EP2195434A1

EP2195434A1 - Plasmid production and expression of recombinant proteins in cells cultivated without antibiotics

Info

Publication number: EP2195434A1
Application number: EP08787440A
Authority: EP
Inventors: Daniel Scherman; Corinne Marie
Original assignee: Centre National de la Recherche Scientifique CNRS; Institut National de la Sante et de la Recherche Medicale INSERM; Universite Paris 5 Rene Descartes
Current assignee: Centre National de la Recherche Scientifique CNRS; Institut National de la Sante et de la Recherche Medicale INSERM; Universite Paris 5 Rene Descartes
Priority date: 2007-08-24
Filing date: 2008-08-22
Publication date: 2010-06-16
Also published as: FR2920158A1; US20110129487A1; US8440455B2; WO2009027351A1; CA2697498A1; JP2010536361A; FR2920158B1

Abstract

The invention relates to a mutated cell such as a bacteria or yeast in which the thyA gene coding thymidylate synthase includes a nonsense codon, preferably the amber codon, said nonsense codon replacing a codon coding an amino acid and inducing the interruption of thyA gene translation and the auxotropy of the cell for the thymidine. Advantageously, the endA gene coding the endonuclease 1 and/or the recA gene coding the recombinase is inactivated in said mutated cell. The invention also relates to an expression plasmid including a transgene and a sequence of a suppressing ARM structural gene containing an anticodon that can be paired with the nonsense codon of the thyA gene and is specific of an amino acid capable of restoring the translation of the mutated thyA gene and thereby obtaining a protein of the wild or mutated type having a thymidylate synthase activity. The invention also relates to a method for the multiplication of the expression plasmid.

Description

PLASMID PRODUCTION AND EXPRESSION OF RECOMBINANT PROTEINS IN CULTIVATED CELLS WITHOUT

ANTIBIOTICS

The present invention relates to a mutated cell such as a bacterium or a yeast, wherein the thyA gene encoding thymidylate synthase comprises a nonsense codon, preferably the amber codon, said non-sense codon replacing a codon encoding an amino acid and causing stopping the translation of the thyA gene and the auxotrophy of the cell for thymidine. Advantageously, the endA gene coding for endonuclease 1 and / or the recA gene encoding the recombinase is inactivated in said mutated cell.

The invention also relates to an expression plasmid comprising a transgene and a suppressor tRNA structural gene sequence comprising an anticodon capable of mating with the nonsense codon of the thyA gene and which is specific for an amino acid capable of restoring translation of the mutated thyA gene and thus obtain a wild-type or mutated protein having a thymidylate synthase activity. A method of multiplying the expression plasmid is also claimed.

Treatment of diseases or vaccination involves the injection of therapeutic or antigenic proteins. These are generally purified from bacterial or other cells such as yeasts that contain expression vectors. Alternatively, the proteins of interest can also be expressed in vivo after injection of the expression plasmid into human or animal cells. This technique is referred to as gene therapy when the expressed protein has a healing aspect and DNA vaccination when the protein of interest is encoded by part of the genetic material of a pathogen or toxic, thereby triggering a protective immune response.

The expression plasmids generally bear an origin of replication, a selection gene such as an antibiotic resistance gene (kanamycin, ampicillin, etc.) that promotes the maintenance of the plasmid in the host cell, and one or more several transgenes with sequences necessary for their expression in animal cells (enhancer, promoter, polyadenylation sequences, etc.), or others such as yeasts or bacteria. Expression plasmids are generally obtained by multiplication in dividing Escherichia coli (E. coli) bacterial cells. In order to ensure the maintenance of the plasmids to isolate or express the recombinant proteins during bacterial cultures, a selection pressure such as antibiotic resistance is exerted. However, in clinical use, it is not recommended to use plasmids or recombinant proteins that have been prepared from culture media containing antibiotics. Injection of antibiotics could lead to sensitization or anaphylactic shock. In addition, in vivo, the injected plasmids could be transferred to the microbes of the endogenous then environmental flora, which could then acquire antibiotic resistance.

Plasmids lacking antibiotic resistance genes have already been constructed, in particular by using a plasmid selection system based on a repressor titration mechanism: the essential chromosomal gene dapD

(involved in peptidoglycan synthesis) ά'E. coli is under the transcriptional control of the lac promoter / operator. In the absence of an inducer in the culture medium, the lac operon repressor binds to the operator and inhibits the expression of the essential gene. Only the strains which contain a plasmid bearing operator sequences grow. The presence of this plasmid makes it possible to titrate the repressor linked to the operator located upstream of the dapD gene and to restore the bacterial growth (Cranenburg et al, 2001 and 2004). However, it appears that the yield of the plasmids prepared using this strategy is not satisfactory.

Another strategy is to construct mini-circles containing only the expression cassette of the eukaryotic gene. The mini-circles are generated in the bacteria from a plasmid which carries prokaryotic sequences necessary for its propagation and a eukaryotic gene expression cassette flanked by sites recognized by a recombinase. Recombination generates two molecules: the mini-circles and a "mini-plasmid" carrying the bacterial sequences (Kreiss et al, 1998). The latter may eventually be digested using endonucleases (Chen et al, 2003 and 2005). There are several steps to obtaining the mini circles: recombination of the DNA plasmid to generate the mini-circles, possible digestion of the mini-plasmids carrying the bacterial DNA and purification of the mini-circles. Although purification and mini-circle techniques have been considerably improved, contamination of preparations by native plasmids (due to partial recombination) or mini-plasmids carrying prokaryotic sequences can not be ruled out.

(due to enzymatic digestion or incomplete purification).

There is therefore a need to find a novel selection pressure system for the multiplication of expression plasmids lacking antibiotic resistance genes.

This need is solved by the present invention, which makes it possible to select the bacteria transformed by the expression plasmid by using a rich medium and to obtain a good yield by using standard purification techniques. In vivo, these plasmids have no disadvantage in comparison with the currently used expression vectors.

The present invention consists of a new combination of a mutant strain of E. coli and plasmids lacking antibiotic resistance genes. The production of these plasmids is based on the suppression of a point mutation generating a stop codon (non-sense mutation) introduced into an essential gene of E. coli. coli, by a suppressor tRNA encoded by the plasmid of interest (see Figure 1).

The fields of application of the present invention are the vectors used for the transfection of animal cells, the production of vectors for DNA vaccination or gene therapy in humans or animals, and the use of vectors for production. recombinant proteins.

Thus according to a first aspect, the subject of the present invention is a mutated cell in which the thyA gene coding for thymidylate synthase (ThyA) comprises a non-sense codon, said non-sense codon replacing a codon encoding an amino acid and leading to a stop of the translation of the thyA gene and the auxotrophy of said cell for thymidine.

By "mutated cell" is meant any cell expressing the ThyA protein in which a mutation is introduced into the thyA gene (mutated thyA gene).

Advantageously, the mutated cell is chosen from bacteria and yeasts.

The bacteria or yeasts that may be used in the context of the present invention may be of any type, it being understood that they must contain the thyA gene coding for thymidylate synthase (thyA). These are, for example, yeasts of the genus Pichia or Saccharomyces or bacteria Escherichia coli (E. coli), Salmonella, Shigella or Listeria. Preferably, the mutated cell according to the invention is an Escherichia coli (E. coli) bacterium. Advantageously, the E. coli strain is the MG1655 strain (obtained from The Coli Genetic Stock Center, USA) whose genome has been completely sequenced (Blattner et al., 1997).

The four nucleotide bases of the DNA molecules carry the genetic information. This information, in the form of codons from three contiguous bases, is transcribed into mRNA and translated by tRNA and ribosomes to form proteins. The genetic code is the relationship between a codon and a particular amino acid. Of the 64 possible codons that make up the genetic code, there are three "stop" codons or nonsense codons or termination codons, which are known to halt protein production at the ribosome level. The three stop codons are the amber codon UAG, the ocher codon UAA and the opal codon UGA. Mutations that change a codon to a stop codon are called nonsense mutations and induce the cessation of protein synthesis.

The nonsense amber mutation is preferred because the UAG stop codons are minor (7.6%) compared to the stop codons UAA (63%) and UGA (29.4%). This minimizes the risk of affecting the synthesis of other bacterial proteins by recognition of the stop codon by a mutation suppressor t-RNA, resulting in the insertion of an amino acid.

Transfer RNAs (tRNAs) translate mRNA into a protein on the ribosome. Each tRNA contains an anticodon region that hybridizes with the mRNA, and an amino acid that can be attached to the protein being synthesized. The tRNAs range in size from about 72 to 90 nucleotides and fold into a "cloverleaf" structure. The tRNAs are transcribed by RNA polymerase III and contain their own promoters which become part of the sequence encoding mature tRNA. Nonsense suppressors are alleles of tRNA genes that are modified at the anticodon level so that they can insert an amino acid by hybridizing to a stop codon. For example, an amber mutation in a gene results in the creation of a UAG codon in the mRNA. A suppressor gene of the amber mutation produces a tRNA with a CUA anticodon which introduces an amino acid at the UAG site, allowing translation to continue despite the presence of the amber termination codon.

The nonsense lethal mutation is introduced into the thyA gene which encodes a thymidylate synthase (thyA) (EC 2.1.1.45). This enzyme is involved in the synthesis of deoxythymidine 5'-monophosphate (dTMP), a precursor used in DNA synthesis. The nonsense mutation can also be introduced into the thyA gene encoding a protein with the enzymatic properties of thymidylate synthase (EC 2.1.1.45).

The mutants obtained are auxotrophic for thymidine and are isolated by adding this supplement to the culture medium. The thymidine enters the cells via a nucleoside transporter and is then transformed into dTMP by an alternative pathway involving thymidine kinase (see Figure 2). In the absence of exogenous supply of thymidine, the mutation in the thyA gene is lethal; only those strains which contain a plasmid carrying an origin of replication, a mammalian cell-specific expression cassette, bacteria, yeasts or the like and a suppressor tRNA are grown. The latter contains a modified anticodon in order to allow a pairing with the stop codon, thus restoring a complete translation of the wild-type or mutated ThyA protein but nevertheless possessing an activity enzymatic thymidylate synthase. Strains carrying the plasmid are therefore selected by a restoration of their growth. This selection does not require the use of antibiotics and can be carried out using a rich medium such as that of Mueller Hinton containing minute or no amounts of thymidine (Fluka).

The nonsense mutation may be introduced at any site of the thyA gene at positions where suppression by the suppressor tRNA will be effective. Numerous studies have indeed shown that the nucleic sequence located downstream of the amber mutation influences the suppression efficiency (Kleina et al., 1990, Normanly et al.

1986). Preferably, the mutated Escherichia coli bacterium (E. coli) is characterized in that the non-sense codon replaces a codon encoding an amino acid of thymidylate synthase selected from the group consisting of histidine at position 147, glutamate in position 14 or 223, arginine at position 35 or 127, phenylalanine at position 30, aspartate at position 81 or 105, glutamine at position 33 and asparagine at position 121. More preferably, the codon nonsense replaces the codon encoding histidine at position 147 of thymidylate synthase.

UAG nonsense mutations are preferentially deleted by using Phe, Cyst, His, Giy, Ala, Lys, Pro or GIn-like suppressor t-RNAs which are effective amber muting suppressors and / or inserting the desired amino acid ( Bradley et al, 1981, Normanly et al, 1986 and 1990, Kleina et al, 1990). The modification of the anticodon can effectively alter the specificity of the amino acid grafted on

RNAt; this is not desirable when the amino acid is present in an active site of the enzyme.

The nonsense mutation introduced at histidine 147 is effectively deleted using a histidine suppressor tRNA containing a modified CUA type anticodon and downstream the AA nucleotides; which make it possible to increase the suppression efficiency (Kleina et al, 1990). According to a particular embodiment, the mutated cell according to the invention is characterized in that the non-sense codon is the amber codon UAG.

According to a preferred embodiment, the mutated cell according to the invention is the E. coli cell MG 1655 thyA # d2 deposited in the National Collection of Cultures of

Microorganisms (CNCM), Pasteur Institute, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, France, April 5, 2007 under number 1-3739.

Preferably, the mutated cell according to the invention is characterized in that the endA gene coding for endonuclease 1 comprises a mutation inducing a better plasmid stability in said mutated cell. Such a cell therefore contains the thyA gene containing a nonsense mutation and the endA gene containing a mutation inducing better plasmid stability.

The quality of plasmid DNA isolated from endA + or endA mutants has been studied (Schoenfeld et al., 1995). It has been shown that the quality of the DNA prepared from endA mutants is generally better than that of the DNA produced in the endA + strains tested.

The mutation may be introduced into the endA gene encoding a protein having the enzymatic properties of endonuclease 1 (EC 3.1.21.1).

The endA gene may be inactivated by mutation such as a deletion, a point mutation, or an insertion, resulting in loss of function of the targeted protein. Preferably, the mutation is nonpolar; it does not affect the transcription and translation of genes located downstream of the endA gene. A deletion of the coding sequence is preferred in order to avoid possible reversion events. More preferably, the mutation generates a deletion of the sequence encoding amino acids 7-234 of the EndA protein which consists of 235 amino acids.

According to a more preferred embodiment, the mutated cell according to the invention is the E. coli MG1655 thyA endA # 1.2.C3 cell deposited in the National Collection of Cultures of Microorganisms (CNCM), Pasteur Institute, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, France, April 5, 2007 under the number 1-3738.

Preferably, the mutated cell according to the invention is characterized in that the recA gene encoding a recombinase involved in the recombination of DNA sequences is mutated to avoid recombination mechanisms between the bacterial genome and the plasmids and between the plasmids. Such a cell therefore contains the thyA gene containing a nonsense mutation, the endA gene containing a mutation inducing better plasmid stability and / or the recA gene containing a mutation to avoid the recombination mechanisms between the bacterial genome and the plasmids and between the plasmids.

The mutation can be introduced into the recA gene encoding a protein having the enzymatic properties of recombinase.

The recA gene can be inactivated by mutation such as a deletion, point mutation, insertion generating a loss of function of the targeted protein. Preferably, the mutation is nonpolar; it does not affect the transcription and translation of genes located downstream of the recA gene. A deletion of the coding sequence is preferred in order to avoid possible reversion events. More preferably, the mutation generates a deletion of the sequence encoding amino acids 5 to 343 of the RecA protein which consists of 353 amino acids.

According to a particularly preferred embodiment, the mutated cell according to the invention is the E. coli cell MG1655 thyA endA recA # TMla deposited at the

National Collection of Cultures of Microorganisms (CNCM), Pasteur Institute, 25 rue du Docteur Roux, 75724 PARIS Cedex 15, France, April 5, 2007 at the CNCM under number 1-3737.

According to a preferred embodiment, the mutated cell according to the invention is transformed by an expression plasmid, and this plasmid comprises: an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, an expression cassette for the expression of said recombinant protein of interest in a host cell, and a suppressor ARM structural gene sequence, said suppressor tRNA comprising an anticodon capable of to pair with a nonsense codon and being specific for an amino acid capable of restoring translation of said mutated thyA gene into the cell, said cell being capable of multiplication in a thymidine-free medium.

The host cell in which the recombinant protein of interest is expressed can be the mutated cell itself or another cell such as a mammalian cell (human, animal, ...) which will be transformed by the plasmid of expression according to the invention. Advantageously, the expression cassette is chosen from eukaryotic expression cassettes for the expression of said recombinant protein of interest in a mammalian host cell or a yeast and the prokaryotic expression cassettes for the expression of said protein. in prokaryotic host cells such as bacterial cells.

The preferred origins of replication are those well known to those skilled in the art which lead to the production of several hundred copies of plasmids per cell. The more preferred origins of replication are of the CoIE1 or pMB1 type or derivatives. In addition to the origin of replication that allows the initiation of replication, the expression plasmid contains a eukaryotic or prokaryotic expression cassette allowing the expression of the protein of interest in an animal cell, a yeast, a bacterium or other. The prokaryotic expression cassettes contain a strong T7 promoter, Tac (hybrid promoter composed of the -35 region of the trp promoter and the lacUV5 promoter / operator -10 region) or lac. They may also contain "His", "glutathione S-transferase" or "MBP = maltose binding protein" labels intended to purify proteins in the form of fusion proteins. A specific site recognized by thrombin-like proteases, TEV or enterokinase, can be introduced between the label protein and the protein of interest to obtain, after digestion of the fusion protein, a native protein.

The eukaryotic expression cassettes generally contain a functional transcription promoting region in the animal cell (or promoter), an enhancer (a short DNA region to which a transcriptional activator may be attached) and a region located in 3 which specifies an end of transcription signal and a polyadenylation site (Garmory et al, 2003). Among the various promoters that may be used include: the "immediate-early" ubiquitous promoter / enhancer of cytomegalovirus CMV. Introduction of intron downstream of the promoter, such as intron A, may increase expression levels by apparently increasing the level of polyadenylation and / or nuclear transport associated with RNA splicing. . In the case of an application in the fields of gene therapy, immune responses related to expression at an aberrant site of the transgene product can be reduced by using specific promoters of certain tissues such as muscle or skin. Among the muscle-specific promoters, there may be mentioned the desmin promoter which controls the expression of the desmin protein specifically located in the muscle filaments. The creatine muscle kinase promoter that is involved in the transfer of the phosphoryl radical of phosphocreatine to ADP to convert it to ATP. Promoters of genes encoding keratinocyte-specific proteins, cells of the superficial layer of the skin, can be used.

The preferred polyadenylation sequences are those of bovine growth hormone, rabbit β-globin or the SV40 polyadenylation sequence optionally in combination with a second SV40 enhancer located downstream of the polyadenylation signal.

The plasmid may further comprise adjuvant sequences such as those recognized by miRNAs (microRNA) for improving the specificity of cellular expression.

The term "recombinant protein of interest" is intended to denote any proteins, polypeptides or peptides which may be used in fields such as that of human or animal health, cosmetology, animal nutrition, agro-industry or of the chemical industry. Advantageously, the recombinant protein of interest is selected from the group consisting of eukaryotic-type proteins such as those of therapeutic interest or those modulating (stimulation / repression) the immune response. In the context of DNA vaccination, the protein of interest will belong to the group consisting of antigenic determinants identified in human or animal pathogens and possibly producing toxins. Examples of recombinant proteins of interest include, but are not limited to, erythropoietin, dystrophin, insulin, anti-TNF alpha, cytokines, coagulation factors such as human factor IX protective antigens such as Bacillus anthracis, Mycobacterium tuberculosis and prostatic membrane specific antigen (PSMA).

Advantageously, the mutated cell according to the invention is characterized in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation of the mutated thyA gene comprising a nonsense codon replacing the codon encoding histidine at position 147 of thymidylate synthase.

Even more advantageously, the mutated cell according to the invention is characterized in that the suppressor tRNA comprises a CUA anticodon capable of associating with the amber nonsense codon UAG.

Preferably, the mutated cell according to the invention is characterized in that the eukaryotic expression cassette comprises a promoter and polyadenylation sequences, said promoter and said sequences being specific for mammalian host cells. More preferably, the promoter is the cytomegalovirus (CMV) promoter and the polyadenylation sequences are of the "bovine growth hormone" (HBV) type.

Also, the expression plasmid contains any element allowing the expression of the suppressor tRNA. Advantageously, the mutated cell according to the invention is characterized in that the suppressor tRNA structural gene sequence is expressed from the strong prokaryotic lpp promoter (Nakamura et al, 1979) and contains its end 3 'the transcription termination sequence of the rrnC operon (Young, 1979), said sequence preferably being oriented divergently with respect to the nucleotide sequence encoding a recombinant protein of interest. This divergent orientation makes it possible to eliminate the risk of expression of suppressor tRNA from the eukaryotic promoter in mammalian or yeast host cells.

More preferably, the mutated cell according to the invention is characterized in that said plasmid is the plasmid pFAR1 (see FIG. 7).

Most preferably, the mutated cell according to the invention is characterized in that said plasmid is the plasmid pFAR4 of sequence SEQ ID No. 21.

Plasmids derived from pFAR4 are also an advantageous embodiment of the invention.

The expression plasmid according to the present invention advantageously has a reduced number of CpG motifs, which are unmethylated sequences composed of at least one adjacent cytosine and guanine. Such motifs are known to be responsible for inflammatory and immune responses, which should be avoided in gene therapy applications. Conversely, an increased immune response is desired in the case of vaccination by administration of DNA encoding an antigen.

DNA vaccines are generally circular plasmids that contain a gene that encodes an antigen under the control of an active promoter region in mammalian cells. The expressed protein is then cleaved into peptides that interact with molecules of the class I histocompatibility complex, to lead to stimulation of CD8 + lymphocytes.

The immune system also recognizes the unmethylated CpG motifs of bacterial and plasmid DNA. The bacterial DNA differs from that of mammals in the frequency of CpG dinucleotides; this is about four times lower in vertebrates. In addition, 80% of the mammalian DNA CpGs are methylated while the bacterial DNA is unmethylated. These differences bring the system immune to recognizing unmethylated CpG motifs as a danger signal indicating infection by a pathogen. Bacterial DNA and CpG-containing oligonucleotides stimulate human and murine leukocytes, inducing B-cell proliferation and immunoglobulin secretion, activation of macrophages and dendritic cells, and lytic activity of NK cells

"Natural Killer" (Chaung, 2006).

The CpG motifs can therefore be considered as DNA-type adjuvants for improving the antigenic response of the DNA vaccine. In the present invention, the CpG motifs have thus been introduced into the plasmid backbone of the pFAR4 expression vector for the DNA vaccination, pFAR4 then encoding an antigen.

The most immunostimulatory CpG motifs consist of hexanucleotides whose sequence is of the purine-purine-CpG-pyrimidine-pyrimidine type (G / A G / A CG T / C

T / C, SEQ ID No. 22). The introduction of these sequences into the pFAR4.0 thus makes it possible to obtain an increased immune response.

Thus, according to a preferred embodiment, the recombinant protein of interest encoded by said plasmid is a protective antigen and the expression plasmid contains at least one additional immunostimulatory CpG motif, advantageously at least two additional immunostimulatory motifs, even more advantageously between 3 and 10 additional immunostimulatory CpG motifs and, most preferably, between 3 and 6 additional immunostimulatory CpG motifs.

By "additional immunostimulatory CpG motif" is meant in the present invention a CpG motif, i.e., an unmethylated sequence consisting of at least one adjacent cytosine and guanine, which is introduced into the plasmid d expression, unlike the CpG motifs already present in said plasmid.

Advantageously, these additional immunostimulatory CpG motifs are introduced upstream of the origin of replication, preferably between the origin of the replication and the suppressor tRNA structural gene sequence. Preferably, the additional immunostimulatory CpG motif contains between 2 and 20 nucleotides, preferably between 3 and 10 nucleotides, more preferably between 4 and 8 nucleotides; most preferably, the additional immunostimulatory CpG motif contains 6 nucleotides.

Preferably, the sequence of the additional immunostimulatory CpG motif is the Purine-Purine-C-G-Pyrimidine-Pyrimidine hexanucleotide sequence (SEQ ID No. 22). More preferably, this sequence is chosen from the sequences SEQ ID Nos. 23 to 38.

According to a particularly preferred embodiment, the expression plasmid according to the invention contains 6 additional immunostimulatory CpG motifs oriented in the same direction 5 '-3' as that of the origin of replication, said motifs being present upstream of the origin of replication, preferably between the origin of replication and the suppressor tRNA sequence, and the sequences of these 6 motifs are chosen from the sequences SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28 , SEQ ID No. 31 and SEQ ID No. 35.

Advantageously, the 6 sequences corresponding to these units are present in the following order: SEQ ID NO: 28, SEQ ID NO: 28, SEQ ID NO: 27, SEQ ID NO: 35, SEQ ID NO: 31 and SEQ ID NO. ° 26 in the 5'-3 'orientation as indicated above. An example of such a plasmid is the plasmid pFAR5 (see point 8 of the Examples section and Figure 10B).

According to another particularly preferred embodiment, the expression plasmid according to the invention contains three additional immunostimulatory CpG motifs directed in the same 5 '-3' direction as that of the origin of replication, said three motifs being present upstream. the origin of replication, preferably between the origin of replication and the suppressor tRNA sequence, and the sequence of these three motifs is

SEQ ID NO: 35. An example of such a plasmid is the plasmid pFAR6 (see point 8 of the Examples section and Figure 10C). Also, the plasmid according to the invention advantageously has a reduced size, a maximum of prokaryotic sequences is eliminated and / or single cloning sites which facilitate the molecular manipulations are introduced.

According to a second aspect, the subject of the present invention is an expression plasmid comprising an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, an expression cassette for the expression of said recombinant protein of interest in a host cell and a suppressor tRNA structural gene sequence, characterized in that said suppressor tRNA comprises an anticodon capable of pairing with a nonsense codon and is specific for an amino acid capable of restoring the translation of the thyA gene in a mutated cell according to the present invention.

Advantageously, the expression cassette is chosen from eukaryotic expression cassettes for the expression of said recombinant protein of interest in a mammalian host cell or a yeast and the prokaryotic expression cassettes for the expression of said protein. in prokaryotic host cells such as bacterial cells.

Preferably, when the mutated cell is E. coli, the non-sense codon replaces a codon encoding an amino acid of thymidylate synthase selected from the group consisting of histidine at position 147, glutamate at position 14 or 223, and arginine at position 35 or 127, phenylalanine at position 30, aspartate at position 81 or

105, glutamine at position 33 and asparagine at position 121. More preferably, the expression plasmid according to the invention is characterized in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation. of the thyA gene having a nonsense codon replacing the codon encoding histidine at position 147 of the thymidylate synthase. Preferably, the suppressor tRNA comprises a CUA anticodon capable of associating with the amber non-sense codon UAG.

Preferably, the mutated cell according to the invention is the E. coli MG1655 thyA # d2 cell deposited at the CNCM on April 5, 2007 under the number 1-3739.

According to a preferred embodiment, the expression plasmid according to the invention is characterized in that the endA gene coding for endonuclease 1 comprises a mutation inducing a better plasmid stability in said mutated cell. More preferably, the mutated cell according to the invention is the E. coli cell MG1655 thyA endA # 1.2.C3 deposited on April 5, 2007 at the CNCM under the number 1-3738.

According to another preferred embodiment, the expression plasmid according to the invention is characterized in that the recA gene encoding a recombinase involved in the recombination of DNA sequences is mutated in order to avoid recombination mechanisms between the bacterial genome and plasmids and between plasmids. Even more preferably, the mutated cell according to the invention is the E. coli MG 1655 thyA endA recA # TMla cell deposited on April 5, 2007 at the CNCM under the number 1-3737.

According to an advantageous embodiment, the expression plasmid according to the invention is characterized in that the eukaryotic expression cassette comprises a promoter and polyadenylation sequences, said promoter and said sequences being specific for mammalian host cells. Preferably, the promoter is the cytomegalo virus (CMV) promoter and the polyadenylation sequences are of the "bovine growth hormone" type (BGH).

According to a particularly advantageous embodiment when the mutated cell is E. coli, the expression plasmid according to the invention is characterized in that the suppressor tRNA structural gene sequence is expressed from the strong prokaryotic type lpp promoter. and contains at its 3 'end the transcription termination sequence of the rrnC operon, said sequence preferably being oriented divergent with respect to the nucleotide sequence encoding a recombinant protein of interest.

More preferably, said expression plasmid is plasmid pFAR1. Most preferably, said expression plasmid is the plasmid pFAR4 of sequence SEQ ID No. 21 or pFAR4 derivatives.

Advantageously, the recombinant protein of interest is selected from the group consisting of eukaryotic type proteins such as those of therapeutic interest or those modulating (stimulation / suppression) the immune response.

In the context of DNA vaccination, the protein of interest will belong to the group consisting of identified antigenic determinants in pathogens of humans or animals, possibly producing toxins. Preferably, the recombinant protein of interest is selected from the group consisting of erythropoietin, dystrophin, insulin, anti-TNFalpha, cytokines, coagulation factors such as human factor IX, protective antigens such as those of Bacillus anthracis, Mycobacterium tuberculosis and Prostate Membrane Specific Antigen (PSMA).

Advantageously, these additional immunostimulatory CpG motifs are introduced upstream of the origin of replication, preferably between the origin of replication and the suppressor tRNA structural gene sequence. Preferably, the additional immunostimulatory CpG motif contains between 2 and 20 nucleotides, preferably between 3 and 10 nucleotides, more preferably between 4 and 8 nucleotides; most preferably, the additional immunostimulatory CpG motif contains 6 nucleotides.

Preferably, the sequence of the additional immunostimulatory CpG motif is the hexanucleotide sequence of the Purine-Purine-C-G-Pyrimidine-Pyrimidine type.

(SEQ ID NO: 22). More preferably, this sequence is chosen from the sequences SEQ ID Nos. 23 to 38.

Advantageously, the 6 sequences corresponding to these units are present in the following order: SEQ ID NO: 28, SEQ ID NO: 28, SEQ ID NO: 27, SEQ ID NO: 35, SEQ ID NO: 31 and SEQ ID NO. ° 26 in the 5'-3 'orientation as indicated above. An example of such a plasmid is the plasmid pFAR5 (see point 8 of the Examples and

Figure 10B).

According to another particularly preferred embodiment, the expression plasmid according to the invention contains three additional immunostimulatory CpG motifs directed in the same 5 '-3' direction as that of the origin of replication, said three motifs being present upstream. the origin of replication, preferably between the origin of replication and the suppressor tRNA sequence, and the sequence of these three motifs is SEQ ID No. 35. An example of such a plasmid is the plasmid pFAR6 (see point 8 of the Examples section and Figure 10C).

According to a third aspect, the subject of the present invention is a method for multiplying an expression plasmid comprising an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, an expression cassette for the expression of said recombinant protein of interest in a host cell and a suppressor tRNA structural gene sequence, said method comprising: - the culture of a mutated cell in which the thyA gene has a nonsense codon, said nonsense codon replacing a codon encoding an amino acid and resulting in a stop of the translation of the thyA gene and the auxotrophy of the mutated cell for thymidine, the introduction expression plasmid in said cell in culture, wherein the suppressor tRNA of the expression plasmid comprises an anticodon capable of pairing with the non-sense codon of the thyA gene and is specific for an amino acid capable of restoring translation said thyA gene in the mutated cell, and extracting the expression plasmid from the cell culture, said culture being performed in a thymidine-free medium e to allow selection of cells transformed with said expression plasmid.

The introduction of the expression plasmid into the mutated cell can be carried out according to any technique known to those skilled in the art. This may include transformation, electroporation, conjugation or any other appropriate technique.

The expression plasmids obtained after multiplication are extracted according to any technique known to those skilled in the art. Preferably, when the mutated cell is E. coli, the non-sense codon replaces a codon encoding an amino acid of thymidylate synthase selected from the group consisting of histidine at position 147, glutamate at position 14 or 223, and arginine at position 35 or 127, phenylalanine at position 30, aspartate at position 81 or 105, glutamine at position 33 and asparagine at position 121. More preferably, the multiplication process according to the invention is characterized in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation of the thyA gene comprising a nonsense codon replacing the codon encoding histidine at position 147 of the thymidylate synthase.

More preferably, the method according to the invention is characterized in that the suppressor tRNA comprises a CUA anticodon capable of associating with the amber non-sense codon UAG.

According to a preferred embodiment, the method according to the invention is characterized in that the endA gene coding for endonuclease 1 comprises a mutation inducing a better plasmid stability in said mutated cell. More preferably, the mutated cell according to the invention is the E. coli cell MG1655 thyA endA # 1.2.C3 deposited on April 5, 2007 at the CNCM under the number 1-3738.

According to another preferred embodiment, the method according to the invention is characterized in that the recA gene encoding a recombinase involved in the recombination of DNA sequences is mutated to avoid recombination mechanisms between the bacterial genome and the plasmids and between the plasmids. Even more preferably, the mutated cell according to the invention is the E. coli cell MG1655 thyA endA recA # TMla deposited on April 5, 2007 at the CNCM under number 1-3737.

According to an advantageous embodiment, the method according to the invention is characterized in that the eukaryotic expression cassette comprises a promoter and sequences polyadenylation, said promoter and said sequences being specific for mammalian cells. Preferably, the promoter is the cytomegalovirus (CMV) promoter and the polyadenylation sequences are of the "bovine growth hormone" type (BGH).

According to a particularly advantageous embodiment, the method according to the invention is characterized in that, when the mutated cell is E. coli, the suppressor ARM structural gene sequence is expressed from the strong lpp promoter of prokaryotic type and contains at its 3 'end the transcription termination sequence of the rrnC operon, said sequence preferably being oriented divergently with respect to the nucleotide sequence encoding a recombinant protein of interest.

More preferably, the method according to the invention is characterized in that said plasmid is the plasmid pFAR1.

Most preferably, the method according to the invention is characterized in that said plasmid is the plasmid pFAR4 of sequence SEQ ID No. 21 or plasmids derived from pFAR4.

Advantageously, the recombinant protein of interest is selected from the group consisting of eukaryotic type proteins such as those of therapeutic interest or those modulating (stimulation / suppression) the immune response. In the context of DNA vaccination, the protein of interest will belong to the group consisting of identified antigenic determinants in pathogens of humans or animals. Preferably, the recombinant protein of interest is selected from the group consisting of erythropoietin, dystrophin, insulin, anti-TNFalpha, cytokines, coagulation factors such as human factor IX, protective antigens such as those of Bacillus anthracis, Mycobacterium tuberculosis and Prostate Membrane Specific Antigen (PSMA).

According to a fourth aspect, the subject of the present invention is a method for producing a recombinant protein of interest comprising: the multiplication of an expression plasmid according to the multiplication method according to the present invention and described above, the transformation of a host cell by the expression plasmid obtained in the preceding step, the culture of said cell host transformed in a culture medium allowing the expression of the recombinant protein of interest, and the purification of the recombinant protein of interest from the culture medium or the transformed host cell.

According to a fifth aspect, the subject of the present invention is a pharmaceutical composition comprising the expression plasmid according to the invention, the protein of interest of which is chosen from the group consisting of eukaryotic-type proteins such as those presenting a therapeutic interest. or those modulating (stimulating / suppressing) the immune response. In the context of DNA vaccination, the protein of interest will belong to the group consisting of identified antigenic determinants in pathogens of humans or animals and possibly producing toxins. Preferably, the recombinant protein of interest is selected from the group consisting of erythropoietin, dystrophin, insulin, anti-TNFalpha, cytokines, coagulation factors such as human factor IX, protective antigens such as those of Bacillus anthracis, Mycobacterium tuberculosis and Prostate Membrane Specific Antigen (PSMA).

The expression plasmid may be associated with a chemical and / or biochemical transfection vector. It may be in particular cations (calcium phosphate, DEAE-dextran, ...), liposomes. The synthetic vectors associated may be lipids or cationic polymers.

The pharmaceutical compositions according to the invention can be formulated for administration by the topical, oral, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. routes. Preferably, the expression plasmid is used in injectable form or in application. It can be mixed with any pharmaceutically acceptable vehicle for a formulation injectable, in particular for direct injection into the tissue to be treated. It may be in particular sterile, isotonic solutions. The administration of the plasmid can also be promoted by means of a physical method such as the use of electric fields, an electric current, ultrasound, hydrostatic pressure according to the hydrodynamic method. Direct injection into the affected area of the patient is interesting because it allows the therapeutic effect to be concentrated at the level of the affected tissues. Examples of tissues in which the plasmid can be injected include muscle, liver, eye or skin and also tumors. The doses used can be adapted according to different parameters, and in particular according to the gene, the mode of administration, the pathology concerned or the duration of the desired treatment.

According to another aspect, the subject of the present invention is the use of the expression plasmid according to the invention for transfection in vitro or ex vivo in a host cell of the nucleotide sequence encoding a recombinant protein of interest.

According to another aspect, the subject of the present invention is an expression plasmid according to the invention, the recombinant protein of interest of which is chosen from the group consisting of eukaryotic proteins such as those of therapeutic interest or those modulating ( stimulation / suppression) the immune response, for use as a drug or as a vaccine. In the context of DNA vaccination, the protein of interest will belong to the group consisting of identified antigenic determinants in pathogens of humans or animals and possibly producing toxins. Preferably, the recombinant protein of interest is selected from the group consisting of erythropoietin, dystrophin, insulin, anti-TNF alpha, cytokines, coagulation factors such as human factor IX, antigens protectors such as those of Bacillus anthracis, Mycobacterium tuberculosis and Prostate Membrane Specific Antigen (PSMA).

The present invention also relates to the use of the expression plasmid according to the present invention for the treatment and / or the prevention of numerous pathologies, including genetic diseases, neurodegenerative diseases (Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, ...), cancers, diseases related to viral infections (AIDS, hepatitis, ...). Finally, the present invention relates to a method of treating a pathology such as those mentioned above comprising the administration of the expression plasmid according to the present invention to patients in need of such treatment.

According to a last aspect, the subject of the present invention is the use of the expression plasmid according to the present invention or of the mutated cell containing the expression plasmid for the production of recombinant proteins of interest.

For the practice of the present invention, many conventional techniques are used in molecular biology, microbiology and genetic engineering. These techniques are well known and are explained, for example, in Current Protocols in Molecular Biology, Volumes I, II and III, 1997 (FM Ausubel, eds); Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 2 ^nd edition, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY; DNA Cloning: A Practical Approach, Volumes I and II, 1985 (D. Glover, eds.); Oligonucleotide Synthesis, 1984 (MX, Gait, eds.); Nucleic Acid Hybridization, 1985 (Hames and Higgins); Transcription and Translation, 1984 (Hames and Higgins, eds.); Animal CeIl Culture,

1986 (R.I. Freshney, eds.); Immobilized Cells and Enzymes, 1986 (IRL Press); Perbal, 1984, A Pratical Guide to Molecular Cloning; the series, Methods in Enzymology (Academy Press, Inc.); Gene Transfer Vectors for Mammalian Cells, 1987 (J. H. Miller and M. P. Calos, eds., CoId Spring Harbor Laboratory); and Methods in Enzymology Vol. 154 and Col. 155 (Wu and Grossmann, and Wu, ed., Respectively).

The present invention will be more fully described with the aid of the following examples, which should be considered as illustrative and not limiting. LEGEND OF FIGURES

Figure 1: Descriptive diagram of the strategy used for the selection of plasmids lacking antibiotic resistance genes. Introduction of an amber stop codon into the essential gene leads to premature termination of protein synthesis and auxotrophy of the mutant. A modification of the t-RNA anticodon loaded with the preferred amino acid allows codon and anticodon pairing, complete synthesis of the protein and restoration of normal mutant growth. Figure 2: The mutated essential gene is the thyA gene which encodes a thymidylate synthase, an enzyme involved in the synthesis of thymidine monophosphate, which are precursors used in DNA synthesis. A mutation in the thyA gene generates an auxotrophy of the mutant for thymidine. The isolation of the mutant is therefore performed by replacing the culture medium with thymidine. The exogenous thymidine enters the cells via the nucleoside transporter and then is transformed into dTMP by thymidine kinase.

Figure 3: Construction of bacterial mutants: The insertion of the mutated genes into the Escherichia coli genome is carried out in two stages. The pST76-C plasmid derivatives are first introduced by transformation by culturing the transformants at 30 ^° C. in the presence of chloramphenicol (Cm). The first recombination event leading to plasmid integration is selected by culturing the bacteria at 43 ° C in the presence of chloramphenicol. A second recombination event will result in a single allele, either mutated or wild. The mutant strains will be screened by performing colony PCRs. Figure 4: Construction of the thyA mutant.

Figure 5: Construction of the mutant endA. Figure 6: Construction of the recA mutant. Figure 7: Construction of plasmids pFAR1 and pFAR1-LUC Figure 8: Map of plasmid pFAR4: Plasmid pFAR4 is a synthetic plasmid. The Multiple Cloning Site (MCS) sequence contains more than 20 unique restriction sites. This plasmid will therefore be used as a base vector to construct a number of derivatives containing different types of eukaryotic secretion and expression (ubiquitous or tissue-specific promoter in combination with different polyadenylation sequences).

Figure 9: Quantification of luciferase activity in the cranial tibial muscle of mice.

At different times after injection of plasmids pVAX2-LUC and pF AR1-LUC into the cranial tibial muscle of mice, the substrate of the enzyme, luciferin was administered intramuscularly. The enzymatic activity was recorded using a Photolmager camera of Bioespaces Measures. Figure A shows the activities obtained, over time, on a logarithmic scale. Figure B shows the luciferase activity obtained, in linear representation, 18 days after the injection of the plasmids.

Figure 10A: Plasmid map pFAR4 with visualization of CpG motifs.

Figure 10B: Plasmid map pFAR5 with visualization of additional CpG motifs (CpG region) and CpG motifs already present (see Figure 10A).

Figure 10C: Plasmid map pFAR6 with visualization of additional CpG motifs (CpG region) and CpG motifs already present (see Figure 10A).

In FIGS. 10A, 10B and 10C, the numbers 1 to 16 correspond to the different CpG motifs present on the two strands of DNA, the sequences of which are as follows:

# 1 AACGTT (SEQ ID NO: 23)

# 2 AACGCC (SEQ ID NO: 24) # 3 AACGTC (SEQ ID NO: 25) # 4 AACGCT (SEQ ID NO: 26) # 5 GGCGTT (SEQ ID NO: 27) # 6 GGCGCC (SEQ ID NO: 28) # 7 GGCGTC (SEQ ID NO: 29) # 8 GGCGCT (SEQ ID NO: 30) # 9 AGCGTT (SEQ ID NO: 31)

# 10 AGCGCC (SEQ ID NO: 32)

# 11 AGCGTC (SEQ ID NO: 33)

# 12 AGCGCT (SEQ ID NO: 34) # 13 GACGTT (SEQ ID NO: 35) # 14 GACGCC (SEQ ID NO: 36) # 15 GACGTC (SEQ ID NO: 37) # 16: GACGCT (SEQ ID NO: 38)

EXAMPLES

1. Construction of bacterial mutants

The thyA mutant was generated from Escherichia coli strain MG 1655 (obtained from The Coli Genetic Stock Center, USA). The genome of this strain has been entirely sequenced (Blattner et al, 1997). The protocol followed to isolate E mutants. coli is based on that described by Pôsfai et al (1997 and 1999). The mutated genes are cloned into a vector, pST76-C, which confers resistance to chloramphenicol and whose replication is thermally sensitive. It is permissive at 30 ^° C. but not effective between 37 ° and 43 ° C. The plasmids are therefore first introduced into the bacteria by transformation by selecting the bacteria at 30 ^° C. in the presence of chloramphenicol. In order to select the strains in which the plasmid integrated after a first recombination event, the bacteria are cultured at 43 ^° C. in the presence of chloramphenicol (see FIG. Resolution of cointegrates is a rare event in E. coli (Pôsfai et al, 1999). To circumvent this problem, the plasmid pST76-ASceP was introduced into the integrants. This plasmid carries a gene encoding a meganuclease, which is an endonuclease that causes double-strand breaks at the l-SceI site. The genome of the wild strain MG1655 is devoid of this site. This site is inserted into the bacterial genome after integration of the derivatives of plasmid pST76-C which has an I-SceI site. In the presence of meganuclease, only strains that have lost the l-SceI site, following intramolecular recombination, grow (see Figure 3). The replication of plasmid pST76-ASceP is thermosensitive. It can therefore easily be cured mutant strains by growing the bacteria at 43 ° C. at. Construction of the thyA mutant

To isolate the mutant strain, a 2 kb region comprising the thyA gene was amplified by PCR using Ex-Taq polymerase (commercialized by Takara), genomic DNA prepared from strain MG 1655 and ThyA primers. -F and ThyA-R (SEQ ID No. 1 and 2) (see Figure 4). These primers were designed so that the mutation is at the center of the 2kb fragment. After cloning the PCR fragment into the vector pCR2.1 (commercialized by INVITROGEN) and sequencing, the amber nonsense mutation UAG (TAG) was introduced at histidine 147. The site-directed mutagenesis was performed using the primers ThyA-Hisl47-F and ThyA-Hisl47-R (SEQ ID Nos. 3 and 4) and the QuikChange® II Site-Directed kit

Mutagenesis Kit marketed by Stratagene.

After sequencing the insert to verify that the 2kb fragment contains only the desired mutation, the plasmids pCR2.1 region thyA * and pST76-C (Posfai et al., 1997) were fused after being digested, respectively by EcoRV and Smal. In order to eliminate the origin of pUC ori replication, the sequence corresponding to the pCR2.1 vector was deleted by digesting the plasmid pCR2.1 thyA * pST76-C region with BamHI. The mutated thyA fragment is therefore carried by the plasmid pST76-C thyA * region whose replication is thermosensitive. This plasmid was introduced by transformation into strain MG 1655 and then the first recombination event was selected by culturing the bacteria at 43 ° C in the presence of chloramphenicol. The bacterial genome now contains two copies of the thyA gene: a wild-type allele and a mutated allele. The second recombination event was selected by introducing into the integrants the plasmid pST76-SceP which encodes the meganuclease. Auxotrophic strains for thymidine and chloramphenicol sensitive were selected for further analysis. This consists in amplifying the region containing the thyA gene by PCR using the primers ThyA-Igt-F1 and ThyA-seq1 (SEQ ID Nos. 5 and 6) and then sequencing the amplicon obtained in order to verify that the thyA gene is present. contains only the amber mutation. The thyA mutant was removed from plasmid pST76-ASceP by culturing the strains at 43 ° C. This event was confirmed by verifying the loss of ampicillin resistance conferred by plasmid pST76A-SceP. b. Construction of the double mutant thyA - endA

Although the plasmids produced from the thyA mutant grown in a rich medium have purity comparable to that obtained using other strains, in chemically defined media the quality of the plasmids produced is less. Studies have shown that a mutation in the endA gene, which encodes endonuclease 1, can circumvent this problem (Schoenfeld et al, 1995).

In order to obtain the thyA-endA double mutant, two 1 kb PCR fragments located upstream and downstream of the endA gene were amplified using the EndA-F1 / R1 (SEQ ID NO: 7 and 8) and EndA- F2 / R2 (SEQ ID Nos. 9 and 10), genomic DNA prepared from strain MG 1655 and Ex-Taq polymerase (marketed by Takara).

These fragments were cloned in the pCR2.1 vector and then sequenced (see FIG. 5). The regions situated upstream and downstream of the endA gene were fused after digestion of the plasmids pCR2.1 yggl and pCR2.1 rsmE by respectively Smal / XbaI and SmaI / SpeI. The plasmid pCR2.1 delta endA was then digested with Apal, treated with Klenow, and then ligated to the plasmid pST76-C digested with SmaI. The plasmid pCR2.1 delta endA pST76-C produced was digested with BamHI and then ligated in order to eliminate the origin of replication pUC ori. The deleted region of the endA gene was introduced into the genome of the thyA mutant using a strategy similar to that described above. The endA mutant strains were screened by colony PCR using the EndA-seq1 and EndA-seq5 primers (SEQ ID NO ^: 1) and

12). The PCR fragment obtained was sequenced to verify that the integration took place at the locus and did not generate a mutation in the genes located downstream and upstream of the endA gene.

vs. Construction of the triple mutant thyA - endA - recA

In order to avoid possible recombination mechanisms between the bacterial genome and the plasmids and between the plasmids introduced into the thyA mutant, the recA gene which encodes a recombinase has also been deleted. To construct the thyA - endA - recA triple mutant, a strategy similar to that previously described was used. PCR fragments located upstream and downstream of the recA gene were generated using the primers RecA-Fl / Rl (SEQ ID N ⁰ 13 and 14) and RecA-F2 / R2 (SEQ ID N ⁰ 15 and 16), the Ex-Taq polymerase (Takara) and genomic DNA prepared from the strain MG1655 (see Figure 6). After sequencing the inserts, the PCR fragments were ligated after digestion of the plasmids pCR2.1 ygaD and pCR2.1 recX with respectively Smal / XbaI and SmaI / SpeI enzymes. The plasmid pCR2.1 delta recA obtained was digested with XbaI, treated with Klenow, and fused with plasmid pST76-C digested with SmaI, to lead to the formation of plasmid pCR2.1 delta recA pST76-

C. The latter was digested with BamHI and then religated to retain only the heat-sensitive origin of replication. The mutation was introduced into the bacterial genome using the same protocol as before. Selection of the triple mutant was performed by performing colony PCRs using the RecA-seq1 and RecA-R primers (SEQ ID NOS: 17 and 18). The amplicon was sequenced to confirm that the integration was performed at the locus and did not generate any other mutations.

2. Construction of the plasmid pFAR1 (Free of Antibiotic Resistance)

Plasmid pFAR1 was constructed by introducing the histidine suppressor tRNA into pVAX2 (see Figure 7). pVAX2 is a derivative of the plasmid pVAX1 (sold by INVITROGEN) in which the CMV promoter of the plasmid pCMVβ (Clontech) was introduced (Pascal Bigey and Daniel Scherman). The histidine suppressor tRNA is expressed from the strong prokaryotic promoter lpp (Nakamura et al, 1979). In the bacterial genome, this promoter is located upstream of the lpp gene which encodes a lipoprotein. The 3 'end of the suppressor tRNA contains the transcription termination sequence of the rrnC operon (Young, 1979). This cassette was amplified from the plasmid pHis (AS) (obtained from The CoIi Genetic Stock Center, USA) using primers Nco-sup-F and Nco-sup-Rev (SEQ ID N ⁰ 19 and 20). ) and cloned into BspHI-digested pVAX2. The plasmid carrying the suppressor tRNA oriented divergently with respect to the eukaryotic gene was chosen to eliminate the risk of suppressor tRNA expression from the CMV eukaryotic promoter in animal cells. The gene conferring resistance to kanamycin was then deleted by digesting plasmid pVAX2-ARNsup His by the enzymes HindIII (followed by treatment with klenow) and Pvull. This plasmid was designated pFAR1 (Free of Antibiotic Resistance). 3. Validation of the strategy

In order to validate the strategy implemented, the plasmid pFAR1 was introduced by transformation into the thyA mutant. Transformants can be selected on any medium lacking thymidine. It may be a minimum medium of the type M9 (Sambrook et al., 1989) or rich such as that of Mueller Hinton (MH). The latter contains meat infusate (2 g / l), casein hydrolyzate 17.5 g / l, starch 1.5 g / l and possibly agar. This medium has the advantage of being commercially available (Ex: from the company Fluka), to be a rich medium but containing very low or no amounts of thymidine. On this medium, the thyA mutant does not grow. In contrast, strains containing plasmids pFAR have normal growth.

Plasmids pVAX2 and pFAR1 were purified in parallel from the thyA mutant grown in MH medium. Similar yields were obtained. These results made it possible to validate the newly invented combination: amber mutation in the thyA / histidine suppressor tRNA gene carried by the plasmid.

4. In vivo test of luciferase activity

In order to determine whether the pFAR plasmids can be used in vivo, the LUC gene that encodes the luciferase reporter protein was cloned into the plasmid pFAR1. To do this, the pVAX2-LUC plasmid was digested with the BamR1 and XhoI restriction enzymes and then the eukaryotic expression cassette was cloned into the pFAR1 digested with the same enzymes. 3 μg of plasmids pVAX2-LUC and pF AR1-LUC (in 30 μl of physiological saline) were injected then electrotransfers into the cranial tibial muscle of the mouse by making 8 pulses of 20 ms at 200 V / cm, at the frequency of

2 Hz. The luciferase substrate, luciferin, was then injected intramusclarly at a concentration of 100 μg in a volume of 40 μl. Luciferase activity was recorded at different times after plasmid injection using a Photolmager camera from Biospace Measurements (see Figure 9).

These results show that the luciferase activity obtained after injection of the plasmid pFAR1-LUC is similar, and in some cases and, surprisingly, greater than that obtained after transfection of the cells with the plasmid pVAX2-LUC. The newly constructed expression vector therefore has no disadvantage for in vivo testing, thereby conferring an additional advantage on pFAR-like plasmids.

5. Optimization of pFAR Plasmids

These promising results led the inventors to optimize the plasmid pFAR1, in order to reduce its size, eliminate the maximum of prokaryotic sequences and introduce unique cloning sites that facilitate molecular manipulations.

Indeed, prokaryotic sequences are rich in CpG motifs that can induce inflammatory and immune responses, which should be avoided for gene therapy applications.

The optimized plasmid is called pFAR4 (see Figure 8). The production of this plasmid from the thyA mutant grown in Mueller Hinton medium has the same properties (yield, purity) as pVAX2.

6. Validation of pFAR4 derivatives

Two types of experiments are carried out in order to validate the plasmid pFAR4 for in vivo experiments: the CMV-LUC-BGH expression cassette is introduced into the plasmid pFAR4. Plasmids pVAX2-LUC, pF AR1-LUC and pFAR4-CMV LUC BGH are injected into the cranial tibial muscle of the mouse. Luciferase activities are determined at different times after injection and compared. The comparison of the immune response induced after injection of these three plasmids is carried out. the gene encoding murine erythropoietin expressed from the CMV (cytomegamovirus) or MCK (muscle creatine kinase) ubiquitous promoter is cloned into pFAR4 to determine if this plasmid can also be used in a gene therapy context. 7. Construction of pFAR4 derivatives

In order to construct a plasmid platform, the following derivatives of pFAR4 are constructed (see FIG. 8): pFAR4.1: pFAR4 derivative containing the CMV (cytomegalovirus) ubiquitous promoter pFAR4.2: pFAR4 derivative containing the promoter ubiquitous CMV and the BGH polyadenylation sequence pFAR4.3: pFAR4 derivative containing the CMV ubiquitous promoter and the SV40 - pFAR4.4 polyadenylation sequence: pFAR4 derivative containing the muscle specific promoter

MCK.

8. Optimization of plasmid pFAR4 for DNA vaccination

Unlike the application proposed in the previous point 5 (gene therapy - administration of a therapeutic gene), an increased immune response is desired in the case of vaccination by administration of DNA encoding an antigen. For this purpose, the inventors introduced immunostimulatory CpG motifs into the plasmid pFAR4. These CpG motifs constitute immune adjuvants when the plasmid pFAR4 encodes an antigen.

Two derivatives of plasmid pFAR4, the plasmids pFAR5 (FIG. 10B) and pFAR6 (FIG. 10C), were constructed. They contain different combinations of CpG patterns. Plasmid pFAR5 contains on the 5 '-3' oriented DNA strand the following six CpG motifs:

Two GGCGCC motifs (SEQ ID No. 28),

- 1 GGCGTT motif (SEQ ID No. 27),

1 GACGTT motif (SEQ ID No. 35), 1 AGCGTT motif (SEQ ID No. 31), and

- 1 AACGCT motif (SEQ ID No. 26). These six motifs are initially those contained in the gene that confers resistance to kanamycin.

Plasmid pFAR6 contains on the DNA strand oriented 5-3 'three times the CpG motif whose sequence is GACGTT (SEQ ID NO: 35). This sequence represents the optimal motif for immunostimulation in mice (Bauer et al, 2006).

Conclusion A new mutant strain combination of E. coli I plasmid without antibiotic resistance genes was obtained. The present invention makes it possible to select the bacteria transformed by the plasmid of interest by using a rich medium and to obtain a good yield by using standard purification techniques. The minimum medium of type M9 can be used. A rich medium that the Inventors have identified is that of Mueller Hinton. It is marketed, cheap and does not require laborious preparation. In vivo, the plasmid pFAR1 has no disadvantage in comparison with the currently used expression vectors. The inventors have observed, in some cases and surprisingly, a stronger expression with the plasmid pFAR than with a plasmid known to those skilled in the art. PFAR1 was optimized and led to plasmid pFAR4.

After validation and cloning of therapeutic or antigen-encoding genes, the pFAR4 derivatives will have many applications in the field of gene therapy, DNA vaccination and the production of recombinant proteins.

List of primers used

Primer Name Primer Sequences (5 '- 3') Position SEQ ID N ThyA-F CATGCGGTATTGCGCAGGC 2961838 1

ThyA-R CGCTGTATCTGTTCCGTGTCT 2963794 2

ThyA - Hisl47-F CGCTGGCACCGTGCTAGGCATTCTTCCAGTTC 2962753 3

ThyA - Hisl47-R GAACTGGAAGAATGCCTAGCACGGTGCCAGCG 2962722 4

ThyA - lgt-FI GATTCGCGGAGGGTTATAGCG 2964228 5 ThyA - seql GCAGCCAGATTTCATCTTCC 2961579 6

EndA-Fl GTCGGTTTTGCCATGAGTGC 3087383 7

EndA-Rl tacccgggTAGACAAATAACGGTACATCAC 3088387 8

EndA-F2 ttcccgggAGAGCTAACCTACACTAGCG 3089069 9

EndA-R2 CCACTCTTCGTAGTTCTGCT 3090097 10 EndA - seql TGCCACCTTTATCGCAATCG 3087211 11

EndA - seq5 CTCTTCGGCACGTTCCAGA 3090220 12

RecA-Fl GTAATGGCAAACGGTCAGGC 2822782 13

RecA-Rl gatcccgggGTCGATAGCCATTTTTACTCC 2821780 14

RecA-F2 catcccgggGAAGGCGTAGCAGAAACTAAC 2820762 15 RecA-R2 GTCGCCGAAGCTGAAGTTG 2819731 16

RecA - seql TATGAAGATGCGTTGAATCG 2823190 17

RecA - R GGTAACCCACAGACGCTCT 2819641 18

Nco-sup-FgtccatggCTGGCGCCGCTTCTTTGAGC 19

Nco sup-Rev ccccatggACGACGGCCAGTGCCAAGC 20

Sequences of primers used to generate bacterial mutants or pFAR plasmids. The figure in the penultimate column indicates the position of the primers in the genome of strain MG1655 (accession number: U00096). To facilitate the cloning steps, restriction sites and additional nucleotides were introduced at the ends of the primers (indicated in lower case). BIBLIOGRAPHIC REFERENCES

Bauer et al., 2001, Human TLR9 confers responsiveness to bacterial DNA via species- specifies CpG motif recognition, PNAS, vol. 98, No. 16, 9237-9242.

Blattner et al, 1997. The complete genome sequence of Escherichia coli K-12.

Science 277: 1453-1474.

Bradley et al, 1981. tRNA ^Gln Su + 2 mutants that increase amber suppression. J.

Bacteriol. 145 (2): 704-712. Chaung, 2006, CpG oligodeoxynucleotides as DNA adjuvants in vertebrates and their applications in immunotherapy, International Immunopharmacology 6 (2006), 1586-

1596.

Chen et al., 2005. Improved production and purification of plasmid bacterial sequences and the ability of persistent transgene expression in vivo. Hum Gene Ther. 16 (1): 126-131.

Chen et al, 2003. Minicircle DNA vectors devoid of bacterial DNA in vivo and high-level transgene expression in vivo. Mol Ther. 8 (3): 495-500.

Cranenburgh et al., 2004. Effect of plasmid copy and operator sequence on antibiotic-free plasmid selection by operator-repressor titration in Escherichia coli. J Mol Microbiol Biotechnol. 7 (4): 197-203.

Cranenburgh et al., 2001. Escherichia coli strains that allow antibiotic-free plasmid selection and maintenance by repressor titration. Nucleic Acids Res. 29 (5): E26

Garmory et al, 2003. DNA vaccines: improving expression of antigens. Broom

Vaccines Ther. 1: 2. Kleina et al., 1990. Construction of Escherichia coli amber suppressor tRNA genes. HE

Synthesis of additional tRNA genes and improvement of suppressor efficiency. J. Mol.

Biol. 213: 705-717.

Kreiss et al, 1998. Production of a new DNA vehicle for gene transfer using site-specific recombination. Appl Microbiol Biotechnol. 49 (5): 560-567. Nakamura et al, 1979. DNA sequence of the gene for the outer lipoprotein membrane of E. coli: an extremely AT-rich promoter. This is 18: 1109-1117. Normanly et al, 1990. Construction of Escherichia coli amber suppressor tRNA genes. III. Determination of tRNA specificity. J. Mol. Biol. 213: 719-726. Normanly et al, 1986. Construction of two Escherichia coli amber suppressor genes: tRNA ^phe ' ^CUA , and tRNA ^Cys ' ^CUA . Proc. Natl. Acad. Sci USA. 83: 6548-6552. Pôsfai et al., 1999. Markerless gene replacement in Escherichia coli stimulated by a double-strand break in the chromosome. Nucleic Acid Res. 27: 4409-4415. Pôsfai et al., 1997. Versatile plasmid insertion for targeted genome manipulations in bacteria: Isolation, deletion, and rescue of the LEE pathogenicity of the Escherichia coli O157: H7 genome. J. Bacteriol. 179 (13): 4426-4428. Sambrook et al., 1989. Molecular cloning. A laboratory manual. Second Edition.

Sambrook, Fritsch, Maniatis, COI Spring Harbor Laboratory Press. Schoenfeld et al., 1995. Effects of bacterial strains carrying the endogenous genotype on DNA quality with Wizard (TM) plasmid purification systems. Promega Notes Magazine 53: 12. Young, 1979. Transcription Termination in the Escherichia coli ribosomal RNA operon rrnC. J. Biol. Chem 254 (24): 12725-12731.

Claims

A mutated cell in which the thyA gene encoding thymidylate synthase (thyA) has a nonsense codon, said nonsense codon replacing a codon encoding an amino acid and resulting in a stop of translation of the thyA gene and auxotrophy of said cell for thymidine.

2. mutated cell according to claim 1, characterized in that it is selected from bacteria and yeasts.

3. The mutated cell according to claim 2, characterized in that said cell is an Escherichia coli (E. coli) bacterium.

4. mutated cell according to claim 3, characterized in that the non-sense codon replaces a codon encoding an amino acid of the thymidylate synthase selected from the group consisting of histidine at position 147, glutamate at position 14 or 223, and arginine at position 35 or 127, phenylalanine at position 30, aspartate at position 81 or 105, glutamine at position 33 and asparagine at position 121.

5. mutated cell according to claim 4, characterized in that the non-sense codon replaces the codon encoding histidine at position 147 of the thymidylate synthase.

6. mutated cell according to one of claims 1 to 5, characterized in that the non-sense codon is the amber codon UAG.

7. The mutated cell according to claim 6, characterized in that said cell is the E. coli MG 1655 thyA # d2 cell deposited at the CNCM on April 5, 2007 under the number I-3739.

8. mutated cell according to one of claims 1 to 7, wherein the endA encoding endonuclease 1 gene comprises a mutation inducing a better plasmid stability in said mutated cell.

9. The mutated cell according to claim 8, characterized in that said cell is the E. coli MG1655 thyA endA # 1.2.C3 cell filed April 5, 2007 at the CNCM under the number 1-3738.

10. The mutated cell according to one of claims 1 to 9, wherein the recA gene encoding a recombinase involved in the recombination of DNA sequences is mutated to avoid recombination mechanisms between the bacterial genome and the plasmids and between the plasmids. .

11. mutated cell according to claim 10, characterized in that said cell is the cell E. coli MG 1655 thyA endA recA # TMla filed April 5, 2007 at the CNCM under the number 1-3737.

12. mutated cell according to one of claims 1 to 11 transformed by an expression plasmid, characterized in that said expression plasmid comprises: - an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, a an expression cassette for expression of said recombinant protein of interest in a host cell, and

a suppressor tRNA structural gene sequence, said suppressor tRNA comprising an anticodon capable of pairing with a nonsense codon and being specific for an amino acid capable of restoring the translation of said mutated thyA gene into the cell, said cell being able to multiply in a thymidine-free medium.

13. The mutated cell according to claim 12 transformed by an expression plasmid, characterized in that the expression cassette is chosen from eukaryotic expression cassettes for the expression of said recombinant protein of interest. in a mammalian host cell or yeast and prokaryotic expression cassettes for expression of said protein in prokaryotic host cells such as bacterial cells.

Mutated cell according to claim 12 or 13, characterized in that said cell is the E. coli cell and in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation of the mutated thyA gene comprising a codon nonsense replacing the codon encoding histidine at position 147 of the thymidylate synthase.

15. The mutated cell according to one of claims 12 to 14, characterized in that the suppressor tRNA comprises a CUA anticodon capable of pairing with the amber non-sense codon UAG.

16. The mutated cell according to one of claims 13 to 15, characterized in that the eukaryotic expression cassette comprises a promoter and polyadenylation sequences, said promoter and said sequences being specific mammalian host cells.

17. The mutated cell according to claim 16, characterized in that the promoter is the cytomegalo virus (CMV) promoter and the polyadenylation sequences are of the "bovine growth hormone" (HBV) type.

18. The mutated cell according to one of claims 12 to 17, characterized in that said cell is the E. coli cell and in that the suppressor tRNA structural gene sequence is expressed from the strong prokaryotic type lpp promoter. and contains at its 3 'end the transcription termination sequence of the rrnC operon, said sequence preferably being oriented divergently with respect to the nucleotide sequence encoding a recombinant protein of interest.

19. The mutated cell according to claim 18, characterized in that said plasmid is the plasmid pFAR4 of sequence SEQ ID No. 21.

An expression plasmid comprising an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, an expression cassette for the expression of said recombinant protein of interest in a host cell and a structural gene sequence. Suppressor tRNA, characterized in that said suppressor tRNA comprises an anticodon capable of pairing with a nonsense codon and is specific for an amino acid capable of restoring the translation of the thyA gene into a mutated cell according to one of the claims 1 to 11.

21. Expression plasmid according to claim 20, characterized in that the expression cassette is chosen from eukaryotic expression cassettes for the expression of said recombinant protein of interest in a mammalian host cell or a yeast and prokaryotic expression cassettes for expression of said protein in prokaryotic host cells such as bacterial cells.

22. Expression plasmid according to claim 20 or 21, characterized in that the mutated cell is an E. coli cell and in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation of the mutated thyA gene. having a nonsense codon replacing the codon encoding histidine at position 147 of the thymidylate synthase.

23. Expression plasmid according to one of claims 20 to 22, characterized in that the suppressor tRNA comprises a CUA anticodon capable of associating with the amber non-sense codon UAG.

24. The expression plasmid according to one of claims 21 to 23, characterized in that the eukaryotic expression cassette comprises a promoter and polyadenylation sequences, said promoter and said sequences being specific mammalian host cells.

25. Expression plasmid according to claim 24, characterized in that the promoter is the cytomegalovirus (CMV) promoter and the polyadenylation sequences are of the "bovine growth hormone" type (BGH).

26. The expression plasmid according to one of claims 20 to 25, characterized in that the mutated cell is an E. coli cell and in that the suppressor ARM structural gene sequence is expressed from the strong promoter lpp. of the prokaryotic type and further contains at its 3 'end the transcription termination sequence of the rrnC operon, said sequence preferably being oriented divergently with respect to the nucleotide sequence encoding a recombinant protein of interest.

27. The expression plasmid according to claim 26, characterized in that said expression plasmid is the plasmid pFAR4 of sequence SEQ ID No. 21.

28. The expression plasmid according to one of claims 20 to 27, characterized in that the recombinant protein of interest is selected from the group consisting of erythropoietin, dystrophin, insulin, anti-TNFalpha, cytokines, clotting factors such as human factor IX, protective antigens such as Bacillus anthracis, Mycobacterium tuberculosis, and prostate membrane specific antigen (PSMA).

29. Expression plasmid according to one of claims 20 to 28, characterized in that the recombinant protein of interest is a protective antigen and said plasmid contains: or six additional immunostimulatory CpG motifs oriented in the same direction 5 '-3 that of the origin of replication and located upstream of the origin of replication, between the origin of replication and the suppressor tRNA sequence, the sequences of these six motifs being as follows in the 5 '- orientation. 3 ':

SEQ ID NO: 28, SEQ ID NO: 28, SEQ ID NO: 27, SEQ ID NO: 35, SEQ ID NO: 31 and SEQ ID NO: 26; or three additional immunostimulatory CpG motifs oriented in the same direction 5 '-3' as that of the origin of replication and located upstream of the origin of replication, between the origin of replication and the suppressor tRNA sequence, said three motifs all having the same sequence SEQ ID No. 35.

30. A method of multiplying an expression plasmid comprising an origin of replication, a nucleotide sequence encoding a recombinant protein of interest, an expression cassette for the expression of said recombinant protein of interest in a host cell, and a suppressor ARM structural gene sequence, said method comprising:

the culture of a mutated cell in which the thyA gene comprises a non-sense codon, said non-sense codon replacing a codon encoding an amino acid and resulting in a stop of the translation of the thyA gene and the auxotrophy of the mutated cell for the thymidine, - the introduction of the expression plasmid into said cell in culture, wherein the suppressor tRNA of the expression plasmid comprises an anticodon capable of pairing with the nonsense codon of the thyA gene and is specific for an acid amine capable of restoring the translation of said thyA gene into the mutated cell, and - extracting the expression plasmid from the cell culture, said culture being performed in a thymidine-free medium to allow the selection of the transformed cells by said expression plasmid.

31. The method according to claim 30, characterized in that the expression cassette is chosen from eukaryotic expression cassettes for the expression of said recombinant protein of interest in a mammalian host cell or a yeast and the cassettes of prokaryotic expression for expression of said protein in prokaryotic host cells such as bacterial cells.

32. The method according to claim 31, characterized in that the mutated cell is an E. coli cell and in that the suppressor tRNA is specific for histidine and makes it possible to restore the translation of the mutated thyA gene comprising a non-sense codon replacing the codon encoding histidine at position 147 of thymidylate synthase.

33. Method according to one of claims 30 to 32, characterized in that the suppressor tRNA comprises a CUA anticodon capable of associating with the amber nonsense codon UAG.

34. A process for producing a recombinant protein of interest comprising: multiplying an expression plasmid according to one of claims 30 to 33; - transforming a host cell with the expression plasmid obtained at the preceding step, culturing said transformed host cell in a culture medium allowing expression of the recombinant protein of interest, and purification of the recombinant protein of interest from the culture medium or the host cell transformed.

Pharmaceutical composition comprising the expression plasmid according to claim 28.

36. Use of the expression plasmid according to one of claims 20 to 29 for transfection in vitro or ex vivo in a host cell of the nucleotide sequence encoding a recombinant protein of interest.

An expression plasmid according to claim 28 for use as a medicament or vaccine.

38. An expression plasmid according to claim 29 for use as a vaccine.

39. Use of a mutated cell according to one of claims 12 to 19 for the production of recombinant proteins of interest.