Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
  • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
  • C07K14/4702—Regulators; Modulating activity
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
  • G01N33/6803—General methods of protein analysis not limited to specific proteins or families of proteins
• • G—PHYSICS
  • G01—MEASURING; TESTING
  • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
  • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
  • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
  • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
  • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
  • G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
• • G—PHYSICS
  • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
  • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
  • G16B15/00—ICT specially adapted for analysing two-dimensional [2D] or three-dimensional [3D] molecular structures, e.g. structural or functional relations or structure alignment
  • G16B15/30—Drug targeting using structural data; Docking or binding prediction
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2299/00—Coordinates from 3D structures of peptides, e.g. proteins or enzymes
• • G—PHYSICS
  • G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
  • G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
  • G16B15/00—ICT specially adapted for analysing two-dimensional [2D] or three-dimensional [3D] molecular structures, e.g. structural or functional relations or structure alignment

Definitions

• the subject of the present invention is a crystal of the NEMO CC2-LZ domain of sufficient size and quality to make it possible to obtain structural data by X-ray diffraction crystallography.
• the invention relates to the use of NEMO's crystallographic data and three-dimensional structure of the CC2-LZ domain to identify, model, and design compounds that modulate the NF-ÎoB signaling pathway.
• the NF-kB pathway is activated in response to various extracellular stimuli such as bacterial LPS, proinflammmatoires of cytokines such as IL 1 I 1 and TNF (MS Hayden and S. Ghosh, Signaling to NF-kappaB, Genes Dev 18 (2004 ), no.18, 2195-2224). Signals are typically transmitted from cell receptors to the IKK complex, a pivotal regulator of the signaling pathway.
• the IKK complex is composed of two kinases IKK ⁇ and IKK ⁇ and a regulatory protein NEMO (NF- ⁇ B essential modulator) (S. Yamaoka et al., Complementation cloning of NEMO, a component of the IkappaB kinase complex essential for NF-kappaB activation, CeII 93 (1998), No. 7, 1231-1240).
• NEMO plays a crucial role in integrating signals from various stimuli and inducing activation of the IKK complex.
• the NEMO protein is constituted in its N-terminal portion of a binding domain to the IKK complex and in its C-terminal portion of an oligomerization domain (FIG. 1). Note that murine NEMO proteins (SEQ ID NO. 1)
• Activation of the IKK complex proceeds through a mechanism related to the ability of the NEMO protein to oligomerize by trans-activation via an IKKK kinase or by trans-autoactivation via dimerization of IKKs kinases.
• the mechanism of activation of the IKK complex via NEMO is not fully elucidated, although many reports show that oligomerization and attachment to K-63 polyubiquitins involving NEMO's minimal domain CC2-LZ play a pivotal role (JL Poyet et al., Activation of the IkappaB kinases by RIP via Ikkgamma / NEMO-mediated oligomerization, J
• the minimal domain of CC2-LZ oligomerization of NEMO (aa 251-337 in mice, aa 258-344 in humans) is composed of two successive motifs, a coiled-coil CC2 motif (aa 251-290 in mice , aa 258-297 in humans) and a LZ leucine zipper motif (aa 293-337 in mice, aa 300-344 in humans). Variations of one to two amino acids at the ends of the CC2-LZ domain can be observed depending on the software used for the prediction of CC2 and LZ structures.
• the IKK complex phosphorylates IKB proteins, triggering the degradation of these proteins by the 26S proteasome and then releasing the NF-ÎoB transcription factors that are sequestered in the cytoplasm by the IKB proteins.
• the NF-ÎoB transcription factor then migrates into the nucleus and regulates the expression of genes involved in inflammation, immunity, apoptosis and cell survival. Constitutive activation of the NF-ÎoB pathway is involved in oncogenesis.
• the IKK complex has emerged as a very attractive target for the development of anti-inflammatory and anti-tumor compounds (MA Calzado et al., NF-kappaB inhibitors for the treatment of inflammatory diseases and cancer, Curr Med Chem 14 (2007). 3, 367-376) (TD Gilmore and M. Herscovitch, Inhibitors of NF-kappaB signaling: 785 and counting, Oncogene 25 (2006), no.51, 6887-6899) (F. D'Acquisto et al. al., Inhibition of nuclear factor kappa
• NF-kB An emerging theme in anti-inflammatory therapies, Mol Interv 2 (2002), No. 1, 22-35.
• the design of NEMO-targeting compounds rather than kinases selectively suppresses stimuli-dependent IKK activity and thereby decreases the cytotoxicity of such compounds.
• the NEMO protein and the CC2-LZ domain in particular have thus far been unsuccessful.
• the purpose of the present invention is therefore to propose a new strategy for obtaining the crystallization of the CC2-LZ domain of the NEMO protein.
• This alternative strategy is based on an increase in the rigidity of the minimal oligomerization domain of NEMO.
• the crystalline structure was resolved by X-ray diffraction crystallography with a resolution of 3.25 ⁇ .
• the crystalline structure was resolved by X-ray diffraction crystallography with a resolution of 2.9 ⁇ .
• the present invention also relates to crystallization methods of the CC2-LZ domain.
• the CC2-LZ crystals and the information derived therefrom can be analyzed for the purpose of identifying or designing compounds that interact with CC2-LZ.
• the present invention thus relates to a crystal of the mammalian NEMO CC2-LZ domain whose peptide domain CC2-LZ has the amino acid sequence SEQ ID NO.3 and whose peptide variants are derived from said amino acid sequence.
• crystal In the context of the invention the terms “crystal”, “crystal of the CC2-LZ domain”, “crystal of a CC2-LZ complex” and “co-crystal of the CC2-LZ domain” are used indistinctly and refer to a crystal of a complex comprising at least two distinct entities.
• An entity of the crystal according to the invention is the CC2-LZ domain or one of its variants.
• the present invention also relates to a crystal of a mammalian NEMO CC2-LZ domain complex whose peptide domain CC2-LZ has the amino acid sequence SEQ ID NO.4 and whose peptide variants are derived from said amino acid sequence.
• amino acid sequence is to be understood a peptide sequence isolated from the natural context. These include isolated sequences, synthesized chemically and / or purified and possibly modified by genetic engineering.
• variants are meant the amino acid sequences of the peptides described above comprising conservative substitutions or conservative point mutations and having essentially the same properties as the peptides, respectively, encoded by the sequences SEQ ID NO. 3 and SEQ ID NO. .4, the ability to oligomerize and bind to K-63 polyubiquitins.
• Mesh parameter denotes the parameters a, b and c of the crystalline mesh corresponding to the lengths of the basic non-coplanar vectors (a, b, c), and the angles ⁇ , ⁇ and ⁇ which are formed between the vectors ( a, b, c).
• the angle ⁇ is the angle between the vectors b and c, the angle ⁇ between the vectors a and c, and ⁇ that between the vectors a and c.
• crystal mesh is meant the parallelepiped constructed by the vectors (a, b, c).
• the crystal of a CC2-LZ domain complex according to the present invention is not limited to the native CC2-LZ domain. Indeed, the crystal of a complex according to the invention comprises mutants of native CC2-LZ. These mutants are obtained by addition, deletion or substitution of at least one amino acid in the native CC2-LZ polypeptide sequence and have substantially the same three-dimensional structure as that of the native CC2-LZ domain.
• having substantially the same three-dimensional structure it is meant having a set of atomic structure coordinates from a crystal having a mean deviation of less than or equal to 5 A, preferably 2 A, when superimposes on the atomic structure coordinates of native CC2-LZ from which the mutant is derived when at least 50% to about 100% of the native CC2-LZ alpha carbon atoms are included in the superposition.
• the invention preferably relates to a co-crystal, comprising the domain
• ankyrin modular proteins of varying sizes involved in multiple protein: protein interactions.
• Ankyrins are genetically conserved proteins found in bacteria, plants, fungi and animals and whose structure is based on repeating structural units of about 33 amino acids.
• An "ankyrin fragment” according to the invention is capable of binding and stabilizing the complex formed with the NEMO CC2-LZ domain.
• the invention relates to a crystal of the CC2-LZ domain of a mammalian NEMO protein and an ankyrin 1 D5 (SEQ ID NO.5).
• the invention also provides a crystal of the CC2-LZ domain of a mammalian NEMO protein and a 2A1 or 2F6 ankyrin as described by Wyler et al. (Inhibition of NF-kappaB activation with ankyrin-repeat targeting proteins targeting the ubiquitin-binding / oligomerization domain of NEMO, Protein Sci 16 (2007), No. 9, 2013-2022).
• the CC2-LZ domain is complexed with ankyrin 1 D5, which binds to CC2-LZ with high affinity and stiffens the peptide domain.
• LZ complexed with ankyrin 1 D5 is used to determine the three-dimensional structure of CC2-LZ by molecular replacement.
• the ankyrin or the ankyrin fragment is complexed to the LZ motif of the CC2-LZ domain in order, more specifically, to stabilize it.
• the LZ pattern is more flexible and thermodynamically more unstable than the CC2 pattern of the CC2-LZ domain.
• the co-crystal of the NEMO CC2-LZ domain with ankyrin protein can be obtained by a crystallization process comprising the following steps:
• the CC2-LZ crystallization process corresponds to the process as described in Example 1.
• the invention relates to the crystal of a NEMO CC2-LZ domain complex or the CC2-LZ co-crystal having the crystallographic coordinates described in Table 1.
• the crystal and the co-crystal of the CC2-LZ domain according to the invention are respectively defined by their three-dimensional structure obtained by X-ray diffraction which is represented in FIGS. 2 and 3.
• the three-dimensional structure of CC2-LZ forms an elongated dimer composed of two parallel ⁇ -helices that associate with each other to form a coiled-coil structure (Figure 2) ( Figure 3).
• the dimer of CC2-LZ interacts with two molecules of ankyrin 1 D5, each ankyrin forming contacts with ⁇ helices on both LZ chains.
• Three residues located between the CC2 motif and the LZ motif (aa 291-293, mouse numbering) form a pseudo coiled-coil.
• the polyubiquitin chain binding domain K-63 which is described in Ea et al., Is composed of 67 amino acids (259-325 human numbering, 252- 318 numbering mice) corresponding to the C-terminal region of CC2 and the N-terminal region of LZ. Cross-referencing of data from three-dimensional structure, site-directed mutagenesis and sequence alignment
• the region forming the ubiquitin binding site was determined between amino acids 293 and 323 in the murine polypeptide sequence of NEMO (aa 300-330 human numbering).
• the three-dimensional structure of the CC2-LZ crystal and co-crystal according to the invention is obtained by a process comprising the following steps:
• the method for determining the three-dimensional structure of CC2-LZ corresponds to the method as described in Example 1.
• the invention also extends, on the one hand, to the murine CC2-LZ protein crystal comprising the Ala316Pro mutation (A316P) and / or the Phe305Ala mutation (F305A), and on the other hand to the crystal of the human protein of CC2-LZ also comprising the Ala323Pro mutation (A323P) and / or the Phe312Ala mutation (F312A).
• the different mutations obtained by site-directed mutagenesis in the human CC2-LZ protein are shown in Figure 4.
• the Glu296Ala mutation (E296A, position 289 in mice) is localized at the C-terminal end of CC2 and is outside the site of ubiquitin interaction (position aa 259-325, human numbering and aa 252-318, mouse numbering).
• the mutations Phe312Ala (F312A, position 305 in mice) and Glu315Ala (E315A, position 308 in mice) are located in the ubiquitin binding site.
• the mutations Glu315Ala and Ala323Pro are respectively involved in two human pathologies, the anhydrotic ectodermal dysplasia with immunodeficiency (EDA-ID) (R. Doffinger et al., Genetic heterogeneity of mendelian susceptibility to mycobacterial infection, Microbes Infect 2 (2000), No. 13, 1553-1557) and Incontinentia pigmenti (IP) (A. Smahi et al., Genomic rearrangement in nemo odd NF-kappaB activation and is a cause of incontinentia pigmenti. incontinentia pigmenti (IP) consortium,
• EDA-ID anhydrotic ectodermal dysplasia with immunodeficiency
• IP Incontinentia pigmenti
• Leu329Ala Leu336Ala double mutation (L329A L336A, positions 322 and 329 respectively in the mouse) is located in the leucine zipper domain of CC2-LZ.
• NEMO-deficient mouse embryonic fibroblasts are transiently co-transfected with the plasmid encoding the Ig ⁇ -luciferase reporter gene and with the plasmids encoding the different proteins and then stimulated by TNF ⁇ for 24 hours.
• MEFs mouse embryonic fibroblasts
• the mutations A323P and F312A generate the two strongest inhibitions, respectively 95% and 78% inhibition.
• A323P mutation that causes a severe form of incontinentia pigmenti a lack of NEMO dimerization is responsible for the inactivation of the NF- ⁇ B pathway, a result similar to that obtained by Sebban- Benin et al. (Identification of TRAF ⁇ -dependent NEMO polyubiquitination sites through the analysis of a new NEMO mutant pathway incontinentia pigmenti, Hum Mo! Genet 16 (2007), No.23, 2805-2815).
• the NEMO CC2-LZ domain protein mutated at position F312A shows an elution profile, in gel filtration, identical to that of the wild-type CC2-LZ protein, indicating that this mutation does not affect the stability of the dimer but modifies activation of the NF- ⁇ B pathway ( Figure 5).
• the study of this mutant demonstrates for the first time that the lack of activation is not due to a lack of dimerization of the ubiquitin interaction site but to a lack of interaction with the K63 polyubiquitin chains as shown by Ea et al. Therefore, these results highlight the possibility of inhibiting the NF- ⁇ B pathway by either altering the NEMO dimerization or by inhibiting the interaction of NEMO with the polyubiquitin chains.
• the present invention allows on the one hand the structural validation by directed mutagenesis of an active conformation of NEMO and on the other hand the determination of residues critical for the oligomerization of the protein and consequently for the activation of the IKK complex. as well as those involved in binding to K-63 polyubiquitins.
• the invention relates preferably to a method of identifying compounds capable of binding to the NEMO CC2-LZ domain based on crystallographic data obtained in said invention. Peptides mimicking the sequence of CC2 or LZ are shown to be disruptive oligomerization of NEMO and thus suppress activation of the NF-ÎoB pathway in cells in culture.
• the invention relates to the development and identification of compounds interfering with the oligomerization of the CC2-LZ domain, which inhibits the binding of said domain to polyubiquitins K-63.
• the term "compounds” means any chemical molecule inhibiting the dimerization of the CC2-LZ domain of NEMO or inhibiting the interaction of the NEMO CC2-LZ domain with polyubiquitin chains.
• the crystallographic data of the NEMO domain thus made it possible to design high affinity peptides for this protein.
• the peptide probes according to the invention are preferably the peptide PH4 and the peptide P8RD having the respective amino acid sequences SEQ ID NO.6 and SEQ ID NO.7.
• P8RD has an affinity of 60 nM whereas the peptide PH4 has an affinity of 170 nM.
• These measurements are carried out at pH 7 and at ambient temperature in a stringent buffer corresponding to 20 mM Tris-Acetate-MES containing 200 mM potassium chloride and 0.5% Tween 20. They are carried out by fluorescence polarization using N-terminal coupled peptides with Fluorescein or Cy5 fluorophores.
• the peptides can be coupled to all kinds of fluorophores.
• the present invention finally relates to a method for identifying compounds of NEMO dimerization or the interaction of NEMO with polyubiquitin chains between a peptide probe according to the invention and the NEMO CC2-LZ domain.
• This method of high throughput screening or HTS (High Throughput Screening) screening comprises the following steps:
• complex model is meant the three-dimensional structure of the CC2-LZ / ubiquitin complex.
• the NEMO / ubiquitin CC2-LZ complex model was constructed based on the structural information obtained from the ILJIM-Rabbit-5 / ubiquitin complex (Lee S. et al., Structural basis for ubiquitin recognition and autoubiquitination by Rabex-5 Nat Struct Mol Biol 13, 264-271, 2006).
• the CC2-LZ / ubiquitin complex model has been experimentally verified through the chemical shifts observed by NMR of the interaction between ubiquitin and the NEMO CC2-LZ domain ( Figure 9).
• the three-dimensional structure of the NEMO CC2-LZ domain is deduced from the CC2-LZ / ubiquitin complex model.
• This three-dimensional structure of CC2-LZ can be used for in silico design or in silico screening of compounds capable of binding to the NEMO CC2-LZ domain.
• the present invention thus relates to a method of designing compounds capable of binding to the NEMO CC2-LZ domain using the three-dimensional structure of the CC2-LZ domain obtained from the crystallographic coordinates of the crystal according to the invention.
• the invention extends to compounds identified from the identification and design methods supra.
• these compounds inhibit the dimerization of the NEMO CC2-LZ domain or inhibit the interaction of the NEMO CC2-LZ domain with the polyubiquitin chains.
• Figure 1 Representation of the NEMO protein.
• Figure 2 Three-dimensional structure of the NEMO CC2-LZ domain complexed with two molecules of ankyrins. The two subunits of the
• CC2-LZ are dark gray whereas ankyrines are light gray.
• Figure 3 Structure of the NEMO CC2-LZ domain in the complex with ankyrins 1 D5. Seen from the side of the complex in ribbons diagram. The NEMO propellers are represented in gray level according to the CC2, NOA or LZ domain. Ankyrin chains 1 D5 are dark gray in lateral position.
• Figure 4 Localization in the human CC2-LZ domain of the different mutations obtained by site-directed mutagenesis.
• the polyubiquitin binding domain is shown in white.
• the numbering used for amino acids corresponds to that of the human protein.
• Figure 5 Effect of the different mutations on the activation of the NF-KB pathway.
• the numbering of the mutations corresponds to that of the human CC2-LZ protein.
• Figure 6 Model of the NEMO / ubiquitin CC2-LZ Domain Complex. Sequence of alignment between Rabex-5 (MIU / IUIM) (first line) and NEMO (NOA pattern) (second line) with below the positions of NOA (ag) structural motif.
• the vertical lines in solid and dashed lines designate identical and similar residues respectively.
• the diagonal line indicates spatially similar residues in view of the structural model according to the invention.
• the residues strictly conserved in the NOA motif are indicated by *.
• Figure 7 Seen from the side of the NEMO CC2-LZ / ubiquitin complex. The helices of NEMO are colored as in FIG. 3.
• the ubiquitin molecules are gray in lateral position and the 1D5 molecules of co-crystal ankyrins are in semi-transparent light gray also in lateral position.
• Figure 8 Closely viewed from the NOA / ubiquitin interface. The residues involved in the interaction are drawn in a "lease and stick" representation with carbon atoms in gray (ubiquitin) and white (NEMO).
• Figure 9 Chemical shifts observed by NMR of ubiquitin bound to the NEMO CC2-LZ domain. Mean variations of the chemical shift ⁇ av according to the chemical residue. The elements of the corresponding secondary structure are represented above the graph of chemical shifts.
• Figure 10 Representation of the interaction between ubiquitin and the NOA region of the CC2-LZ domain.
• ankyrin 1 D5 The evolution of ankyrin 1 D5 is performed by ribosome display using the N2C DARPin library (designed ankyrin repeat protein) (HK Binz et al., High affinity binders selected from ankyrin repeat protein libraries, Nat Biotechnol 22 (2004)). ), no.5, 575-582) for selection.
• N2C DARPin library designed ankyrin repeat protein
• the results of this study as well as the amino acids of ankyrin 1D5 which differ from the initial model are described in the publication of Wyler et al.
• the cDNA of ankyrin 1 D5 is cloned into the pQE30 vector (Qiagen) in phase with a histidine tag located on the N-terminal side. Plasmid pQE30-1 D5 is introduced into a strain of E.
• Fractions containing the protein are pooled and dialyzed against 20 mM Tris / HCl pH 7.6, 50 mM buffer. KCI using dialysis bags with a cutoff of 6-8 kDa (Spectra / Por). The protein is concentrated by ultrafiltration in Amicon tubes (Millipore) with a cut-off of 5 kDa.
• the CC2-LZ domain (SEQ ID NO.3) (aa 251-337 of murine NEMO) is cloned into the plasmid pET28 in phase with a histidine tag located on the N-terminal side. This domain corresponds to residues 258-344 of human NEMO (SEQ ID NO.4).
• the protein is expressed in a strain of E. coli, BL21-gold (DE3), and purified on a nickel column as described for purification of ankyrin 1 D5.
• the CC2-LZ protein is then purified on a cation exchange column, Poros 20-HS (Perseptive Biosystem).
• the column is pre-equilibrated in the buffer 50 mM MES pH 7.1, 50 mM KCl and the proteins are eluted by a linear gradient of KCl. Fractions of interest are pooled and dialyzed against a 20mM Tris / HCl buffer pH 8.0, 100mM KCl, then concentrated by ultrafiltration.
• the purity of the protein is estimated to be greater than 98% by electrophoresis analysis under denaturing conditions and staining with Coomassie blue.
• the protein concentration is determined by the Bradford method and by measurement of absorption at 280 nm using an absorption coefficient of 2312 M -1 cm -1 for CC 2 -LZ and 1490 M -1 cm -1 for the 1 D5.
• Proteins 1 D5 and CC2-LZ are incubated together for 30 min in ice and the complex is purified on a Superdex 200 HR column (Pharmacia) equilibrated in 20 mM Tris / HCl buffer pH 8, 100 mM KCl.
• the binding stoichiometry in the complex is 1: 1.
• the complex is concentrated by ultrafiltration to obtain a protein concentration of 10-13 mg / ml.
• the 3A4 tank solution contains: 10% PEG 40000, 5% isopropanol, 100 mM Na Hepes pH 7.5, and 8B5 solution contains: 5% MPD (2-methyl-2,4-pentadiol), 5% ethanol, 100 mM Na Hepes pH7.5.
• the crystals grew under vapor diffusion in suspended droplets seeded with microcrystals (microseeding). 1 .mu.l of the protein complex is added to 1 .mu.l of the reservoir solution and equilibrated under vapor diffusion at 18-20 0 C for more than 36 hours. Micro crystals (0.1 ⁇ l) obtained from crystal fragments are introduced into the drop. After seeding, the crystals grow in a few days to reach a size of 300x150x20 ⁇ m. For cryogenic protection, the crystals are immersed for 30 seconds in the reservoir solution containing in addition to the
• the crystals are mounted on nylon loops and frozen very quickly before data collection.
• the best candidates for modeling the CC2-LZ / ubiquitin complex are structures comprising a simple ⁇ -helix such as I 1 UIM (ubiquitin-interacting motif) and I 1 inverted UIM (IUIM or MIU) derived from Rabex-5.
• I 1 UIM ubiquitin-interacting motif
• IUIM I 1 inverted UIM
• the IUIM motif of Rabex-5 binds to the hydrophobic region of ubiquitin centered around the Ile 44 residue. It has also been shown that this same Ile 44 residue is necessary in the interaction between NEMO and polyubiquitin-K63 (Bloor S.
• ubiquitin molecules are attached to the NEMO helix.
• the ubiquitin molecules bind to the hydrophobic region of NOA whose binding site partially overlaps the ankyrin 1 D5.
• the residue D304 of NOA is dipped in the center of the CC2-LZ / ubiquitin interface and forms H bonds with the H68 residue of ubiquitin.
• the other main interactions involve non-polar residues including Ala 307, corresponding to the invariant residue AIa found in the IUIM motif and the residue F305 involved in the NEMO / polyubiquitin-K63 interaction. These interactions mask the hydrophobic surface of
• the cDNA coding for the human CC2-LZ domain of NEMO called Tax CC2-LZ and ranging from Met 215 to Glu 362 (human numbering) is obtained by PCR using the following two nucleotide primers: NEMO 1 SEQ ID NO.8 ( 5'- CCCCATATGGAGCGCCAGGCCGCCTC) and NEMO 2 SEQ ID NO.9 (5'-TGAGGAAGCGGATGTCGAGTAGCTCGAGGGG).
• This cDNA is introduced between the NdeI and XhoI restriction sites of a bacterial expression vector, pET-28b (Novagen) to generate the pET-NEMO vector.
• the FLAG tag corresponding to the DYKDDDDK sequence is introduced into a pcDNA3 mammalian expression vector between the HindIII and EcoRI restriction sites to create the plasmid pcFLAG.
• NEMO 3 SEQ ID No. 10 5'-GGGGAATTCTAATAGGCACCTCTGGAAGAG
• NEMO 4 SEQ ID No. 11 5'-CATGGAGTGCATTGAGTAGCTCGAGGGG
• the point mutations Glu296Ala, Phe312Ala, Glu315Ala, Ala323Pro and the double mutant Leu329Ala Leu336Ala are introduced firstly into the bacterial vector pET-NEMO-WT and secondly into the mammalian vector pcDNA3 / NEMO-WT using the technique site-directed mutagenesis, the protocol of which is described in the "Quikchange II Site-Directed Mutagenesis" kit from Stratagene.
• Mouse embryonic fibroblasts (MEFs) deficient in NEMO are cultured in cell culture dishes and transiently transfected with a mixture containing: 0.2 ⁇ g of a plasmid pEF1 encoding ⁇ -galactosidase, 0.5 ⁇ g of a plasmid containing the reporter gene Ig-luciferase and 2 ⁇ g plasmids expressing the different variants of NEMO. Twenty four hours after transfection, the cells are activated with TNF ⁇ (20 ng / ml) for 24 h.
• the cells are then recovered and then lysed in 110 ⁇ l of 25 mM Tris / Phosphate pH 7.8 buffer, 8 mM MgCl 2 , 1% Triton, 1 mM dithiothreitol, 15% glycerol to which a cocktail of proteases (Roche) is added.
• the cell lysate is centrifuged at 13,000 rpm for 20 min at 4 ° C. The activity of the reporter gene is measured.
• the purification of the various proteins is made from a culture of 3 liters of BL21-Gold D3 bacteria (Stratagene) transformed with the different plasmids pET 28 and in the presence of kanamycin (50 ⁇ g / ml). Protein expression is induced with 1mM IPTG at 37 ° C for 4 hours. After centrifugation for 20 min at 6000 g at 4 ° C., the bacteria are washed in 100 mM Tris / HCl pH 8 buffer containing 10 mM MgCl 2 . The bacterial pellets are frozen at -20 ° C.
• the pellets are then resuspended in extraction buffer (50 mM Tris / HCl pH 8, 20 mM KCl and 5% glycerol) containing a mixture of protease inhibitors (Complete EDTA -free, Roche) at a rate of 2 ml / g of bacteria then crushed with a French Press at a pressure of 1500 psi.
• the bacterial lysate undergoes 3 times 10 seconds of sonication at 90 W thus reducing the viscosity of the medium by fragmentation of the DNA.
• the lysate is then diluted 2.5 times in 50 mM Tris / HCl buffer pH8, 1 M NaCl and centrifuged at 10,000 g for 30 min at 4 ° C.
• the supernatant is then deposited on a 20 ml Ni-NTA Superflow affinity column (Qiagen) previously equilibrated in the previous buffer. After a night's washing of the column to remove all unbound proteins as well as DNA, the proteins are eluted by a linear gradient (0-500 mM) of imidazole (ACS, Merck) in the equilibration buffer of the column. The fractions containing the protein of interest are pooled and dialyzed against 20 mM HEPES buffer pH 7.5, 50 mM KCl, 1 mM EDTA. The dialysate whose pH is brought to 6 with
• MES 1 M is loaded on a Poros 20-HS cation exchange column (Perseptive Biosystem) previously equilibrated in a 50 mM MES buffer pH6, 50 mM KCl. The elution is carried out by a linear gradient of KCl (50 mM-1 M). The protein fractions are combined and then concentrated by ultrafiltration (Amicon-Ultra with a cutoff of 10,000) and dialyzed against a buffer
• the proteins are stored aliquoted at -80 ° C.
• the purity of the various proteins is estimated to be> 98% according to the electrophoresis analysis under denaturing conditions and staining with Coomassie blue.
• the protein concentration is determined by measuring the absorbance at 280 nm using a molar extinction coefficient of 5960 M ".
• Chains A & B Nemo CC2LZ with numbering corresponding to entry 088522
• Nemo aa M251 to L336 chain A starts at 242 and chain B at 247 (extra aa from the his tag) chains
• C & D ankyrin 1D5 (yrs. 12 to 136)
• ATOM 171 CA ALA A 263 58.057 30.460 233.712 .00 80.70 6
• ATOM 254 CA ILE A 274 53.295 33.054 218.387 1.00 78.05 6
• ATOM 361 C ISLE A 286 46.152 37.327 200.623 1.00 68.99 6
• ATOM 402 CA PRO A 292 49.844 43.624 192.470 1..00 54.30 6
• ATOM 642 CA TYR A 321 31.440 66.468 160.019 1.00 42.74 6
• ATOM 662 CA GLN A 323 25.897 65.992 159.923 1.00 47.61 6
• ATOM 680 CA GLN A 325 27.848 67.141 154.853 1.00 53.55 6
• ATOM 812 CA ALA B 249 68.688 15.087 247.548 1.00 79.06 6

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Molecular Biology (AREA)
• Physics & Mathematics (AREA)
• Urology & Nephrology (AREA)
• Immunology (AREA)
• Hematology (AREA)
• General Health & Medical Sciences (AREA)
• Biomedical Technology (AREA)
• Medicinal Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biophysics (AREA)
• Cell Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biochemistry (AREA)
• Biotechnology (AREA)
• General Physics & Mathematics (AREA)
• Pathology (AREA)
• Microbiology (AREA)
• Spectroscopy & Molecular Physics (AREA)
• Food Science & Technology (AREA)
• Bioinformatics & Computational Biology (AREA)
• Analytical Chemistry (AREA)
• Organic Chemistry (AREA)
• Zoology (AREA)
• Toxicology (AREA)
• Genetics & Genomics (AREA)
• Pharmacology & Pharmacy (AREA)
• Crystallography & Structural Chemistry (AREA)
• Gastroenterology & Hepatology (AREA)
• Evolutionary Biology (AREA)
• Medical Informatics (AREA)
• Theoretical Computer Science (AREA)
• Peptides Or Proteins (AREA)
• Analysing Materials By The Use Of Radiation (AREA)
• Sampling And Sample Adjustment (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=39638688

Family Applications (1)

Country Status (9)

Family Cites Families (4)

• 2008
  • 2008-02-05 FR FR0800605A patent/FR2927080A1/fr active Pending
• 2009
  • 2009-02-04 AR ARP090100356A patent/AR070555A1/es not_active Application Discontinuation
  • 2009-02-05 EA EA201001228A patent/EA020189B1/ru not_active IP Right Cessation
  • 2009-02-05 JP JP2010545522A patent/JP5529759B2/ja not_active Expired - Fee Related
  • 2009-02-05 EP EP09722579A patent/EP2240513A2/de not_active Withdrawn
  • 2009-02-05 WO PCT/FR2009/000127 patent/WO2009115664A2/fr not_active Ceased
  • 2009-02-05 AU AU2009227090A patent/AU2009227090B2/en not_active Ceased
  • 2009-02-05 US US12/735,671 patent/US8440790B2/en not_active Expired - Fee Related
  • 2009-02-05 CA CA2713884A patent/CA2713884A1/fr not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events