EP2193377A2 - Procédé de criblage de composés utilisables pour le traitement de troubles respiratoires - Google Patents
Procédé de criblage de composés utilisables pour le traitement de troubles respiratoiresInfo
- Publication number
- EP2193377A2 EP2193377A2 EP08865189A EP08865189A EP2193377A2 EP 2193377 A2 EP2193377 A2 EP 2193377A2 EP 08865189 A EP08865189 A EP 08865189A EP 08865189 A EP08865189 A EP 08865189A EP 2193377 A2 EP2193377 A2 EP 2193377A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- task
- polypeptide
- respiratory
- functional activity
- mice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6872—Intracellular protein regulatory factors and their receptors, e.g. including ion channels
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/12—Pulmonary diseases
Definitions
- the present invention relates to the use of a method of screening compounds for the treatment of respiratory disorders in a mammal. It finds particular application in the identification of new candidate molecules for the treatment of respiratory disorders.
- respiration is regulated by three chemical parameters of the arterial blood: i) the increase in carbon dioxide, or hypercapnia. ii) decreased blood pH, or acidosis. iii) the decrease of oxygen concentration in the blood, or hypoxia.
- sleep apnea syndrome is a real public health problem. This syndrome is often associated with obesity. For example, in the United States, about 3 million men and 1.5 million women suffer from sleep apnea syndrome. This syndrome could have negative consequences on the state of health of the people suffering from it, for example by worsening the cardiovascular diseases as indicated by the article of Namen and collaborators ((2002) «Increase Physician-reported sleep apnea: the National Ambulatory Medical Care Survey. "Chest 121 (6): 1741-1747 (Ref 5)).
- sleep apnea syndromes have a heterogeneous etiology and can be classified according to the likely underlying pathologies.
- the subgroup of obstructive sleep apnea is characterized by upper airway obstruction that prevents proper and efficient ventilation.
- the subgroup of central sleep apnea is characterized by defects in the regulation of respiration at the level of the brainstem, the nerve control of the respiratory muscles no longer functioning transiently.
- the mixed apnea subgroup corresponds to central apnea followed by obstructive sleep apnea.
- non-hypercapnic central apnea is characterized by periods of hyperventilation that result in a reduction in the concentration of arterial carbon dioxide called hypocapnia.
- the reduction of carbon dioxide results in a lack of stimulation of the brainstem breathing centers which results in longer breaks in breathing, and therefore, causes a reduction in arterial oxygen concentration.
- sleep apnea syndrome therapy includes surgical procedures and devices for establishing positive pressure in the upper respiratory tract.
- the TASK-1 channels are part of a family comprising the TASK 1, TASK 2 and TASK 3 channels. These are K + channels with 4 transmembrane domains and two channel domains (K2P channels) (Goldstein SA et al (2005), "International Union Pharmacology, LV. Nomemclature and molecular relationship of two-pot potassium channels ". Pharmacol Rev., 57, 527-540. (Ref 6)).
- TWIK-related acid sensitive K + (TASK) heteroneric express motorkines channels TASK-1 (KNCK3) and TASK-3 (KNCK9) subunits.” J. Neurosci, 24, 6693-6702 (Ref 9)). These channels produce a K + current that is inhibited by external acidification and subsequent activation of G protein-coupled receptors (Mathie A (2007) “Neuronal two pore domain potassium channels and their regulation by G protein-coupled receptors”. J. Physiol, 578, 377-385 (Ref 10)).
- TASK-1 channels are abundant in the brain, adrenal glands, blood vessels, and heart, and based on observations of knock-out mice for TASK-1, it has been shown that noted that the genetic inactivation of TASK-1 leads to aldosterone secretion disorders, arterial hypertension and changes in the electrocardiogram, and pulmonary hypertension can also be observed. it has been found that the use of TASK-1 inhibitors for therapeutic treatment is not an acceptable solution.
- hypoxia leads to an increase in ventilation which leads to a reduction in arterial carbon dioxide (hypocapnia) and results in an increase in arterial pH (respiratory alkalosis).
- Respiratory alkalosis affects the regulation of breathing and leads to irregular breathing patterns, especially during sleep phases.
- substances capable of inhibiting respiratory alkalosis for example acetazolamide, can improve the respiratory patterns and symptoms associated with high altitude by increasing the elimination of bicarbonate by the kidneys, which has as a consequence the decrease of the arterial pH.
- acetazolamide may cause side effects, for example by disrupting electrolyte homeostasis.
- the present invention specifically addresses the aforementioned need by providing a method of screening • for the identification of candidate molecules for the treatment of respiratory disorders in a mammal, said screening method comprising a step of determining whether the functional activity of a TASK-2 ion channel polypeptide (KCNK5) in the presence of a test molecule is decreased or suppressed with respect to the functional activity of said TASK-2 ion channel in the absence of said test molecule.
- KCNK5 TASK-2 ion channel polypeptide
- test molecule is considered a candidate molecule for the treatment of respiratory disorders in a mammal.
- the inventors of the present invention are indeed the first to have demonstrated that the TASK-2 channels, also called KCNK5, are present in certain regions of the respiratory centers of the brain stem and play a surprising role in the breathing.
- TASK-2 channels also called KCNK5
- In vitro experiments on a brainstem preparation from neonatal mice show a marked decrease in respiratory activity during anoxia. This decrease is no longer observed on brainstem preparations from mice disabled for the TASK-2 channel. Inhibition or absence of TASK-2 therefore protects against anoxia.
- These data indicate that the expression of these channels at the level of certain neurons is directly or indirectly associated with chemoreception.
- the inventors of the present invention have further demonstrated the expression of these TASK-2 channels at certain neurons known to be directly or indirectly associated with chemoreception.
- mice invalidated for the TASK-2 inactive channel exhibit a remarkable maintenance of respiration during hypoxia, unlike mouse-type wild that have a strong respiratory depression.
- adaptation to hypoxia may include a body defense mechanism by reducing the expression of TASK-2 channels.
- this physiological adaptation probably requires several hours and does not work for an immediate response to short-term hypoxia.
- TASK-2 may make it possible to anticipate the down-regulation defense mechanisms of TASK-2 expression.
- TASK-1 and TASK-3 channels which are probably also involved in the regulation of respiration due to their expression in multiple groups of chemosensitive respiratory neurons (Sirois et al., 2000). "The TASK-1 two-pore domain K + channel is a molecular substrate for neuronal effects of anesthetic inhalation.” J.
- TASK-2 in the central nervous system is extremely weak and limited to restricted groups of neurons in the breathing circuits (Reyes R et al (1998) "Cloning and expression of a new pH-sensitive two-pore domain K + channel from human kidney.” J. Biol Chem, 273, 30863-30869 (Ref. 15)). Moreover, TASK-2 is not or very weakly expressed in the heart where TASK-1 is very strongly expressed. Thus, the very limited expression of TASK-2 in the central nervous system and its virtual absence in the heart constitutes a huge advantage for the specific inhibition of TASK-2.
- Respiratory disorders means respiratory deficiencies due to dysfunction of the central nervous system, particularly any respiratory insufficiency related to a malfunction of brain respiratory centers located at the level of the brainstem.
- Respiratory disorders include, but are not limited to: sleep apnea syndrome, respiratory forms of sudden infant death syndrome, altitude sickness breathing models, respiratory syndrome Ondine or congenital alveolar hypoventilation syndrome, disorders due to accidental or intentional drug intoxication (eg absorption of barbiturates or opioids), respiratory depression related to general anesthesia, acute respiratory failure and severe hypoxemia.
- test molecule means a molecule tested by the method of the invention to determine whether it decreases or suppresses the activity of the TASK-2 channel or its expression.
- candidate molecule means a molecule identified by the practice of the present invention as decreasing or suppressing the activity of the TASK-2 channel or its expression.
- the present invention makes it possible to identify candidate molecules for the treatment of respiratory disorders in a mammal, whether human or animal.
- test molecules for the practice of the present invention may be selected for example randomly in molecular libraries or, for example, from biologically acceptable molecules capable of interacting with an ion channel.
- test molecules capable of decreasing or suppressing the activity of TASK-2 mention may be made, for example, of quinine, quinidine, clofilium, lidocaine, bupivacaine, doxapram and volatile anesthetics such as halothane.
- an antibody against TASK-2 may also be mentioned.
- This antibody can be manufactured by techniques known to those skilled in the art.
- This antibody may be, for example, a polyclonal, monoclonal, chimeric, or Fab fragment.
- the step of determining the functional activity of TASK-2 can be carried out according to one of the methods known to those skilled in the art for determining the activity of an ion channel. It can be as an example of a method such as that described for the KCNK2 channel in WO 05/054866 (PCT / EP / 2004/012823 - Bayer Healthcare
- the step of determining whether the functional activity of the TASK-2 polypeptide is decreased or suppressed may include:
- TASK-2 having functional activity, with said test molecule, and ii) a measurement of the functional activity of the TASK-2 polypeptide and / or its expression in the presence of said test molecule.
- the cell expressing the TASK-2 polypeptide may express it endogenously or in recombinant form.
- Methods for expressing this polypeptide by cells for the practice of the present invention are described for example in WO 00/27871 (COS cells or xenopus oocytes) and in the other aforementioned documents.
- the functional activity can be measured by one or more parameter (s) chosen from the group comprising: the ion current flowing through the TASK-2 polypeptide, the change of potential membrane of the cell expressing the TASK-2 polypeptide, the change in the intracellular ionic concentration of the cell expressing the TASK-2 polypeptide.
- a parameter chosen from the group comprising: the ion current flowing through the TASK-2 polypeptide, the change of potential membrane of the cell expressing the TASK-2 polypeptide, the change in the intracellular ionic concentration of the cell expressing the TASK-2 polypeptide.
- the functional activity can be determined, for example, by measuring the ionic current flowing through the TASK-2 polypeptide, the ion current flowing through the TASK-2 polypeptide possibly being, for example, an efflux of rubidium ions.
- the measurement of the ion current passing through the TASK-2 polypeptide is carried out by measuring the efflux of rubidium ions, this measurement being able to be carried out for example by atomic absorption spectroscopy, for example as indicated in FIG.
- test molecule which decreases the activity of TASK-2 preferably by at least 10%, preferably by at least 50%, and even more preferably by 75, 90 or 100% is identified. as a candidate molecule to decrease the activity of TASK-2.
- the invention notably allows the identification of candidate molecules for the treatment of disorders.
- Respiratory selected from the group consisting of sleep apnea syndrome, respiratory forms of sudden infant death syndrome, models of pathological breathing due to altitude.
- a step subsequent to the identification of a candidate molecule may be a step of studying the effect of said molecule on respiratory disorders, for example after administration of the candidate molecule to an animal model presenting breathing or put in conditions causing respiratory disorders.
- Another aspect of the invention thus relates to the use of a molecule modulating the functional activity of the TASK-2 polypeptide and / or inhibiting its expression, for the preparation of a composition for the treatment of respiratory disorders.
- RNA encoding TASK-2 or TASK-2 can be determined for example by one of the immunochemical methods known to those skilled in the art, for example by immunoassay, a Western blot technique or immunohistochemistry.
- the screening of the present invention can be carried out in a cell-free or cell-free system. Any cell expressing TASK-2 can be used.
- the TASK-2 polypeptide may be naturally expressed in the cell or may be introduced therein by a genetic recombination technique known to those skilled in the art. Examples of genetic recombination protocols that can be used for the implementation of the present invention are described in the three aforementioned documents.
- a candidate molecule may for example be a sequence complementary to the polynucleotide sequence encoding TASK-2 (or KCNK5) which is capable of blocking the channel transcription.
- Expression vectors derived from retroviruses, adenovirus, vaccinia or herpes virus or other bacterial viruses can be used to deliver nucleotide sequences complementary to target organs, tissues or cell populations. Methods known to those skilled in the art can be used for the construction of vectors that express the nucleic acid sequence complementary to the polynucleotides of the TASK-2 coding genes (Scott JK, Smith GP (1990). epitope library. "Science, 249: 386-390 (Ref 17)). Methods known to those skilled in the art can be used to construct expression vectors containing TASK-2 coding sequences as well as transcriptional and translational control elements. These methods include DNA techniques recombinant in vitro, synthetic techniques and in vivo genetic recombination. The three aforementioned documents describe methods that can be used for constructing vectors for implementing the present invention.
- Figure 1 is a photograph of TASK-2 channels present on the ventral surface of the rostral spinal bulb.
- Figure 2 is a histogram showing the experimental results of Example 2 below in vitro demonstration of TASK-2 channel intervention in central chemosensitivity mechanisms.
- the ordinate axis represents the frequency of the respiratory rhythmic activity (expressed in number of cycles per minute), and the abscissa axis, the various tests implemented in this example.
- the white bars correspond to the results obtained on the wild mice and the black bars on the mutant TASK-2 mice.
- Figure 3 is a histogram showing the experimental results of Example 3 below in vivo demonstration of intervention of TASK-2 channels in the mechanisms of respiration.
- the ordinate axis represents the ventilatory flow rate per minute ("minute volume" or MV) expressed in ml / min / g of body weight, and the abscissa axis, the various tests implemented in this example. .
- Figure 4 shows a recording "patch-clamp" the TASK-2 current (intensity I in picoamperes (pA)) on transfected HEK cells with 1 I DNA encoding human TASK-2 channel.
- Figure 5 depicts the location of TASK-2 channels present in the brainstem of an adult mouse. A: whole brain, ventral surface of the brain stem around the facial motor nucleus (VII) and enlargement showing the retrotrapezoid nucleus and the parafacial respiratory group (RTN / pfRG). From B to E: localization of cells expressing TASK-2 on coronal sections. B: mesencephalon, dorsal raphe (DR).
- C rostral bridge, lateral nucleus of the superior olive (LSO).
- D caudal bridge, ventral surface (RTN / pfRG) and parvocellular reticular nucleus (PCRtA).
- E rostral spinal bulb, caudal end of VII.
- F Summary diagram showing the distribution of TASK-2 expressing cells on a sagittal section of the brainstem.
- 3N oculomotor nucleus
- 4V 4 th ventricle
- 7N facial nucleus
- 1ON vagal motor dorsal nucleus
- 12N hypoglossal nucleus
- Amb ambiguous core
- AP area postrema
- CIC caudal nucleus of lower colliculus
- ILL intermediate nucleus of lateral lemniscus
- IO lower olive
- Self nucleus of the solitary tract.
- Figure 6 illustrates the respiratory adaptation measured by the plethysmography technique in response to hypercapnia and short-lived hypoxia in awake mice. This adaptation is similar in wild mice or mice disabled for TASK-2.
- the ordinate axis represents the ventilatory flow rate per minute ("minute volume" or MV) expressed in ml / min / g of body weight, the respiratory rate (RF) and the tidal volume (VT), the x-axis, the different tests implemented in this example as a function of time.
- FIGS 7A and B illustrate the respiratory adaptation measured by the plethysmography technique in response to long-term hypoxia.
- the strong respiratory depression observed in wild mice is totally absent in TASK-2-disabled mice.
- the y-axis represents the tidal volume (VT), the frequency respiratory (RF) and ventilatory flow rate per minute (MV, expressed in ml / min / g); the abscissa axis represents the different tests implemented in this example as a function of time.
- B the same parameters are represented on a longer time scale; TE, expiration time.
- C are shown examples of original traces for individual animals at different times (1, 2, 3 and 4 as indicated in B, last trace of the bottom).
- wild-type and mutant mice show increased respiration (point 2). This response is followed by depression (point 3) observable only in wild mice. After 12 hours of hypoxia (point 4) all mice show similar ventilation.
- Figure 8 is a histogram showing the expression of messenger RNAs of TASK-1, TASK-2 and erythropoietin (EPO) in kidney and brainstem in mice maintained for 12 hours in an environment hypoxic. These are quantitative PCR results (8 mice per group).
- Figure 9A illustrates the expression of TASK-2 in the area around the facial motor nucleus (retrotrapezoid nucleus and parafacial respiratory group) on a whole mouse brain aged 1 day. This area is preserved in the block recording technique.
- B schematic representation of the block preparation where the structures of the medulla oblongata and the most caudal part of the bridge are preserved.
- An electrode placed on the cervical root C4 makes it possible to record the activity of the phrenic nerve representing the respiratory activity.
- C example of recording trace (C4) and integration (JC4) inspiratory puffs from which the amplitude, the surface and the duration of the inspiratory (Tl) and expiratory (TE) phases are measured.
- D examples of respiratory activity (JC4) under normoxic (control) and anoxic conditions obtained on block preparations of wild mice (task2 + / +) or mutants (task2 - / -).
- E Histogram of respiratory frequencies (RF) under control conditions, anoxia, respiratory or metabolic acidosis and alkalosis for wild (WT), heterozygous (task2 +/-) or homozygous (task2 - / -) mice.
- RF Histogram of respiratory frequencies
- the experiments in this example demonstrate the presence of TASK-2 channels in a major nerve structure belonging to the respiratory centers of the brainstem. These experiments were performed on adult heterozygous mutant mice (TASK-2 + / - ), and the TASK-2 gene, which is invalidated, is replaced by a coding sequence for an enzyme called beta-galactosidase. Cells that normally express the TASK-2 channels can be easily identified by the standard histochemical revelation technique using I 1 X-GaI as a substrate that turns blue when hydrolyzed.
- FIG. 1 illustrates the TASK-2 channels present on the ventral surface of the rostral spinal bulb. This is a cross-section illustrating the presence of X-gal labeling in neurons of the ventral surface of the rostral spinal bulb (retotrapezoidal nucleus, RTN).
- this zone plays a fundamental role in central chemosensitivity, that is to say, in the processes of adaptation of ventilation in response to a chemical variation of the internal environment (blood, cerebrospinal fluid or CSF). Thanks to the unique location of these channels in areas as soon as involved in the control of respiration, it is therefore possible to specifically modulate respiration by a method acting on TASK-2.
- Example 2 In Vitro Demonstration of the Intervention of TASK-2 Channels in the Central Mechanisms of Respiratory Adaptation
- mice active TASK-2 channels
- mutant TASK-2 mice mutant TASK-2 mice that do not express active TASK-2 channels
- the brainstem of wild-type or mutant mice (TASK-2 " ⁇ ) is rapidly dissected in ice, isolated from adjacent tissues, and placed in artificial (ARF) equilibrated CFL (95% O 2 , 5). % CO 2 ).
- the ventral root of the C4 spinal segment is at the origin of the phrenic nerve which innervates the diaphragm. This nerve root is sucked inside a glass electrode to collect the spontaneous rhythmic activity generated spontaneously by the preparation.
- the electrical activity of the root C4 is filtered, amplified, visualized and stored on computer to analyze a posteriori the respiratory parameters (frequency, amplitude, duration). The tests consisted in modifying the quantity of dissolved gases in the LCRa or its chemical composition and comparing the respiratory activities.
- Figure 2 is a histogram showing the experimental results of this example ("bulk" preparation: respiratory rate and electrical activity of the phrenic nerve C4 root recorded in wild-type mice and task2 - / -).
- Control Artificial CSF balanced 95% O 2 , 5% CO 2 .
- Anoxia 95% N 2 , 5% CO 2 .
- the ordinate axis represents the frequency of the respiratory rhythmic activity (expressed in number of cycles per minute), and the abscissa axis, the various tests implemented in this example.
- the white bars correspond to the results obtained on the wild mice and the black bars on the mutant TASK-2 mice.
- mice [76] In this example, the inventors also used "wild-type" mice and mutant TASK-2 mice. [77] The respiration of the mice was measured with a plethysmographic apparatus (EMKA technologies, France).
- FIG. 3 is a histogram showing the experimental results of this example illustrating the ventilatory responses of wild-type and TASK-2 - / - mice on prolonged exposure to hypoxia (8% O2).
- the ordinate axis represents the ventilatory flow rate per minute ("minute volume" or MV, expressed in ml / min / g), and the abscissa axis, the various tests implemented in this example.
- the white bars correspond to the results obtained on the wild mice and the black bars on the mutant TASK-2 mice.
- hypoxia caused a transient increase in respiration in all animals (hyperventilation secondary to peripheral chemoreceptor stimulation) (not shown).
- hypoxia caused a transient increase in respiration in all animals (hyperventilation secondary to peripheral chemoreceptor stimulation) (not shown).
- hypoxia resulted in a reduction in respiratory movements or depression that is only seen in wild-type mice.
- the reduction of arterial carbon dioxide subsequent to initial hyperventilation was an important factor in wild type mice (in white on the histogram of Figure 1) to reduce their respiration.
- the invalidated animals for the TASK2 channel have on the contrary a sustained ventilation. throughout the duration of hypoxia.
- hypoxia is a powerful stimulus for respiration, including under conditions of hypocapnia (respiratory alkalosis). It is likely that respiratory alkalosis is no longer able to activate TASK-2 canals of the central nervous system.
- mice and conditions used in this experiment were identical to those of Example 1.
- the vector used for the generation of TASK-2 mice ";” contains a gene encoding beta-galactosidase as described in Mitchell KJ et al. (2001) "Functional analysis of secreted and transmembrane proteins critical to mouse development”. Nat Genet, 28, 241-249 (Ref 18).
- the expression of TASK-2 cells was visualized using a TASK-2 promoter activity in directing the TASK-2 mice "/ +. Surprisingly, specific labeling with X-gal Ie is restricted few regions of the brainstem. No cell expressing TASK-2 has found in other areas of the brain.
- the cells expressing TASK-2 form a bilateral column extending over 1.5 mm, from 500-700 ⁇ m in front of the obex to the rostral pole of the facial motor nucleus (VII). These cells form clusters located in the marginal zone on the surface of the brainstem and in the tissue parenchyma between 100 to 300 ⁇ m deep (see Figure 5).
- This region corresponds to the peri-facial region comprising the retrotrapezoid nucleus and the parafacial respiratory group (RTN / pfRG).
- the TASK-2 channels are present on the ventral surface of the rostral spinal bulb, more particularly in the region corresponding to the retrotrapezoid nucleus (RTN) and the parafacial respiratory group (pfRG). ).
- mice used in this experiment are identical to that of Example 2 above.
- mice used in this experiment are identical to those of the previous example. [106] For this experiment, 8 TASK-2 + / + mice and 7 TASK-2 '7 " mice were used.
- RNAs were isolated from the kidney and brainstem of mice using the Mini RNeasy Kit (Qiagen). For reverse transcription, a reverse transcriptase (Promega) was used according to the protocol provided by the manufacturer. A real time polymerase chain reaction was performed with the LightCycler system (Roche) using SYBR Green PCR Kit (Qiagen). The transcription of the TASK-2, TASK-1 and erythropoietin genes was measured and normalized with respect to the expression of beta-actin.
- primers used and the conditions for performing the real time polymerization reaction were as follows.
- Primers for beta-actin sense primer, 5 'CCACCGATCCACACAGAGTACTT 3' (SEQ ID NO: 1); Antisense primer, 5 'GACAGGATGCAGAAGGAGATTACTG 3 (SEQ ID NO: 2)'.
- Primers for erythropoietin sense primer, 5 'AGAATGGAGGTGGAAGAACAG 3' (SEQ ID NO: 3); Antisense primer, 5 'TGTCTATATGAAGCTGAAGGGT 3' (SEQ ID NO: 4).
- Primers for TASK-2 sense primer, 5 'GCTTTGGGGACTTTGTGG 3' (SEQ ID NO: 5); Antisense primer, 5 'AAAGAGGGACAGCCAAGC 3' (SEQ ID NO: 6).
- the hybridization temperature of the primers was 55 ° C.
- TASK-2 - / - mice showed decreases in respiratory rate similar to the change in pH. However, this response to anoxia was completely suppressed in TASK-2 - / - mice ( Figure 9 D and E). [129] This experiment shows that there exists in TASK-2 - / - mice a response to hypoxia which results in an increase in the duration of the inspirations without a change in the respiratory rate. [130] Thus, the potassium channel TASK-2 is therefore a new target for inhibiting respiratory depression and stimulating breathing under hypoxic conditions. 2
- Example 8 Implementation of a Screen According to the Present Invention
- HEK Human Embryonic Kidney cells
- pRES-CD8-hTASK2 the DNA complementary to the human TASK-2 channel gene
- the TASK-2 currents are recorded by the voltage-clamp method (patch-clamp in whole cell configuration). The currents are activated by voltage jumps from a rest potential at -95V up to variable values between -80 and + 45mV.
- the currents are recorded in whole cell configuration using an EPC-10 amplifier (HEKA).
- the "patch" pipette contains a 95 K-gluconate solution, 30 mM KCl, 4.8 mM Na 2 HPO 4 , 1.2 mM
- the external solution is a RINGER solution: 145 mM
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Cell Biology (AREA)
- Hematology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR0706999A FR2921935B1 (fr) | 2007-10-05 | 2007-10-05 | Procede de criblage de composes utilisables pour le traitement de troubles respiratoires |
PCT/FR2008/001391 WO2009080910A2 (fr) | 2007-10-05 | 2008-10-03 | Procédé de criblage de composés utilisables pour le traitement de troubles respiratoires |
Publications (1)
Publication Number | Publication Date |
---|---|
EP2193377A2 true EP2193377A2 (fr) | 2010-06-09 |
Family
ID=39401127
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP08865189A Withdrawn EP2193377A2 (fr) | 2007-10-05 | 2008-10-03 | Procédé de criblage de composés utilisables pour le traitement de troubles respiratoires |
Country Status (6)
Country | Link |
---|---|
US (1) | US8119362B2 (fr) |
EP (1) | EP2193377A2 (fr) |
JP (1) | JP2011501657A (fr) |
CA (1) | CA2700875A1 (fr) |
FR (1) | FR2921935B1 (fr) |
WO (1) | WO2009080910A2 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE202017007491U1 (de) * | 2016-12-02 | 2022-01-07 | Sophion Bioscience A/S | Dichtungsverstärker |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1675953A2 (fr) * | 2003-10-23 | 2006-07-05 | Sirna Therapeutics, Inc. | INHIBITION INDUITE PAR INTERFERENCE D'ARN DE L'EXPRESSION GENIQUE RAS AU MOYEN DE PETIT ACIDE NUCLEIQUE INTERFERENT (siNA) |
WO2005054867A2 (fr) * | 2003-11-25 | 2005-06-16 | Bayer Healthcare Ag | Diagnostics et therapeutique pour maladies associees au canal potassique de la sous-famille k, membre 5 (kcnk5) |
US20050234000A1 (en) * | 2003-12-12 | 2005-10-20 | Mitchell Gordon S | SiRNA delivery into mammalian nerve cells |
DE102005044817A1 (de) * | 2005-09-20 | 2007-03-22 | Sanofi-Aventis Deutschland Gmbh | Substituierte 4-Phenyltetrahydroisochinoline, Verfahren zu ihrer Herstellung, ihre Verwendung als Medikament, sowie sie enthaltendes Medikament |
-
2007
- 2007-10-05 FR FR0706999A patent/FR2921935B1/fr not_active Expired - Fee Related
-
2008
- 2008-10-03 CA CA2700875A patent/CA2700875A1/fr not_active Abandoned
- 2008-10-03 EP EP08865189A patent/EP2193377A2/fr not_active Withdrawn
- 2008-10-03 US US12/681,452 patent/US8119362B2/en not_active Expired - Fee Related
- 2008-10-03 WO PCT/FR2008/001391 patent/WO2009080910A2/fr active Application Filing
- 2008-10-03 JP JP2010527497A patent/JP2011501657A/ja active Pending
Non-Patent Citations (1)
Title |
---|
See references of WO2009080910A2 * |
Also Published As
Publication number | Publication date |
---|---|
US20110014642A1 (en) | 2011-01-20 |
FR2921935A1 (fr) | 2009-04-10 |
WO2009080910A3 (fr) | 2009-09-03 |
WO2009080910A2 (fr) | 2009-07-02 |
WO2009080910A8 (fr) | 2010-04-29 |
US8119362B2 (en) | 2012-02-21 |
CA2700875A1 (fr) | 2009-07-02 |
FR2921935B1 (fr) | 2011-10-28 |
JP2011501657A (ja) | 2011-01-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Iturriaga et al. | Carotid body chemoreceptors: physiology, pathology, and implications for health and disease | |
Dobretsov et al. | Neuronal function and alpha3 isoform of the Na/K-ATPase | |
Bolognin et al. | An experimental rat model of sporadic Alzheimer’s disease and rescue of cognitive impairment with a neurotrophic peptide | |
Zhang et al. | The disruption of central CO2 chemosensitivity in a mouse model of Rett syndrome | |
Zhang et al. | Targeted deletion of melanocortin receptor subtypes 3 and 4, but not CART, alters nutrient partitioning and compromises behavioral and metabolic responses to leptin | |
Donner et al. | Serotonergic systems in the balance: CRHR1 and CRHR2 differentially control stress-induced serotonin synthesis | |
Crowley et al. | Ketamine normalizes binge drinking-induced defects in glutamatergic synaptic transmission and ethanol drinking behavior in female but not male mice | |
Holleran et al. | Organic cation transporter 3 and the dopamine transporter differentially regulate catecholamine uptake in the basolateral amygdala and nucleus accumbens | |
Roux et al. | O2‐sensing after carotid chemodenervation: hypoxic ventilatory responsiveness and upregulation of tyrosine hydroxylase mRNA in brainstem catecholaminergic cells | |
Ables et al. | Understanding the habenula: A major node in circuits regulating emotion and motivation | |
Nakano et al. | Increased fibroblast growth factor-21 in chronic kidney disease is a trade-off between survival benefit and blood pressure dysregulation | |
Dereli et al. | Adaptation of respiratory-related brain regions to long-term hypercapnia: focus on neuropeptides in the RTN | |
WO2020081538A1 (fr) | Méthodes associées à des agents thérapeutiques opioïdes | |
EP2571515A2 (fr) | Procédés et tests pour le traitement de sujets présentant une délétion, une mutation ou une expression réduite de shank3 | |
Pinares-Garcia et al. | Antidepressant-like activity of a brain penetrant HCN channel inhibitor in mice | |
EP2193377A2 (fr) | Procédé de criblage de composés utilisables pour le traitement de troubles respiratoires | |
Lagos et al. | Role of spinal nitric oxide synthase-dependent processes in the initiation of the micturition hyperreflexia associated with cyclophosphamide-induced cystitis | |
Speed | The role of insulin signaling on dopamine transporter trafficking | |
WO2011115106A1 (fr) | Produit pharmaceutique pour la thérapie de pseudo-exercice | |
Ruginsk et al. | Neuroendocrine regulation of hydrosaline metabolism | |
Salvatierra | The role of Nav1. 9 and Nav1. 1 in somatosensory perception | |
Caprio et al. | Hydro Saline Metabolism: Epidemiology, Genetics, Pathophysiology, Diagnosis and Treatment | |
Fernández | Dysfunction in striatal dopaminergic and oxytocinergic system on impulsive choice behavior | |
Moreno Fernández | Dysfunction in striatal dopaminergic and oxytocinergic system on impulsive choice behavior | |
Montaner et al. | A neuronal circuit driven by GLP-1 in the olfactory bulb regulates insulin secretion |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20100316 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR |
|
AX | Request for extension of the european patent |
Extension state: AL BA MK RS |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: THOMAS, JOERG Inventor name: HEITZMANN, DIRK Inventor name: WARTH, RICHARD Inventor name: GESTREAU, CHRISTIAN Inventor name: BARHANIN, JACQUES |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: THOMAS, JOERG Inventor name: HEITZMANN, DIRK Inventor name: WARTH, RICHARD Inventor name: GESTREAU, CHRISTIAN Inventor name: BARHANIN, JACQUES |
|
DAX | Request for extension of the european patent (deleted) | ||
17Q | First examination report despatched |
Effective date: 20121217 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20141028 |