Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
  • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/158—Expression markers

Definitions

• the present invention relates to the field of diagnosing Parkinson's disease in a subject.
• the present invention essentially relates to a method for detecting the differential expression of a set of molecular markers that is associated with the presence or risk of developing Parkinson's disease, and in particular a sporadic form of this disease.
• Parkinson's disease is a common neurodegenerative disease characterized by degeneration of neurons of the nigrostriatal axis and following a slow and irreversible progression. The average age of diagnosis of the disease is around 57, at a time when individuals are still working. Parkinson's disease is the second neurodegenerative disease after Alzheimer's disease and affects about 2% of the population of industrialized countries beyond 65 years. The prevalence of this disease increases with the age of the population and the current demographic evolution.
• hereditary forms also called familial forms
• familial forms have been identified during the last ten years and are currently being studied. These family forms account for between 5 and 15% of cases. They have an autosomal dominant or recessive mode of transmission. More than 13 lods were linked to the disease and the inventors identified a new locus on chromosome 3 in a familial form of autosomal dominant inheritance.
• the gene of this locus responsible for the disease is involved in the mRNA translation mechanism and is called EIF4G1. It is in addition to the 10 other genes already described in Parkinson's disease carrying deleterious mutations, here the most frequently mutated genes.
• the parkin gene (PARK2 or PRKN) is responsible for 50% of early forms (development of symptoms before age 40) of the disease.
• mutations of this gene represent only 0.4% of all cases.
• the most common mutations occur in the autosomal dominant forms and concern the SNCA (alpha-synuclein), SCA2 and especially LRRK2.
• the latter is thought to be responsible for 3% of Caucasian familial forms and about 1% of sporadic cases of the disease. In rare cases, this proportion can reach 18% of patients in some Arab-North African populations and 39% of Ashkenazi Jewish populations. These high percentages are related to cultural habits and a significant percentage of consanguinity.
• the LRRK2 gene encodes a kinase that occurs at a metabolic junction in different parkinsonian syndromes and related diseases (synucleopathies and tauopathies, which are characterized by aggregates of alpha-synuclein and Tau proteins respectively).
• This connection between parkinsonian syndromes and other neurodegenerative diseases is also illustrated by the mutations affecting the SCA2 gene; some mutations are responsible for a typical Cerebellar Ataxia (SCA2-C) while others give rise to Parkinson's disease (SCA2-P).
• the SNCA gene codes for alpha-synuclein which can aggregate and form inclusions like Lewy bodies; its abnormal aggregation characterizes the family of diseases called synucleopathies including Parkinson's Disease, Lewy Body Dementia (DLB), and Multi-Systemic Atrophy (MSA).
• synucleopathies including Parkinson's Disease, Lewy Body Dementia (DLB), and Multi-Systemic Atrophy (MSA).
• Parkinson's disease is made only by the insidious onset of asymmetrical symptoms that have progressed slowly for several years. There is no diagnosis at the early stage of the disease. At this stage, we often speak of Parkinson's syndromes. Indeed, the development of DLB or MSA for example can mimic Parkinson's disease or the onset of this disease.
• Parkinson's syndrome is present in Parkinson's disease but can also be found in other conditions such as DLB, some forms of MSA and Supra Nuclear Progressive Palsy (PSP) ...
• Parkinson's disease stands out among others Parkinson's syndromes by a fourth cardinal sign: postural instability of late onset and positive response to levodopa (L-dopa) treatment. Most people with Parkinson's Syndrome have resistance to this treatment.
• L-dopa levodopa
• several exclusion criteria have been defined in order to establish the diagnosis of Parkinson's disease.
• a definite diagnosis holds the four cardinal criteria (bradykinesia / akinesia, resting tremor, stiffness, postural instability) and confirmation by autopsy.
• a probable diagnosis uses three criteria on the four previous ones, often with additional prospective criteria. Indeed, this diagnosis based on clinical arguments is difficult to establish with certainty, especially at the early stage of the disease because of the similarity of symptoms between Parkinson's disease and Parkinson's syndromes. As a result, most of the scientific studies carried out employ strict criteria for the diagnosis of Parkinson's disease, taking into account three of the four criteria including bradykinesia and the positive response to levodopa and the absence of the 16 exclusion criteria defined by Hughes ⁇ above).
• a possible diagnosis usually begins with two of the four cardinal signs of the disease, the criterion of bradykinesia being required to hold the diagnosis as possible.
• Unified / Parkinson's Disease Rating Scale is the most widely used by clinicians. This scale is an objective assessment of the severity, fluctuation and progression of clinical symptoms and their impact on the patient's daily life. This scale is not essential for diagnosis and follow-up but may be necessary for certain therapeutic decisions, particularly surgical decisions.
• This multidimensional scale has four parts to which they are assigned scores:
• the UPDRS scale includes, in addition to these four parts, a patient ranking according to the Hoehn scale and Yahr (HY).
• the HY scale has 8 stages (Table 1) that estimate the severity of Parkinson's disease in a patient.
• Parkinson's disease is therefore complex and can be called into question during the evolution of the disease. There is currently no specific biological signature of Parkinson's disease that can diagnose or predict development of this early stage disease.
• the provision of an effective and simple diagnostic test, for an early stage, would enable patients to be treated early in their illness and thus benefit from a more effective treatment, more adapted to their needs. and offer them neuroprotective strategies.
• the present invention provides solutions to these needs.
• a tool is available to detect the presence or risk of developing this disease, even in asymptomatic or pauci-symptomatic subjects, or to confirm a diagnosis in patients with symptoms.
• the invention also makes it possible to identify patients with Parkinson's syndrome from those with Parkinson's disease.
• the international application published under number WO2006 / 050475 describes a method for diagnosing neurodegenerative diseases from a blood sample in which the expression of one or more genetic markers is measured and then compared with that of said marker (s) ( s) in a healthy subject to determine if the subject has a neurodegenerative disease.
• a list of 8 genes would differentiate subjects at risk of developing a sporadic form of Parkinson's disease.
• the familial criterion has been excluded from the diagnosis of Parkinson's disease. Indeed, the authors seek to identify molecular markers that would be involved in the development of this disease whose etiology is unknown. Family hereditary forms do not fit into this definition since, in essence, their cause is known; the development of the disease being linked to the presence of a mutation. It is generally accepted by the scientific community that each carrier of pathogenic mutation develops a particular case (a variant) of Parkinson's disease. Indeed, a pathogenic mutation of a gene will generate a gain or loss of function of the encoded protein.
• each mutated gene will result in a distinct form of disease in relation to another mutated gene in the sense that it only highlights a small part of the potentially important mechanisms for understanding all cases. of the disease.
• the role of environmental factors is preponderant for the occurrence of sporadic cases and that familial forms account for only 5 to 15% of the total forms of Parkinson's disease.
• SNCA, LRRK2, SCA2 and PRKN gene mutations account for less than 2% of all cases. Family forms are thus rare forms appearing at an often early age (often before 40 years) while sporadic forms are observed to develop later (on average after 57 years).
• the method devised by the inventors based on the set of genes whose expression is deregulated in familial forms due to rare mutations in the general Caucasian population makes it possible to identify subjects suffering from Parkinson's disease presenting with or not symptoms with a low error rate.
• the method according to the invention makes it possible to determine the presence or the risk of developing Parkinson's disease with an error rate of less than or equal to 30%, and in particular to identify sporadic cases of this disease.
• the diagnostic criteria for Parkinson's disease according to the invention are based on those accepted in the field by the French Federation of Neurology, National Agency for Accreditation and Health, 2000. Specifically, the cumulative criteria 1) 2) and 3 ) were used:
• bradykinesia which is necessarily part of one of the 3 cardinal signs used for diagnosis
• subject with a familial or hereditary form or family case means any subject carrying a deleterious mutation linked to Parkinson's disease and at least one other member of his family suffering from this disease.
• family history is that defined in Hughes et al., 1992 (supra).
• asymptomatic subject means any subject suffering from a hereditary or sporadic form having no symptoms of Parkinson's disease.
• pauci-symptomatic subject person with mild disorders but insufficient to make a diagnosis of Parkinson's disease according to the diagnostic criteria mentioned above.
• symptomatic subject a person who has developed Parkinson's disease whose symptoms are visible and unequivocal to make a diagnosis according to these same criteria.
• Parkinson's disease the silent phase (asymptomatic subject) and the symptomatic pauci phase of the disease.
• deregulated expression or deregulated genes is meant any gene whose level of expression in a subject is increased or decreased compared to that of a control subject.
• the expression variation threshold considered significant depends on each comparison technique. For example, for cDNA microarray analysis, an expression variation threshold of at least 1.2 with a Welch T-test during Volcano plot filtering is conventionally considered significant. Thus, a person skilled in the art is able to determine the expression variation threshold to be taken into account as a function of the detection and expression comparison technique used.
• mutation is understood to mean any genetic disorder consisting of the replacement of a nucleotide base, the deletion of one or more nucleotide base (s), the deletion or the multiplication of exons. or regulatory sequences (1, 2, 3 or advantages of copies of exons or regulatory sequences), etc., but also variations in the number of gene copies such as the presence of a copy (deletion), d a copy number greater than 3 (duplication) or 4 copies (triplication) or more than one chromosomal region.
• the present invention therefore relates to a method for detecting in a biological sample to be tested the differential expression of a set of molecular markers associated with the presence or risk of developing Parkinson's disease, characterized in that it includes the following steps: (al) in vitro extraction of molecular markers from the biological sample to be tested, (a2) in vitro extraction of molecular markers from biological samples of subjects with different familial forms of Parkinson's disease, subjects with other neurodegenerative diseases or parkinsonian syndromes and healthy subjects, b) determine all the molecular markers whose expression is significantly deregulated in common in subjects with different familial forms, whatever the stage of the disease, but whose expression is not is not significantly deregulated in subjects with other neurodegenerative diseases or parkinsonian syndromes, compared to that measured in healthy subjects, c) verify that the expression of all these molecular markers is well deregulated in the sample to test.
• the originality of the present invention therefore lies in the use of data
• the major advantage of the method according to the invention is to be able to detect the presence or the risk of developing a sporadic form of Parkinson's disease.
• the distinction between a family form and a sporadic form of Parkinson's disease will be determined on the basis of information already available about other family members (ie whether at least one other the family has already developed or not the disease).
• the implementation of the present invention also makes it possible to determine the presence of Parkinson's disease even in persons with asymptomatic forms of the disease.
• the method according to the invention makes it possible to determine the presence or the risk of developing Parkinson's disease with an error rate of less than or equal to 30%.
• Patients with different familial forms of Parkinson's disease are referred to as patients with at least one member of their family with Parkinson's disease.
• Significantly deregulated gene expression data in subjects with familial forms of Parkinson's disease may in particular be derived from patients with different familial forms, and preferably carriers of mutations in the SNCA gene and / or patients carrying mutations in the PRKN gene and / or patients carrying mutations in the SCA2 gene and / or patients carrying mutations in the LRRK2 gene.
• the gene expression data come from subjects suffering from the four familial forms, each of which is caused by mutation in the SNCA, PRKN, SCA2 and LRRK2 genes respectively.
• the expression data of the deregulated genes are in particular derived from patients carrying a mutation in the LRRK2 gene, the patients preferably have the G2019S mutation.
• the expression data of the deregulated genes are in particular derived from patients carrying mutations responsible for Parkinson's disease in the SNCA gene, these patients preferably have a multiplication of the SNCA gene, and preferably a duplication of the SNCA gene. .
• the patients when the expression data of the deregulated genes are in particular derived from patients carrying a mutation in the SCA2 gene, the patients preferably have a mutation of 39 interrupted CAG / CAA repeat triplet type.
• the patients when the expression data of the deregulated genes are in particular derived from patients carrying a mutation in the PRKN gene, the patients preferably have a homozygous type mutation or a composite heterozygous mutation Trp445stop or ex3.4dupl or ex6del /c.l385insA or ex6dupl / c.225delA.
• the expression data of the deregulated genes in subjects suffering from other neurodegenerative diseases or parkinsonian syndromes may in particular be obtained from patients with different neurodegenerative diseases or different parkinsonian syndromes such as Spino-Cerebellar Ataxia (SCA). ), MSA, DLB, PSP, amyotrophic lateral sclerosis (ALS), and in particular these expression data come from both patients with ACS, patients with ASM and patients with DLB. More particularly, these expression data come from patients with ACS, MSA patients, DLB patients, PSP patients, and ALS patients.
• SCA Spino-Cerebellar Ataxia
• MSA MSA
• DLB DLB
• PSP amyotrophic lateral sclerosis
• ALS amyotrophic lateral sclerosis
• the set of biological markers whose expression is deregulated consists of the markers that are common to at least 1 patient carrying a multiplication of the SNCA gene, at least 4 patients carrying a mutation.
• the PRKN gene at least 6 parkinsonian patients carrying a mutation in the SCA2 gene and at least 9 patients carrying a mutation in the LRRK2 gene (in the case of patients with familial forms) and not at least 6 patients with SCA, at least 1 patient with MSA and at least 4 patients with DLB (for patients with other neurodegenerative diseases or parkinsonian syndromes).
• the biological sample that is used in the context of the present invention consists more particularly of any material from the patient, which may contain a biological marker that can detect the expression of a gene or its product.
• the biological sample may be a biological fluid (whole blood, serum, saliva, smears of the mucous membranes, circulating cells of the patient (blood or immune, such as platelets or mononuclear blood cells). or a tissue such as skin or cells derived from the skin such as fibroblasts, cells derived from muscle, hair, or hair), as long as it contains molecular markers that may reflect the expression of genes for example, such as RNAs or proteins.
• the biological sample from the person to be tested is same type as that which is derived from the reference subjects (subjects with different familial forms of Parkinson's disease, subjects with other neurodegenerative diseases or parkinsonian syndromes and healthy subjects).
• the biological sample used in the context of the method according to the invention preferably consists of mononuclear cells derived from whole blood.
• the biological markers according to the present invention are represented by any molecule whose detection corresponds or makes it possible to demonstrate the expression of genes, such as in particular a ribonucleic acid or a protein.
• the molecular markers used are RNAs (in particular mRNAs) or proteins.
• RNAs which will be used as a biological marker for the implementation of the method can be extracted in particular.
• the biological sample is preferably obtained from a fasting patient.
• the biological markers can be extracted from the biological samples by any conventional means well known to those skilled in the art and specifically adapted to the nature of the biological marker chosen.
• any technique for quantitatively measuring gene expression and comparing levels of expression well known to those skilled in the art can be used for the implementation of the present invention.
• the measurement and comparison techniques will be chosen to be specifically adapted to the type of biological markers chosen.
• the deregulated expression of the molecular markers is determined by a quantitative measurement of the expression of the genes or the quantity of the proteins chosen from microchips and quantitative RT-PCR.
• step c) of the method makes use of the knowledge of the man of the a profession which will be able to prepare the specific reagents (for example, design of primers, chips, antibodies, etc.) or to choose these reagents from those which are already commercially available and to use them to analyze the differential expression of these molecular markers according to current practices in the field.
• the specific reagents of the molecular markers identified in step b) can detect homologs of these markers.
• homologues any molecular marker whose sequence homology is at least 70%, and preferably at least 80%, at least 85% or even at least 90%, or at least 90%. minus 95% with the sequence of the molecular marker concerned which will have been identified in step b).
• the method according to the present invention may further comprise a step of validating the results obtained using a predictive analysis to determine the rate of prediction error of being reached or developing Parkinson's disease.
• This step which can be performed using any method known to those skilled in the art is able to best predict the phenotype of new individuals from their expression data.
• Known methods include, but are not limited to, KNN (K Nearest Neighbors) method, closest centroid method (nearest Shrunken centroid also called Prediction Analysis for Microarray PAM), the SVM (Support Vector Machine) method, the Linear Discriminant Analysis (LDA) method, ...
• the set of genes whose deregulated expression is associated with Parkinson's disease is mentioned in the following Table 2:
• Table 2 Example of a set of genes whose dysregulated expression is associated with Parkinson's disease.
• the present invention relates to the use of specific reagents of a set of molecular markers identified according to step b) of the method described above for determining the presence or risk of developing Parkinson's disease.
• the identification of the set of molecular markers, as well as the use of the specific reagents of these markers in order to study their differential expression are implemented ex vivo and therefore not applied to the human body. animal.
• reagents specific to all 21 genes mentioned in Table 2 above will be used.
• the probes SEQ ID NO: 1 to SEQ ID NO: 21 indicated in Table 3 below can in particular be used.
• Other probes can also be used.
• SEQ ID NO: 1 to SEQ ID NO: 6 and SEQ ID NO: 8 to SEQ ID NO: 21 can be used as specific reagents for all 21 genes in Table 2, and a 21 th sequence. selected from SEQ ID NO: 7, SEQ ID NO: 22 and SEQ ID NO: 23.
• Table 3 Examples of probes specific for 21 genes whose expression is significantly deregulated in subjects with Parkinson's disease.
• the present invention relates to a kit or necessary for the implementation of the method described above comprising at least the following elements:
• the reagents and / or devices that are necessary and adapted according to the type of molecular markers chosen to carry out the extraction of the molecular markers to be analyzed and / or the detection and / or the relative quantification of these markers relative to the quantity of the markers Molecules of the same type in a sample from a healthy subject (negative control), and
• the invention relates to a kit or necessary for detecting in a biological sample to be tested the differential expression of a set of molecular markers associated with the presence or risk of developing Parkinson's disease, comprising at least one less:
• the invention relates to a kit or kit for detecting in a biological test sample the differential expression of a set of molecular markers associated with the presence or risk of developing Parkinson's disease, comprising at least:
• RNAs and / or the detection and / or the relative quantification of RNA with respect to the amount of RNA in a sample from a healthy subject negative control
• RNAs and / or the detection and / or the relative quantification of RNA with respect to the amount of RNA in a sample from a healthy subject (negative control )
• negative control - possibly a sample of RNA from a patient with Parkinson's disease in a proven way
• the specific reagents of the molecular markers identified according to step b) of the above method are chosen from primers, probes, antibodies, etc.
• the positive control provided in the kits according to the invention is a sample from a subject having a pathogenic mutation responsible for Parkinson's disease at a stage HY of the disease greater than or equal to 3.
• the negative control provided in the kits according to the invention is a sample from a subject free of any personal or family history of Parkinson's disease, without any other apparent disease (and in particular without any other neurodegenerative disease or syndrome Parkinsonian disease), nor medical treatment.
• the kit according to the invention contains reagents specific for the 21 genes of Table 2, and in particular the probes which are indicated in Table 3 above.
• the kit may especially contain the sequences SEQ ID NO: 1 to SEQ ID
• SEQ ID NO: 7 SEQ ID NO: 22 and SEQ ID NO: 23, as specific reagents for the 21 genes of Table 2.
• the invention also includes a method of identifying a set of molecular markers useful for the diagnosis of Parkinson's disease, i.e., to determine the presence or risk of developing this disease. , consisting in selecting markers whose expression is significantly deregulated in common in subjects suffering from Parkinson's disease in comparison with those which come from control individuals, characterized in that
• said population of subjects with Parkinson's disease consists of subjects with different familial forms of the disease, and 2) markers whose expression is also significantly deregulated between samples from subjects with other neurodegenerative diseases Parkinsonian syndromes and those from control individuals are not retained.
• the differential expression of the molecular markers is analyzed at the transcriptional or protein level, and preferably using microchips.
• the analysis of the expression data is advantageously automated and implemented by computer.
• FIG. 1 represents the correlation between the expression measurements obtained by microchips and those obtained by RT-PCR quantitative.
• FC FoId Change
• Figure 2A shows the ranking of the samples of the group
• the training group includes healthy subjects (T1 to T20) and subjects with mutations in the PRKN gene and developing Parkinson's disease (P13 to P16).
• the x-axis represents the number of subjects in the training group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• FIGS. 2B, 2C, 2D show the ranking of the "test" group of samples according to the probability that subjects could belong to the control group (t, white circle) or to the sick group (m, black square) from the control group. all 233 significantly deregulated genes in patients with PRKN gene mutations.
• Figure 2B shows the ranking of patients with neurodegenerative diseases other than Parkinson's disease (A1 to AI1).
• Figure 2C represents the ranking of subjects with familial forms of Parkinson's disease other than familial cases carrying mutation of the PRKN gene (Pl to P12 and P17 to P29).
• Figure 2D shows the ranking of subjects with sporadic forms of Parkinson's disease (Sl to S17).
• the x-axis represents the number of subjects (A, P or S) in the "test" group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• Figure 3A shows the ranking of the samples of the group
• the training group includes healthy subjects (T1 to T20) and subjects with mutations in the SCA2 gene and developing Parkinson's disease (P17 to P22).
• the x-axis represents the number of subjects in the training group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• Figures 3B, 3C, 3D represent the ranking of the "test" sample according to the probability that subjects could belong to the control group (t, white circle) or to the sick group (m, black square) from the of the 176 genes significantly deregulated in patients with gene mutations
• Figure 3B shows the ranking of patients with neurodegenerative diseases other than Parkinson's disease (A1 to AI1).
• Figure 3C represents the ranking of subjects with familial forms of Parkinson's disease other than familial cases carrying mutations of the SCA2 gene (Pl to).
• Figure 3D represents the ranking of subjects with sporadic forms of Parkinson's disease (Sl to S17).
• the x-axis represents the number of subjects (A, P or S) in the "test" group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• Figure 4A represents the ranking of the samples of the group
• the training group includes healthy subjects (T1 to T20) and subjects carrying the LRRK2 mutation (P2 to P5 and P7 to PI1).
• the x-axis represents the number of subjects in the training group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• FIGS. 4B, 4C, 4D show the ranking of the "test" group members according to the probability that subjects could belong to the control group (t, white circle) or to the sick group (m, black square) from the control group. all 438 genes significantly deregulated in patients with the LRRK2 mutation.
• Figure 4B shows the ranking of patients with neurodegenerative diseases other than Parkinson's disease (A1 to AI1).
• Figure 4C represents the ranking of subjects with familial forms of Parkinson's disease other than familial cases carrying mutations of the LRRK2 gene (except for two of them P6 and P12) (Pl, P6, P12 to P29).
• Figure 4D represents the ranking of subjects with sporadic forms of Parkinson's disease (Sl to S17).
• the x-axis represents the number of subjects (A, P or S) in the "test" group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• Figure 5A shows the ranking of the samples from the group
• the "training” group includes healthy subjects (T1 to T20) and subjects carrying mutations of PRKN, SCA2, LRRK2 or SNCA genes developing familial and hereditary forms of Parkinson's disease (Pl to P22, except subjects P6 and P12).
• the x-axis represents the number of subjects in the training group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• FIGS. 5B, 5C, 5D show the ranking of the samples of the "test" group according to the probability that subjects could belong to the control group (t, white circle) or to the sick group (m, black square) from the all 21 genes significantly deregulated in patients with different familial forms of Parkinson's disease.
• Figure 5B represents the ranking of patients with neurodegenerative diseases other than Parkinson's disease (Al to AIl).
• FIG. 5C represents the classification of subjects suffering from familial forms of Parkinson's disease other than familial cases carrying mutations of the PRKN, SCA2, LRRK2 genes (except for two of them P6 and P12) or SNCA (P6, P12, P23 to P29).
• Figure 5D represents the ranking of subjects with sporadic forms of Parkinson's disease (Sl to S17).
• the x-axis represents the number of subjects (A, P or S) in the "test" group.
• the y-axis represents the probability rate that a subject belongs to the control or diseased group.
• treated or symptomatic patients with Parkinson's disease were diagnosed according to the following cumulative criteria 1) 2) and 3) accepted in the field, namely
• These subjects do not meet the diagnostic criteria for Parkinson's disease as defined above (subjects referred to as “treated or symptomatic patients") and especially as regards the response to levodopa treatment and the exclusion criteria.
• forty healthy individuals with no personal or family history of Parkinson's disease or any other neurodegenerative disease were also recruited as controls (T).
• the blood samples were taken from each type of population (sick or control individuals) after obtaining the informed consent of the subjects.
• Table 4 Description of symptoms and stage of severity of familial cases of Parkinson's disease
• the score of Part III of the UPDRS scale is indicated. The higher the score, the more the motor examination is unfavorable and the more the patient presents disorders in the speech, the gestures of the everyday life and a disturbed gait, annoying for his everyday life.
• Table 5 Description of symptoms and stage of severity of sporadic cases of Parkinson's disease
• the score of Part III of the UPDRS scale is indicated. The higher the score, the more the motor examination is unfavorable and the more the patient presents disorders in the speech, the gestures of the everyday life and a disturbed gait, annoying for his everyday life.
• Table 6 Description of patients with another neurodegenerative disease or parkinsonian syndrome meeting the criteria in force Patients Al to A6 carry an SCA2-C mutation.
• RNA RNA extraction is performed using the RNeasy mini kit and the QIAGEN ® RNase-free DNase kit according to the manufacturer's recommendations. Briefly, the cells are mechanically lysed. A volume of 70% ethanol is then incorporated into each sample and the mixture is homogenized with a pipette. The mixture thus obtained is deposited on a column containing a silica membrane which will retain the nucleic acids. After washing, DNase I treatment is applied to remove residual DNA. Three other washes allow to eliminate DNase, DNA and traces of ethanol. The RNA is recovered in a volume of 30 ⁇ l of RNase-free water by a centrifugation of one minute at 10,000 g. The purified total RNA sample is stored at -80 ° C.
• RNA assay is performed using the Nano-Drop ® spectrophotometer
• ND-1000 by measuring the absorbance at 260 nm from i ⁇ l of sample. Calculation of the 260 nm / 280 nm and 260 nm / 230 nm absorbance ratios makes it possible to evaluate the purity of the RNA.
• RNA quality analysis is performed using Agilent ® Bioanalyzer RNA 6000 nano.
• the samples to be analyzed (l ⁇ l) and a molecular weight marker are deposited in each well of the RNA 6000 nano chip composed of a gel mixed with a fluorophore (intercalating single-stranded nucleic acids).
• the wells are analyzed by the Bioanalyzer Agilent 2100 ®.
• the data used to verify the quality of the RNAs are the ratio of 28S / 18S ribosomal RNA fractions and the RIN for RNA Integrity Number which is an algorithm developed by Agilent ® for rating the degradation of RNA on a scale from 1 to 10.
• Complementary DNA microarrays The technology of cDNA microarrays makes it possible to simultaneously analyze all the transcripts of the genome.
• the expression chips used are developed by Agilent ® and fully cover the human genome thanks to nearly 44,000 probes (44K whole human genome expression arrays (Agilent ® , 4 X 44K slide formats) . These probes are based on technology In situ synthesis of 60-mer oligonucleotides on a glass slide that will be used to capture labeled targets of complementary DNA (cDNA) From the total RNA (300 ng), the targets are prepared.
• cDNA complementary DNA
• Data Extraction Software eliminates background noise and verifies the quality of spots on the blades. Each probe on the slide corresponds to a fluorescence intensity. Data normalization is necessary because experimental biases exist. Indeed, there may be differences in the rate of incorporation of cyanines into the cDNA, a poor quality of fluorescence detection by the scanner; other biases may be caused by deposition, hybridization.
• RNA samples used for the chips showed a satisfactory quality of 260 nm / 280 nm absorbance ratios (between 1.8 and 2), and 28S / 18S (> 1.5) and RIN ( > 8.9).
• the analysis of the quality reports of the chips by
• the analysis of the results of the chips comprises, conventionally, a step of normalization of the data per chip and per gene on the median fluorescence intensities of the control subjects. Normalized values are expressed in log ratio. Expression data are then classified according to the subject's HY stage of Parkinson's disease.
• the deregulated genes whose expression variation threshold is less than 1.2 will not be retained for the rest of the analysis.
• a list of genes specifically deregulated for a given HY stage list_A, listE_B, list_C).
• All of the expression data of subjects with neurodegenerative diseases or Parkinson's disease other than Parkinson's disease is compared with all of the expression data of the controls by applying the same criteria as above for the statistical analysis by the Welch T-test.
• a list of specifically deregulated genes is obtained in subjects with neurodegenerative diseases or Parkinson's syndrome other than Parkinson's disease (List_D).
• Genes whose expression is significantly deregulated in common at the different stages of Parkinson's disease HY are selected through a graphical representation of Venn diagrams by crossing lists: list_A, list_B and list_C. The last step is to exclude from this list (list_E), genes that are common with those that are also significantly deregulated in patients with other neurodegenerative diseases or parkinsonian syndromes (list_D). This gives a set of genes deregulated specifically in patients with Parkinson's disease (liste_F).
• the word "gene” is used to refer to the Agilent ® probes on the chip. However, several probes may be present for the same gene and probes may still correspond to potential genes or even sequences whose role is not yet known.
• the expression data corresponding to the set of genes obtained as defined in paragraph C 3 are introduced into the PAM software (Prediction Analysis for Microarray) (version 2.1; http://www-stat.stanford.edu/ ⁇ tibs / PAM /), which applies the closest proximate colloid analysis ("closest shrunken centroid analysis").
• the optimal number of genes is determined from the cross validation method (10 times) from the "training” group.
• the "training” group is made up of subjects for whom class membership is known (the class being defined by sick group or a group of witnesses). Gene expression data from these subjects are provided for analysis.
• the "training” group makes it possible to determine all the genes whose expression is most correlated with the diagnosis (patient / control).
• test group is a group consisting of subjects for which class membership will be predicted according to the rules learned from the "training” group. The true belonging of these samples to the class may or may not be known.
• a subject P will be correctly classified as a patient when his probability is close to 1 and will be represented by the symbol corresponding to the sick group.
• a subject T will be correctly classified as a control subject when its probability is close to 1 and will be represented by the symbol corresponding to the control group.
• a subject with a risk of developing Parkinson's disease will be correctly classified as a patient when his probability is close to 1 and will be represented by the symbol corresponding to the sick group.
• the error rate makes it possible to evaluate the effectiveness of the set of genes used in the method of detecting molecular markers to determine the presence or the risk of developing Parkinson's disease.
• the error rate is the number of misclassified subjects out of the total number of subjects in that class; two classes are possible: parkinsonian patient or control (healthy or suffering from a parkinsonian syndrome or another neurodegenerative pathology that Parkinson's disease).
• EXAMPLE 1 Concordance of the Results Obtained by the Use of Microchips with Those Obtained by Other Expression Measurement Techniques Such as Quantitative RT-PCR (Technical Verification Example)
• Reverse transcription (Qiagen) from 250 ng of RNA according to the manufacturer's protocol. Residual residual DNA is first removed by DNase treatment prior to performing the retro-transcription reaction.
• the primers used are a mixture of hexamers and oligo-dT allowing the synthesis of cDNA from all the RNA.
• Real-time PCR step
• Quantitative PCR was performed according to the manufacturer's recommendations using the SYBR® Green PCR Master Kit (Applied Biosystems). This step makes it possible to follow in real time the amplification of a target cDNA fragment using the SYBR® Green fluorophore.
• This DNA intercalator becomes fluorescent when bound to double-stranded DNA.
• the amount of fluorescence is measured at the end of the elongation step of each PCR cycle. This measurement makes it possible to detect which cycle (Ct for cycle threshold) the fluorescence exceeds the threshold determined by the user, on the amplification curve. This technique makes it possible to calculate the relative normalized expression of the target gene.
• Normalization is with respect to a reference gene (18S ribosomal RNA, sense primer CCTGGATACCGCAGCTAGGA (SEQ ID NO: 24), anti-sense primer GCGGCGCAATACGAATGCCCC (SEQ ID NO: 25), hybridization temperature 60 ° C.).
• the calculation method is derived from method 2 " ⁇ ct to account for the fact that the efficiency is not 100%, so the normalized expression is the ratio: (1 / efficiency of target gene and target gene ) / (l / efficiency of gene refer ct gene référentv
• the mixture comprises 10 ⁇ l of water, 0.75 ⁇ l of each of the primers (10 pmol / ⁇ l) and 12.5 ⁇ l of master (2 ⁇ ) for one well.
• One ⁇ l of cDNA is added to the reaction mixture.
• the measurements of the samples are carried out in duplicate.
• Real-time PCR is performed on an ABI Prism® 7700 device (Applied Biosystems).
• the statistical analysis of the expression ratios between the sick individuals and the controls is carried out for each gene by a Mann and Whitney test (threshold of significance p ⁇ 0.05).
• Table 7 Primer sequences, amplimer sizes and hybridization temperatures for each gene studied in quantitative PCR.
• the sequences of the primers were designed using Oligo 5 ⁇ software.
• Example 2 Determination of a list of genes whose expression is deregulated in patients with a particular familial form of Parkinson's disease and study of the ability to identify individuals with sporadic forms of Parkinson's disease. from this list
• the prediction value (error rate) of the set of genes thus calculated to determine the presence or the risk of developing Parkinson's disease, and in particular a sporadic form of this disease, is analyzed using PAM software as described herein. above in paragraph C 4. a. Study of deregulated genes only in patients with Parkin PRKN gene mutation
• 2,775 genes make up the list_B of genes specifically deregulated compared to the controls of PRKN mutation-positive subjects who have developed Parkinson's disease with an HY stage of 2 or 2.5 (subjects P15, P16). 2,211 genes make up the list_C list of specifically deregulated genes compared to the controls of subjects with a PRKN mutation and who developed Parkinson's disease whose HY stage is 3, 4 or 5 (subjects P13, P14).
• the genes specifically deregulated and common to the different HY stages are selected from the list_E list (270 genes).
• the "training” group consists of the 4 subjects carrying the PRKN gene mutation (subjects P13, P14, P15, P16) and the controls (subjects T1 to T20),
• the "test” group consists of the 25 other family subjects (subjects P1 to P12 and P17 to P29), the 17 sporadic subjects (subjects S1 to S17) and the 11 subjects suffering from another parkinsonian syndrome (subjects A1 to AI1) .
• 6,446 genes make up the list_C list of genes specifically deregulated compared to controls in subjects with an SCA2 mutation and who developed Parkinson's disease whose HY stage is 3, 4 or 5 (subjects P21).
• the genes specifically deregulated and common to the different HY stages are selected from the list_E list (217 genes).
• the "training” group consists of 6 subjects carrying mutations of the SCA2 gene (subjects P17 to P22) and 20 controls (subjects T1 to T20).
• the "test” group consists of the 23 other family subjects (subjects P1 to P16 and P23 to P29), the 17 sporadic subjects (subjects S1 to S17) and the 11 subjects suffering from another parkinsonian syndrome (subjects A1 to AI1). :
• 5,783 genes make up the list_B of genes specifically deregulated compared to the controls of subjects with a LRRK2 mutation and who developed Parkinson's disease with an HY stage of 2 or 2.5 (subjects P4, P7, P8, PIl ).
• Subject P12 was not considered in this analysis for the selection of deregulated genes because P12 had both Parkinson's disease and manic-depressive syndrome, which could bias specificity towards Parkinson's disease selected genes.
• 6,665 genes make up the list_C of genes specifically deregulated compared to the controls of subjects carrying a mutation LRRK2 and having developed a Parkinson's disease whose stage HY is 3, 4 or 5 (subjects P2, P9, PlO).
• the P6 sample showed significant contamination with hemoglobin, which could bias gene selection; it was therefore not taken into account in this analysis.
• the genes specifically deregulated and common to the different HY stages are selected from the list_E list (759 genes). This list of deregulated genes (Liste_E) was then crossed with the list of deregulated genes in subjects with other neurodegenerative diseases or Parkinson's syndrome (List_D). After excluding genes that are common with those that are also significantly deregulated in patients with other neurodegenerative diseases or parkinsonian syndromes, we obtain a set of 438 genes deregulated specifically in subjects carrying the mutation LRRK2 (Liste_F).
• the "training" group consisted of 9 subjects carrying mutation of the LRRK2 gene (subjects P2 to P5 and P7 to PI1) and 20 controls (subjects T1 to T20).
• the test group consists of the 18 other family subjects (Pl and P13 to P29 subjects) as well as the other 2 subjects carrying an LRRK2 mutation (subjects P6 and P12), 17 sporadic subjects (subjects S17 to S17) and 11 subjects with another Parkinson syndrome (subjects Al to AIl).
• Complementary analyzes were performed by decreasing the number of genes included in the F-list in PAM, but the different sets of genes obtained during these analyzes also make it impossible to distinguish the sporadic cases from the control subjects.
• EXAMPLE 3 Determination of a Set of Genes the Expression of which Is Deregulated in Patients With Different Familial Forms of Parkinson's Disease and Study of the ability to Identify Individuals With Disease, Including Sporadic Disorders, From This Disease together
• the gene expression data obtained from a set of 4 types of familial forms of Parkinson's disease were taken into account to determine if the set of genes thus obtained can predict the disease of Parkinson's disease. Parkinson's, and especially the sporadic forms of the disease.
• PRKN responsible for these 4 familial forms of Parkinson's disease were taken into account in the analysis by the GeneSpring software, except for the subjects P6 and P12 (see example 2 c).
• Parkinsonian patients patients P23, P24, P25, P26, P27, P28, P29
• sporadic were not included in this first analysis with GeneSpring, but were included in the analysis with PAM. They will be used to verify the predictive value of the genes selected in this analysis.
• 4,415 genes make up the list_A list of genes specifically deregulated compared to the controls of subjects carrying a mutation SCA2, PRKN, SNCA and
• 3,292 genes make up the list_C list of genes specifically deregulated compared to controls with SCA2, PRKN, SNCA and LRRK2 mutation and who developed Parkinson's disease with an HY stage of 3, 4 or 5 (P2 subjects , P9, P10, P13, P14, P21). As for Example 2c, subject P6 was not considered for this analysis.
• genes that are specifically deregulated and common to the different HY stages are selected from the listE_list (38 genes).
• This set of 21 genes grouped in Table 8 below corresponds to specifically deregulated genes in subjects carrying the SCA2, PRKN, SNCA and LRRK2 mutation.
• the samples were divided as follows the "training" group corresponds to the 20 healthy controls (subjects Tl to T20) and the 20 subjects carrying a mutation LRRK2, PRKN, SNCA and SCA2 (subjects P1, P2, P3, P4, P5, P7, P8 , P9, P10, P11, P13, P14, P15, P16, P17, P18, P19, P20, P21 and P22).
• the "test" group includes 9 other family cases (ie family cases other than those carrying a PRKN, LRRK2, SCA2 or SNCA mutation (subjects P), namely subjects, P23, P24 , P25, P26, P27, P28, P29 and 2 LRRK2 mutation-positive individuals (P6 and P12), the 17 sporadic cases (subjects S17-S17), and the 11 subjects with other Parkinson's syndrome ( subjects Al to AIl).
• family cases ie family cases other than those carrying a PRKN, LRRK2, SCA2 or SNCA mutation (subjects P), namely subjects, P23, P24 , P25, P26, P27, P28, P29 and 2 LRRK2 mutation-positive individuals (P6 and P12), the 17 sporadic cases (subjects S17-S17), and the 11 subjects with other Parkinson's syndrome ( subjects Al to AIl).
• This set of 21 genes classifies patients and controls with an error rate of 0% and 10% respectively on the training group.
• Test are misclassified. These are 2 sporadic cases (Sl and S13, Figure 5D) and 3 other familial cases (P24, P25, P12 Figure 5C) that have been classified as witnesses represented by a white circle instead of patients represented by a black square in the group of patients.
• Pauci-symptomatic family members (P28, P29) were well classified as patients at risk of developing Parkinson's disease (as well as the subject carrying a LRRK2 (P6) mutation with hemoglobin contamination).
• Subjects with another neurodegenerative pathology A5, A6, A8 and AI1 are misclassified as represented by a black square instead of a white circle in the control group ( Figure 5B).

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Wood Science & Technology (AREA)
• Analytical Chemistry (AREA)
• Zoology (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Pathology (AREA)
• Immunology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Biophysics (AREA)
• Physics & Mathematics (AREA)
• Biochemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=40377133

Family Applications (1)

Country Status (3)

Families Citing this family (3)

Family Cites Families (4)

• 2008
  • 2008-09-05 FR FR0855997A patent/FR2935712A1/fr not_active Withdrawn
• 2009
  • 2009-08-28 EP EP09740504A patent/EP2334825A1/de not_active Withdrawn
  • 2009-08-28 WO PCT/FR2009/051643 patent/WO2010026335A1/fr active Application Filing

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events