EP2277903A2 - Differential in tumour gene products and use of same - Google Patents

Abstract

A pharmaceutical composition containing an agent (A) that: (a) inhibits expression or activity of a tumor-associated antigen (TAg); (b) has selective tumor-inhibiting activity against cells with (abnormal) expression of TAg; or (c) increases the amount of complex formed between an HLA (human leukocyte antigen) molecule and TAg, or its fragment, is new. A pharmaceutical composition containing an agent (A) that: (a) inhibits expression or activity of a tumor-associated antigen (TAg); (b) has selective tumor-inhibiting activity against cells with (abnormal) expression of TAg; or (c) increases the amount of complex formed between an HLA (human leukocyte antigen) molecule and TAg, or its fragment. TAg is encoded by nucleic acid (NA) that: (a) comprises any of 28 defined sequences given in the specification, or their fragments; (b) can hybridize to (a) under stringent conditions; (c) is a degenerate version of (a) or (b); or (d) is complementary to (a)-(c). Independent claims are also included for: (1) a pharmaceutical composition containing one or more of TAg, NA encoding TAg, antibody that binds to TAg, antisense sequences specific for NA, host cells that express TAg, or isolated complex of TAg with an HLA molecule (TAg may always by a fragment); (2) diagnosing diseases associated with (abnormal) expression of TAg (M1); (3) determining regression, progression or outbreak of diseases associated with (abnormal) expression of TAg (M2); (4) treating diseases associated with (abnormal) expression of TAg (M3); (5) NA as new compounds; (6) a nucleic acid (NA1) that encodes any of 35 specified peptide sequences or their fragments; (7) a recombinant DNA or RNA (NA2) that includes NA or NA1; (8) a host cell containing NA, NA1 or NA2; (9) proteins encoded by NA1 and their fragments that are immunogenic or can bind to HLA receptors or human antibodies; (10) agents (B) that bind specifically to a protein encoded by NA; (11) antibodies (Ab) that bind specifically to a complex of: (a) protein or its fragments encoded by NA; and (b) Major Histocompatibility (MHC) molecules to which (a) bind, but does not bind to (i) or (ii) singly; (12) a conjugate (C) between (B) or Ab and a diagnostic or therapeutic agent; (13) a kit for detecting (abnormal) expression of TAg; (14) recombinant DNA that includes a promoter region derived from NA; and (15) treatment, diagnosis and monitoring of metastatic cancer associated with (abnormal) expression of TPTE. ACTIVITY : Cytostatic. No biological data given. MECHANISM OF ACTION : Vaccine; Antisense/antibody inhibition of gene expression or activity.

Description

Despite interdisciplinary approaches and the spread of classical therapeutic modalities, cancer remains one of the leading causes of death. More recent therapeutic concepts aim to integrate the patient's own immune system into the overall therapeutic concept by using recombinant tumor vaccines and other specific measures such as antibody therapy. The prerequisite for the success of such a strategy is the recognition by the immune system of the patient of tumor-specific or tumor-associated antigens or epitopes whose effector functions are to be intensified interventionally. Tumor cells differ biologically significantly from their non-malignant cells of origin. These differences are due to genetic alterations acquired during tumor development and also lead, inter alia, to the formation of qualitatively or quantitatively altered molecular structures in the cancer cells. If such tumor-associated structures are recognized by the specific immune system of the tumor-bearing host, one speaks of tumor-associated antigens. The specific recognition of tumor-associated antigens involves cellular and humoral mechanisms that represent two units that are functionally linked to one another: CD4 ⁺ and CD8 ⁺ T lymphocytes recognize processed antigens that are located on the molecules of the MHC (Major Histocompatibility Complex) antigens. Classes II and I, respectively, while B lymphocytes produce circulating antibody molecules that bind directly to unprocessed antigens. The potential clinical-therapeutic importance of tumor-associated antigens arises from the fact that the recognition of antigens on neoplastic cells by the immune system leads to the initiation of cytotoxic effector mechanisms and in the presence of T helper cells can cause the elimination of cancer cells ( Pardoll, Nat. Med. 4: 525-31, 1998 ). Accordingly, a central goal of tumor immunology is to define these structures molecularly. The molecular nature of these antigens has long remained enigmatic. Only when appropriate cloning techniques were developed was it possible, by analyzing the cytotoxic T lymphocyte (CTL) target structures ( van der Bruggen et al., Science 254: 1643-7, 1991 ) or with circulating autoantibodies ( Sahin et al., Curr. Opin. Immunol. 9: 709-16, 1997 ) as probes to screen cDNA expression libraries of tumors systematically for tumor-associated antigens. For this purpose, cDNA expression libraries were prepared from fresh tumor tissue and recombinantly expressed in suitable systems as proteins. Immune effectors isolated from patients, namely CTL clones with tumor specificity Lysis patterns or circulating autoantibodies were used to clone the respective antigens.

Through these approaches, a variety of antigens have been defined in various neoplasias in recent years. Of great interest is the class of Cancer / Testis antigens (CTA). CTA and their coding genes (cancer / testis genes or CTG) are defined by their characteristic expression pattern [ Tureci et al, Mol Med Today. 3: 342-9, 1997 ]. They are not found in normal tissues except for testis or germ cells, but are expressed in a number of human malignancies and not tumor specific, but with varying frequency in tumor entities of very different origin ( Chen & Old, Cancer J. Sci. At the. 5: 16-7, 1999 ). Also serum reactivities against CTA are not found in healthy controls, but only in tumor patients. In particular, because of its tissue distribution, this class of antigen is of particular value for immunotherapeutic purposes and is being tested in current clinical patient studies ( Marchand et al., Int. J. Cancer 80: 219-30, 1999 ; Knuth et al., Cancer Chemother. Pharmacol. 46: S46-51, 2000 ).

However, the classical methods of antigen identification presented above utilize immune effectors (circulating autoantibodies or CTL clones) from patients with usually advanced cancer as probes. From a series of data it can be seen that tumors e.g. can lead to the tolerization and anergization of T cells and lost in the course of the disease, those specificities from the immune effector repertoire that could cause an effective immune recognition. Ongoing patient studies have not yet provided any proven evidence of an actual effect of the previously discovered and used tumor-associated antigens. Accordingly, it can not be ruled out that spontaneous immune response evoking proteins are the wrong target structures.

It was the object of the present invention to provide target structures for the diagnosis and therapy of cancers.

This object is achieved by the subject matter of the claims.

According to the invention, a strategy for identifying and providing tumor-associated expressed antigens and the nucleic acids coding therefor was pursued. This strategy is based on the fact that actually testis and thus germ cell specific Genes that are normally silent in adult tissues are ectopically and illegally reactivated in tumor cells. By data mining, a complete list of all known testis-specific genes is first set up and then evaluated by expression analyzes by means of specific RT-PCR for their aberrant activation in tumors. Data mining is a well-known method for identifying tumor-associated genes. However, in conventional strategies, transcriptomes from normal tissue banks are usually electronically subtracted from tumor tissue banks, assuming that the remaining genes are tumor specific ( Schmitt et al., Nucleic Acids Res. 27: 4251-60, 1999 ; Vasmatzis et al., Proc. Natl. Acad. Sci. USA 95: 300-4, 1998 , Scheurle et al., Cancer Res. 60: 4037-43, 2000 ).

However, the inventive concept, which has proven to be much more successful, relies on utilizing data mining for the electronic extraction of all testis-specific genes and then evaluating them for ectopic expression in tumors.

Thus, in one aspect, the invention relates to a strategy for identifying genes that are differentially expressed in tumors. This combines data mining of public sequence banks (" in silico ") with subsequent evaluating laboratory-experimental ("wet bench") investigations.

A combined strategy based on two different bioinformatic scripts enabled the invention to identify new members of the cancer / testis (CT) gene class. These have hitherto been classified as purely testis, germ cell or sperm specific. The recognition that these genes are aberrantly activated in tumor cells allows them to assign them a substantially new quality with functional implications. The identification and provision of these tumor-associated genes and the gene products encoded thereby took place according to the invention independently of an immunogenic effect.

The tumor-associated antigens identified according to the invention have an amino acid sequence encoded by a nucleic acid selected from the group consisting of (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1 -5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88 is selected from a part or derivative thereof, (b) a nucleic acid which is described in U.S. Pat (b) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b) and (d) hybridizes to the nucleic acid under (a); a nucleic acid complementary to the nucleic acid of (a), (b) or (c). In a preferred embodiment, a tumor-associated antigen identified according to the invention has an amino acid sequence encoded by a nucleic acid selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39 , 40, 54-57, 62, 63, 70, 74, 85-88. In another preferred embodiment, a tumor-associated antigen identified according to the invention comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58- 61, 64, 65, 71, 75, 80-84, 89-100 a part or derivative thereof.

The present invention relates in general to the use of tumor-associated antigens identified in accordance with the invention or of parts thereof, nucleic acids coding therefor or nucleic acids directed against the coding nucleic acids or of antibodies directed against the tumor-associated antigens identified in accordance with the invention or parts thereof are directed for therapy and diagnosis. This use may involve single but also combinations of several of these antigens, functional fragments, nucleic acids, antibodies, etc., in one embodiment also in combination with other tumor-associated genes and antigens for diagnosis, therapy and follow-up.

Preferred disorders for therapy and / or diagnosis are those in which there is selective expression or abnormal expression of one or more of the tumor-associated antigens identified according to the invention.

The invention also relates to nucleic acids and gene products which are expressed tumor cell-associated and which are formed by altered splicing (splice variants) of known genes or by altered translation using alternative open reading frames. These nucleic acids include the sequences according to (SEQ ID NO: 2-5, 20, 21, 31-33, 54-57, 85-88) of the Sequence Listing. Furthermore, the gene products comprise sequences according to (SEQ ID NO: 7-13, 23, 24, 34-36, 58-61, 89-100) of the Sequence Listing. The splice variants according to the invention are usable according to the invention as targets for the diagnosis and therapy of tumor diseases.

• die Nutzung variabler Transkriptionsinitiationsstellen
• die Nutzung zusätzlicher Exons
• vollständiges oder unvollständiges Aus Spleißen von einzelnen oder mehreren Exons,
• über Mutation veränderte Spleißregulatorsequenzen (Deletion bzw. Schaffung neuer Donor/Acceptorsequenzen),
• die unvollständige Elimination von Intronsequenzen.

For the emergence of splice variants a variety of mechanisms can be causal, for example

• the use of variable transcription initiation sites
• the use of additional exons
• complete or incomplete out splicing of single or multiple exons,
• mutation-modified splice regulatory sequences (deletion or creation of new donor / acceptor sequences),
• the incomplete elimination of intron sequences.

The altered splicing of a gene leads to an altered transcript sequence (splice variant). If a splice variant is translated in the region of its altered sequence, this results in a modified protein, which may differ significantly from the original structure and function. In tumor-associated splice variants, tumor-associated transcripts and tumor-associated proteins / antigens can arise. These can be used as molecular markers both for the detection of tumor cells and for the therapeutic targeting of tumors. The detection of tumor cells, for example in the blood, serum, bone marrow, sputum, bronchial lavage, Körpersekreten and tissue biopsies can be carried out according to the invention, for example, after extraction of nucleic acids by PCR amplification with splice variant specific oligonucleotides. For detection, all sequence-dependent detection systems are suitable according to the invention. In addition to PCR, these are eg gene chip / microarray systems, Northern blot, RNAse protection assays (RDA) and others. All detection systems have in common that the detection is based on a specific hybridization with at least one splice variant-specific nucleic acid sequence. However, the detection of tumor cells can also be carried out according to the invention by antibodies that recognize a coded by the splice variant specific epitope. For the production of the antibodies peptides for immunization can be used that are specific for this splice variant. Particularly suitable for the immunization are the amino acids which have distinct epitope differences to the variant (s) of the gene product which is preferably formed in healthy cells. The detection of tumor cells with antibodies can be done on a sample isolated from the patient or as imaging with intravenously applied antibodies. In addition to diagnostic utility, splice variants that have new or altered epitopes are attractive targets for immunotherapy. The epitopes of the invention can be used to target therapeutically effective monoclonal antibodies or T lymphocytes. In passive immunotherapy, antibodies or T lymphocytes that recognize splice variant-specific epitopes are adoptively transferred. The generation of antibodies can, as with other antigens, also using standard technologies (Immunization of animals, panning strategies for the isolation of recombinant antibodies) using polypeptides containing these epitopes done. Alternatively, for immunization, nucleic acids encoding oligo- or polypeptides containing these epitopes may be used. Various techniques for in vitro or in vivo generation of epitope-specific T lymphocytes are known and extensively described, for example (Kessler JH, et al., 2001, Sahin et al., 1997) and are also based on the use of oligo or polypeptides containing the Include splice variant-specific epitopes or nucleic acids encoding them. Oligo or polypeptides incorporating the splice variant-specific epitopes or nucleic acids encoding these polypeptides are also useful for use as pharmaceutically active substances in active immunotherapy (vaccination, vaccine therapy).

In one aspect, the invention relates to a pharmaceutical composition comprising an agent which recognizes the tumor-associated antigen identified according to the invention and is preferably selective for cells having expression or abnormal expression of a tumor-associated antigen identified according to the invention. In certain embodiments, the agent may cause induction of cell death, reduction of cell growth, damage to the cell membrane, or secretion of cytokines, and preferably has antitumor activity. In one embodiment, the agent is an antisense nucleic acid that selectively hybridizes to the nucleic acid encoding the tumor-associated antigen. In another embodiment, the agent is an antibody that selectively binds to the tumor-associated antigen, particularly a complement-activated antibody that selectively binds to the tumor-associated antigen. In another embodiment, the agent comprises a plurality of agents, each of which selectively recognizes various tumor-associated antigens, wherein at least one of the tumor-associated antigens is a tumor-associated antigen identified according to the invention. The recognition need not be directly associated with an inhibition of the activity or expression of the antigen. In this aspect of the invention, the antigen selectively restricted to tumors preferably serves as a label for recruiting effector mechanisms at that specific site. In a preferred embodiment, the agent is a cytotoxic T lymphocyte which recognizes the antigen on an HLA molecule and lyses the cell so labeled. In another embodiment, the agent is an antibody that selectively binds to the tumor-associated antigen, thus recruiting natural or artificial effector mechanisms to that cell. In a further embodiment this is Means a T helper lymphocyte that strengthens effector functions of other cells that specifically recognize this antigen.

In one aspect, the invention relates to a pharmaceutical composition comprising an agent which inhibits the expression or activity of a tumor-associated antigen identified according to the invention. In a preferred embodiment, the agent is an antisense nucleic acid that selectively hybridizes to the nucleic acid encoding the tumor-associated antigen. In another embodiment, the agent is an antibody that selectively binds to the tumor-associated antigen. In another embodiment, the agent comprises a plurality of agents each selectively inhibiting the expression or activity of various tumor-associated antigens, wherein at least one of the tumor-associated antigens is a tumor-associated antigen identified according to the invention.

The invention further relates to a pharmaceutical composition comprising an agent which, upon administration, selectively increases the amount of complexes between an HLA molecule and a peptide epitope from the tumor-associated antigen identified according to the invention. The agent in one embodiment comprises one or more components selected from the group consisting of (i) the tumor-associated antigen or a portion thereof, (ii) a nucleic acid encoding the tumor-associated antigen or a portion thereof (iii) a host cell expressing the tumor-associated antigen or portion thereof, and (iv) isolated complexes between peptide epitopes from the tumor-associated antigen and an MHC molecule. In one embodiment, the agent comprises a plurality of agents, each of which selectively increases the amount of complexes between MHC molecules and peptide epitopes of various tumor-associated antigens, wherein at least one of the tumor-associated antigens is a tumor-associated antigen identified according to the invention.

The invention further relates to a pharmaceutical composition which comprises one or more constituents selected from the group consisting of (i) a tumor-associated antigen identified in accordance with the invention or a part thereof, (ii) a nucleic acid which is suitable for the invention (iii) an antibody that binds to a tumor-associated antigen or part thereof identified according to the invention, (iv) an antisense nucleic acid that specifically binds with a nucleic acid that is in accordance with the invention identified tumor-associated Antigen encodes, hybridizes, (v) a host cell expressing a tumor-associated antigen or part thereof identified according to the invention, and (vi) isolated complexes between a tumor-associated antigen identified according to the invention or a part thereof and an HLA molecule.

A nucleic acid encoding a tumor-associated antigen or part thereof identified according to the invention may be present in the pharmaceutical composition in an expression vector and operably linked to a promoter.

A host cell contained in a pharmaceutical composition of the present invention may secrete the tumor-associated antigen or portion thereof, express it on the surface, or may additionally express an HLA molecule that binds to the tumor-associated antigen or portion thereof. In one embodiment, the host cell expresses the HLA molecule endogenously. In a further embodiment, the host cell recombinantly expresses the HLA molecule and / or the tumor-associated antigen or part thereof. Preferably, the host cell is non-proliferative. In a preferred embodiment, the host cell is an antigen-presenting cell, in particular a dendritic cell, a monocyte or a macrophage.

An antibody contained in a pharmaceutical composition of the invention may be a monoclonal antibody. In further embodiments, the antibody is a chimeric or humanized antibody, a fragment of a natural antibody, or a synthetic antibody that can be produced by combinatorial techniques. The antibody may be coupled to a therapeutically or diagnostically useful agent.

An antisense nucleic acid contained in a pharmaceutical composition according to the invention may comprise a sequence of 6-50, in particular 10-30, 15-30 and 20-30 contiguous nucleotides from the nucleic acid which codes for the tumor-associated antigen identified according to the invention.

In further embodiments, a tumor-associated antigen, or a portion thereof, provided by a pharmaceutical composition of the invention, either directly or by the expression of a nucleic acid, binds to MHC molecules on the Surface of cells, wherein the binding preferably causes a cytolytic reaction and / or induces a cytokine secretion.

A pharmaceutical composition of the invention may comprise a pharmaceutically acceptable carrier and / or adjuvant. The adjuvant may be selected from saponin, GM-CSF, CpG nucleotides, RNA, a cytokine or a chemokine. A pharmaceutical composition according to the invention is preferably used for the treatment of a disease characterized by the selective expression or abnormal expression of a tumor-associated antigen. In a preferred embodiment, the disease is cancer.

Furthermore, the invention relates to methods for the treatment or diagnosis of a disease characterized by the expression or abnormal expression of one or more tumor-associated antigens. In one embodiment, the treatment comprises the administration of a pharmaceutical composition according to the invention.

In one aspect, the invention relates to a method of diagnosing a disease characterized by the expression or abnormal expression of a tumor-associated antigen identified according to the invention. The method comprises detecting (i) a nucleic acid encoding the tumor-associated antigen, or a portion thereof, and / or (ii) detecting the tumor-associated antigen or a portion thereof, and / or (iii) detecting an antibody against the tumor-associated antigen or a part thereof and / or (iv) the detection of cytotoxic or helper T lymphocytes specific for the tumor-associated antigen or a part thereof in a biological sample isolated from a patient , In certain embodiments, detection comprises (i) contacting the biological sample with an agent that specifically binds to the nucleic acid encoding the tumor-associated antigen, or the portion thereof, to the tumor-associated antigen or portion thereof binding the antibody or to cytotoxic or helper T lymphocytes specific for the tumor-associated antigen or parts thereof, and (ii) detecting the complex formation between the agent and the nucleic acid or part thereof, the tumor-associated one. Antigen or part thereof, the antibody or the cytotoxic or helper T lymphocytes. In one embodiment, the disease is characterized by the expression or abnormal expression of several different tumor-associated antigens and the detection comprises detection of several nucleic acids encoding the several different tumor-associated antigens, or portions thereof, detection of the several different tumor-associated antigens or portions thereof, detection of multiple antibodies to the several different tumor-associated antigens or to portions thereof or the detection of multiple cytotoxic or helper T lymphocytes specific for the several different tumor-associated antigens. In another embodiment, the isolated biological sample from the patient is compared to a comparable normal biological sample.

In a further aspect, the invention relates to a method for determining the regression, the course or the onset of a disease characterized by the expression or abnormal expression of a tumor-associated antigen identified according to the invention, comprising monitoring a sample from a patient receiving the Disease or suspected of contracting the disease with respect to one or more parameters selected from the group consisting of (i) the amount of the nucleic acid encoding the tumor-associated antigen or a portion thereof , (ii) the amount of tumor-associated antigen or portion thereof, (iii) the amount of antibody that binds to the tumor-associated antigen or portion thereof, and (iv) the amount of cytolytic T cell or helper T cells specific for a complex between the tumor-associated antigen or a part thereof and an MHC molecule. The method preferably comprises the determination of the parameter (s) at a first time in a first sample and at a second time in another sample, wherein the course of the disease is determined by comparing the two samples. In certain embodiments, the disease is characterized by the expression or abnormal expression of a plurality of different tumor-associated antigens and monitoring includes monitoring (i) the amount of multiple nucleic acids encoding the several different tumor-associated antigens, or portions thereof and / or (ii) the amount of the several different tumor-associated antigens or parts thereof and / or (iii) the amount of multiple antibodies that bind to the several different tumor-associated antigens or parts thereof, and / or (iv) the amount of multiple cytolytic T cells or helper T cells specific for complexes between the several different tumor-associated antigens or portions thereof and MHC molecules.

Detection of a nucleic acid or portion thereof, or monitoring of the amount of a nucleic acid or portion thereof, may be accomplished with a polynucleotide probe that specifically hybridizes to the nucleic acid or portion thereof, or by selective amplification of the nucleic acid or portion thereof , In one embodiment, the polynucleotide probe comprises a sequence of 6-50, in particular 10-30, 15-30 and 20-30 contiguous nucleotides from the nucleic acid.

In certain embodiments, the tumor-associated antigen or portion thereof to be detected is present intracellularly or on the cell surface. Detection of a tumor-associated antigen or portion thereof or monitoring the amount of a tumor-associated antigen or portion thereof may be accomplished in accordance with the invention with an antibody that specifically binds to the tumor-associated antigen or portion thereof.

In further embodiments, the tumor-associated antigen or portion thereof to be detected is in complex with an MHC molecule, particularly an HLA molecule.

Detection of an antibody or monitoring of the amount of antibodies can be carried out according to the invention with a protein or peptide which specifically binds to the antibody.

Detection of cytolytic T cells or helper T cells, or monitoring the amount of cytolytic T cells or helper T cells specific for complexes between an antigen or a portion thereof and MHC molecules, can be used in accordance with the invention a cell presenting the complex between the antigen or part thereof and an MHC molecule.

The polynucleotide probe used for detection or monitoring, the antibody, protein or peptide or cell are preferably detectably labeled. In certain embodiments, the detectable marker is a radioactive marker or an enzyme label. The detection of T-lymphocytes can additionally be done by detecting their proliferation, their cytokine production, and their cytotoxic activity, which is triggered by the specific stimulation with the complex of MHC and tumor-associated Antigen or parts thereof. The detection of T-lymphocytes can also be carried out by a recombinant MHC molecule or even a complex of several MHC molecules which are loaded with the respective immunogenic fragment from one or more of the tumor-associated antigens and by contacting the specific T-cell receptor identify the specific T lymphocytes.

In a further aspect, the invention relates to a method of treating, diagnosing or monitoring a disease characterized by the expression or abnormal expression of a tumor-associated antigen identified according to the invention, comprising administering to the tumor-associated antigen or antibody an antibody Part of binds and is coupled with a therapeutic or diagnostic agent. The antibody may be a monoclonal antibody. In further embodiments, the antibody is a chimeric or humanized antibody or a fragment of a natural antibody.

The invention also relates to a method for treating a patient with a disease characterized by the expression or abnormal expression of a tumor-associated antigen identified according to the invention, comprising (i) removing a sample from the patient with immunoreactive cells, (ii) Contacting the sample with a host cell expressing the tumor-associated antigen or portion thereof, under conditions favoring production of cytolytic T cells against the tumor-associated antigen or portion thereof, and (iii) introducing the cytolytic T Cells in the patient in an amount effective to lyse cells expressing the tumor-associated antigen or a portion thereof. The invention also relates to the cloning of the T-cell receptor of cytolytic T-cells against the tumor-associated antigen. This can be transferred to other T cells, which thus obtain the desired specificity and as in (iii) can be introduced into the patient.

In one embodiment, the host cell endogenously expresses an HLA molecule. In another embodiment, the host cell expresses an HLA molecule and / or the tumor-associated antigen or part thereof recombinantly. Preferably, the host cell is non-proliferative. In a preferred embodiment, the host cell is an antigen-presenting cell, in particular a dendritic cell, a monocyte or a macrophage.

In a further aspect, the invention relates to a method for treating a patient with a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising (i) the identification of a nucleic acid encoding a tumor-associated antigen identified according to the invention, (ii) the transfection of a host cell with the nucleic acid or a part thereof, (iii) the cultivation of the transfected host cell for expression of the nucleic acid (this is not the case when a high transfection rate is reached) obligate), and (iv) introducing the host cells or an extract thereof into the patient in an amount effective to increase the immune response to the patient's cells associated with the disease. The method may further comprise identifying an MHC molecule presenting the tumor-associated antigen or a portion thereof, wherein the host cell expresses the identified MHC molecule and presents the tumor-associated antigen or portion thereof. The immune response may include a B-cell response or a T-cell response. In addition, a T-cell response may include the production of cytolytic T-cells and / or helper T-cells specific for the host cells which present the tumor-associated antigen or a part thereof or are specific for cells of the patient expressing the tumor-associated antigen or a part thereof.

The invention also relates to a method of treating a disorder characterized by the expression or abnormal expression of a tumor-associated antigen identified according to the invention, comprising (i) the identification of cells from the patient which express abnormal amounts of the tumor-associated antigen, (ii) isolating a sample of the cells, (ii) culturing the cells, and (iv) introducing the cells into the patient in an amount effective to induce an immune response to the cells.

Preferably, the host cells used in the invention are non-proliferative or rendered non-proliferative. A disease characterized by the expression or abnormal expression of a tumor-associated antigen is, in particular, cancer.

Furthermore, the present invention relates to a nucleic acid selected from the group consisting of (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2-5, 20-21, 31-33 , 39, 54-57, 62, 63, 85-88 a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which relates to and (d) a nucleic acid which is complementary to the nucleic acid of (a), (b) or (c). The invention further relates to a nucleic acid which codes for a protein or polypeptide which comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65, 89-100 a part or derivative thereof.

In a further aspect, the invention relates to promoter sequences of nucleic acids according to the invention. These may be operably linked to another gene, preferably in an expression vector, thus ensuring selective expression of that gene in corresponding cells.

In a further aspect, the invention relates to a recombinant nucleic acid molecule, in particular a DNA or RNA molecule, which comprises a nucleic acid according to the invention.

The invention also relates to host cells which contain a nucleic acid according to the invention or a recombinant nucleic acid molecule which comprises a nucleic acid according to the invention.

The host cell may further comprise a nucleic acid encoding an HLA molecule. In one embodiment, the host cell expresses the HLA molecule endogenously. In a further embodiment, the host cell recombinantly expresses the HLA molecule and / or the nucleic acid according to the invention or a part thereof. Preferably, the host cell is non-proliferative. In a preferred embodiment, the host cell is an antigen-presenting cell, in particular a dendritic cell, a monocyte or a macrophage.

In a further embodiment, the invention relates to oligonucleotides which hybridize with a nucleic acid identified according to the invention and can be used as genetic probes or as "antisense" molecules. Nucleic acid molecules in the form of Oligonucleotide primers or competent samples which hybridize with a nucleic acid identified according to the invention or parts thereof can be used to find nucleic acids which are homologous to the nucleic acid identified according to the invention. PCR amplification, Southern and Northern hybridization can be used to detect homologous nucleic acids. Hybridization can occur under low, better under medium, and most preferably under high stringency conditions. The term "stringent conditions" according to the invention relates to conditions that allow specific hybridization between polynucleotides.

In a further aspect, the invention relates to a protein or polypeptide encoded by a nucleic acid selected from the group consisting of (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2 -5, 20-21, 31-33, 39, 54-57, 62, 63, 85-88 a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a) , (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b) and (d) a nucleic acid which is complementary to the nucleic acid under (a), (b) or (c). In a preferred embodiment, the invention relates to a protein or polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65 , 89-100 part or derivative thereof.

In a further aspect, the invention relates to an immunogenic fragment of a tumor-associated antigen identified according to the invention. The fragment preferably binds to a human HLA receptor or human antibody. A fragment according to the invention preferably comprises a sequence of at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30 or at least 50 amino acids.

In a further aspect, the invention relates to an agent which binds to a tumor-associated antigen identified according to the invention or to a part thereof. In a preferred embodiment, the agent is an antibody. In other embodiments, the antibody is a chimeric antibody, a humanized or combinatorial antibody, or a fragment of an antibody. Furthermore, the invention relates to an antibody which selectively to a complex of (i) one according to the invention identified tumor-associated antigen or a part thereof and (ii) an MHC molecule binds to which the inventively identified tumor-associated antigen or the part thereof binds, wherein the antibody does not bind alone to (i) or (ii). An antibody of the invention may be a monoclonal antibody. In further embodiments, the antibody is a chimeric or humanized antibody or a fragment of a natural antibody.

The invention further relates to a conjugate between an agent according to the invention which binds to a tumor-associated antigen identified according to the invention or to a part thereof, or an antibody according to the invention and a therapeutic or diagnostic agent. In one embodiment, the therapeutic or diagnostic agent is a toxin.

In a further aspect, the invention relates to a kit for detecting the expression or abnormal expression of a tumor-associated antigen identified according to the invention, comprising means for detecting (i) the nucleic acid encoding the tumor-associated antigen or a part thereof, (ii ) of the tumor-associated antigen or a part thereof, (iii) antibodies which bind to the tumor-associated antigen or a part thereof, and / or (iv) T cells which are responsible for a complex between the tumor-associated Antigen or part thereof and an MHC molecule. In one embodiment, the means for detecting the nucleic acid or the part thereof are nucleic acid molecules for the selective amplification of the nucleic acid, which comprise in particular a sequence of 6-50, in particular 10-30, 15-30 and 20-30 contiguous nucleotides from the nucleic acid.

1. 1. Phannazeutische Zusammensetzung, umfassend ein Mittel, das die Expression oder Aktivität eines Tumor-assoziierten Antigens hemmt, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
   1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88 einem Teil oder Derivat davon ausgewählt ist,
   2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
   3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
   4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
2. 2. Pharmazeutische Zusammensetzung, umfassend ein Mittel mit tumorhemmender Aktivität, das selektiv ist für Zellen, die eine Expression oder abnormale Expression eines tumorassoziierten Antigens aufweisen, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus
   1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
   2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
   3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
   4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
3. 3. Pharmazeutische Zusammensetzung nach Ziffer 2, wobei das Mittel die Induktion des Zelltods, die Reduktion des Zellwachstums, eine Schädigung der Zellmembran oder eine Sekretion von Zytokinen bewirkt.
4. 4. Pharmazeutische Zusammensetzung nach Ziffer 1 oder 2, wobei das Mittel eine Antisense-Nukleinsäure ist, die selektiv mit der Nukleinsäure hybridisiert, die für das Tumor-assoziierte Antigen kodiert.
5. 5. Pharmazeutische Zusammensetzung nach Ziffer 1 oder 2, wobei das Mittel ein Antikörper ist, der selektiv an das Tumor-assoziierte Antigen bindet.
6. 6. Pharmazeutische Zusammensetzung nach Ziffer 2, wobei das Mittel ein komplementaktivierender Antikörper ist, der selektiv an das Tumor-assoziierter Antigen bindet.
7. 7. Pharmazeutische Zusammensetzung, umfassend ein Mittel, das bei einer Verabreichung selektiv die Menge an Komplexen zwischen einem HLA-Molekül und einem Tumor-assoziierten Antigen oder einem Teil davon erhöht, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
   1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
   2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
   3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
   4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
8. 8. Pharmazeutische Zusammensetzung nach Ziffer 7, wobei das Mittel einen oder mehrere Bestandteile umfasst, die aus der Gruppe ausgewählt sind, bestehend aus:
   1. (i) dem Tumor-assoziierten Antigen oder einem Teil davon,
   2. (ii) einer Nukleinsäure, die für das Tumor-assoziierte Antigen oder einen Teil davon kodiert,
   3. (iii) einer Wirtszelle, die das Tumor-assoziierte Antigen oder einen Teil davon exprimiert, und
   4. (iv) isolierten Komplexen zwischen dem Tumor-assoziierten Antigen oder einem Teil davon und einem HLA-Molekül.
9. 9. Pharmazeutische Zusammensetzung nach Ziffer 1, 2 oder 7, wobei das Mittel mehrere Mittel umfasst, die jeweils selektiv die Expression oder Aktivität verschiedener Tumor-assoziierter Antigene hemmen, jeweils selektiv für Zellen sind, die verschiedene Tumor-assoziierte Antigene exprimieren oder die Menge an Komplexen zwischen HLA-Molekülen und verschiedenen Tumor-assoziierten Antigenen oder Teilen davon erhöhen, wobei mindestens eines der Tumor-assoziierten Antigene eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
   1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
   2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
   3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
   4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
10. 10. Pharmazeutische Zusammensetzung umfassend einen oder mehrer Bestandteile, die aus der Gruppe ausgewählt sind, bestehend aus:
    1. (i) einem Tumor-assoziierten Antigen oder einem Teil davon,
    2. (ii) einer Nukleinsäure, die für ein Tumor-assoziiertes Antigen oder einen Teil davon kodiert,
    3. (iii) einem Antikörper, der an ein Tumor-assoziiertes Antigen oder einen Teil davon bindet,
    4. (iv) einer Antisense-Nukleinsäure, die spezifisch mit einer Nukleinsäure, die für ein Tumor-assoziiertes Antigen kodiert, hybridisiert,
    5. (v) einer Wirtszelle, die ein Tumor-assoziiertes Antigen oder einen Teil davon exprimiert, und
    6. (vi) isolierten Komplexen zwischen einem Tumor-assoziierten Antigen oder einem Teil davon und einem HLA-Molekül,
       wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29; 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
11. 11. Pharmazeutische Zusammensetzung nach Ziffer 8 oder 10, wobei die Nukleinsäure unter (ii) in einem Expressionsvektor vorliegt.
12. 12. Pharmazeutische Zusammensetzung nach Ziffer 8 oder 10, wobei die Nukleinsäure unter (ii) funktionell mit einem Promotor verbunden ist.
13. 13. Pharmazeutische Zusammensetzung nach Ziffer 8 oder 10, wobei die Wirtszelle das Tumor-assoziierte Antigen oder den Teil davon sekretiert.
14. 14. Pharmazeutische Zusammensetzung nach Ziffer 8 oder 10, wobei die Wirtszelle zusätzlich ein HLA-Molekül exprimiert, das an das Tumor-assoziierte Antigen oder den Teil davon bindet.
15. 15. Pharmazeutische Zusammensetzung nach Ziffer 14, wobei die Wirtszelle das HLA-Molekül und/oder das Tumor-assoziierte Antigen oder den Teil davon rekombinant exprimiert.
16. 16. Pharmazeutische Zusammensetzung nach Ziffer 14, wobei die Wirtszelle das HLA-Molekül endogen exprimiert.
17. 17. Pharmazeutische Zusammensetzung nach Ziffer 8, 10, 14 oder 16, wobei die Wirtszelle eine Antigen-präsentierende Zelle ist.
18. 18. Pharmazeutische Zusammensetzung nach Ziffer 17, wobei die Antigen-präsentierende Zelle eine dendritische Zelle oder ein Makrophage ist.
19. 19. Pharmazeutische Zusammensetzung nach einer der Ziffern 8, 10 und 13-18, wobei die Wirtszelle nicht-proliferativ ist.
20. 20. Pharmazeutische Zusammensetzung nach Ziffer 5 oder 10, wobei der Antikörper ein monoklonaler Antikörper ist.
21. 21. Pharmazeutische Zusammensetzung nach Ziffer 5 oder 10, wobei der Antikörper ein chimärer oder humanisierter Antikörper ist.
22. 22. Pharmazeutische Zusammensetzung nach Ziffer 5 oder 10, wobei der Antikörper ein Fragment eines natürlichen Antikörpers ist.
23. 23. Pharmazeutische Zusammensetzung nach Ziffer 5 oder 10, wobei der Antikörper mit einem therapeutischen oder diagnostischen Mittel gekoppelt ist.
24. 24. Pharmazeutische Zusammensetzung nach Ziffer 4 oder 10, wobei die Antisense-Nukleinsäure eine Sequenz von 6-50 zusammenhängenden Nukleotiden aus der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, umfasst.
25. 25. Pharmazeutische Zusammensetzung nach einer der Ziffern 8 und 10-13, wobei das durch die pharmazeutische Zusammensetzung bereitgestellte Tumor-assoziierte Antigen oder der Teil davon an MHC-Moleküle auf der Oberfläche von Zellen bindet, die eine abnormale Menge des Tumor-assoziierten Antigens oder eines Teils davon exprimieren.
26. 26. Pharmazeutische Zusammensetzung nach Ziffer 25, wobei die Bindung eine cytolytische Reaktion hervorruft und/ oder eine Cytokinausschüttung induziert
27. 27. Pharmazeutische Zusammensetzung nach einer der Ziffern 1-26, ferner umfassend einen pharmazeutisch verträglichen Träger und/oder ein Adjuvans.
28. 28. Pharmazeutische Zusammensetzung nach Ziffer 27, wobei das Adjuvans Saponin, GM-CSF, CpG, Zytokin oder ein Chemokin ist.
29. 29. Pharmazeutische Zusammensetzung nach einer der Ziffern 1-28, die zur Behandlung einer Erkrankung eingesetzt werden kann, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet.
30. 30. Pharmazeutische Zusammensetzung nach Ziffer 29, wobei die Erkrankung Krebs ist.
31. 31. Pharmazeutische Zusammensetzung nach Ziffer 29, wobei die Erkrankung ein Lungentumor, ein Brusttumor, ein Prostatatumor, ein Melanom, ein Colontumor, eine Metastase eines Colontumors, ein Nierenzellkarzinom oder ein Zervixkarzinom, ein Coloncarcinom oder ein Mammacarcinom ist.
32. 32. Pharmazeutische Zusammensetzung nach einer der Ziffern 1-31, wobei das Tumor-assoziierte Antigen eine Aminosäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 80-84, 89-100 einem Teil oder Derivat davon ausgewählt ist.
33. 33. Verfahren zur Diagnose einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend
    1. (i) den Nachweis einer Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, oder eines Teils davon, und/oder
    2. (ii) den Nachweis des Tumor-assoziierten Antigens oder eines Teils davon, und/oder
    3. (iii) den Nachweis eines Antikörpers gegen das Tumor-assoziierte Antigen oder eines Teils davon und/oder
    4. (iv) den Nachweis von cytotoxischen oder Helfer-T-Lymphozyten, die für das Tumor-assoziierte Antigen oder einen Teil davon spezifisch sind in einer aus einem Patienten isolierten biologischen Probe, wobei
       das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
34. 34. Verfahren nach Ziffer 33, wobei der Nachweis
    1. (i) die Kontaktierung der biologischen Probe mit einem Mittel, das spezifisch an die Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, oder den Teil davon, an das Tumor-assoziierte Antigen oder den Teil davon, an den Antikörper oder an die cytotoxischen oder Helfer-T-Lymphozyten bindet, und
    2. (ii) den Nachweis der Komplexbildung zwischen dem Mittel und der Nukleinsäure oder dem Teil davon, dem Tumor-assoziierten Antigen oder dem Teil davon, dem Antikörper oder den cytotoxischen oder Helfer-T-Lymphozyten umfasst.
35. 35. Verfahren nach Ziffer 33 oder 34, wobei der Nachweis mit dem Nachweis in einer vergleichbaren normalen biologischen Probe verglichen wird.
36. 36. Verfahren nach einer der Ziffern 33-35, wobei sich die Erkrankung durch die Expression oder abnormale Expression mehrerer verschiedener Tumor-assoziierter Antigene auszeichnet und der Nachweis einen Nachweis mehrerer Nukleinsäuren, die für die mehreren verschiedenen Tumor-assoziierten Antigene kodieren, oder von Teilen davon, den Nachweis der mehreren verschiedenen Tumor-assoziierten Antigene oder von Teilen davon, den Nachweis mehrerer Antikörper, die an die mehreren verschiedenen Tumor-assoziierten Antigene oder an Teile davon binden, oder den Nachweis mehrerer cytotoxischer oder Helfer-T-Lymphozyten, die für die mehreren verschiedenen Tumor-assoziierten Antigene spezifisch sind, umfasst.
37. 37. Verfahren nach einer der Ziffern 33-36, wobei der Nachweis der Nukleinsäure oder des Teils davon mit einer Polynukleotid-Sonde erfolgt, die spezifisch mit der Nukleinsäure oder dem Teil davon hybridisiert.
38. 38. Verfahren nach Ziffer 37, wobei die Polynukleotid-Sonde eine Sequenz von 6-50 zusammenhängenden Nukleotiden aus der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, umfasst.
39. 39. Verfahren nach einer der Ziffern 33-36, wobei der Nachweis der Nukleinsäure oder des Teils davon durch selektive Amplifikation der Nukleinsäure oder des Teils davon erfolgt.
40. 40. Verfahren nach einer der Ziffern 33-36, wobei das nachzuweisende Tumor-assoziierte Antigen oder der Teil davon in einem Komplex mit einem MHC-Molekül vorliegt.
41. 41. Verfahren nach Ziffer 40, wobei das MHC-Molekül ein HLA-Molekül ist.
42. 42. Verfahren nach einer der Ziffern 33-36 und 40-41, wobei der Nachweis des Tumor-assoziierten Antigens oder des Teils davon mit einem Antikörper erfolgt, der spezifisch an das Tumor-assoziierte Antigen oder den Teil davon bindet.
43. 43. Verfahren nach einer der Ziffern 33-36, wobei der Nachweis des Antikörpers mit einem Protein oder Peptid erfolgt, das spezifisch an den Antikörper bindet.
44. 44. Verfahren zur Bestimmung der Regression, des Verlaufs oder des Ausbruchs einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend die Überwachung einer Probe aus einem Patienten, der die Erkrankung aufweist oder in Verdacht steht, an der Erkrankung zu erkranken in Bezug auf einen oder mehrere Parameter, ausgewählt aus der Gruppe, bestehend aus:
    1. (i) der Menge der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, oder eines Teil davon,
    2. (ii) der Menge des Tumor-assoziierten Antigens oder eines Teils davon,
    3. (iii) der Menge an Antikörpern, die an das Tumor-assoziierte Antigen oder einen Teil davon binden, und
    4. (iv) der Menge an cytolytischen oder Cytokin-ausschüttenden T-Zellen, die für einen Komplex zwischen dem Tumor-assoziierten Antigen oder einem Teil davon und einem MHC-Molekül spezifisch sind, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
45. 45. Verfahren nach Ziffer 44, wobei das Verfahren die Bestimmung des oder der Parameter zu einem ersten Zeitpunkt in einer ersten Probe und zu einem zweiten Zeitpunkt in einer weiteren Probe umfasst und durch einen Vergleich der beiden Proben der Verlauf der Erkrankung ermittelt wird.
46. 46. Verfahren nach Ziffer 44 oder 45, wobei die Erkrankung sich durch die Expression oder abnormale Expression mehrerer verschiedener Tumor-assoziierter Antigene auszeichnet und die Überwachung eine Überwachung
    1. (i) der Menge mehrerer Nukleinsäuren, die für die mehreren verschiedenen Tumor-assoziierten Antigene kodieren, oder von Teilen davon,
    2. (ii) der Menge der mehreren verschiedenen Tumor-assoziierten Antigene oder von Teilen davon,
    3. (iii) der Menge mehrerer Antikörper, die an die mehreren verschiedenen Tumor-assoziierten Antigene oder an Teile davon binden, und/oder
    4. (iv) der Menge mehrerer cytolytischer oder Cytokine-ausschüttender T-Zellen, die für Komplexe zwischen den mehreren verschiedenen Tumor-assoziierten Antigenen oder von Teilen davon und MHC-Molekülen spezifisch sind, umfasst.
47. 47. Verfahren nach einer der Ziffern 44-46, wobei die Überwachung der Menge der Nukleinsäure oder des Teils davon mit einer Polynukleotid-Sonde erfolgt, die spezifisch mit der Nukleinsäure oder dem Teil davon hybridisiert.
48. 48. Verfahren nach Ziffer 47, wobei die Polynukleotid-Sonde eine Sequenz von 6-50 zusammenhängenden Nukleotiden aus der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, umfasst.
49. 49. Verfahren nach einer der Ziffern 44-46, wobei die Überwachung der Menge der Nukleinsäure oder des Teils davon durch selektive Amplifikation der Nukleinsäure oder des Teils davon erfolgt.
50. 50. Verfahren nach einer der Ziffern 44-46, wobei die Überwachung der Menge des Tumor-assoziierten Antigens oder des Teils davon mit einem Antikörper erfolgt, der spezifisch an das Tumor-assoziierte Antigen oder den Teil davon bindet.
51. 51. Verfahren nach einer der Ziffern 44-46, wobei die Überwachung der Menge an Antikörpern mit einem Protein oder Peptid erfolgt, das spezifisch an den Antikörper bindet.
52. 52. Verfahren nach einer der Ziffern 44-46, wobei die Überwachung der Menge an cytolytischen oder Cytokin-aussschüttenden T-Zellen mit einer Zelle erfolgt, die den Komplex zwischen dem Tumor-assoziierten Antigen oder dem Teil davon und einem MHC-Molekül präsentiert.
53. 53. Verfahren nach einer der Ziffern 37-38, 42-43, 47-48 und 50-52, wobei die Polynukleotid-Sonde, der Antikörper, das Protein oder Peptid oder die Zelle nachweisbar markiert sind.
54. 54. Verfahren nach Ziffer 53, wobei der nachweisbare Marker ein radioaktiver Marker oder ein Enzymmarker ist.
55. 55. Verfahren nach einer der Ziffern 33-54, wobei die Probe Körperflüssigkeit und/oder Körpergewebe umfasst.
56. 56. Verfahren zur Behandlung einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend die Verabreichung einer pharmazeutischen Zusammensetzung nach einer der Ziffern 1-32, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
    1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
    2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
    3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
    4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
57. 57. Verfahren zur Behandlung, Diagnose oder Überwachung einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend die Verabreichung eines Antikörpers, der an das Tumor-assoziierte Antigen oder einen Teil davon bindet und mit einem therapeutischen oder diagnostischen Mittel gekoppelt ist, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
    1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
    2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
    3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
    4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
58. 58. Verfahren nach Ziffer 42, 50 oder 57, wobei der Antikörper ein monoklonaler Antikörper ist.
59. 59. Verfahren nach Ziffer 42, 50 oder 57, wobei der Antikörper ein chimärer oder humanisierter Antikörper ist.
60. 60. Verfahren nach Ziffer 42, 50 oder 57, wobei der Antikörper ein Fragment eines natürlichen Antikörpers ist.
61. 61. Verfahren zur Behandlung eines Patienten mit einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend:
    1. (i) die Entfernung einer Probe mit immunreaktiver Zellen aus dem Patienten,
    2. (ii) die Kontaktierung der Probe mit einer Wirtszelle, die das Tumor-assoziierte Antigen oder einen Teil davon exprimiert, unter Bedingungen, die eine Produktion cytolytischer oder Cytokine-ausschüttender T-Zellen gegen das Tumor-assoziierte Antigen oder einen Teil davon begünstigen, und
    3. (iii) das Einbringen der cytolytischen oder Cytokine-ausschüttenden T-Zellen in den Patienten in einer Menge, die geeignet ist, Zellen zu lysieren, die das Tumor-assoziierte Antigen oder einen Teil davon exprimieren, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
62. 62. Verfahren nach Ziffer 61, wobei die Wirtszelle ein HLA-Molekül rekombinant exprimiert, das an das Tumor-assoziierte Antigen oder einen Teil davon bindet.
63. 63. Verfahren nach Ziffer 62, wobei die Wirtszelle ein HLA-Molekül endogen exprimiert, das an das Tumor-assoziierte Antigen oder einen Teil davon bindet.
64. 64. Verfahren zur Behandlung eines Patienten mit einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend:
    1. (i) die Identifizierung einer Nukleinsäure, die von Zellen exprimiert wird, die mit der Erkrankung assoziiert sind, wobei die Nukleinsäure aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist,
    2. (ii) die Transfelction einer Wirtszelle mit der Nukleinsäure oder einem Teil davon,
    3. (iii) die Kultivierung der transfizierten Wirtszelle für eine Expression der Nukleinsäure, und
    4. (iv) das Einbringen der Wirtszellen oder eines Extrakts davon in den Patienten in einer Menge, die geeignet ist, die Immunreaktion gegen die Zellen des Patienten, die mit der Erkrankung assoziiert sind, zu erhöhen.
65. 65. Verfahren nach Ziffer 64, ferner umfassend die Identifizierung eines MHC-Moleküls, das das Tumor-assoziierte Antigen oder einen Teil davon präsentiert, wobei die Wirtszelle das identifizierte MHC-Molekül exprimiert und das Tumor-assoziierte Antigen oder einen Teil davon präsentiert.
66. 66. Verfahren nach Ziffer 64 oder 65, wobei die Immunreaktion eine B-Zellen-Reaktion oder eine T-Zellen-Reaktion umfasst.
67. 67. Verfahren nach Ziffer 66, wobei die Immunreaktion eine T-Zellen-Reaktion ist, umfassend die Produktion cytolytischer oder Cytokine-ausschüttenden T-Zellen, die spezifisch für die Wirtszellen sind, die das Tumor-assoziierte Antigen oder einen Teil davon präsentieren oder spezifisch für Zellen des Patienten sind, die das Tumor-assoziierte Antigen oder einen Teil davon exprimieren.
68. 68. Verfahren nach einer der Ziffern 61-67, wobei die Wirtszellen nicht-proliferativ sind.
69. 69. Verfahren zur Behandlung einer Erkrankung, die sich durch die Expression oder abnormale Expression eines Tumor-assoziierten Antigens auszeichnet, umfassend:
    1. (i) die Identifikation von Zellen aus dem Patienten, die abnormale Mengen des Tumor-assoziierten Antigens exprimieren,
    2. (ii) die Isolierung einer Probe der Zellen,
    3. (iii) die Kultivierung der Zellen, und
    4. (iv) das Einbringen der Zellen in den Patienten in einer Menge, die geeignet ist, eine Immunreaktion gegen die Zellen auszulösen, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst; die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
70. 70. Verfahren nach einer der Ziffern 33-69, wobei die Erkrankung Krebs ist.
71. 71. Verfahren zur Hemmung der Entwicklung von Krebs bei einem Patienten, umfassend die Verabreichung einer wirksamen Menge einer pharmazeutischen Zusammensetzung nach einer der Ziffern 1-32.
72. 72. Verfahren nach einer der Ziffern 33-71, wobei das Tumor-assoziierte Antigen eine Aminosäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 80-84, 89-100 einem Teil oder Derivat davon ausgewählt ist.
73. 73. Nukleinsäure, die aus der Gruppe ausgewählt ist, bestehend aus:
    1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 2-5, 20-21, 31-33, 37, 39, 54-57, 62, 63, 85-88 einem Teil oder Derivat davon ausgewählt ist,
    2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
    3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
    4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
74. 74. Nukleinsäure, die für ein Protein oder Polypeptid kodiert, das eine Aminosäuresequenz umfasst, ausgewählt aus der Gruppe bestehend aus SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65, 89-100 einem Teil oder Derivat davon.
75. 75. Rekombinantes DNA- oder RNA-Molekül, das eine Nukleinsäure nach Ziffer 73 oder 74 umfasst.
76. 76. Rekombinantes DNA-Molekül nach Ziffer 75, wobei das rekombinante DNA-Molekül ein Vektor ist.
77. 77. Rekombinantes DNA-Molekül nach Ziffer 76, wobei der Vektor ein viraler Vektor oder ein Bakteriophage ist.
78. 78. Rekombinantes DNA-Molekül nach einer der Ziffern 75-77, das ferner Expressionskontrollsequenzen umfasst, die die Expression der Nukleinsäure steuern.
79. 79. Rekombinantes DNA-Molekül nach Ziffer 78, wobei die Expressionskontrollsequenzen homo- oder heterolog zu der Nukleinsäure sind.
80. 80. Wirtszelle, die eine Nukleinsäure nach Ziffer 73 oder 74 oder ein rekombinantes DNA-Molekül nach einer der Ziffern 75-79 umfasst.
81. 81. Wirtszelle nach Ziffer 80, die ferner eine Nukleinsäure umfasst, die für ein HLA-Molekül kodiert.
82. 82. Protein oder Polypeptid, das von einer Nukleinsäure nach Ziffer 73 kodiert wird.
83. 83. Protein oder Polypeptid, das eine Aminosäuresequenz umfasst, ausgewählt aus der Gruppe bestehend aus SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65, 89-100 einem Teil oder Derivat davon.
84. 84. Immunogenes Fragment des Proteins oder Polypeptids nach Ziffer 82 oder 83.
85. 85. Fragment des Proteins oder Polypeptids nach Ziffer 82 oder 83, das an menschlichen HLA-Rezeptor oder menschlichen Antikörper bindet.
86. 86. Mittel, das spezifisch an ein Protein oder Polypeptid oder an einen Teil davon bindet, wobei das Protein oder Polypeptid von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
    1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
    2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
    3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
    4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
87. 87. Mittel nach Ziffer 86, wobei das Protein oder Polypeptid eine Aminosäuresequenz umfasst, die aus der Gruppe ausgewählt ist, bestehend aus SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 80-84, 89-100 einem Teil oder Derivat davon.
88. 88. Mittel nach Ziffer 86 oder 87, wobei das Mittel ein Antikörper ist.
89. 89. Mittel nach Ziffer 88, wobei der Antikörper ein monoklonaler, chimärer oder humanisierter Antikörper oder ein Fragment eines Antikörpers ist.
90. 90. Antikörper, der selektiv an einen Komplex aus:
    1. (i) einem Protein oder Polypeptid oder einem Teil davon und
    2. (ii) einem MHC-Molekül bindet, an das das Protein oder Polypeptid oder der Teil davon bindet, wobei der Antiköper nicht alleine an (i) oder (ii) bindet und das Protein oder Polypeptid von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
91. 91. Antikörper nach Ziffer 90, wobei das Protein oder Polypeptid eine Aminosäuresequenz umfasst, die aus der Gruppe ausgewählt ist, bestehend aus SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 80-84, 89-100, einem Teil oder Derivat davon.
92. 92. Antikörper nach Ziffer 90 oder 91, wobei der Antikörper ein monoklonaler, chimärer oder humanisierter Antikörper oder ein Fragment eines Antikörpers ist.
93. 93. Konjugat zwischen einem Mittel nach einer der Ziffern 86-89 oder einem Antikörper nach einer der Ziffern 90-92 und einem therapeutischen oder diagnostischen Mittel.
94. 94. Konjugat nach Ziffer 93, wobei das therapeutische oder diagnostische Mittel ein Toxin ist.
95. 95. Kit zum Nachweis der Expression oder abnormalen Expression eines Tumor-assoziierten Antigens, umfassend Mittel zum Nachweis
    1. (i) der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, oder eines Teils davon,
    2. (ii) des Tumor-assoziierten Antigens oder eines Teils davon,
    3. (iii) von Antikörpern, die an das Tumor-assoziierte Antigen oder einen Teil davon binden, und/oder
    4. (iv) von T-Zellen, die für einen Komplex zwischen dem Tumor-assoziierten Antigen oder einem Teil davon und einem MHC-Molekül spezifisch sind, wobei das Tumor-assoziierte Antigen eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird, die aus der Gruppe ausgewählt ist, bestehend aus:
       1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfasst, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88 einem Teil oder Derivat davon ausgewählt ist,
       2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
       3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
       4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
96. 96. Kit nach Ziffer 95, wobei die Mittel zum Nachweis der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, oder eines Teils davon Nukleinsäuremoleküle für die selektive Amplifikation der Nukleinsäure sind.
97. 97. Kit nach Ziffer 96, wobei die Nukleinsäuremoleküle für die selektive Amplifikation der Nukleinsäure eine Sequenz von 6-50 zusammenhängenden Nukleotiden aus der Nukleinsäure, die für das Tumor-assoziierte Antigen kodiert, umfassen.
98. 98. Rekombinantes DNA-Molekül, umfassend eine Promotorregion, die von einer Nukleinsäuresequenz abgeleitet ist, die aus der Gruppe bestehend aus SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88 ausgewählt ist.
99. 99. Pharmazeutische Zusammensetzung, umfassend ein Mittel, das die Expression oder Aktivität des Tumorantigens TPTE SEQ ID NOs:19, 22 hemmt.
100. 100. Pharmazeutische Zusammensetzung, umfassend ein Mittel, das die Migrations- und Metastasierungsaktivität von TPTE hemmt.
101. 101. Mittel nach Ziffer 99 oder 100, wobei das Mittel ein Antikörper ist.
102. 102. Mittel nach Ziffer 101, wobei der Antikörper ein monoklonaler, chimärer oder humanisierter Antikörper oder ein Fragment eines Antikörpers ist.
103. 103. Antikörper, der an die extrazellulären Proteinbereiche umfassend die Sequenzen SEQ ID NOs:81-82 bindet.
104. 104. Mittel nach Ziffer 99 oder 100, wobei das Mittel eine Antisense-Nukleinsäure ist, die selektiv mit der Nukleinsäure hybridisiert, die für TPTE kodiert.
105. 105. Mittel nach Ziffer 104, wobei die Antisense-Nukleinsäure eine Sequenz von 6-50 zusammenhängenden Nukleotiden aus der Nukleinsäure, die für TPTE kodiert, umfasst.
106. 106. Mittel nach Ziffer 99 oder 100, wobei das Mittel RNA Interferenz (RNAi) ist.
107. 107. Mittel nach Ziffer 106, wobei RNAi eine sog. short hairpin Struktur (shRNA) enthält.
108. 108. Mittel nach Ziffer 107, wobei shRNA durch Transkription nach Transfektion mit Expressionsvektoren entstehen.
109. 109. Mittel nach Ziffer 107, wobei shRNA durch Transkription von Retroviren entsteht
110. 110. Mittel nach Ziffer 107, wobei shRNA durch lentivirale Systeme vermittelt wird.
111. 111. Mittel nach Ziffer 99 oder 100, wobei das Mittel ein kleines chemisches Molekül ist.
112. 112. Mittel nach Ziffer 111, wobei die kleinen chemischen Moleküle an TPTE binden
113. 113. Mittel nach Ziffer 112, wobei die kleinen chemischen Moleküle an die extrazellulären Bereiche umfassend SEQ ID NO:81-82 binden.
114. 114. Verfahren zur Behandlung Diagnose oder Überwachung eines metastasierenden Tumors, der sich durch die Expression oder abnormaler Expression von TPTE auszeichnet, umfassend die Verabreichung eines Antikörpers, der an TPTE oder einen Teil davon bindet und mit einem therapeutischen oder diagnostischen Mittel gekoppelt ist, wobei das TPTE eine Sequenz aufweist, die von einer Nukleinsäure kodiert wird bestehend aus:
     1. (a) einer Nukleinsäure, die eine Nukleinsäuresequenz umfassend die SEQ ID NO:19 einem Teil oder Derivat davon ausgewählt ist,
     2. (b) einer Nukleinsäure, die unter stringenten Bedingungen mit der Nukleinsäure unter (a) hybridisiert,
     3. (c) einer Nukleinsäure, die in Bezug auf die Nukleinsäure unter (a) oder (b) degeneriert ist und
     4. (d) einer Nukleinsäure, die zu der Nukleinsäure unter (a), (b) oder (c) komplementär ist.
115. 115. Verfahren nach Ziffer 114, wobei der Antikörper ein monoklonaler Antikörper ist.
116. 116. Verfahren nach Ziffer 114, wobei der Antikörper ein chimärer oder humanisierter Antikörper ist.
117. 117. Verfahren nach Ziffer 114, wobei der Antikörper ein Fragment eines natürlichen Antikörpers ist.

The invention particularly relates to the following:

1. A pharmaceutical composition comprising an agent that inhibits the expression or activity of a tumor-associated antigen, wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of:
   1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88 a part or derivative thereof,
   2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
   3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
   4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
2. A pharmaceutical composition comprising an agent having antitumor activity that is selective for cells having expression or abnormal expression of a tumor associated antigen, wherein the tumor associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of: is selected, consisting of
   1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
   2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
   3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
   4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
3. 3. A pharmaceutical composition according to item 2, wherein the agent causes the induction of cell death, the reduction of cell growth, damage to the cell membrane or secretion of cytokines.
4. 4. A pharmaceutical composition according to item 1 or 2, wherein the agent is an antisense nucleic acid which hybridizes selectively with the nucleic acid encoding the tumor-associated antigen.
5. 5. A pharmaceutical composition according to item 1 or 2, wherein the agent is an antibody that binds selectively to the tumor-associated antigen.
6. 6. A pharmaceutical composition according to item 2, wherein the agent is a complement-activating antibody that selectively binds to the tumor-associated antigen.
7. A pharmaceutical composition comprising an agent which, when administered, selectively increases the amount of complexes between an HLA molecule and a tumor-associated antigen or portion thereof, the tumor-associated antigen having a sequence encoding a nucleic acid which is selected from the group consisting of:
   1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
   2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
   3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
   4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
8. 8. A pharmaceutical composition according to item 7, wherein the agent comprises one or more ingredients selected from the group consisting of:
   1. (i) the tumor-associated antigen or a part thereof,
   2. (ii) a nucleic acid encoding the tumor-associated antigen or a part thereof,
   3. (iii) a host cell expressing the tumor-associated antigen or a portion thereof, and
   4. (iv) isolated complexes between the tumor-associated antigen or a part thereof and an HLA molecule.
9. 9. A pharmaceutical composition according to item 1, 2 or 7, wherein the agent comprises a plurality of agents each selectively inhibiting the expression or activity of various tumor-associated antigens, each being selective for cells expressing different tumor-associated antigens or amount Increase complexes between HLA molecules and various tumor-associated antigens or parts thereof, wherein at least one of the tumor-associated antigens has a sequence encoded by a nucleic acid selected from the group consisting of:
   1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
   2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
   3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
   4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
10. A pharmaceutical composition comprising one or more ingredients selected from the group consisting of:
    1. (i) a tumor-associated antigen or a part thereof,
    2. (ii) a nucleic acid encoding a tumor-associated antigen or a portion thereof,
    3. (iii) an antibody which binds to a tumor-associated antigen or a part thereof,
    4. (iv) an antisense nucleic acid that specifically hybridizes with a nucleic acid encoding a tumor-associated antigen,
    5. (v) a host cell expressing a tumor-associated antigen or a portion thereof, and
    6. (vi) isolated complexes between a tumor-associated antigen or a part thereof and an HLA molecule,
       wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29; 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
11. 11. Pharmaceutical composition according to item 8 or 10, wherein the nucleic acid is present under (ii) in an expression vector.
12. 12. A pharmaceutical composition according to item 8 or 10, wherein the nucleic acid under (ii) is operably linked to a promoter.
13. A pharmaceutical composition according to item 8 or 10, wherein the host cell secretes the tumor-associated antigen or part thereof.
14. 14. A pharmaceutical composition according to item 8 or 10, wherein the host cell additionally expresses an HLA molecule which binds to the tumor-associated antigen or the part thereof.
15. 15. The pharmaceutical composition according to item 14, wherein the host cell recombinantly expresses the HLA molecule and / or the tumor-associated antigen or the part thereof.
16. 16. The pharmaceutical composition according to item 14, wherein the host cell endogenously expresses the HLA molecule.
17. 17. A pharmaceutical composition according to item 8, 10, 14 or 16, wherein the host cell is an antigen-presenting cell.
18. 18. A pharmaceutical composition according to item 17, wherein the antigen-presenting cell is a dendritic cell or a macrophage.
19. 19. A pharmaceutical composition according to any of items 8, 10 and 13-18, wherein the host cell is non-proliferative.
20. 20. A pharmaceutical composition according to item 5 or 10, wherein the antibody is a monoclonal antibody.
21. 21. A pharmaceutical composition according to item 5 or 10, wherein the antibody is a chimeric or humanized antibody.
22. 22. A pharmaceutical composition according to item 5 or 10, wherein the antibody is a fragment of a natural antibody.
23. 23. A pharmaceutical composition according to item 5 or 10, wherein the antibody is coupled to a therapeutic or diagnostic agent.
24. 24. A pharmaceutical composition according to item 4 or 10, wherein the antisense nucleic acid comprises a sequence of 6-50 contiguous nucleotides from the nucleic acid encoding the tumor-associated antigen.
25. 25. A pharmaceutical composition according to any one of paragraphs 8 and 10-13, wherein the tumor-associated antigen provided by the pharmaceutical composition or the portion thereof binds to MHC molecules on the surface of cells containing an abnormal amount of the tumor-associated antigen express part of it.
26. 26. A pharmaceutical composition according to item 25, wherein the binding causes a cytolytic reaction and / or induces a cytokine secretion
27. 27. A pharmaceutical composition according to any one of items 1-26, further comprising a pharmaceutically acceptable carrier and / or adjuvant.
28. 28. A pharmaceutical composition according to item 27, wherein the adjuvant is saponin, GM-CSF, CpG, cytokine or a chemokine.
29. 29. A pharmaceutical composition according to any one of items 1-28, which can be used to treat a disease characterized by the expression or abnormal expression of a tumor-associated antigen.
30. 30. The pharmaceutical composition according to item 29, wherein the disease is cancer.
31. 31. The pharmaceutical composition according to item 29, wherein the disease is a lung tumor, a breast tumor, a prostate tumor, a melanoma, a colon tumor, a metastasis of a colon tumor, a renal cell carcinoma or a cervical carcinoma, a colon carcinoma or a mammary carcinoma.
32. 32. The pharmaceutical composition according to any one of items 1-31, wherein the tumor-associated antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 80-84, 89-100 a part or derivative thereof.
33. 33. A method of diagnosing a disorder characterized by the expression or abnormal expression of a tumor-associated antigen
    1. (i) the detection of a nucleic acid encoding the tumor-associated antigen, or a portion thereof, and / or
    2. (ii) the detection of the tumor-associated antigen or a part thereof, and / or
    3. (iii) the detection of an antibody to the tumor-associated antigen or a part thereof and / or
    4. (iv) the detection of cytotoxic or helper T lymphocytes specific for the tumor-associated antigen or a portion thereof in a biological sample isolated from a patient, wherein
       the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
34. 34. Procedure according to paragraph 33, whereby the proof
    1. (i) contacting the biological sample with an agent that specifically binds to the nucleic acid encoding the tumor-associated antigen or portion thereof, to the tumor-associated antigen or portion thereof, to the antibody or to the cytotoxic or helper T lymphocytes binds, and
    2. (ii) detecting the complexation between the agent and the nucleic acid or portion thereof, the tumor-associated antigen or portion thereof, the antibody, or the cytotoxic or helper T lymphocytes.
35. 35. The method according to item 33 or 34, wherein the detection is compared with the detection in a comparable normal biological sample.
36. 36. The method of any of clauses 33-35, wherein the disease is characterized by the expression or abnormal expression of a plurality of different tumor-associated antigens, and the detection comprises detection of a plurality of nucleic acids encoding the several different tumor-associated antigens or portions thereof detection of multiple different tumor-associated antigens or portions thereof, detection of multiple antibodies binding to, or portions of, several different tumor-associated antigens or detection of multiple cytotoxic or helper T lymphocytes responsible for which are specific to several different tumor-associated antigens.
37. 37. The method of any one of items 33-36, wherein the detection of the nucleic acid or portion thereof is with a polynucleotide probe that specifically hybridizes with the nucleic acid or portion thereof.
38. 38. The method of item 37, wherein the polynucleotide probe comprises a sequence of 6-50 contiguous nucleotides from the nucleic acid encoding the tumor-associated antigen.
39. 39. The method according to any one of paragraphs 33-36, wherein the detection of the nucleic acid or the part thereof is carried out by selective amplification of the nucleic acid or the part thereof.
40. 40. The method of any of items 33-36, wherein the tumor-associated antigen or portion thereof to be detected is in a complex with an MHC molecule.
41. 41. The method of item 40, wherein the MHC molecule is an HLA molecule.
42. 42. The method of any of items 33-36 and 40-41, wherein the detection of the tumor-associated antigen or portion thereof is with an antibody that binds specifically to the tumor-associated antigen or portion thereof.
43. 43. The method according to any one of items 33-36, wherein the detection of the antibody is carried out with a protein or peptide which binds specifically to the antibody.
44. 44. A method for determining the regression, course or onset of a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising monitoring a sample from a patient having or suspected of having the disease of the disease in relation to one or more parameters selected from the group consisting of:
    1. (i) the amount of nucleic acid encoding the tumor-associated antigen or a part thereof,
    2. (ii) the amount of the tumor-associated antigen or a part thereof,
    3. (iii) the amount of antibodies that bind to the tumor-associated antigen or a part thereof, and
    4. (iv) the amount of cytolytic or cytokine-releasing T cells specific for a complex between the tumor-associated antigen or a part thereof and an MHC molecule, the tumor-associated antigen having a sequence that is derived from a Nucleic acid selected from the group consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
45. 45. The method according to item 44, wherein the method comprises the determination of the parameter (s) at a first time in a first sample and at a second time in another sample, and the course of the disease is determined by comparing the two samples.
46. 46. The method of item 44 or 45, wherein the disease is characterized by the expression or abnormal expression of a plurality of different tumor-associated antigens and the monitoring is a monitoring
    1. (i) the amount of multiple nucleic acids encoding the several different tumor-associated antigens, or portions thereof,
    2. (ii) the amount of the several different tumor-associated antigens or parts thereof,
    3. (iii) the amount of multiple antibodies that bind to the several different tumor-associated antigens or portions thereof, and / or
    4. (iv) the amount of a plurality of cytolytic or cytokine-releasing T cells specific for complexes between the several different tumor-associated antigens or parts thereof and MHC molecules.
47. 47. The method of any of clauses 44-46, wherein the monitoring of the amount of nucleic acid or portion thereof is with a polynucleotide probe that specifically hybridizes to the nucleic acid or portion thereof.
48. 48. The method of item 47, wherein the polynucleotide probe comprises a sequence of 6-50 contiguous nucleotides from the nucleic acid encoding the tumor-associated antigen.
49. 49. The method of any of clauses 44-46, wherein monitoring of the amount of nucleic acid or portion thereof is by selective amplification of the nucleic acid or portion thereof.
50. 50. The method of any of clauses 44-46, wherein monitoring the amount of the tumor-associated antigen or portion thereof with an antibody that binds specifically to the tumor-associated antigen or portion thereof.
51. 51. The method of any of clauses 44-46, wherein the monitoring of the amount of antibodies is with a protein or peptide that specifically binds to the antibody.
52. 52. The method of any of clauses 44-46, wherein the monitoring of the amount of cytolytic or cytokine secretory T cells is with a cell presenting the complex between the tumor associated antigen or portion thereof and an MHC molecule.
53. 53. The method of any one of items 37-38, 42-43, 47-48 and 50-52, wherein the polynucleotide probe, antibody, protein or peptide or cell is detectably labeled.
54. 54. The method of item 53, wherein the detectable label is a radioactive label or an enzyme label.
55. 55. The method of any of clauses 33-54, wherein the sample comprises body fluid and / or body tissue.
56. 56. A method of treating a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising administering a pharmaceutical composition according to any one of items 1-32, wherein the tumor-associated antigen has a sequence that is derived from a Nucleic acid selected from the group consisting of:
    1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
    2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
    3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
    4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
57. 57. A method for the treatment, diagnosis or monitoring of a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising administering an antibody that binds to the tumor-associated antigen or a portion thereof and with a therapeutic or diagnostic agent, the tumor-associated antigen having a sequence encoded by a nucleic acid selected from the group consisting of:
    1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
    2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
    3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
    4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
58. 58. The method of clause 42, 50 or 57, wherein the antibody is a monoclonal antibody.
59. 59. The method of item 42, 50 or 57, wherein the antibody is a chimeric or humanized antibody.
60. 60. The method of item 42, 50 or 57, wherein the antibody is a fragment of a natural antibody.
61. 61. A method of treating a patient with a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising:
    1. (i) removing a sample of immunoreactive cells from the patient,
    2. (ii) contacting the sample with a host cell expressing the tumor-associated antigen or portion thereof under conditions that favor production of cytolytic or cytokine-releasing T cells against the tumor-associated antigen or portion thereof, and
    3. (iii) introducing the cytolytic or cytokine-releasing T cells into the patient in an amount effective to lyse cells expressing the tumor-associated antigen or portion thereof, the tumor-associated antigen having a sequence which is encoded by a nucleic acid selected from the group consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
62. 62. The method of item 61, wherein the host cell recombinantly expresses an HLA molecule that binds to the tumor-associated antigen or a portion thereof.
63. 63. The method of item 62, wherein the host cell endogenously expresses an HLA molecule that binds to the tumor-associated antigen or a portion thereof.
64. 64. A method of treating a patient with a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising:
    1. (i) the identification of a nucleic acid expressed by cells associated with the disease, wherein the nucleic acid is selected from the group consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c),
    2. (ii) the transfection of a host cell with the nucleic acid or a part thereof,
    3. (iii) culturing the transfected host cell for expression of the nucleic acid, and
    4. (iv) introducing the host cells or an extract thereof into the patient in an amount effective to increase the immune response to the cells of the patient associated with the disease.
65. 65. The method of clause 64, further comprising identifying an MHC molecule that presents the tumor-associated antigen or a portion thereof, wherein the host cell expresses the identified MHC molecule and presents the tumor-associated antigen or portion thereof.
66. 66. The method of item 64 or 65, wherein the immune response comprises a B-cell response or a T-cell response.
67. 67. The method of item 66, wherein the immune response is a T cell response comprising the production of cytolytic or cytokine-releasing T cells specific to the host cells presenting the tumor-associated antigen or portion thereof or specific for cells of the patient expressing the tumor-associated antigen or a part thereof.
68. 68. The method of any one of items 61-67, wherein the host cells are non-proliferative.
69. 69. A method of treating a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising:
    1. (i) the identification of cells from the patient expressing abnormal amounts of the tumor-associated antigen,
    2. (ii) isolating a sample of cells,
    3. (iii) the cultivation of the cells, and
    4. (iv) introducing the cells into the patient in an amount effective to elicit an immune response against the cells, the tumor-associated antigen having a sequence encoded by a nucleic acid selected from the group consisting out:
       1. (a) a nucleic acid comprising a nucleic acid sequence; those selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70, 74, 85-88, a part or derivative is selected from
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
70. 70. The method of any of paragraphs 33-69, wherein the disease is cancer.
71. 71. A method of inhibiting the development of cancer in a patient comprising administering an effective amount of a pharmaceutical composition according to any one of items 1-32.
72. 72. The method of any of items 33-71, wherein the tumor-associated antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38 , 41, 58-61, 64, 65, 71, 75, 80-84, 89-100 a part or derivative thereof.
73. 73. Nucleic acid selected from the group consisting of:
    1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 2-5, 20-21, 31-33, 37, 39, 54-57, 62, 63, 85-88 a part or derivative thereof is selected
    2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
    3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
    4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
74. 74. A nucleic acid encoding a protein or polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65 , 89-100 part or derivative thereof.
75. 75. A recombinant DNA or RNA molecule comprising a nucleic acid according to item 73 or 74.
76. 76. The recombinant DNA molecule according to item 75, wherein the recombinant DNA molecule is a vector.
77. 77. The recombinant DNA molecule according to item 76, wherein the vector is a viral vector or a bacteriophage.
78. 78. Recombinant DNA molecule according to any of the numbers 75-77, which further comprises expression control sequences that direct the expression of the nucleic acid.
79. 79. Recombinant DNA molecule according to item 78, wherein the expression control sequences are homo- or heterologous to the nucleic acid.
80. 80. A host cell comprising a nucleic acid according to item 73 or 74 or a recombinant DNA molecule according to any one of items 75-79.
81. 81. The host cell according to item 80, which further comprises a nucleic acid encoding an HLA molecule.
82. 82. Protein or polypeptide encoded by a nucleic acid according to item 73.
83. 83. A protein or polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7-13, 14-18, 23-24, 34-36, 58-61, 64, 65, 89-100 a part or derivative thereof.
84. 84. Immunogenic fragment of the protein or polypeptide referred to in paragraphs 82 or 83.
85. 85. Fragment of the protein or polypeptide according to item 82 or 83 which binds to human HLA receptor or human antibody.
86. 86. An agent which binds specifically to a protein or polypeptide or to a part thereof, wherein the protein or polypeptide is encoded by a nucleic acid selected from the group consisting of:
    1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
    2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
    3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
    4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
87. 87. The agent of item 86, wherein the protein or polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41 , 58-61, 64, 65, 71, 75, 80-84, 89-100 a part or derivative thereof.
88. 88. Agent according to item 86 or 87, wherein the agent is an antibody.
89. 89. The agent according to item 88, wherein the antibody is a monoclonal, chimeric or humanized antibody or a fragment of an antibody.
90. 90. Antibody selective to a complex of:
    1. (i) a protein or polypeptide or part thereof and
    2. (ii) binds to an MHC molecule to which the protein or polypeptide or portion thereof binds, wherein the antibody does not bind to (i) or (ii) alone and the protein or polypeptide is encoded by a nucleic acid selected from the group consisting of is selected, consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88, a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
91. 91. The antibody of item 90, wherein the protein or polypeptide comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-13, 14-18, 22-24, 30, 34-36, 38, 41 , 58-61, 64, 65, 71, 75, 80-84, 89-100, part or derivative thereof.
92. 92. An antibody according to item 90 or 91, wherein the antibody is a monoclonal, chimeric or humanized antibody or a fragment of an antibody.
93. 93. Conjugate between an agent according to any one of items 86-89 or an antibody according to any one of items 90-92 and a therapeutic or diagnostic agent.
94. 94. A conjugate according to item 93, wherein the therapeutic or diagnostic agent is a toxin.
95. 95. A kit for detecting the expression or abnormal expression of a tumor-associated antigen comprising means for detection
    1. (i) the nucleic acid encoding the tumor-associated antigen or a part thereof,
    2. (ii) the tumor-associated antigen or a part thereof,
    3. (iii) antibodies which bind to the tumor-associated antigen or a part thereof, and or
    4. (iv) T cells specific for a complex between the tumor-associated antigen or a part thereof and an MHC molecule, wherein the tumor-associated antigen has a sequence encoded by a nucleic acid derived from the Group is selected, consisting of:
       1. (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63, 70 , 74, 85-88 a part or derivative thereof,
       2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
       3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
       4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
96. 96. The kit according to item 95, wherein the means for detecting the nucleic acid coding for the tumor-associated antigen or a part thereof are nucleic acid molecules for the selective amplification of the nucleic acid.
97. 97. The kit according to item 96, wherein the nucleic acid molecules for the selective amplification of the nucleic acid comprise a sequence of 6-50 contiguous nucleotides from the nucleic acid which codes for the tumor-associated antigen.
98. 98. A recombinant DNA molecule comprising a promoter region derived from a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 19-21, 29, 31-33, 37, 39, 40, 54- 57, 62, 63, 70, 74, 85-88.
99. 99. A pharmaceutical composition comprising an agent that inhibits the expression or activity of the tumor antigen TPTE SEQ ID NOs: 19, 22.
100. 100. A pharmaceutical composition comprising an agent that inhibits the migration and metastasis activity of TPTE.
101. 101. Agent according to item 99 or 100, wherein the agent is an antibody.
102. 102. Means according to item 101, wherein the antibody is a monoclonal, chimeric or humanized antibody or a fragment of an antibody.
103. 103. Antibody that binds to the extracellular protein regions comprising the sequences SEQ ID NOs: 81-82.
104. 104. Means according to item 99 or 100, wherein the agent is an antisense nucleic acid which hybridizes selectively with the nucleic acid coding for TPTE.
105. 105. Means according to item 104, wherein the antisense nucleic acid comprises a sequence of 6-50 contiguous nucleotides from the nucleic acid coding for TPTE.
106. 106. Agent according to item 99 or 100, wherein the agent is RNA interference (RNAi).
107. 107. Means according to item 106, wherein RNAi contains a so-called short hairpin structure (shRNA).
108. 108. Means according to item 107, shRNA being produced by transcription after transfection with expression vectors.
109. 109. Means according to item 107, wherein shRNA is produced by transcription of retroviruses
110. 110. The agent according to item 107, wherein shRNA is mediated by lentiviral systems.
111. 111. Composition according to item 99 or 100, wherein the agent is a small chemical molecule.
112. 112. Means according to item 111, wherein the small chemical molecules bind to TPTE
113. 113. Composition according to item 112, wherein the small chemical molecules bind to the extracellular regions comprising SEQ ID NO: 81-82.
114. 114. METHODS OF TREATMENT Diagnosis or monitoring of a metastatic tumor characterized by the expression or abnormal expression of TPTE, comprising administration of an antibody that binds to TPTE or a portion thereof and is coupled to a therapeutic or diagnostic agent, wherein the TPTE has a sequence which is encoded by a nucleic acid consisting of:
     1. (a) a nucleic acid which is a nucleic acid sequence comprising SEQ ID NO: 19 selected a part or derivative thereof,
     2. (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a),
     3. (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and
     4. (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).
115. 115. The method of item 114, wherein the antibody is a monoclonal antibody.
116. 116. The method of item 114, wherein the antibody is a chimeric or humanized antibody.
117. 117. The method of item 114, wherein the antibody is a fragment of a natural antibody.

Detailed description of the invention

According to the invention, genes are described which are selectively expressed or aberrantly expressed in tumor cells and represent tumor-associated antigens.

According to the invention, these genes or their derivatives are preferred target structures for therapeutic approaches. Conceptually, the therapeutic approaches may target an inhibition of the activity of the selectively expressed tumor-associated gene product. This is useful if the aberrant or selective expression is functional from Tumorpathogenetischer meaning and their suppression is associated with a selective damage to the corresponding cells. Other therapeutic concepts regard tumor-associated antigens as labels that selectively recruit effector mechanisms with cell-damaging potential to tumor cells. Here, the function of the target molecule itself and its role in tumorigenesis is completely irrelevant.

By "derivative" of a nucleic acid according to the invention is meant that single or multiple nucleotide substitution, deletion and / or addition are present in the nucleic acid. Furthermore, the term "derivative" also includes a chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate. The term "derivative" also includes nucleic acids containing non-naturally occurring nucleotides and nucleotide analogs.

According to the invention, a nucleic acid is preferably deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). Nucleic acids according to the invention comprise genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. According to the invention, a nucleic acid can be present as a single-stranded or double-stranded and linear or covalently circular closed molecule.

The nucleic acids described according to the invention are preferably isolated. The term "isolated nucleic acid" according to the invention means that the nucleic acid (i) was amplified in vitro , for example by polymerase chain reaction (PCR), (ii) was produced recombinantly by cloning, (iii) was purified, for example by cleavage and gel electrophoretic separation or (iv) was synthesized, for example by chemical synthesis. An isolated nucleic acid is a nucleic acid available for manipulation by recombinant DNA techniques.

One nucleic acid is "complementary" to another nucleic acid if the two sequences hybridize with each other and can form a stable duplex, the hybridization preferably taking place under conditions allowing specific hybridization between polynucleotides (stringent conditions). Stringent conditions are for example in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., Eds., 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989 or Current Protocols in Molecular Biology, FM Ausubel et al., Ed., John Wiley & Sons, Inc., new York pertaining, for example, to hybridization at 65 ° C. in hybridization buffer (3.5 × SSC, 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 2.5 mM NaH ₂ PO ₄ (pH 7), 0, 5% SDS, 2 mM EDTA). SSC is 0.15 M sodium chloride / 0.15 M sodium citrate, pH 7. After hybridization, the membrane to which the DNA has been transferred becomes, for example, 2 × SSC at room temperature and then 0.1-0.5 × SSC / 0.1 x SDS at temperatures up to 68 ° C washed.

Complementary nucleic acids according to the invention have at least 40%, in particular at least 50%, at least 60%, at least 70%, at least 80%, at least 90% and preferably at least 95%, at least 98 or at least 99% identity of the nucleotides.

Nucleic acids which code for tumor-associated antigens can be present according to the invention alone or in combination with other nucleic acids, in particular heterologous nucleic acids. In preferred embodiments, a nucleic acid is functionally in association with expression control sequences or regulatory sequences which may be homologous or heterologous relative to the nucleic acid. A coding sequence and a regulatory sequence are then "operably linked" if covalently linked such that the expression or transcription of the coding sequence is under the control or under the influence of the regulatory sequence. If the coding sequence is to be translated into a functional protein, in a functional connection of a regulatory sequence with the coding sequence, induction of the regulatory sequence will result in transcription of the coding sequence without resulting in frameshifting in the coding sequence or in failure The coding sequence comes to be translated into the desired protein or peptide.

The term "expression control sequence" or "regulatory sequence" according to the invention comprises promoters, enhancers and other control elements which control the expression of a gene. In certain embodiments of the invention, the expression control sequences are regulatable. The precise structure of regulatory sequences may vary species-dependent or cell-type dependent, but generally includes 5'-untranscribed and 5'-untranslated sequences involved in the initiation of transcription, such as TATA box, capping sequence , CAAT sequence and similar. In particular, 5 'untranscribed regulatory sequences include a promoter region that includes a promoter sequence for transcriptional control of the functionally linked gene. Regulatory sequences may also include enhancer sequences or upstream activator sequences.

On the one hand, therefore, the tumor-associated antigens shown here can be combined with any expression control sequences and promoters. On the other hand, according to the invention, the promoters of the tumor-associated gene products shown here can be combined with any other genes. This allows to exploit the selective activity of these promoters.

Further, according to the invention, a nucleic acid may be present in association with another nucleic acid encoding a polypeptide that directs secretion of the nucleic acid-encoded protein or polypeptide from a host cell. Also, in accordance with the invention, a nucleic acid may be present in association with another nucleic acid encoding a polypeptide that causes anchoring of the encoded protein or polypeptide on the cell membrane of the host cell or its compartmentalization into particular organelles of that cell.

In a preferred embodiment, a recombinant DNA molecule according to the invention is a vector, optionally with a promoter, which promotes the expression of a nucleic acid, e.g. a nucleic acid encoding a tumor-associated antigen of the invention. The term "vector" is used in its most general sense and encompasses any intermediate vehicle for a nucleic acid, e.g. enable the nucleic acid to be introduced into prokaryotic and / or eukaryotic cells and, if appropriate, to be integrated into a genome. Such vectors are preferably replicated and / or expressed in the cell. An intermediate vehicle may e.g. adapted for use in electroporation, microprojectile bombardment, liposomal delivery, Agrobacterium transfer or insertion via DNA or RNA viruses. Vectors include plasmids, phagemids or viral genomes.

The nucleic acids encoding a tumor-associated antigen identified according to the invention can be used for transfection of host cells. By nucleic acids is meant both recombinant DNA and RNA. Recombinant RNA can pass through In vitro transcription of a DNA template can be produced. It can also be modified prior to application by stabilizing sequences, capping and polyadenylation. The term "host cell" according to the invention relates to any cell that is transformable or transfectable with an exogenous nucleic acid. The term "host cells" according to the invention comprises prokaryotic (eg E. coli ) or eukaryotic (eg dendritic cells, B cells, CHO cells, COS cells, K562 cells, yeast cells and insect cells). Particularly preferred are mammalian cells such as human, mouse, hamster, pig, goat, primate cells. The cells can be derived from a variety of tissue types and include primary cells and cell lines. Specific examples include keratinocytes, peripheral blood leukocytes, bone marrow stem cells and embryonic stem cells. In further embodiments, the host cell is an antigen-presenting cell, in particular a dendritic cell, monocyte or macrophage. A nucleic acid may be present in the host cell in single or multiple copies and in one embodiment is expressed in the host cell.

The term "expression" is used according to the invention in its most general meaning and includes the production of RNA or of RNA and protein. It also includes partial expression of nucleic acids. Furthermore, the expression can be transient or stable. Preferred expression systems in mammalian cells include pcDNA3.1 and pRc / CMV (Invitrogen, Carlsbad, CA) containing a selectable marker such as a gene conferring resistance to G418 (thus allowing selection of stably transfected cell lines) and the enhancer-promoter Sequences of cytomegalovirus (CMV).

In the cases of the invention in which an HLA molecule presents a tumor-associated antigen or part thereof, an expression vector may also comprise a nucleic acid sequence encoding the HLA molecule. The nucleic acid sequence encoding the HLA molecule may be on the same expression vector as the nucleic acid encoding the tumor-associated antigen or portion thereof or both nucleic acids may be on different expression vectors. In the latter case, the two expression vectors can be cotransfected into a cell. If a host cell expresses neither the tumor-associated antigen or the part thereof nor the HLA molecule, both nucleic acids coding for it are transfected into the cell either on the same expression vector or on different expression vectors. If the cell already has the HLA molecule only the nucleic acid sequence encoding the tumor-associated antigen or portion thereof can be transfected into the cell.

The invention encompasses kits for the amplification of a nucleic acid which codes for a tumor-associated antigen. Such kits include, for example, a pair of amplification primers that hybridize to the nucleic acid encoding the tumor-associated antigen. The primers preferably comprise a sequence of 6-50, more preferably 10-30, 15-30 and 20-30 contiguous nucleotides from the nucleic acid and are non-overlapping to avoid the formation of primer dimers. One of the primers will hybridize to one strand of the nucleic acid encoding the tumor-associated antigen, and the other primer will hybridize to the complementary strand in an arrangement that permits amplification of the nucleic acid encoding the tumor-associated antigen ,

"Antisense" molecules or "antisense" nucleic acids can be used to regulate, in particular reduce, the expression of a nucleic acid. The term "antisense molecule" or "antisense nucleic acid" according to the invention relates to an oligonucleotide which is an oligoribonucleotide, oligodeoxyribonucleotide, modified oligoribonucleotide or modified oligodeoxyribonucleotide and which under physiological conditions hybridizes to DNA comprising a particular gene or mRNA of this gene, whereby the transcription of this gene and / or the translation of this mRNA is inhibited. According to the invention, an "antisense molecule" also comprises a construct which contains a nucleic acid or a part thereof in reverse orientation with respect to its natural promoter. An antisense transcript of a nucleic acid or portion thereof may enter into a duplex with the naturally occurring mRNA that specifies the enzyme, thus preventing accumulation of or translation of the mRNA into the active enzyme. Another possibility is the use of ribozymes for inactivating a nucleic acid. Preferred antisense oligonucleotides according to the invention have a sequence of 6-50, in particular 10-30, 15-30 and 20-30 contiguous nucleotides from the target nucleic acid and are preferably completely complementary to the target nucleic acid or a part thereof.

In preferred embodiments, the antisense oligonucleotide hybridizes to an N-terminal or 5'-upstream site such as a translation initiation, Transcription initiation or promoter site. In further embodiments, the antisense oligonucleotide hybridizes to a 3 'untranslated region or mRNA splicing site.

In one embodiment, an oligonucleotide of the invention consists of ribonucleotides, deoxyribonucleotides or a combination thereof. The 5'-end of a nucleotide and the 3'-end of another nucleotide are linked together by a phosphodiester bond. These oligonucleotides can be synthesized in a conventional manner or produced recombinantly.

In preferred embodiments, an oligonucleotide of the invention is a "modified" oligonucleotide. In this case, the oligonucleotide, for example, to increase its stability or therapeutic efficacy, be modified in a variety of ways without its ability to bind to its target is impaired. The term "modified oligonucleotide" means according to the invention an oligonucleotide in which (i) at least two of its nucleotides are linked together by a synthetic internucleoside bond (ie an internucleoside linkage that is not a phosphodiester bond) and / or (ii) a chemical moiety is covalently linked to the oligonucleotide is that does not normally occur with nucleic acids. Preferred synthetic internucleoside bonds are phosphorothioates, alkylphosphonates, phosphorodithioates, phosphate esters, alkylphosphonothioates, phosphoramidates, carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl esters and peptides.

The term "modified oligonucleotide" also includes oligonucleotides with a covalently modified base and / or sugar. For example, "modified oligonucleotides" include oligonucleotides having sugar moieties covalently bonded to low molecular weight organic groups that are not a hydroxyl group at the 3'-position and no phosphate group at the 5'-position. Modified oligonucleotides may include, for example, a 2'-O-alkylated ribose residue or another sugar instead of ribose, such as arabinose.

The proteins and polypeptides described according to the invention are preferably isolated. The terms "isolated protein" or "isolated polypeptide" mean that the protein or polypeptide is separated from its natural environment. An isolated protein or Polypeptide may be in a substantially purified state. The term "substantially purified" means that the protein or polypeptide is substantially free of other substances present in nature or in vivo .

Such proteins and polypeptides serve, for example, for the production of antibodies and can be used in an immunological or diagnostic assay or as therapeutics. Proteins and polypeptides described according to the invention can be isolated from biological samples such as tissue or cell homogenates and can also be expressed recombinantly in a multiplicity of pro- or eukaryotic expression systems.

"Derivatives" of a protein or polypeptide or an amino acid sequence for the purposes of this invention include amino acid insertion variants, amino acid deletion variants and / or amino acid substitution variants.

1. 1. kleine aliphatische, nicht-polare oder leicht-polare Reste: Ala, Ser, Thr (Pro, Gly)
2. 2. negativ geladene Reste und ihre Amide: Asn, Asp, Glu, Gln
3. 3. positiv geladene Reste: His, Arg, Lys
4. 4. große aliphatische, nicht-polare Reste: Met, Leu, Ile, Val (Cys)
5. 5. große aromatische Reste: Phe, Tyr, Trp.

Amino acid insertion variants include amino- and / or carboxy-terminal fusions, as well as insertions of single or multiple amino acids in a particular amino acid sequence. In amino acid sequence variants with an insertion, one or more amino acid residues are introduced into a predetermined site in an amino acid sequence, although random insertion with appropriate screening of the resulting product is also possible. Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence. Amino acid substitution variants are characterized in that at least one residue in the sequence is removed and another residue is inserted in its place. Preferably, the modifications are at positions in the amino acid sequence that are not conserved between homologous proteins or polypeptides. Preferably, amino acids are replaced by others with similar properties, such as hydrophobicity, hydrophilicity, electronegativity, side chain volume, and the like (conservative substitution). For example, conservative substitutions refer to the replacement of one amino acid with another, listed below in the same group as the substituted amino acid:

1. 1. small aliphatic, non-polar or slightly polar residues: Ala, Ser, Thr (Pro, Gly)
2. 2. negatively charged residues and their amides: Asn, Asp, Glu, Gln
3. 3. positively charged residues: His, Arg, Lys
4. 4. large aliphatic, non-polar residues: Met, Leu, Ile, Val (Cys)
5. 5. large aromatic residues: Phe, Tyr, Trp.

Three residues are bracketed because of their special role in protein architecture. Gly is the only residue without a side chain, giving the chain flexibility. Pro has an unusual geometry that severely limits the chain. Cys can form a disulfide bridge.

The amino acid variants described above can be readily synthesized by known peptide synthesis techniques such as e.g. by "Solid Phase Synthesis" (Merrifield, 1964) and the like, or by recombinant DNA manipulation. Techniques for introducing substitution mutations into pre-scanned sites in DNA having a known or partially known sequence are well known and include e.g. M13 mutagenesis. The manipulation of DNA sequences to produce proteins with substitutions, insertions or deletions is e.g. in Sambrook et. al. (1989).

"Derivatives" of proteins or polypeptides according to the invention also include single or multiple substitutions, deletions and / or additions of any molecules associated with the enzyme, such as carbohydrates, lipids and / or proteins or polypeptides. Furthermore, the term "derivative" also extends to all functional chemical equivalents of the proteins or polypeptides.

A portion or fragment of a tumor-associated antigen according to the invention has a functional property of the polypeptide from which it is derived. Such functional properties include interaction with antibodies, interaction with other polypeptides or proteins, selective binding of nucleic acids, and enzymatic activity. An important feature is the ability to complex with HLA and, where appropriate, to produce an immune response. This immune response may be due to stimulation of cytotoxic or helper T cells. Preferably, a part or fragment of a tumor-associated antigen according to the invention comprises a sequence of at least 6, in particular at least 8, at least 10, at least 12, at least 15, at least 20, at least 30 or at least 50 consecutive amino acids from the tumor-associated antigen.

A part or a fragment of a nucleic acid which codes for a tumor-associated antigen relates, according to the invention, to the part of the nucleic acid which codes at least for the tumor-associated antigen and / or for a part or a fragment of the tumor-associated antigen as defined above coded.

The isolation and identification of genes that encode tumor-associated antigens also allows for the diagnosis of a disease characterized by the expression of one or more tumor-associated antigens. These methods include the determination of one or more nucleic acids encoding a tumor-associated antigen and / or the determination of the encoded tumor-associated antigens and / or peptides derived therefrom. A determination of the nucleic acid can be made in a conventional manner, including by polymerase chain reaction or hybridization with a labeled probe. Determination of tumor-associated antigens or peptides derived therefrom may be by screening patient antisera for recognition of the antigen and / or peptides. It may also be done by screening the patient's T cells for specificity for the corresponding tumor-associated antigen.

The present invention also enables the isolation of proteins that bind to tumor-associated antigens described herein, including antibodies and cellular binding partners of the tumor-associated antigens.

In accordance with the invention, certain embodiments also provide "dominant negative" polypeptides derived from tumor-associated antigens. A dominant negative polypeptide is an inactive variant of a protein that, by interacting with the cellular machinery, displaces an active protein from its interaction with the cellular machinery or competes with the active protein, thereby reducing the effect of the active protein. For example, a dominant negative receptor that binds a ligand but does not generate a signal in response to binding of the ligand can reduce the biological activity of the ligand. Similarly, a dominant negative catalytically-inactive kinase, which normally interacts with target proteins but does not phosphorylate the target proteins, can reduce phosphorylation of the target proteins in response to a cellular signal. Similarly, a dominant negative transcription factor that binds to a promoter site in the control region of a gene, however, does not increase the transcription of the gene, reduce the effect of a normal transcription factor by occupying promoter binding sites without an increase in transcription.

The result of expression of a dominant negative polypeptide in a cell is a reduction in the function of active proteins. One skilled in the art can produce dominant negative variants of a protein, for example, by conventional mutagenesis methods and evaluating the dominant negative effect of the variant polypeptide.

Also included in the invention are substances such as polypeptides that bind to tumor-associated antigens. Such binding agents may e.g. in screening assays for detection of tumor-associated antigens and complexes of tumor-associated antigens with their binding partners and in a purification of the tumor-associated antigens and complexes thereof with their binding partners use. Such substances may also find use for inhibiting the activity of tumor-associated antigens, for example by binding to such antigens.

Therefore, according to the invention, binding agents such as e.g. Antibodies or antibody fragments having the ability to bind selectively to tumor-associated antigens. Antibodies include polyclonal and monoclonal antibodies prepared in a conventional manner.

It is known that only a small part of an antibody molecule, the paratope, is involved in the binding of the antibody to its epitope (cf. Clark, WR (1986), The Experimental Foundations of Modern Immunology, Wiley & Sons, Inc., New York ; Roitt, I. (1991), Essential Immunology, 7th Edition, Blackwell Scientific Publications, Oxford ). The pFc 'and Fc regions are, for example, effectors of the complement cascade but are not involved in antigen binding. An antibody from which the pFc 'region has been enzymatically cleaved or which has been produced without the pFc' region, referred to as the F (ab ') ₂ flag, carries both antigen binding sites of a complete antibody. Similarly, an antibody from which the Fc region has been enzymatically cleaved or which has been produced without the Fc region, termed a Fab fragment, carries an antigen binding site of an intact antibody molecule. Furthermore, Fab fragments consist of a covalently linked light chain of an antibody and a part of the heavy chain of the Antibody, termed Fd. The Fd fragments are the major determinants of antibody specificity (a single Fd fragment can be associated with up to ten different light chains without altering the specificity of the antibody) and Fd fragments remain an isolation ability to bind to an epitope.

Within the antigen-binding portion of an antibody are complementarity determining regions (CDRs) that directly interact with the epitope of the antigen and framework regions (FRs) that maintain the tertiary structure of the paratope. Both the Fd fragment of the heavy chain and the IgG immunoglobulin light chain contain four framework regions (FR1 to FR4), each separated by three complementarity determining regions (CDR1 to CDR3). The CDRs and in particular the CDR3 regions, and more particularly the CDR3 heavy chain region, are largely responsible for antibody specificity.

It is known that the non-CDR regions of a mammalian antibody can be replaced by similar regions of antibodies of the same or different specificity, while retaining the specificity for the epitope of the original antibody. This has allowed the development of so-called "humanized" antibodies in which non-human CDRs are covalently linked to human FR and / or Fc / pFc 'regions for the production of a functional antibody.

For example, that describes WO 92/04381 the production and use of mouse humanized RSV antibodies in which at least a portion of mouse FR regions have been replaced by FR regions of a human origin. Such antibodies, including fragments of intact antibodies having antigen-binding ability, are often referred to as "chimeric" antibodies.

According to the invention, F (ab ') ₂ , Fab, Fv and Fd fragments of antibodies, chimeric antibodies, in which the Fc and / or FR and / or CDR1 and / or CDR2 and / or light Chain CDR3 regions have been replaced by homologous human or non-human sequences, chimeric F (ab ') ₂ fragment antibodies in which the FR and / or CDR1 and / or CDR2 and / or light chain CDR3 Regions were replaced by homologous human or non-human sequences, chimeric Fab fragment antibodies, in which the FR and / or CDR1 and / or CDR2 and / or light chain CDR3 regions were replaced by homologous human or non-human sequences, and chimeric Fd fragment antibodies in which the FR and / or CDR1 and / or CDR2 regions have been replaced by homologous human or non-human sequences. Also included according to the invention are so-called single-chain antibodies.

Also included within the scope of the invention are polypeptides that specifically bind to tumor-associated antigens. For example, such polypeptide binding agents can be provided by degenerate peptide libraries that can be readily prepared in solution in immobilized form or as phage display libraries. Combinatorial libraries of peptides with one or more amino acids can also be prepared. Furthermore, libraries of peptoids and non-peptidic synthetic residues can be prepared.

Phage display may be particularly effective in identifying binding peptides of the invention. For example, a phage library (using, for example, the m13, fd, or lambda phage) is prepared which presents inserts of 4 to about 80 amino acid residues in length. Phages are then selected that carry inserts that bind to the tumor-associated antigen. This process can be repeated over several cycles of reselection of phages that bind to the tumor-associated antigen. Repeated rounds lead to an accumulation of phages that carry certain sequences. An analysis of DNA sequences may be made to identify the sequences of the expressed polypeptides. The smallest linear portion of the sequence that binds to the tumor-associated antigen can be determined. The "two-hybrid system" of yeast can also be used to identify polypeptides that bind to a tumor-associated antigen. Tumor-associated antigens or fragments thereof described in accordance with the invention can be used for screening peptide libraries, including phage display libraries, to identify and select peptide binding partners of the tumor-associated antigens. Such molecules may be used, for example, for screening assays, purification protocols, for interference with the function of the tumor-associated antigen, and for other purposes known to those skilled in the art.

For example, the antibodies and other binding molecules described above can be used to identify tissue that expresses a tumor-associated antigen. Antibodies may also be coupled to specific diagnostic agents for imaging cells and tissues that express tumor-associated antigens. They can also be coupled to therapeutically useful substances. Diagnostic agents include, but are not limited to, barium sulfate, iocetamic acid, iopanoic acid, calcium ipodate, sodium diatrizoate, meglumine diatrizoate, metrizamide, sodium tylopanoate and radiodiagnostics, including positron emitters such as fluorin-18 and carbon-11, gamma emitters such as Iodine-123, technitium-99m, iodine-131 and indium-111, nuclides for nuclear magnetic resonance such as fluorine and gadolinium. The term "therapeutically useful substance" means according to the invention any therapeutic molecule desirably selectively delivered to a cell expressing one or more tumor-associated antigens, including anti-cancer agents, radioactive iodine-containing compounds, toxins, cytostatic or cytolytic drugs, etc. Anticancer agents include, for example, aminoglutethimide, azathioprine, bleomycin sulfate, busulfan, carmustine, chlorambucil, cisplatin, cyclophosphamide, cyclosporine, cytarabidine, dacarbazine, dactinomycin, daunorubin, doxorubicin, taxol, etoposide, fluorouracil, interferon-α, lomustine, mercaptopurine, methotrexate, mitotane, procarbazine HCl, thioguanine, vinblastine sulfate and vincristine sulfate. Other anti-cancer drugs are for example in Goodman and Gilman, "The Pharmacological Basis of Therapeutics," 8th Edition, 1990, McGraw-Hill, Inc. especially Chapter 52 (Antineoplastic Agents (Paul Calabresi and Bruce A. Chabner) Toxins may be proteins such as pokeweed antiviral protein, cholera toxin, pertussis toxin, ricin, gelonin, abrin, diphtheria exotoxin or Pseudomonas exotoxin be emitting radionuclides such as cobalt-60.

The term "patient" means according to the invention human, non-human primate or another animal, in particular mammal such as cow, horse, pig, sheep, goat, dog, cat or rodent such as mouse and rat. In a particularly preferred embodiment, the patient is a human.

The term "disease" according to the invention relates to any pathological condition in which tumor-associated antigens are expressed or abnormally expressed. According to the invention, "abnormal expression" means that the expression is changed, preferably increased, in relation to the condition in a healthy individual. An increase in the Expression refers to an increase of at least 10%, in particular at least 20%, at least 50% or at least 100%. In one embodiment, the tumor-associated antigen is expressed only in tissue of a diseased individual, while expression is repressed in a healthy individual. An example of such a disease is cancer, especially seminomas, melanomas, teratomas, gliomas, colorectal, breast, prostate, uterine, ovarian, and lung cancers.

A biological sample may be a tissue and / or cellular sample according to the invention and may be recovered for use in the various methods described herein in a conventional manner, such as tissue biopsy, including punch biopsy, and blood, bronchial aspirate, urine, faeces or other body fluids.

The term "immunoreactive cell" means according to the invention a cell which can mature into an immune cell (such as B cell, T helper cell or cytolytic T cell) with appropriate stimulation. Immunoreactive cells include CD34 ⁺ hematopoietic stem cells, immature and mature T cells, and immature and mature B cells. If the production of cytolytic or helper T cells recognizing a tumor-associated antigen is desired, the immunoreactive cell is contacted with a cell expressing a tumor-associated antigen under conditions involving production, differentiation, and / or or favoring selection of cytolytic as well as helper T cells. Differentiation of T cell progenitors into a cytolytic T cell upon exposure to an antigen is similar to clonal selection of the immune system.

Some therapeutic methods rely on a response of a patient's immune system that results in lysis of antigen-presenting cells, such as cancer cells, that present one or more tumor-associated antigens. For example, autologous cytotoxic T lymphocytes specific for a complex of a tumor-associated antigen and an MHC molecule are administered to a patient having a cellular abnormality. The production of such cytotoxic T lymphocytes in vitro is known. An example of a method for the differentiation of T cells can be found in the WO-A-9633265 , In general, a sample of cells, such as blood cells, is removed from the patient and the cells are contacted with a cell which can present the complex and induce proliferation of cytotoxic T lymphocytes (eg dendritic cells). The target cell may be a transfected cell, such as a COS cell. These transfected cells present the desired complex on their surface and stimulate their proliferation when contacted with cytotoxic T lymphocytes. The clonally expanded autologous cytotoxic T lymphocytes are then administered to the patient.

In another method of selecting antigen-specific cytotoxic T lymphocytes, fluorogenic tetramers of MHC class I molecule / peptide complexes are used for detection of specific clones of cytotoxic T lymphocytes ( Altman et al., Science 274: 94-96, 1996 ; Dunbar et al., Curr. Biol. 8: 413-416, 1998 ). Soluble MHC class I molecules are folded in vitro in the presence of β ₂ -microglobulin and a peptide antigen that binds to the class 1 molecule. After purification of the MHC / peptide complexes, they are labeled with biotin. Tetramers are formed by mixing the biotinylated peptide-MHC complexes with labeled avidin (eg, phycoerythrin) at a 4: 1 molar ratio. Tetramers are then contacted with cytotoxic T lymphocytes such as peripheral blood or lymph nodes. The tetramers bind to cytotoxic T lymphocytes that recognize the peptide antigen / MHC class I complex. Cells that bind to the tetramers can be sorted by fluorescence-directed cell sorting to isolate reactive cytotoxic T lymphocytes. The isolated cytotoxic T lymphocytes can then be propagated in vitro .

In a therapeutic procedure called adoptive transfer ( Greenberg, J. Immunol. 136 (5): 1917, 1986 ; Riddle et al., Science 257: 238, 1992 ; Lynch et al., Eur. J. Immunol. 21: 1403-1410, 1991 ; Kast et al., Cell 59: 603-614, 1989 ), cells presenting the desired complex (eg, dendritic cells) are combined with cytotoxic T lymphocytes of the patient to be treated, resulting in an increase in specific cytotoxic T lymphocytes. The increased cytotoxic T lymphocytes are then administered to a patient with a cellular abnormality characterized by certain abnormal cells presenting the specific complex. The cytotoxic T lymphocytes then lyse the abnormal cells, thereby achieving a desired therapeutic effect.
Often, only low-affinity T cells can be multiplied from the T cell repertoire of a patient against such a specific complex, since the high affines pass through Tolerance development have been wiped out. An alternative here may be a transfer of the T cell receptor itself. For this purpose, cells which present the desired complex (eg dendritic cells) are also combined with healthy cytotoxic T lymphocytes. This results in proliferation of high affinity specific cytotoxic T lymphocytes if the donor has so far had no contact with the specific complex. The high-affinity T cell receptor from these increased specific T lymphocytes is cloned and can be transduced by gene transfer, for example, with retroviral vectors as desired in T cells from other patients. Adoptive transfer then takes place with these genetically modified T lymphocytes ( Stanislavski et al., Nat Immunol. 2: 962-70, 2001 . Kessels et al., Nat Immunol. 2: 957-61, 2001 ).

The foregoing therapeutic aspects assume that at least some of the patient's abnormal cells present a complex of a tumor-associated antigen and an HLA molecule. An identification of such cells can take place in a manner known per se. Once cells presenting the complex have been identified, they can be combined with a sample from the patient containing cytotoxic T lymphocytes. If the cells presenting the complex are lysed by the cytotoxic T lymphocytes, it can be assumed that a tumor-associated antigen is presented.

The adoptive transfer is not the only form of therapy which is applicable according to the invention. Cytotoxic T lymphocytes can also be generated in vivo in a manner known per se. One method uses non-proliferative cells expressing the complex. The cells used will be those that normally express the complex, such as irradiated tumor cells or cells transfected with one or both genes necessary for presentation of the complex (ie, the antigenic peptide and the presenting HLA -Molecule). Different cell types can be used. Furthermore, vectors carrying one or both of the genes of interest may be used. Viral or bacterial vectors are particularly preferred. For example, nucleic acids encoding a tumor-associated antigen or portion thereof can be operably linked to promoter and enhancer sequences that direct expression of the tumor-associated antigen or fragment thereof in particular tissues or cell types. The nucleic acid can be incorporated into an expression vector. expression vectors may be unmodified extrachromosomal nucleic acids, plasmids or viral genomes capable of inserting exogenous nucleic acids. Nucleic acids encoding a tumor-associated antigen can also be inserted into a retroviral genome, thereby enabling integration of the nucleic acid into the genome of the target tissue or cell. In these systems, a microorganism such as vaccinia virus, poxvirus, herpes simplex virus, retrovirus or adenovirus carries the gene of interest and "inactivates" de facto host cells. Another preferred form is the introduction of the tumor-associated antigen in the form of recombinant RNA. This can be introduced, for example, by liposomal transfer or by electroporation into cells. The resulting cells present the complex of interest and are recognized by autologous cytotoxic T lymphocytes, which then multiply.

A similar effect can be achieved by combining the tumor-associated antigen or a fragment thereof with an adjuvant to allow incorporation into antigen-presenting cells in vivo . The tumor-associated antigen or a fragment thereof may be represented as protein, as DNA (eg within a vector) or as RNA. The tumor-associated antigen is processed to yield a peptide partner for the HLA molecule, while a fragment thereof can be presented without the need for further processing. The latter is especially the case when they can bind and HLA molecules. Forms of administration in which the total antigen is processed in vivo by a dendritic cell are preferred, since it is also possible for helper T cell responses to arise here. An effective immune response requires this ( Ossendorp et al, Immunol Lett. 74: 75-9, 2000 ; Ossendorp et al, J. Exp. Med. 187: 693-702, 1998 ). In general, an effective amount of the tumor-associated antigen can be administered to a patient, for example, by intradermal injection. The injection can also be done intranodally in a lymph node ( Maloy et al, Proc Natl Acad Sci USA 98: 3299-303, 2001 ). It can also be used in combination with reagents that facilitate uptake into dendritic cells. In vivo preferred tumor-associated antigens include those that react with allogeneic cancer antisera or with T cells from many cancer patients. Of particular interest, however, are also those against which no spontaneous immune responses exist. Immune responses that can lysate tumors can be demonstrably induced against them ( Keogh et al, J. Immunol. 167: 787-96, 2001 ; Appella et al, Biomed Pept Protein Nucleic Acids 1: 177-84, 1995 ; Wentworth et al, Mol. Immunol. 32: 603-12, 1995 ).

The pharmaceutical compositions described in the invention can also be used as vaccines for immunization. The terms "immunization" or "vaccination" mean according to the invention an increase or activation of an immune reaction to an antigen. Animal models can be used to test an immunizing effect against cancer by using a tumor-associated antigen or a nucleic acid encoding it. For example, human cancer cells may be introduced into a mouse for the creation of a tumor, and one or more nucleic acids encoding tumor-associated antigens may be administered. The effect on the cancer cells (e.g., reduction in tumor size) can be measured as a measure of the effectiveness of nucleic acid immunization.

As part of the composition for immunization, one or more tumor-associated antigens or stimulating fragments thereof are administered with one or more adjuvants for induction of an immune response or enhancement of an immune response. An adjuvant is a substance that is incorporated into or coadministered with the antigen and enhances the immune response. Adjuvants can enhance the immune response by providing an antigen reservoir (extracellular or in macrophages), activating macrophages and stimulating certain lymphocytes. Adjuvants are known and include, but are not limited to, monophosphoryl lipid A (MPL, SmithKline Beecham), saponins such as QS21 (SmithKline Beecham), DQS21 (SmithKline Beecham; WO 96/33739 ), QS7, QS17, QS18 and QS-L1 ( So et al., Mol. Cells 7: 178-186, 1997 ), incomplete Freund's adjuvant, complete Freund's adjuvant, vitamin E, montanide, alum, CpG oligonucleotides (cf. Kreig et al., Nature 374: 546-9, 1995 ) and various water-in-oil emulsions made from biodegradable oils such as squalene and / or tocopherol. Preferably, the peptides are administered in a mixture with DQS21 / MPL. The ratio of DQS21 to MPL is typically about 1:10 to 10: 1, preferably about 1: 5 to 5: 1 and most preferably about 1: 1. For human administration, DQS21 and MPL are typically present in a vaccine formulation ranging from about 1 μg to about 100 μg.

Other substances that stimulate a patient's immune response may also be administered. For example, cytokines are useful in vaccination because of their regulatory properties on lymphocytes. Such cytokines include, for example, interleukin-12 (IL-12), which has been shown to enhance the protective effects of vaccines (cf. Science 268: 1432-1434, 1995 ), GM-CSF and IL-18.

There are a number of compounds that enhance an immune response and therefore can be used in vaccination. These include co-stimulatory molecules provided in the form of proteins or nucleic acids. Such co-stimulatory molecules are, for example, B7-1 and B7-2 (CD80 and CD86, respectively), which are expressed on dendritic cells (DC) and interact with the CD28 molecule expressed on the T cells. This interaction provides co-stimulation (signal 2) for an antigen / MHC / TCR-stimulated (signal 1) T cell, thereby enhancing T cell proliferation and effector function. B7 also interacts with CTLA4 (CD 152) on T cells, and studies involving CTLA4 and B7 ligands show that B7-CTLA4 interaction can enhance anti-tumor immunity and CTL proliferation ( Zheng, P. et al., Proc. Natl. Acad. Sci. USA 95 (11): 6284-6289 (1998 )).

B7 is typically not expressed on tumor cells, so they are not effective antigen presenting cells (APCs) for T cells. Induction of B7 expression would allow tumor cells to more effectively stimulate proliferation of cytotoxic T lymphocytes and effector function. Co-stimulation by a combination of B7 / IL-6 / IL-12 showed induction of the IFN gamma and Th1 cytokine profile in a T cell population, resulting in further enhanced T cell activity ( Gajewski et al., J. Immunol. 154: 5637-5648 (1995 )).

Complete activation of cytotoxic T lymphocytes and complete effector function requires the involvement of T helper cells through the interaction between the CD40 ligand on the T helper cells and the CD40 molecule expressed by dendritic cells ( Ridge et al., Nature 393: 474 (1998 ) Bennett et al., Nature 393: 478 (1998 ) Schonberger et al., Nature 393: 480 (1998 )). The mechanism of this co-stimulatory signal is probably related to the enhancement of B7 and associated IL-6 / IL-12 production by the dendritic cells (antigen-presenting cells). The CD40-CD40L interaction thus complements the interactions of signal 1 (antigen / MHC-TCR) and signal 2 (B7-CD28).

The use of anti-CD40 antibodies for stimulation of dendritic cells would be expected to directly enhance a response to tumor antigens that are normally outside the range of an inflammatory response or presented by non-professional antigen presenting cells (tumor cells). In these situations, T helper and B7 co-stimulating signals are not provided. This mechanism could be used in the context of therapies based on antigen-pulsed dendritic cells, or in situations where T helper epitopes have not been defined in known TRA precursors.

Also provided according to the invention is administration of nucleic acids, polypeptides or peptides. Administration of polypeptides and peptides may be accomplished in a manner known per se. In one embodiment, administration of nucleic acids is by ex vivo methods, ie, by removing cells from a patient, genetically modifying the cells to incorporate a tumor-associated antigen, and reintroducing the altered cells into the patient. This generally involves introducing a functional copy of a gene into the cells of a patient in vitro and returning the genetically altered cells to the patient. The functional copy of the gene is under the functional control of regulatory elements that allow expression of the gene in the genetically engineered cells. Transfection and transduction methods are known in the art. Also provided according to the invention is administration of nucleic acids in vivo through the use of vectors such as viruses and targeted liposomes.

In a preferred embodiment, a viral vector for the administration of a nucleic acid encoding a tumor-associated antigen is selected from the group consisting of adenoviruses, adeno-associated viruses, poxviruses, including vaccinia virus and attenuated poxviruses, Semliki forest virus, Retroviruses, Sindbis virus and Ty virus-like particles. Particularly preferred are adenoviruses and retroviruses. The retroviruses are usually replication-deficient (ie, they are unable to produce infectious particles).

Various methods can be used to introduce according to the invention nucleic acids in cells in vitro or in vivo . Such methods include transfection of nucleic acid CaPO ₄ precipitates, transfection of nucleic acids associated with DEAE, transfection or infection with the above viruses carrying the nucleic acids of interest, liposome-mediated transfection, and the like. In certain embodiments, control of the nucleic acid to particular cells is preferred. In such embodiments, a carrier used to deliver a nucleic acid to a cell (eg, a retrovirus or a liposome) may have a bound targeting molecule. For example, a molecule such as an antibody specific for a surface membrane protein on the target cell or a ligand for a receptor on the target cell can be incorporated into or bound to the nucleic acid carrier. Preferred antibodies include antibodies that selectively bind a tumor-associated antigen. If administration of a nucleic acid by liposomes is desired, proteins that bind to a surface membrane protein associated with endocytosis may be incorporated into the liposome formulation to facilitate targeting and / or uptake. Such proteins include capsid proteins or fragments thereof that are specific for a particular cell type, antibodies to proteins that are internalized, proteins that target an intracellular site, and the like.

The therapeutic compositions of the invention can be administered in pharmaceutically acceptable formulations. Such preparations may ordinarily contain pharmaceutically acceptable concentrations of salts, buffers, preservatives, carriers, supplemental immunity enhancing agents such as adjuvants, CpG and cytokines, and optionally other therapeutic agents.

The therapeutic agents of the present invention can be administered by any conventional route, including injection or infusion. The administration may be, for example, oral, intravenous, intraperitoneal, intramuscular, subcutaneous or transdermal. Therapeutic administration of antibodies is preferably by a lung aerosol. The administration of antisense nucleic acids is preferably by slow intravenous administration.

The compositions of the invention are administered in effective amounts. An "effective amount" refers to the amount that achieves a desired response or effect alone or with other doses. In the case of treatment of a particular disease or condition characterized by the expression of one or more tumor-associated antigens, the desired response relates to the inhibition of disease progression. This includes slowing the progression of the disease and, in particular, interrupting the progression of the disease. The desired response in treating a disease or condition may also be the delay in the onset or prevention of the onset of the disease or condition.

An effective amount of a composition of the invention will depend on the condition being treated, the severity of the disease, the individual parameters of the patient, including age, physiological condition, height and weight, duration of treatment, type of concomitant therapy (if any) specific route of administration and similar factors.

The pharmaceutical compositions of the invention are preferably sterile and contain an effective amount of the therapeutically active substance for the production of the desired reaction or effect.

The doses of the compositions of the present invention administered may depend on various parameters such as the mode of administration, the condition of the patient, the desired period of administration, and so on. In the event that a patient's response is insufficient at an initial dose, higher doses (or effectively higher doses achieved by a different, more localized route of administration) may be employed.

Generally, for treatment or to create or enhance an immune response, doses of the tumor-associated antigen are formulated and administered from 1 ng to 1 mg, preferably from 10 ng to 100 μg. If the administration of nucleic acids (DNA as well as RNA) encoding tumor-associated antigens is desired, doses of 1 ng to 0.1 mg are formulated and administered.

The pharmaceutical compositions of the invention are generally administered in pharmaceutically acceptable amounts and in pharmaceutically acceptable compositions. The term "pharmaceutically acceptable" refers to a non-toxic material that does not interfere with the action of the active ingredient of the pharmaceutical composition. Such preparations may usually contain salts, buffers, preservatives, carriers and optionally other therapeutic agents. When used in medicine, the salts should be pharmaceutically acceptable. However, non-pharmaceutically acceptable salts can be used for the preparation of pharmaceutically acceptable salts thereof and are included in the invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those made from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic , Malonic, succinic and the like. Pharmaceutically acceptable salts may also be prepared as alkali metal or alkaline earth metal salts such as sodium, potassium or calcium salts.

A pharmaceutical composition of the invention may comprise a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" as used herein refers to one or more compatible solid or liquid fillers, diluents or capsule substances suitable for administration to a human. The term "carrier" refers to an organic or inorganic ingredient, natural or synthetic, in which the active ingredient is combined to facilitate application. The components of the pharmaceutical composition according to the invention are usually such that no interaction occurs which substantially impairs the desired pharmaceutical activity.

The pharmaceutical compositions of the invention may contain suitable buffers such as acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt.

The pharmaceutical compositions may also optionally contain suitable preservatives such as benzalkonium chloride, chlorobutanol, parabens and thimerosal.

The pharmaceutical compositions are usually presented in a unit dosage form and can be prepared in a manner known per se. For example, pharmaceutical compositions of the present invention may be in the form of capsules, tablets, lozenges, suspensions, syrups, elixirs or as an emulsion.

Compositions suitable for parenteral administration usually comprise a sterile aqueous or non-aqueous preparation of the active ingredient, which is preferably isotonic with the blood of the recipient. Compatible carriers and solvents include Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are usually used as the solution or suspension medium.

The present invention will be described in detail by the following figures and examples, which are given by way of illustration only and not by way of limitation. On the basis of the description and the examples, further embodiments are accessible to the person skilled in the art, which are likewise included according to the invention.

pictures:

• Fig. 1 : Schematic representation of the cloning of eCT. The strategy involves the identification of candidate genes (GOIs) in databases and the testing of these genes by RT-PCR.
• Fig. 2 : Splicing of LDH C. Alternative splicing events lead to the absence of exon 3 (SEQ ID NO: 2), the two exons 3 and 4 (SEQ ID NO: 3), exons 3, 6 and 7 (SEQ ID NO: 4) or exon 7 (SEQ ID NO: 5). ORF = open reading frame, aa = amino acid.
• Fig. 3 : Alignment of possible LDH-C proteins. SEQ ID NO: 8 and SEQ ID NO: 10 represent truncated portions of the prototype protein (SEQ ID NO: 6). The protein sequences of SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13 additionally modified and contain only tumor-specific epitopes (in bold). The catalytic center is framed.
• Fig. 4 : Quantification of LDH C in Different Tissues by Real-Time PCR. No transcripts were detected in normal tissues other than testis but significant expression levels in tumors.
• Fig. 5 : Exon composition of TPTE variants. In accordance with the invention, splice variants were identified (SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57) expressed in testicular tissue and tumors and frameshifting and thus have altered sequence regions.
• Fig. 6 : Alignment of the possible TPTE proteins. Alternative splicing events result in changes in the encoded protein, the reading frame basically being preserved. The putative transmembrane domains are in bold, the catalytic domain is boxed.
• Fig. 7 : Alignment of TSBP variants at the nucleotide level. The differences in the nucleotide sequences of the TSBP variants found according to the invention (SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33) to the known sequence (NM_006781, SEQ ID NO: 29) are shown in bold.
• Fig. 8 : Alignment of TSBP variants at the protein level. Frame shifts result in the proteins encoded by the TSBP variants found according to the invention (SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36) to substantial differences from the protein described above (SEQ ID NO: 30, NM_006781) and are marked in bold.
• Fig. 9 : RT-PCR for MS4A12. In the tissues tested, expression could only be detected in testis, colon and colorectal carcinomas (colonic Ca's). Of the 6 liver tissue samples shown, one positive for MS4A12 was detected, as it is infiltrated by a metastasis of a colon carcinoma. Later investigations also showed a clear expression in colon carcinoma metastases
• Fig. 10 : RT-PCR for BRCO1. In breast tumors, BRCO1 is significantly overexpressed compared to expression in normal mammary gland tissue.
• Fig. 11: RT-PCR for MORC, TPX1, LDHC, SGY-1. Examination of various normal tissues shows expression only in testis (1 skin, 2 small intestine, 3 colon, 4 liver, 5 lung, 6 stomach, 7 breast, 8 kidney, 9 ovary, 10 prostate, 11 thyroid, 12 leukocytes, 13 thymus, 14 negative Control, 15 testis). Examination of tumors (1-17 lung tumors, 18-29 melanomas, 30 negative controls, 31 testis) shows ectopic expression in these at different frequencies for each eCT.
• Fig. 12: Mitochondrial localization of LDHC in the MCF-7 breast cancer cell line. MCF-7 cells were transiently transfected with an LDHC expression plasmid. The antigen was detected with LDHC-specific antibodies and showed marked colocalization with the mitochondrial respiratory chain enzyme cytochome C oxidase.
• Fig. 13: Predicted topology of TPTE and subcellular localization at the cell surface of MCF-7 cells
  The left panel shows the 4 putative trypsum membrane domains (arrows) of TPTE. MCF-7 cells were transiently transfected with a TPTE expression plasmid. The antigen was detected with TPTE-specific antibodies and showed marked colocalization with cell surface localized MHC I molecules.
• Fig. 14 : MS4A12 Localization at the cell membrane.
  Tumor cells were transiently transfected with a GFP-tagged MS4A12 construct and displayed complete colocalization with plasma membrane markers in confocal immunofluorescence microscopy.

Examples: material and methods

The terms " in silico ", "electronic" and "virtual cloning" refer purely to the use of database-based techniques that can be used to simulate laboratory experimental procedures.

All other terms and terms are, unless explicitly defined otherwise, used as understood by those skilled in the art. The techniques and methods mentioned are carried out in a manner known per se and are, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. described. All procedures involving the use of kits and reagents are carried out according to the manufacturer's instructions.

Datamining-based strategy for the detection of eCT (electronically cloned cancer / testis genes)

Two in silico strategies namely GenBank keyword search and the cDNAxProfiler were combined ( Fig. 1 ). Using the ENTREZ Search and Retrieval System of the NCBI (http://www.ncbi.nlm.nih.gov/Entrez), a search was made for candidate genes in the GenBank that are annotated as specifically expressed in testicular tissue ( Wheeler et al., Nucleic Acids Research 28: 10-14, 2000 ).

Through search queries with the keywords "testis-specific genes", "sperm-specific genes", "spermatogonia-specific genes" candidate genes (GOI, genes of interest) were extracted from the databases. The search was restricted to a part of the total information of these databases by using "homo sapiens" as limit for the organism and "mRNA" for the molecular species.

The list of found GOIs was curated by identifying different names for the same sequence and correcting such redundancies.

All candidate genes, which resulted from the keyword search, were again examined by the method of "electronic northem" (eNorthern) regarding their tissue distribution. The eNorthern is based on the sequence of a GOI compared to an EST (expressed sequence tag) database ( Adams et al., Science 252: 1651, 1991 ) (http://www.ncbi.nlm.nih.gov/BLAST). To each EST, which is homologous to the Given the GOI input results, the origin of the tissue can be determined and the sum of all ESTs can be used to obtain a preliminary assessment of the tissue distribution of the GOI. Only those GOIs were submitted to further studies that had no homologies to EST from non-testicular normal tissues except placenta and fetal tissue. For this evaluation, it was also considered that there are false-annotated cDNA libraries in the public domain ( Scheurle et al., Cancer Res. 60: 4037-4043, 2000 ) (www.fau.edu/cmbb/publications/cancergenes6.htm).

As a second data mining method the cDNA xProfiler of the Cancer Genome Anatomy project of NCBI (http://cgap.nci.nih.gov/Tissues/xProfiler) was used ( Hillier et al., Genome Research 6: 807-828, 1996 ; Pennisi, Science 276: 1023-1024, 1997 ). This allows pools of database-stored transcriptomes to be related by logical operators. We have defined pool A, to which all expression libraries produced from testis have been assigned, excluding mixed libraries. Pool B was assigned all cDNA libraries prepared from normal tissues except testis, ovary and fetal tissue. In general, all cDNA libraries were used regardless of the underlying manufacturing process, but only those with a thickness> 1000 admitted. Pool B was digitally subtracted from Pool A using the BUT NOT operator. Also, the set of GOI found in this way was subjected to eNorthern studies, and verified by a literature search. This combined data mining involves all of the approximately 13,000 full-length genes in the public domain and predicts from these a total of 140 genes with potential testis-specific expression. Among these were 25 already known genes of the CT gene class, which underlines the efficiency of our strategy.

All other genes were initially evaluated by specific RT-PCR in normal tissues. All GOI that were expressed as expressed in non-testicular normal tissues had to be considered as false-positives and were excluded from further investigations. The remaining ones were examined in a large panel of different tumor tissues. The antigens shown below proved to be activated ectopically in tumor cells.

RNA extraction, preparation of poly-d (T) primed cDNA and RT-PCR analysis

Total RNA from native tissue material was extracted using guanidium isothiocyanates as a chaotrophic agent ( Chomczynski & Sacchi, Anal. Biochem. 162: 156-9, 1987 ). After extraction with acidic phenol and precipitation with isopropanol, the RNA was dissolved in DEPC-treated water.

From 2-4 μg of total RNA, a first-strand cDNA synthesis was carried out in a 20 μl reaction mixture using Superscript II (Invitrogen) according to the manufacturer's instructions. The primer used was a dT (18) oligonucleotide. Integrity and quality of the cDNA were checked by amplification of p53 in a 30-cycle PCR (sense CGTGAGCGCTTCGAGATGTTCCG, antisense CCTAACCAGCTGCCCAACTGTAG, hybridization temperature 67 ° C).

An archive of first-strand cDNAs from a variety of normal tissues and tumor entities was prepared. For expression studies, 0.5 μl of these cDNAs were amplified in a 30 μl reaction mixture using GOI-specific primers (see below) and 1 U HotStarTaq DNA polymerase (Qiagen). The reaction mixture contained in each case 0.3 mM dNTPs, 0.3 μM each of each primer and 3 μl of 10 × reaction buffer.

The primers were chosen to be in 2 different exons, and elimination of interference from contaminating genomic DNA as the cause of false positives was confirmed by testing non-reverse transcribed DNA as a template. After 15 minutes at 95 ° C to activate the HotStarTaq DNA polymerase 35 cycles of PCR were performed (1 min 94 ° C, 1 min each hybridization temperature, 2 min 72 ° C and final elongation at 72 ° C for 6 min). 20μl of this reaction was separated on an ethidium bromide stained agarose gel and analyzed.

• LDH-C (67°C)
  sense TGCCGTAGGCATGGCTTGTGC, antisense CAACATCTGAGACACCATTCC
• TPTE (64°C)
  sense TGGATGTCACTCTCATCCTTG, antisense CCATAGTTCCTGTTCTATCTG
• TSBP (63°C)
  sense TCTAGCACTGTCTCGATCAAG, antisense TGTCCTCTTGGTACATCTGAC
• MS4A12 (66°C)
  sense CTGTGTCAGCATCCAAGGAGC, antisense TTCACCTTTGCCAGCATGTAG
• BRCO1 (60°C)
  sense CTTGCTCTGAGTCATCAGATG, antisense CACAGAATATGAGCCATACAG
• TPX1 (65°C)
  sense TTTTGTCTATGGTGTAGGACC, antisense GGAATGGCAATGATGTTACAG

The following primers were used for the expression analysis of the corresponding antigens at the indicated hybridization temperature.

• LDH-C (67 ° C)
  sense TGCCGTAGGCATGGCTTGTGC, antisense CAACATCTGAGACACCATTCC
• TPTE (64 ° C)
  sense TGGATGTCACTCTCATCCTTG, antisense CCATAGTTCCTGTTCTATCTG
• TSBP (63 ° C)
  sense TCTAGCACTGTCTCGATCAAG, antisense TGTCCTCTTGGTACATCTGAC
• MS4A12 (66 ° C)
  sense CTGTGTCAGCATCCAAGGAGC, antisense TTCACCTTTGCCAGCATGTAG
• BRCO1 (60 ° C)
  sense CTTGCTCTGAGTCATCAGATG, antisense CACAGAATATGAGCCATACAG
• TPX1 (65 ° C)
  sense TTTTGTCTATGGTGTAGGACC, antisense GGAATGGCAATGATGTTACAG

Preparation of random hexamer-primed cDNA and quantitative real-time PCR

The expression of LDHC was quantified by real-time PCR.

The principle of quantitative real-time PCR with the ABI PRISM Sequence Detection System (PE Biosystems, USA) utilizes the 5'-3 'exonuclease activity of Taq DNA polymerase for direct and specific detection of PCR products by release of fluorescence reporter dyes. In addition to sense and antisense primers, a double fluorescence-labeled probe (TaqMan probe) is used in the PCR which hybridizes to a sequence of the PCR product. The probe is labeled 5 'with a reporter dye (eg FAM) and 3' with a quencher dye (eg TAMRA). If the probe is intact, the close proximity of reporter to quencher suppresses the emission of reporter fluorescence. When the probe hybridizes to the PCR product during PCR, it is cleaved by the 5'-3 'exonuclease activity of the Taq DNA polymerase and the suppression of reporter fluorescence is abolished. The increase in reporter fluorescence as a result of target amplification is measured after each PCR cycle and used for quantification. The expression quantification of the target gene is absolute or relative to the expression of a control gene with constant expression in the tissues to be examined. The expression of LDHC was calculated after normalization of the samples against 18s RNA as a so-called housekeeping gene using the ΔΔ-C _t method (PE Biosystems, USA). The reactions were performed in duplex approaches and determined in duplicates. The synthesis of the cDNA was carried out using the High Capacity cDNA Archive Kit (PE Biosystems, USA) using hexamer primers according to the manufacturer. In each case 5 μl of the diluted cDNA were used in 25 μl total volume for the PCR: sense primer (GGTGTCACTTCTGTGCCTTCCT) 300 nM; antisense primer (CGGCACCAGTTCCAACAATAG) 300 nM; TaqMan sample (CAAAGGTTCTCCAAATGT) 250 nM; sense primer 18s RNA 50 nM; antisense primer 18s RNA 50 nM; 18 s RNA sample 250 nM; 12.5 μl TaqMan Universal PCR Master Mix; initial denaturation 95 ° C (10 min); 95 ° C (15 sec); 60 ° C (1 min); 40 cycles. By amplification of a 128 bp product across the border of exon 1 and exon 2, all described splice variants of LDHC were included in the quantification.

Cloning and sequence analysis

Cloning of full-length or gene fragments was carried out according to common methods. To determine the sequence, corresponding antigens were amplified by means of the proofreading polymerase pfu (Stratagene). After completion of the PCR, adenosine was ligated to the ends of the amplicon using HotStarTaq DNA polymerase to clone the fragments into the TOPO-TA vector according to the manufacturer's instructions. The sequencing was performed by a commercial service. The sequences were analyzed using common prediction programs and algorithms.

Example 1: Identification of LDH C as a new tumor antigen

LDH C (SEQ ID NO: 1) and its translation product (SEQ ID NO: 6) have been described as a testis-specific isoenzyme of the lactate dehydrogenase family. The sequence is published in GenBank under accession number NM_017448. The enzyme forms a homotetramer with a molecular weight of 140 kDa ( Goldberg, E. et al., Contraception 64 (2): 93-8, 2001 ; Cooker et al., Biol. Reprod. 48 (6): 1309-19, 1993 ; Gupta, GS, Crit. Rev. Biochem. Mol. Biol. 34 (6): 361-85, 1999 ).

RT-PCR Assays for expression analysis with a primer pair (5'-TGCCGTAGGCATGGCTTGTGC-3 ', 5'-CAACATCTGAGACACCATTCC-3') that do not cross-amplify the related and ubiquitously expressed isoenzymes LDH A and LDH B, and on the LDH C prototype sequence NM_017448, the is described as being testis-specific, confirmed the lack of expression in all the normal tissues tested according to the invention, but showed that the stringent transcriptional repression of this antigen is abolished in somatic cells in tumors; see. Table 1. As traditionally described for CT genes, LDH C is expressed in a number of tumor entities. <b> Table 1. Expression of LDHC in tumors </ b> tissue tested in total positive % melanoma 16 7 44 breast cancers 20 7 35 Colorectal tumors 20 3 15 prostate cancers 8th 3 38 lung 17 8th 47 Renal cell carcinoma 7 4 57 ovarian cancer 7 3 43 thyroid carcinomas 4 1 25 Zervixkarzimome 6 5 83 Melanoma cell lines 8th 5 63 Bronchogenic carcinoma cell lines 6 2 33

The expected size of the amplification product with the above-mentioned PCR primers is 824 bp. According to the invention, however, the amplification of multiple additional bands was observed in tumors, but not in testis. Since this is indicative of the presence of alternative splice variants, the entire open reading frame was amplified with LDH-C specific primers (5'-TAGCGCCTCAACTGTCGTTGG-3 ', 5'-CAACATCTGAGACACCATTCC-3') and independent full-length clones were sequenced. Comparisons with the prototype ORF of the described sequence of LDH C (SEQ ID NO: 1) and the genomic sequence on chromosome 11 confirm additional splice variants (SEQ ID NO: 2-5). The alternative splicing events result in the absence of exon 3 (SEQ ID NO: 2), the two exons 3 and 4 (SEQ ID NO: 3), exons 3, 6 and 7 (SEQ ID NO: 4) and exon 7, respectively (SEQ ID NO: 5) (cf. Fig. 2 ).

These new splice variants are generated exclusively in tumors but not in the testis. The alternative splicing results in changes in reading frame and results in new possible ORF encoding the amino acid sequences shown in SEQ ID NOs: 7-13 (ORF for SEQ ID NO: 7: nucleotide position 59-214 of SEQ ID NO: 2 and SEQ ID NO: 4; ORF for SEQ ID NO: 8: nucleotide position 289-939 of SEQ ID NO: 2; ORF for SEQ ID NO: 9: nucleotide position 59-196 of SEQ ID NO: 3; ORF for SEQ ID NO: 10: nucleotide position 535-765 of SEQ ID NO: 3; ORF for SEQ ID NO: 11: nucleotide position 289-618 of SEQ ID NO: 4; ORF for SEQ ID NO: 12: nucleotide position 497-697 of SEQ ID NO: 4; ORF for SEQ ID NO: 13: nucleotide position 59-784 of SEQ ID NO: 5) ( Fig. 2 . 3 ). In addition to premature termination, the use of alternative start codons is possible, so that the encoded proteins can be shortened N- as well as C-terminal.

• SEQ ID NO:14: GAVGMACAISILLK ITVYLQTPE (aus SEQ ID NO:7)
• SEQ ID NO:15: GAVGMACAISILLKWIF (aus SEQ ID NO:9)
• SEQ ID NO:16: GWIIGEHGDSS GIIWNKRRTLSQYPLCLGAEWCLRCCEN (aus SEQ ID NO:11)
• SEQ ID NO:17: MVGLLENMVILV GLYGIKEELFL (aus SEQ ID NO:12)
• SEQ ID NO:18: EHWKNIHKOVIO RDYME (aus SEQ ID NO:13)

While SEQ ID NO: 8 and SEQ ID NO: 10 represent truncated portions of the prototype protein, the protein sequence of SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 13 additionally altered and include only tumor-specific epitopes (bold in Fig. 3 ). Peptide regions that could lead to tumor-specific epitopes are as follows (the strictly tumor-specific fraction that results from frameshifting is underlined):

• SEQ ID NO: 14: GAVGMACAISILLK ITVYLQTPE (from SEQ ID NO: 7)
• SEQ ID NO: 15: GAVGMACAISILLKWIF (from SEQ ID NO: 9)
• SEQ ID NO: 16: GWIIGEHGDSS GIIWNKRRTLSQYPLCLGAEWCLRCCEN (from SEQ ID NO: 11)
• SEQ ID NO: 17: MVGLLENMVILV GLYGIKEELFL (from SEQ ID NO: 12)
• SEQ ID NO: 18: EHWKNIHKOVIO RDYME (from SEQ ID NO: 13)

These regions may potentially contain epitopes that can be recognized on MHC I or MHC II molecules of T lymphocytes and result in a strictly tumor-specific response.

Not all of the predicted proteins have the catalytic lactate dehydrogenase domain for the NADH-dependent metabolism of pyruvate to lactate, which is the last step in anaerobic glycolysis. This domain would be necessary for the enzymatic function as lactate dehydrogenase (framed in Fig. 3 ). Further analysis eg with algorithms such as TMpred and pSORT (Nakai & Kanehisa, 1992) predict different subcellular localizations for the putative proteins.

According to the invention, expression level was quantified by real-time PCR with a specific primer probe set. The amplicon lies in the transition between exon 1 and 2 and thus detects all variants (SEQ ID NO: 1-5). Also detect these studies no transcripts in normal tissues except testis. They confirm significant expression levels in tumors ( Fig. 4 ).

For the production of LDHC-specific polyclonal antibodies, a peptide from the outermost N-terminal region was selected according to the invention. MSTVKEQLIEKLIEDDENSQ (SEQ ID NO: 80). Using this peptide, LDHC-specific antibodies were produced in rabbits. Subsequent studies on protein expression confirmed the selective expression of LDHC in testis as well as in various tumors. In addition, according to the invention, in immunohistological examinations a pronounced colocalization of LDHC in the mitochondria with cytochrome C oxidase was found. This suggests that LDHC plays an important role in the respiratory chain of tumors.

Example 2: Identification of TPTE as a new tumor antigen

The sequences of the transcript of TPTE (SEQ ID NO: 19) and its translation product (SEQ ID NO: 22) are published in GenBank under accession number NM_013315 ( Walker, SM et al., Biochem. J. 360 (Pt 2): 277-83, 2001 ; Guipponi M. et al., Hum. Genet. 107 (2): 127-31, 2000 ; Chen H. et al., Hum. Genet. 105 (5): 399-409, 1999 ). TPTE has been described as a gene encoding a possible transmembrane tyrosine phosphatase with testis-specific expression located in the pericentromeric region of chromosomes 21, 13, 15, 22, and Y ( Chen, H. et al., Hum. Genet. 105: 399-409, 1999 ). Inventive alignment studies additionally show homologous genomic sequences on chromosomes 3 and 7.

Based on the sequence of TPTE (SEQ ID NO: 19), PCR primers were generated according to the invention (5'-TGGATGTCACTCTCATCCTTG-3 'and 5'-CCATAGTTCCTGTTCTATCTG3'-) and for RT-PCR analyzes (95 ° 15min; 94 ° 1 min, 63 ° 1 min, 72 ° 1 min, 35 cycles) in a variety of human tissues. It was found that expression in normal tissues is restricted to testis. As described for the other eCTs, according to the invention it has been shown that TPTE variants are activated ectopically in a number of tumor tissues; see. According to the invention, further splice variants were identified for TPTE (SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57), which are described in US Pat testicular tissue and tumors and show frameshifting and thus altered sequence regions ( Fig. 5 ). <b> Table 2. Expression of TPTE in tumors </ b> tissue tested in total positive % melanoma 18 9 50 breast cancers 20 4 20 Colorectal tumors 20 0 0 prostate cancers 8th 3 38 lung 23 9 39 Renal cell carcinoma 7 0 0 ovarian cancer 7 2 29 thyroid carcinomas 4 0 0 Zervixkarzimome 6 1 17 Melanoma cell lines 8th 4 50 Bronchogenic carcinoma cell lines 6 2 33 Breast carcinoma cell lines 5 4 80

The genomic sequence of TPTE consists of 24 exons (accession number NT_029430). The transcript shown in SEQ ID NO: 19 contains all of these exons. The splice variant shown in SEQ ID NO: 20 is formed by splicing out exon 7. The splice variant shown in SEQ ID NO: 21 shows a partial incorporation of an intron following exon 15. As can be seen from the variants SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, alternatively, exons 18, 19, 20 and 21 can also be spliced out.

These alternative splicing events result in alterations of the encoded protein, whereby the reading frame is basically preserved ( Fig. 6 ). For example, the translation product encoded by the sequence shown in SEQ ID NO: 20 (SEQ ID NO: 23) has a deletion of 13 amino acids compared to the sequence shown in SEQ ID NO: 22. The translation product encoded by the sequence shown in SEQ ID NO: 21 (SEQ ID 24) carries an additional insertion in the central region of the molecule, thereby differing by 14 amino acids from the other variants.

The translation products of the variants SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57 namely the proteins SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61 are also changed.

Functional domain prediction assays for SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 58, SEQ ID NO: 60, but not for SEQ ID NO: 59, SEQ ID NO: 61, the presence of a tyrosine phosphatase domain. For all variants, 3-4 transmembrane domains are predicted ( Fig. 6 ).

Analysis of TPTE antigen expression with specific antibodies confirmed selective expression in testis as well as in a number of different tumors. Colocalization studies also revealed that TPTE is localized with class I immunoglobulins on the cell surface of tumor cells. So far, TPTE has only been described as a Golgi-associated protein. Due to the expression of TPTE on the cell surface of tumor cells, this tumor antigen is suitable according to the invention as an excellent target for the development of diagnostic and therapeutic monoclonal antibodies. Due to the predicted membrane topology of TPTE, the extracellularly exposed areas are suitable for this purpose according to the invention in particular. According to the invention, this includes the peptides FTDSKLYIPLEYRS (SEQ ID NO: 81) and FDIKLLRNIPRWT (SEQ ID NO: 82). In addition, it has been shown that TPTE promotes the migration of tumor cells. For this purpose, tumor cells that were transfected with TPTE under the control of a eukaryotic promoter and control cells in so-called Boyden Chamber migration experiments were examined for whether they show a directed migration. TPTE-transfected cells had a significantly (3-fold) increased migration in 4 independent experiments according to the invention. These functional data indicate that TPTE plays a key role in metastasis of tumors. Thus, methods which according to the invention inhibit the endogenous activity of TPTE in tumor cells, for example by the use of antisense RNA, different methods of RNA interference (RNAi) by means of expression vectors or retroviruses, as well as by the use of small molecules, could lead to a reduced meatstasis and thus be therapeutically very significant. A causal relationship between the activity of a phosphatase in tumors and increased migration and increased metastasis formation has recently been established for tyrosine phosphatase PTEN ( Iijima and Devreotes Cell 109: 599-610, 2002 ).

Example 3: Identification of TSBP as New Tumor Antigen

The electronic cloning method used according to the invention gave TSBP (SEQ ID NO: 29) and the protein derived therefrom (SEQ ID NO: 30). The gene is prescribed as a testis-specific regulated (accession number NM_006781). It has been predicted that the gene encodes a basic protein and is located on chromosome 6 in the vicinity of a MHC complex coding sequence (C6orf10) ( Stammers M. et al., Immunogenetics 51 (4-5): 373-82, 2000 ). According to the invention, it has been shown that the above-described sequence is defective. The sequence according to the invention has significant sequence differences from the known sequence. According to the invention, 3 different splicing variants were cloned. The differences in the nucleotide sequences of the TSBP variants found according to the invention (SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33) to the known sequence (NM_006781, SEQ ID NO: 29) are described in US Pat Fig. 7 shown (differences shown in bold). They lead to frameshifts so that the proteins encoded by the TSBP variants found in accordance with the invention (SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36) substantially differ from the above-described protein (SEQ ID NO: 30) differ ( Fig. 8 ).

For this antigen, strict transcriptional repression in normal tissues was confirmed according to the invention (PCR primer 5'-TCTAGCACTGTCTCGATCAAG-3 'and 5'-TGTCCTCTTGGTACATCTGAC-3'). However, TSBP was also expressed in normal lymph node tissue in 25 examined normal tissues except in testis. According to the invention, ectopic activation has also been demonstrated in tumors for TSBP, which is why it qualifies as a tumor marker or tumor-associated antigen (Table 3).

Although TSBP expression is found in primary tumor tissue but not in permanent cell lines from corresponding tumor entities. In addition, the gene is in direct proximity to Notch 4, which has specific expression in arteries and is involved in vascular morphogenesis. These are significant indications that this is a marker for specific endothelial cells. TSBP may therefore serve as a potential marker for tumor endothelia and for neovascular targeting.

Thus, the promoter of TSBP can be cloned to another gene product whose selective expression in the lymph node is desired.

The analysis of TSBP antigen expression with specific antibodies confirmed the selective localization of the protein in testis and lymph nodes as well as in melanomas and Lung cancer. In addition, immunohistological studies with GFP-tagged TSBP showed pronounced perinuclear accumulation. <b> Table 3. Expression of TSBP in tumors </ b> tissue tested in total positive % melanoma 12 2 16 breast cancers 15 0 - Colorectal tumors 15 0 - prostate cancers 8th 0 - lung 7 17 41 Renal cell carcinoma 7 0 - ovarian cancer 7 0 - thyroid carcinomas 4 0 - Zervixkarzimome 6 0 - Melanoma cell lines 8th 0 - Bronchogenic carcinoma cell lines 6 0 -

Example 4: Identification of MS4A12 as a New Tumor Antigen

MS4A12 (SEQ ID NO: 37, accession number NM_017716) and its translation product (SEQ ID NO: 38) are members of a multigene family related to the B-cell specific antigen CD20, the hematopoietic cell-specific protein HTm4, and the β-chain of the high affinity IgE receptor. As a characteristic, all family members have at least four potential transmembrane domains, both the C- and the N-terminus are cytoplasmic ( Liang Y. et al., Immunogenetics 53 (5): 357-68, 2001 ; Liang Y. & Tedder, Genomics 72 (2): 119-27, 2001 ). In accordance with the invention, RT-PCR investigations were carried out for MS4A12. The primers were selected based on the published MS4A12 sequence (NM_017716) (sense: CTGTGTCAGCATCCAAGGAGC, antisense: TTCACCTTTGCCAGCATGTAG). In the tissues tested, expression was only possible in testis, colon (6/8) and colorectal Carcinoma (colonic Ca's) (16/20) as well as in colonic metastases (12/15) ( Fig. 9 ).

The high incidence in colonic metastases makes TSBP an attractive diagnostic and therapeutic target. For the production of monoclonal antibodies and small chemical inhibitors, according to the invention, the extracellularized pederized region which comprises the protein sequence GVAGQDYWAVLSGKG (SEQ ID NO: 83) is particularly suitable. The intracellular localization of the MS4A12 protein on the cell membrane was also confirmed according to the invention by fluorescence superimposition with plasma membrane markers in confocal immunofluorescence. <b> Table 4. Expression of MS4A12 in normal and colorectal carcinomas and metastases </ b> ileum + colon + liver - lung - lymph node - stomach - spleen - adrenal - kidney - esophagus - ovary - rectum + testis + thymus - skin - Mamma - pancreas - PBMC - PBMC act. - prostate - thyroid - tube - uterus - cerebrum - cerebellum - Colorectal tumors 16/20 Colorectal tumors metastases 12/15

Thus, MS4A12 is a cell membrane-associated differentiation antigen for normal colonic epithelium, which is also expressed in colorectal tumors and metastases.

Example 5: Identification of BRCO1 as New Tumor Antigen

BRCO1 and its translation product are not previously described. The data mining method according to the invention gave the EST (expressed sequence tag) AI668620. Specific primers (sense: CTTGCTCTGAGTCATCAGATG, antisense: CACAGAATATGAGCCATACAG) were used for RT-PCR expression analysis. According to the invention, specific expression was found in testicular tissue, as well as additionally in normal mammary gland (Table 5). In all other tissues this antigen is transcriptionally repressed. It is also detected in mammary tumors (20 out of 20). In breast tumors, BRCO1 is significantly overexpressed compared to expression in normal mammary gland tissue ( Fig. 10 ).

By electronic full-length cloning using EST contigs (following EST were incorporated AW137203, BF327792, BF327797, BE069044, BF330665) succeeded according to the invention, the cloning of more than 1500 bp of this transcript (SEQ ID NO: 39). The sequence maps to chromosome 10p11-12. In the immediate vicinity of the same region, the gene for a mammalian differentiation antigen NY-BR-1 has already been described (NM_052997; Jager, D. et al., Cancer Res. 61 (5): 2055-61, 2001 ). <b> Table 5. Expression of BRCO1 in normal and breast tumors </ b> ileum - colon - liver - lung - lymph node - stomach - spleen - adrenal - kidney - esophagus - ovary - rectum - testis + thymus - skin - Mamma + pancreas - PBMC - PBMC act. - prostate - thyroid - tube - uterus - cerebrum - cerebellum - breast cancers ++ (20/20)

In matched pair (mamma carcinoma and adjacent normal tissue) studies showed in accordance with the invention in 70% of the mammal carcinomas BRCO1 overexpression compared to normal tissue.

Thus, BRCO1 is a new differentiation antigen for normal mammary epithelium that is overexpressed in breast tumors.

Example 6: Identification of TPX1 as New Tumor Antigen

The sequence of TPX1 (Acc Nos NM_003296, SEQ ID NO: 40) and its translation product (SEQ ID NO: 41) are known. The antigen has heretofore been described as merely testis-specific as an element of the outer fibers and the acrosome of spermatozoa. He has been playing a role as an adhesion molecule in the Attachment of sperm to Sertoli cells ( O'Bryan, MK et al., Mol. Reprod. Dev. 58 (1): 116-25, 2001 ; Maeda, T. et al., Dev. Growth Differ. 41 (6): 715-22, 1999 ). According to the invention, the aberrant expression of TPX1 in solid tumors was shown for the first time (Table 6). Due to the pronounced amino acid homology between TPX1 and the neutrophil-specific matrix glycoprotein SGP 28 ( Kjeldsen et al., FEBS Lett 380: 246-259, 1996 ) are suitable for the production of diagnostic and therapeutic molecules according to the invention TPX1-specific protein sequences comprising the peptide SREVTTNAQR (SEQ ID NO: 84). <b> Table 6. Expression of TPX1 in tumors </ b> tissue tested in total positive % melanoma 16 1 6 breast cancers 20 3 15 Colorectal tumors 20 0 0 prostate cancers 8th 3 37 lung 17 2 11 Renal cell carcinoma 7 1 14 ovarian cancer 7 1 14 thyroid carcinomas 4 0 0 Zervixkarzimome 6 1 16 Melanoma cell lines 8th 2 25 Bronchogenic carcinoma cell lines 6 1 16

Example 7: Identification of BRCO2 as a New Tumor Gene Product

BRCO2 and its translation product are not previously described. The process according to the invention gave the ESTs (expressed sequence tag) BE069341, BF330573 and AA601511. Specific primers (sense: AGACATGGCTCAGATGTGCAG, antisense: GGAAATTAGCAAGGCTCTCGC) were used to perform RT-PCR expression analysis studies. According to the invention, specific expression in testicular tissue, as well additionally found in normal mammary gland (Table 7). In all other tissues, this gene product is transcriptionally repressed. It is also detected in mammary tumors. By electronic Vollängeklonierung using EST contigs (following EST were incorporated BF330573, AL 044891 and AA601511) succeeded according to the invention, the cloning of 1300 bp of this transcript (SEQ ID 62). The sequence maps to chromosome 10p11-12. In the immediate vicinity of the same region, the gene for a mammalian differentiation gene product NY-BR-1 has already been described (NM_052997; Jager, D. et al., Cancer Res. 61 (5): 2055-61, 2001 ) and here is the example described above 6 BRCO1. Further genetic analyzes according to the invention showed that the sequence listed under SEQ ID NO: 62 represents the hitherto undescribed 3 'untranslated region of the NY-BR-1 gene. <b> Table 7. Expression of BRCO2 in normal and breast tumors </ b> tissue expression testis + Mamma + skin - liver - prostate - thymus - brain - lung - lymph node - spleen - adrenal - ovary - leukocytes - colon - esophagus - uterus - skeletal muscle - epididymis - bladder - kidney - Mamma-Ca +

BRCO2 is a novel differentiation gene product for normal mammary epithelium, which is also expressed in breast tumors.

Example 8: Identification of PCSC as a new tumor gene product

PCSC (SEQ ID_63) and its translation product are not previously described. The data mining method according to the invention gave the EST (expressed sequence tag) BF064073. Specific primers (sense: TCAGGTATTCCCTGCTCTTAC, antisense: TGGGCAATTCTCTCAGGCTTG) were used for RT-PCR expression analysis. According to the invention, specific expression was found in normal colon and additionally in colon carcinomas (Table 5). In all other tissues, this gene product is transcriptionally repressed. PCSC encodes two putative ORFs (SEQ_ID_64 and SEQ_ID_65). Sequence analysis of SBQ_ID_64 revealed a structural homology to CXC cytokines. In addition, 4 alternative PCSC cDNA fragments were cloned (SEQ ID NO: 85-88). According to the invention, each cDNA contains 3 putative ORFs which code for the polypeptides shown in SEQ ID NO: 89-100. <b> Table 8. Expression of PCSC in normal and colorectal carcinomas </ b> ileum + colon + liver - lung - lymph node - stomach - spleen - adrenal - kidney - esophagus - ovary - rectum + testis - thymus - skin - Mamma - pancreas - PBMC - PBMC act. - prostate - thyroid - tube - uterus - cerebrum - cerebellum - Colorectal tumors 19/20 Colorectal tumors metastases 15/15

Thus, PCSC is a differentiation antigen for normal colonic epithelium, which is also expressed in colorectal tumors as well as in all colonic metastases examined. The PCSC expression detected according to the invention in all colorectal metastases make this tumor antigen a very interesting target for the prophylaxis and treatment of metastatic colon tumors.

Example 9: Identification of SGY-1 as a new tumor antigen

The sequences of the transcript of SGY-1 (SEQ ID NO: 70) and its translation product (SEQ ID NO: 71) are published in GenBank under accession number AF177398 ( Krupnik et al., Gene 238, 301-313, 1999 ). Soggy-1 is described above as a member of the dickhead protein family which act as inhibitors and antagonists of the Wnt family of proteins. In turn, Wnt proteins have important functions in embryonic development. Based on the sequence of SGY-1 (SEQ ID NO: 70) PCR primers were generated according to the invention (5'-CTCCTATCCATGATGCTGACG-3 'and 5'-CCTGAGGATGTACAGTAAGTG-3') and for RT-PCR analyzes (95 ° 15min; 94 ° 1 min, 63 ° 1 min, 72 ° 1 min, 35 cycles) in a variety of human tissues. It was found that expression in normal tissues is restricted to testis. As described for the other eCTs, according to the invention it has been shown that SGY-1 is activated in a number of tumor tissues; see. Table 9. <b> Table 9. Expression of SGY-1 in tumors </ b> tissue tested in total positive % melanoma 16 4 25 breast cancers 20 4 20 Colorectal tumors 20 0 0 prostate cancers 8th 1 13 lung 32 3 18 Renal cell carcinoma 7 0 0 ovarian cancer 7 4 57 thyroid carcinomas 4 0 0 Zervixkarzimome 6 2 33 Melanoma cell lines 8th 2 25 Bronchogenic carcinoma cell lines 6 2 33 Breast carcinoma cell lines

Example 10: Identification of MORC as a new tumor antigen

The sequences of the transcript of MORC (SEQ ID NO: 74) and its translation product (SEQ ID NO: 75) are published in GenBank under accession number XM_037008 ( Inoue et al., Hum Mol Genet. Jul; 8 (7): 1201-7, 1999 ).

MORC is originally described as involved in spermatogenesis. Mutation of this protein in the mouse system leads to gonadal development.

Based on the sequence of MORC (SEQ ID NO: 74), PCR primers were generated according to the invention (5'-CTGAGTATCAGCTACCATCAG-3 'and 5'-TCTGTAGTCCTTCACATATCG-3') and for RT-PCR analyzes (95 ° 15min; 94 ° 1 min, 63 ° 1 min, 72 ° 1 min, 35 cycles) in a variety of human tissues. It was found that expression in normal tissues is restricted to testis. As described for the other eCTs, according to the invention it has been shown that MORC is activated ectopically in a number of tumor tissues; see. Table 10. <b> Table 10. Expression of MORC in tumors </ b> tissue tested in total positive % melanoma 16 3 18 breast cancers 20 0 0 Colorectal tumors 20 0 0 prostate cancers 8th 0 0 lung 17 3 18 Renal cell carcinoma 7 0 0 ovarian cancer 7 1 14 thyroid carcinomas 4 0 0 Zervixkarzimome 6 0 0 Melanoma cell lines 8th 1 12 Bronchogenic carcinoma cell lines 6 1 17

Claims (20)

A pharmaceutical composition comprising one or more ingredients selected from the group consisting of: (i) a tumor-associated antigen or a part thereof, (ii) a nucleic acid encoding a tumor-associated antigen or a portion thereof, (iii) an antibody which binds to a tumor-associated antigen or a part thereof, (iv) an antisense nucleic acid that specifically hybridizes with a nucleic acid encoding a tumor-associated antigen, (v) a host cell expressing a tumor-associated antigen or a portion thereof, and (vi) isolated complexes between a tumor-associated antigen or a part thereof and an HLA molecule,
wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). The pharmaceutical composition of claim 1, wherein the host cell secretes the tumor-associated antigen or portion thereof, expresses it on the surface, or expresses an HLA molecule that binds to the tumor-associated antigen or portion thereof. A pharmaceutical composition according to claim 1 or 2 for the treatment of a disorder characterized by the expression or abnormal expression of a tumor-associated antigen. A method of diagnosing a disease characterized by the expression or abnormal expression of a tumor-associated antigen (i) the detection of a nucleic acid encoding the tumor-associated antigen, or a portion thereof, and / or (ii) the detection of the tumor-associated antigen or a part thereof, and / or (iii) the detection of an antibody to the tumor-associated antigen or a part thereof and / or (iv) the detection of cytotoxic or helper T lymphocytes specific to the tumor-associated antigen or a portion thereof,
in a biological sample isolated from a patient,
wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). A method of determining the regression, progression or onset of a disease characterized by the expression or abnormal expression of a tumor-associated antigen comprising monitoring a sample from a patient having or suspected of having the disease to fall ill with respect to one or more parameters selected from the group consisting of: (i) the amount of nucleic acid encoding the tumor-associated antigen, or a portion thereof, (ii) the amount of the tumor-associated antigen or a part thereof, (iii) the amount of antibodies that bind to the tumor-associated antigen or a part thereof, and (iv) the amount of cytolytic or cytokine-releasing T cells specific for a complex between the tumor-associated antigen or a part thereof and an MHC molecule,
wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). An antibody that specifically binds to a protein or polypeptide or to a portion thereof, wherein the protein or polypeptide is encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). The pharmaceutical composition of claim 1 or the antibody of claim 6, wherein the antibody is coupled to a therapeutic or diagnostic agent. The antibody of claim 7 for use in a method of treating, diagnosing or monitoring a disease characterized by the expression or abnormal expression of a tumor-associated antigen, the method comprising administering the antibody and the tumor-associated antigen comprising a sequence which is encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). A pharmaceutical composition according to claim 1 or 7 or an antibody according to any one of claims 6 to 8, wherein the antibody is a monoclonal, chimeric or humanized antibody or a fragment of an antibody. A cytolytic or cytokine-releasing T-cell for use in a method of treating a patient with a disease characterized by the expression or abnormal expression of a tumor-associated antigen, comprising: (i) the removal of a sample with immunoreactive cells from the patient, (ii) contacting the sample with a host cell expressing the tumor-associated antigen or portion thereof under conditions that favor production of cytolytic or cytokine-releasing T cells against the tumor-associated antigen or portion thereof, and (iii) introducing the cytolytic or cytokine-releasing T cells into the patient in an amount effective to lyse cells expressing the tumor-associated antigen or portion thereof, the tumor-associated antigen having a sequence which is encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88, a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). The cytolytic or cytokine-releasing T cells of claim 10, wherein the host cell recombinantly or endogenously expresses an HLA molecule that binds to the tumor-associated antigen or a portion thereof. A pharmaceutical composition according to claim 3, a method according to claim 4 or 5, an antibody according to claim 8 or 9, or cytolytic or cytokine-secreting T cells according to claim 10 or 11, wherein the disease is cancer. A pharmaceutical composition according to claim 3, a method according to claim 4 or 5, an antibody according to claim 8 or 9, or cytolytic or cytokine-secreting T cells according to claim 10 or 11, wherein the disease is a lung tumor, a breast tumor, a prostate tumor, a melanoma, a colon tumor, a metastasis of a colon tumor, a renal cell carcinoma, a cervical carcinoma, a colon carcinoma or a mammary carcinoma. A pharmaceutical composition according to any one of claims 1 to 3, 7, 9, 12 and 13, a method according to any one of claims 4, 5, 12 and 13, an antibody according to any one of claims 6 to 9, 12 and 13, or cytolytic or cytokine releasing agents T cells according to any one of claims 10 to 13, wherein the protein or polypeptide or the tumor-associated antigen comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 6-12, 14-18, 80, 22- 24, 30, 34-36, 38, 41, 58-61, 64, 65, 71, 75, 81-84, 89-100, a part or derivative thereof. A nucleic acid encoding a protein or polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 7-12, 14-18, 80, 23-24, 34-36, 58-61, 64, 65, 89-100, a part or derivative thereof. A nucleic acid according to claim 15 which is selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 2-4, 20-21, 31-33, 37, 39, 54-57, 62, 63, 85-88 , a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c). A host cell comprising a nucleic acid according to claim 15 or 16. A protein or polypeptide encoded by a nucleic acid of claim 15 or 16, or an immunogenic fragment of the protein or polypeptide. A protein or polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 13, 7-12, 14-18, 80, 23-24, 34-36, 58-61, 64, 65, 89- 100, part or derivative thereof, or an immunogenic fragment of the protein or polypeptide. A kit for detecting the expression or abnormal expression of a tumor-associated antigen comprising means for detection (i) the nucleic acid encoding the tumor-associated antigen or a part thereof, (ii) the tumor-associated antigen or a part thereof, (iii) antibodies which bind to the tumor-associated antigen or a part thereof, and / or (iv) T cells specific for a complex between the tumor-associated antigen or a part thereof and an MHC molecule,
wherein the tumor-associated antigen has a sequence encoded by a nucleic acid selected from the group consisting of: (a) a nucleic acid comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 5, 1-4, 19-21, 29, 31-33, 37, 39, 40, 54-57, 62, 63 , 70, 74, 85-88 a part or derivative thereof, (b) a nucleic acid which hybridizes under stringent conditions with the nucleic acid under (a), (c) a nucleic acid which is degenerate with respect to the nucleic acid under (a) or (b), and (d) a nucleic acid complementary to the nucleic acid of (a), (b) or (c).

Images