatidylcholine, cyclodextrin and derivatives thereof; bile salts such as sodium deoxycholate, sodium taurocholate, sodium glycochlate, and sodium fusidate; chelating agents including EDTA, citric acid and salicylates; and fatty acids (e.g., oleic acid, lauric acid, acylcarnitines, mono- and diglycerides).
- surfactants such as sodium lauryl sulfate, palmitoyl carnitine, Laureth-9, phosphatidylcholine, cyclodextrin and derivatives thereof
- bile salts such as sodium deoxycholate, sodium taurocholate, sodium glycochlate, and sodium fusidate
- chelating agents including
- oral absorption enhancers include benzalkonium chloride, benzethonium chloride, CHAPS (3-(3-cholamidopropyl)-dimethylammonio-l- propanesulfonate), Big-CHAPS (N, N-bis(3-D-gluconamidopropyl)-cholamide), chlorobutanol, octoxynol-9, benzyl alcohol, phenols, cresols, and alkyl alcohols.
- An especially preferred oral absorption enhancer for the present invention is sodium lauryl sulfate.
- administer refers to the placement of a composition into a subject by a method or route which results in at least partial localization of the composition at a desired site such that desired effect is produced.
- composition described herein can be administered by any appropriate route known in the art including, but not limited to, oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration.
- oral or parenteral routes including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration.
- Exemplary modes of administration include, but are not limited to, injection, infusion, instillation, inhalation, or ingestion.
- injection includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection and infusion.
- Methods of delivering RNAi interfering (RNAi) agents e.g., an siRNA
- RNAi interfering (RNAi) agents e.g., an siRNA
- other nucleic acid modulators e.g., other nucleic acid modulators
- vectors containing modulatory nucleic acids to the target cells (e.g., melanocytes) can include, for example directly contacting the cell with a composition comprising a modulatory nucleic acid, or local or systemic injection of a composition containing the modulatory nucleic acid.
- nucleic acid agents e.g. RNAi, siRNA, or other nucleic acid
- modulatory nucleic may be delivered by systemic administration, wherein the nucleic acid is complexed with, or alternatively contained within a carrier.
- compounds include, but are not limited to, peptide carriers, viral vectors, gene therapy reagents, and/or liposome carrier complexes and the like.
- the compound may be administered in liposomes or microspheres (or microparticles).
- Methods for preparing liposomes and microspheres for administration to a patient are well known to those of skill in the art.
- U.S. Pat. No. 4,789,734 the contents of which are hereby incorporated by reference, describes methods for encapsulating biological materials in liposomes. A review of known methods is provided by G. Gregoriadis, Chapter 14,
- the compound/agents described herein for treatment of melanoma can be administered to a subject in combination with additional pharmaceutically active agents.
- exemplary pharmaceutically active compound include, but are not limited to, those found in Harrison's Principles of Internal Medicine, 13 th Edition, Eds. T.R. Harrison et al.
- Toxicity and therapeutic efficacy can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compositions that exhibit large therapeutic indices, are preferred.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the therapeutic which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- Levels in plasma may be measured, for example, by high performance liquid chromatography.
- the effects of any particular dosage can be monitored by a suitable bioassay.
- the dosage may be determined by a physician and adjusted, as necessary, to suit observed effects of the treatment.
- compositions are administered so that a compound is given at a dose from 1 ⁇ g/kg to 150 mg/kg, 1 ⁇ g/kg to 100 mg/kg, 1 ⁇ g/kg to 50 mg/kg, 1 ⁇ g/kg to 20 mg/kg, 1 ⁇ g/kg to 10 mg/kg, ⁇ g/kg to lmg/kg, 100 ⁇ g/kg to 100 mg/kg, 100 ⁇ g/kg to 50 mg/kg, 100 ⁇ g/kg to 20 mg/kg, 100 ⁇ g/kg to 10 mg/kg, 100 ⁇ g/kg to lmg/kg, 1 mg/kg to 100 mg/kg, 1 mg/kg to 50 mg/kg, 1 mg/kg to 20 mg/kg, 1 mg/kg to 10 mg/kg, 10 mg/kg to 100 mg/kg, 10 mg/kg to 50 mg/kg, or 10 mg/kg to 20 mg/kg.
- ranges given here include all intermediate ranges, for example, the range 1 mg/kg to 10 mg/kg includes lmg/kg to 2 mg/kg, lmg/kg to 3 mg/kg, lmg/kg to 4 mg/kg, lmg/kg to 5 mg/kg, lmg/kg to 6 mg/kg, lmg/kg to 7 mg/kg, lmg/kg to 8 mg/kg, lmg/kg to 9 mg/kg, 2mg/kg to lOmg/kg, 3mg/kg to lOmg/kg, 4mg/kg to lOmg/kg, 5mg/kg to lOmg/kg, 6mg/kg to lOmg/kg, 7mg/kg to 10mg/kg,8mg/kg to lOmg/kg, 9mg/kg to lOmg/kg etc...
- ranges intermediate to the given above are also within the scope of this invention, for example, in the range lmg/kg to 10 mg/kg, dose ranges such as 2mg/kg to 8 mg/kg, 3mg/kg to 7 mg/kg, 4mg/kg to 6mg/kg etc.
- duration and frequency of treatment it is typical for skilled clinicians to monitor subjects in order to determine when the treatment is providing therapeutic benefit, and to determine whether to increase or decrease dosage, increase or decrease administration frequency, discontinue treatment, resume treatment or make other alteration to treatment regimen.
- the dosing schedule can vary from once a week to daily depending on a number of clinical factors, such as the subject's sensitivity.
- the desired dose can be administered at one time or divided into subdoses, e.g., 2-4 subdoses and administered over a period of time, e.g., at appropriate intervals through the day or other appropriate schedule.
- sub-doses can be administered as unit dosage forms.
- administration is chronic, e.g., one or more doses daily over a period of weeks or months.
- dosing schedules are administration daily, twice daily, three times daily or four or more times daily over a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months or more.
- the pharmaceutical compositions can be administered during infancy (between 0 to about 1 year of life), childhood (the period of life between infancy and puberty) and during puberty (between about 8 years of life to 18 years of life).
- the pharmaceutical compositions can also be administered to treat adults (greater than about 18 years of life).
- a dose administered at least once, may be provided as a bolus, a continuous administration or sustained release. Multiple administration over a period of weeks or months may be preferable. It may also be preferable to administer the dose at least once/week and even more frequent administrations (e.g. daily). Subsequent doses may be administered as indicated.
- the inhibitor of DHODH e.g. leflunomide
- the inhibitor of DHODH is administered to a subject using an administration regime that results in a steady state concentration of 70 mcg/mL, or 60 mcg/mL, or 50 mcg/mL, 40 mcg/mL, 30 mcg/ml, or 20 mcg/mL (Rozman, B. (2002) Clinical pharmacokinetics of leflunomide, Clin. Pharmacokinetic, 41:421-430).
- the steady state concentration is 60 mcg/mL or less, 50 mcg/mL or less, 40 mcg/mL or less, 30 mcg/ml or less , or 20 mcg/mL or less.
- the inhibitor of DHODH e.g. leflunomide
- the inhibitor of DHODH is administered at 100 mg daily for 3 days, followed by lower daily doses of 20 mg/ml for a sustained
- the inhibitor of BRAF (e.g. PLX4302) is administered at a dosage of 960mg twice a day. In one embodiment, the inhibitor of BRAF (e.g. PLX4302) is administered at a dosage less than 900 mg twice a day, less than 850mg twice a day, less than 800mg twice a day, or less than 700 mg twice per day.
- the efficacy of a given treatment regime for melanoma can be determined by the skilled clinician, for example by assessing physical indicators of melanoma, such as e.g., tumor size or lesion size, metastasis, tumor growth rate, etc.
- a treatment is considered "effective treatment," as the term is used herein, if any one or all of the signs or symptoms of the cancer are altered in a beneficial manner, e.g. improved or ameliorated by at least 10% following treatment with a compound or agent that inhibits BRAF and/or DHODH.
- Efficacy can also be measured by a failure of an individual to worsen as assessed by stabilization of tumor growth, hospitalization or need for medical interventions (i.e., progression of the melanoma is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and/or described herein.
- Treatment includes in an individual includes: (1) inhibiting the disease, e.g., arresting, or slowing melanoma tumor or lesion growth; or (2) relieving the disease, e.g., causing regression of symptoms, reducing tumor or lesion size; and (3) preventing or reducing the likelihood of the development of melanoma, or preventing metastasis of the melanoma. [0113] Screening Methods
- BRAF(V600E):p537- embryos exhibit an abnormal expansion in the number of crestin+ progenitors (marker of embryonic neural crest progenitors), and that in the adult
- Crestin is normally downregulated after terminal differentiation of neural crest progenitors.
- a screen for compounds useful for melanoma treatment that comprises screening for inhibitors of neural crest progenitors during embryogenesis, e.g. screening for inhibitors of the crestin+ lineage.
- Methods of screening for agents that inhibit melanoma growth comprise: (a) contacting a zebrafish embryo with a test agent for a period of time (e.g. hours, days, or weeks), (b) rinsing the embryos of step (a); and (c) assaying the number of neural crest progenitors as compared to a control zebrafish embryo that has not been contacted with the test agent, wherein a reduced number of neural crest progenitors indicates that the compound is capable of inhibiting melanoma growth.
- a test agent for a period of time (e.g. hours, days, or weeks)
- the method further comprises the step of measuring inhibition of melanoma growth, e.g. in a transgenic melanoma zebrafish model, or in a melanoma
- the embryos may be contacted at any time of embryonic development. In in one embodiment, the embryos are contacted with an agent at approximately 20%, 30%, 40%, 50%, 60%, or 70% epiboly. [0119] In one embodiment, the zebrafish embryos used in the screen are wild type (wt) zebrafish embryos.
- inhibition of neural crest progenitors is scored by monitoring for inhibition of crestin expression in cells of the neural crest of the embryo.
- Crestin expression can be monitored by any means known to those of skill in the art, including but not limited to in situ hybridization with a crestin riboprobe.
- the method further comprises the step of fixing the embryos prior to performing ISH using means well known to those of skill in the art (e.g. fixing in PFA and methanol).
- Expression can be scored using visualization, or other means known to those of skill in the art, e.g.
- manual scoring may comprises assigning a score within a range of 1 (no crestin staining) to 3 (no change in crestin) to 5, a marked increase in crestin, e.g. compounds having a score of 2 or less may be considered to inhibit the number of crestin " cells.
- the zebrafish embryos are of mitfa-GFP transgenic zebrafish (express green fluorescent protein (GFP) operably linked to mitfa melanocyte specific promoter), and inhibition of neural crest progenitors is scored by monitoring for inhibition of the number of melanocytes along the neural crest of the embryo, e.g. by determining the amount of GFP expression in the neural crest, e.g. by visual scoring or computerized means.
- GFP green fluorescent protein
- inhibition of neural crest progenitors is scored by monitoring for inhibition of soxlO expression, or dct expression in cells of the neural crest of the embryo.
- the methods of screening described herein can be performed as high throughput assays. For example a plurality of embryos may be contacted with a plurality of compounds or agents, e.g. in a multi-well format, and the step of assaying the number of neural crest progenitors may be atomized, e.g. using automated in situ hybridization or fluorescence imaging. Compounds showing inhibition of neural crest progenitors may then be selected.
- An exemplary assay may involve plating wild type zebrafish embryos in multi-well plates in appropriate media, e.g. at a density of about 10 embryos per well, and at about 50% epiboly, adding the test agent to the wells. Any concentration of test agent can be used. In one embodiment, the test agent concentration ranges from, luM to 50uM, 0.1 nm to lOOOmM, or e.g. luM to 1mm, or more. High concentrations may be toxic to the embryos, which can easily be determined by testing and the concentration can be adjusted to minimize toxicity. 24 hours after treatment the cells embryos are rinsed of test drug and fixed for in situ hybridization, e.g.
- the zebrafish embryo used in the screening methods described herein has been genetically manipulated to express a nucleic acid encoding a mutant human BRAF and a mutant tumor suppressor and/or protooncogene, e.g. mitf- BRAF(V600E);p53-/-, or other oncogenic BRAF zebrafish melanoma models.
- a mutant human BRAF e.g. mitf- BRAF(V600E);p53-/-, or other oncogenic BRAF zebrafish melanoma models.
- mitf- BRAF(V600E) p53-/-, or other oncogenic BRAF zebrafish melanoma models.
- test compound refers to compounds and/or compositions that are to be screened for their ability to inhibit the number of neural crest progenitors.
- the test compounds can include a wide variety of different compounds, including chemical compounds and mixtures of chemical compounds, e.g., small organic or inorganic molecules; saccharines; oligosaccharides; polysaccharides; biological macromolecules, e.g., peptides, proteins, and peptide analogs and derivatives; peptidomimetics; nucleic acids; nucleic acid analogs and derivatives; an extract made from biological materials such as bacteria, plants, fungi, or animal cells; animal tissues; naturally occurring or synthetic compositions; and any combinations thereof.
- the test compound is a small molecule.
- small molecule refers to in organic or organic compounds. However, small molecules typically are characterized in that they contain several carbon— carbon bonds, and have a molecular weight of less than 5000 Daltons (5 kD), preferably less than 3 kD, still more preferably less than 2 kD, and most preferably less than 1 kD. In some cases it is preferred that a small molecule has a molecular weight equal to or less than 700 Daltons.
- a chemical library or compound library is a collection of stored chemicals usually used ultimately in high-throughput screening or industrial manufacture.
- the chemical library can consist in simple terms of a series of stored chemicals.
- Each chemical has associated information stored in some kind of database with information such as the chemical structure, purity, quantity, and physiochemical characteristics of the compound.
- the compounds/agents are typically provided free in solution, however the compounds/or agent may be in complex with solid forms.
- the test compound inhibits neural crest progenitors by at least 5%, 10%, 20%, 30%, 40%, 50%, 50%, 70%, 80%, 90%, 1-fold, 1.1-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or more higher relative to an untreated control.
- compositions, methods, and respective component(s) thereof are used in reference to compositions, methods, and respective component(s) thereof, that are essential to the invention, yet open to the inclusion of unspecified elements, whether essential or not.
- the term "consisting essentially of” refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention.
- compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
- the terms “decrease” , “reduced”, “reduction” , “decrease” or “inhibit” are all used herein generally to mean a decrease by a statistically significant amount. However, for avoidance of doubt, “"reduced”, “reduction” or “decrease” or “inhibit” means a decrease by at least 10% as compared to a reference level, for example a decrease by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% decrease (e.g. absent level as compared to a reference sample), or any decrease between 10-100% as compared to a reference level.
- a 100% decrease e.g. absent level as compared to a reference sample
- the terms “increased” /'increase” or “enhance” or “activate” are all used herein to generally mean an increase by a statically significant amount; for the avoidance of any doubt, the terms “increased”, “increase” or “enhance” or “activate” means an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level.
- the term "statistically significant” or “significantly” refers to statistical significance and generally means a two standard deviation (2SD) below normal, or lower, concentration of the marker.
- the term refers to statistical evidence that there is a difference. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using the p-value.
- IC50 refers to the concentration of an inhibitor that produces 50% of the maximal inhibition of activity or expression measurable using the same assay in the absence of the inhibitor.
- the IC50 can be as measured in vitro or in vivo.
- the IC50 can be determined by measuring activity using a conventional in vitro assay (e.g. protein activity assay, or gene expression assay).
- the present invention may be as defined in any one of the following numbered paragraphs. [0147] 1.
- a method for treating melanoma in a subject comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of dihydroorotate
- DHODH dehydrogenase
- DHODH dihydroorotate dehydrogenase
- a method for treating melanoma in a subject comprising administering to a subject in need thereof a therapeutically effective amount of an inhibitor of dihydroorotate
- DHODH dehydrogenase
- inhibitor of dihydroorotate dehydrogenase is selected from the group consisting of: a small molecule, a nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, and an antibody.
- DHODH dihydroorotate dehydrogenase
- a method of screening for an agent that inhibits melanoma growth comprising (a) contacting a zebrafish embryo with a test agent for a period of time,
- step (b) rinsing the test agent from the embryos of step (a);
- DHODH dihydroorotate dehydrogenase
- inhibitor of oncogenic BRAF is selected from the group consisting of: a small molecule, a nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, and an antibody.
- any of para.'s 19-23, wherein the inhibitor of dihydroorotate dehydrogenase is selected from the group consisting of: a small molecule, a nucleic acid RNA, a nucleic acid DNA, a protein, a peptide, and an antibody.
- BRAF V600E mutations depend upon transcriptional programs present in the developmental lineage of tumor initiation. These programs may be therapeutic targets when combined with BRAF V600E inhibition.
- Transgenic zebrafish expressing human BRAF V600E under the melanocyte-specific mitf promoter (m/t/-BRAF v600E ) develop melanoma at 4-12 months of age when crossed with p53 _/ ⁇ mutants ( Figure la).
- Leflunomide a structurally distinct DHODH inhibitor , phenocopied NSC210627 ( Figure 2a, right) and was used for further studies given its availability.
- NCSCs neural crest stem cells isolated from the fetal(E14.5) rat gut 9 ' 10 . Both reduced the number of self -renewing NCSCs from primary stem cell colonies to 27+/-5.35% and 35+/-6.16% of controls (p ⁇ 0.0003 and p ⁇ 0.00007, t-test, Figure 2e and Figure 6a). Colony size was reduced compared to controls (by 18% and 24%, respectively, p ⁇ 0.02, t-test) but there was no effect on differentiation or survival of specific progeny ( Figure 6b, Fig6c). These results demonstrate that DHODH inhibitors negatively regulate NCSC self -renewal and affect NCSCs from multiple species.
- DHODH is the fourth step in the synthesis of pyrimidine nucleotides(NTPs) 11 .
- NTPs pyrimidine nucleotides
- transcriptional elongation (measured as an increase in the TR), particularly for genes with an initially low TR ⁇ 7.5.
- the TR increased by >1.3 fold in 21.3% of loci; in MAMLE-3M, this was 36.3% of loci (data not shown).
- Examination of pol II occupancy using metagene analysis at a variety of fold-change cutoffs revealed no defect in transcription initiation, but a decrease in elongation pronounced at the 3' end of genes such as Npml and Ccndl ( Figure 3c).
- NTP production is regulated at the level of carbamoyl-phosphate synthetase (CAD) 19 , the enzyme upstream of DHODH.
- CAD is phosphorylated by MAP kinase 20 , which would be activated in melanoma due to the BRAF V600E mutation.
- MAP kinase 20 MAP kinase 20
- We measured melanoma proliferation utilizing the BRAF V600E inhibitor PLX4720 21 together with A771726 ( Figure 4b, Fig4c and Figure 8a, Fig8b), and found that the combination led to a cooperative suppression of melanoma growth.
- PLX4720 had no effect in non-melanoma cell lines
- Leflunomide is a well-tolerated arthritis drug in humans 27 , and our data suggest it would be most effective in combination with a BRAF V600E inhibitor. This may help to overcome resistance to BRAF v6ooE inhibitors 28_ As an increasing number of genomic changes are identified in cancer, the challenge is to target these in concert with lineage- specific factors to uncover therapeutic synergy. Our approach to identifying lineage- specific suppressors in zebrafish embryos can be generalized to other cell types, with direct relevance to human cancer.
- Microarray analysis was performed on 4 groups of 72hpf embryos: 1) WT, 2) mitf- BRAF V600E , 3) p53 _/ ⁇ or 4) m ' -BRAF v600E ;p53 "/” .
- Arrays were similarly performed on adult mitf- BRAF v600E ;p53 "/" melanomas and adjacent skin.
- the transcriptional signature of the melanomas was used in GSEA to identify genes significantly enriched in the mz ' -BRAF v600E ;p53 "/" embryos.
- This signature (123 genes), enriched for markers of the neural crest, were concordantly up/downregulated in both BRAF v600E ;p53 "/" embryos and tumors.
- In situ hybridization (ISH) for crestin (a pan NC marker) and other NC genes, was examined in embryos (24-72hpf) and adult tumors. Chemical screening was performed to identify suppressors of the crestin " lineage by treating wild-type embryos from 50% epiboly to 24hpf, followed by robotic ISH.
- Two inhibitors of DHODH abrogated crestin expression NSC210627 and leflunomide. The latter was used for further studies due to more widespread availability.
- leflunomide The effect of leflunomide on zebrafish embryonic neural crest development was assessed by scoring for embryonic melanocytes, iridophores, and glial cells. Leflunomide was further assessed for its ability to affect multipotent self -renewal of purified p75 + 0C4 + rat neural crest stem cells. The effects of leflunomide on transcriptional elongation in the neural crest was tested using the spt5 m806 allele, and measuring pigmentation in response to 3-5uM leflunomide. Elongation in melanoma cells was assayed by ChlP-Seq using an antibody to RNA Polymerase II and measuring the traveling ratio.
- Leflunomide was tested for anti-melanoma effects in human melanoma cells lines in the presence or absence of the BRAF V600E inhibitor PLX4720.
- In vitro proliferation assays were performed using the CellTiterGlo system (Promega).
- In vivo effects were tested by treatment of established A375 xenografts by daily intraperitoneal dosing of PLX4720 alone, leflunomide alone or the combination, and tumor growth rate measured on day 4, 7 and 12.
- Wild-type strains used in these studies were the Tu variety.
- the p53 _/ ⁇ and transgenic mzY/-BRAF v600E lines were established as previously described 29 ' 30 .
- Double homozygous animals were genotyped using PCR primers for WT BRAF (Forward:
- GATAGCCTAGTGCGAGCACACTCTT (SEQ ID NO: 11)
- the four genotypes used for the microarray analyses were produced by incrossing of each respective line.
- Embryos Fertilized eggs were collected immediately after mating, and placed at 28.5C. Chorions were removed by pronase solution (2.5mg/ml in E3 water), and embryos allowed to grow until either 24hpf or 3dpf. Clutches containing -50 embryos were homogenized in Trizol, RNA precipitated with chloroform/isopropanol, DNasel treated and the cleaned up using RNEasy columns. RNA was then utilized for Affymetrix Zebrafish Genome chips.
- GSEA version 2
- Leflunomide and spt5 signature Tu embryos were treated with 6.5uM leflunomide from 50% epiboly to 24hpf, and then chorions removed and RNA extracted as above. Gene that were 2-fold up or downregulated by leflunomide were identified and then significance assessed by Welch's T-test followed by Benjamini-Hochberg FDR. This yielded 223 downregulated and
- A375 signature A375 cells were treated with 25uM leflunomide for 3 days, and RNA then isolated using Trizol as above. Expression analysis was performed using Illumina WG6 v3 arrays, and the data was analyzed using Illumina Genome Studio. Genes significantly affected by leflunomide are those with an Illumina difference score of +/-30 or greater, which
- the screen was performed essentially as previously described 31.
- WT embryos were collected, staged and then plated at a density of 10 embryos per well in a well-well tissue culture plate in 200ul of E3 water.
- lOOul of a 3X chemical stock was added to each well using a Hamilton liquid handling robot, yielding a final IX concentration.
- concentration of ⁇ 33uM For the majority of the chemicals in the library, this yielded a concentration of ⁇ 33uM.
- the libraries used were the BIOMOL 480, Sigma LOPAC1280, and selected additional compounds obtained through the Children's Hospital Boston Chemical Screening facility. Compounds known to affect pigmentation in Xenopus were obtained from a screen previously described 32 ' 33.
- embryos were rinsed in E3 water, pronase treated to remove chorions, washed 4X in E3 and IX in PBT, and then fixed in 4% PFA for 24 hours. Fixed embryos were changed to 100% methanol 24h later, and kept until the time of ISH.
- Embryos underwent automated ISH using a Biolane HTI robot with a crestin riboprobe as previously described 31. All wells were manually scored by eye, assigning a score within a range of 1 (no crestin staining) to 3 (no change in crestin) to 5 (marked increase in crestin). Note was also taken of chemicals that affected migratory patterns in both A-P and D-V directions, and overall morphology. Approximately 7% of chemicals were generally toxic, 2.2% showed a decrease in crestin, and 1% showed an increase in crestin. All hits were validated in larger, independent clutches of 100-200 embryos using chemicals obtained from independent suppliers.
- the DHODH activity assay monitored the reduction of 2,6-dichloroindophenol (DCIP) and was conducted in 50 ⁇ of 100 mM HEPES (pH 8.0) containing 150 mM NaCl, 5% glycerol, 0.05% Triton X-100, 175 ⁇ L-DHO, 18 ⁇ decylubiquinone (CoQD), and 95 ⁇ DCIP, arrayed in a 384- well format.
- concentrations of enzymes used were as follows:
- NCSCs from the fetal (E14.5) rat gut were isolated using flow cytometry to select the l%-2% of cells expressing the highest levels p75 and oc4 integrin as previously described 9 .
- Self-renewal medium contains: DMEM-low glucose, 15% Chick Embryo Extract (CEE), Penn/Strep (P/S), 1 % N2 supplement, 2% B27 supplement, 110 nM Retinoic Acid, 50 ⁇ 2-mercaptoethanol 20ng/ml bFGF, and 20 ng/ml IGF-1.
- Differentiation medium is the same except it contains 1% CEE, lOng/ml bFGF and no IGF-1. Differences between groups were calculated using ANOVA followed by posthoc Sheffe.
- Dissociated fetal rat gut cells were plated at clonal density in non-adherent conditions in self -renewal medium with LEF, a77 or DMSO for 10 days 10 .
- Three to five primary neurospheres per treatment were individually re-plated in adherent conditions with LEF, a77 or DMSO and after three days were dissociated into a single cell suspension using trypsin and collagenase IV.
- Dissociated cells from each neurosphere were re-plated in non-adherent conditions without LEF or a77 and after 10 days, the number of secondary neurospheres were counted and compared. To assess the number of multipotent primary and secondary
- neurospheres a subset of neurospheres were plated adherently for 8 days in self -renewal medium followed by 6 days in differentiation medium. Cultures were fixed in 4% PFA and stained with antibodies against peripherin, GFAP, and SMA to identify neurons (N), glia (G) and
- M myofibroblasts
- the spt5 m&06 allele was used to assess whether leflunomide interacted with the elongation machinery. This allele has only a mild pigment defect on its own. Heterozygous spt5 m806 adults were incrossed, and embryos then collected and treated with leflunomide 3, 4 or 5uM, as above. Embryos were scored at 48hpf for pigmentation, scored as "unpigmented", "light”, or "fully pigmented” as compared to untreated wells. Individual embryos were then genotyped for the spt5 m806 mutation as previously described 14 . Kruskall-Wallis analysis was used to detect a difference between the genotyped groups.
- Embryos were treated with DMSO or leflunomide 6.5uM from 50% epiboly until 24hpf, and then RNA prepared as above. Primers were designed to the noted genes, situated at the very 5' end or 3' end of the gene, situated in the UTR if annotated. qRT-PCR was then performed using SYBR Green, and each primer pair was normalized to an average of the Ct value for the 5' beta-actin and 3' beta-actin primers. Fold-change was calculated using the delta- delta Ct method, and all values are expressed relative to the DMSO control, after log2 transformation. Differences between groups were assessed using t-tests. Primer sequences available upon request.
- RNA Pol II ChlP-seq analysis was done in A375 and MAMLE-3M cells with and without Leflunomide treatment as described in 16 .
- A375 and MAMLE-3M cells were grown as described above and treated with 25uM (A375) or 50uM (MAMLE-3M) leflunomide (dissolved in DMSO) or DMSO alone for 72 hours. Cells were crosslinked for 10 minutes with the addition of one-tenth of the volume of 11% formaldehyde solution (11% formaldehyde, 50mM Hepes pH7.3, lOOmM NaCl, ImM EDTA pH8.0, 0.5mM EGTA pH8.0) to the growth media followed by two washes with PBS.
- 11% formaldehyde solution (11% formaldehyde, 50mM Hepes pH7.3, lOOmM NaCl, ImM EDTA pH8.0, 0.5mM EGTA pH8.0
- Crosslinked cells were lysed with lysis buffer 1 (50mM Hepes pH7.3, 140mM NaCl, ImM EDTA, 10% glycerol, 0.5% NP-40, and 0.25% Triton X-100) and washed with lysis buffer 2 (lOmM Tris-HCl pH8.0, 200mM NaCl, ImM EDTA pH8.0 and 0.5mM EGTA pH8.0).
- lysis buffer 1 50mM Hepes pH7.3, 140mM NaCl, ImM EDTA, 10% glycerol, 0.5% NP-40, and 0.25% Triton X-100
- sonication buffer 50mM Tris-HCl pH7.5, 140mM NaCl, ImM EDTA, ImM EGTA, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS
- Sonicated lysates were cleared and incubated overnight at 4°C with magnetic beads bound with antibody to enrich for DNA fragments bound by the indicated factor.
- RNA and protein were digested using RNAse A and Proteinase K, respectively and DNA was purified with phenol chloroform extraction and ethanol precipitation. The purified DNA from A375+Leflunomide, A375+DMSO, A375 input DNA, Mamle+Leflunomide, Mamle+DMSO and Mamie input DNA samples were then used for preparation of Illumina sequencing libraries.
- Sample preparation [0224] Purified DNA was prepared for sequencing according to a modified version of the Illumina/Solexa Genomic DNA protocol. Fragmented DNA was prepared by repairing the ends and adding a single adenine nucleotide overhang to allow for directional ligation. A 1:30 dilution (in water) of the Adaptor Oligo Mix (Illumina) was used in the ligation step. A subsequent PCR step with limited (18) amplification cycles added additional linker sequence to the fragments to prepare them for annealing to the Genome Analyzer flow-cell.
- Fragmented DNA was prepared by repairing the ends and adding a single adenine nucleotide overhang to allow for directional ligation. A 1:30 dilution (in water) of the Adaptor Oligo Mix (Illumina) was used in the ligation step. A subsequent PCR step with limited (18) amplification cycles added additional linker sequence to the fragments to prepare them for annealing to the Genome Analyzer flow-cell
- the amplified library was size selected by separation on a 2% agarose gel and a band between 150-300 bp (representing shear fragments between 50 and 200nt in length and ⁇ 100bp of primer sequence) was excised.
- the DNA was purified from the agarose and this DNA library was subsequently used for polony generation and sequencing.
- the DNA library (2-4 pM) was applied to the flow-cell (8 samples per flow-cell) using the Cluster Station device from Illumina.
- the concentration of library applied to the flow- cell was calibrated such that polonies generated in the bridge amplification step originate from single strands of DNA.
- Multiple rounds of amplification reagents were flowed across the cell in the bridge amplification step to generate polonies of approximately 1,000 strands in ⁇ diameter spots. Double stranded polonies were visually checked for density and morphology by staining with a 1:5000 dilution of SYBR Green I (Invitrogen) and visualizing with a microscope under fluorescent illumination.
- Validated flow-cells were stored at 4°C until sequencing.
- Flow-cells were removed from storage and subjected to linearization and annealing of sequencing primer on the Cluster Station. Primed flow-cells were loaded into the Illumina Genome Analyzer 1G. After the first base was incorporated in the Sequencing -by-Synthesis reaction the process was paused for a key quality control checkpoint. A small section of each lane was imaged and the average intensity value for all four bases was compared to minimum thresholds. Flow-cells with low first base intensities were re -primed and if signal was not recovered the flow-cell was aborted. Flow-cells with signal intensities meeting the minimum thresholds were resumed and sequenced for 26 or 32 cycles.
- the probability of observing a given number of reads in a lkb window can be modeled as a Poisson process in which the expectation can be estimated as the number of mapped reads multiplied by the number of bins (40) into which each read maps, divided by the total number of bins available (estimated at 70%). Enriched bins within lkb of one another were combined into regions.
- the Poissonian background model assumes a random distribution of background reads, however we have observed deviations from this expectation. Some of these non-random events can be detected as sites of apparent enrichment in negative control DNA samples and can create many false positives in ChlP-Seq experiments.
- genomic bins and regions that meet the statistical threshold for enrichment to a set of reads obtained from Solexa sequencing of DNA from whole cell extract (WCE) in matched cell samples. We required that enriched bins and enriched regions have fivefold greater ChlP-Seq density in the specific IP sample, compared with the control sample, normalized to the total number of reads in each dataset.
- rank normalization was used to normalize the datasets being compared. This normalization method is described in 38. Briefly, a quantile normalization method was used for analysis. For each dataset compared, the genomic bin with the greatest ChlP-Seq density was identified. The average of these values was calculated and the highest signal bin in each dataset was assigned this average value. This was repeated for all genomic bins from the greatest signal to the least, assigning each the average ChlP-Seq signal for all bins of that rank across all datasets.
- TR Traveling ratios
- the promoter region is defined as -300bp to +300bp relative to the TSS and the gene body is defined as the remaining length of the gene plus 2500bp relative to the gene end.
- the method used here is a variation of the analysis used in Rahl et al, and is more sensitive due to the fact that gene densities are treated as vectors rather than mean values.
- ChIP for RNA polymerase II was carried out as above using A375-scramble and A375-shRNA#877 cells.
- shRNA against DHODH we utilized TRNC clone
- Human melanoma cell lines (A375, RPMI7951, Hs.294T, MAMLE-3M) were obtained from the American Type Culture Collection. The 8988 cell line was provided by Alec Kimmelman at Dana Farber, and the PANC1 and MDA-231-MB lines were provided by Rania Hartouche at Harvard. Cells were cultured in DMEM/10% FCS at 37C, 5%C0 2 .
- 96- well clear bottom plates were used to plate cells at a density of 5,000 cells/well (RPMI7951 and A375) or 10,000 cells/well (MAMLE-3M-3M and Hs.294T) in lOOul containing indicated concentrations of A771726 or PLX4720 or DMSO. All conditions were tested in triplicate. Media was changed at day 2, and proliferation rate was measured at day 4 using the CellTiterGlo assay kit (Promega). All values are expressed are the % of luciferase relative to the DMSO control well. Differences between groups were statistically analyzed using a generalized linear ANOVA model taking into account factors of PLX4720, A771726 and dose. IC50's were calculated using a log-logistic model.
- PLX4720 in this line.
- Cells were grown to 60-70% confluence, trypsinized and 3.5xl0 5 cells were transplanted into the right flank of nude mice in a volume of 200ul. Tumors were allowed to develop for 2 weeks (day 0) at which time daily intraperitoneal dosing of either DMSO, PLX4720 2.5mg/kg, Leflunomide 7.5mg/kg or both PLX4720/Leflunomide was begun. Tumors were measured with digital calipers on day 4, 7 and 12 and growth rate was compared to the tumor size on day 0. Growth rates were compared between DMSO, PLX, LEF or PLX4720 using ANOVA with repeated measures to identify significant interactions. For the day 12 data, differences between the groups were compared using ANOVA followed by posthoc Tukey's least- squared difference.
- Human melanoma array ME1001 (US Biomax) was stained using antibodies to ednrb (Abeam abl921), edn3 (PTG Inc. 10674-1- AP), mitf (Abeam 3201) or dct (Sigma HPA010743). Melanomas were scored by an independent pathologist (SG) for reactivity to given antibody. In some cases, tumors stained for multiple antibodies in different areas of the same tumor, and these were scored as positive for each individual antigen.
- SG pathologist
- Example II Example guidance for a Phase II trial to test the efficacy of a combination therapy of the combination therapy of BRAF inhibitor PLX4032 and leflunomide.
- Leflunomide to block neural crest cell fate by inhibiting transcriptional elongation, wherein a reduced number of neural crest progenitors leading to a decrease in the number of differentiated melanocyte cells unexpectedly indicated that the compound is capable of inhibiting melanoma.
- the targets of these events include c-myc and mitf (Fig 9, Figl3) directed genes.
- Leflunomide could be utilized in therapies to treat melanoma given its previous use as an anti-arthritic agent predicated on its ability to target lymphocytes (See e.g., Fox et al., (1999) Mechanism of Action for Leflunomide in Rhuematoid Arthritis, Clinical immunology 93(3): 198-208).
- Non-lymphocytes were previously believed to be unaffected because of their ability to meet their ribonucleotide needs utilizing the salvage pyrimidine pathway.
- Melanoma is a non- lymphocyte derived cancer characterized by uncontrolled growth of melanocytes.
- Combination therapies that include BRAF inhibitors will be particularly important for treating melanoma, especially within the context of developing long term responses.
- PLX40321 Tsai, J. et al. Discovery of a selective inhibitor of oncogenic B-Raf kinase with potent antimelanoma activity. Proc. Natl. Acad. Sci. U. S. A. 105, 3041-3046 (2008)
- GSK211843616 Kefford, R. A. et al. Phase MI study of GSK2118436, a selective inhibitor of oncogenic mutant BRAF kinase, in patients with metastatic melanoma and other solid tumors. /. Clin. Oncol.
- one metrics for judging improvement in outcome for the combination regimen with BRAF inhibitors is to improve the duration of response (PFS) or increase the percentage of patients with complete responses, by a statistically significant amount. It is expected that the combination of BRAF inhibitor PLX4032 and leflunomide will significantly improve PFS, or significantly increase the percent of patients with complete responses.
- tumor biopsy samples before, during and at progression using single- agents PLX and GSK2118436 will be taken and analyzed; and compared to the combination therapy of the phase II trial that combines leflunomide and PLX.
- Leflunomide is given to patients with arthritis, at doses that produce steady state concentrations exceeding those used in our preclinical studies.
- the FDA- approved dose of leflunomide Kaplan, M. J. Leflunomide Aventis Pharma. Curr. Opin. Investig Drugs 2, 222-230 (2001)
- doses much smaller than those required for therapeutic efficacy in arthritis patients will be needed for therapeutic efficacy in melanoma treatment.
- PLX standard dose of PLX in our proposed trial. Given the efficacy of the combination in preclinical studies, we expect that doses smaller than those required for therapeutic efficacy in arthritis patients will be needed for therapeutic efficacy in melanoma treatment.
- An example dose and administration regime follows: Within 6-12 hours of a single dose, leflunomide is metabolized into a single active metabolite that has a long half-life ( ⁇ 2 weeks). Therefore, when leflunomide is given in 3 daily loading doses (100 mg daily for 3 days), followed by lower daily doses (20 mg per day), it produces steady-state concentrations of approximately 60 mcg/mL (Rozman, B. Clinical pharmacokinetics of leflunomide. Clin. Pharmacokinet. 41, 421- 430 (2002)). Neither the parent compound nor the active metabolite is metabolized by CYP450 isoenzymes, so there is very little possibility of a drug-drug interaction with PLX.
- liver transaminase In placebo-controlled clinical trials with use of leflunomide in arthritis patients, the only treatment-related adverse event that was more prevalent for leflunomide than with placebo was elevation of liver transaminase. While this is also seen with PLX, it is rarely dose limiting. We thus have a low concern for leflunomide contributing to the toxicity of PLX. As is standard practice, we will monitor liver transaminases in our patients using means well known to those of skill in the art.
- the primary endpoint of the proposed phase II trial that combines leflunomide with PLX will be PFS; we expect improvement in median PFS from 7 months (observed in phase I, II and III trials with single-agent PLX) to 10 months or more. Assuming 90% power and a type I error of 5%, this would require 43 patients.
- Our secondary clinical endpoint is complete response. We will use 90% power to detect an increase in complete rate to 12% or higher.
- a critical secondary endpoint will be the determination of pharmacodynamic effects of leflunomide in patients' tumors: to accomplish this, patients will start leflunomide as a single-agent for two weeks, before initiating PLX.
- DHODH Human dihydroorotate dehydrogenase
- Human BRAF mRNA v-raf murine sarcoma viral oncogene homolog Bl (BRAF), 1 cgcctccctt ccccctcccc gcccgacagc ggccgctcgg gccccggctc tcggttataa
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US201161440475P | 2011-02-08 | 2011-02-08 | |
PCT/US2012/024295 WO2012109329A2 (en) | 2011-02-08 | 2012-02-08 | Methods for treatment of melanoma |
Publications (2)
Publication Number | Publication Date |
---|---|
EP2672963A2 true EP2672963A2 (en) | 2013-12-18 |
EP2672963A4 EP2672963A4 (en) | 2015-06-24 |
Family
ID=46639181
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP12745011.2A Withdrawn EP2672963A4 (en) | 2011-02-08 | 2012-02-08 | Methods for treatment of melanoma |
Country Status (3)
Country | Link |
---|---|
US (3) | US20140031383A1 (en) |
EP (1) | EP2672963A4 (en) |
WO (1) | WO2012109329A2 (en) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10016402B2 (en) | 2011-02-08 | 2018-07-10 | Children's Medical Center Corporation | Methods for treatment of melanoma |
SG11201702516UA (en) * | 2014-10-23 | 2017-04-27 | Sanofi Sa | Novel selection marker for cell transfection and protein production |
WO2016200778A1 (en) * | 2015-06-08 | 2016-12-15 | Children's Medical Center Corporation | Methods for treatment of melanoma |
NZ755835A (en) | 2017-01-17 | 2023-12-22 | Heparegenix Gmbh | Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death |
JP2021519334A (en) | 2018-03-26 | 2021-08-10 | クリア クリーク バイオ, インコーポレイテッド | Compositions and Methods for Inhibiting Dihydroorotoic Acid Dehydrogenase |
CN111960937B (en) * | 2020-08-20 | 2022-09-02 | 广西中医药大学 | Mixed source terpenoid, preparation method thereof and application thereof in preparation of anti-breast cancer or dihydroorotate dehydrogenase inhibitor drugs |
Family Cites Families (55)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US3270960A (en) | 1964-09-11 | 1966-09-06 | Sperry Rand Corp | Fluid sensor |
US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
US3625214A (en) | 1970-05-18 | 1971-12-07 | Alza Corp | Drug-delivery device |
US4906474A (en) | 1983-03-22 | 1990-03-06 | Massachusetts Institute Of Technology | Bioerodible polyanhydrides for controlled drug delivery |
US4789734A (en) | 1985-08-06 | 1988-12-06 | La Jolla Cancer Research Foundation | Vitronectin specific cell receptor derived from mammalian mesenchymal tissue |
NL8720442A (en) | 1986-08-18 | 1989-04-03 | Clinical Technologies Ass | DELIVERY SYSTEMS FOR PHARMACOLOGICAL AGENTS. |
US5976848A (en) | 1990-08-03 | 1999-11-02 | Dow Agrosciences Llc | Method of identifying potential fungicides using dihydroorotate dehydrogenase inhibition assay |
US6177401B1 (en) | 1992-11-13 | 2001-01-23 | Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften | Use of organic compounds for the inhibition of Flk-1 mediated vasculogenesis and angiogenesis |
US5763441A (en) * | 1992-11-13 | 1998-06-09 | Sugen, Inc. | Compounds for the treatment of disorders related to vasculogenesis and/or angiogenesis |
GB9520092D0 (en) | 1995-10-02 | 1995-12-06 | Hoechst Roussel Ltd | Chemical compounds |
DE19547648A1 (en) | 1995-12-20 | 1997-06-26 | Hoechst Ag | Preparation containing high density lipoproteins and crotonic acid amide derivatives |
DE19610955A1 (en) | 1996-03-20 | 1997-09-25 | Hoechst Ag | Combination preparation containing 5-methylisoxazole-4-carboxylic acid- (4-trifluoromethyl) -anilide and N- (4-trifluoromethylphenyl) -2-cyano-3-hydroxycrotonic acid amide |
AU2108099A (en) | 1998-01-30 | 1999-08-16 | Procept, Inc. | Immunosuppressive agents |
AR015514A1 (en) | 1998-02-10 | 2001-05-02 | Novartis Ag | AMIDA COMPOUND, PROCESS FOR PREPARATION AND PHARMACEUTICAL COMPOSITION CONTAINING IT |
GB9804343D0 (en) | 1998-02-27 | 1998-04-22 | Univ Cardiff | Chemical compounds |
US6841561B1 (en) | 1999-10-01 | 2005-01-11 | Institute Of Molecular And Cell Biology | Dihydroorotate dehydrogenase inhibitors for the treatment of viral-mediated diseases |
EP1237546A2 (en) | 1999-10-01 | 2002-09-11 | Institute of Molecular and Cell Biology | Dihydroorotate dehydrogenase inhibitors for the treatment of viral-mediated diseases |
US6865549B1 (en) | 1999-11-15 | 2005-03-08 | Sun Microsystems, Inc. | Method and apparatus for concurrency control in a policy-based management system |
ATE396719T1 (en) | 2001-04-05 | 2008-06-15 | Aventis Pharma Inc | USE OF (Z)-2-CYANO-3-HYDROXY-BUT-2-ENEIC ACID (4'-TRIFLUOROMETHYLPHENYL)-AMIDE FOR THE TREATMENT OF MULTIPLATE SCLEROSIS |
WO2003006424A1 (en) | 2001-07-10 | 2003-01-23 | 4Sc Ag | Novel compounds as anti-inflammatory, immunomodulatory and anti-proliferatory agents |
WO2003030905A1 (en) | 2001-10-01 | 2003-04-17 | Shionogi & Co., Ltd. | Dihydroorotate dehydrogenase inhibitor |
US20060052600A1 (en) | 2002-05-17 | 2006-03-09 | Nielsen Simone F | Amino-functional chalcones |
JP2004099586A (en) | 2002-05-21 | 2004-04-02 | Sumitomo Pharmaceut Co Ltd | Dihydroorotatedehydrogenase inhibitor |
EP1581477B1 (en) | 2002-12-23 | 2009-12-02 | 4Sc Ag | Cycloalkene dicarboxylic acid compounds as anti-inflammatory, immunomodulatory and anti-proliferatory agents |
US7071355B2 (en) | 2002-12-23 | 2006-07-04 | 4 Sc Ag | Compounds as anti-inflammatory, immunomodulatory and anti-proliferatory agents |
US7247736B2 (en) | 2002-12-23 | 2007-07-24 | 4Sc Ag | Method of identifying inhibitors of DHODH |
EP1581478A1 (en) | 2002-12-23 | 2005-10-05 | 4Sc Ag | Dhodh-inhibitors and method for their identification |
SE0400234D0 (en) | 2004-02-06 | 2004-02-06 | Active Biotech Ab | New compounds, methods for their preparation and use thereof |
US20100004304A1 (en) * | 2004-03-16 | 2010-01-07 | Kohn Leonard D | Methods and compositions for the treatment of malignant melanoma, breast, prostate, colon, papillary thyroid and pancreatic cancer |
US20080072337A1 (en) | 2004-05-10 | 2008-03-20 | Children's Medical Center Corporation | Braf Expression in Zebrafish and Uses Thereof |
JP2008500393A (en) | 2004-05-21 | 2008-01-10 | ザ ユーエービー リサーチ ファンデーション | Compositions and methods for pyrimidine synthesis inhibitors |
WO2006022442A1 (en) | 2004-08-24 | 2006-03-02 | Santen Pharmaceutical Co., Ltd. | Novel heterocyclic amide derivatives having dihydroorotate dehydrogenase inhibiting activity |
US20070299114A1 (en) | 2004-10-05 | 2007-12-27 | Shionogi & Co., Ltd. | Biaryl Derivatives |
SG142305A1 (en) | 2004-10-19 | 2008-05-28 | Aventis Pharma Inc | Use of (z)-2-cyano-3-hydroxy-but-2-enoic acid-(4'- trifluoromethylphenyl)-amide for treating inflammatory bowel disease |
JPWO2006051937A1 (en) | 2004-11-15 | 2008-05-29 | 塩野義製薬株式会社 | Hetero 5-membered ring derivatives |
US7442507B2 (en) | 2005-01-24 | 2008-10-28 | New York University School Of Medicine | Methods for detecting circulating mutant BRAF DNA |
JP2006265117A (en) * | 2005-03-22 | 2006-10-05 | Noribumi Sawamukai | LEFLUNOMIDE USED IN ORDER TO INHIBIT ACTIVATION OF Akt SIGNAL PATHWAY |
BRPI0611863B1 (en) | 2005-06-22 | 2021-11-23 | Plexxikon, Inc | COMPOUND, AS WELL AS COMPOSITION AND KIT COMPRISING THE SAME, INTERMEDIATE COMPOUND IN THE PREPARATION OF THE SAME, METHOD FOR TREATMENT AND USE OF THE SAME |
JP2007015952A (en) | 2005-07-06 | 2007-01-25 | Shionogi & Co Ltd | Naphthalene derivative |
US7256008B2 (en) | 2006-01-06 | 2007-08-14 | Abbott Laboratories | Determination of concentration of FK778 by competitive immunoassay |
WO2007109571A2 (en) * | 2006-03-17 | 2007-09-27 | Prometheus Laboratories, Inc. | Methods of predicting and monitoring tyrosine kinase inhibitor therapy |
EP2019675A4 (en) * | 2006-05-02 | 2011-03-02 | Merck Frosst Canada Ltd | Methods for treating or preventing neoplasias |
US20080027079A1 (en) | 2006-06-22 | 2008-01-31 | Board Of Regents, University Of Texas System | Dihydroorotate dehydrogenase inhibitors with selective anti-malarial activity |
ES2319596B1 (en) | 2006-12-22 | 2010-02-08 | Laboratorios Almirall S.A. | NEW DERIVATIVES OF THE AMINO-NICOTINIC AND AMINO-ISONICOTINIC ACIDS. |
AU2008213147A1 (en) | 2007-02-06 | 2008-08-14 | Chelsea Therapeutics, Inc. | New compounds, methods for their preparation and use thereof |
AU2008251381B2 (en) | 2007-05-11 | 2014-10-30 | The Johns Hopkins University | Biomarkers for melanoma |
UY31272A1 (en) | 2007-08-10 | 2009-01-30 | Almirall Lab | NEW DERIVATIVES OF AZABIFENILAMINOBENZOIC ACID |
US7960400B2 (en) | 2007-08-27 | 2011-06-14 | Duquesne University Of The Holy Ghost | Tricyclic compounds having cytostatic and/or cytotoxic activity and methods of use thereof |
US7982035B2 (en) | 2007-08-27 | 2011-07-19 | Duquesne University Of The Holy Spirit | Tricyclic compounds having antimitotic and/or antitumor activity and methods of use thereof |
MX2010005960A (en) | 2007-11-30 | 2010-06-11 | Schering Corp | Braf biomarkers. |
US9216983B2 (en) | 2007-12-21 | 2015-12-22 | Board Of Regents, University Of Texas System | Dihydroorotate dehydrogenase inhibitors with selective anti-malarial activity |
GB0808029D0 (en) | 2008-05-01 | 2008-06-11 | F2G Ltd | Antifungal target |
EP2135610A1 (en) | 2008-06-20 | 2009-12-23 | Laboratorios Almirall, S.A. | Combination comprising DHODH inhibitors and methotrexate |
EP2210615A1 (en) | 2009-01-21 | 2010-07-28 | Almirall, S.A. | Combinations comprising methotrexate and DHODH inhibitors |
US8686048B2 (en) | 2010-05-06 | 2014-04-01 | Rhizen Pharmaceuticals Sa | Immunomodulator and anti-inflammatory compounds |
-
2012
- 2012-02-08 US US13/983,090 patent/US20140031383A1/en not_active Abandoned
- 2012-02-08 WO PCT/US2012/024295 patent/WO2012109329A2/en active Application Filing
- 2012-02-08 EP EP12745011.2A patent/EP2672963A4/en not_active Withdrawn
-
2015
- 2015-06-03 US US14/729,513 patent/US20150328204A1/en not_active Abandoned
-
2019
- 2019-08-27 US US16/552,569 patent/US20200215038A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
US20200215038A1 (en) | 2020-07-09 |
US20150328204A1 (en) | 2015-11-19 |
WO2012109329A2 (en) | 2012-08-16 |
EP2672963A4 (en) | 2015-06-24 |
WO2012109329A3 (en) | 2012-10-04 |
US20140031383A1 (en) | 2014-01-30 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20200215038A1 (en) | Inhibitors of dihydroorotate dehydrogenase | |
Nicholatos et al. | Nicotine promotes neuron survival and partially protects from Parkinson’s disease by suppressing SIRT6 | |
Sriramula et al. | Tumor necrosis factor-alpha is essential for angiotensin II-induced ventricular remodeling: role for oxidative stress | |
US10646478B2 (en) | Methods for treatment of melanoma | |
Chiacchiera et al. | Blocking p38/ERK crosstalk affects colorectal cancer growth by inducing apoptosis in vitro and in preclinical mouse models | |
McCormack et al. | Pharmacologic targeting of sirtuin and PPAR signaling improves longevity and mitochondrial physiology in respiratory chain complex I mutant Caenorhabditis elegans | |
Koene et al. | Effects of antiepileptic drugs in a new TSC/mTOR‐dependent epilepsy mouse model | |
EP3512506B1 (en) | Use of pridopidine for treating rett syndrome | |
US10568854B2 (en) | Compositions and methods for treating kabuki syndrome and related disorders | |
US20210163929A1 (en) | Methods and compositions for the treatment of hepatic and metabolic diseases | |
KR20150131260A (en) | Methods of treating colorectal cancer | |
WO2016200778A1 (en) | Methods for treatment of melanoma | |
KR20110084533A (en) | Enzastaurin for the treatment of cancer | |
Ki et al. | Mechanisms underlying synergy between DNA topoisomerase I-targeted drugs and mTOR kinase inhibitors in NF1-associated malignant peripheral nerve sheath tumors | |
Sun et al. | MicroRNA-96 is required to prevent allodynia by repressing voltage-gated sodium channels in spinal cord | |
Kawasaki et al. | Selective blockade of transient receptor potential vanilloid 4 reduces cyclophosphamide-induced bladder pain in mice | |
Ding et al. | JQ-1 ameliorates schistosomiasis liver fibrosis by suppressing JAK2 and STAT3 activation | |
JP2011525174A5 (en) | ||
Compton et al. | LKB1 controls inflammatory potential through CRTC2-dependent histone acetylation | |
US10350204B2 (en) | Methods for treating cognitive deficits associated with fragile X syndrome | |
Udden et al. | Targeting ESR1 mutation–induced transcriptional addiction in breast cancer with BET inhibition | |
Layeghi-Ghalehsoukhteh et al. | Concerted cell and in vivo screen for pancreatic ductal adenocarcinoma (PDA) chemotherapeutics | |
WO2011127482A2 (en) | Modulation of histone deacetylases for the treatment of metabolic disease, methods and compositions related thereto | |
US11000524B2 (en) | Tyrosine kinase inhibition as a treatment for epilepsy | |
Kumar | Trace amine-associated receptor 1 activation regulates glucose-dependent insulin secretion in pancreatic beta cells in vitro |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20130822 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
DAX | Request for extension of the european patent (deleted) | ||
RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 31/122 20060101ALI20150107BHEP Ipc: A61K 31/135 20060101ALI20150107BHEP Ipc: G01N 33/00 20060101ALI20150107BHEP Ipc: A61K 31/42 20060101ALI20150107BHEP Ipc: A61K 31/02 20060101AFI20150107BHEP |
|
A4 | Supplementary search report drawn up and despatched |
Effective date: 20150527 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 31/122 20060101ALI20150520BHEP Ipc: A61K 31/42 20060101ALI20150520BHEP Ipc: A61K 31/135 20060101ALI20150520BHEP Ipc: A61K 31/02 20060101AFI20150520BHEP Ipc: G01N 33/00 20060101ALI20150520BHEP |
|
17Q | First examination report despatched |
Effective date: 20180119 |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61P 35/00 20060101AFI20191107BHEP Ipc: A61K 31/506 20060101ALI20191107BHEP Ipc: A61K 31/517 20060101ALI20191107BHEP Ipc: A61K 31/44 20060101ALI20191107BHEP Ipc: A61K 31/4709 20060101ALI20191107BHEP Ipc: A61K 45/06 20060101ALI20191107BHEP Ipc: A61K 31/437 20060101ALI20191107BHEP Ipc: A61K 31/4439 20060101ALI20191107BHEP Ipc: A61K 31/4184 20060101ALI20191107BHEP |
|
INTG | Intention to grant announced |
Effective date: 20191129 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20200603 |