EP1997907A1 - Bifidobakterien - Google Patents

Bifidobakterien Download PDF

Info

Publication number
EP1997907A1
EP1997907A1 EP07109444A EP07109444A EP1997907A1 EP 1997907 A1 EP1997907 A1 EP 1997907A1 EP 07109444 A EP07109444 A EP 07109444A EP 07109444 A EP07109444 A EP 07109444A EP 1997907 A1 EP1997907 A1 EP 1997907A1
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
nucleotides
sequence
length
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP07109444A
Other languages
English (en)
French (fr)
Inventor
Arjen Nauta
Elisabeth Gertruda Hendrika Maria Van Den Heuvel
Janine Henriët Veurink
Johannes Marie Wilhelmus Geurts
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FrieslandCampina Nederland BV
Original Assignee
Friesland Brands BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Friesland Brands BV filed Critical Friesland Brands BV
Priority to EP07109444A priority Critical patent/EP1997907A1/de
Publication of EP1997907A1 publication Critical patent/EP1997907A1/de
Withdrawn legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Definitions

  • the invention relates to the fields of biology and microbiology.
  • Bifidobacterium is a genus of anaerobic bacteria which are abundantly present in the gastrointestinal tract.
  • the term Bifidobacteria is a generic term referring to a group of organisms belonging to the genus Bifidobacterium. This group is classified into at least 30 (sub-)species, of which several inhabit the intestinal lumen of mammals (including humans). Bifidobacteria have health-promoting properties since they improve food uptake and they are associated with resistance to gastroenterological infections and resistance to tumors such as colon cancer. They are also associated with a lower incidence of allergies.
  • Bifidobacteria in the gastrointestinal tract is important for the well-being of individuals.
  • a decrease of the amount of Bifidobacteria for instance resulting from immune depression, disease, stress or the use of antibiotics, other drugs or excess alcohol, adversely influences an individual's well-being.
  • a diminished amount of Bifidobacteria has an influence on the general health status and often coincides with an increase in susceptibility to gastroenterological infections and chronic diseases like colon cancer.
  • the amount of Bifidobacteria also alters with increasing age. Lower numbers of Bifidobacteria are present in the bacterial flora in human individuals over 60 years of age, compared to younger healthy adults.
  • a sufficiently high amount of Bifidobacteria is for instance obtained and/or maintained by the uptake of probiotics and/or prebiotics.
  • Probiotics and prebiotics are useful for improving and/or restoring a normal healthy amount of Bifidobacteria in an individual's digestive tract.
  • Probiotics are live micro-organisms, such as Bifidobacterium, that are capable of improving the balance of the intestinal microflora.
  • Probiotic bacterial cultures assist the body's naturally occurring flora within the digestive tract to reestablish themselves.
  • Prebiotics are food ingredients that beneficially affect the host by selectively stimulating the growth and/or the activity of a limited number of bacteria in the colon.
  • the presence and/or amount of Bifidobacteria in a sample is often determined using a Bifidobacterium-specific probe.
  • Nucleic acid present in a sample is often amplified using Bifidobacterium -specific primers, after which the presence of Bifidobacterium- specific nucleic acid is detected.
  • false positive results and false negative results are preferably avoided. False positive results are obtained if nucleic acid other than Bifidobacterium nucleic acid is detected. False negative results are obtained if nucleic acid of one or more strains of Bifidobacterium present in a sample is not detected.
  • Currently used nucleic acid detection methods are often not specific enough (yielding false-positive results) or too specific, so that nucleic acid of one or more Bifidobacterium strains are not detected (yielding false-negative results).
  • the invention provides a method for determining whether a sample comprises nucleic acid of at least one member of Bifidobacteria, comprising administering to nucleic acid of said sample a probe with a length of between 10 and 50 nucleotides, preferably between 13 and 30 nucleotides, comprising a nucleic acid sequence capable of specifically binding to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1104 to about 1175 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically binding to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1162 to about 1175 in the general consensus sequence depicted in Figure 1 , and
  • Such probe is preferably capable of specifically hybridizing with the above mentioned 16S rRNA nucleic acid sequences under stringent conditions.
  • Ribosomal RNA is the central component of the ribosome, the protein manufacturing machinery of all living cells.
  • the small 30S subunit of prokaryotic ribosomes comprises 16S rRNA and various proteins.
  • the 16S rRNA is important for subunit association and translational accuracy.
  • Figure 1 shows an alignment of (consensus) 16S rRNA nucleic acid sequences of eight bacterial genera. Since the 16S rRNA nucleic acid sequences are highly conserved, the corresponding positions of 16S rRNA nucleic acid sequences in other Bifidobacterium strains are easily assessed based on homology.
  • a 16S rRNA nucleic acid sequence is defined herein as any kind of (natural or non-natural) nucleic acid sequence corresponding to a 16S rRNA sequence.
  • a nucleic acid sequence corresponds to a 16S rRNA sequence when said nucleic acid sequence comprises a sequence which is capable of specifically binding to a complementary sequence of said 16S rRNA sequence.
  • a nucleic acid sequence also corresponds to a 16S rRNA sequence when said nucleic acid sequence comprises a sequence which is capable of specifically binding to a 16S rRNA sequence, meaning that said nucleic acid sequence comprises a sequence which is complementary to said 16S rRNA sequence.
  • 16S rRNA nucleic acid sequence for instance encompasses a DNA sequence comprising a sequence which is capable of specifically binding to a 16S rRNA sequence.
  • the term “16S rRNA nucleic acid sequence” also encompasses a DNA sequence comprising a sequence which is identical to a 16S rRNA sequence (except, of course, the fact that DNA comprises thymine instead of uracil).
  • the term “16S rRNA nucleic acid sequence” hence encompasses a 16S rDNA sequence.
  • the term “16S rRNA sequence” means any kind of 16S rRNA nucleic acid sequence.
  • a probe capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1104 to about 1175 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically binding to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1162 to about 1175 in the general consensus sequence depicted in Figure 1 is particularly suitable for detecting Bifidobacteria because such probe is capable of detecting nucleic acids of a wide variety of Bifidobacterium strains.
  • a skilled person is well capable of determining which 16S rRNA sequences of other Bifidobacterium strains correspond to the above mentioned 16S rRNA sequences.
  • Most preferably a probe according to the invention is provided which is capable of specifically hybridizing to a 16S rRNA nucleic acid sequence located from about nucleotide position 1104 to about 1175 in the Bifidobacterium consensus sequence depicted in Figure 1 .
  • a first nucleic acid molecule specifically hybridizes to a second nucleic acid molecule if said first nucleic acid molecule comprises a sequence of at least four, preferably at least five, more preferably at least six nucleotides which is complementary to at least part of a sequence of said second nucleic acid molecule.
  • adenine (A) is complementary to thymine (T) and uracil (U).
  • Guanine (G) is complementary to cytosine (C).
  • the term "specifically hybridizing" or “specifically binding" of a nucleic acid sequence to another nucleic acid sequence therefore means a binding event resulting from hybridization of complementary nucleic acid sequences.
  • nucleic acid molecules do not encompass non-specific sticking of nucleic acid molecules, which is not due to a complementary sequence.
  • the terms encompass a binding event of two nucleic acid molecules under mild conditions, which nucleic acid molecules comprise sequences that are less than 100% but more than 65% complementary to each other. Two nucleic acid sequences that are less than 100% but more than 65% complementary to each other are nevertheless capable of hybridizing under mild conditions such as for instance a low temperature.
  • Each of said two nucleic acid molecules preferably comprises a sequence that is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85% complementary to a sequence of the other nucleic acid molecule.
  • stringent conditions are used, however, two nucleic acid molecules only bind if they comprise a sequence which is at least 85%, preferably at least 90%, complementary to a sequence of the other nucleic acid molecule.
  • Stringent conditions are therefore defined herein as conditions where hybridization of nucleic acid molecules only takes place if said nucleic acid molecules comprise a sequence which is at least 85%, preferably at least 90%, complementary to a sequence of the other nucleic acid molecule.
  • a nucleic acid sequence as used herein for instance comprises naturally occurring nucleic acids, such as DNA, RNA or a DNA/RNA helix, modified nucleic acid sequences and/or nucleic acid derivatives such as for instance peptide nucleic acid (PNA).
  • Possible bases of a nucleic acid sequence according to the invention comprise naturally occurring purines and/or pyrimidines, such as adenine, thymine, cytosine, guanine and uracil, as well as modified bases such as for instance inosine.
  • One embodiment of the invention provides a method for determining whether a sample comprises nucleic acid of at least one member of Bifidobacteria, comprising:
  • Such probe is particularly well capable of detecting a wide variety of Bifidobacteria.
  • Said probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCGCATGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • the higher the homology the more Bifidobacterium strains are detectable with said probe.
  • a probe consisting of the sequence TCGCCGCATGTTGC is used.
  • Another embodiment of the invention provides a method for determining whether a sample comprises nucleic acid of at least one member of Bifidobacteria, comprising:
  • Such probe is particularly well capable of detecting a wide variety of Bifidobacteria.
  • Said probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCCCGTGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • the higher the homology the more Bifidobacterium strains are detectable with said probe.
  • a probe consisting of the sequence TCGCCCCGTGTTGC is used.
  • a first probe with a length of between 10 and 50 nucleotides, preferably between 13 and 30 nucleotides, comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCGCATGTTGC is used in combination with a second probe with a length of between 10 and 50 nucleotides, preferably between 13 and 30 nucleotides, comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCCCGTGTTGC, said part having at least 10 nucleotides.
  • Said first probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCGCATGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • Said second probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCCCGTGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • Bifidobacterium-specific probes involve the risk of false negative results, meaning that one or more Bifidobacterium strains are not detected, this risk is particularly well diminished if a combination of at least two of the above mentioned probes are used.
  • a combination of two Bifidobacterium-specific probes according to the present invention at least 29 different Bifidobacterial species are detectable.
  • a combination of at least two Bifidobacterium- specific probes according to the invention provides a preferred tool for detection of Bifidobacteria. Further provided is therefore a method for determining whether a sample comprises nucleic acid of at least one member of Bifidobacterium, comprising:
  • a nucleic acid amplification reaction comprises any kind of reaction wherein a nucleic acid sequence is duplicated at least one time.
  • Preferred amplification reactions comprise (reverse transcriptase)-polymerase chain reaction ((RT)-PCR), nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA) and transcription mediated amplification (SDA).
  • RT reverse transcriptase
  • NASBA nucleic acid sequence based amplification
  • SDA strand displacement amplification
  • SDA transcription mediated amplification
  • a preferred embodiment thus provides a method according to the invention, wherein nucleic acid of said sample is subjected to a nucleic acid amplification reaction.
  • nucleic acid is firstly amplified, where after a probe according to the invention, or preferably a combination of at least two probes according to the invention, is administered to the amplified nucleic acid in order to determine whether Bifidobacterium nucleic acid is present.
  • Amplified nucleic acid is incubated with at least one probe, unbound probe is preferably washed away and bound probe is visualized, for instance using a visible label and/or an enzyme reaction.
  • real time monitoring is performed, for instance using a Taqman or beacon probe.
  • a Taqman probe comprises an oligonucleotide, complementary to a target sequence, which is labeled with a 5'-reporter dye and a 3'-quencher dye. When both dyes are attached to the probe the reporter dye cannot be detected.
  • a TaqMan probe hybridizes to a target nucleic acid sequence. During a nucleic acid amplification reaction the TaqMan probe is hydrolyzed, resulting in separation of the reporter dye and quencher dyes. This, in turn, results in increased fluorescence of the reporter. Increase in fluorescence is monitored over time. Many well known alternative methods for detection of amplified nucleic acid are available in the art
  • a primer capable of specifically hybridizing to Bifidobacterial nucleic acid is preferably used.
  • Said primer is capable of binding a higher number of different Bifidobacterium nucleic acid sequences, as compared to the number of different non- Bifidobacterium nucleic acid sequences that said primer is capable of binding to.
  • Such primer is called herein a Bifidobacterium -specific primer.
  • Said primer is preferably capable of binding less than ten, preferably less than eight, more preferably less than six different non- Bifidobacterium nucleic acid sequences. Most preferably said primer is only capable of specifically binding to nucleic acid of Bifidobacterial strains.
  • a method according to the invention comprising subjecting nucleic acid of a sample to a nucleic acid amplification reaction using at least one Bifidobacterium -specific primer is therefore also provided.
  • nucleic acid is amplified with a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, which primer is capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 969 to about 989 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1023 to about 1043 in the general consensus sequence depicted in Figure 1 .
  • Said primer preferably comprises a nucleic acid sequence which is at least 70% homologous to at least part of the sequence CCTTACCTGGGCTTGACATGT, said part having at least 10 nucleotides. Preferably, said part comprises at least 15 nucleotides.
  • Said primer preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence CCTTACCTGGGCTTGACATGT, said part having at least 10 nucleotides.
  • a primer consisting of the sequence CCTTACCTGGGCTTGACATGT is used.
  • nucleic acid is amplified using a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, which primer is capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1187 to about 1207 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1245 to about 1265 in the general consensus sequence depicted in Figure 1 .
  • Said primer preferably comprises a nucleic acid sequence which is at least 70% homologous to at least part of the sequence GACGTAAGGGGCATGATGATC, said part having at least 10 nucleotides, preferably at least 15 nucleotides.
  • Said primer preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence GACGTAAGGGGCATGATGATC, said part having at least 10 nucleotides.
  • a primer consisting of the sequence GACGTAAGGGGCATGATGATC is used.
  • a primer according to the invention is preferred because it is suitable for amplifying nucleic acid of a wide variety of (at least 29) different Bifidobacteria species while amplification of non-Bifidobacterial nucleic acid is at least in part avoided.
  • This combination of primers according to the invention is particularly suitable for specifically amplifying a wide variety of Bifidobacterial nucleic acid, while at least in part avoiding amplification of non-Bifidobacterial nucleic acid.
  • a primer consisting of the sequence CCTTACCTGGGCTTGACATGT in combination with a primer consisting of the sequence GACGTAAGGGGCATGATGATC is used.
  • the amount of Bifidobacterial nucleic acid in a sample derived from an individual's gastrointestinal tract is preferably quantified because a sufficiently high, natural amount of Bifidobacteria is important for the well-being of individuals whereas a diminished amount of Bifidobacteria has an influence on the general health status and often coincides with an increase in susceptibility to gastroenterological infections and chronic diseases like colon cancer.
  • a method according to the invention which further comprises quantifying nucleic acid of at least one member of Bifidobacteria is therefore also provided herewith.
  • Quantitation of nucleic acid is for instance performed using quantitative nucleic acid amplification, which is well known in the art.
  • known amounts of nucleic acid of interest are amplified and visualised beforehand. The obtained values are plotted in order to obtain a reference curve. Subsequently, an unknown amount of nucleic acid is amplified and visualised, where after the obtained value is compared with said reference curve in order to establish the (original) amount of said nucleic acid of interest.
  • real time quantitative nucleic acid amplification is used with Taqman or beacon probes.
  • an amplification plot is established in which a fluorescence signal is plotted versus the cycle number.
  • a fluorescence signal is plotted versus the cycle number.
  • An increase in fluorescence above the baseline implies detection of accumulated nucleic acid amplification product.
  • a fixed fluorescence threshold is preferably set above the baseline.
  • a parameter Ct is defined as the fractional cycle number at which the fluorescence passes the fixed threshold. Quantitation of the amount of target nucleic acid in unknown samples is subsequently preferably accomplished by measuring the Ct and using said standard curve to determine the starting copy number.
  • Nucleic acid is also quantified in various alternative ways, which are known in the art and need no further explanation.
  • the presence and/or amount of total Bifidobacterial nucleic acid content in a sample is investigated. Additionally, or alternatively, nucleic acid of at least one member of Bifidobacteria is identified. This embodiment is particularly suitable in situations wherein the presence of at least one particular Bifidobacterial strain is investigated, for instance when nucleic acid of an unknown species (for instance present in a food product) is amplified and identified, or when nucleic acid of a pool of Bifidobacteria (for instance present in faeces) is amplified after which the different species are identified.
  • a method according to the present invention is performed with a first probe according to the invention which is at least 70% homologous to at least part of the sequence TCGCCGCATGTTGC and a second probe according to the invention which is at least 70% homologous to at least part of the sequence TCGCCCCGTGTTGC, after which one of the probes is used in order to provide more information about the presence or absence of individual species.
  • a method according to the invention is, amongst other things, particularly suitable for investigating the presence and/or amount of Bifidobacterium species in the gastrointestinal tract.
  • a faeces sample is particularly well suitable for this purpose. Further provided is therefore a method according to the invention, wherein said nucleic acid is obtained from a faeces sample.
  • a member of the Bifidobacterium genus is present in a sample, it is particularly well detected with a probe according to the present invention.
  • Such probe is also suitable for isolating nucleic acid of a Bifidobacterium member. Detection and/or isolation of Bifidobacterium nucleic acid is for instance performed using a column or dipstick with at least one probe according to the invention. Such column or dipstick is incubated with a sample, where after unbound components are washed away and bound nucleic acid is detected and/or isolated.
  • Various alternative ways of detecting and/or isolating nucleic acid using a probe sequence are available in the art, which are also applicable.
  • a method for detecting and/or isolating nucleic acid of at least one member of Bifidobacteria comprising administering a probe with a length of between 10 and 50 nucleotides, preferably between 13 and 30 nucleotides, comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCGCATGTTGC, said part having at least 10 nucleotides, to nucleic acid of at least one member of Bifidobacteria.
  • Said probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCGCATGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • said probe consists of the sequence TCGCCGCATGTTGC.
  • a method for detecting and/or isolating nucleic acid of at least one member of Bifidobacteria comprising administering a probe with a length of between 10 and 50 nucleotides, preferably between 13 and 30 nucleotides, comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCCCGTGTTGC, said part having at least 10 nucleotides, to nucleic acid of at least one member of Bifidobacteria.
  • Said probe preferably comprises a nucleic acid sequence which is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence TCGCCCCGTGTTGC, said part having at least 10 nucleotides, preferably at least 12 nucleotides.
  • said probe consists of the sequence TCGCCCCGTGTTGC.
  • the present invention provides the insight that a combination of at least two different probes according to the present invention is preferred because even more different Bifidobacterium strains are detectable with said combination.
  • the above mentioned probe comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCGCATGTTGC is combined with the above mentioned probe comprising a nucleic acid sequence which is at least 70% homologous to at least part of the sequence TCGCCCCGTGTTGC.
  • a probe consisting of the sequence TCGCCGCATGTTGC in combination with a probe consisting of the sequence TCGCCCCGTGTTGC is used.
  • a primer according to the present invention capable of specifically hybridizing to Bifidobacterial nucleic acid is preferably used so that Bifidobacterial nucleic acid is specifically amplified while amplification of nucleic acid of other genera is at least in part avoided.
  • a method for subjecting nucleic acid to a nucleic acid amplification reaction comprising providing said nucleic acid with at least one primer and performing a nucleic acid amplification reaction, wherein said nucleic acid is provided with a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, which primer is capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 969 to about 989 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1023 to about 1043 in the general consensus sequence depicted in Figure 1 is therefore also provided.
  • Said primer preferably comprises a nucleic acid sequence which is at least 70% homologous to at least part of the sequence CCTTACCTGGGCTTGACATGT, said part having at least 10 nucleotides.
  • such primer is capable of hybridizing to nucleic acid of a wide variety of Bifidobacterial species, while amplification of non-Bifidobacterial nucleic acid is at least in part avoided.
  • nucleic acid to a nucleic acid amplification reaction
  • a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, which primer is capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1187 to about 1207 in the Bifidobacterium consensus sequence depicted in Figure 1 , and/or capable of specifically hybridizing to a 16S rRNA nucleic acid sequence corresponding to the nucleic acid sequence located from about nucleotide position 1245 to about 1265 in the general consensus sequence depicted in Figure 1 .
  • Said primer preferably comprises a nucleic acid sequence which is at least 70% homologous to at least part of the sequence GACGTAAGGGGCATGATGATC, said part having at least 10 nucleotides.
  • Such primer is capable of hybridizing to nucleic acid of a wide variety of Bifidobacterial species, while amplification of non-Bifidobacterial nucleic acid is at least in part avoided.
  • nucleic acid amplification reaction comprising providing said nucleic acid with a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, comprising a nucleic acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence CCTTACCTGGGCTTGACATGT or GACGTAAGGGGCATGATGATC, said part having at least 10 nucleotides, preferably at least 15 nucleotides.
  • Nucleic acid of a sample is preferably provided with a combination of a forward primer and a reverse primer, wherein the forward primer is a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, comprising a nucleic acid sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence CCTTACCTGGGCTTGACATGT, said part having at least 10 nucleotides, and wherein the reverse primer is a primer with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, comprising a nucleic acid sequence which is at least 70%, preferably at least 75%,
  • This combination of primers according to the invention is particularly suitable for specifically amplifying a wide variety of Bifidobacterial nucleic acid, while at least in part avoiding amplification of non-Bifidobacterial nucleic acid.
  • a primer consisting of the sequence CCTTACCTGGGCTTGACATGT in combination with a primer consisting of the sequence GACGTAAGGGGCATGATGATC is used.
  • nucleic acid sequence is particularly suitable for use as a probe.
  • Said nucleic acid preferably consists of the sequence TCGCCGCATGTTGC.
  • Such nucleic acid sequence is also particularly suitable for use as a probe.
  • Said nucleic acid preferably consists of the sequence TCGCCCCGTGTTGC.
  • nucleic acid is particularly suitable for use as a forward primer for specifically amplifying Bifidobacterial nucleic acid.
  • Said nucleic acid preferably consists of the sequence CCTTACCTGGGCTTGACATGT.
  • the invention furthermore provides a nucleic acid sequence with a length of between 9 and 50 nucleotides, preferably with a length of between 9 and 40 nucleotides, more preferably with a length of between 15 and 25 nucleotides, comprising a sequence which is at least 70%, preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, most preferably at least 95% homologous to at least part of the sequence GACGTAAGGGGCATGATGATC, said part having at least 10 nucleotides, preferably at least 15 nucleotides.
  • Such nucleic acid is particularly suitable for use as a reverse primer for specifically amplifying Bifidobacterial nucleic acid.
  • a particularly preferred embodiment provides a primer pair consisting of the above mentioned forward primer and the above mentioned reverse primer. Further provided is therefore a primer pair consisting of:
  • a primer pair consisting of a primer consisting of the sequence CCTTACCTGGGCTTGACATGT in combination with a primer consisting of the sequence GACGTAAGGGGCATGATGATC is provided.
  • the invention furthermore provides a kit for detecting Bifidobacterial nucleic acid, comprising at least one probe according to the invention.
  • Said kit preferably comprises a combination of at least two different probes according to the invention, as outlined before.
  • a kit for amplifying Bifidobacterial nucleic acid comprising at least one primer according to the invention is also provided.
  • Said kit preferably comprises a primer pair according to the invention.
  • a kit comprising at least one probe, preferably at least two probes, and at least one primer according to the present invention is also provided.
  • a method according to the invention is used for testing whether a candidate compound is capable of influencing the amount of Bifidobacteria in a population. This is for instance useful for identifying, developing and/or testing probiotics and/or prebiotics.
  • Probiotics and prebiotics are useful for improving and/or restoring a normal healthy equilibrium in an individual's digestive tract.
  • Probiotics are live micro-organisms, such as Bifidobacterium species, that are capable of improving the balance of the intestinal microflora.
  • Probiotic bacterial cultures assist the body's naturally occurring flora within the digestive tract to reestablish themselves.
  • Prebiotics are food ingredients that beneficially affect the host by selectively stimulating the growth and/or the activity of a limited number of bacteria in the colon.
  • the effects upon the presence and/or amount of Bifidobacteria is preferably assessed since Bifidobacteria are known to contribute to the well-being of individuals.
  • the effect of a (candidate) probiotic and/or (candidate) prebiotic is preferably assessed by determining the presence and/or amount of Bifidobacteria in a sample from an individual that has been provided with said (candidate) probiotic and/or (candidate) prebiotic, using a method according to the present invention.
  • the presence and/or amount of Bifidobacteria in a first sample of an individual is investigated with a method according to the invention before said individual has been provided with a (candidate) probiotic and/or (candidate) prebiotic.
  • the presence and/or amount of Bifidobacteria in the same kind of sample (called herein a second sample) of said individual is investigated with a method according to the invention, which second sample is obtained after said individual has been provided with said (candidate) probiotic and/or (candidate) prebiotic.
  • Differences in the amount or concentration of Bifidobacteria in said first and second sample is indicative for an effect of said (candidate) probiotic and/or (candidate) prebiotic.
  • a method for determining whether a candidate compound is capable of influencing the amount of Bifidobacteria in a population comprising:
  • a (candidate) compound appears to be capable of beneficially influencing the amount of Bifidobacteria in said population, it is preferably selected and/or isolated.
  • a method according to the invention further comprising selecting and/or isolating a candidate compound capable of beneficially influencing the amount of Bifidobacteria in said population is therefore also provided.
  • a candidate compound is selected and/or isolated which is capable of increasing the amount of Bifidobacteria in said population.
  • Said selected and/or isolated compound is preferably incorporated into a food product in order to improve health.
  • Said selected and/or isolated compound is preferably incorporated into a dairy product.
  • a food product capable of beneficially influencing the amount of Bifidobacteria, obtainable by a method according to the invention is therefore also herewith provided.
  • Said food product preferably comprises a dairy product.
  • reaction mixture Twenty-five ⁇ l of reaction mixture was composed of 12,5 ⁇ l 2x Universal PCR Master Mix (TaqMan, Applied Biosystems), 0,1 ⁇ M of each primer, 0,25 ⁇ M probe and 5 ⁇ l of template DNA. PCR was carried out for 40 cycles of 95 °C for 15 sec and 60 °C for 60 sec.
  • reaction mixture Twenty-five ⁇ l of reaction mixture was composed of 12,5 ⁇ l 2x Universal PCR Master Mix (TaqMan, Applied Biosystems), 0,1 ⁇ M of each primer, 0,25 ⁇ M probe and 5 ⁇ l of template DNA. PCR was carried out for 40 cycles of 95 °C for 15 sec and 60 °C for 60 sec.
  • a primer consisting of the sequence CCTTACCTGGGCTTGACATGT in combination with a primer consisting of the sequence GACGTAAGGGGCATGATGATC was used.
  • Vivinal galactooligosaccharides exerts a prebiotic effect, i.e. in beneficially affecting the host by selectively stimulating the growth and/or activity of one or a limited number of bacterial species already resident in the colon, and thus attempt to improve host health.
  • Chemostat nutrient media was prepared containing: Peptone water 2g/l (Oxoid, Basingstoke, UK), yeast extract 2g/l (Oxoid), NaCl 0.1g/l (Fisher, Loughborough, UK), K2HPO4.3H2O 0.05g/l (BDH, Poole, UK), KH2PO4 0.04g/l (BDH), MgSO4.7H2O 0.01g/l (Sigma), CaC12.2H2O 0.005g/l (BDH), NaHCO3 2g/l (Sigma), Tween 80 (BDH) 2ml, Hemin 0.005g/l, Vitamin K1 10 ⁇ l (Sigma), Cystiene HCl 0.5g/l (Oxoid), Bile Salts 0.5g/l (Oxoid), Resazurin 4ml/l (Sigma), pH7.
  • a stool sample was collected from several volunteer, free of known gastrointestinal disorders, between the ages of 25-54. None of the volunteers used had taken antibiotics within a three-month period prior to sampling.
  • Each pH-controlled, stirred batch culture experiment was repeated 3 times with 3 different faecal adult donors.
  • fecal slurry was prepared from 1 part pooled fecal sample and 9 parts pre-reduced phosphate-buffered saline (PBS: 10% w/w) at pH 7.4.
  • PBS pre-reduced phosphate-buffered saline
  • Vessels were connected to pH Controller Models 260 (Electrolab) and culture pH maintained at pH 5.5 -5.8 (vessel 1), 6.2 -6.5 (vessel 2), and 6.8 -7.1 (vessel 3).
  • the autoclaved medium was connected to vessel 1 via a pump.
  • Media and fermentation vessels were constantly stirred and kept at 37°C and anaerobic by a constant nitrogen flow. After filling half of the vessels with medium, roughly the same amount of a freshly prepared faecal slurry was added to each vessel.
  • faecal slurries were prepared from 1 part freshly voided faecal sample and 9 parts pre-reduced phosphate-buffered saline (PBS) (10 % w/v).
  • PBS pre-reduced phosphate-buffered saline
  • the media pump was turned off, and the inoculated vessels incubated without flow for one day. After 24 hours, the medium pump was started again at a flow rate of ca. 20 mL per hour to simulate a retention time of about 44 hours. After two weeks, when an equilibrium or steady state was reached, the carbohydrates in the media were proportionally replaced by the testing substrate. The medium of the last 2 weeks contained 1% substrate. At the time points 0, days 12, 13, 14, 20/21 and 26, 27, 28 samples were taken. Steady state 1 and 2 is calculated as the average of time point 12, 13 and 14, and 26, 27 and 28. See Figure 6B .
  • RNA DNA was amplified by PCR with oligonucleotide prF21bifido and prR21bifido (Bifidobacterium) and with lactobacilli-speeific primers.
  • Bifidobacteria-specific primer set prF21bifido and prR21bifido: a primer consisting of the sequence
  • Lactobacilli-specific primer set
  • Quantitative PCR was used to determine Bifidobacteria and Lactobacilli: The 16 s RNA was amplified by PCR with oligonucleotides prF21bifido and prR21bifido. Twenty-five ⁇ l of reaction mixture was composed of 12,5 ⁇ l 2x Universal PCR Master Mix (TaqMan, Applied Biosystems), 0,1 ⁇ M of each primer, 0,25 ⁇ M probe and 5 ⁇ l of template DNA. PCR was carried out for 40 cycles of 95°C for 15 sec and 60° C for 60 sec.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP07109444A 2007-06-01 2007-06-01 Bifidobakterien Withdrawn EP1997907A1 (de)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP07109444A EP1997907A1 (de) 2007-06-01 2007-06-01 Bifidobakterien

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP07109444A EP1997907A1 (de) 2007-06-01 2007-06-01 Bifidobakterien

Publications (1)

Publication Number Publication Date
EP1997907A1 true EP1997907A1 (de) 2008-12-03

Family

ID=38704678

Family Applications (1)

Application Number Title Priority Date Filing Date
EP07109444A Withdrawn EP1997907A1 (de) 2007-06-01 2007-06-01 Bifidobakterien

Country Status (1)

Country Link
EP (1) EP1997907A1 (de)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011096808A1 (en) 2010-02-05 2011-08-11 Friesland Brands B.V. Use of sialyl oligosaccharides in weight management
WO2011096809A1 (en) 2010-02-05 2011-08-11 Friesland Brands B.V. Use of sialyl oligosaccharides to modulate the immune system
EP3284830A4 (de) * 2015-04-16 2018-12-19 National Center of Neurology and Psychiatry Biomarker für eine geisteskrankheit
US10322151B2 (en) 2015-06-15 2019-06-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10391128B2 (en) 2015-11-23 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
US10391130B2 (en) 2015-06-15 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
US10456444B2 (en) 2014-12-23 2019-10-29 4D Pharma Research Limited Pirin polypeptide and immune modulation
US10471108B2 (en) 2015-11-20 2019-11-12 4D Pharma Research Limited Compositions comprising bacterial strains
US10485830B2 (en) 2016-12-12 2019-11-26 4D Pharma Plc Compositions comprising bacterial strains
US10493112B2 (en) 2015-06-15 2019-12-03 4D Pharma Research Limited Compositions comprising bacterial strains
US10500237B2 (en) 2015-06-15 2019-12-10 4D Pharma Research Limited Compositions comprising bacterial strains
US10576111B2 (en) 2017-07-05 2020-03-03 Evelo Biosciences, Inc. Method of treating cancer using Bifidobacterium animalis ssp. lactis strain PTA-125097
US10583158B2 (en) 2016-03-04 2020-03-10 4D Pharma Plc Compositions comprising bacterial strains
US10610548B2 (en) 2016-07-13 2020-04-07 4D Pharma Plc Compositions comprising bacterial strains
US10610550B2 (en) 2015-11-20 2020-04-07 4D Pharma Research Limited Compositions comprising bacterial strains
US10736926B2 (en) 2015-06-15 2020-08-11 4D Pharma Research Limited Compositions comprising bacterial strains
US10744166B2 (en) 2015-11-23 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10851137B2 (en) 2013-04-10 2020-12-01 4D Pharma Research Limited Polypeptide and immune modulation
CN112063619A (zh) * 2020-08-20 2020-12-11 天津农学院 一种快速、高灵敏性检测和定量酸奶中动物双歧杆菌bb-12的方法
US10987387B2 (en) 2017-05-24 2021-04-27 4D Pharma Research Limited Compositions comprising bacterial strain
US11007233B2 (en) 2017-06-14 2021-05-18 4D Pharma Research Limited Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
US11013773B2 (en) 2011-07-14 2021-05-25 4D Pharma Research Limited Lactic acid bacterial strains
US11123378B2 (en) 2017-05-22 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11123379B2 (en) 2017-06-14 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11224620B2 (en) 2016-07-13 2022-01-18 4D Pharma Plc Compositions comprising bacterial strains
US11266698B2 (en) 2011-10-07 2022-03-08 4D Pharma Research Limited Bacterium for use as a probiotic for nutritional and medical applications
US11723933B2 (en) 2014-12-23 2023-08-15 Cj Bioscience, Inc. Composition of bacteroides thetaiotaomicron for immune modulation
US12048720B2 (en) 2017-06-14 2024-07-30 Cj Bioscience, Inc. Compositions comprising bacterial strains

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010093A1 (en) 1996-09-03 1998-03-12 Peter Kaufmann Oligonucleotide probes for the detection of bifidobacteria
WO2001042457A2 (en) 1999-11-29 2001-06-14 Avi Biopharma, Inc. Uncharged antisense oligonucleotides targeted to bacterial 16s and 23s prnas and their uses
WO2003052128A1 (en) 2001-12-19 2003-06-26 Quantibact A/S A method and a kit for determination of a microbial count
US6699661B1 (en) 1999-04-20 2004-03-02 Kankyo Engineering Co., Ltd. Method for determining a concentration of target nucleic acid molecules, nucleic acid probes for the method, and method for analyzing data obtained by the method
EP1528107A1 (de) 2003-10-29 2005-05-04 Maurice Stroun Verfahren zur Diagnose von Krebs
EP1719815A1 (de) 2004-02-24 2006-11-08 Morinaga Milk Industry Co., Ltd. Verfahren zum nachweis von bifidobacterium infantis
WO2006122850A1 (en) 2005-05-16 2006-11-23 Universite De Liege Probiotic bifidobacterial species

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998010093A1 (en) 1996-09-03 1998-03-12 Peter Kaufmann Oligonucleotide probes for the detection of bifidobacteria
US6699661B1 (en) 1999-04-20 2004-03-02 Kankyo Engineering Co., Ltd. Method for determining a concentration of target nucleic acid molecules, nucleic acid probes for the method, and method for analyzing data obtained by the method
WO2001042457A2 (en) 1999-11-29 2001-06-14 Avi Biopharma, Inc. Uncharged antisense oligonucleotides targeted to bacterial 16s and 23s prnas and their uses
WO2003052128A1 (en) 2001-12-19 2003-06-26 Quantibact A/S A method and a kit for determination of a microbial count
EP1528107A1 (de) 2003-10-29 2005-05-04 Maurice Stroun Verfahren zur Diagnose von Krebs
EP1719815A1 (de) 2004-02-24 2006-11-08 Morinaga Milk Industry Co., Ltd. Verfahren zum nachweis von bifidobacterium infantis
WO2006122850A1 (en) 2005-05-16 2006-11-23 Universite De Liege Probiotic bifidobacterial species

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KWON ET AL., FEMS MICROBIOL LETT., vol. 250, no. 1, 2005, pages 55 - 62
KWON ET AL: "Rapid identification of potentially probiotic Bifidobacterium species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA", FEMS MICROBIOLOGY LETTERS, AMSTERDAM, NL, vol. 250, no. 1, 1 September 2005 (2005-09-01), pages 55 - 62, XP005021267, ISSN: 0378-1097 *
MATSUKI ET AL., APPL ENVIRON MICROBIOL., vol. 70, no. 1, 2004, pages 167 - 173
MATSUKI TAKAHIRO ET AL: "Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, WASHINGTON,DC, US, vol. 70, no. 1, January 2004 (2004-01-01), pages 167 - 173, XP002431255, ISSN: 0099-2240 *

Cited By (50)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011096808A1 (en) 2010-02-05 2011-08-11 Friesland Brands B.V. Use of sialyl oligosaccharides in weight management
WO2011096809A1 (en) 2010-02-05 2011-08-11 Friesland Brands B.V. Use of sialyl oligosaccharides to modulate the immune system
US11013773B2 (en) 2011-07-14 2021-05-25 4D Pharma Research Limited Lactic acid bacterial strains
US11266698B2 (en) 2011-10-07 2022-03-08 4D Pharma Research Limited Bacterium for use as a probiotic for nutritional and medical applications
US11414463B2 (en) 2013-04-10 2022-08-16 4D Pharma Research Limited Polypeptide and immune modulation
US10851137B2 (en) 2013-04-10 2020-12-01 4D Pharma Research Limited Polypeptide and immune modulation
US10973872B2 (en) 2014-12-23 2021-04-13 4D Pharma Research Limited Pirin polypeptide and immune modulation
US10456444B2 (en) 2014-12-23 2019-10-29 4D Pharma Research Limited Pirin polypeptide and immune modulation
US11723933B2 (en) 2014-12-23 2023-08-15 Cj Bioscience, Inc. Composition of bacteroides thetaiotaomicron for immune modulation
EP3284830A4 (de) * 2015-04-16 2018-12-19 National Center of Neurology and Psychiatry Biomarker für eine geisteskrankheit
US11655493B2 (en) 2015-04-16 2023-05-23 National Center Of Neurology And Psychiatry Biomarker for mental disease
US10864236B2 (en) 2015-06-15 2020-12-15 4D Pharma Research Limited Compositions comprising bacterial strains
US10493112B2 (en) 2015-06-15 2019-12-03 4D Pharma Research Limited Compositions comprising bacterial strains
US10322151B2 (en) 2015-06-15 2019-06-18 4D Pharma Research Limited Compositions comprising bacterial strains
US11040075B2 (en) 2015-06-15 2021-06-22 4D Pharma Research Limited Compositions comprising bacterial strains
US11273185B2 (en) 2015-06-15 2022-03-15 4D Pharma Research Limited Compositions comprising bacterial strains
US11331352B2 (en) 2015-06-15 2022-05-17 4D Pharma Research Limited Compositions comprising bacterial strains
US10736926B2 (en) 2015-06-15 2020-08-11 4D Pharma Research Limited Compositions comprising bacterial strains
US10744167B2 (en) 2015-06-15 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10391130B2 (en) 2015-06-15 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
US10780134B2 (en) 2015-06-15 2020-09-22 4D Pharma Research Limited Compositions comprising bacterial strains
US11433106B2 (en) 2015-06-15 2022-09-06 4D Pharma Research Limited Compositions comprising bacterial strains
US10500237B2 (en) 2015-06-15 2019-12-10 4D Pharma Research Limited Compositions comprising bacterial strains
US11389493B2 (en) 2015-06-15 2022-07-19 4D Pharma Research Limited Compositions comprising bacterial strains
US10471108B2 (en) 2015-11-20 2019-11-12 4D Pharma Research Limited Compositions comprising bacterial strains
US10610550B2 (en) 2015-11-20 2020-04-07 4D Pharma Research Limited Compositions comprising bacterial strains
US11058732B2 (en) 2015-11-20 2021-07-13 4D Pharma Research Limited Compositions comprising bacterial strains
US10744166B2 (en) 2015-11-23 2020-08-18 4D Pharma Research Limited Compositions comprising bacterial strains
US10391128B2 (en) 2015-11-23 2019-08-27 4D Pharma Research Limited Compositions comprising bacterial strains
US10583158B2 (en) 2016-03-04 2020-03-10 4D Pharma Plc Compositions comprising bacterial strains
US11224620B2 (en) 2016-07-13 2022-01-18 4D Pharma Plc Compositions comprising bacterial strains
US10960031B2 (en) 2016-07-13 2021-03-30 4D Pharma Plc Compositions comprising bacterial strains
US10967010B2 (en) 2016-07-13 2021-04-06 4D Pharma Plc Compositions comprising bacterial strains
US10610549B2 (en) 2016-07-13 2020-04-07 4D Pharma Plc Composition comprising bacterial strains
US10610548B2 (en) 2016-07-13 2020-04-07 4D Pharma Plc Compositions comprising bacterial strains
US10543238B2 (en) 2016-12-12 2020-01-28 4D Pharma Plc Compositions comprising bacterial strains
US10485830B2 (en) 2016-12-12 2019-11-26 4D Pharma Plc Compositions comprising bacterial strains
US10898526B2 (en) 2016-12-12 2021-01-26 4D Pharma Plc Compositions comprising bacterial strains
US11382936B2 (en) 2017-05-22 2022-07-12 4D Pharma Research Limited Compositions comprising bacterial strains
US11123378B2 (en) 2017-05-22 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11376284B2 (en) 2017-05-22 2022-07-05 4D Pharma Research Limited Compositions comprising bacterial strains
US10987387B2 (en) 2017-05-24 2021-04-27 4D Pharma Research Limited Compositions comprising bacterial strain
US11123379B2 (en) 2017-06-14 2021-09-21 4D Pharma Research Limited Compositions comprising bacterial strains
US11660319B2 (en) 2017-06-14 2023-05-30 4D Pharma Research Limited Compositions comprising bacterial strains
US11007233B2 (en) 2017-06-14 2021-05-18 4D Pharma Research Limited Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
US11779613B2 (en) 2017-06-14 2023-10-10 Cj Bioscience, Inc. Compositions comprising a bacterial strain of the genus Megasphera and uses thereof
US12048720B2 (en) 2017-06-14 2024-07-30 Cj Bioscience, Inc. Compositions comprising bacterial strains
US10792314B2 (en) 2017-07-05 2020-10-06 Evelo Biosciences, Inc. Compositions and methods of treating cancer using Bifidobacterium animalis ssp. lactis
US10576111B2 (en) 2017-07-05 2020-03-03 Evelo Biosciences, Inc. Method of treating cancer using Bifidobacterium animalis ssp. lactis strain PTA-125097
CN112063619A (zh) * 2020-08-20 2020-12-11 天津农学院 一种快速、高灵敏性检测和定量酸奶中动物双歧杆菌bb-12的方法

Similar Documents

Publication Publication Date Title
EP1997907A1 (de) Bifidobakterien
EP1997906A1 (de) Lactobacillus
US20060194241A1 (en) Lactobacillus specific probes
Claassen et al. A comparison of the efficiency of five different commercial DNA extraction kits for extraction of DNA from faecal samples
Sarma-Rupavtarm et al. Spatial distribution and stability of the eight microbial species of the altered schaedler flora in the mouse gastrointestinal tract
Masco et al. Evaluation of real-time PCR targeting the 16S rRNA and recA genes for the enumeration of bifidobacteria in probiotic products
Schwiertz et al. Quantification of different Eubacterium spp. in human fecal samples with species-specific 16S rRNA-targeted oligonucleotide probes
EP1997905A1 (de) Amplifikation von Nukleinsäure
Reiter et al. Reference genes for quantitative, reverse-transcription PCR in Bacillus cereus group strains throughout the bacterial life cycle
CN101023170B (zh) 结核菌检测用的引物和探针以及使用它们检测人型结核菌的方法
Uyeno et al. Impact of consumption of probiotic lactobacilli-containing yogurt on microbial composition in human feces
Kim et al. Development of 16S rRNA targeted PCR methods for the detection and differentiation of Vibrio vulnificus in marine environments
Duary et al. Expression of the atpD gene in probiotic Lactobacillus plantarum strains under in vitro acidic conditions using RT-qPCR
US11365452B2 (en) Composition for diagnosing or predicting risk of metabolic syndrome or metabolic syndrome-related diseases using human oral microbiome
KR101732676B1 (ko) 덤벨 구조를 갖는 핵산 증폭용 프라이머 및 이를 이용한 장내 유익균 검출방법
Garofolo et al. Development of a real time PCR taqman assay based on the TPI gene for simultaneous identification of Clostridium chauvoei and Clostridium septicum
CN1942592B (zh) 淋病奈瑟氏球菌检测
AU728893B2 (en) Process for detecting live microbiological contaminants in food product sample
AU710996B2 (en) Compositions and methods for the detection of mycobacterium kansasii
Vaugien et al. Bifidobacteria identification based on 16S rRNA and pyruvate kinase partial gene sequence analysis
JP2022025153A (ja) ビフィドバクテリウム・ブレーベに対して特異的な１以上のプライマーまたはプローブ
Scornec et al. Rapid 96-well plates DNA extraction and sequencing procedures to identify genome-wide transposon insertion sites in a difficult to lyse bacterium: Lactobacillus casei
Ongol et al. A real-time PCR method targeting a gene sequence encoding 16S rRNA processing protein, rimM, for detection and enumeration of Streptococcus thermophilus in dairy products
EP3523447B1 (de) Verfahren zur detektion von legionellen
JP2014064543A (ja) ビフィドバクテリウム・ロンガムの検出および／または定量用オリゴヌクレオチド

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK RS

17P Request for examination filed

Effective date: 20090529

17Q First examination report despatched

Effective date: 20090708

AKX Designation fees paid

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC MT NL PL PT RO SE SI SK TR

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: FRIESLAND BRANDS B.V.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20110621