EP2245160A1

EP2245160A1 - Cell surface display of proteins

Info

Publication number: EP2245160A1
Application number: EP09703905A
Authority: EP
Inventors: Heinrich Volschenk; Mariska Lilly
Original assignee: Stellenbosch University
Current assignee: Stellenbosch University
Priority date: 2008-01-22
Filing date: 2009-01-21
Publication date: 2010-11-03
Also published as: WO2009093118A9; WO2009093118A1; EP2245160A4

Abstract

A yeast cell surface display system is described comprising a scaffoldin protein from Clostridium which includes at least one cohesin domain capable of binding to a dockerin domain, the scaffoldin protein displayable on the surface of the yeast cell, such as S. cerevisiae, and an anchoring protein capable of tethering the scaffoldin protein the yeast cell surface, such as cell wall protein 1 (Cwp 1 ). Cwp 1 is fused to the C-terminus of the scaffoldin protein and a secretion signal, such as Trichoderma reesei XYN2 is fused to the N-terminus of the chimeric scaffoldin protein. The scaffoldin protein is chimeric and comprises at least one C. cellulolyticum cohesin domain and at least one C. Thermocellum cohesin domain. The invention also includes a vector for expression of such a fusion protein.

Description

CELL SURFACE DISPLAY OF PROTEINS

FIELD OF THE INVENTION

The invention relates to a yeast cell surface display system, to a method of displaying a polypeptide on a yeast cell surface, and to vectors and proteins for use therein.

BACKGROUND TO THE INVENTION

The microbial cell surface display of proteins is a widely used approach for industrial applications including vaccine development, gene therapy, cell-based diagnostics, high-throughput polypeptide library screening, whole-cell biocatalysis, bioremediation, biosensors and even biofuels production (Chen and Georgiou 2002; Wu et al. 2008). Microbial cell surface display systems are typically based on the expression of translational fusions of a carrier protein and a desired passenger protein (such as one demonstrating desirable enzymatic activity) (Lee et al. 2003). Systems have been developed for displaying desired proteins on the outer surface of both prokaryotic and eukaryotic cells, including Gram-positive (Gunneriusson et al. 1996; Samuelson et al. 1995; Schneewind et al. 1995) and Gram-negative (Earhart 2000; Georgiou et al. 1997; Lang et al. 2000; Westerlund-Wikstrom 2000) bacteria, yeasts (Kondo and Ueda 2004; Gai and Wittrup 2007), mammalian cells (Baumann et al. 2000; Ho et al. 2006), as well as phages (Smith 1985; Charbit et al. 1986; Chriswell and McCafferty 1992) and baculovirus (Makela et al. 2006). In yeast, Saccharomyces cerevisiae, several display systems have also been developed and applied with varying degrees of success (Ueda and Tanaka 2000; Matsumoto et al. 2002; Wang et al. 2007; Yue et al. 2008). Most of the cell surface display methods developed for S. cerevisiae have been based on the agglutinin and flocculin model systems (Saleem et al. 2008). The cell wall proteins used include σ-agglutinin, Aga1, Cwp1 , Cwp2, Tipi p, Srp1 (Van der Vaart et al. 1995, 1997), FIoIp (Theunissen et al. 1993; Tanino et al. 2007), Sedip (Hardwick et al. 1992), TiMp (Marguet et al. 1988) and YCR89W (Oliver et al. 1992). These cell wall proteins contain the glycosyl phosphatidylinositol (GPI) signal motif and are covalently cross-linked to /?-1 ,6-glucan in the cell wall. The tethering of a lipase to the yeast cell wall using the mannose-oligosacharide binding property of a FIoIp lacking the GPI domain has also been described (Matsumoto et al. 2002). Further yeast strains have been reported that are equipped with a variety of functional displayed proteins including antibodies, enzymes and combinatorial protein libraries (Breinig et al. 2006; Furukawa et al. 2006; Lee et al. 2006; Parthasarathy et al. 2006; Dϋrauer et al. 2008).

The use of these published cell surface systems for the expression of an enzyme as a fusion protein often result in a reduction in displayed enzyme activity of the enzymatic passenger protein. For example, surface displayed α- galactosidase, lipase, cutinase and β-lactamase enzymes have been shown to have reduced catalytic activities as compared to their native free forms (Schreuder et al. 1996). It has been proposed that this loss of displayed enzymatic activity is due to the incomplete exposure, unfolding or misfolding of the protein, or possibly to steric effects or repulsion of ligands by the hydrophobicity of the yeast cell wall (Chen and Georgiou 2002).

The use of these published cell surface systems often further result in cell envelope or cell wall perturbations, leading to the activation of extracytoplasmic and cell wall stress pathways (Narayanan and Chou 2008, De Nobel et al. 2000) which adversely affect the performance of the displayed protein.

There is a need for an improved cell surface display system capable of both producing a functional desired protein and displaying that functional protein on the cell surface.

OBJECT OF THE INVENTION

It is an object of the invention to provide an improved cell surface display system that may alleviate, at least to some extent, the abovementioned problems.

SUMMARY OF THE INVENTION

In accordance with the invention there is provided a yeast cell surface display system comprising a) at least one scaffoldin protein having at least one functional cohesin domain, and b) at least one anchoring protein, wherein the anchoring protein is capable of tethering the scaffoldin protein to a surface of a yeast cell.

Further features of the invention provide for the anchoring protein to be cell wall protein 1 (Cwp1 ) or a protein having at least 80% homology to SEQ ID NO 1 ; and for the N-terminus thereof to be fused to the C-terminus of the scaffoldin protein; for the yeast cell surface display system to further include a secretion signal, such as Trichoderma reesei XYN2 or a secretion signal having at least 80% homology to SEQ ID NO 2, fused to the N-terminus of the scaffoldin protein; for the scaffoldin to be a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain; for the scaffoldin protein to be from Clostridium; for the scaffoldin to be SEQ ID NO 3 or a protein having at least 80% homology to SEQ ID NO 3; and for the yeast to be S. cerevisiae.

The invention also provides a vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the scaffoldin protein on the yeast cell surface.

Further features of the invention provide for the expression elements to include nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to SEQ ID NO 4, ligated in frame with, and 3' to, the nucleic acid encoding the scaffoldin protein; for the vector to further include a nucleic acid encoding a secretion signal, such as Trichoderma reesei XYN2 or nucleic acid having at least 80% homology to SEQ ID NO 5, ligated in frame with, and 5' to, the nucleic acid encoding the scaffoldin protein; for the scaffoldin protein to be a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain; for the scaffoldin protein to be from

Clostridium; for the nucleic acid encoding the scaffoldin protein to be SEQ ID

NO 6 or nucleic acid having at least 80% homology to SEQ ID NO 6; for the expression elements to include at least one element selected from the group including the phosphoglycerate kinase I gene promoter (PGK1_P), nucleic acid at least 80% homologous to SEQ ID NO 7, the phosphoglycerate kinase I gene terminator (PGK1_T), and nucleic acid at least 80% homologous to SEQ ID NO 8; and for the yeast to be S. cerevisiae. The invention extends to a vector having the sequence of SEQ ID NO 9, or a vector at least 80% homologous to SEQ ID NO 9.

The invention still further provides a fusion protein comprising a) at least one scaffoldin protein having at least one functional cohesin domain, and b) at least one anchoring protein, wherein the anchoring protein is capable of tethering the scaffoldin protein to a surface of a yeast cell, and wherein the N-terminus of the anchoring protein is fused to the C-terminus of the scaffoldin protein.

Further features of the invention provide for the anchoring protein to be cell wall protein 1 (Cwp1) or a protein having at least 80% homology to SEQ ID NO 1 ; for the fusion protein to further include a secretion signal, such as Tήchoderma reesei XYN2 or a secretion signal having at least 80% homology to SEQ ID NO 2; for the C-terminus of the secretion signal to be fused to the N-terminus of the scaffoldin protein; for the scaffoldin protein to be a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain; for scaffoldin protein to be from Clostridium; for the scaffoldin to be SEQ ID NO 3 or a protein having at least 80% homology to SEQ ID NO 3; and for the yeast to be S. cerevisiae.

The invention yet further provides a yeast cell transformed with a vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the scaffoldin protein on the yeast cell surface. The invention also provides a method of displaying a polypeptide on a yeast cell surface, the method including the steps of a) transforming the yeast cell with a vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the expressed scaffoldin protein on the yeast cell surface, and b) contacting the yeast cell with a fusion protein comprising a dockerin domain and a polypeptide to be displayed.

Further features of the invention provide for the expression elements to include nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to SEQ ID NO 4, ligated in frame with, and 3' to, the nucleic acid encoding the scaffoldin protein; for the vector to further include a nucleic acid encoding a secretion signal, such as Thchoderma reesei XYN2 or nucleic acid having at least 80% homology to SEQ ID NO 5, ligated in frame with, and 5' to, the nucleic acid encoding the scaffoldin protein; for the scaffoldin to be a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain; for the scaffoldin protein to be from Clostridium; for the nucleic acid encoding the scaffoldin to be SEQ ID NO 6 or nucleic acid having at least 80% homology to SEQ ID NO 6; for the expression elements to include at least one element selected from the group including the phosphoglycerate kinase I gene promoter (PGK1_P), nucleic acid at least 80% homologous to SEQ ID NO 7, the phosphoglycerate kinase I gene terminator (PGK1τ), and nucleic acid at least 80% homologous to SEQ ID NO 8; for the yeast to be S. cerevisiae; for the dockerin domain of the fusion protein to be SEQ ID NO 10, or a protein having at least 80% homology to SEQ ID NO 10; for the dockerin domain to be fused to a random linker having the sequence of SEQ ID NO 11 or poly-alanine linker having the sequence of SEQ ID NO 12; and for the C-terminus of the linker to be fused to the N-terminus of the dockerin domain.

The term "functional cohesin domain" as used in this application may be defined as a cohesin domain capable of binding to a dockerin domain.

Further features of the invention will now become apparent from the following description, by way of example only, with reference to the accompanying drawings and figures.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the plasmid maps of (A) pMBRE2 {PGK1 p-XYNSEC- Scaf3-CWP2-PGK1 T expression cassette) and (B)

PMBRE21 (PGK1p-XYNSEC-CWP2-Scaf3-PGK1_T expression cassette); Figure 2 shows the plasmid maps of (A) pMBRE5-A (PGK1_P-

XYNSEC-GFP-Ala₁₀Dock-PGK1_T expression cassette) and (B) pMBRE5-B (PGK1 p-XYNSEC-GFP-Linker_Dock-PGK1 _τ expression cassette); Figure 3 is a micrograph of the immunofluorescent detection of cell surface displayed scaf3p at 1000 x magnification, (A) Parent strain S. cerevisiae NI-C-D4 without the Scaf3 gene, (B) S. cerevisiae Nl-C-D4( pMBRE21) expressing the Cwp2-scaf3 fusion protein with the primary antibody against the CBM- module of the scaf3p (rabbit anti-CBM) and goat anti-rabbit

IgG-AlexaFluor 488 as secondary antibody, (C) S. cerevisiae NI-C-D4(pMBRE2) expressing the scaf3-Cwp2 fusion protein with the primary antibody against the CBM- module of the scaf3p (rabbit anti-CBM) and goat anti-rabbit IgG-AlexaFluor 488 as secondary antibody, the first column represents the fluorescent image, the second column the light microscopy image and the third column shows the combination of the two;

Figure 4 is a Western-like blot showing the detection of membrane and cell wall associated scaf3p using the dockerin containing protein CelδA-Dockcf as a probe: Lane 1 : Biotinylated SDS molecular weight marker B2787 (Sigma

Aldrich), Lane 2: Purified scaf3p from Clostridium, Lane 3: Membrane-bound protein fraction isolated from S. cerevisiae NI-C-D4 parent strain, Lane 4: Membrane-bound protein fraction isolated from S. cerevisiae Nl-C- D4(pMBRE21) strain, Lane 5: Membrane-bound protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE2) strain, Lane 6: Cell wall associated protein fraction isolated from S. cerevisiae NI-C-D4 parent strain, Lane 7: Cell wall associated protein fraction isolated from S. cerevisiae Nl-C- D4(pMBRE2) strain, Lane 8: Cell wall associated protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE21) strain;

Figure 5 is a graph of the comparative endoglucanase activity

(measured as mg/ml glucose released from carboxymethylcellulose) of purified Cel5A-Dockcf fusion protein in the absence of yeast cells and in the presence of the S. cerevisiae NI-C-D4 parent strain and the recombinant S. cerevisiae NI-C-D4(pMBRE2) strain; Figure 6 is a micrograph of the comparative attachment of S. cerevisiae NI-C-D4 parent strain (A) and S. cerevisiae Nl-C-

D4(pMBRE2) expressing the PGK1 p-XYNSECScaf3-

CWP2-PGK1_T expression cassette (B) to the straight cut edge of Whatman® 3MM Chr filter paper at 1000 x magnification;

Figure 7 is a Western-like blot showing the detection of_λ the

GFPmut2-Docktf fusion proteins using scaf3p as a probe: Lane 1: Biotinylated SDS molecular weight marker B2787 (Sigma Aldrich), Lane 2: Purified Cel5A-Dockcf fusion protein from C. thermocellum, Lane 3: Membrane-bound protein fraction isolated from S. cerevisiae NI-C-D4 parent strain, Lane 4: Membrane-bound protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE5-A) strain, Lane 5: Membrane-bound protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE5-B) strain, Lane 6: Cell wall associated protein fraction isolated from S. cerevisiae Nl-C- D4 parent strain, Lane 7: Cell wall associated protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE5-A) strain, Lane 8: Cell wall associated protein fraction isolated from S. cerevisiae NI-C-D4(pMBRE5-B) strain; SEQ ID NO 1 is the amino acid sequence of the Cwp1 module;

SEQ ID NO 2 is the amino acid sequence of the Trichoderma reesei XYN2 secretion signal; SEQ ID NO 3 is the amino acid sequence of the scaffoldin protein;

SEQ ID NO 4 is the DNA sequence of the Cwp1 module;

SEQ ID NO 5 is the DNA sequence of the Trichoderma reesei XYN2 secretion signal; SEQ ID NO 6 is the DNA sequence of the scaffoldin protein; SEQ ID NO 7 is the DNA sequence of the PGK1 promoter;

SEQ ID NO 8 is the DNA sequence of the PGK1 terminator;

SEQ ID NO 9 is the DNA sequence of pMBRE2; and

SEQ ID NO 10 is the amino acid sequence of the Dockerin protein domain. SEQ ID NO 11 is the amino acid sequence of the random linker; and

SEQ ID NO 12 is the amino acid sequence of the poly-alanine linker.

DETAILED DESCRIPTION WITH REFERENCE TO THE DRAWINGS

To express part of the Clostridium cellulosome on the cell surface of S. cerevisiae, an expression vector encoding a chimeric scaffoldin protein was cloned in order to express the scaffoldin as a fusion protein with cell wall protein 1 (Cwp1 ), together with the T. reeseiXYN2 secretion signal.

Briefly, the scaf3p, (62,470 Da) (consisting of a carbohydrate binding module (CBM), a hydrophilic domain, Coh1 C. cellulolyticum cohesin domain, a Coh3 C. thermocellum cohesin domain and a His tag) was cloned in frame and downstream of the T. reesei XYN2 secretion signal and upstream or downstream of the S. cerevisiae cell wall anchoring protein (Cwp2) under the constitutive control of the S. cerevisiae PGKI regulatory sequences. The C. thermocellum dockerin domain was also cloned in frame with the T. reesei XYN2 secretion signal and GFPmut2 regulated by the PGK1 promoter and terminator. Two different linker sequences (Table 2) were also included between the GFP and dockerin domain to facilitate the correct folding in the fusion protein.

Materials and Methods

Microbial strains, media and culturing conditions All yeast and bacterial strains used in this study and their relevant genotypes are listed in Table 1. Escherichia coli cells were grown in Luria-Bertani (LB) broth (BioLab, Midrand, South Africa) at 37^°C (Sambrook et al. 1989). Ampicillin for selecting and proliferating transformants was added to a final concentration of 100 μg ml_^~1. S. cerevisiae cells were grown at 30^°C in either a synthetic medium, SC^"ura [containing 2% glucose, 0.67% yeast nitrogen base without amino acids (Difco, Detroit, Ml, USA), 0.13% amino acid stock solution (Ausubel et al. 1994) lacking uracil and supplemented with 50 mM HEPES buffer (pH 7.0) for strains containing the green fluorescent protein (GFP) or in a rich medium, YDP (containing 1% yeast extract, 2% peptone and 2% glucose). Solid media contained 2% agar (Difco) was also employed for transformant selection and maintenance.

Recombinant DNA manipulations

Standard procedures for the isolation and manipulation of DNA were used throughout this study (Sambrook et al. 1989). Restriction enzymes, T4 DNA Ligase and Expand Hi-Fidelity DNA polymerase (Roche, Mannheim, Germany) were used in the enzymatic manipulation of DNA, according to the specifications of the supplier. Primers synthesized to amplify the genes are listed in Table 2.

Plasmid vector construction

Scaf3p expression vector

A previously described Scaf3 chimeric construct (Fierobe et al. 2001) was cloned in frame with the T. reesei XYN2 secretion signal and the S. cerevisiae cell wall protein 2 (Cwp2), and placed under the constitutive control of the PGK1 promoter and terminator sequences. The Scaf3 sequence was based on the C. cellulolyticum cellulosome and contained an N-terminal carbohydrate binding module (CBM), a hydrophilic domain, as well as one C. cellulolyticum and one C. thermocellum cohesin domain, respectively. These cohesin domains are the binding sites for the dockerin domains of the cellulosomal catalytic subunits. The terminal C. thermocellum cohesin domain was fused to the yeast Cwp2p. Since the presence of the Cwp2 anchoring module at the C-terminal extremity of the fusion protein might hamper the folding of the adjacent cohesin(s) and/or interfere with the binding to the corresponding dockerin domain, another genetic construct was prepared in which the Cwp2p module preceded the N-terminus of scaf3.

Dockerin domain expression vector

In order to assess whether a dockerin domain capable of binding a cohesin domain was produced in S. cerevisiae, an expression vector was constructed containing the green fluorescent protein (GFPmut2) fused in frame with the T. reesei XYN2 secretion signal upstream of a C. thermocellum dockerin domain and placed under the constitutive control of the PGK1 regulatory sequences. Included in the latter design was the separation of the GFP and dockerin domains by two different linkers to ensure proper folding of the GFP and dockerin domains.

Plasmids constructed are shown in Figures 1 and 2. Primers used in this study to PCR amplify the coding regions of the different genes are listed in Table 2. Plasmid DNA was used as template to amplify the coding regions of the respective genes (refer to Table 2 for details). All the PCR-generated fragments were sub-cloned into the pGEM-T-Easy vector system (Promega, USA) prior to Table 1 Microbial strains and plasmids used

Strain or plasmid Genotype or construct Reference or source

Bacterial strains Escherichia coll DH5α F βndA1 hsdR17 (rk? mk+) supE44 thι-1 recA1 GIBCO-BRL/Life Technologies gyrA (NaIr ) relA 1 Δ{laclZYA-argF)U169 deoR [F80d/ac DE(/acZ)M15]

Yeast strains

Saccharomycβs cβrevisiae NI-C-D4 Matα trp1 ura3 pep4 Wang er a/ (2001 )

Transformants

NI-C-D4(pMBRE2) Matα tφ1 ura3 pβp4 PGK1P-XYNSEC-Scaf3-CWP2-PGK1T This study

NI-C-D4(pMBRE21) Matα trp1 ura3 pep4 PGK1P-XYNSEC-CWP2-Scaf3-PGK1T This study

NI-C-D4(pMBRE5-A) Matα trp1 ura3 pep4 PGK1 P-XYNSEC-GFP-AIaI 0Dock-PGK1 T This study

NI-C-D4(pMBRE5-B) Matα trp1 ura3 pep4 PGK1P-XYNSEC-GFP-LιnkerDock-PGK1T This study

Plasmids pETScaf3 CBD-a hydrophilic domaιn-Coh1-Coh3-Hιs tag Fierobθ θf a/ (2001) pETEt CBD-lg-Ce/E-Dock-His tag Fierobe βf a/ (2002) pGFPmut2 GFP mutant gene Cormack e/ a/ (1996) pHVXII bla LEU2 PGK1 _P-PGK1 _T Volschenk et al (1997) pDLG59 bla URA3 PGK1 _P-XYN2-CWP2-PGK1 _τ Le Grange ef al pMBREI bla URA3 PGK1 _P-XYNSEC-CWP2-PGK1 _τ This study pMBRE2 bla URA3 PGK1 _P-XYNSEC-Scaf3-CWP2-PGK1 _τ This study PMBRE3 bla LEU2 PGK1 _P-GFP -PGK1 _τ This study pMBRE4-A bla LEU2 PGK1 _P-GFP-A\a_KDock-PGK1 _τ This study pMBRE4-B bla LEU2 PGK1 _P-GFP-LmkerDock-PGK1 _τ This study PMBRE5-A bla URA3 PGK1 _P-XYNSEC-GFP-Ma_nDoCk-PGKI _τ This study pMBRE5-B bla URA3 PGK1 p-XYNSEC-GFP-UnkerDock-PGKI _τ This study PMBRE20 bla URA3 PGK1 _P-XYNSEC-CWP2-PGK1 _r This study pMBRE21 bla URA3 PGK1 _P-XYNSEC-CWP2-Scaf3-PGK1 _τ This study

Table 2 Primers used to PCR amplify the genes

Gene Template Primer name Sequence Enzyme

Xynsec'F 5'- GATCGAATTCAGGCCTCAACATGGTCTCCTTCACCTCCC -3' Eco Rl

XYNSEC pDLG59

Xynsec'R 5'- GATCAGATCTTCGCGAGCGCTTCTCCACAGCCACGGG -3' BgIW

Scaf3'F 5'- GATCAGATCTCGCAGGTACTGGCGTCGTATCAGTGC -3' BgIII

Scaf3 pETScaf3

Scaf3'R (His tag) 5'-GATCAGATCTGTGGTGGTGGTGGTGGTGCTCGAGGATCCTATC-3^■ BgIII

CWP2'F (BgIII) 5'- GATCAGATCTATTTCTCAAATCACTGACGG -3' BgIW

CWP2 pDLG59

CWP2'R (Linker-Xhol) 5'- GATCCTCGAGGAATTCGCCAGAACCAGCAGCGGAGCCAGCGGATCCTAACAACATAGCAGCAGCAGC -3' Xho I

Scaf3'F (Sail) δ'- GATCGTCGACGCAGGTACTGGCGTCGTATCAGTGC-S' Sail

Scaf3 pETScaf3 Scaf3'R (Sail) 5'- GATCGTCGACTCACTCGAGGATCCTATCTCCAACATTT-S' Sail GFP'F 5'- GATCAGATCTCAGTAAAGGAGAAGAACTTTTCACTGGAG-3¹ BgIII

GFP pGFPmut2 GFP'R 5'- TCGACTCGAGTTTGTATAGTTCATCCATGCC -3' Xho I

CtDockerin'F (Linker) 5'- CTCGAGGGATCCGCTGGCTCCGCTGCTGGTTCTGGCGAATTCGCCAAGACAAGCCCTAGCCCATCTA -3' Xho I

Dock pETEt CtDockerin'F (AIa₁₀) 5'- CTCGAGGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCCAAGACAAGCCCTAGCCCATCTA -3' Xho l CtDockerin'R 5'- TCGACTCGAGTTAGTTCTTGTACGGCAATGTATCTATT -3' Xho I

* The enzyme sites are indicated in bold, and the linker sequences are underlined.

automated sequencing (3130XL Genetic Analyzer, Applied Biosystems) to identify possible amplification artifacts. Also all final genetic constructs were again subjected to automated sequencing to confirm in frame fusions.

Genetic construction of the scaf3 expression vectors

The multicopy episomal S. cerevisiae-E. coli shuttle vector pDLG59 (La Grange 1999), containing the promoter (PGK1_P) and terminator (PGK1_T) sequences of the yeast phosphoglycerate kinase I gene (PGK1), as well as the cell wall binding module of the cell wall protein 2 (CWP2) was used. The 121-bp XYNSEC (Trichoderma reesei XYN2 secretion signal) was PCR-generated fragment containing its native start codon, and digested using the built-in EcoRI and SgI 11 sites before it was cloned in frame into pDLG59, thus generating pMBREI (plasmid map not shown). The 1758-bp Scaf3 PCR-generated fragment (native ATG and stop codon excluded) was digested using the built-in βglll site and cloned into pMBREI, thereby generating pMBRE2 containing the PGK1p-XYNSEC-Scaf3-CWP2-PGK1_T expression cassette (Figure 1A). To construct the alterative expression vector with the CWP2 in front of the scaf3 protein, the 208-bp CWP2 PCR-generated fragment (with native stop codon excluded) was digested using the built-in βglll and Xho\ sites and cloned into pMBREI , resulting in pMBRE20 (plasmid map not shown). To complete this construct, a 1758-bp Scaf3 PCR-generated fragment (with native ATG excluded but stop codon retained) was digested with Sal\ and cloned into XΛol-digested pMBRE20, thereby creating pMBRE21 containing the PGK1P-XYNSEC-CWP2- Scaf3-PGK1 T expression cassette (Figure 1B). Genetic construction of the GFP-dockerincf expression vectors (Figure 2)

The 717-bp PCR-generated GFPmut2 fragment (with native start and stop codons excluded) was digested using the built-in SgIII and Xho\ sites and sub- cloned into pHVXII (Volschenk et al. 1997), creating pMBRE3 (plasmid map not shown). The 267-bp PCR-generated dockerincf (C. thermocellum dockerin) fragment (with its native stop codon) containing the two different linker sequences was digested with Xho\, and cloned into the pMBRE3 vector, thereby generating pMBRE4-A (containing the Ala-io-Linker) and pMBRE4-B (containing the random linker sequence), respectively (plasmid maps not shown). The two 1310-bp Bgl\\-Kpn\ fragments containing the GFPmut2-Ala₁₀-dock-PGK1τ and GFPmut2-Linker-dock-PGK1 T cassettes, respectively, were then isolated from pMBRE4-A and pMBRE4-B, and cloned into pMBREI, containing XYNSEC, resulting in pMBRE5-A (Figure 2A) containing the PGK1p-XYNSEC-GFPmut2- Alaw-Dock-PGKI _τ expression cassette and pMBRE5-B containing the PGKIp- XYNSEC-GFPmut2-Linker-Dock-PGK1 _τ expression cassette (Figure 2B).

Bacterial and yeast transformations

All bacterial transformations and the isolation of DNA were carried out according to standard protocols (Sambrook et al. 1989). All yeast transformations were performed according to the standard lithium acetate procedure (Ausubel et al. 1994). Yeast transformants were plated on SC^"ura plates and incubated for 3 days at 30^°C.

lmmunofluorescent detection of ceil surface displayed scaf3p

The parent NI-C-D4 yeast strain and transformants, NI-C-D4(pMBRE2) and Nl- CD4(pMBRE21), were grown overnight at 30°C in sc^complete and Sσ^ura media, respectively. After culturing, 2 ml cells were centrifuged at 6000 rpm for 3 minutes and washed with 1 mi l x phosphate buffered saline solution (PBS) pH 7.0. The cells were resuspended in 200 μl 1 x PBS containing 1% bovine serum albumin (BSA) and 1 :500 primary antibody raised against the CBM-module of the scaf3p (rabbit anti-CBM) and incubated for 1 hour at room temperature whilst slowly shaking (antibody supplied by H-P Fierobe). The cells were washed with 1 x PBS and resuspended in 200 μl 1 x PBS containing 1% BSA and goat anti-rabbit IgG-AlexaFlour 488 (1:250, 2 mg/ml, Invitrogen) and incubated for 1 hour at room temperature whilst slowly shaking. The cells were washed three times with 1 x PBS and resuspended in 200 μl 1 x PBS and viewed using a fluorescent microscope at 1000 x magnification (Nikon Eclipse E400, Nikon).

Isolation of extracellular protein fractions

Yeast cells were grown overnight in 100 ml SC^"ura media and 15 ml were centrifuged for 5 minutes at 5000 rpm. The supernatant was transferred to an Amicon Ultra-15 centrifugal filter device (Millipore, USA) and centrifuged in a swinging bucket rotor at 4^°C at 4000 x g for 45 minutes. The 200 μl concentrated supernatant was transferred to a 1.5 ml eppendorf tube and stored at -20^°C. For SDS-PAGE analysis, 15 μl of each sample containing the concentrated extracellular protein fraction was loaded onto SDS-PAGE gels.

For larger scale extracellular protein fraction isolation, the yeast strains were grown in 2 L SC^'ura medium overnight at 30^°C. The cultures were centrifuged and the supernatant applied to a Minitan apparatus, which concentrated the supernatant to 200 ml. The 200 ml supernatant was additionally concentrated to 10 ml using an Amicon Ultrafiltration Unit with a 10 kDa membrane. The concentrated supernatant was stored at -20^°C. For SDS-PAGE analysis, 15 μl of each sample containing the large-scale concentrated extra cellular protein fraction was loaded onto SDS-PAGE gels.

Isolation of intracellular proteins fractions

For the isolation of the intracellular protein fraction from the yeast cells, the YeastBuster protein extraction reagent (MERCK, Germany) was used according to the manufacturer's specifications. The isolated proteins were stored at -20^°C. Similarly, 15 μl of each sample containing the intracellular protein fraction was loaded onto SDS-PAGE gels.

Isolation of cell membrane-bound and cell wall-associated protein fractions

Proteins were isolated based on the procedures of Beki et al. (2003) and Del Carratore et al. (2000). A 10 ml SC^"ura yeast preculture was grown overnight at 30^°C and inoculated into 100 ml SC^'ura medium and grown overnight at 30^°C. After culturing, 60 ml cells were centrifuged at 5000 rpm for 5 minutes at 4^°C (± 1 g yeast cells). The cells were resuspended in 10 ml HCS Buffer (50 mM HEPES, 10 mM CaCI₂ pH 7, 2 M Sorbitol) and 1 mg Zymolyase T20 per gram cells were added and incubated for 1 hour at 37^°C. The cells were centrifuged at 5000 rpm for 5 minutes and the supernatant decanted. The cells were washed twice with 10 ml HCS Buffer at 5000 rpm for 5 minutes and the spheroplasts resuspended in 10 ml HCS Buffer. The spheroplasts were sonicated (Omni- Ruptor 400, Omni International Inc.) on ice 3 times for 90 seconds at a 50% power setting followed by centrifugation at 13 000 rpm for 30 minutes. The supernatant which contained the cell-membrane bound protein fractions was transferred to a sterile McCartney Bottle and kept at -2O⁰C. The pellets obtained, containing the cell wall-associated protein fraction, were resuspended in 2 ml HCS Buffer and kept at - 20^°C. As with the intracellular and extracellular protein fraction, 15 μl of each sample containing either the cell-membrane bound or cell wall-associated protein fraction was loaded onto SDS-PAGE gel.

Far Western blot detection of scaf3p expressed in S. cerevisiae

For the detection of the heterologously expressed scaf3p, the Cel5A-Dockcf protein (purified enzyme supplied H-P Fierobe) was used as a probe. This protein is a C. cellulolyticum endoglucanase appended with a C. thermocellum dockerin (Fierobe et al. 2001 ). The CelδADockcf by protein was biotinylated on the lysine groups with a biotinyl Λ/-hydroxysuccinimide ester as described by the manufacturer (Biotin protein labeling kit, Roche). All four protein fractions (extracellular, intracellular, cell membrane-bound and cell wall-associated) isolated from NI-C-D4, NI-C-D4(pMBRE2) and NI-C-D4(pMBRE21) were separated by 12% (v/v) SDS-PAGE according to the method of Laemmli (1970) and transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). Nonspecific binding was blocked by incubating (1 hour at room temperature) the membrane with 3% blocking solution (non-fat dry milk powder in TBS buffer containing 50 mM Tris and 150 mM NaCI, pH 7.5). The membranes were then incubated with 15 mM calcium chloride for 1 hour at room temperature to ensure the cohesin-dockerin interaction, which is calcium dependant. The membranes were then incubated (1 hour at room temperature) with blocking solution containing the biotin-labelled Cel5A-Dockcf used as "primary antibody". Unbound proteins were washed off with 1 x washing buffer (from the LumiGLO Reserve chemiluminescent substrate kit) three times for 5 minutes and a fourth time for 10 minutes. The membranes were then incubated with the secondary antibody, a streptavid in-horse radish ^-peroxidase (POD) conjugate (Roche Diagnostics, Germany) diluted in 3% blocking solution according to the supplier. The membranes were washed as above and the labeled proteins were detected using the LumiGLO Reserve chemiluminescent substrate kit (KPL, USA).

Far Western blot detection of the dockerin domain expressed in S. cerevisiae

For the detection of the heterologously expressed dockerin domain, the scaf3 protein (purified protein supplied by H-P Fierobe) was used as a probe and was biotinylated as described above. All four protein fractions isolated from NI-C-D4, NI-C-D4(pMBRE5-A) and NI-CD4(pMBRE5-B) were separated by 12% (v/v) SDS-PAGE according to the method of Laemmli (1970) and transferred onto a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). Nonspecific binding was blocked by incubating (1 hour at room temperature) the membrane with 3% blocking solution (same composition as described above). The membranes were subsequently incubated with 15 mM calcium chloride for 1 hour at room temperature followed by incubation (1 hour at room temperature) with blocking solution containing the primary antibody, biotin-labelled scaf3p. Further washing steps and detection was done as described above.

Cellulose binding capacity of S. cerevisiae expressing the cell wall- targeted scaf3 protein

Cellulose binding capacity, as mediated by the scaf3p CBM, was used to visually detect the cell wall-targeted expression of the scaf3 protein in S. cerevisiae. Cells of NI-C-D4 and NI-C-D4(pMBRE2) from a overnight pre- cultures were inoculated at the same cell density (OD₆oo = 0.05) and cultured for 72 hrs at 30⁰C in 100 ml selective media (as described above) containing Whatman^® 3MM Chr filter paper (cut to size to 2 cm x 2 cm) (Whatman International Ltd., UK). After culturing, the Whatman filter paper was carefully removed so as not to disturb the straight cut edges and rinsed 3 x with 50 mM HEPES buffer (pH 7.0) before microscopic examination (Nikon Eclipse E800, 1000 x magnification). A total of 10 fields for both NI-C-D4 and Nl-C- D4(pMBRE2) were examined to rule out cellulose binding artefacts.

Yeast cell surface associated endoglucanase enzyme activity assay

NI-C-D4 and NI-C-D4(pMBRE2) cells were grown for 72 hrs at 3O⁰C in 25ml 2 x gQ^∞mpiete and 2 x SC^"ura medium, respectively, buffered with succinic acid (20g/L) and pH 6.0 (adjusted with sodium hydroxide). Cells (25 ml) were centrifuged at 3000 rpm for 3 minutes and washed with 1 ml 5OmM Tris-Maleate buffer (pH 6.0) containing 5mM Calcium Chloride (CaCI₂). Washed cell cultures were divided in half and to one half of the cells 1 ml of NI-CD4 supernatant (negative control) was added and to the other half 1 ml of 1:100 diluted CelδA- Docket protein (5.3 mg protein/ml). Cells were incubated for 1 hour at room temperature, thereafter they were washed 3 times with an excess volume of 5OmM Tris-Maleate buffer pH 6.0 containing 5 mM CaCl₂. The cells were resuspended in 1 ml Tris-Maleate buffer (50 mM, pH 6.0) containing 5 mM CaCb as well as 1% (w/v) low viscosity carboxymethylcellulose sodium salt (Sigma, Germany) as substrate and incubated for 3.5 hours at 37°C while shaking. As a positive control 1 ml Cel5A-Dockcf protein (final dilution of 1 :100) in Tris-Maleate buffer (50 mM, pH 6.0) containing 5 mM CaCI₂ was also directly incubated for 3.5 hours at 37⁰C while shaking in the presence of 1% (w/v) low viscosity carboxymethylcellulose sodium salt. Endoglucanase activity was quantified as described by Bailey et al. (1992) and the reduced sugar was determined by dinitrosalicylic acid (DNS) according to the standard method (Miller et al. 1960). All assays were repeated in triplicate and significance was statistically verified using the non-parametric Mann-Whitney U test (Jones 1973). Results

Scaf3 is expressed and targeted to the yeast cell surface

To visualize the scaffoldin protein on the cell surface of S. cerevisiae, an immunofluorescent detection method targeted at the scaf3 CBM was employed. NI-C-D4, NI-C-D4(pMBRE2) and NI-C-D4(pMBRE21) yeast cells were treated with rabbit anti-CBM and goat anti-rabbit IgG-Alexa Fluor 488 and subjected to fluorescent microscopy (Figure 3). A clear granular green fluorescence was visible on the yeast cell surface for the cells containing pMBRE2 {PGK1_P- XYNSEC-Scaf3-CWP2-PGK1_T) (Figure 3a) and not in the cells containing PMBRE21 (PGK1_P-XYNSEC-CWP2-Scaf3-PGK1_T) or in the parent strain (Figure 3a and 3b, respectively).

Scaf3 that is expressed and targeted to the yeast cell surface is capable of binding to Cel5A-dockerincf

Additional evidence of the correct functioning and targeting of the scaf3 protein to the yeast cell surface was obtained through the detection of cohesin-dockerin interaction. To confirm whether the C. thermocellum cohesin domain of the yeast cell-surface displayed scaf3 protein is functional, four different protein fractions (intracellular, extracellular, cell membrane-associated and cell wall debris-associated) were isolated from yeast cells containing pMBRE2(PGK7_P- XYNSEC-Scaf3-CWP2-PGK1_T) and pMBRE21 (PGK1 _P-XYNSEC-CWP2-Scaf3- PGK1τ) and subjected to SDS-PAGE gel electrophoresis and Far Western blot analysis (Figure 4). Binding of purified biotinylated CelδA-dockerincf to the C. thermocellum cohesin domain was detected in the cell membrane (Figure 4: lane 5) and cell wall debris protein fractions (Figure 4: lane 7) of the yeast containing pMBRE2. No chemiluminescent signal could be detected for the intracellular and extracellular protein fractions, even for the large scale extracellular protein fraction isolation (results not shown). Purified scaf3 protein was used as positive control (Figure 4: lane 2). No cohesin-dockerin interaction could be detected in the cell membrane and cell wall debris protein fractions for the parent strain NI-C-D4 (Figure 4: lanes 3 and 6, respectively) and the Nl-C- D4(pMBRE21) strain (Figure 4: lanes 4 and 8, respectively).

The Far Western blot results confirmed both the functional expression and targeting of scaf3 to the cell wall of S. cerevisiae, and that the yeast produced cohesin domain (as part of the scaf3 protein) is able to bind to a purified dockerin domain (as part of the CelδA-dockerinrt protein). This data confirmed the importance of the orientation of the Cwp2 module relative to scaf3p in the fusion protein and the influence of this orientation on scaf3 functionality. The positioning of the Cwp2 module upstream or downstream of the scaf3p had a significant influence on the correct display of the scaf3p, not initially obvious upon design of the scaf3 expression vector, since the antibody was able to bind to the CBM of the scaf3p in the cells containing pMBRE2 (C-terminal Cwp2 fusion), but could not bind to the scaf3 CBM when the Cwp2 module was located at the N-terminus of the fusion protein.

Actual sizes of the recombinant scaf3 protein could not be accurately deduced from the blot, due to a difference in the protein mobilities of cell membrane and cell wall debris extracts compared to the scaf3 purified protein.

The functional expression and targeting of the scaf3p to the yeast cell surface was further assessed by determining the acquired endoglucanase enzyme activity in the yeast NI-C-D4 and NI-C-D4(pMBRE2) (PGK1_P-XYNSEC-Scaf3- CWP2-PGK1_T) incubated in the presence of purified Cel5A-Dockcf fusion protein and carboxymethylcellulose (Figure 5). Endoglucanase activity (hydrolytic activity towards cellulose) of the Cel5A-Dockrt fusion protein on carboxymethylcellulose in the absence of any yeast cells was taken as the 100% level (Figure 5). Cells of NI-C-D4(pMBRE2) showed a 2 fold increase in endoglucanase activity (28% of maximum activity) over the parent strain Nl-C- D4 (14% of maximum activity). The difference in endoglucanase activity between cells of NI-CD4(pMBRE2) and NI-C-D4 was calculated as significant (P < 0.05, two-tailed test) using the Mann-Whitney U statistical test. These results indicated that significantly more endoglucanase protein was tethered to the yeast cell surface through scaf3-cohesin:Cel5A-dockerin interaction as compared to non-specific cell wall binding of endoglucanase protein in the parent yeast strain lacking the scaf3 protein.

Scaf3 expressed and targeted to the yeast cell surface is capable of binding to cellulose

The correct targeting and functioning of the scaf3 protein on the cell surface of S. cerevisiae was assessed for the capacity of S. cerevisiae cells expressing the cell wall-targeted scaf3 protein to bind to cellulose as mediated by the C. cellulolyticum CBM. The rationale of this qualitative approach was based on the fact that the native Clostridium scaffoldin promotes the binding of the cellulosomes to cellulose via the CBM, thus functional display of the scaf3p on the yeast cell surface should enable yeast cells to attach to cellulose. Upon microscopic inspection of cells of S. cerevisiae strain NI-C-D4 and strain Nl-C- D4(pMBRE2) cultured in the presence of Whatman^® 3MM Chr filter paper, yeast cell attachment to Whatman paper could clearly be detected in all 10 microscopic fields studied for the recombinant strain NI-C-D4(pMBRE2) (Figure 6B), but not for the parent strain NI-C-D4 (Figure 6A). GFP-dockerincf expressed in S. cerevisiae is capable of binding to a C. thermocellum cohesin domain in Scaf3

In order to determine whether a yeast-produced dockerin domain (as part of a GFP-dockerinctf fusion) is able to bind the cohesin domain of a scaf3 protein, the green fluorescent protein (GFPmut2) was fused in frame with the C. thermocellum dockerin domain and separated by two different linkers to ensure proper folding. When yeast transformants containing pMBRE5-A (PGKIp- XYNSEC-GFP-Ala₁₀D∞k-PGK1_τ) and pMBRE5-B (PGK1 p-XYNSECGFP- Linker D_ock-PGKI Y) were viewed under a fluorescent microscope, green fluorescence was visible throughout the whole cell and also highly fluorescent green granules were present in the cells (results not shown). This data indicates that expression of the dockerin fusion in S. cerevisiae allowed the correct folding of the passenger protein, in this case the PFG protein.

Subsequently, all four protein fractions (intracellular, extracellular, cell membrane-associated and cell wall debris-associated) isolated from NI-C-D4, NI-C-D4(pMBRE5-A) and NI-CD4(pMBRE5-B) were subjected to SDS-PAGE gel electrophoresis and Far Western blot analysis using biotinylated scaf3p as a probe in order to determine whether the dockerincf domain was functional (Figure 7). The GFPmut2-Dockcf fusion proteins (expected size of 38 kDa, i.e. 31 kDa for GFPmut2 and 7 kDa for Dockcf) were detected in the cell membrane bound fraction (Figure 7: lane 4 and 5), as well as in the cell wall associated protein fraction (Figure 7: lane 7 and 8). As shown in Figure 7, the fusion protein containing the random linker (Figure 7: lane 5 and 8) seemed to be more abundant than the GFPmut2-Dockcf protein in which the C-terminal dockerin domain is connected to the GFP with a poly-alanine linker (Figure 7: lane 4 and 7). Furthermore, two protein bands (38 kDa and ca. 39 kDa) for the GFPmut2- Dockcf fusion protein were always detected, indicating the potential occurrence of glycosylation by the yeast. The cell membrane bound and cell wall associated protein fractions of the parent strain (Figure 7: lane 3 and 6) did not show any interaction with the scaf3p, while the purified Cel5A-Dockrt fusion protein (51.6 kDa) showed a clear interaction with scaf3 (Figure 7: lane 2). Thus the GFPmut2-Dockcf fusion protein was correctly translated and functional in S. cerevisiae, as indicated by its interaction with the cohesin domain of the biotinylated scaf3 protein. The cohesin and dockerin domains are proposed to serve as binding moieties for the assembly of the multi-unit cellulosome enzyme complex. Data presented herein demonstrates that both domains retain their complementary binding properties when expressed in the yeast, S. cerevisiae.

Conclusions

The scaffoldin protein from the cellulosome of Clostridium species which is responsible for the degradation of crystalline cellulose, is herein proposed as a candidate carrier protein for cell surface displaying proteins in yeast. The protein is relatively large, containing a scaffoldin subunit (160-189 kDa), a non-catalytic modular polypeptide containing an internal carbohydrate binding module (CBM) and multiple copies (8 and 9 in the case of C. cellulolyticum and C. thermocellum, respectively) of cohesin domains inherently flexibly linked to one another. The relatively large size of the scaffoldin protein is proposed to increase the distance of the displayed protein from the cell wall, thereby decreasing steric effects of the yeast cell wall on the functionality of the displayed protein. Furthermore, the nature of the inherent flexible linking of the cohesin domains to one another is proposed to confer advantageous conformational flexibility in the display of desired proteins.

The invention is further proposed to decrease yeast cell wall perturbation. The use of published cell surface systems often result in cell envelope or cell wall perturbations, leading to the activation of extracytoplasmic and cell wall stress pathways (Narayanan and Chou 2008, De Nobel et al. 2000) which may adversely affect the performance of the displayed protein. The Clostridium scaffoldin protein, however, characteristically possesses numerous cohesin domains which, when two are more are used, are herein proposed to alleviate cell wall perturbation by directly increasing the ratio of anchor protein to displayed protein, thereby permitting lower expression levels of the anchor protein and consequently decreasing cell wall perturbation effects.

The use of a partly reconstituted chimeric Clostridium cellulosome in S. cerevisiae for cell surface display of proteins offers further conformational flexibility to the system by way of the dual binding property of the C. thermocellum and the C. cellulolyticum cohesin domains, allowing binding of a dockerin-containing protein to its cognate cohesin in two different orientations. The little or no specificity in the binding among the various cohesins and the dockerins within a given species also lends a degree of flexibility to the design of the system.

A further advantage of the invention relates to the use of a bacterial scaffoldin protein in a yeast cell surface display system. This facilitates the expression and flexible display in S. cerevisiae of proteins of eukaryotic origin that require complex post-translation modification and that are therefore not easily produced in their native form in recombinant bacterial systems.

The use of scaffoldin proteins for presenting proteins on a yeast cell surface is herein proposed to serve as a highly flexible platform for numerous applications including high throughput screening of peptide and enzyme libraries, whole cell sorbents, recombinant biocatalysts, and cell-based diagnostics, including high throughput drug discovery/screening, directed protein evolution and protein engineering applications.

References

Ausubel FMR, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1994) Current Protocols in Molecular Biology. Wiley, New York

Bailey MJ, Biely P, Poutanen K (1992) lnterlaboratory testing of methods for assay of xylanase activity. J Biotechnol 23:257-270

Baumann NA, Vidugiriene J, Machamer CE, Menon AK (2000) Cell Surface Display and Intracellular Trafficking of Free Glycosylphosphatidylinositols in Mammalian Cells. J Biol Chem 275:7378-7389

Bayer EA, Shimon LJW, Shoham Y, Lamedi R (1998) Cellulosomes - Structure and ultrastructure. J Struct Biol 124:221-234

Beki E, Nagy I, Vanderleyden J, Jager S, Kiss L, Fϋlδp L, Hornok L, Kukolaya J (2003) Cloning and heterologous expression of a β-D-Mannosidase (EC 3.2.1.25)-encoding gene from Thermobifida fusca TM51. Appl Environ Microbiol 69:1944-1952

Breinig F, Diehl B, Rau S, Zimmer C, Schwab H, Schmitt MJ (2006) Cell surface expression of bacterial esterase A by Saccharomyces cerevisiae and its enhancement by constitutive activation of the cellular unfolded protein response. Appl Environ Microbiol 72:7140-7147

Charbit A, Boulain JC, Ryter A, Hofnung M (1986) Probing the topology of a bacterial membrane protein by genetic insertion of a foreign epitope; expression at the cell surface. EMBO J 5:3029-3037

Chen W, Georgiou W (2002) Cell surface display of heterologous proteins: From highthroughput screening to environmental applications. Biotechnol Bioeng 79:496-503

Chriswell DJ, McCafferty J (1992) Phage antibodies: will new 'coliclonal' antibodies replace monoclonal antibodies? Trends Biotechnol 10:80-84

Cormack BP, Valdivia RH, Falkow S (1996) FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33-38

Del Carratore MR, Mezzatesta C, Hidestrand M, Neve P, Amato G, Gervasi PG (2000) Cloning and expression of rat CYP2E1 in Saccharomyces cerevisiae: Detection of genotoxicity of N-alkylformamides. Environ MoI Mutagenesis 36:97- 104

De Nobel H, Ruiz C, Martin H, Morris W, Brul S, Molina M, KNs FM (2000) Cell wall perturbation in yeast results in dual phosphorylation of the Slt2/Mpk1 MAP kinase and in an Slt2-mediated increase in FKS2-lacZ expression, glucanase resistance and thermotolerance. Microbiol 146:2121-2132

Durauer A, Berger E, Zandian M, Mersich C, Schuster M, Loibner H, Jungbauer A (2008) Yeast cell surface display system for determination of humoral response to active immunization with a monoclonal antibody against EpCAM. J Biochem Biophys Methods 70:1109-1115 Earhart CF (2000) Use of an Lpp-OmpA fusion vehicle for bacterial surface display. Methods Enzymol 326:506-516

Fierobe HP, Bayer EA, Tardif C, Czjzek M, Mechaly A, Belaϊch A, Lamed R, Shoham Y, Belaϊch JP (2002) Degradation of cellulose substrates by cellulosome chimeras. J Biol Chem 277:49621-49630

Fierobe HP, Mechaly A, Tardif C, Belaϊch A, Lamed R, Shoham Y, Belaϊch JP, Bayer EA (2001) Design and production of active cellulosome chimeras. J Biol Chem 276: 21257- 21261

Fierobe HP, Mingardon F, Mechaly A, Belaϊch A, Rincon MT, Pages S, Lamed R, Tardif C, Belaϊch JP, Bayer EA (2005) Action of designer cellulosomes on homogeneous versus complex substrates: controlled incorporation of three distinct enzymes into a defined trifunctional scaffoldin. J Biol Chem 280:16325- 34

Furukawa H, Tanino T, Fukuda H, Kondo A (2006) Development of a novel yeast cell surface display system for homo-oligomeric protein by coexpression of native and anchored subunits. Biotechnol Prog 22:994-997

Gai SA, Wittrup KD 2007 Yeast surface display for protein engineering and characterization. Curr Opin Struc Biol 17:467-473

Georgiou G, Stathopoulos C, Daugherty PS, Nayak AR, Iverson BL, Curtiss R (1997) Display of heterologous proteins on the surface of microorganisms: from the screening of combinatorial libraries to live recombinant vaccines. Nat Biotechnol 15:29-34 Gunneriusson E, Samuelson M, Uhlen M, Nygren P-A, Stahl S (1996) Surface display of a functional single-chain Fv antibody on Staphylococci. J Bacteriol 178:1341-1346

Hammel M, Fierobe HP, Czjzek M, Kurkal V, Smith JC, Bayer EA, Finet S, Receveur-Brechot V (2005) Structural basis of cellulosome efficiency explored by small angle X-ray scattering. J Biol Chem 280:38562-8

Hardwick KG, Boothroyd JC, Rudner AD, Pelham RB (1992) Genes that allow yeast cells to grow in the absence of the HDEL receptor. EMBO J 11 :4187-4195 Ho M, Nagata S, Pastan I (2006) Isolation of anti-CD22 Fv with high affinity by Fv display on human cells. Proc Natl Acad Sci USA 103:9637-9642

Jones JG (1973) Use of nonparametric tests for the analysis of data obtained from preliminary surveys: a review. J Appl Bact 36:197-210

Kondo A, Ueda M (2004) Yeast cell-surface display - applications of molecular display. Appl Microbiol Biotechnol 64:28-40

La Grange DC (1999) Genetic engineering of the yeast Saccharomyces cerevisiae to degrade xylan. PhD Thesis, University of Stellenbosch, Stellenbosch

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophages T4. Nature 227:680-685

Lang H, Maki M, Rantakari A, Korhonen TK (2000) Characterization of adhesive epitopes with the OmpS display system. Eur J Biochem 267:163-170 Lee HW, Lee SH, Park KJ, Kim JS, Kwon MH, Kim YS (2006) Construction and characterization of a pseudo-immune human antibody library using yeast surface display. Biochem Biophys Res Comm 346:896-903

Lee SY, Choi JH, Xu Z (2003) Microbial cell-surface display. Trends Biotechnol 21 :45-52

Makela AR, Matilainen H, White DJ, Ruoslahti E, Oker-Blom C (2006) Enhanced baculovirus-mediated transduction of human cancer cells by tumor- homing peptides. J Virol 80:6603-6611

Marguet D, Guo XJ, Lauquin GJM (1988) Intragenic repeat structure and identification of a family of SRP1 -related DNA sequences. J MoI Biol 202:455- 470

Matsumoto T, Fukuda H, Ueda M, Tanaka M, Kondo A (2002) Construction of yeast strains with high cell surface lipase activity by using novel display systems based on the FIoIp flocculation functional domain. Appl Environ Microbiol 68:4517-5422

Miller GL, Blum R, Glennon WE, Burton AL (1960) Measurement of carboxymethylcellulase activity. Anal Biochem 2:127-132

Mingardon F, Perret S, Belaich A, Tardif C, Belaich JP, Fierobe HP (2005) Heterologous production, assembly, and secretion of a minicellulosome by Clostridium acetobutylicum ATCC 824. Appl Environ Microbiol 71 :1215-22 Narayanan N, Chou CP (2008) Periplasmic chaperone FkpA reduces extracytoplasmic stress response and improves cell-surface display on Escherichia coli. Enzyme Microb Tech 42:506-513

Oliver SG (1992) The complete DNA sequence of the yeast chromosome III. Nature 357:38-46

Parthasarathy R, SubramBoder ET, Discher DE (2006) Post-translational regulation of expression and conformation of an immunoglobulin domain in yeast surface display. Biotechnol Bioeng 93:159-168

Pinheiro BA, Proctor MR, Marti nez-Fleites C, Prates JA, Money VA, Davies GJ, Bayer EA, Fontes CM, Fierobe HP, Gilbert HJ (2008) The Clostridium cellulolyticum dockerin displays a dual binding mode for its cohesin partner. J Biol Chem 283: 18422-18430

Saleem M, Brim H, Hussain S, Arshad M, Leigh MB, Zia-ul-hassan (2008) Perspectives on microbial cell surface display in bioremediation. Biotechnol Adv 26:151-161

Sambrook J, Fritsch EF, Maniatis T (eds) (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York

Samuelson P, Hansson M, Ahborg N, Andreoni C, Gotz F, Bachi T, Nguyen TN, Binz H, Uhlen M, Stahl S (1995) Cell surface display of recombinant proteins on Staphylococcus carnosus. J Bacterid 177:1470-1476 Schreuder MP, Mooren ATA, Toschka HY, Verrips CT, Klis FM (1996) Immobilizing proteins on the yeast cells. Trends Biotechnol 14:115-120

Smith GP (1985) Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science 228: 1315-1317

Tanino T, Noguchi E, Kimura S, Sahara H, Hata Y, Fukuda H, Kondo A (2007) Effect of cultivation conditions on cell-surface display of FIoI fusion protein using sake yeast. Biochem Eng J 33:232-237

Theunissen AWRH, Holub E, Van der Hucht J, Ven den Berg JA, Steensma HY (1993) Sequence of the open reading frame of the FLO1 gene from Saccharomyces cerevisiae. Yeast 9:423-427

Ueda M, Tanaka A (2000) Genetic immobilization of proteins on the yeast cell surface. Biotechnol Adv 18:121-140

Van der Vaart JM, Biesebeke R, Chapman JW, Toschka HY, Klis FM, Verrips T (1997) Comparison of cell wall proteins of Saccharomyces cerevisiae as anchors for cell surface expression of heterologous proteins. Appl Environ Microbiol 63:615-620

Van der Vaart JM, Caro LHP, Chapman JW, Klis FM, Verrips CT (1995) Identification of three mannoproteins in the cell wall of Saccharomyces cerevisiae. J Bacteriol 177:2104-3110

Volschenk H, Viljoen M, Grobler J, Petzold B, Bauer FF, Subden R, Young RA, Lonvaud A, Denayrolles M, Van Vuuren HJJ (1997) Engineering pathways for malate degradation in Saccharomyces cerevisiae. Nat Biotechnol 15:253-257 Wang BD, Chen DC, Kuo TT (2001 ) Characterization of a Saccharomyces cerevisiae mutant with oversecretion phenotype. Appl Microbiol Biotechnol 55:712-720

Wang Q, Li L, Chen M, Qi Q, Wang PG (2007) Construction of a novel system for cell surface display of heterologous proteins on Pichia pastoris. Biotechnol Lett 29:1561- 1566

Westerlund-Wikstrom B (2000) Peptide display on bacterial flagellar principles and applications, lnt J Med Microbiol 290:223-230

Wu CH, Mulchandani A, Chen W (2008) Versatile microbial surface-display for environmental remediation and biofuels production. Trends Microbiol 16:181- 188

Yue L, Chi Z, Wang L, Liu J, Madzak C, Li J, Wang X (2008) Construction of a new plasmid for surface display on cells of Yarrowia lipolytica. J Microbiol Meth 72:116-123

Claims

1. A yeast cell surface display system comprising a) at least one scaffoldin protein having at least one functional cohesin domain, and b) at least one anchoring protein, wherein the anchoring protein is capable of tethering the scaffoldin protein to a surface of a yeast cell.

2. The yeast cell surface display system according to claim 1 , wherein the N-terminus of the anchoring protein is fused to the C-terminus of the scaffoldin protein.

3. The yeast cell surface display system according to either claim 1 or claim 2, wherein the anchoring protein is cell wall protein 1 (Cwp1) or a protein having at least 80% homology to SEQ ID NO 1.

4. The yeast cell surface display system according to any one of the preceding claims, further including a secretion signal.

5. The yeast cell surface display system according to claim 4, wherein the secretion signal is fused to the N-terminus of the scaffoldin protein.

6. The yeast cell surface display system according to either claim 4 or claim 5, wherein the secretion signal is Trichoderma reesei XYN2 or a secretion signal having at least 80% homology to SEQ ID NO 2.

7. The yeast cell surface display system according to any one of the preceding claims, wherein the scaffoldin is a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain.

8. The yeast cell surface display system according to any one of claims 1 to 7, wherein the scaffoldin protein is from Clostridium.

9. The yeast cell surface display system according to any one of claims 1 to 7, wherein the scaffoldin protein is SEQ ID NO 3 or a protein having at least 80% homology to SEQ ID NO 3.

10. The yeast cell surface display system according to any one of the preceding claims, wherein the yeast is S. cerevisiae.

11. A vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the scaffoldin protein on the yeast cell surface.

12. The vector according to claim 11, wherein the expression elements include nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to SEQ ID NO 4.

13. The vector according to claim 12, wherein the nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to

SEQ ID NO 4, is in frame with, and 3' to, the nucleic acid encoding the scaffoldin protein.

14. The vector according to any one of claims 11 to 13, further including nucleic acid encoding a secretion signal.

15. The vector according to claim 14, wherein the secretion signal is Trichoderma reesei XYN2 or nucleic acid having at least 80% homology to SEQ ID NO 5.

16. The vector according to claim 15, wherein the expression elements include nucleic acid encoding the Trichoderma reesei XYN2 secretion signal or nucleic acid having at least 80% homology to SEQ ID NO 5 is in frame with, and 5' to, the nucleic acid encoding the scaffoldin protein.

17. The vector according to any one of claims 11 to 16, wherein the scaffoldin protein is a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain.

18. The vector according to any one of claims 11 to 16, wherein the scaffoldin protein is from Clostridium.

19. The vector according to any one of claims 11 to 16, wherein the nucleic acid encoding the scaffoldin protein is SEQ ID NO 6 or nucleic acid having at least 80% homology to SEQ ID NO 6.

20. The vector according to any one of claims 11 to 19, wherein the expression elements include at least one element selected from the group including the phosphoglycerate kinase I gene promoter (PGK1_P), nucleic acid at least 80% homologous to SEQ ID NO 7, the phosphoglycerate kinase I gene terminator (PGK1τ), and nucleic acid at least 80% homologous to SEQ ID NO 8.

21. The vector according to any one of claims 11 to 20, wherein the yeast is S. cerevisiae.

22. A vector having the sequence of SEQ ID NO 9, or a vector at least 80% homologous to SEQ ID NO 9.

23. A fusion protein comprising a) at least one scaffoldin protein having at least one functional cohesin domain, and b) at least one anchoring protein, wherein the anchoring protein is capable of tethering the scaffoldin protein to a surface of a yeast cell, and wherein the N-terminus of the anchoring protein is fused to the C- terminus of the scaffoldin protein.

24. The fusion protein according to claim 23, wherein the anchoring protein is cell wall protein 1 (Cwp1) or a protein having at least 80% homology to SEQ ID NO 1.

25. The fusion protein according to either claim 23 or claim 24, further including a secretion signal.

26. The fusion protein according to claim 25, wherein the secretion signal is fused to the N-terminus of the scaffoldin protein.

27. The fusion protein according to either claim 25 or claim 26, wherein the secretion signal is Trichoderma reesei XYN2 or a secretion signal having at least 80% homology to SEQ ID NO 2.

28. The fusion protein according to any one of claims 23 to 27, wherein the scaffoldin is a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain.

29. The fusion protein according to any one of claims 23 to 27, wherein the scaffoldin protein is from Clostridium.

30. The fusion protein according to any one of claims 23 to 27, wherein the scaffoldin is SEQ ID NO 3 or a protein having at least 80% homology to SEQ ID NO 3.

31. The fusion protein according to any one of claims 23 to 30, wherein the yeast is S. cerevisiae.

32. A yeast cell transformed with a vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the scaffoldin protein on the yeast cell surface.

33. A method of displaying a polypeptide on a yeast cell surface, the method including the steps of a) transforming the yeast cell with a vector having nucleic acid encoding a scaffoldin protein comprising at least one cohesin domain operably linked to expression elements for expressing and displaying the expressed scaffoldin protein on the yeast cell surface, and b) contacting the yeast cell with a fusion protein comprising a dockerin domain and a polypeptide to be displayed.

34. The method according to claim 33, wherein the expression elements include nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to SEQ ID NO 4.

35. The method according to claim 34, wherein the nucleic acid encoding cell wall protein 1 (Cwp1), or nucleic acid having at least 80% homology to SEQ ID NO 4, is in frame with, and 3' to, the nucleic acid encoding the scaffoldin protein.

36. The method according to any one of claims 33 to 35, further including nucleic acid encoding a secretion signal.

37. The method according to claim 36, wherein the secretion signal is Trichoderma reesei XYN2 or nucleic acid having at least 80% homology to SEQ ID NO 5.

38. The method according to claim 37, wherein the expression elements include nucleic acid encoding the Trichoderma reesei XYN2 secretion signal or nucleic acid having at least 80% homology to SEQ ID NO 5 is in frame with, and 5' to, the nucleic acid encoding the scaffoldin protein.

39. The method according to any one of claims 33 to 38, wherein the scaffoldin is a chimeric protein comprising at least one C. cellulolyticum cohesin domain and at least one C. thermocellum cohesin domain.

40. The method according to any one of claims 33 to 38, wherein the scaffoldin protein is from Clostridium.

41. The method according to any one of claims 33 to 38, wherein the nucleic acid encoding the scaffoldin is SEQ ID NO 6 or nucleic acid having at least 80% homology to SEQ ID NO 6.

42. The method according to any one of claims 33 to 41 , wherein the expression elements include at least one element selected from the group including the phosphoglycerate kinase I gene promoter (PGK1_P), nucleic acid at least 80% homologous to SEQ ID NO 7, the phosphoglycerate kinase I gene terminator (PGK1_T), and nucleic acid at least 80% homologous to SEQ ID NO 8.

43. The method according to any one of claims 33 to 42, wherein the yeast is S. cerevisiae.

44. The method according to any one of claims 33 to 43, wherein the dockerin domain of the fusion protein is SEQ ID NO 10, or a protein having at least 80% homology to SEQ ID NO 10.

45. The method according to claim 44, wherein the dockerin domain is fused to a random linker having the sequence of SEQ ID NO 11 or poly-alanine linker having the sequence of SEQ ID NO 12.

46. The method according to claim 45, wherein the C-terminus of the linker is fused to the N-terminus of the dockerin domain.