EP1973568A1

EP1973568A1 - Cytotoxic antibodies targeting antibodies inhibiting factor viii

Info

Publication number: EP1973568A1
Application number: EP06831055A
Authority: EP
Inventors: Christian Behrens; Christine Gaucher; Christophe De Romeuf
Original assignee: LFB SA
Current assignee: LFB Biotechnologies SAS
Priority date: 2005-11-02
Filing date: 2006-11-02
Publication date: 2008-10-01
Also published as: FR2892724A1; WO2007051926A1; IL191150A0; US8038993B2; JP2009514516A; EP2389954A1; CN101351226A; FR2892724B1; AU2006310396A1; US20110274684A1; KR20080099231A; BRPI0619709A2; CA2638166A1; US20090130094A1

Abstract

The invention relates to an anti-idiotypical antibody targeting an antibody inhibiting the human factor VIII, said inhibiting antibody targeting the C2 region of the human factor VIII, the variable region of each of the light chains thereof being encoded by a sequence of nucleic acids of which at least 70 % is identical to the murine sequence of nucleic acids SEQ ID NO: 1, and the variable region of each of the heavy chains thereof being encoded by a sequence of nucleic acids of which at least 70 % is identical to the murine sequence of nucleic acids SEQ ID NO: 2, the constant regions of the light chains and the heavy chains being constant regions from a non-murine species. The invention also relates to the use of said antibody for activating the Fc?RIII receptors of cytotoxic immune cells, and to the production of a medicament especially for the treatment of haemophilia A.

Description

Cytotoxic antibodies to factor VIII inhibitory antibodies

The present invention relates to an anti-idiotypic antibody directed against a human factor VIII inhibitory antibody, said inhibitory antibody being directed against the C2 region of human factor VIII, whose variable region of each of the light chains is encoded by a sequence of nucleic acids having at least 70% identity with the murine nucleic acid sequence SEQ ID NO: 1, the variable region of each of its heavy chains is encoded by a nucleic acid sequence having at least 70% of identity with the murine nucleic acid sequence SEQ ID NO: 2, and wherein the constant regions of the light and heavy chains are constant regions from a non-murine species, as well as the use of this antibody to activate the FcγRIII receptors of cytotoxic immune cells, and for the manufacture of a medicament, in particular for the treatment of hemophilia A.

Introduction and prior art

Hemophilia A is a hereditary condition associated with an abnormality of the X chromosome, which results in an inability to coagulate in people with the disease. Hemophilia A is the most common defect affecting blood coagulation: it affects 1 in 5000 men in France, which represents 80% of patients with hemophilia. This disease is the result of mutations in the gene of a protein involved in coagulation, factor VIII (FVIII), which determine either a complete absence of FVIII in the blood, or a partial deficit.

The other type of hemophilia, hemophilia B, affects 20% of patients with hemophilia; it is caused by the deficiency of another factor of coagulation, factor IX.

The current treatment for hemophilia (type A or B) is to administer intravenously the deficient or missing coagulation factor. In France, FVIII for the treatment of type A hemophiliacs is available in the form of blood-derived medicinal products provided by the French Fractionation and Biotechnology Laboratory (LFB) or by international pharmaceutical laboratories, as well as in the form of recombinant medicinal products. genetic engineering. Indeed, the DNA coding for FVIII has been isolated and expressed in mammalian cells (Wood et al., Nature

(1984) 312: 330-337), and its amino acid sequence deduced from the cDNA.

The secreted FVIII is a glycoprotein with a molecular weight of 300 Kda (2332 amino acids) playing a key role in the activation of the intrinsic pathway of coagulation. Inactive FVIII consists of six domains: Al (residues 1-372), A2 (residues 373-740), B (residues 741-1648), A3 (residues 1690-2019), C1 (residues 2020-2172), and C2 (residues 2173-2332), from the N-terminus to the C-terminus. After secretion, FVIII interacts with von Willebrand factor (vWF), which protects it from plasma proteases. FVIII dissociates from vWF after cleavage by thrombin. This cleavage results in the elimination of the B domain and the formation of a heterodimer. It is in this form that FVIII circulates in the plasma. This heterodimer consists of a heavy chain (Al, A2) and a light chain (A3, Cl, C2).

When infused into a haemophiliac patient, FVIII binds to the vWF in the patient's bloodstream. Activated FVIII acts as an activated factor IX cofactor, accelerating conversion of factor X to factor X enabled. Activated Factor X converts prothrombin to thrombin. Thrombin then converts fibrinogen into fibrin and a clot appears.

The major problem encountered with the administration of FVIII is the appearance in the patient of antibodies directed against FVIII, called "inhibitory antibodies". These antibodies neutralize the procoagulant activity of FVIII, which is rendered inactive as soon as it is perfused. Thus, the coagulation factor administered is destroyed before it can stop the bleeding, which is a serious complication of hemophilia, the treatment becoming ineffective. In addition, some genetically non-haemophilic patients may develop inhibitors against endogenous FVIII: this is an acquired hemophilia.

Studies have shown that the anti-FVIII immune response is polyclonal, and primarily directed against the A2 and C2 domains (Gilles JG et al (1993) Blood, 82: 2452-2461). An animal model has been developed to study the formation of FVIII inhibitors; rats immunized with recombinant human FVIII show a fast, polyclonal immune response (Jarvis et al., Thromb Haemost, 1996 Feb; 75 (2): 318-25). The mechanisms by which anti-FVIII inhibitory antibodies interfere with the function of FVIII are numerous, and include interference in FVIII proteolytic cleavage and in the interaction of FVIII with different partners such as vWF, phospholipids (PL), factor IX, activated factor X (FXa) or APC (Activated Protein C).

There are several treatments to mitigate the consequences of this immune response, such as treatments involving desmopressin which is a synthetic hormone stimulating the production of FVIII, coagulation promoters such as concentrates prothrombin complexes or activated prothrombin complex concentrates, recombinant factor VIIa, plasmapheresis and large or intermediate amounts of FVIII infusions. However, these methods are very expensive and inefficient.

Another, more recent, strategy envisages the administration of anti-idiotypic antibodies neutralizing the inhibitory antibodies (Saint-Rémy JM et al (1999) Vox Sang; 77 (suppl 1): 21-24). A murine anti-idiotypic monoclonal antibody, 14C12, described in WO 2004/014955, in vivo reverses in a dose-dependent manner the inhibitory properties of a human FVIII inhibitory antibody. However, these antibodies only act on the neutralization of antibodies. They have no action upstream of the secretion of inhibitory antibodies.

Thus, there is an important need for new treatment tools that make it possible both to neutralize the circulating inhibitory antibodies and to act upstream of the secretion of the inhibitory antibodies in order to reduce it.

The Applicant has developed a new tool useful in the treatment of hemophilia A having both an action on secreted inhibitory antibodies and an upstream action on the precursors of secretory plasmocytes secreting inhibitory antibodies to FVIII, in particular the memory B cells.

Description

The Applicant has developed new anti-

- idiotypic cytotoxic, directed against the inhibitory antibodies of FVIII, allowing at the same time to neutralize these inhibitory antibodies circulating by binding, and to act on the memory B cells which are at the origin of the plasma cells which produce these inhibitory antibodies, by causing their lysis by a mechanism of ADCC (antibody-dependent cell lysis) .

Anti-idiotypic antibody is understood an antibody having the ability to interact ^one with the other antibody variable region. The anti-idiotypic cytotoxic antibody according to the invention is directed against any inhibitory antibody binding to any domain of human FVIII, such as the A1 domain, the A2 domain, the B domain, the A3 domain or the C1 domain. The preferred anti-idiotypic drug according to the invention is an antibody directed against a human inhibitory antibody binding to the C2 domain of FVIII.

The C2 domain of FVIII contains binding sites for phospholipids (PL) and major von Willebrand factor binding sites (vWF). PL binding is essential for the physiological activity of FVIII, particularly for the formation of the tenase complex with factor IX (FIX) and factor X (FX). VWF acts as a chaperone protein, protecting FVIII from early degradation and clearance. FVIII inhibitory antibodies to the C2 domain of FVIII are the most frequently encountered inhibitors in patients developing inhibitory antibodies. Thus, the preferred anti-idiotypic antibodies according to the invention targeting inhibitory antibodies directed against the C2 domain of FVIII are particularly interesting in that they are likely to affect a majority of patients with hemophilia A who have developed inhibitory antibodies. Thus, an object of the invention relates to an anti-idiotypic monoclonal antibody directed against a human FVIII inhibitory antibody, this inhibitory antibody being directed against the C2 region of human FVIII, the variable region of each of the light chains of the human FVIII. anti-idiotypic monoclonal antibody according to the invention being encoded by a nucleic acid sequence having at least 70% identity with the murine nucleic acid sequence SEQ ID NO: 1, the variable region of each of its heavy chains being encoded by a nucleic acid sequence having at least 70% identity with the murine nucleic acid sequence SEQ ID NO: 2, and the constant regions of its light and heavy chains being constant regions derived from an unripe species.

Advantageously, the sequence identity is at least 70%, preferably at least 80%, and still more preferably at least 95% or at least 99% identity. The percent identity is calculated by aligning the 2 sequences to be compared and counting the number of positions having an identical nucleotide, this number being divided by the total number of nucleotides of the sequence. The degeneracy of the genetic code may be at the origin of the fact that the same amino acid can be encoded by several triplets of different nucleotides. In any case, these sequence differences do not affect the specificity of the monoclonal antibody for its target, nor its ability to neutralize the inhibitory activity of the target inhibitory antibodies by binding to it. Preferably, the affinity of the antibody according to the invention for its target remains identical or almost identical.

For the purpose of the invention, the equivalent expressions "monoclonal antibody" or "monoclonal antibody composition" refer to a preparation of molecules antibodies having identical and unique specificity.

The anti-idiotypic monoclonal antibody according to the invention, in which the variable regions of the light and heavy chains belong to a species different from the constant regions of the light and heavy chains, is called a "chimeric" antibody. The chimeric anti-idiotypic antibodies according to the invention can be constructed using standard techniques of recombinant DNA, which are well known to those skilled in the art, and more particularly by using the chimeric antibody construction techniques described, for example, in Morrison. et al., Proc. Natl. Acad. Sci. USA, 81: 6851-55 (1984), where recombinant DNA technology is used to replace the constant region of a heavy chain and / or the constant region of a light chain of an antibody originating from a non-human mammal with the corresponding regions of a human immunoglobulin. Such antibodies and their method of preparation have also been described in the publication of EP 173,494, in Neuberger, MS et al., Nature 312 (5995): 604-8 (1985), as well as in EP 125 023 for example.

The murine nucleic acid sequences SEQ ID NO: 1 and SEQ ID NO: 2 encode respectively for the variable domain of each of the light chains and the variable domain of each of the heavy chains of the antibody produced by the murine hybridoma 14C12. available since 30 June 2002 to the Belgian Coordinated Collections of Microorganisms (BCCM), LMBP (plasmid collection, Laboratory for Molecular Biology, Universiteit, KL Ledeganckstraat 35, 9000 Gent, Belgium), accession number LMBP 5878CB. Clone 14C12 was described in WO 2004/014955. The murine sequences of the 14C12 antibody have been chosen to encode the variable regions of the antibody according to the invention or to derive sequences having an identity of at least 70%, advantageously at least 80%, and still more advantageous at least 90% or at least 99%, with these sequences because of the many advantageous characteristics of the variable region of the murine 14C12 antibody, described in WO 2004/014955. A first advantageous aspect of the 14C12 murine antibody is its ability to bind an inhibitory antibody directed against the C2 domain of FVIII, the BO2C11 antibody, which is a human monoclonal antibody specific for FVIII derived from the natural repertoire of a patient having developed inhibitors (Jacquemin et al., (1998), Blood 92: 496-506) and to inhibit in a dose-dependent manner the binding of this circulating inhibitory antibody to its target, the C2 domain of FVIII. The nucleotide and peptide sequences of the light and heavy chain variable regions of the BO2C11 antibody are described in WO 01/04269. In addition, the 14C12 murine antibody has the ability to dose-dependently neutralize the inhibitory properties of the BO2C11 antibody. In addition, it has been shown that the murine 14C12 antibody neutralizes in vitro 60% of the inhibition of FVIII activity observed with polyclonal FVIII inhibitory antibodies. The murine antibody 14C12 further significantly in vitro neutralizes the inhibitory activity of FVIII observed with polyclonal antibodies from a patient different from the patient causing the clone BO2C11, indicating that the murine 14C12 antibody recognizes an epitope routinely expressed on human antibodies directed against the C2 domain of FVIII. As regards the in vivo properties of the murine 14C12 antibody, it has FVIII - / - C57B1 / 6 mice injected with recombinant human FVIII and the inhibitory antibody BO2C11 were shown to inhibit, in a dose-dependent manner, the inhibitory properties of the BO2C11 antibody, thus confirming the interest of murine 14C12 antibody in therapy to treat patients with haemophilia A who have developed inhibitors against the C2 domain of FVIII. On the other hand, the 14C12 murine antibody binds with high affinity to the BO2C11 antibody, with k _on and k _off values of 10 ⁵ M ^-1 s ^-1 and 10 ⁵ s ^-1, respectively. In addition, it has been shown that the variable portion of the heavy chain of the murine antibody 14C12 contains both the C2 domain internal image made of 13 identical or homologous amino acids, and several contact residues for the variable part. of BO2C11. Finally, it has been shown that murine antibody 14C12 does not inhibit the binding of FVIII to vWF or PL. Thus, administration of the murine 14C12 antibody to patients with hemophilia A having developed inhibitory antibodies directed against the C2 domain of FVIII does not cause undesirable inhibition of the functional properties of FVIII. Advantageously, the anti-idiotypic monoclonal antibody according to the invention has all the advantageous properties related to the variable region of the 14C12 antibody.

The antibody according to the invention also has constant regions of its light and heavy chains belonging to a non-murine species. In this respect, all families and species of non-murine mammals are likely to be used, and in particular humans, monkeys, murids (except the mouse), suids, cattle, equines, felids , canids, for example, and birds, this list is not exhaustive. Preferably, the variable region of each of the light chains of the anti-idiotypic antibody of the invention is encoded by the murine nucleic acid sequence SEQ ID NO: 1, and the variable region of each of its heavy chains is encoded by the murine nucleic acid sequence SEQ ID NO: 2, the constant regions of its light and heavy chains being constant regions from a non-murine species. Advantageously, the anti-idiotypic monoclonal antibody according to the invention is produced by a cell in the form of an antibody composition, the ratio of fucose content / galactose level of the glycannic structures present on the site of glycosylation of the region. Fc antibodies, is less than or equal to 0.6. By "glycosylation site of the Fc region" is meant asparagine 297 (Asn 297, Kabat numbering), which carries an N-glycosylation site. Indeed, the constant Fc region of the antibodies consists of 2 globular domains named CH ₂ and CH ₃ . The 2 heavy chains interact closely at the CH ₃ domains while at the CH ₂ domains, the presence, on. each of the two chains, of a biantennal T-glycine, bound to the Asn 297, contributes to a separation of the two domains. Thus, in the practice of the invention, the glycan structures carried by all the glycosylation sites present in the antibody composition show a fucose / galactose ratio ratio of less than or equal to 0.6, for which it has been demonstrated in patent application FR 03 12229 that it is optimal for conferring high ADCC ("antibody-dependent cellular cytotoxicity") activity on antibodies. The anti-idiotypic antibodies according to the invention therefore have the particularity and advantage of having an increased ability to activate, by their Fc region, the Fc receptors of the cytotoxic effector cells, and in particular the FcγRIIIA receptor (also called CD16), receptor activator of cytotoxic effector cells. The effector cells that can be activated by the anti-idiotypic monoclonal antibody according to the invention are, for example, NK (Natural Killer) cells, macrophages, neutrophils, CD8 lymphocytes, Tγδ lymphocytes, NKT cells, eosinophils, basophils or mast cells. Preferably, the anti-idiotypic antibody according to the invention makes it possible to recruit NK cells. The anti-idiotypic monoclonal antibody according to the invention is said to be cytotoxic, and will make it possible to recruit effector cells via its Fc region, which will destroy the cell carrying on its surface the target of the anti-idiotypic antibody according to the invention. .

Thus, the antibody according to the invention allows the destruction of cells expressing on their surface said FVIII inhibitory antibody, which are the precursors of plasma secretory secretory FVIII inhibitory antibodies, in particular memory B cells.

In a preferred manner, the target cells are the memory B cells.

Thus, the anti-idiotypic monoclonal antibody according to the invention will, on the one hand, inhibit the binding of the inhibitory antibody to FVIII by binding to the idiotope of the inhibitory antibody, and on the other hand cause the lysis of the memory B cells expressing on their surface the target inhibitory antibody and precursors of plasmocytes secreting the inhibitory antibodies, both of these effects contributing to the reduction of the inhibitory effect of the FVIII inhibitory antibodies produced by the haemophiliac patient.

Preferably, the anti-FVIII inhibitory antibody against which the anti-idiotypic antibody of the invention is directed is the BO2C11 antibody. This antibody is a FVIII-specific human IgG4kappa monoclonal antibody derived from the natural repertoire of a hemophilia A patient with inhibitors (Jacquemin MG et al (1998) Blood 92: 496-506). The BO2C11 antibody recognizes the C2 domain and inhibits the binding of FVIII to vWF and phospholipids (PL), this mechanism of action being most commonly found in patients with inhibitory antibodies specific for the C2 domain of FVIII. In addition, the exact binding site of the BO2C11 antibody on the C2 domain was identified by X-ray analysis of Fab fragment crystals and C2 domain (Spiegel PC et al (2001) Blood 98: 13-19). . The amino acid and nucleotide sequences of the variable regions of the heavy and light chains of the BO2C11 antibody have been described in WO 01/04269, dating from 2000.

Thus, the anti-idiotypic antibody according to the invention recognizes the circulating BO2C11 antibody, as well as the membrane BO2C11 antibody (BCR) located on the surface of the BO2C11 memory cell B clone. The anti-idiotypic antibody according to the invention will therefore, on the one hand, neutralize the circulating antibody by binding thereto, and on the other hand bind to the membrane immunoglobulin, which will be followed by the link between the Fc region of the antibody according to the invention and cytotoxic cells via the Fc receptor of these cytotoxic cells. The antibody according to the invention will therefore participate in the lysis of memory B cells expressing the immunoglobulin BO2C11 on their surface. Preferably, the constant regions of each of the light chains and of each of the heavy chains of the anti-idiotypic antibody according to the invention are human constant regions. This preferred embodiment of the invention makes it possible to reduce the immunogenicity of the antibody in humans and thereby even to improve its effectiveness during its therapeutic administration in humans. In a preferred embodiment of the invention, the constant region of each of the light chains of the antibody according to the invention is of type a (kappa). Any allotype is suitable for carrying out the invention, for example Km (I), Km (I, 2), Km (I, 2, 3) or Km (3) but the preferred allotype is Km (3). In another complementary embodiment, the constant region of each of the light chains of the antibody according to the invention is of type λ (lambda). In a particular aspect of the invention, and especially when the constant regions of each of the light chains and of each of the heavy chains of the antibody according to the invention are human regions, the constant region of each of the heavy chains of the antibody is of type γ (gamma). According to this variant, the constant region of each of the heavy chains of the antibody may be of type γ1, γ2, or γ3, these three types of constant regions having the particularity of fixing the human complement, or of type γ4. Antibodies possessing a constant region of each of the γ heavy chains belong to the IgG class. Immunoglobulin type G (IgG) are heterodimers consisting of 2 heavy chains and 2 light chains, linked together by disulfide bridges. Each chain consists, in the N-terminal position, of a region or variable domain (encoded by the rearranged genes VJ for the light chain and VDJ for the heavy chain) specific for the antigen against which the antibody is directed, and in the C-terminal position, a constant region consisting of a single CL domain for the light chain or 3 domains (CH1, CH2 and CH3) for the heavy chain. The association of variable domains and CHi and CL domains of heavy and light chains forms the Fab regions, which are connected to the Fc region by a very flexible hinge region allowing each Fab to bind to its antigenic target whereas the Fc region, mediating the effector properties of the antibody, remains accessible to the effector molecules such that FcγR receptors and CIq. The Fc region, consisting of the 2 globular domains CH ₂ and CH ₃ , is glycosylated at the CH ₂ domain with the presence, on each of the 2 chains, of a biantennal γ-glycan linked to Asn 297.

Preferably, the constant region of each of the heavy chains of the antibody is of γ1 type, since such an antibody shows an ability to generate ADCC activity in the largest number of (human) individuals. In this respect, any allotype is suitable for carrying out the invention, for example GIm (3), GIm (1, 2, 17), GIm (1, 17) or GIm (I, 3). Preferably, the allotype is GIm (I, 17). In a particular aspect of the invention, the constant region of each of the heavy chains of the antibody is of type γ1, and it is encoded by a nucleic acid sequence having at least 70% identity with the sequence of human nucleic acid SEQ ID NO: 3, the constant region of each of its light chains being encoded by a sequence having at least 70% identity with the human nucleic acid sequence SEQ ID NO: 4.

Advantageously, the identity of the sequences mentioned above is at least 80%, and particularly advantageously at least 90% or 99%, the sequence modifications not modifying the functional properties of the antibody. according to the invention. Preferably, the constant region of each of the heavy chains of the antibody according to the invention is type γ1 and is encoded by the human nucleic acid sequence SEQ ID NO: 3 and the constant region of each of its light chains is encoded by the human nucleic acid sequence SEQ ID NO: 4. Thus, such an antibody possesses a murine variable region and a human constant region, with heavy chains of γ1 type. This antibody therefore belongs to the subclass of human IgG1. This antibody has two light chains whose variable domain is encoded by the murine nucleic acid sequence SEQ ID NO: 1 and the human constant region is encoded by the nucleic acid sequence SEQ ID NO: 4, and two heavy chains of which the variable domain is encoded by the murine nucleic acid sequence SEQ ID NO: 2 and the constant region is encoded by the human nucleic acid sequence SEQ ID NO: 3.

In another aspect of the invention, each of the light chains of the antibody according to the invention is encoded by a sequence having at least 70% identity with the murine-human chimeric nucleic acid sequence SEQ ID NO: 5 and each of the heavy chains is encoded by a sequence having at least 70% identity with the murine-human chimeric nucleic acid sequence SEQ ID NO: 6. Particularly advantageously, the sequence identities are at least 80%, and even more advantageously at least 90% or at least 99%, the sequence modifications do not alter the specificity of the antibody nor its functional properties. Preferably, each of the light chains of the antibody according to the invention is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of the heavy chains is encoded by the chimeric nucleic acid sequence. murine-human SEQ ID NO: 6. The murine-human chimeric nucleic acid sequence SEQ ID NO: 5 encoding each of the light chains of the antibody is obtained by fusion of the murine nucleic acid sequence SEQ ID NO: 1 coding for the variable domain of each of the light chains of the antibody and the human nucleic acid sequence SEQ ID NO: 4 coding for the constant region of each of the light chains of the antibody. The murine-human chimeric nucleic acid sequence SEQ ID NO: 6 coding for each of the heavy chains of the antibody is obtained by fusion of the murine nucleic acid sequence SEQ ID NO: 2 coding for the variable domain of each of the heavy chains of the antibody and the human nucleic acid sequence SEQ ID NO: 3 coding for the constant region of each of the heavy chains of the antibody. Advantageously, each of the light chains of the antibody according to the invention has a peptide sequence having at least 70% identity with the peptide sequence SEQ ID NO: 7, and each of the heavy chains of the antibody according to the invention. The invention has a peptide sequence having at least 70% identity with the peptide sequence SEQ ID NO: 8. Particularly advantageously, the sequence identity is at least 80%, 90%, or 95%, or 99%, the sequence modifications do not alter the specificity of the antibody or its functional properties. Preferably, the peptide sequence of each of the light chains of the antibody according to the invention is the peptide sequence SEQ ID NO: 7, and the peptide sequence of each of the heavy chains of the antibody according to the invention is the sequence Peptide SEQ ID NO: 8.

Thus, when each of the light chains of the antibody is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of the chains W

17

lourdes is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 6, the peptide sequence of each of the light chains deduced from the nucleic acid sequence SEQ ID NO: 5 is the sequence SEQ ID NO: 7 and the peptide sequence of each of the heavy chains, deduced from the nucleic acid sequence SEQ ID NO: 6, is the sequence SEQ ID NO: 8. The antibody according to the invention can be produced by any cell line, and more particularly by a

Cell line producing antibodies having high affinity for CD16.

Particularly advantageously, the antibody of the invention is produced by a rat myeloma cell line. The producing line of the antibody

According to the invention is an important feature since it gives the antibody some of its particular properties. Indeed, the means of expression of the antibodies is at the origin of the post-translational modifications, in particular modifications of the

Glycosylation, which can vary from one cell line to another, and thus confer different functional properties on antibodies having identical primary structures. In a preferred embodiment, the antibody is

Produced in YB2 / 0 rat myeloma (YB2 / 3HL.P2.GI1.16Ag20 cell, deposited at the American Type Culture Collection as ATCC number CRL-1662). This line was chosen because of its ability to produce antibodies with enhanced ADCC activity by

Compared to antibodies of the same primary structure produced for example in CHO, and the absence of production of endogenous immunoglobulins. Thus, the antibodies according to the invention produced in the YB2 / 0 cell line have an increased ability to activate

By their Fc region the Fc receptors of the cells W

18

cytotoxic compared to an antibody of the same primary structure produced in another cell line. In addition, this cell line has the particularity and advantage of producing antibodies in the form of an antibody composition, the ratio of fucose / galactose content of the glycan structures present at the glycosylation site of the Fc region of the antibodies, is less than or equal to 0.6. Advantageously, the antibody according to the invention is

10 likely to be produced by the clone R565, filed October 25, 2005, under the number 1-3510 to the National Collection of Microorganisms Culture (CNCM, 25 rue du Docteur Roux, 75724 Paris cedex 15). Advantageously, the antibody according to the invention is

The EMAB565 antibody produced by the R565 clone. Each of the light chains of the EMAB565 antibody is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 5, and each of its heavy chains is encoded by the chimeric nucleic acid sequence.

The chimeric antibody competes with the 14C12 murine antibody for FVIII binding and has an increased cytotoxic activity, much higher than that of murine 14C12, which can be attributed in part to the murine-human SEQ ID NO: 6. glycosylation

Particular N-glycan of the heavy chain of these antibodies. Indeed, the R565 clone has the particularity of producing an EMAB565 antibody composition having a fucose / galactose ratio of less than 0.6, for which it has been demonstrated in the application of

FR 03 12229 patent that it is optimal for conferring strong ADCC activity on the antibodies. This antibody is therefore particularly useful as a therapeutic tool for the treatment of pathologies in which the cells to be targeted express antibodies that inhibit FVIII. The invention also includes any monoclonal antibody having substantially the same characteristics as the EMAB565 antibody.

Another subject of the invention relates to an expression vector of the light chain of an antibody according to the invention. This vector is the vector allowing the expression of an antibody according to the invention, the light chain of which is encoded by the SED ID NO: 5 nucleic acid sequence, the deduced peptide sequence of which is the sequence SEQ ID NO: 7. This vector is a nucleic acid molecule in which the murine nucleic acid sequence SEQ ID ISTO: 1 coding for the variable domain of each of the light chains of the antibody and the nucleic acid sequence SEQ ID NO: 4 coding for the constant region of each of the light chains of the antibody were inserted, in order to introduce and maintain them in a host cell. It allows the expression of these foreign nucleic acid fragments in the host cell because it has essential sequences (promoter, polyadenylation sequence, selection gene) for selection and expression. Such vectors are well known to those skilled in the art, and may be an adenovirus, a retrovirus, a plasmid or a bacteriophage, this list not being limiting. In addition, any mammalian cell may be used as a host cell, that is to say as a cell expressing the antibody according to the invention, for example YB2 / 0, CHO, CHO dhfr- (for example CHO DX BIl, CHO DG44), CHO Lecl3, SP2 / 0, NSO, 293, BHK or COS. Another subject of the invention relates to an expression vector of the heavy chain of an antibody according to the invention. This vector is the vector allowing the expression of an antibody according to the invention, the heavy chain of which is encoded by the nucleic acid sequence SED ID NO: 6, the peptide sequence deduced from which is the SEQ ID NO: 8 sequence. This vector is a nucleic acid molecule in which the murine nucleic acid sequence SEQ ID NO: 2 coding for the variable domain of each of the heavy chains of the antibody and the acid sequence. SEQ ID NO: 3 human nucleic acid coding for the constant region of each of the heavy chains of the antibody were inserted, in order to introduce and maintain them in a host cell. It allows the expression of these foreign nucleic acid fragments in the host cell because it has essential sequences (promoter, polyadenylation sequence, selection gene) to this expression. As indicated above, the vector may be for example a plasmid, an adenovirus, a retrovirus or a bacteriophage, and the host cell may be any mammalian cell, for example YB2 / 0, CHO, CHO dhfr- (CHO DX BIl, CHO DG44), CHO Lecl3, SP2 / 0, NSO, 293, BHK or COS. An antibody produced by coexpression of the heavy chain and light chain expression vectors in the YB2 / 0 cell is illustrated by the antibody EMAB565, produced by the clone R565 (deposited under the registration number 1- 3510 to the CNCM). This antibody induces a cytotoxicity much higher than that induced by the murine 14C12 antibody in the presence of human NK cells. In addition, the EMAB565 antibody induces a secretion of IL-2 (interleukin 2) by the Jurkat-CD16 cells much stronger than the murine 14C12 antibody. The EMAB565 antibody, which can be produced by culturing the clone R565 in a culture medium and under conditions allowing the expression of the previously described vectors, is therefore a most interesting tool likely to advance the therapy and diagnosis of pathologies involving BO2C11, and more particularly hemophilia A, as well as research in this area. Another particular object of the invention is a stable cell line expressing an antibody according to the invention.

Advantageously, the stable cell line expressing an antibody according to the invention is chosen from the group consisting of: SP2 / 0, YB2 / 0, IR983F, a human myeloma such as Namalwa or any other cell of human origin such as PER. C6, the CHO lines, in particular CHO-KI, CHO-Lec10, CHO-Lec1, CHO-Lec13, CHO Pro-5, CHO dhfr- (CHO DX BI1, CHO DG44), or other lines selected from WiI-2 , Jurkat, Vero, Molt-4, COS-7, 293-HEK, BHK, K6H6, NSO, SP2 / O-Ag 14 and P3X63Ag8.653. Preferably, the line used is rat myeloma YB2 / 0. This line was chosen because of its ability to produce antibodies with improved ADCC activity compared to antibodies of the same primary structure produced for example in CHO. In a particular aspect of the invention, the stable cell line expressing an antibody according to the invention, and more particularly chosen from the group previously described, integrated the two expression vectors of the heavy chain and the light chain, such as than previously described. A particular aspect of the invention relates to the clone R565 deposited under registration number 1-3510 in the National Collection of Cultures of Microorganisms (CNCM).

The present invention also relates to any cell line producing a monoclonal antibody having a reactivity substantially similar to that of the EMAB565 antibody produced by the R565 line as described above.

Another particular object of the invention relates to an anti-idiotypic monoclonal antibody binding to a antibody directed against the C2 domain of human FVIII and produced by clone R565.

Another subject of the invention relates to a DNA fragment of sequence SEQ ID NO: 6 coding for the heavy chain of an antibody according to the invention. The murine-human chimeric nucleic acid sequence SEQ ID NO: 6 encodes each of the heavy chains of the antibody. It is obtained by melting the murine nucleic acid sequence SEQ ID NO: 2 coding for the variable region of each of the heavy chains of the antibody and the human nucleic acid sequence SEQ ID NO: 3 coding for the region. constant of each of the heavy chains of the antibody. Another particular subject of the invention relates to a DNA fragment of sequence SEQ ID NO: 5 coding for the light chain of an antibody according to the invention. The murine-human chimeric nucleic acid sequence SEQ ID NO: 5 encodes each of the light chains of the antibody. It is obtained by melting the murine nucleic acid sequence SEQ ID NO: 1 coding for the variable region of each of the light chains of the antibody and of the human nucleic acid sequence SEQ ID NO: 4 coding for the region. constant of each of the light chains of the antibody. Another subject of the invention is the use of an anti-idiotypic antibody, advantageously monoclonal, directed against a human FVIII inhibitory antibody for the recruitment, in vivo or in vitro, by the Fc region of said anti-human antibody. idiotypic, cytotoxic immune cells. Such use can be carried out with any cytotoxic anti-idiotypic antibody directed against any FVIII domain. These anti-idiotypic cytotoxic antibodies will activate the FcγR111 receptors, and especially the FcγRIIIA receptors of immune cells. cytotoxic. Advantageously, the antibody used is an antibody according to the invention as described above, and particularly advantageously it is the EMΑB565 antibody. The antibodies of the invention have the ability to activate by their Fc region the FcγRIIIA receptor. This is of considerable interest because this receptor is expressed on the surface of cells called "effector cells": the binding of the Fc region of the antibody to its receptor carried by the effector cell causes the activation of the FcγRIIIA of the effector cell and the destruction of the target cells. The effector cells are, for example, NK (Natural Killer) cells, macrophages, neutrophils, CD8 lymphocytes, Tγδ lymphocytes, NKT cells, eosinophils, basophils or mast cells.

Advantageously, such a use can be carried out for the destruction, in vivo or in vitro, of FVIII inhibitory antibody secreting plasma precursor cells, expressing on their surface an FVIII inhibitory antibody. Preferably, these cells are B cells, in particular memory B cells. Advantageously, this inhibitory antibody is directed against the C2 domain of FVIII. B-cells express on their surface a receptor for the antigen (BCR for "B-cell receptor") which consists of a membrane immunoglobulin associated with other proteins. Each B lymphocyte synthesizes only one variety of membrane immunoglobulin whose variable regions are identical to those of the secreted antibodies. By their BCR, B cells directly recognize antigens. The binding of an antigen by the BCR, if accompanied by other essential signals, can trigger the multiplication of said B lymphocyte causing clone formation by multiplication of this lymphocyte. A part of the B lymphocytes resulting from the mitoses is differentiated into circulating antibody secreting plasmocytes, the other part forming memory B lymphocytes, which are inactive at the end of this first reaction.

Patients with haemophilia A (especially severe haemophilia A) have no or very little endogenous FVIII, ie this protein is foreign to their body, and the administered FVIII can trigger an immune reaction during its first administration or subsequent administration. The binding between the administered FVIII and the BCR expressed on a B lymphocyte, provided that it is sufficiently affine, can activate the B lymphocyte, resulting in the secretion of soluble anti-FVIII antibody by plasma cells and in the formation of lymphocytes B memories expressing at the surface a BCR specific for FVIII. In the case of a new contact with FVIII, these memory B cells multiply to increase the number of memory B cells with the same specificity and differentiate into plasma cells that secrete anti-FVIII antibodies with a high affinity.

The reaction generated by the memory B lymphocytes is more intense than that generated by the naive B lymphocytes, these memory cells being more numerous and having a BCR more affine than the lymphocytes from which they originated. Moreover, the differentiation into plasma cells is faster from the memory cells than from the initial cells of the same specificity.

Membrane immunoglobulin, due to its specificity with respect to a certain antigen, is a distinguishing feature of a B lymphocyte. A B lymphocyte with an anti-FVIII BCR and giving rise to plasma secretory cells secreting FVIII inhibitory antibodies can so be targeted by an antibody binding to the portions of the immunoglobulin that give specificity to the anti-FVTII antibody. Thus, the antibody according to the invention recognizes the membrane immunoglobulin, and, thanks to the recruitment of cytotoxic immune cells by its region Fc ₇ is responsible for the lysis of the cells expressing the BCR on their surface. More particularly, such a use can be carried out for the destruction, in vivo or in vitro, of memory B cells expressing on their surface a BCR having the variable regions of the light chains (VL) and the variable regions of the heavy chains (VH) of the BO2C11 antibody. This destruction takes place via an antibody-dependent cellular elimination mechanism, in particular ADCC.

Another particular object of the invention is the use of the antibody according to the invention as a medicament. Advantageously, such a medicament is intended to treat diseases in which inhibitory antibodies to FVIII are produced.

Another object of the invention is the use of an antibody according to the invention for the manufacture of a medicament. In this regard, another subject of the invention is the use of the antibody according to the invention for the manufacture of a medicament used in the treatment of hemophilia A. For the purposes of the invention, the expression "Used in the treatment of hemophilia A" should be understood to be equivalent to the phrase "intended for the treatment of hemophilia A".

Advantageously, the hemophilia A treated is hemophilia A with inhibitors.

The anti-idiotypic antibody according to the invention can be administered to the patient at the same time as FVIII, either in the same drug, either by two separate but concomitant administrations.

Finally, a final subject of the invention relates to a pharmaceutical composition comprising an antibody according to the invention and one or more pharmaceutically acceptable excipients and / or vehicles. The excipient may be any solution, such as saline, physiological, isotonic, buffered, etc., as well as any suspension, gel, powder, etc., compatible with a pharmaceutical use and known to those skilled in the art. The compositions according to the invention may also contain one or more agents or vehicles chosen from dispersants, solubilizers, stabilizers, surfactants, preservatives, etc. On the other hand, the compositions according to the invention may comprise other agents or active principles.

Moreover, the compositions can be administered in different ways and in different forms. The administration may be carried out by any conventional route for this type of therapeutic approach, such as in particular by the systemic route, in particular by intravenous, intradermal, intratumoral, subcutaneous, intraperitoneal, intramuscular or intraarterial injection, etc. For example, intratumoral injection or injection into an area close to the tumor or irrigating the tumor may be mentioned.

The doses may vary according to the number of administrations, the association with other active ingredients, the stage of evolution of the pathology, etc.

Description of figures

Figure 1: Lysis of BO2C11 induced by the EMΑB565 antibody (noted 14C12 CH in the figure) in the presence of human NK cells. Figure 2: Secretion of IL2 by Jurkat CD16 in the presence of BO2C11 and the EMAB565 antibody (noted 14C12 CH in the figure).

Figure 3: Capping BCR BO2C11 induced by the EMAB565 antibody (noted 14C12 CH in the figure).

Figure 4: Apoptosis of BO2C11 induced by the EMAB565 antibody (noted 14C12 CH in the figure).

Figure 5: Lysis of BO2C11 induced by the antibody EMAB565 (noted 14C12 CH in the figure) in the presence of complement.

Examples

EXAMPLE 1 Construction of Expression Vectors of the Chimeric Anti-Id FavIII Antibody EMAB565

A. Determination of the leader sequence of the variable regions of the murine antibody 14C12

The total RNA of the 14C12 murine hybridoma producing immunoglobulin IgG2a, κ type was isolated. After reverse transcription, the variable domains of the light (VK) and heavy (VH) chains of the 14C12 antibody were amplified by the Rapid Amplification of DNA Ends (5'RACE) technique (GeneRacer kit, Invitrogen ref. 01).

Briefly, a first reverse transcription step was first performed using a primer located in the 5 'region of the murine CK OR Gl constant regions. A poly-dC sequence was then added at 3 'to the synthesized cDNAs before performing the amplification of the VK and VH regions using a 5' primer recognizing the poly-dC sequence and a 3 'primer, located in the murine CK OR Gl constant regions 5 'of the reverse transcription primer. The primers used for these two steps are as follows: 1. reverse transcription primers a. Murine Kappa specific antisense primer (SEQ ID NO: 19) 5 '- ACT GCC ATC AAT CTT CCA CTT GAC -3' b. Murine G2a specific antisense primer (SEQ ID NO: 20)

5'- CTG AGG GTG TAG AGG TCA GAC TG -3 '

2. 5 'RACE PCR primers a. Kappa specific antisense primer (SEQ ID NO: 21)

5 '- TTGTTCAAGAAGCACACGACTGAGGCAC -3' b. Murine G2a specific antisense primer (SEQ ID NO: 22)

5'- GAGTTCCAGGTCAAGGTCACTGGCTCAG -3 '

The VH and VK PCR products thus obtained were cloned into the pCR4Blunt-TOPO vector (Zero blunt TOPO PCR cloning kit, Invitrogen, K2875-20) and then sequenced.

The nucleotide sequence of the VK region of the 14C12 murine antibody is indicated under the sequence SEQ ID NO: 1 and the deduced peptide sequence is the sequence SEQ ID NO: 9. The VA gene; belongs to the subgroup Vκ23 [Almagro JC et al Immunogenetics (1998), 47: 355-363]. The CDR1, CDR2 and CDR3 sequences of the murine 14C12 VK region, as defined by Kabat numbering [Kabat et al., "Sequences of Proteins of Immunological Interest," NIH Publication, 91-3242 (1991)] , are indicated under the following sequences: SEQ ID NO: 13, SEQ ID NO: 14 and SEQ ID NO: 15, respectively. The CDR1-IMGT, CDR2-IMGT and CDR3-IMGT sequences of the VK region of the murine 14C12 antibody, defined according to the IMGT (International ImMunoGeneTics database) analysis [Lefranc, M. -P. et al., Dev. Comp. Immunol. , 27, 55-77 (2003)] are indicated in the following sequences: SEQ ID NO: 27, SEQ ID NO: 28 and SEQ ID NO: 29, respectively. This definition, different from that of Kabat based on the analysis of sequence variability alone, takes into account and combines the characterization of hypervariable loops [Chothia C. and Lesk AMJ Mol. Biol. 196: 901-17 (1987)] and structural analysis of antibodies by crystallography.

The nucleotide sequence of the VH region of 14C12 is the sequence SEQ ID NO: 2 and the deduced peptide sequence is the sequence SEQ ID NO: 10. The VH gene belongs to the VH1 subgroup [Honjo T. and Matsuda F. in " Immunoglobulin genes ". Honjo T. and Alt F. W. eds, Academy Press, London (1996), ppl45-171]. The CDR1, CDR2 and CDR3 sequences of the VH region of the 14C12 murine antibody, defined according to the Kabat numbering

[Kabat et al., "Sequences of Proteins of Immunological

Interest ", NIH Publication, 91-3242 (1991)], are indicated under the following sequences: SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, respectively The sequences of CDR1-IMGT, CDR2- IMGT and CDR3-IMGT of the VH region of the 14C12 murine antibody, defined according to the IMGT (International ImMunoGeneTics database) analysis [Lefranc, M.P. et al., Immunol Comp Dev., 27, 55- 77 (2003)] are indicated in the following sequences: SEQ ID NO: 30, SEQ ID NO: 31 and SEQ ID NO: 32, respectively.This definition, which is different from that of Kabat based on the single analysis of sequence variability, takes into account and combines the characterization of hypervariable loops [Chothia C. and Lesk AMJ Mol Biol 196: 901-17 (1987)] and the structural analysis of antibodies by crystallography. B. Construction of the heavy chain and light chain expression vectors of the EMAB565 chimeric antibody

1. Kappa light chain vector

The VK sequence cloned into the pCR4Blunt-TOPO sequencing vector was amplified using the following cloning primers: a) VA forward primer: (SEQ ID NO: 23) 5'-GTATACTAGTGCCGCCACCAΓGGTTTTCACACCTCAGAT -3 '

The underlined sequence corresponds to the Spe I restriction site, the bold sequence corresponds to a consensus Kozak sequence, the initiator ATG is italicized. b) antisense primer VK (SEQ ID NO: 24) 5'- TGAAGACACTTGGTGCAGCCACAGTCCQTTTTATTTCCAACTTGGTC -3 '

This primer joins the murine VK (in italic) and human constant region (CK) sequences (in bold). The underlined sequence corresponds to the Dra III restriction site.

The VK PCR product thus obtained contains the sequence encoding the natural signal peptide of the murine 14C12 antibody. This VK PCR was then cloned between the Spe I and Dra III sites of the 5 'light chain chimeric vector of the human CK constant region, whose nucleic sequence is the sequence SEQ ID NO: 4 and the deduced peptide sequence is the sequence SEQ ID No. 12. The human CK sequence of this chimeric vector was previously modified by silent mutagenesis to create a Dra III restriction site to allow the cloning of murine VK sequences. This chimerization vector contains a promoter well known to those skilled in the art, such as CMV or RSV and a human growth hormone (HGH) polyadenylation sequence, as well as the dhfr (dihydrofolate reductase) selection gene. For the expression of the EMAB565 antibody, the promoter of the chimeric vector was then replaced by the human EF-I alpha promoter.

The sequence of the light chain of the chimeric antibody EMAB565 encoded by this vector is presented in SEQ ID NO: 5 for the nucleotide sequence and corresponds to the deduced peptide sequence SEQ ID NO: 7.

2. Vector heavy chain

A similar approach has been applied for the chimericization of the heavy chain of the EMAB565 antibody. The VH sequence cloned into the pCR4Blunt-TOPO vector was first amplified using the following cloning primers: a) VH sense primer (SEQ ID NO: 25)

5'- CTATTACTAGTGCCGCCACCATGGAATGGAGTTGGATATTT -3 'The underlined sequence corresponds to the Spe I restriction site, the bold sequence corresponds to a consensus Kozak sequence, the initiating ATG is in italic.

b) VH antisense primer (SEQ ID NO: 26)

5'- GACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCGTG -3 'This primer joins the murine VH sequences (in italics) and the human Gl constant region (in bold).

The underlined sequence corresponds to the Apa I restriction site.

The amplified VH fragment contains the sequence encoding the natural signal peptide of murine 14C12 antibody. This

PCR VH was then cloned between the Spe I and Apa sites

I of the 5 'heavy chain chimeric vector of the human γ1 constant region whose nucleic sequence is the sequence SEQ ID NO: 3 and the deduced peptide sequence is the sequence SEQ ID NO: 11. chimerization contains a promoter well known to those skilled in the art, such as CMV or RSV and a bGH (bovine Growth Hormone) polyadenylation sequence as well as the neo selection gene. For the expression of the EMAB565 antibody, the promoter of the chimeric vector was then replaced by the human EF-I alpha promoter.

The sequence of the heavy chain of the chimeric antibody EMAB565 encoded by this vector is presented in SEQ ID NO: 6 for the nucleotide sequence and SEQ ID NO: 8 sequence for the deduced peptide sequence.

Example 2 Creation of a Cell Line Derived from the YB2 / 0 Line Producing the Chimeric Anti-Inhibitor Antibody of FVIII EMAB565

The YB2 / 0 rat line (ATCC # CRL-1662) was cultured in EMS medium (Invitrogen, ref 041-95181M) containing 5% fetal calf serum (FCS) (JRH Biosciences, ref 12107). For transfection, 5 million cells were electroporated (Biorad electroporator, model 1652077) in Optimix medium (Equibio, ref EKITE 1) with 25 μg of light chain vector linearized by Aat II, and 27 μg of vector linearized heavy chain. Sca I. The applied electroporation conditions were 230 volts and 960 microfarads for a 0.5 ml cuvette. Each electroporation cuvette was then distributed over 5 P96 plates with a density of 5000 cells / well. The RPMI selective medium (Invitrogen, ref 21875-034) containing 5% dialysis serum (Invitrogen, ref 10603-017), 500 μg / ml geneticin G418 (Invitrogen, ref 10131-027) and 25 nM Methotrexate (Sigma, M8407) was performed 3 days after transfection. Supernatants from the resistant transfection wells were screened for the presence of chimeric immunoglobulin (Ig) by ELISA assay specific for human Ig sequences. The transfectants producing the most antibodies were amplified in P24 plates and their supernatant redosed by ELISA in order to estimate their productivity and to select the 3 best producers for limiting dilution cloning (40 cells / plate). After cloning, the clone R565, hereinafter referred to as "R565", was selected for the production of the chimeric antibody EMAB565 and gradually adapted to the CD Hybridoma production medium (Invitrogen, ref 11279-023). The production of the chimeric antibody EMAB565 was carried out by expansion of the adapted culture in CD Hybridoma medium, obtained by dilution with 3 × 10 ⁵ cells / ml in flasks of 75 cm ² and 175 cm ² and then by dilution with 4.5 × 10 ⁵ cells. / ml in roller type bottle. After reaching the maximum volume (1 1), the culture was continued until cell viability was only 20%. After production, the chimeric EMAB565 antibody was purified by affinity chromatography on protein A (purity estimated by HPLC <95%) and monitored by polyacrylamide gel electrophoresis.

The glycan analysis of the antibody composition produced (EMAB565) was carried out by HPCE-LIF and shows a fucose content of about 7%, a galactose content of about 52% and a fuc / Gal ratio of 0.133.

Example 3; B02C11 lysis induced by the EMAB565 antibody in the presence of human NK cells

ADCC technique NK cells are isolated from PBMCs

(Peripheral Blood Mononuclear Cells) using the technique of separation on magnetic beads (MACS) from Myltenyi. NK cells are washed and resuspended in IMDM (Iscove's modified Dubelcco's

Medium) + 5% FCS (45x10 ⁵ cells / ml). Effector cells and target cells are used in a ratio of 15: 1. The target cells BO2C11 are adjusted to

3x10 ⁵ cells / ml in IMDM 5% FCS. The antibodies are diluted in IMDM 0.5% FCS (final concentration 500, 50.5, 0.5, 0.005 and 0.005 ng / ml).

The reaction mixture is composed of 50 μl of antibody, 50 μl of effector cells, 50 μl of targeted cells and 50 μl of IMDM medium in microtiter plate "996. Two negative controls are established:

Lysis without NK: the NK effector cells are replaced by IMDM + 5% FCS.

- Lyse without antibody (Ac): the antibodies are replaced by IMDM + 5% FCS.

After 16 hours of incubation at 37 ^° C. under an atmosphere enriched with 5% CO ₂ , the plates are centrifuged and the levels of intracellular LDH released into the supernatant evaluated by a specific reagent (Cytotoxicity Detection Kit 164479).

Percent lysis is estimated using a calibration range obtained with different dilutions of Triton X100 (2%) lysed target cells corresponding to 100, 50, 25 and 0% lysis respectively.

The results are calculated according to the following formula:

% lysis = (% lysis with Antibody and NK) - (% lysis without Antibody) - (% lysis without NK). The anti-idiotype antibodies of murine 14C12 FVIII and EMABling 14C12 chimeric inhibitors are studied for their ability to lyse BO2C11 cells in the presence of NK cells. Figure 1 shows that the murine 14C12 antibody does not induce lysis of BO2C11 cells while the chimeric antibody (EMABling Technology) induces a dose-dependent lysis.

EXAMPLE 4 Secretion of IL-2 by Jurkat CD16 in the Presence of BO2C11 and the EMAB565 Antibody

This test estimates the ability of antibodies to bind to the CD16 receptor (Fc gamma RIIIa) expressed on Jurkat CD16 cells and to induce secretion of IL2. For this, a 96-well plate is mixed:

50 μl of an antibody solution (final concentration at 25, 2.5, 0.25, 0.025, 0.012 μg / ml in IMDM 5% FCS),

- 50μl of PMA. (dilution at 40 ng / ml in IMDM 5% FCS), 50 μl of BO2C11 cells diluted to 6 × 10 ⁵ / ml in IMDM 5% FCS, and

50 .mu.l of Jurkat cells CDlβ (20xl0 ^e / ml in IMDM 5% FCS). After incubation overnight at 37 ° C, the plates are centrifuged, and the IL2 contained in the supernatants evaluated by the commercial kit (Quantikine from R / D). The OD reading is 450nm.

The results are expressed as IL-2 levels as a function of the antibody concentration.

The anti-idiotype antibody of FVIII inhibitors EMAB565 is investigated for its ability to induce IL2 secretion of Jurkat cells transfected with

CD16 in the presence of BO2C11 cells.

Figure 2 shows that the EMAB565 antibody induces the secretion of IL-2. Example 5: Capping of BCR-induced I ⁷ BO2C11 antibody EMAB565

BO2C11 cells (1.2X10 ⁶ cells / ml) are washed and stored in IMDM containing 5% FCS pH 7.4. The cells are incubated for 1 h, 4 h and 16 h at ^{40 °} C. and 37 ^° C. with the previously labeled antibody EMAB565 (ALEXA) at a concentration of 10 μg / ml. The capping, ie the capping of the receptors by the antibody, is visualized under a fluorescent LEICA microscope (objective x63 under immersion oil).

Different incubation times have been studied and show that the intensity of the capping is early (30 minutes) and intensifies over time. By way of example, FIG. 4 shows that at 16h, the antibodies fixed on BO2C11 are clustered on poles and not evenly distributed over the surface of the membrane. This indicates that the binding of the 14C12 CH antibody to BO2C11 induces a rearrangement of the membrane receptors and potentially the induction of a transduction signal.

EXAMPLE 6 Apoptosis of BO2C11 Induced by the EMAB565 Antibody The BO2C11 cells (2.5 × 10 ⁵ ) are incubated with the EMAB565 antibody (1 μg / ml) with or without crosslinker (F (ab2) 'goat anti-Fcγ' of human IgG at 10 μg / ml) in 1 ml of 10% FCS, in P24 plates for 24 hours at 37 ^° C. The cells are then centrifuged, washed twice with PBS, taken up in the buffer provided by the kit. and incubated with AnnexinV-FITC and propidium iodide (PI) as recommended by BD Biosciences. The cells are analyzed by flow cytometer, the percentage of apoptotic cells corresponds to cells labeled with annexin V (annexin V and annexin V + IP).

Figure 4 shows that the induction of apoptosis in the presence of EMAB565 antibody (EMABling technology) is less than 3% in the absence of cross linker and only 6.5% in the presence of cross-linker (Figure 4).

EXAMPLE 7 Lysis of B02C11 Induced by the EMAB565 Antibody in the Presence of Complement

The BO2C11 cells are washed and incubated for 1 h at 37 ^° C. with different concentrations of the EMAB565 antibody (final concentration of 0 to 2.5 μg / ml) in the presence of a complement source (Young rabbit complement Cedarlane) diluted 1: 10 in medium IMDM + SVF 5%. The cells are then centrifuged twice at 1200 rpm (270 g) for 1 minute and the supernatants are removed. The amount of intracellular LDH released into the supernatant corresponding to cell lysis is measured by a specific reagent (Cytotoxicity Detection Kit 164479).

Percent lysis is estimated using a calibration range obtained with different dilutions of Triton X-100 lysed target cells (2%) corresponding to 100, 50, 25 and 0% lysis respectively. Controls include spontaneous release (target cells only).

The results are calculated according to the following formula:

% lysis = (% lysis with Antibody and complement) - (% lysis without complement).

In FIG. 5 it is observed that the CDC (complement-dependent cytotoxicity) activity induced by the EMΑB565 antibody (EMABling technology) is at most 5% for the highest concentrations of antibodies used.

Claims

claims

An anti-idiotypic monoclonal antibody directed against a human factor VIII (FVIII) inhibitory antibody, said inhibitory antibody being directed against the C2 region of human FVIII, characterized in that the variable region of each of its light chains is encoded by a nucleic acid sequence having at least 70% identity with the murine nucleic acid sequence SEQ ID NO: 1, the variable region of each of its heavy chains is encoded by a nucleic acid sequence having at least 70% identity with the murine nucleic acid sequence SEQ ID NO: 2, and the constant regions of its light and heavy chains are constant regions from a non-murine species.

An anti-idiotypic monoclonal antibody according to claim 1, characterized in that the variable region of each of its light chains is encoded by the murine nucleic acid sequence SEQ ID NO: 1, the variable region of each of its heavy chains. is encoded by the murine nucleic acid sequence SEQ ID NO: 2, and the constant regions of its light and heavy chains are constant regions from a non-murine species.

Anti-idiotypic monoclonal antibody according to any one of claims 1 or 2, characterized in that it is produced by a cell in the form of an antibody composition, the ratio of fucose / galactose content of glycan structures present on the glycosylation site of the Fc region, is less than or equal to 0.6.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that said FVIII inhibitory antibody is the BO2C11 antibody.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the constant regions of each of its light chains and of each of its heavy chains are human constant regions.

Anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the constant region of each of its light chains is of type a.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the constant region of each of its heavy chains is of type γ.

An anti-idiotypic monoclonal antibody according to claim 7, characterized in that the constant region of each of its heavy chains is of type γ1.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the constant region of each of its heavy chains is of type γ1 and is coded by a sequence having at least 70% identity. with the human nucleic acid sequence SEQ ID NO: 3 and in that the constant region of each of its light chains is encoded by a sequence having at least 70% identity with the human nucleic acid sequence SEQ ID NO : 4.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the constant region of each of its heavy chains is of type γ1 and is encoded by the human nucleic acid sequence SEQ ID NO: 3 and in that the constant region of each of its light chains is encoded by the human nucleic acid sequence SEQ ID NO: 4.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that each of its light chains is encoded by a nucleic acid sequence having at least 70% identity with the murine chimeric nucleic acid sequence. - Human SEQ ID NO: 5 and in that each of its heavy chains is encoded by a sequence having at least 70% identity with the murine-human chimeric nucleic acid sequence SEQ ID NO: 6.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that each of its light chains is encoded by the chimeric murine-human nucleic acid sequence SEQ ID NO: 5 and in that each of its heavy chains is encoded by the murine-human chimeric nucleic acid sequence SEQ ID NO: 6.

An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that each of its light chains has a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 7 and in that each of its heavy chains has a peptide sequence having at least 70% identity with the sequence SEQ ID NO: 8.

14. An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that the peptide sequence of each of its light chains is the peptide sequence SEQ ID NO: 7 and in that the peptide sequence of each of its chains. lourdes is the peptide sequence SEQ ID NO: 8.

Anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that it is produced by a rat hybridoma cell line.

An anti-idiotypic monoclonal antibody according to claim 15, characterized in that it is produced in the YB2 / 0 rat hybridoma (YB2 / 3HL.P2.GI1 .16Ag.20 cell, deposited at the American Type Culture Collection under number ATCC CRL-1662).

17. An anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that it is capable of being produced by the clone R565 deposited under the registration number 1-3510 in the National Collection of Cultures of Microorganisms. .

18. anti-idiotypic monoclonal antibody according to any one of the preceding claims, characterized in that it is the EMAB565 antibody produced by the clone R565 deposited under the registration number 1-3510 in the National Collection of Cultures of Microorganisms.

A stable cell line expressing an antibody according to any one of claims 1 to 14.

The stable cell line of claim 19 selected from the group consisting of: SP2 / 0, YB2 / 0, IR983F, Namalwa human myeloma, PER. C6, the CHO lines, especially CHO-KI, CHO-Lec10, CHO-Lecl, CHO-Lecl3, CHO Pro-5, CHO dhfr-, Wil-2, Jurkat, Vero, MoIt-4, COS-7, 293- HEK, BHK, K6H6, MSO, SP2 / O-Ag14 and P3X63Ag8.653.

21. Clone R565 filed under registration number 1-3510 at the National Crop Collection of Canada

Microorganisms.

22. A DNA fragment of sequence SEQ ID NO: 6 coding for the heavy chain of an antibody according to any one of Claims 1 to 18.

23. DNA fragment of sequence SEQ ID NO: 5 encoding the light chain of an antibody according to one of claims 1 to 18.

24. Use of an anti-idiotypic monoclonal antibody directed against a human FVIII inhibitory antibody for the in vitro recruitment, by the Fc region of said anti-idiotypic antibody, of cytotoxic immune cells.

25. Use according to claim 24, characterized in that said antibody is an antibody according to any one of claims 1 to 18.

26. Use of an anti-idiotypic monoclonal antibody according to any one of claims 24 or 25, for the in vitro destruction of B cells, in particular memory B cells, expressing on their surface an FVIII inhibitory antibody.

27. Use of an antibody according to any one of claims 24 to 26, for the in vitro destruction of memory B cells expressing on their surface a BCR having the variable regions of the light chains (VL) and the variable regions of the heavy chains. (VH) of the BO2C11 antibody.

28. Use according to any one of claims 24 to 27, characterized in that the destruction mechanism is an antibody-dependent cell lysis mechanism (ADCC).

29. Use of an antibody according to any one of claims 1 to 18 for the manufacture of a medicament.

30. Use of an antibody according to any one of claims 1 to 18, for the manufacture of a medicament used in the treatment of hemophilia A.

31. Use of an antibody according to claim 30, characterized in that said hemophilia A is hemophilia A with inhibitors.

A pharmaceutical composition comprising an anti-idiotypic monoclonal antibody according to any one of claims 1 to 18 and one or more pharmaceutically acceptable excipients and / or carriers.