EP2384366A2 - Prévention de manière transgénique de l établissement et de la propagation d algues transgéniques dans des écosystèmes naturels - Google Patents

Prévention de manière transgénique de l établissement et de la propagation d algues transgéniques dans des écosystèmes naturels

Info

Publication number
EP2384366A2
EP2384366A2 EP09811866A EP09811866A EP2384366A2 EP 2384366 A2 EP2384366 A2 EP 2384366A2 EP 09811866 A EP09811866 A EP 09811866A EP 09811866 A EP09811866 A EP 09811866A EP 2384366 A2 EP2384366 A2 EP 2384366A2
Authority
EP
European Patent Office
Prior art keywords
trait
gene
mitigating
sequence
advantageous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP09811866A
Other languages
German (de)
English (en)
Other versions
EP2384366A4 (fr
Inventor
Jonathan Gressel
Shai Ufaz
Ofra Chen
Doron Eisenstadt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US12/322,686 external-priority patent/US20090215179A1/en
Application filed by Individual filed Critical Individual
Publication of EP2384366A2 publication Critical patent/EP2384366A2/fr
Publication of EP2384366A4 publication Critical patent/EP2384366A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora

Definitions

  • the present invention relates to a genetic mechanism for preventing the establishment of transgenic algae and cyanobacteria in natural ecosystems should they be released from enclosed cultivation.
  • Algae and cyanobacteria have recently attracted much interest as biofactories for production of foods, bioactive compounds and biofuels. Since algae and cyanobacteria need sunlight, carbon-dioxide, and water for growth, they can be cultivated in open or enclosed water bodies. These systems are vulnerable to being contaminated by other algal species and cyanobacteria. Similarly, the cultivated algae may escape outside the cultivation. This may become a serious concern when the cultivated cells are transgenically modified.
  • Introgression of genetically engineered traits Needed traits could be artificially forced horizontally into the algae and cyanobacteria by genetic engineering to enhance cost-effectiveness (higher yields, new products, resistances to contaminations, adaptability to cultivation with high levels of light and carbon dioxide not presently occurring in their natural ecosystems). Detractors of both the process of genetic engineering and its products have raised the possibilities that the engineered algae and cyanobacteria would become uncontrollable problems if there was an inadvertent leak or spill from such cultivation into natural ecosystems.
  • genes for herbicide resistance could provide a selective advantage in the few areas where herbicides are used (typically in freshwater, not marine habitats). It might be harder to predict the competitive advantages of other genes such as enhanced or modified lipid, amino acid, protein or carbohydrate contents, but precaution might prevent the utilization of such genes, unless there are mechanisms in place to prevent their establishment in natural ecosystems, should they escape cultivation.
  • a method is provided to obtain transgenic algae or cyanobacteria bearing at least one genetically engineered, commercially desirable genetic trait that is at risk of establishing in natural ecosystems (Table 1) but is tandemly linked to, and co-expressing at least one transgene (mitigating gene) that is desirable in or neutral to the cultivated transgenic algae or cyanobacteria but rendering the transgenic algae or cyanobacteria incapable of establishing by itself or in introgressed offspring in natural ecosystems (Table 2), thereby obtaining a cultivated algae or cyanobacteria capable of mitigating the effects of release of said genetically engineered, commercially desirable genetic trait of the algae or cyanobacteria in natural ecosystems.
  • the sequence encoding the desirable genetic trait and the sequence of the mitigating gene remain genetically linked in the transgenic algae or cyanobacteria according to this invention, because of the introduction of the sequences in tandem. If there is no recombination in the species, the genes need not be tandemly linked.
  • the transgene that prevents the establishment of the algae or cyanobacteria may be, one or more of the following:
  • a transgene encoding a reduced content of RUBISCO (ribulose 1,5 bis phosphate carboxylase/oxygenase) (such as an antisense or RNAi construct of the small or the large subunit of RUBISCO) which allows normal algae or cyanobacteria growth only at artificially high carbon dioxide concentrations, but not in natural environments; '
  • RUBISCO ribulose 1,5 bis phosphate carboxylase/oxygenase
  • transgene encoding reduced photosystem 2 antennae size such as tla ⁇ , which allows growth only at high light intensities but allows greater packing of cells in commercial production facilities with less light energy wasted as heat; such organisms would not have enough chlorophyll to compete with indigenous organisms in natural ecosystems.
  • the gene of choice can be introduced into a mutant strain having a reduced antennae.
  • RNAi construct of any of the genes encoding cilia or flagella (or similar motility organ) formation or action such that the transgenic algae or cyanobacteria cannot optimally position themselves based on environmental stimuli. Such movement is required to compete in natural ecosystems, but is unnecessary and utilizes energy in commercial cultivation;
  • a transgenic mutant form of the phytoene desaturase ipds) gene conferring resistance to phytoene desaturase inhibiting herbicides, which synthesizes less beta- carotene.
  • the herbicide resistance allows controlling unwanted species in commercial culture and the less carotene is of little consequence in dense commercial culture but provides photoprotection to organisms in the natural environments and organisms with less beta carotene are less competitive in the natural ecosystems.
  • other herbicide resistances can be used;
  • a transgene in the anti-sense or RNAi form encoding one or more of the polymers of the cell walls such that the algae or cyanobacteria has a thinner cell wall.
  • This thinner cell wall is of little consequence in commercial production, and the cell walls are the least commercially valued part of the cell, but organisms with thinner cell walls cannot compete in the variable vicissitudes of environmental conditions in natural ecosystems;
  • This is desirable in commercial production when the new polymer has a greater value than starch, but renders an organism that cannot mobilize reserves less fit in a natural environment, where it cannot compete with organisms that can mobilize reserves in times of need; or 7.
  • a method is provided to obtain a cultivated algae or cyanobacteria having multiple transgenes in tandem, (or in some cases separately introduced), derived from different sources with at least one of the transgenes capable of mitigating the fitness effects preventing stable establishment of at least one genetically engineered, commercially desirable genetic trait of the algae or cyanobacteria in natural ecosystems.
  • a method of obtaining a cultivated algae or cyanobacteria capable of mitigating the effects of self propagation or of asexual or sexual introgression of at least one genetically engineered, commercially desirable genetic trait to an undesirable species related to the cultivated algae or cyanobacteria comprising transforming a population of the cultivated algae or cyanobacteria to express at least one genetically engineered commercially desirable genetic trait in the algae or cyanobacteria under genetic control of at least one genetic control element which is inexpressible by said undesirable interbreeding species related to the cultivated algae or cyanobacteria, thereby obtaining a cultivated algae or cyanobacteria capable of mitigating the effects of self propagation or of introgression of said genetically engineered, commercially desirable genetic trait of the cultivated algae or cyanobacteria to said undesirable species related thereto.
  • a method of obtaining cultivated asexual, non-conjugating algae or cyanobacteria capable of mitigating the effects of self propagation of at least one genetically engineered, commercially desirable genetic trait in natural ecosystems comprising transforming a population of the cultivated algae or cyanobacteria to express at least one genetically engineered, commercially desirable genetic trait into algae or cyanobacteria bearing a natural or induced mutation that acts as a mitigating genetic trait, wherein said mitigating genetic trait is selected such that a self propagated said mitigating genetic trait is less fit than native algae or cyanobacteria not expressing said mitigating genetic trait.
  • a method of obtaining a cultivated algae or cyanobacteria capable of mitigating the effects of self propagation or of introgression of at least one genetically engineered, commercially desirable genetic trait to an undesirable, uncultivated interbreeding species related to the cultivated algae or cyanobacteria, the method comprising transforming a population of the cultivated algae or cyanobacteria to co-express at least one genetically engineered, commercially desirable genetic trait, and at least one genetically linked, mitigating genetic trait, wherein said mitigating genetic trait is selected such that a self propagated or undesirable, species introgressing genes from the transgenic alga or cyanobacterium related to the cultivated algae or cyanobacteria expressing said mitigating genetic trait is less fit than an undesirable uncultivated interbreeding/introgressing species related to the cultivated algae or cyanobacteria not expressing said mitigating genetic trait, thereby obtaining a cultivated algae or cyanobacteri
  • At least one commercially desirable genetic trait is selected from the group consisting of herbicide resistance, disease or zooplankton resistance, environmental stress resistance, the ability to fluoresce near ultraviolet light to photosynthetically usable light, high productivity, modified polysaccharide, protein or lipid qualities and quantities, enhanced yield, expression of heterologous products and other genetically modified algae and cyanobacteria products.
  • the at least one mitigating genetic trait is selected from the group consisting of decreased RUBISCO, decreased storage or cell wall polysaccharides, decreased chlorophyll and/or carotene, decreased or eliminated motility organs, and increased non self metabolizable storage materials.
  • the at least one mitigating genetic trait is a reduced expression of endogenous genetic trait of said cultivated algae or cyanobacteria.
  • the cultivated algae or cyanobacteria is one of the following Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp., Isochrysis sp.
  • the commercially desirable genetic trait is single double or triple herbicide resistance, virus resistance, the ability to fluoresce near ultraviolet light as blue or red light, protein content modified to high lysine and methionine and enhanced non self metabolizable storage polysaccharides and the mitigating genetic trait is selected from the group consisting of reduced RUBISCO, lack of motility organs, reduced photosystem II antenna size, reduced carotene synthesis as part of resistance to phytoene desaturase inhibiting herbicides, and reduced storage starch formation.
  • a genetic construct for mitigating the effects of establishment by self propagation or introgression of a genetically engineered commercially desirable genetic trait of a cultivated algae or cyanobacteria to an undesirable species related to the cultivated algae or cyanobacteria comprising a first polynucleotide encoding the at least one commercially desirable genetic trait and a second polynucleotide encoding at least one mitigating genetic trait, wherein said at least one mitigating genetic trait is selected such that an undesirable, species related to the cultivated algae or cyanobacteria expressing said at least one mitigating genetic trait is less fit than the undesirable species related to the cultivated algae or cyanobacteria not expressing said at least one mitigating genetic trait and wherein expression of said commercially desirable and said at least one mitigating genetic trait is genetically linked, and a genetically modified cultivated algae or cyanobacteria comprising the genetic construct.
  • the first and said second polynucleotides are functionally linked.
  • the first and second polynucleotides are co-transformed.
  • the first and second polynucleotides are integrated into the same chromosomal locus.
  • the first and second polynucleotides are integrated separately into an organism that has no known ability to exchange DNA among cells.
  • the at least one commercially desirable genetic trait is selected from the group consisting of herbicide resistance, disease or zooplankton resistance, environmental stress resistance, the ability to fluorescence near ultraviolet light to photosynthetically usable light, high productivity, modified polysaccharide, protein or lipid qualities and quantities, enhanced yield, and expression of heterologous products and other genetically modified algae and cyanobacteria products.
  • the present invention successfully addresses the shortcomings of the presently known configurations by conceiving and providing a mechanism for mitigating the establishment of the transgenic algae or cyanobacteria and its progeny from establishing by self-propagation or the effects of introgression of a genetically engineered genetic trait of a alga or cyanobacteria to competing organisms.
  • the mitigating gene be an irreversible mutation to a mitigating form.
  • FIG. 1 Schematic diagram used to induce glyphosate resistant epsps in tandem with tlal RNAi in C. reinhardtii.
  • the coding region of epsps is cloned under the control of the RbcS promoter.
  • the RNAi cassette of tlal is cloned in tandem to the epsps, upstream to the RbcS terminator.
  • FIG. 1 Schematic diagram used to induce HPPD in background mutant algae with reduced antenna size.
  • the coding region of HPPD is cloned under the control of the RbcS promoter.
  • FIG. 3 Schematic diagram used to induce the virus CAPSID and RbcS RNAi cassette in C. reinhardtii.
  • the coding region of the CAPSID is cloned under the control of the RbcS promoter.
  • the RbcS RNAi cassette is cloned in tandem to the CAPSID, upstream to the RbcS terminator.
  • FIG. 4 Schematic diagram used to induce the virus CAPSID and RbcS antisense in the green alga C. reinhardtii.
  • the coding region of the CAPSID is cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • the RbcS is cloned in an antisense orientation in tandem to the CAPSID, downstream to the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 5 Schematic diagram used to induce the virus CAPSID and RbcS antisense in cyanobacteria Synechococcus PCC7002.
  • the coding region of the CAPSID is cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • the RbcS is cloned in an antisense orientation in tandem to the CAPSID, downstream to the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 6 Schematic diagram used to induce pds together with the high lysine BHL8 protein or high methionine 2S albumin protein in C. reinhardtii.
  • the coding region of PDS is cloned under the control of the hsp70A and the RbcS promoters and upstream to the RbcS terminator.
  • the BHL8 or 2S are cloned in tandem to PDS, downstream to the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 7 Schematic diagram used to induce pds together with the high lysine BHL8 protein or high methionine 2S albumin protein in cyanobacteria Synechococcus PCC7002.
  • the coding region of pds is cloned under the control of RbcS promoter and upstream to the RbcS terminator.
  • the BHL8 of 2S are cloned in tandem to pds, downstream to the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 8 Schematic diagram used to induce the MERA and MERE genes together with RNAi of stal (A) and the l-S5Tand 1 -FFT genes (B) in C. reinhardtii.
  • the coding region of MERA is cloned under the control of the RbcS promoter and upstream to the RbcS terminator in tandem to merB, which is cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • This is in tandem to RNAi cassette of sta ⁇ or sta ⁇ , which are cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 9 Schematic diagram used to induce the BFP in the C. reinhardtii mutant odal2-l.
  • the coding region of BFP is cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • FIG. 10 Schematic diagram used to induce the BFP and PiH antisense in cyanobacteria Synechococcus PCC7002.
  • the coding region of BFP is cloned under the control of the RbcS promoter and upstream to the RbcS terminator.
  • the PiIT is cloned in an antisense orientation in tandem to BFP, downstream to the RbcS promoter and upstream to the RbcS terminator.
  • Figure 11 Schematic diagram used to induce the PPO in the C. reinhardtii mutant oda 12-1.
  • the present invention is of genetic mechanisms that can be used for preventing the establishment of transgenic algae or cyanobacteria in natural ecosystems and mitigating the effects of introgression of a genetically engineered genetic trait of a cultivated algae or cyanobacteria to an undesirable, related species of the algae or cyanobacteria.
  • the present invention can be used to preclude the establishment of self-propagated transgenic algae or cyanobacteria and mitigating the effects of introgression of genetically engineered traits related algae or cyanobacteria.
  • DNA ligase DNA polymerase, restriction endonucleases and the like are performed according to the manufacturers' specifications.
  • the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Sambrook et al., (1989); Ausubel, R. M., ed. (1994); Ausubel et al (1989); Perbal, (1988); Watson et al., (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202;
  • the term genetically linked refers to a genetic distance smaller than 50 centiMorgan, preferably smaller than 40 centiMorgan, more preferably smaller than 30 centiMorgan, more preferably smaller than 20 centiMorgan, more preferably smaller than 10 centiMorgan, more preferably smaller than 5 centiMorgan, more preferably smaller than 1 centiMorgan, most preferably in the range of 0 to 1 centiMorgan, wherein 0 centiMorgan refers to juxtaposed sequences.
  • herbicide-resistant algae and cyanobacteria allow control of closely-related algae and cyanobacteria that have the same herbicide selectivity spectrum as the cultivated algae and cyanobacteria and could not be previously controlled.
  • an advantage of disease resistant algae and cyanobacteria is that they will not be decimated by pathogens.
  • Highly productive algae and cyanobacteria are also advantageous, as are algae and cyanobacteria with modified product such as different types of starch and oils.
  • Table 1 Commercially desirable traits that can be engineered into algae and cyanobacteria that may be undesirable if algae or cyanobacteria released into natural ecosystems
  • transgenics are well appreciated, if there is no danger of establishment of the transgenic algae or cyanobacteria in natural ecosystems or introgression into a related alga or cyanobacterium. Because the advantages of transgenics are so great, as in the above cases, new modified transgenic algae and cyanobacteria are being developed.
  • the genetically engineered, commercially desirable genetic trait can be transformed into a population of the cultivated algae or cyanobacteria that express an irreversible (e.g. deletion) mutation conferring a mitigating trait.
  • mutations exist in culture collections or can be obtained by mutagenesis, preferably by ultraviolet or gamma irradiation that causes deletions that cannot be reversed.
  • Chemical mutagenesis which typically causes point mutations in a single nucleotide can be reversed. Such mutations have been reported, e.g.
  • genes that decrease RUBISCO or starch, remove cilia or other movement organelles among others would all be useful for that purpose, as they would often be benign or advantageous to the cultivated algae or cyanobacteria while detrimental establishment in the wild.
  • Table 2 Example of commercially desirable traits that can be engineered into algae and cyanobacteria that would render algae or cyanobacteria unfit and non-competitive if released into natural ecos stems.
  • a transgene encoding reduced content of RUBISCO (ribulose 1,5 bis phosphate carboxylase/oxygenase) (such as an antisense or RNAi construct of the small or the large subunit of RUBISCO) allows normal algae or cyanobacteria growth only at artificially high carbon dioxide concentrations.
  • RUBISCO ribulose 1,5 bis phosphate carboxylase/oxygenase
  • a transgene or a mutation encoding reduced chlorophyll a oxygenase or reduced photosystem II antennae size allows growth only at high light intensities but allows greater cell packing in commercial production facilities with less light energy wasted as heat; such organisms would not have enough chlorophyll to compete with indigenous organisms in natural ecosystems.
  • RNAi constructs of any of the genes encoding cilia or flagella (or similar motility organ) formation or action prevents the transgenic alga or cyanobacterium to position itself optimally based on environmental stimuli. Such movement is required to compete in natural ecosystems, but is unnecessary and wastes energy in commercial cultivation.
  • a transgenic mutant form of the phytoene desaturase (pds) gene conferring resistance to phytoene desaturase inhibiting herbicides synthesizes less beta-carotene. The herbicide resistance allows controlling unwanted species in commercial culture and the less carotene is of little consequence in dense commercial culture but provides photoprotection to organisms in the natural environments and organisms with less beta carotene are less competitive in the natural ecosystems.
  • a transgene in the anti-sense or RNAi form encoding one of the genes encoding one or more of the polymers of the cell walls causes the alga or cyanobacterium to form a thinner cell wall.
  • This thinner cell wall is of little consequence in commercial production, and the cell walls are the least commercially valued part of the cell, but organisms with thinner cell walls cannot compete in the variable vicissitudes of environmental conditions in natural ecosystems.
  • This is desirable in commercial production when the new polymer has a greater value than starch, but renders an organism that cannot mobilize reserves, less fit in a natural environment where it cannot compete with organisms that can mobilize reserves in times of need.
  • the present invention also provides a genetic construct for mitigating the effects of establishment or introgression of a genetically engineered commercially desirable genetic trait of a cultivated alga or cyanobacterium.
  • the genetic construct comprises a first polynucleotide encoding at least one commercially desirable genetic trait and a second polynucleotide encoding at least one mitigating genetic trait.
  • the polynucleotide encoding the first, primary genetic trait is preferably flanked on both sides by polynucleotides encoding the second, mitigating genetic trait, to thereby reduce the risk of losing the second, mitigating genetic trait due to mutation, etc.
  • a cultivated algae or cyanobacteria genetically modified to include the above described genetic constructs and to express the traits encoded thereby.
  • the second, mitigating genetic trait is selected from the group consisting of reduced RUBISCO, reduced photosynthetic antennae, or reduced starch content or removal of cilia or other propelling organelles Numerous specific examples of such genetic traits are listed herein and are further discussed in the
  • RUBISCO would be neutral or advantageous to the algae or cyanobacteria growing in saturating carbon dioxide, but deleterious to the algae or cyanobacteria in the wild, by themselves or in introgressed progeny, where carbon dioxide is limiting and there would not be enough enzyme to fix carbon dioxide.
  • Another such mitigating trait is decreased starch content.
  • Such algae or cyanobacteria would be desirable as they would funnel more photosynthate to more valuable products, but without starch, such algae and cyanobacteria would not have the desired storage components to compete and exist in natural ecosystems
  • Yet another such mitigating trait is the reducing of the photosystem II antennae size by reducing the chlorophyll content (anti-sense or RNAi of the tlal or similar transgene, or a mutation encoding a reduced antenna) or by reducing the carotenoid content (using the mutant pds gene conferring herbicide resistance to fluridone and related herbicides).
  • This is advantageous in high light intensity photobioreactors and shallow ponds, as it allows more biomass production and less photoinhibition, but in light-limiting natural ecosystems is highly deleterious.
  • Still another such mitigating trait is using mutants that are obtained transgenically that are less mobile.
  • these anti-establishment in natural ecosystem, introgression-mitigating traits are combined, according to the present invention, with the desirable genetically engineered traits, which genetically engineered traits include, but are not limited to, traits imposing resistance to herbicides, disease, zooplankton pests, and pathogens, resistance to environmental stress such as, but not limited to, heat, salinity, etc., and traits affecting yield, modified product and by-product quality, bioremediation, as well as expression of heterologous products and genetically modified products such as starches and oils, etc.
  • genes modifying fatty content [delta(12)-fatty acid dehydrogenase (fad2), fatty acid desaturase, and thioesterase (TE)], PAT), herbicide tolerance genes that collaterally control many bacteria and fungal pathogens (5-enolpyruvylshikimate- 3-phosphate synthase (EPSPS), acetolactate synthase, glyphosate oxidoreductase, nitrilase, phosphinothricin N-acetyltransferase), genes conferring favorable mutations (acetolactate synthase (ALS) and acetyl-CoA-carboxylase), and numerous viral resistance genes (helicase replicase and various specific viral coat protein genes). Additional suitable genes are listed in Table land summarized in many recent texts.
  • a gene responsible for a mitigating trait must be engineered for algal or cyanobacterial expression along with the desirable trait that confers an advantage thereto.
  • a suitable chimeric gene and transformation vector must be constructed.
  • a typical chimeric gene for transformation will include a promoter region, a heterologous structural DNA coding sequences and a 3' non-translated polyadenylation site for algae.
  • a heterologous structural DNA coding sequence means a structural coding sequence that is not native to the algae or cyanobacteria being transformed.
  • Heterologous with respect to the promoter means that the coding sequence does not exist in nature in the same gene with the promoter to that it is now attached.
  • Chimeric means a novel non-naturally occurring gene that is comprised of parts of different genes.
  • the various DNA fragments may be manipulated as necessary to create the desired vector. This includes using linkers or adaptors as necessary to form suitable restriction sites or to eliminate unwanted restriction sites or other like manipulations that are known to those of ordinary skill in the art.
  • Promoters that are known or found to cause transcription of a selected gene or genes in plant and bacterial cells can be used to implement the present invention in algae or cyanobacteria, respectively.
  • Such promoters may be obtained from plants, plant pathogenic bacteria or plant viruses and include, but are not necessarily limited to, strong constitutive promoter such as a 35S promoter (Odell et al (1985) ), a 35S'3 promoter (Hull and Howell (1987) ) and the 19S promoter of cauliflower mosaic virus (CaMV35S and CaMV19S), the full-length transcript promoter from the figwort mosaic virus (FMV35S) and promoters isolated from plant genes such as EPSP synthase, ssRUBISCO genes.
  • strong constitutive promoter such as a 35S promoter (Odell et al (1985) ), a 35S'3 promoter (Hull and Howell (1987) ) and the 19S promoter of cauliflower mosaic virus (CaMV35S and CaMV19S), the
  • Selective expression in green tissue can be achieved by using, for example, the promoter of the gene encoding the small subunit of Rubisco ( EP 0 242 246). All of these promoters have been used to create various types of DNA constructs that have been expressed in plants. See, for example WO 84/02913 ). The particular promoter selected should be capable of causing sufficient expression to result in the production of an effective amount of the respective proteins to confer the traits.
  • a particularly useful promoter for use in some embodiments of the present invention is the full-length transcript promoter from the figwort mosaic virus (FMV35S).
  • the FMV35S promoter is particularly useful because of its ability to cause uniform and high levels of expression in plant tissues.
  • the DNA sequence of a FMV.35S promoter is presented in U.S.5,512,466 and is identified as SEQ ID NO:17 therein.
  • the promoters used for expressing the genes according to the present invention may be further modified if desired to alter their expression characteristics.
  • the CaMV35S promoter may be ligated to the portion of the ssRUBISCO gene which represses the expression of ssRUBISCO in the absence of light, to create a promoter which is active in leaves but not in roots.
  • the resulting chimeric promoter may be used as described herein.
  • the phrase "CaMV35S” or "FMV35S” promoter includes variations of these promoters, e.g., promoters derived by means of ligation with operator regions, random or controlled mutagenesis, addition or duplication of enhancer sequences, etc.
  • the 3' non-translated region contains a polyadenylation signal that functions in algae (but not cyanobacteria) to cause the addition of polyadenylated nucleotides to the 3' end of an RNA sequence.
  • suitable 3' regions are the 3' transcribed, non-translated regions containing the polyadenylation signal of plant genes like the 7s soybean storage protein genes and the pea E9 small subunit of the RuBP carboxylase gene (ssRUBISCO).
  • RNAs produced by a DNA construct of the present invention also preferably contains a 5' non-translated leader sequence.
  • This sequence can be derived from the promoters selected to express the genes, and can be specifically modified so as to increase translation of the mRNAs.
  • the 5' non-translated regions can also be obtained from viral RNA's, from suitable eukaryotic genes, or from a synthetic gene sequence.
  • the present invention is not limited to constructs wherein the non- translated region is derived from the 5' non-translated sequence that accompanies the promoter sequence.
  • non-translated leader sequences can be part of the 5' end of the non-translated region of the native coding sequence for the heterologous coding sequence, or part of the promoter sequence, or can be derived from an unrelated promoter or coding sequence as discussed above.
  • the vector that is used to introduce the encoded proteins into the host cells of the algae or cyanobacteria will comprise an appropriate selectable marker.
  • the vector is an expression vector comprising both a selectable marker and an origin of replication.
  • the vector will be a shuttle vector, which can propagate both in E. coli (wherein the construct comprises an appropriate selectable marker and origin of replication) and be compatible for propagation or integration in the genome of the plant organism of choice.
  • the construct comprising the promoter of choice, and the gene of interest is placed in a viral vector which is used to infect the cells. This virus may be integrated in the genome of the organism of choice or may remain non-integrated.
  • the construct will comprise a signal sequence to effect secretion as is known in the art.
  • a signal sequence that is recognized in the active growth phase will be most preferred.
  • the appropriate signal sequence should be placed immediately downstream of the translational start site (ATG), and in frame with the coding sequence of the gene to be expressed.
  • ATG translational start site
  • Introduction of the construct into the cells is accomplished by any conventional method for transfection, infection or the like as is known in the art including electroporation and biolistic transformations.
  • constructs comprising a selectable marker the cells may be selected for those bearing functional copies of the construct.
  • the appropriate selective conditions will be used during growth.
  • Stable transfectants and stable cell lines may be derived from the transfected cells in appropriate cases, in order to conveniently maintain the genotype of interest.
  • Cell growth is accomplished in accordance with the cell type, using any standard growth conditions as may be suitable to support the growth of the specific cell line.
  • a DNA construct of the present invention can be inserted into the genome of algae or cyanobacteria by any suitable method. Such methods may involve, for example, the use of liposomes, electroporation, chemicals that increase free DNA uptake such as polyethylene glycol (PEG), vacuum filtration, particle gun technology (biolistic bombardment with tungsten or gold particles; see, for example, U.S.
  • An additional advantage of using a dual (tandem) system including a gene that may have an advantage in natural ecosystems with a mitigating gene is that the pair can be chosen in such a manner that one of the pair can have traits that will allow it to be used as a selectable marker, obviating the need for a separate selectable marker. Confirmation of the transgenic nature of the algal or cyanobacterial cells may be performed by PCR analysis, antibiotic or herbicide resistance, enzymatic analysis and/or Southern blots to verify transformation.
  • Progeny of the initial algal or cyanobacterial strains may be obtained by continuous sub-culturing may be obtained and analyzed to verify whether the transgenes are heritable. Heritability of the transgene is further confirmation of the stable transformation of the transgene in the algae or cyanobacteria. The transgenic algae or cyanobacteria are then grown and harvested using conventional procedures.
  • transgene construct has in totality a small fitness disadvantage, it will remain localized as a very small proportion of the population. Therefore, gene establishment and flow should be mitigated by lowering the fitness of recipients below the fitness of the wild type so that they will not spread.
  • transgenic mitigation was proposed for higher plants WO 04/46362, from which the present invention claims priority) and in a subsequent publication (Gressel, 1999: , see Figs. 9 and 10) in which mitigator genes are added to the desired primary transgene, which would reduce the fitness advantage to hybrids and their rare progeny, and thus considerably reduce risk. It is now extended to transgenic algae and cyanobacteria.
  • the TM approach is based on the facts that: 1) tandem constructs act as tightly linked genes, and their segregation from each other is exceedingly rare, far below the natural mutation rate; and 2) The TM traits chosen are selected to be nearly neutral or favorable to the cultivated crops, but deleterious to non-crop progeny (weeds, etc) due to a negative selection pressure; and 3) Individuals bearing even mildly harmful TM traits will be kept at exceedingly low frequencies in weed populations because weeds typically have a very high seed output and strongly compete amongst themselves, eliminating even marginally unfit individuals (Gressel, 1999). That this approach has been effective in higher plants has been illustrated in the following scientific publications: Al-Ahmad, et al., (2004; 2005; 2006, Al-Ahmad and Gressel, 2006).
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is down regulation of a form of the tlal gene (e.g. AF534571) that reduces the number of chlorophyll molecules in the antennae of photosystem II.
  • a form of the tlal gene e.g. AF534571
  • Such strains can live only in the high light intensity of bioreactors and shallow ponds, where they allow greater packing, but cannot compete with the superior light capture of organisms with full size antennae.
  • Such organisms with full size antennae are kept out of the culture ponds by having traits such as glyphosate herbicide resistance.
  • Rare algae or cyanobacteria introgressing the TM construct could also no longer compete with native organisms in natural ecosystems.
  • tandem construct was made containing an EPSP synthase gene (enolphosphate shikimate phosphate synthase) gene (SEQ ID NO: 1) for glyphosate herbicide resistance as the primary desirable gene, and a RNAi cassette of the tlal gene (SEQ ID NO: 2) as a mitigator, and used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp., I
  • a DNA fragment corresponding to nucleotides 1 to 293 of the C. reinhardtii tlal gene is de novo synthesized in sense and antisense orientation with a 50-bp DNA spacer separating the sense and antisense fragments (SEQ ID NO:2).
  • This fragment is cloned under the control of the C. reinhardtii rbcS2B promoter and downstream to the de novo synthesized EPSPS gene (SEQ ID NO:1) in the plasmid pSP124s (Lumbreras et al. 1998) to generate plasmid pEPSPS-tlal (Fig. 1).
  • the de novo synthesized EPSPS gene for algae under the control of rbcS2 promoter and 3 'rbcS2 terminator, downstream to the ble selectable marker in the plasmid pSP124s is transformed into the C. reinhardtii tlal mutant (Polle et al., 2003).
  • the transformed algae will express the EPSPS gene on the background of the tlal deficient mutant.
  • Algae cells in 0.4 ml of growth medium containing 5% PEG6000 were transformed with the pEPSPS-tlal plasmid (l ⁇ 5mg) by the glass bead vortexing method (Kindle, 1990).
  • the transformation mixture was then transferred to 10 ml of non-selective growth medium for recovery.
  • the cells were kept for at least 18 h at 25 0 C in the light.
  • Cells were collected by centrifugation and plated at a density of 10 8 cells per 80 mm plate.
  • Transformants were selected on fresh TAP agar plates containing 10 mM glyphosate, for 7-10 days at 30 0 C. Conditions are modified for each organism according to its needs, based on modifications of standard protocols.
  • Genomic DNA was isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA was isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.). The DNA was analyzed by PCR for the presence of intact tandemly linked epsps and tla ⁇ genomic insert.
  • EPSPS forward primer 1 SEQ ID NO:3: TCCCCGGCGACAAGAGCAT Tlal reverse primer 1 (SEQ ID NO:4): AAGAGCGCGGTTTGGTCAGC EPSPS forward primer 2 (SEQ ID NO:5): CACCGCATCGCCATGAGCTT Tlal Reverse primer 2 (SEQ ID NO:6): GCTGACCAAACCGCGCTCTT PCR reactions were carried out in 50 ⁇ L aliquots containing about 200 ng genomic DNA, 5 ⁇ L of 10 X DyNAzymeTM II buffer (Finnzymes Oy, ESPOO, Finland), 1.5 U of DyNAzymeTM II DNA polymerase (Finnzymes Oy, ESPOO, Finland), 5 ⁇ L of 2.5 mM of each dNTP(s) (Roche Diagnostics, GmbH), and 35 pmol of each primer, in sterile distilled water.
  • the mixture was denatured for 3 min at 94° C and amplified for 35 cycles (94° C for 30 s, 51 0 C (DNA segments A and C) or 57° C (segments B and D) for 30 s, 72° C for 1 min) with a final cycle of 7 min at 72° C.
  • the PCR products (15 ⁇ L) were loaded directly onto 1% (w/v) agarose gels to verify single bands.
  • the remaining PCR products were purified using the QIAquick PCR Purification Kit ® (Qiagen, Hilden, Germany) according to the manufacturer's instructions, and sequenced to confirm the integration of the TM T-DNA.
  • In vivo epsps assay Putative transformed algal or cyanobacterial cells were cultured in a solution of 10 mM glyphosate in standard algae or cyanobacteria culture media. At this concentration, all non-transgenic cells are killed. In vivo tlal assay Putatively transformed algae or cyanobacteria cells were diluted and plated out and cultured on agar plates in standard algae or cyanobacteria culture media such that single cells develop into colonies. These colonies were light yellow green in color vs. wild type colonies that are dark green in color. Inheritance of the TM construct transgenes
  • transgenic TM algae or cyanobacteria were used to compete with natural species in simulated conditions. 1000 transgenic cells per ml were pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots were removed initially at daily, and later at weekly intervals, and the dwindling proportion of yellow green colonies are counted. Aliquots at the same dilutions were plated in parallel on the same media, but containing 10 mM glyphosate.
  • One of the traits suitable for Mitigation in constructs with a primary, desirable trait is down regulation of a form of the tlal gene, as described in Example 1.
  • Such modification of antenna size can be achieved by mutagenesis of the organism prior to introducing the commercial gene of choice.
  • Such mutant strains can live only in the high light intensity of bioreactors and shallow ponds, where they allow greater packing, but cannot compete with the superior light capture of organisms with full size antennae.
  • Such organisms with full size antennae are kept out of the culture ponds by having traits such as herbicide resistance, in this example resistance to inhibitors of the enzyme HPPD (4-hydroxyphenyl-pyruvate-dioxygenase).
  • HPPD AF0002228 gene
  • SEQ ID NO:9 conferring resistance to the herbicide isoxaflutole (and related HPPD inhibiting herbicides), as the primary desirable gene, and used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp, Isochrysis sp.
  • CS- 177 Tetraselmis chuii CS-26 Tetraselmis suecica CS-187, bearing a mutation conferring small antennae size.
  • Attaining reduced antennae mutants by UV mutagenesis with metronidazole selection was shown to be effective for the selective enrichment of mutants of Chlamydomonas reinhardtii that possess impaired photosynthetic electron transport. More than 99.9% of wild-type cells were killed when incubated in the presence of 6-10 mM metronidazole for 24 hr under illumination of 7500 lux. Survival of wild-type cells in darkness and of mutants that are blocked at different steps in photosynthetic electron transport was nearly 100% when incubated in the presence of the drug under identical conditions (Schmidt et al. 1977).
  • Nannochloropsis sp. strains CS 246 and CS 179.
  • Cells were grown in Artificial Sea Water (ASW) (Guillard, 1962) enriched with f/2. 25ml of each cell culture in liquid media was placed in Petri dish and was exposed to UV irradiation (UV-C Lamp 30W) for 6.5 min. resulting in cell death of approximately 90%. The remaining cells were allowed a recovery time of 15 hrs. under dark conditions, then centrifuged (4000 rpm, 5 min.), re-suspended in 2 ml.
  • ASW Artificial Sea Water
  • UV-C Lamp 30W UV irradiation
  • each modified strain is checked for the trait modified, (reduced antennae size).
  • a screening process is established where colonies of mutant algae are allowed to grow on metronidazole containing agar plates to verify that the desired trait, i.e. reduced antennae size has been established and is maintained.
  • pale green growing colonies where picked and transferred to liquid medium for further physiological evaluation. This includes: Growth rate, Photosynthetic activity, Respiration activity, and Chlorophyll content
  • the de novo synthesized HPPD gene for algae is cloned under the control of rbcS2 promoter and 3 'rbcS2 terminator, downstream to the ble selectable marker in the plasmid pSP124s (Lumbreras et al. 1998) and transformed into the algae bearing a mutation conferring small antennae size.
  • Algae cells in 0.4 ml of growth medium containing 5% PEG6000 were transformed with the pHPPD plasmid (l ⁇ 5mg) by the glass bead vortexing method (Kindle, 1990).
  • the transformation mixture was then transferred to 10 ml of nonselective growth medium for recovery.
  • the cells were kept for at least 18 h at 25°C in the light.
  • Cells were collected by centrifugation and plated at a density of 10 8 cells per 80 mm plate.
  • Transformants were selected on fresh TAP agar plates containing 10 mM isoxaflutole, for 7-10 days at 30 0 C. Conditions are modified for each organism according to its needs, based on modifications of standard protocols.
  • Genomic DNA was isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA was isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen,
  • HPPD forward primer 1 (SEQ ID NO:7): ATGG GCCACCAAAA CGCCGC HPPD reverse primer 2 (SEQ ID NO:8): CCCACTAACTGTTTGGCTTC
  • PCR reactions were carried out in 50 ⁇ L aliquots containing about 200 ng genomic DNA, 5 ⁇ L of 10 X DyNAzymeTM II buffer (Finnzymes Oy, ESPOO, Finland), 1.5 U of DyNAzymeTM II DNA polymerase (Finnzymes Oy, ESPOO, Finland), 5 ⁇ L of 2.5 mM of each dNTP(s) (Roche Diagnostics, GmbH), and 35 pmol of each primer, in sterile distilled water.
  • the mixture was denatured for 3 min at 94 0 C and amplified for 35 cycles (94° C for 30 s, 51 0 C (DNA segments A and C) or 57° C (segments B and D) for 30 s, 72 0 C for 1 min) with a final cycle of 7 min at 72 0 C.
  • the PCR products (15 ⁇ L) were loaded directly onto 1% (w/v) agarose gels to verify single bands.
  • the remaining PCR products were purified using the QIAquick PCR Purification Kit ® (Qiagen, Hilden, Germany) according to the manufacturer's instructions, and sequenced to confirm the integration of the TM T-DNA.
  • transgenic TM algae or cyanobacteria were used to compete with natural species in simulated conditions. 1000 transgenic cells per ml were pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots were removed initially at daily, and later at weekly intervals, and the dwindling proportion of yellow green colonies are counted. Aliquots at the same dilutions were plated in parallel on the same media, but containing 10 mM isoxaflutole.
  • Example 3 Prevention of establishment and introgression of virus resistance by coupling with the transgenes conferring a lowered RUBISCO content
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is using an antisense or RNAi form of one or both of the subunits of the RUBISCO gene (such as GenBank Accessions XM_001702356, NC_005353) that cause the reduction of the number of RUBISCO molecules in the algae or cyanobacteria.
  • Such strains can live only in the carbon dioxide levels artificially created by using carbon dioxide enrichment - such as from flue gasses from industrial sources to facilitate high levels of carbon fixation in bioreactors and shallow ponds. In this situation, lower levels of the low affinity RUBISCO are needed as the carbon dioxide levels in the ponds are at least 100 fold greater than ambient levels.
  • Algae and cyanobacteria with less RUBISCO cannot compete in natural ecosystems with the superior carbon dioxide capture of native organisms with full RUBISCO content at the low ambient levels of carbon dioxide. Such organisms with full RUBISCO complement are kept out of the culture ponds by having traits such as herbicide resistance (Example 1). Rare algae or cyanobacteria introgressing the TM construct can also no longer compete with native organisms in natural ecosystems.
  • tandem construct is made containing a desirable gene encoding a gene conferring virus resistance ( M85052) as the primary desirable gene, and the rubisco mutant gene as a mitigator ( XM OO 1702356).
  • the chlorella virus capsid sequence is chemically synthesized using the published sequence ( M85052 ) with modifications according to the codon usage of the green algae Chlamydomonas reinhardtii (SEQ ID NO: 12).
  • the gene is cloned under the control of the RbcS2 promoter in the plasmid pSP124S (Sizova et al. 2001).
  • RNAi of rbcS2B a 248 bp fragment corresponding to the coding sequence of rbcS is amplified with primers : TCTAGA CTGCAG CGCCGTCATTGCCAAGTCCT (SEQ ID NO: 10) adding Xbal and Pstl and GGATCC AAGCTT AATGTAGTCGACCTGGGCGG (SEQ ID NO: 1 1) adding BamHI and HindIII restriction in their 5' flanking region.
  • the PCR product is cloned in forward and reverse orientations into the Pstl/BamHI and Hindlll/Xbal sites of the pSTBlue-1 vector (Novagen, Madison, WI, USA), flanking a 200-bp DNA spacer previously inserted into the EcoRV site.
  • the rbcS RNAi cassette is then excised from pSTBlue-1 by Xbal digestion and is cloned downstream to the virus capsid in the corresponding site of pSP124S (Lumbreras, Stevens et al. 1998) (Fig. 3).
  • Chlamydomonas reinhardtii expressing the virus CAPSID and the antisense rbcS2B gene under the control of the rbcS2 promoter The chlorella virus CAPSID sequence is chemically synthesized using the published sequence (M85052 ) with modifications according to the codon usage of the green algae Chlamydomonas reinhardtii (SEQ ID NO: 12). The gene is cloned into pGEM-T vector (Promega) and then transferred under the control of the RbcS2 promoter in the plasmid pSP124S (Sizova et al. 2001).
  • the 567 bp fragment of the C. reinhardtii rbcS2B gene (SEQ ID NO:57) is PCR amplified with the forward primer: TCTAGA ATGGCCGCCGTCATTGCCAAG (SEQ ID NO: 13) and the reverse primer:
  • TCTAGA ACGAGCGCCTCCATTTACACG (SEQ ID NO: 14), containing the Xbal site in their 5' region, and is cloned into pGEM-T (Promega). The Xbal fragment is then cloned downstream to the virus capsid in the corresponding site of pSP124S (Lumbreras, Stevens et al. 1998) (Fig. 4).
  • Algae cells in 0.4 ml of growth medium containing 5% PEG6000 are transformed with the pCAPSID- (anti)RUBISCO plasmid (l ⁇ 5mg) by the glass bead vortexing method (Kindle, 1990).
  • the transformation mixture is then transferred to 10 ml of non-selective growth medium for recovery.
  • the cells are kept for at least 18 h at 25° C in the light. Cells were collected by centrifiigation and plated at a density of 10 8 cells per 80 mm plate. Selection is made according to (Van Etten et al., 1983).
  • transformants are grown to a density of 2 x 10 7 to 3 x 10 7 algae per milliliter, concentrated by centrifiigation, and resuspended in MBBIM (Van Etten et al., 1983) at 38 x 10 7 algae per milliliter.
  • MBBIM Van Etten et al., 1983
  • Two hundred microliters of algae (7.6 x 10 7 algae) plus 100 ⁇ l of appropriate dilutions of the virus are added to 2.5 ml of 0.7 percent agar in MBBM (48 0 C to 50 0 C) and immediately overlaid on petri plates containing 15 ml of MBBM plus 1.5 percent agar. The plates are then incubated at 25°C in continuous light. Plaques are visible after 2-4 days. Conditions are modified for each organism according to its needs, based on modifications of standard protocols.
  • the Synechococcus virus (Syn9) capsid gene is chemically synthesized using the published sequence ( 4239190 ) (SEQ ID NO: 15) and is directly cloned downstream to the RbcS promoter in the pCB4 plasmid.
  • the coding sequence of Synechococcus PCC7002 rbcS2B (SEQ ID NO:66) is amplified using the forward primer: (SEQ ID NO: 16) and the reverse primer: GTAACGGGTTTGGTTGGGC (SEQ ID NO: 17) harboring BamHI restriction sites in their 5' ends, followed by cloning into pGEM-T plasmid (Promega).
  • the 333 bp fragment is then excised from the pGEM-T plasmid and cloned into the BamHI site in the shuttle vector pCB4 in an antisense orientation downstream to the virus capsid gene (Fig. 5).
  • the transformants are selected on BG-I l agar plates using the plaque selection assay which is preformed as described in (Wilson et al. 1993).
  • Serial dilutions of the cyanophage filtrates are added to separate 0.5-ml volumes of a 4Ox concentration (ca. 8 x 10 9 cells ml "1 ) of exponentially growing Synechococcus PCC7002 that are incubated at 25° C for 1 h with occasional agitation to encourage cyanophage adsorption.
  • Each phage-cell suspension is then added to 2.5 ml of 0.4% molten ASW agar (42° C); these suspensions are mixed gently and then poured evenly onto a solid 1% ASW agar plate (diameter, 85mm) before being left to set at room temperature for 1 h. Incubation of the plates is carried out at 25 0 C under constant illumination (15 to 25 microeinsteins m ⁇ 2 s "1 ), and the plates are monitored daily for the formation of plaques. Conditions are modified for each organism according to its needs, based on modifications of standard protocols.
  • Genomic DNA was isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA was isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.).
  • the DNA was analyzed by PCR for the presence of intact tandemly linked
  • DNA insert were amplified over the positions indicated in Figure 4 with the following primers for algae: For CAPSID and RNAi of RUBISCO:
  • CAPSID Forward primer ATGGCCGGCGGCCTGAGCCA (SEQ ID NO:20) rubisco Reverse primer: GTGTAAATGGAGGCGCTCGT (SEQ ID NO:21)
  • transgenic TM algae or cyanobacteria are used to compete with natural species in simulated conditions. 1000 transgenic cells per ml are pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth at ambient carbon dioxide levels. Aliquots are removed initially at daily, and later at weekly intervals, and the dwindling proportion of virus resistant colonies are counted.
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is using a mutant form of the pds (phytoene desaturase) gene (e.g.AY639658) that confers resistance to the herbicide fluridone and related herbicides, but also reduces the carotene levels leaving algae more subject photoinhibition and to UV light ⁇ induced damage.
  • pds phytoene desaturase
  • Such strains can live only under high light intensity of bioreactors and shallow ponds, but in dense cultures, but cannot compete with the superior light capture of organisms with full size antennae with its complete complement of carotenoids.
  • Such organisms with full size antennae are kept out of the culture ponds by having traits such as herbicide resistance, which is needed to prevent contamination in any event.
  • This tandem construct contained a modified high lysine or a modified high methionine or a fusion storage protein containing high levels of both as one of the primary desirable genes together with expression of feedback insensitive bacterial DHDPS (dihydrodipicolinate synthase) and with RNAi of LKR/SDH (lysine-ketoglutarate reductase/saccharopine dehydrogenase) as described previously (Zhu and Galili, 2004) to increase free lysine level or overexpression of cystathionine ⁇ -synthase (CGS).
  • DHDPS dihydrodipicolinate synthase
  • RNAi of LKR/SDH lysine-ketoglutarate reductase/saccharopine dehydrogenase
  • CGS is the enzyme that controls the synthesis of the first intermediate metabolite in the methionine pathway to increase free methionine (Avraham et al., 2005).
  • the construct contained mutant pds gene (AY639658) for herbicide resistance as a mitigator gene as well as a desirable gene in its own right, and as a selectable marker to isolate transformants.
  • the construct was used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp., Isochrysis sp. CS-177 Tetraselmis chuii CS-26 Tetraselmis suecica CS- 187.
  • the de novo synthesized pds (SEQ ID NO:27) genes together with high lysine BHL8 protein coding gene (SEQ ID NO:28) or high methionine 2S albumin coding gene (SEQ ID NO:29) are cloned under the control of the constitutive promoter of the rbcLS operon (Deng and Coleman 1999) in the plasmid pCB4 by BamHI restriction sites, as well into various expression vectors, allowing various levels of expression driven by different promoters, including constitutive, inducible, and log phase temporal promoters (Fig. 7).
  • Transformation into algae was conducted as described in example 1. Transformation of Cyanobacteria
  • Genomic DNA is isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992). Total RNA was isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.).
  • the DNA is analyzed by PCR for the presence of intact tandemly linked pds and BHL8 genomic insert.
  • Four different DNA segments within the genomic TM T- DNA insert were amplified over the positions indicated in Figs. 6 and 7 with the following primers: forward primer: (SEQ ID NO:30): ATGACTGTTGCTAGGTCGGT (PDS)
  • PCR reactions is carried out in 50 ⁇ L aliquots containing about 200 ng genomic DNA, 5 ⁇ L of 10 X DyNAzymeTM II buffer (Finnzymes Oy, ESPOO, Finland), 1.5 U of DyNAzymeTM II DNA polymerase (Finnzymes Oy, ESPOO, Finland), 5 ⁇ L of 2.5 mM of each dNTP(s) (Roche Diagnostics, GmbH), and 35 pmol of each primer, in sterile distilled water.
  • the mixture is denatured for 3 min at 94 0 C and amplified for 35 cycles (94 0 C for 30 s, 51° C (DNA segments A and C) or 57° C (segments B and D) for 30 s, 72 0 C for 1 min) with a final cycle of 7 min at 72 0 C.
  • the PCR products (15 ⁇ L) are loaded directly onto 1% (w/v) agarose gels to verify single bands.
  • the remaining PCR products are purified using the QIAquick PCR Purification Kit ® (Qiagen, Hilden, Germany) according to the manufacturer's instructions, and sequenced to confirm the integration of the TM T-DNA.
  • Putative algae or cyanobacteria cells are cultured in a solution of 100 ⁇ M fluridone in standard algae or cyanobacteria culture media and cultured in high light. At this concentration, all non-transgenic cells are bleached and eventually die.
  • transgenic TM algae or cyanobacteria are used to compete with natural species in simulated conditions. 1000 transgenic cells per ml are pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots are removed initially at daily, and later at weekly intervals, and plated on dishes with and without fluridone. The dwindling proportion of fluridone resistant colonies are counted.
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is to have cells incapable of phototactic/chemotactic or thermotactic motility such that they cannot swim in a direction that is optimal survival (such as odal-12 mutant for Chlamydomonas and the PUT accession NC_010475 for cyanobacteria).
  • Such strains do not need motility to exist in continually mixed high cell density bioreactors and ponds, but cannot compete with native organisms in a natural ecosystem, where they must ' be able to swim towards optimal light and away from danger.
  • a construct was made containing a PPO (protoporphyrinogen oxidase) gene ( DQ3861 14) (SEQ ID NO: 32) conferring pyrazoxyfen herbicide resistance (and other PPO related herbicides) as the primary desirable gene, in the background of the odal2-l mutant in algae or in tandem to the PiIT gene (SEQ ID NO:33) (NC_010475) from cyanobacteria conferring non swimming as a mitigator, and used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942,
  • the odal2-l mutant lacks the entire LC2 + LClO genes. This strain exhibits a flagellar beat frequency that is consistently less than that observed for strains that fail to assemble the entire outer arm and docking complex (Tanner 2008). Therefore the PPO herbicide resistant construct is transformed in the background of the odal2-l mutant .
  • the PPO herbicide resistant sequence ( Patzoldt 2006) is synthesized using the published sequence ( DQ386114) (SEQ ID NO:32) with modifications according to the codon usage of the green algae C. reinhardtii.
  • the gene is cloned into pGEM-T vector (Promega) and then transferred into pSP124S (Sizova et al. 2001) under the control of the RbcS2 promoter and 3 ' RbcS2 terminator.
  • Fig. 1 1.
  • RNAi or antisense constructs directed against dynein heavy/light chains in tandem with the PPO herbicide resistant gene under the control of the RbcS2 promoter and 3 ' RbcS2 terminator in the pSP124S vector.
  • Algae cells in 0.4 ml of growth medium containing 5% PEG6000 are transformed with plasmid from examples 1 and 2 (l ⁇ 5mg) by the glass bead vortexing method (Kindle 1990) or electroporation (Chow and Tung 1999).
  • the transformation mixture is then transferred to 10 ml of non-selective growth medium for recovery.
  • the cells are kept for at least 18 h at 25° C in the light. Cells are collected by centrifugation and plated at a density of 10 8 cells per 80 mm plate.
  • the PPO herbicide resistant gene (Patzoldt 2006) is chemically synthesized using the published sequence (DQ386114) (SEQ ID NO:32) with modifications according to the codon usage of Synechococcus PCC7002 (SEQ ID NO:35) and with the addition of BamHI restriction sites in its both ends.
  • the gene is cloned into pGEM-T vector (Promega) and then transferred into the BamHI site of pCB4 plasm id
  • Synechococcus PCC7002 PUT gene is amplified using the forward primer: ATGGATTACATGATCGAAGA (SEQ ID NO:36) and the reverse primer: GCGACGTTTTGCGGTTGGGC (SEQ ID NO:37) followed by cloning into pGEM-T plasmid (Promega). The fragment is then excised from the pGEM-T plasmid and cloned into the shuttle vector pCB4 in an antisense orientation downstream to the PPO herbicide resistant gene.
  • Synechococcus PCC7002 cells are cultured in 100 ml of ASN-III liquid medium at 28°C under white fluorescent light and subcultured at the mid-exponential phase of growth.
  • donor DNA in 10 mM Tris/1 mM EDTA, pH 8.0
  • For selection transformants were grown on fresh TAP agar plates containing 10 mM pyrazoxyfen, for 7-10 days at 30 0 C.
  • Conditions are modified for each organism according to its needs, based on modifications of standard protocols. Surviving cells are then transferred for future culturing and further examination.
  • Genomic DNA is isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA is isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.).
  • Reverse primer (SEQ ID NO:39) CGGTCTTCTCATCCATCTTC And the following primers for cyanobacteria: Forward primer: CTGG ACTCTC ATATATACGT
  • Reverse primer C AACCGC AAAACGTCGCTAA (SEQ ID NO 41) from PUT In vivo PPO assay.
  • Putative transformed algal or cyanobacterial cells were cultured in a solution of 10 mM pyrazoxyfen in standard algae or cyanobacteria culture media. At this concentration, all non-transgenic cells are killed.
  • transgenic TM algae or cyanobacteria are used to compete with natural species in simulated conditions. 1000 transgenic cells per ml are pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots are removed initially at daily, and later at weekly intervals and plated out, and the dwindling proportion of colonies that fluoresce in blue light are counted.
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is using an antisense or RNAi form of starch synthesizing genes that confer non-storage of starch (such as stal, GenBank Accession: XM OO 1693395) coupled to genes encoding enzymes responsible for the synthesis of polysaccharides such a inulin (such as 1-SST and 1-FFT, AJ009757, AJ009756) or levan (such as SacB from Bacillus subtilis (NC 000964) or Bacillus amyloliquifaciens (NC_009725) or levan sucrase gene from Erwinia amylovora (AJ831832) or ftf gene from Streptococcus mutans, NC 004350) or graminan, a highly branched levan found in wheat, barley and other graminae that the algae or cyanobacteria are capable of storing but are incapable of mobilizing in times of need.
  • Such strains can live only in bioreactors and ponds, where other traits are separately used to prevent the establishment of competing organisms.
  • Rare algae or cyanobacteria introgressing the TM construct in natural ecosystems could also no longer compete with native organisms in the natural ecosystems.
  • the merA SEQ TD NO:64; NC_002134
  • merB genes SEQ ID NO:65,U77087 conferring mercury resistance are used as the primary desirable genes
  • a tandem construct is made containing the above starch reducing/inulin over-producing genes as a mitigator and used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp., lsochrysis
  • reinhardtii stal gene encodes for AGPase large subunit (which are later used together with the merA and merB genes conferring mercury resistance),
  • the primer for stal is: GCTCTAGAGCATGC TGTTAATGGCGACGCCTGG (SEQ ID NO: 42), and primer: GC GGATCCAAGCTT GAACCACTCCTTGTCGGTGG (SEQ ID NO:43) containing the Xbal+Sphl and BamHI+Hindlll restriction in their 5' flanking region are used for amplification of exons number 2,3,4 and introns 2,3 (597-1649 gDNA) of C.
  • reinhardtii stal gene (SEQ ID NO: 67) using gDNA (genomic DNA) as a template and exons 2,3,4 (40-504 CDS) of C. reinhardtii staicDNA using cDNA as template.
  • the 1053 bp genomic fragment was cloned into pSTBlue-1 (Novagene) in Sphl/BamHI restriction sites and the 465 bp cDNA fragment is cloned into Hindlll/Xbal sites of the same pSTBlue-1 plasmid in antisense orientation downstream to the sense genomic sequence.
  • the stal RNAi cassette is then excised from pSTBlue-1 by Xbal digestion and cloned into the corresponding site of pSP124s, in the ble 3'UTR. Then a de novo synthesized merA and merB is synthesized according to the appropriate codon usage of the desired algae, each cloned under the control of rbcS2 promoter and terminator, is introduced into the same plasmid replacing the ble selectable marker, upstream to the stal RNAi cassette (Fig. 8A).
  • a construct including genes encoding enzymes responsible for the synthesis of inulin (such as Helianthus tuberosus ISST (SEQ ID NO: 44) and 1-FFT (SEQ ID NO:45); AJ009757, AJ009756, respectively ) or levans,such as SacB from Bacillus subtilis (NC 000964) (SEQ ID NO:69)or Bacillus amyloliquifaciens (NC 009725) or levan sucrase gene from Erwinia amylovora (AJ831832) orftfgene from Streptococcus mutans, NC_004350) the coding sequence of each gene is de novo synthesized according to the appropriate codon usage of the desired algae and cloned under the control of rbcS2 promoter and terminator.
  • enzymes responsible for the synthesis of inulin such as Helianthus tuberosus ISST (SEQ ID NO: 44) and 1-FFT (SEQ ID NO:45); AJ009757,
  • the tandem construct is introduced into the pSP124s plasmid downstream to the ble 3'UTR (Fig. 8B). Co-transformation of the two plasmids into Chlamydomonas reinhardtii is analyzed using inverse PCR with specific primers (arrows indicates primers positions in Figs. 8A and B).
  • glgC glucose- 1 -phosphate adenyltransferase
  • Prime ⁇ GTGTGTTGTTGGCAATCGAG SEQ ID NO:46
  • PrimerCTAGATTACCGTGCCGTCGG SEQ ID NO:47
  • Genomic DNA is isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA is isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad, Calif.).
  • the DNA is analyzed by inverse PCR as described by Ochman et al., 1998, for the presence of intact tandem linked merA, merB, and 1-FFT, ISST genomic inserts.
  • Two different DNA segments within the genomic TM T-DNA insert are amplified over the positions indicated in Fig. 8 with the following primers: Forward primer 1 (SEQ ID NO:48): TCTCATCGCATTGCGCTGCA (merB) Reverse primer 1 (SEQ ID NO:49): CCAACTTTCCTGGAACCCGC (merA) forward primer 2 (SEQ ID NO: 50): CACGTTTAGTTCCCATGATC (FFT-I) Reverse primer 2 (SEQ ID NO: 51 ⁇ CAAGCGTGGAACACATCTAC (SST-I)
  • PCR products are purified using the QIAquick PCR Purification Kit ® (Qiagen, Hilden, Germany) according to the manufacturer's instructions, and sequenced to confirm the integration of the TM T-DNA.
  • QIAquick PCR Purification Kit ® Qiagen, Hilden, Germany
  • In vivo starch assay Mercury resistant transgenic algae or cyanobacteria cells from numbered colonies of picked cells are cultured in 96-well dishes in standard algae or cyanobacteria culture media such that single cells develop into cultures. When cultures are dense, they are bleached with DMSO as in Example 3, and then stained for the absence of starch with iodine / potassium iodide solution.
  • transgenic TM algae or cyanobacteria are used to compete with natural species in simulated conditions. 1000 transgenic cells per ml are pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots are removed initially at daily, and later at weekly intervals, and the dwindling proportion of yellow green colonies are counted. Aliquots at the same dilutions were plated in parallel on the same media, but containing 10 ⁇ M PMA.
  • One of the traits suitable for Transgenic Mitigation in constructs with a primary, desirable trait is to have cells incapable of phototactic/chemotactic or thermotactic motility such that they cannot swim in a direction that is optimal survival (such as odal-12 mutant for Chlamydomonas and the PUT NC Ol 0475 for cyanobacteria). Such strains do not need motility to exist in continually mixed high cell density bioreactors and ponds, but cannot compete with native organisms in a natural ecosystem, where they must be able to swim towards optimal light and away from danger.
  • a tandem construct was made containing a BFP- blue fluorescing protein (SEQ ID NO:53) that converts cell damaging near ultraviolet light to blue light that can be used in photosynthesis, and the odal2-l mutant in algae / PiIT gene in cyanobacteria conferring non swimming as a mitigator (NC Ol 0475), and used to transform Synechococcus PCC7002, Phaeodactylum tricornutum, Nannochloropsis sp CS 246, Nannochloropsis oculata, Nannochloropsis salina, Pavlova lutheri CS 182, Synechococcus PCC7942, Synechosystis PCC6803, Chlamydomonas reinhardtii, Chlorella vulgaris, Chlorella ssp.
  • SEQ ID NO:53 BFP- blue fluorescing protein
  • the odal 2-1 mutant lacks the entire LC2 + LClO genes. This strain exhibits a flagellar beat frequency that is consistently less than that observed for strains that fail to assemble the entire outer arm and docking complex (Tanner 2008). Therefore the BFP-azurite construct is built in with the background of the odal 2-1 mutant.
  • the BFP-azurite construct sequence (Mena et al. 2006) is chemically synthetized using the published sequence with modifications according to the codon usage of the green algae C. reinhardtii (SEQ ID NO:54).
  • RNAi or antisense constructs directed against dynein heavy/light chains in tandem with the BFP-blue fluorescing protein gene under the control of the RbcS2 promoter and 3 ' RbcS2 terminator in the pSP124S vector.
  • Algae cells in 0.4 ml of growth medium containing 5% PEG6000 are transformed with plasmid from examples 1 and 2 (l ⁇ 5mg) by the glass bead vortexing method (Kindle 1990) or electroporation (Chow and Tung 1999).
  • the transformation mixture is then transferred to 10 ml of non-selective growth medium for recovery.
  • the cells are kept for at least 18 h at 25° C in the light. Cells are collected by centrifugation and plated at a density of 10 8 cells per 80 mm plate.
  • Transformants are grown on fresh TAP agar plates for 7 days in 30° C. For selection, transformants are grown on fresh TAP agar plates for 7 days at 30° C.
  • Colonies are transferred to micro-well plates at a dilution of 1-2 cells per microwell using medium, and cultured under UV light until it is apparent that there cells growing in most wells.
  • BFP fluorescence is monitored at excitation of 383 nm and emission of 450 nm.
  • DsRed and any other FP used are monitored with their specific excitation and emission spectra.
  • Cells from microwells producing the highest fluorescent signal are collected and cultured as single cell colonies under UV light (duration and intensity are set at LD 99% of wild type cells). Surviving cells are then transferred for future culturing and further examination.
  • the BFP-azurite sequence (Mena et al. 2006) is chemically synthesized using the published sequence (SEQ ID NO:52) with modifications according to the codon usage of Synechococcus PCC7002 (SEQ ID NO:55) and with the addition of BamHI restriction sites in its both ends.
  • the gene is cloned into pGEM-T vector (Promega) and then transferred into the BamHI site of pCB4 plasmid (Deng and Coleman, 1999) downstream to the Synechococcus rbcLS promoter and upstream to antisense of PUT gene (SEQ ID NO:53), followed by rbcLS terminator.
  • the coding sequence of Synechococcus PCC7002 PUT gene is amplified using the forward primer: ATGGATTACATGATCGAAGA (SEQ ID NO:58) and the reverse primer: GCGACGTTTTGCGGTTGGGC (SEQ ID NO:59) followed by cloning into pGEM-T plasmid (Promega). The fragment is then excised from the pGEM-T plasmid and cloned into the shuttle vector pCB4 in an antisense orientation downstream to the BFP gene ( Fig. 11).
  • Synechococcus PCC7002 cells are cultured in 100 ml of ASN-III liquid medium at 28°C under white fluorescent light and subcultured at the mid-exponential phase of growth.
  • donor DNA in 10 mM Tris/1 mM EDTA, pH 8.0
  • transformants are grown on fresh TAP Agar plates for 7 days at 30° C.
  • Colonies are transferred to micro-well plates at a dilution of 1-2 cells per microwell using medium, and cultured with a 16/8 h light/dark period under white fluorescent light at 30° C until it is apparent that there cells growing in most wells.
  • BFP fluorescence is monitored at excitation of 383 nm and emission of 450 nm.
  • DsRed and any other FP used are monitored with their specific excitation and emission spectra.
  • Cells from microwells producing the highest fluorescent signal are collected and cultured as single cell colonies under UV light (duration and intensity are set at LD 99% of wild type cells). Surviving cells are then transferred for future culturing and further examination.
  • Genomic DNA is isolated using either Stratagene's (La Jolla, Calif.) DNA purification kit or a combination of QIAGEN's (Valencia, Calif.) DNeasy plant mini kit and phenol chloroform extraction (Davies et al. 1992).
  • Total RNA is isolated using either QIAGENS's Plant RNeasy Kit or the Trizol Reagent (Invitrogen, Carlsbad,
  • the DNA is analyzed by PCR for the presence of intact tandemly linked BFP- blue fluorescing protein gene and PUT gene in an antisense orientation.
  • Four different DNA segments within the genomic TM T-DNA insert are amplified over the positions indicated in Fig. 11 with the following primers for algae:
  • Reverse primer CAACCGCAAAACGTCGCTAA (SEQ ID NO 63) from PUT In vivo UV resistance assay.
  • Putative algae or cyanobacteria cells are plated on Petri dishes and placed in a box where the sole irradiation is near UV light. Green colonies that develop are expected to contain the BFP gene.
  • In vivo motility assay Picked UV resistant algae or cyanobacteria cells are placed on a microscope slide and observed. The slide is then unilaterally illuminated and movement towards or away from the light (depending on intensity) is observed in wild type but not mutant cells . Competition of TM transgenics with the wild type algae and cyanobacteria
  • transgenic TM algae or cyanobacteria are used to compete with natural species in simulated conditions. 1000 transgenic cells per ml are pipetted into unfiltered sea water in aquaria and cultivated in 100 ⁇ Ein per cm 2 per sec light fluence, to simulate light conditions in the sea at a nominal depth. Aliquots are removed initially at daily, and later at weekly intervals and plated out, and the dwindling proportion of colonies that fluoresce in blue light are counted.
  • Wassilewskija ecotype defines a role for phytochrome D in red/far-red light sensing. Plant Cell 9: 1317-1326. Avraham T, B ad an i H, Galili S, Amir R (2005) Enhanced levels of methionine and cysteine in transgenic alfalfa (Medicago sativa L.) plants over-expressing the
  • Arabidopsis cystathionine gamma-synthase gene Plant Biotechnol J 3: 71-79 Azpiroz, R., Y. Wu, J. C. LoCascio and K.A. Feldmann., 1998. An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. Plant Cell 10: 219-
  • the DWF4 gene of Arabidopsis encodes a cytochrome P450 that mediates multiple
  • Herbicide-Resistant Crops Decision Trees for Assessment. Plant Breeding Rev. ,
  • Arabidopsis cDNA encoding a sterol-C24-methyltransferase in tobacco modifies the ratio of 24-methyl cholesterol to sitosterol and is associated with growth reduction.
  • the first step of gibberellin biosynthesis in pumpkin is catalyzed by at least two copalyl diphosphate synthases encoded by differentially regulated genes. Plant Physiol. 1 18: 141 1-
  • Arabidopsis COPl reveals specific roles of its three structural modules in light control of seedling development. EMBO J. 17:5577-5587. Turner, C. E., 1988. Ecology of invasions by weeds. Weed Management in
  • Arabidopsis thaliana encodes ent-kaurene synthase of gibberellin biosynthesis.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Catching Or Destruction (AREA)

Abstract

La présente invention concerne un mécanisme génétique destiné à limiter les effets de l’introgression d’un trait génétique conçu génétiquement d’algues cultivées ou de cyanobactéries vers sa forme sauvage ou vers une espèce indésirable croisée. L’invention concerne également la prévention de l’établissement des algues transgéniques ou de cyanobactéries dans des écosystèmes naturels.
EP09811866A 2008-09-05 2009-09-08 Prévention de manière transgénique de l établissement et de la propagation d algues transgéniques dans des écosystèmes naturels Withdrawn EP2384366A4 (fr)

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
US19116708P 2008-09-05 2008-09-05
US19116908P 2008-09-05 2008-09-05
US19145308P 2008-09-09 2008-09-09
US19244708P 2008-09-18 2008-09-18
US12/322,686 US20090215179A1 (en) 2001-07-20 2009-02-05 Transgenically preventing establishment and spread of transgenic algae in natural ecosystems
US27460809P 2009-08-19 2009-08-19
PCT/US2009/005067 WO2010027516A2 (fr) 2008-09-05 2009-09-08 Prévention de manière transgénique de l’établissement et de la propagation d’algues transgéniques dans des écosystèmes naturels

Publications (2)

Publication Number Publication Date
EP2384366A2 true EP2384366A2 (fr) 2011-11-09
EP2384366A4 EP2384366A4 (fr) 2012-10-24

Family

ID=41797734

Family Applications (1)

Application Number Title Priority Date Filing Date
EP09811866A Withdrawn EP2384366A4 (fr) 2008-09-05 2009-09-08 Prévention de manière transgénique de l établissement et de la propagation d algues transgéniques dans des écosystèmes naturels

Country Status (2)

Country Link
EP (1) EP2384366A4 (fr)
WO (1) WO2010027516A2 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8835137B2 (en) 2008-12-23 2014-09-16 Matrix Genetics, Llc Modified photosynthetic microorganisms with reduced glycogen and their use in producing carbon-based products
WO2011127069A1 (fr) 2010-04-06 2011-10-13 Targeted Growth, Inc. Micro-organismes photosynthétiques modifiés pour la production de lipides
MX2013015327A (es) 2011-06-30 2014-01-31 Exxonmobil Res & Eng Co Regulacion de genes toxina y antitoxina para contencion biologica.
EP3794017A4 (fr) 2018-05-17 2022-03-09 Lumen Bioscience, Inc. Plate-forme d'administration de vaccin oral d'arthrospira platensis
US12252513B2 (en) 2018-07-16 2025-03-18 Lumen Bioscience, Inc. Thermostable phycobiliproteins produced from recombinant arthrospira
AU2020298626A1 (en) 2019-07-03 2022-02-24 Lumen Bioscience, Inc. Arthrospira platensis non-parenteral therapeutic delivery platform
AU2023247269A1 (en) * 2022-04-01 2024-10-24 Entozyme Pty Ltd Transgenic animals for mercury bioremediation

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2180050B1 (fr) * 1998-05-07 2016-04-20 Universite Libre De Bruxelles Confinement biologique à base de cytotoxine
US7612255B2 (en) * 1999-02-03 2009-11-03 Jonathan Gressel Transgenic plants for mitigating introgression of genetically engineered genetic traits
FI19992659A7 (fi) * 1999-12-10 2001-06-11 Unicrop Ltd Prosessi kaksisirkkaisten siementen varastoravintoaineiden muuttamiseksi yhden tai useamman geenituotteen sisältäviksi aineosiksi
US20070148166A1 (en) * 2002-05-13 2007-06-28 Wu Madeline C S Scfvs in photosynthetic microbes
CN1926238A (zh) * 2004-02-27 2007-03-07 陶氏化学公司 植物细胞中的高效肽生产
US7745696B2 (en) * 2006-06-12 2010-06-29 The Regents Of The University Of California Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae
US9637714B2 (en) * 2006-12-28 2017-05-02 Colorado State University Research Foundation Diffuse light extended surface area water-supported photobioreactor

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
MAKINO AMANE ET AL: "Does decrease in ribulose-1,5-bisphosphate carboxylase by antisense RbcS lead to a higher N-use efficiency of photosynthesis under conditions of saturating CO-2 and light in rice plants?", PLANT PHYSIOLOGY, AMERICAN SOCIETY OF PLANT PHYSIOLOGISTS, ROCKVILLE, MD, US, vol. 114, no. 2, 1 January 1997 (1997-01-01), pages 483-491, XP002540220, ISSN: 0032-0889 *
PARRY M A J ET AL: "Manipulation of Rubisco: the amount, activity, function and regulation", JOURNAL OF EXPERIMENTAL BOTANY, OXFORD UNIVERSITY PRESS, GB, vol. 54, no. 386, 1 May 2003 (2003-05-01), pages 1321-1333, XP002599744, ISSN: 0022-0957, DOI: 10.1093/JXB/ERG141 [retrieved on 2003-03-14] *
See also references of WO2010027516A2 *

Also Published As

Publication number Publication date
WO2010027516A3 (fr) 2010-05-27
EP2384366A4 (fr) 2012-10-24
WO2010027516A2 (fr) 2010-03-11

Similar Documents

Publication Publication Date Title
US20090215179A1 (en) Transgenically preventing establishment and spread of transgenic algae in natural ecosystems
US12428650B2 (en) Corn event 5307
EP1737290B1 (fr) Mais mir604
US20110045593A1 (en) Transgenically mitigating the establishment and spread of transgenic algae in natural ecosystems by suppressing the activity of carbonic anhydrase
Vieira et al. Expression of a cystatin transgene can confer resistance to root lesion nematodes in Lilium longiflorum cv.‘Nellie White’
WO2010027516A2 (fr) Prévention de manière transgénique de l’établissement et de la propagation d’algues transgéniques dans des écosystèmes naturels
WO2022235606A1 (fr) Molécules d'acide nucléique pour conférer des propriétés insecticides à des plantes
Van der Merwe Attempting to enhance sugarcane growth through genetic modification
Zhu et al. Genomic integration, functional expression and genetic inheritance of three potato late blight resistance genes in cv Desiree provided through a single T-DNA

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20110726

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/82 20060101ALI20120718BHEP

Ipc: C12P 21/06 20060101AFI20120718BHEP

Ipc: C12N 15/74 20060101ALI20120718BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20120924

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/74 20060101ALI20120918BHEP

Ipc: C12N 15/82 20060101ALI20120918BHEP

Ipc: C12P 21/06 20060101AFI20120918BHEP

17Q First examination report despatched

Effective date: 20131009

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140423