RU2800370C2 - Gipr antibody and its glp-1 function protein as well as pharmaceutical composition based on it and its use - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to an antibody or its antigen-binding fragment that specifically binds to the human gastric inhibitory polypeptide receptor (GIPR), as well as to a glucagon-like peptide-1 (GLP-1) fusion protein and a composition containing it. Also a polynucleotide encoding the said antibody and a polynucleotide encoding the said GLP-1 fusion protein, as well as a cell and a vector containing them are disclosed.

EFFECT: prevention or treatment of non-alcoholic fatty liver disease, prevention or treatment of type 2 diabetes mellitus, and also prevention or treatment of obesity.

27 cl, 5 dwg, 3 tbl

Description

FIELD OF TECHNOLOGY TO WHICH THE INVENTION RELATES

The present application provides an antibody to the gastric inhibitory polypeptide receptor (GIPR) and its fusion with glucagon-like peptide-1 (GLP-1) protein, as well as a pharmaceutical composition based on it. Also provided herein is a method of using an anti-GIPR antibody and its GLP-1 fusion protein to treat, prevent, or alleviate one or more symptoms of non-alcoholic fatty liver disease, non-alcoholic steatohepatitis, type 2 diabetes, or obesity.

BACKGROUND OF THE INVENTION

Intestinal gastric inhibitory polypeptide (GIP) is a polypeptide hormone secreted by intestinal K cells after ingestion and includes two peptide isoforms of 42 and 30 amino acids. GIP is involved in the physiological process of insulin secretion by activating the gastric inhibitory polypeptide receptor (GIPR) on the surface of pancreatic β-cells (Tseng et al. , 1996, J. Clin . Invest. 98:2440-2445; Ravn et al. , 2013, J. Biol. Chem. 288:19760-72). Since the classical biological function of GIP is similar to that of GLP-1, these peptide hormones are collectively referred to as incretins. GIPR is widely distributed in many tissues, including those of the pancreas, bone, heart, stomach, intestines, and adipose tissue (Peter et al. , 2013, J. Biol. Chem. 288:19760-72), and this diverse distribution suggests that the GIP/GIPR pathway has more biological functions than blood glucose regulation. Experimental evidence indicates that the GIP/GIPR signaling pathway is at least closely related to lipid metabolism in these tissues (Yip and Wolfe, 2000, Life Sci. 66:91-103). Experimental data also show that in obese or diabetic patients there is an increase in circulating GIP concentration (Creutzfeldt et al. , 1978, Diabetologia 14:15-24; Flatt et al. , 1984, J. Endocrinol. 101:249-256; Salera et al. , 1982, J. Clin. Endocrinol. Metab 55:329-336; Vilsb∅ll et al. , 2003, J. Clin. Endocrinol Metab. 88:2706-2713). After blocking the GIPR signal with a GIPR inhibitor, obese mice induced with a high fat diet showed significant weight loss, reduced insulin resistance, and even reversal of type 2 diabetes (Ravn et al. , 2013, J. Biol. Chem. 288:19760-72).

Long-acting glucagon-like peptide-1 analogs (GLP-1 analog) represent a new generation of drugs for type 2 diabetes (Tomlinson et al. , 2015, Expert Opin. Investig. Drugs 25:1744-7658; Gallwitz, 2015, Eur. Endocr . 11:21-25). Long-acting GLP-1 drugs are also being studied in clinical trials for the treatment of non-alcoholic fatty liver disease (NAFLD). Studies show that long-acting GLP-1 drugs have a significant effect on improving liver tissue morphology, reducing the ratio of alanine aminotransferase / glutathione aminotransferase and liver fat in patients with NAFLD (Samson et al. , 2013, J. Diabetes Complications 27:401-6; Portillo-Sanchez and Cusi, 2016, Clin. Diabetes Endocrinol . 2:9).

If GLP-1 drugs and GIPR inhibitors can be used together, including a combination of the two together, for example, as a fusion protein, then this combination can provide the effect of simultaneously alleviating insulin resistance and reducing excessive fat accumulation (obesity), with a decrease in where blood glucose levels, as well as an effect on lipid metabolism. In this regard, the GLP-1 portion can be used to improve glucose tolerance, reduce appetite, lower blood glucose, and reduce body weight; while the anti-GIPR portion can be used to reduce further fat accumulation and improve liver function. The fat reducing effect of anti-GIPR antibody and the weight loss effect of GLP-1 can be used synergistically to treat non-alcoholic fatty liver disease/non-alcoholic steatohepatitis. The present disclosure provides a fusion protein drug that will benefit patients who suffer from one or more of non-alcoholic fatty liver disease/non-alcoholic steatohepatitis, type 2 diabetes, and obesity.

BRIEF DESCRIPTION OF THE INVENTION

Provided herein is an antibody that specifically binds to GIPR, wherein the antibody is a GIPR inhibitor.

The present application also provides an antibody that specifically binds to GIPR, containing one, two, three, four, five or six amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR1 amino acid sequence: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, and SEQ ID NO:15;

b. light chain CDR2 amino acid sequence: SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, and SEQ ID NO:16;

c. light chain CDR3 amino acid sequence: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:17;

d. heavy chain CDR1 amino acid sequence: SEQ ID NO:18, SEQ ID NO:23, and SEQ ID NO:26;

e. heavy chain CDR2 amino acid sequence: SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:29;

f. heavy chain CDR3 amino acid sequence: SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, and SEQ ID NO:30.

Provided herein is a GLP-1 fusion protein comprising an antibody that specifically binds to GIPR and one, two, three, four, five, six, seven, or eight GLP-1 fragments; wherein in the fusion protein, the carboxy terminus of the GLP-1 fragment is fused to the amino terminus of the light chain or heavy chain of the anti-GIPR antibody or the amino terminus of the GLP-1 fragment is fused to the carboxy terminus of the light chain of the anti GIPR antibody.

Provided herein is a GLP-1 fusion protein comprising an anti-GIPR antibody and two GLP-1 fragments; where in the fused protein, the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the light chain of the antibody to GIPR: N'-GLP-1-linker-R-C'; or the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the heavy chain of the anti-GIPR antibody: N'-GLP-1-linker-R-C'; where N' is the amino end of the polypeptide chain of the fusion protein, C' is the carboxy end of the polypeptide chain of the fusion protein, GLP-1 is a fragment of GLP-1, R is the amino acid sequence of the light chain or heavy chain of an anti-GIPR antibody, and the linker is a peptidic linker.

Provided herein is a polynucleotide encoding an anti-GIPR antibody as described herein.

Provided herein is a polynucleotide encoding an anti-GIPR and GLP-1 antibody fusion protein as described herein.

This application provides a vector containing a polynucleotide encoding an antibody to GIPR described in this application.

This application provides a vector containing a polynucleotide encoding a fusion protein of antibodies to GIPR and GLP-1 described in this application.

This application provides a host cell containing the vector described in this application.

This application provides a pharmaceutical composition containing an antibody to GIPR described in this application, and a pharmaceutically acceptable carrier.

Provided herein is a pharmaceutical composition comprising a fusion protein of an anti-GIPR and GLP-1 antibody described herein and a pharmaceutically acceptable carrier. In addition, the present application provides the use of antibodies to GIPR, described in this application, in the preparation of a medicinal product for the treatment, prevention or reduction of the intensity of cases of the disease, which is non-alcoholic steatohepatitis.

The present application provides the use of an anti-GIPR and GLP-1 antibody fusion protein of the present application in the preparation of a medicament for the treatment, prevention or amelioration of cases of non-alcoholic fatty liver disease.

This application provides the use of an antibody to GIPR, described in this application, in the preparation of a medicinal product for the treatment, prevention or reduction of the intensity of type 2 diabetes.

The present application provides the use of an anti-GIPR and GLP-1 antibody fusion protein of the present application in the preparation of a medicament for the treatment, prevention or amelioration of type 2 diabetes.

This application provides the use of an antibody to GIPR described in this application, in the preparation of a drug for weight loss or treatment, prevention or reduction of obesity and obesity-related diseases.

The present application provides the use of an anti-GIPR and GLP-1 antibody fusion protein of the present application in the preparation of a medicament for weight loss or the treatment, prevention or amelioration of obesity and obesity-related diseases.

This application provides the use of an antibody to GIPR described in this application, in the preparation of a medicinal product for the simultaneous treatment of two or more diseases of non-alcoholic fatty liver disease, obesity or type 2 diabetes.

The present application provides the use of an anti-GIPR and GLP-1 antibody fusion protein of the present application in the preparation of a medicament for the simultaneous treatment of two or more diseases of non-alcoholic fatty liver disease, obesity, or type 2 diabetes.

Provided herein is a method of treating, preventing, or alleviating one or more of the symptoms of non-alcoholic steatohepatitis, comprising providing subjects with a therapeutically effective dose of an anti-GIPR antibody described herein.

Provided herein is a method of treating, preventing, or alleviating one or more of the symptoms of non-alcoholic steatohepatitis, comprising providing subjects with a therapeutically effective dose of an anti-GIPR and GLP-1 antibody fusion protein described herein.

Provided herein is a method of treating, preventing, or alleviating one or more symptoms of type 2 diabetes, comprising providing subjects with a therapeutically effective dose of an anti-GIPR antibody described herein.

Provided herein is a method for treating, preventing, or alleviating one or more symptoms of type 2 diabetes, comprising providing subjects with a therapeutically effective dose of an anti-GIPR and GLP-1 antibody fusion protein described herein.

Provided herein is a method for treating, preventing or alleviating one or more symptoms of obesity, comprising providing subjects with a therapeutically effective dose of an anti-GIPR antibody described herein.

Provided herein is a method for treating, preventing, or alleviating one or more symptoms of obesity, comprising providing subjects with a therapeutically effective dose of an anti-GIPR and GLP-1 antibody fusion protein described herein.

BRIEF DESCRIPTION OF GRAPHICS

1 shows the results of a FACS specific binding test of recombinantly expressed anti-hGIPR antibody L10H8 (comprising SEQ ID NO:70 and SEQ ID NO:79) to hGIPR. The gray peak and dashed peak are negative controls, the gray peak is the CHO-DHFR- blank cell background peak, the dashed-line peak is L10H8 negative binding peak to CHO-DHFR- blank cell, and the solid line peak is L10H8 specific binding peak to CHO-DHFR-hGIPR.

Figure 2 shows the concentration-inhibition curve of the hGIPR antibody L7H6 (comprising SEQ ID NO:67 and SEQ ID NO:77) antagonizing GIP activation of the hGIPR signaling pathway as determined by direct cAMP analysis (IC ₅₀ =7.6 nM, R ² =0.99).

Figure 3 shows an inhibition curve of an anti-GIPR/GLP-1 antibody GLP-1-linker-L7H6 fusion protein (comprising SEQ ID NO:67, SEQ ID NO:77, SEQ ID NO:106, SEQ ID NO:111) antagonizing GIP activation of the hGIPR signaling pathway as determined by direct cAMP assay (IC ₅₀ =14.9 nM, R ² =0.99).

Figure 4 shows an activation curve of a reporter gene experiment to test the anti-GIPR/GLP-1 antibody GLP-1-linker-L7H6 fusion protein to activate the hGLP-1R signal transduction pathway as determined by reporter gene analysis (EC ₅₀ =0.04 nM, R ² =0.99).

Figure 5 shows a time curve of the rate of change in body weight in different groups of high fat diet obese C57BL/6 mice over the efficacy testing period.

DETAILED DESCRIPTION

Definitions

Unless otherwise indicated in this application, scientific and technical terms have meanings that are understandable to ordinary specialists in this field. In general, the nomenclature and techniques related to pharmacology, biology, biochemistry, cell and tissue culture, biology, molecular biology, immunology, microbiology, genetics and chemistry of proteins and nucleic acids, and hybridization are well known and widely used in this field.

The present invention uses standard one-letter or three-letter abbreviations to refer to polynucleotide and polypeptide sequences. When writing a polypeptide sequence, the first amino acid residue (N') with an amino group is leftmost, and the last amino acid residue (C') with a carboxyl group is rightmost, for example, the GLP-1 fragment sequence included in the present invention: SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108 and SEQ ID NO:109. Reverse polypeptide sequence refers to a polypeptide sequence where the amino acids are in the reverse order of the original, such as the reverse GLP-1 fragment sequences converted from the above GLP-1 fragment sequences: SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, and SEQ ID NO:123. The 5' ends of the reverse strands of single-stranded and double-stranded nucleic acid sequences are on the left, while their 3' ends are on the right. The specific portion of the polypeptide may be represented by the number of amino acid residues, such as amino acids 80 to 130, or represented by the actual site residue, such as Lys80 to Lys130. A particular polypeptide or polynucleotide sequence can also be described with an explanation of its difference from the reference sequence.

The terms "peptide", "polypeptide" and "protein" refer to a molecule containing two or more amino acids that are linked by a peptide bond. These terms cover, for example, natural and artificial proteins and peptide analogs of protein sequences (such as mutant proteins, variants, and fusion proteins) and proteins that are post-transcriptionally or otherwise covalently or non-covalently modified. The peptide, polypeptide or protein may be a monomer or a polymer.

The term "polypeptide fragment" refers to a polypeptide that has an amino end and/or a carboxyl end that is not present in the corresponding full-length protein. For example, a fragment may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 50, 70, 80, 90, 100, 150, or 200 amino acids long. The length of the fragment may be, for example, up to 1000, 750, 500, 250, 200, 175, 150, 125, 100, 90, 80, 70, 60, 50, 40, 30, 20, 15, 14, 13, 12, 11, or 10 amino acids. The fragment may further comprise one or more additional amino acids at one or both ends, such as amino acid sequences from various naturally occurring proteins (eg Fc domains or leucine zipper domains) or artificial amino acid sequences (eg artificial bridging sequences).

The peptides of the present invention include peptides modified for any reason and by any means, for example, by (1) desensitization to proteolysis, (2) desensitization to oxidation, (3) changes in affinity for protein complex formation, (4) changes in binding affinity, and (5) conferring or changing other physicochemical or functional properties. The analog provides for a mutant polypeptide protein. For example, one or more amino acid substitutions (eg, conservative amino acid substitutions) can be made in naturally occurring sequences (eg, outside the domain of the polypeptide that forms the intramolecular contact). A "conservative amino acid substitution" is a substitution that does not significantly alter the structural characteristics of the original sequence (e.g., the amino acid substitution must not disrupt the helices present in the original sequence or interfere with other secondary structural types necessary to confer the original sequence its property or function).

A "mutant" polypeptide is characterized in that the amino acid sequence contains an insertion, deletion and/or substitution of one or more residues in the amino acid sequence relative to another polypeptide sequence. Options in the present invention include fused proteins.

A "derivative" of a polypeptide is a chemically modified polypeptide, for example by binding to other chemical moieties such as polyethylene glycol, albumin (eg human serum albumin), phosphorylation and glycosylation.

Unless otherwise indicated, the term "antibody" includes antibodies with two full length heavy chains and two full length light chains, as well as derivatives, variants, fragments and mutated proteins, examples of which are listed below.

The term "antibody" is a protein that contains an antigen-binding portion and optionally a backbone or backbone that allows the antigen-binding portion to assume a conformation that facilitates binding of an antibody to an antigen. Examples of antibodies include complete antibodies, antibody fragments (such as the antigen-binding portion of an antibody), antibody derivatives, and antibody analogs. For example, an antibody may contain alternative protein backbones or artificial backbones with transplanted CDRs or CDR derivatives. The backbone includes, without limitation, an antibody-derived backbone that is introduced, such as a backbone that stabilizes the three-dimensional structure of the antibody, and such as a fully synthetic backbone for a biocompatible polymer. See, for example, Korndorfer et al. , 2003, Proteins 53:121-129; Roque et al. , 2004, Biotechnol. Prog. 20:639-654. In addition, the antibody can be either a mock peptide antibody ("PAM") or a scaffold containing mock antibodies, where fibrin ligands are used as scaffolds.

Antibodies may have structures such as innate immunoglobulin. "Immunoglobulin" is a tetrameric molecule. In natural immunoglobulin, each tetramer consists of two identical pairs of polypeptide chains, where each pair has a "light" chain (about 25 kDa) and a "heavy" chain (about 50-70 kDa). The amino terminus of each chain includes a variable domain of approximately 100-110 amino acids, which is primarily associated with antigen recognition. The carboxyl end of each chain defines a constant region, mainly associated with the action of effectors. The human antibody light chain is divided into κ and λ light chains. The heavy chains were divided into μ, δ, α or ε and the same type of antigen was identified such as IgM, IgD, IgG, IgA and IgE. In the light and heavy chains, the variable and constant regions are connected by a "J" region of about 12 or more amino acids, and the heavy chain also includes a "D" region of about 10 or more amino acids. Reference to Fundamental Immunology, chapter 7 (edited by Paul, 2nd edition, Raven Press, 1989). The variable regions of each light/heavy chain pair form antibody binding sites, thus a complete immunoglobulin has two binding sites.

Innate immunoglobulin chains show the same basic structure as a relatively conserved skeletal region (FR) connected by three highly variable regions, also known as complementarity determining regions or CDRs. From the N-terminus to the C-terminus, the light and heavy chains contain the structural domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The distribution of amino acids in all structural domains is consistent with Kabat et al. in Sequences of Proteins of Immunological Interest, 5th edition, US Dept. Of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991.

Unless otherwise indicated, "antibody" means either an intact immunoglobulin or an antigen-binding moiety that can specifically compete for binding to an intact antibody. The antigen-binding portion can be obtained by recombinant DNA techniques, enzymatic or chemical cleavage of intact antibodies. The antigen-binding portion includes, in particular, Fab, Fab', F(ab) ₂ , Fv, structural domain antibodies (dAb) containing complementarity determining region (CDR), single-chain antibody (scFv), chimeric antibody, double-chain antibody (diabodies), three-chain (triabodies), four-chain (tetrabodies) antibodies, and a polypeptide that contains at least a portion of an immunoglobulin. that binds to a polypeptide-specific antigen.

The Fab fragment is a univalent fragment with V _L , V _H , _CL and C _H1 domains; fragment F(ab') ₂ is a bivalent fragment having two Fab-fragment connected by a disulfide bond in the hinge region; Fv fragments have V _H and V _L domains; dAb fragments have a V _H domain, a V _L domain, or antigen-binding fragments of a V _H or V _L domain (U.S. Patent Nos. US 6,846,634 and US 6,696,245; US Patent Applications Public Access Numbers US 2005/0202512, US 2004/0202995, US 2004/0038291, US 200 4/0009507 and US 2003/0039958; Ward et al. , 1989, Nature 341:544-546).

A single chain antibody (scFv) is a fusion protein in which the V _L and V _H regions are joined by a connecting element (e.g., a synthetic sequence of amino acid residues) to form a continuous protein antibody, where the connecting element is long enough to allow the protein chain to fold back and form a monovalent antigen binding site (see, for example, Bird et al. , 1988, Science 242:423-26 and Huston et al. , 1988, Proc Natl Acad Sci USA 85:5879-83).

A double chain antibody is a bivalent antibody containing two polypeptide chains, each containing a V _H and a V _L region connected by such a short junction that the two domains on the same chain cannot pair. Therefore, each domain is paired with a complementary domain in the other polypeptide chain (see, for example, Holliger et al. , 1993, Proc. Natl. Acad. Sci. USA 90:6444-48; Poljak et al. , 1994, Structure 2:11 21-23). If two polypeptide chains of a double-stranded antibody are identical, then the paired double-stranded antibody will have the same antigen-binding site. Polypeptide chains with different sequences can be used to generate double-stranded antibodies with different antigen-binding sites. Similarly, three-chain and four-chain antibodies are antibodies that contain three and four polypeptide chains and form three and four antigen-binding sites, which may be the same or different.

This article uses the method that Kabat et al. described in Sequences of Proteins of Immunological Interest, 5th edition, US Dept. Of Health and Human Services, PHS, NIH, NIH Publication No. 91-3242, 1991 to identify the complementarity determining region (CDR) and framework region (FR) of a given antibody. One or more CDRs can be incorporated into a molecule, either covalently or non-covalently, to make it an antibody. The antibody may include a larger polypeptide chain in the CDR. The CDR may(may) be covalently attached(s) to another polypeptide chain or may(may) be non-covalently incorporated(s) into the CDR. CDRs allow antibodies to specifically bind to specific associated antigens.

Antibodies may have one or more binding sites. If there is more than one binding site, then the binding site may be the same or different from the other. For example, natural human immunoglobulin typically has two identical binding sites, while "bispecific" or "bifunctional" antibodies have two different binding sites.

The term "mouse antibody" includes antibodies having one or more variable and constant regions derived from mouse immunoglobulin sequences.

The term "humanized antibody" is an antibody obtained by transplanting a sequence of complementarity-determining regions of mouse antibody molecules into a framework of human antibody variable regions.

The terms "antigen-binding domain", "antigen-binding region" or "antigen-binding site" are parts of an antibody that contain amino acid residues that interact with an antigen and contribute to its specificity and affinity for the antigen. For antibodies that specifically bind to their antigens, they will include at least a portion of at least one of its CDR domains.

The term "epitope" is the portion of a molecule that binds to (eg, an antibody) an antibody. An epitope may contain a discontinuous moiety (eg, in a polypeptide, amino acid residues that are discontinuous in the primary configuration of the polypeptide are close enough to each other in the tertiary and quaternary structures of the polypeptide to be bound by an antibody).

"Same percentage" of two polynucleotide or two polypeptide sequences is determined using the default parameter comparison sequence of the GAP computer program (GCG Wisconsin Package; part of version 10.3 (Accelrys, San Diego, CA, USA)).

The terms "polynucleotide", "oligonucleotide", and "nucleic acid" may alternatively be used throughout the text and include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), DNA or RNA analogs, and hybrids thereof prepared using nucleotide analogs (e.g., peptide nucleic acids and non-natural nucleotide analogs). Nucleic acid molecules can be single or double stranded. In one embodiment, the nucleic acid molecules of the present invention encode an antibody or fragments, derivatives, mutant proteins, or contiguous open reading frame variants thereof.

If their sequences can be reversed and parallel, then the two single-stranded nucleotides are "complementary" to each other, so that each nucleotide in one polynucleotide is opposite to the complementary nucleotide in the other, no gaps are introduced, and no unpaired nucleotides are found at the 5' or 3' ends of each sequence. If two polynucleotides can cross under moderately stringent conditions, then one polynucleotide is "complementary" to the other. Thus, one polynucleotide may be complementary to another polynucleotide, but not to its complementary sequence.

The term "carrier" is a nucleic acid that can be used to introduce another associated nucleic acid into a cell. One type of carrier is a "plasmid", referring to a linear or circular double-stranded DNA molecule that can be attached to an additional nucleic acid segment. Another type of carrier is a viral vector (eg, replication defective retroviruses, adenoviruses, and adenoviral satellite viruses) in which additional DNA segments can be introduced into the viral genome. Some carriers can autonomously replicate in host cells into which they are introduced (eg, bacterial carriers containing a bacterial origin of replication and free-type mammalian carriers). Other carriers (eg, non-free mammalian carriers) integrate into the host cell genome when introduced into the host cell and thus replicate with the host genome. An "expression carrier" is a type of carrier that can direct the expression of selected polynucleotides.

If a regulatory sequence affects the expression of a nucleotide sequence (eg, expression level, timing, or site), then the nucleotide sequence is "operably linked" to the regulatory sequence. A "regulatory sequence" is a nucleic acid that affects the expression (eg, expression level, timing, or site) of the nucleic acid to which it is operably linked. For example, regulatory genes act directly on regulated nucleic acids or through one or more other molecules (eg, polynucleotides that bind to regulatory sequences and/or nucleic acids). Examples of regulatory sequences include promoters, enhancers, and other expression control elements (eg, polyadenylation signals). Additional examples of regulatory sequences may be described, such as in Goeddel, 1990, Gene Expression Technology: Methods in Enzymology , Volume 185, Academic Press, San Diego, CA and Baron et al. , 1995, Nucleic Acids Res . 23:3605-06.

The term "host cell" refers to a cell used to express a nucleic acid, such as that provided herein. The host cell may be prokaryotes, such as E. coli, or it may be eukaryotes, such as unicellular eukaryotes (for example, yeast or other fungi), plant cells (such as tobacco or tomato plant cells), animal cells (for example, monkey cells, hamster cells, insect cells, or rat and mouse cells), or a hybridoma. Typically, the host cell is a culture cell that can be transformed or transfected with a nucleic acid encoding a peptide, which can then be expressed in the host cell. The phrase "recombinant host cell" can be used to describe a host cell that has been transformed or transfected to express the expected nucleic acid. The host cell can also be a cell that contains the nucleic acid but does not express it at the desired level, unless control sequences are introduced into the host cell so that it is operably linked to the nucleic acid. It should be appreciated that the term "host cell" refers not only to the particular cell in question, but also to the progeny or possible progeny of that cell. Due to certain modifications occurring in subsequent generations, such as mutations or environmental influences, the offspring may actually differ from the parent cell, but still fall within the scope of the terminology used in the present invention.

Intestinal gastric inhibitory polypeptide receptor

The receptor for the intestinal gastric inhibitory polypeptide belongs to the type B family of seven-stranded transmembrane G-protein coupled receptors. The receptor is coupled to one or more intracellular signal transduction pathways via a heterotrimeric guanine nucleotide binding protein (G protein) (Drucker et al. , 2006, Cell Metab . 3:153-65). So far, studies show that GIPR is mainly expressed on the surface of pancreatic β-cells and fat cells (Ravn et al. , 2013, J. Biol. Chem . 288:19760-72), is involved in both glucose and lipid metabolism in humans, and therefore is strongly associated with diabetes, obesity and related diseases (Skaw et al. , 2016, Diabetes Obes Metab 18:847-854). Both "human GIPR" and "hGIPR" as used herein refer to the human intestinal inhibitory peptide receptor and can be used interchangeably. Both the terms "mouse GIPR" and "mGIPR" as used herein refer to the mouse gastric inhibitory polypeptide receptor and can also be used interchangeably.

In one embodiment, the antibody provided in this application is an antibody that specifically binds to human GIPR. In another embodiment, the antibody provided herein is an antibody that specifically binds to GIPR on a cell membrane, and the antibody can inhibit or block GIP signaling in these cells. In another embodiment, an antibody provided herein is an antibody that specifically binds to human GIPR and can bind to GIPR of other species (eg, monkeys or mice) and block GIP signaling in those species. In a further embodiment, the antibody provided herein is a mouse antibody that binds to human GIPR and can bind to GIPR of other species (eg, monkeys).

In one embodiment, GIPR amino acid and polynucleotide sequences are provided below with sequence data from the US National Center for Biotechnology Information Gene-Bank and the European Institute for Biological Information Uniprot database:

human ( Homo sapiens ) polynucleotide sequence (SEQ ID NO:114); access number: S79852;

human amino acid sequence ( Homo sapiens ) (SEQ ID NO:113); access number: AAB35419.2;

monkey ( Rhesus macaque ) polynucleotide sequence (SEQ ID NO:116); access number: XM_015124289.1;

monkey ( Rhesus macaque ) amino acid sequence (SEQ ID NO:115); access number: XP_014979775;

mouse ( Mus musculus ) polynucleotide sequence (SEQ ID NO:118); accession number: CCDS39795 and mouse ( Mus musculus ) amino acid sequence (SEQ ID NO:117); access number: Q0P543.

Anti-intestinal gastric inhibitory polypeptide receptor (GIPR) antibody

In one embodiment, provided herein is an anti-GIPR antibody. In another embodiment, the anti-GIPR antibody provided herein is a complete anti-GIPR antibody. In another embodiment, the anti-GIPR antibody provided herein is an anti-GIPR antibody fragment. In another embodiment, the anti-GIPR antibody provided herein is a derivative of an anti-GIPR antibody. In another embodiment, the anti-GIPR antibody provided herein is a mutant anti-GIPR antibody protein. In a further embodiment, the anti-GIPR antibody provided herein is a variant of an anti-GIPR antibody.

In one embodiment, an anti-GIPR antibody provided herein comprises one, two, three, four, five, or six amino acid sequences, each independently selected from the amino acid sequences below:

a. light chain CDR1 amino acid sequence: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, and SEQ ID NO:15;

b. light chain CDR2 amino acid sequence: SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, and SEQ ID NO:16;

c. light chain CDR3 amino acid sequence: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:17;

d. heavy chain CDR1 amino acid sequence: SEQ ID NO:18, SEQ ID NO:23, and SEQ ID NO:26;

e. heavy chain CDR2 amino acid sequence: SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:29; And

f. heavy chain CDR3 amino acid sequence: SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, and SEQ ID NO:30.

Table 1 lists the amino acid sequences of the light chain CDRs of the anti-GIPR antibody provided herein, as well as the corresponding polynucleotide coding sequences. Table 2 lists the amino acid sequences of the heavy chain CDRs of the anti-GIPR antibody provided herein, as well as the corresponding polynucleotide coding sequences.

Table 1. Amino acid sequences and polynucleotide coding sequences for light chain CDRs

CDR1 CDR2 CDR3 A-1
nucleotide. post aaggccagtcaggatgtgggtactgctgtagcc
(SEQ ID NO:31) tgggcatacatccggcacact
(SEQ ID NO:32) cagcaatatagcagctatccgtggacg
(SEQ ID NO:33) A-1
amino acid KASQDVGTAVA
(SEQ ID NO:1) WAYIRHT
(SEQ ID NO:2) QQYSSYPWT
(SEQ ID NO:3) A-2
nucleotide. post agacccagtgaaagtgttgatagttatggcaatagttttatgcac
(SEQ ID NO:34) cttgcatccaacctagaatct
(SEQ ID NO:35) cagcaaaataatgaggatcctcggacg
(SEQ ID NO:36) A-2
amino acid RPSESVDSYGNSFMH
(SEQ ID NO:4) LASNLES
(SEQ ID NO:5) QQNNEDPRT
(SEQ ID NO:6) A-3
nucleotide. post aaggcaagtgaggacatatataatcggttcgcc
(SEQ ID NO:37) gatgcaaccagtttggaaact
(SEQ ID NO:38) caacagtattggagtattccgtggacg
(SEQ ID NO:39) A-3
amino acid KASEDIYNRFA
(SEQ ID NO:7) DATSLET
(SEQ ID NO:8) QQYWSIPWT
(SEQ ID NO:9) A-4
nucleotide. post agggccagccaaagtgtcaatacatctgtctatagtttatatacacac
(SEQ ID NO:40) tatgcatccaacctagaatct
(SEQ ID NO:41) caacacagttgggattttccttacacg
(SEQ ID NO:42) A-4
amino acid RASQSVNTSVYSYIH
(SEQ ID NO:10) YASNLES
(SEQ ID NO:11) QHSWDFPYT
(SEQ ID NO:12) A-5
nucleotide. post agagccagccagtccgtgaacacagccgtgtactcttatatccac
(SEQ ID NO:43) tatgcatccaacctagaatct
(SEQ ID NO:41) cagcacagcttcgatttcccctacacc
(SEQ ID NO:44) A-5
amino acid RASQSVNTAVYSYIH
(SEQ ID NO:13) YASNLES
(SEQ ID NO:11) QHSFDFPYT
(SEQ ID NO:14) A-6
nucleotide. post aaggcgagtcaggacattaatagctatttaagc
(SEQ ID NO:45) gcaaacagattggtagat
(SEQ ID NO:46) ctacagtatgatgagtttccattcacg
(SEQ ID NO:47) A-6
amino acid KASQDINSYLS
(SEQ ID NO:15) ANRLVD
(SEQ ID NO:16) LQYDEFPFT
(SEQ ID NO:17)

Table 2. Amino acid sequences and polynucleotide coding sequences of heavy chain CDRs

CDR1 CDR2 CDR3 A-1
nucleotide. post ggattcactttcagtagctatgccatgtct
(SEQ ID NO:48) tccattagtagtggtggtgccacctactatccagacagtgtgaag
(SEQ ID NO:49) ggcgagggcggtagtagctacccggcctggtttgctttc
(SEQ ID NO:50) A-1
amino acid GFTFSSYAMS
(SEQ ID NO:18) SISSGGATYYPDSVKG
(SEQ ID NO:19) GEGGSSYPAWFAF
(SEQ ID NO:20) A-2
nucleotide. post ggattcactttcagtagctatgccatgtct
(SEQ ID NO:48) gaaattagtagtggtggtagttacacctactatccagacactgtgacggggc
(SEQ ID NO:51) gataaggcgactcgaactggcatgggattttttttaccatactatggactac
(SEQ ID NO:52) A-2
amino acid GFTFSSYAMS
(SEQ ID NO:18) EISSGGSYTYYPDTVTG
(SEQ ID NO:21) DKATRTGMGFFYHTMDY
(SEQ ID NO:22) A-3
nucleotide. post ggctacacattcagtaggtactggatagag
(SEQ ID NO:53) gagattttacctggaagtgatagtcctaactacaatgagaagttcaagggc
(SEQ ID NO:54) acggtagtagctacaaggtttgcttac
(SEQ ID NO:55) A-3
amino acid GYTFSRYWIE
(SEQ ID NO:23) EILPGSDSPNYNEKFK
(SEQ ID NO:24) TVVATRFAY
(SEQ ID NO:25) A-4
nucleotide. post ggctactcaatcaccagtgattatgcctggaac
(SEQ ID NO:56) tacataagctacagaggcatcgctacctataaaccatctctcaaaagt
(SEQ ID NO:57) ggggaatacggccccggcaactttgacttc
(SEQ ID NO:58) A-4
amino acid GYSITSDYAWN
(SEQ ID NO:26) YISYRGIATYKPSLKS
(SEQ ID NO:27) GEYGPGNDFDF
(SEQ ID NO:28) A-5
nucleotide. post ggctactcaatcaccagtgattatgcctggaac
(SEQ ID NO:56) tacataagctacagaggcatcgctacctataaaccatctctcaaaagt
(SEQ ID NO:57) ggggaatacggccccggcaactttgacttc
(SEQ ID NO:58) A-5
amino acid GYSITSDYAWN
(SEQ ID NO:26) YISYRGIATYKPSLKS
(SEQ ID NO:27) GEYGPGNDFDF
(SEQ ID NO:28) A-6
nucleotide. post ggctactcaatcaccagtgattatgcctggaac
(SEQ ID NO:56) tacatgagctaccgtggtaccgcaacgtacaatccatttctcaaaagt
(SEQ ID NO:59) tatgattacgacgttccccggttttccttac
(SEQ ID NO:60) A-6
amino acid GYSITSDYAWN
(SEQ ID NO:26) YMSYRGTATYNPFLKS
(SEQ ID NO:29) YDYDVPRFPY
(SEQ ID NO:30)

In one embodiment, an antibody provided herein contains a sequence that differs from that of the CDR amino acid sequences shown in Tables 1 and 2 by five, four, three, two, or one addition, substitution, and/or deletion of a single amino acid. In another embodiment, the antibody provided in this application contains a sequence that differs from that of the amino acid sequences of the CDRs shown in tables 1 and 2, four, three, two or one addition, substitution and/or deletion of a single amino acid.

In another embodiment, the antibody provided in this application contains a sequence that differs from that of the amino acid sequences of the CDRs shown in tables 1 and 2, three, two or one addition, substitution and/or deletion of a single amino acid.

In another embodiment, the antibody provided in this application contains a sequence that differs from that of the amino acid sequences of the CDRs shown in tables 1 and 2, two or one addition, substitution and/or deletion of a single amino acid.

In additional embodiments, the implementation of the antibody presented in this application contains a sequence that differs from that of the CDR amino acid sequences shown in tables 1 and 2, the addition, substitution and/or deletion of a single amino acid.

In one embodiment, the anti-GIPR antibody provided herein comprises one or two amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR1 amino acid sequences: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, and SEQ ID NO:15 and

b. heavy chain CDR1 amino acid sequences: SEQ ID NO:18, SEQ ID NO:23, and SEQ ID NO:26.

In another embodiment, the anti-GIPR antibody provided herein comprises one or two amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR2 amino acid sequences: SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, and SEQ ID NO:16 and

b. heavy chain CDR2 amino acid sequences: SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:29.

In another embodiment, the anti-GIPR antibody provided herein comprises one, two, three, or four amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR3 amino acid sequences: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:17 and

b. heavy chain CDR3 amino acid sequences: SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, and SEQ ID NO:30.

In another embodiment, the anti-GIPR antibody provided herein comprises one, two, three, or four amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR1 amino acid sequences: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, and SEQ ID NO:15;

b. heavy chain CDR1 amino acid sequences: SEQ ID NO:18, SEQ ID NO:23, and SEQ ID NO:26;

c. light chain CDR2 amino acid sequences: SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, and SEQ ID NO:16; And

d. heavy chain CDR2 amino acid sequences: SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:29.

In another embodiment, the anti-GIPR antibody provided herein comprises one, two, three, or four amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR1 amino acid sequences: SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:13, and SEQ ID NO:15;

b. heavy chain CDR1 amino acid sequences: SEQ ID NO:18, SEQ ID NO:23, and SEQ ID NO:26;

c. light chain CDR3 amino acid sequences: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:17; And

d. heavy chain CDR3 amino acid sequences: SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, and SEQ ID NO:30.

In additional embodiments, an anti-GIPR antibody provided herein comprises one, two, three, or four amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below:

a. light chain CDR2 amino acid sequences: SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:11, and SEQ ID NO:16;

b. heavy chain CDR2 amino acid sequences: SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:24, SEQ ID NO:27, and SEQ ID NO:29;

c. light chain CDR3 amino acid sequences: SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:17; And

d. heavy chain CDR3 amino acid sequences: SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:25, SEQ ID NO:28, and SEQ ID NO:30.

In one embodiment, an anti-GIPR antibody provided herein comprises one, two, or three amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, and SEQ ID NO:17.

In another embodiment, the anti-GIPR antibody provided herein comprises one, two, or three amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequences below: SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SE Q ID NO:27, SEQ ID NO:28, SEQ ID NO:29, and SEQ ID NO:30.

In one embodiment, the anti-GIPR antibody provided herein comprises a combination of light chain and heavy chain CDR1 amino acid sequences independently selected from the following list: SEQ ID NO:1 and SEQ ID NO:18, SEQ ID NO:4 and SEQ ID NO:18, SEQ ID NO:7 and SEQ ID NO:23, SEQ ID NO:10 and SEQ ID NO:26, SEQ ID NO:13 and SEQ ID NO:26, and SEQ ID NO:15 and SEQ ID NO:26.

In another embodiment, the anti-GIPR antibody provided herein comprises a combination of light chain and heavy chain CDR2 amino acid sequences independently selected from the following list: SEQ ID NO:2 and SEQ ID NO:19, SEQ ID NO:5 and SEQ ID NO:21, SEQ ID NO:8 and SEQ ID NO:24, SEQ ID NO:11 and SEQ ID NO:27, and SEQ ID NO:16 and SEQ ID NO:29 .

In additional embodiments, an anti-GIPR antibody provided herein comprises a combination of light chain and heavy chain CDR3 amino acid sequences independently selected from the following list: SEQ ID NO:3 and SEQ ID NO:20, SEQ ID NO:6 and SEQ ID NO:22, SEQ ID NO:9 and SEQ ID NO:25, SEQ ID NO:12 and SEQ ID NO:28, SEQ ID NO:14 and SEQ ID NO:28, and SEQ ID NO:17 and SEQ ID NO:30.

In one embodiment, the anti-GIPR antibody provided herein comprises

a. a combination of light and heavy chain CDR1 amino acid sequences independently selected from the list below: SEQ ID NO:1 and SEQ ID NO:18, SEQ ID NO:4 and SEQ ID NO:18, SEQ ID NO:7 and SEQ ID NO:23, SEQ ID NO:10 and SEQ ID NO:26, SEQ ID NO:13 and SEQ ID NO:26, and SEQ ID NO:15 and SEQ ID NO:26; And

b. a combination of light and heavy chain CDR2 amino acid sequences independently selected from the list below: SEQ ID NO:2 and SEQ ID NO:19, SEQ ID NO:5 and SEQ ID NO:21, SEQ ID NO:8 and SEQ ID NO:24, SEQ ID NO:11 and SEQ ID NO:27, and SEQ ID NO:16 and SEQ ID NO:29.

In another embodiment, the anti-GIPR antibody provided herein comprises

a. a combination of light and heavy chain CDR1 amino acid sequences independently selected from the list below: SEQ ID NO:1 and SEQ ID NO:18, SEQ ID NO:4 and SEQ ID NO:18, SEQ ID NO:7 and SEQ ID NO:23, SEQ ID NO:10 and SEQ ID NO:26, SEQ ID NO:13 and SEQ ID NO:26, and SEQ ID NO:15 and SEQ ID NO:26; And

b. a combination of light and heavy chain CDR3 amino acid sequences independently selected from the list below: SEQ ID NO:3 and SEQ ID NO:20, SEQ ID NO:6 and SEQ ID NO:22, SEQ ID NO:9 and SEQ ID NO:25, SEQ ID NO:12 and SEQ ID NO:28, SEQ ID NO:14 and SEQ ID NO:28, and SEQ ID NO:17 and SEQ ID NO:30.

In another embodiment, the anti-GIPR antibody provided herein comprises

a. a combination of light and heavy chain CDR2 amino acid sequences independently selected from the list below: SEQ ID NO:2 and SEQ ID NO:19, SEQ ID NO:5 and SEQ ID NO:21, SEQ ID NO:8 and SEQ ID NO:24, SEQ ID NO:11 and SEQ ID NO:27, and SEQ ID NO:16 and SEQ ID NO:29; And

b. a combination of light and heavy chain CDR3 amino acid sequences independently selected from the list below: SEQ ID NO:3 and SEQ ID NO:20, SEQ ID NO:6 and SEQ ID NO:22, SEQ ID NO:9 and SEQ ID NO:25, SEQ ID NO:12 and SEQ ID NO:28, SEQ ID NO:14 and SEQ ID NO:28, and SEQ ID NO:17 and SEQ ID NO:30.

In a further embodiment, the anti-GIPR antibody provided herein comprises

a. a combination of light and heavy chain CDR1 amino acid sequences independently selected from the list below: SEQ ID NO:1 and SEQ ID NO:18, SEQ ID NO:4 and SEQ ID NO:18, SEQ ID NO:7 and SEQ ID NO:23, SEQ ID NO:10 and SEQ ID NO:26, SEQ ID NO:13 and SEQ ID NO:26, and SEQ ID NO:15 and SEQ ID NO:26;

b. a combination of light and heavy chain CDR2 amino acid sequences independently selected from the list below: SEQ ID NO:2 and SEQ ID NO:19, SEQ ID NO:5 and SEQ ID NO:21, SEQ ID NO:8 and SEQ ID NO:24, SEQ ID NO:11 and SEQ ID NO:27, and SEQ ID NO:16 and SEQ ID NO:29; And

c. a combination of light and heavy chain CDR3 amino acid sequences independently selected from the list below: SEQ ID NO:3 and SEQ ID NO:20, SEQ ID NO:6 and SEQ ID NO:22, SEQ ID NO:9 and SEQ ID NO:25, SEQ ID NO:12 and SEQ ID NO:28, SEQ ID NO:14 and SEQ ID NO:28, and SEQ ID NO:17 and SEQ ID NO:30.

In one embodiment, the anti-GIPR antibody provided herein comprises

a. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:18, SEQ ID NO:19, and SEQ ID NO:20;

b. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:18, SEQ ID NO:21, and SEQ ID NO:22;

c. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:23, SEQ ID NO:24, and SEQ ID NO:25;

d. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28;

e. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:13, SEQ ID NO:11, SEQ ID NO:14, SEQ ID NO:26, SEQ ID NO:27, and SEQ ID NO:28; or

f. a combination of light chain and heavy chain CDR1, CDR2 and CDR3 amino acid sequences: SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:26, SEQ ID NO:29, and SEQ ID NO:30.

In one embodiment, the anti-GIPR antibody provided herein comprises one or two amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequence below:

a. light chain variable domain amino acid sequences: SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO:71; and an amino acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to any of the above sequences; And

b. heavy chain variable domain amino acid sequences: SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, and SEQ ID NO:80; and an amino acid sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to any of the above sequences.

In another embodiment, the polynucleotide coding sequence for an anti-GIPR antibody provided herein includes one or two polynucleotide coding sequences, where each polynucleotide coding sequence is independently selected from the polynucleotide sequences below:

a. light chain variable domain polynucleotide coding sequences: SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:83, SEQ ID NO:84, SEQ ID NO:85, SEQ ID NO:86, SEQ ID NO:87, SEQ ID NO:88, SEQ ID NO:89, SEQ ID NO:90, and SEQ ID NO:91; and a polynucleotide sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to any of the above sequences; And

b. heavy chain variable domain polynucleotide coding sequences: SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:99, and SEQ ID NO:100; and a polynucleotide sequence that is at least 80%, at least 85%, at least 90%, or at least 95% identical to any of the above sequences.

In one embodiment, the anti-GIPR antibody provided herein comprises an amino acid sequence independently selected from the following list: SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, and SEQ ID NO: 71.

In another embodiment, the anti-GIPR antibody provided herein comprises an amino acid sequence independently selected from the following list: SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO:78, SEQ ID NO:79, and SEQ ID NO:80.

In one embodiment, an anti-GIPR antibody provided herein comprises a combination of amino acid sequences independently selected from the light chain and heavy chain variable domain amino acid sequences listed below: SEQ ID NO:61 and SEQ ID NO:72, SEQ ID NO:62 and SEQ ID NO:73, SEQ ID NO:63 and SEQ ID NO:74, SEQ ID NO:64 and SEQ ID NO:74, SEQ ID NO:65 and SE Q ID NO:75, SEQ ID NO:66 and SEQ ID NO:76, SEQ ID NO:67 and SEQ ID NO:77, SEQ ID NO:68 and SEQ ID NO:77, SEQ ID NO:69 and SEQ ID NO:78, SEQ ID NO:70 and SEQ ID NO:79, and SEQ ID NO:71 and SEQ ID NO:80.

In one embodiment, the anti-GIPR antibody provided herein comprises an amino acid sequence independently selected from the following list: SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:76, and SEQ ID NO:77.

In another embodiment, the anti-GIPR antibody provided herein comprises a combination of amino acid sequences independently selected from the light chain and heavy chain variable domain amino acid sequences listed below: SEQ ID NO:61 and SEQ ID NO:72 (L1H1), SEQ ID NO:62 and SEQ ID NO:73 (L2H2), SEQ ID NO:63 and SEQ ID NO:74 (L3H3), SEQ ID NO:64 and SEQ ID NO:74 (L4H3), SEQ ID NO:65 and SEQ ID NO:75 (L5H4), SEQ ID NO:66 and SEQ ID NO:76 (L6H5), SEQ ID NO:67 and SEQ ID NO:77 (L7H6), SEQ ID NO:68 and SEQ ID NO:77 (L8H6), SEQ ID NO:69 and SEQ ID NO:78 (L9H7), SEQ ID NO:70 and SEQ ID NO:79 (L10H8), and SEQ ID NO:71 and SEQ ID NO:80 (L11H9).

The symbol "LxHy" can also be used herein in relation to the anti-GIPR antibody provided herein, where "x" corresponds to the light chain variable region sequence code and "y" corresponds to the heavy chain variable region sequence code. For example, L2H2 is a complete antibody with a light chain variable region containing the amino acid sequence of SEQ ID NO:62 (L2) and a heavy chain variable region containing the amino acid sequence of SEQ ID NO:73 (H2).

In one embodiment, the anti-GIPR antibody provided herein comprises one or two amino acid sequences, where each amino acid sequence is independently selected from the amino acid sequence below:

a. light chain constant domain amino acid sequences: SEQ ID NO:101 and SEQ ID NO:102; And

b. heavy chain constant domain amino acid sequences: SEQ ID NO:103 and SEQ ID NO:104 and SEQ ID NO:124.

In one embodiment, an anti-GIPR antibody provided herein comprises one or two amino acid sequences, wherein each amino acid sequence is independently selected from a combination of the light chain and heavy chain constant domain amino acid sequences below: SEQ ID NO:101 and SEQ ID NO:103, SEQ ID NO:101 and SEQ ID NO:104, SEQ ID NO:102 and SEQ ID NO:103, and SEQ ID NO:102 and SE QID NO:104. In another embodiment, the anti-GIPR antibody provided herein comprises one or two amino acid sequences, wherein each amino acid sequence is independently selected from a combination of the light chain and heavy chain constant domain amino acid sequences of SEQ ID NO:101 and SEQ ID NO:124, and SEQ ID NO:102 and SEQ ID NO:124.

In one embodiment, the anti-GIPR antibodies provided herein comprise the light and heavy chain CDRs provided herein and the FR (framework) amino acid sequences. The FR amino acid sequences are contained in the light chain or heavy chain variable domain and are not displayed separately. In one embodiment, the antibody contains the light chain CDR1 sequence provided herein. In another embodiment, the antibody contains the light chain CDR2 sequence provided herein. In another embodiment, the antibody contains the light chain CDR3 sequence provided herein. In another embodiment, the antibody comprises the heavy chain CDR1 sequence provided herein. In another embodiment, the antibody contains the heavy chain CDR2 sequence provided herein. In another embodiment, the antibody comprises the heavy chain CDR3 sequence provided herein. In another embodiment, the antibody contains the light chain FR1 sequence provided herein. In another embodiment, the antibody contains the light chain FR2 sequence provided herein. In another embodiment, the antibody contains the light chain FR3 sequence provided herein. In another embodiment, the antibody contains the light chain FR4 sequence provided herein. In another embodiment, the antibody comprises the heavy chain FR1 sequence provided herein. In another embodiment, the antibody contains the heavy chain FR2 sequence provided herein. In another embodiment, the antibody comprises the heavy chain FR3 sequence provided herein. In a further embodiment, the antibody comprises the heavy chain FR4 sequence provided herein.

In one embodiment, the antibody light chain CDR3 sequence differs from SEQ ID NO:6, SEQ ID NO:12, and SEQ ID NO:14 of the light chain CDR3 sequences illustrated above by no more than six, five, four, three, two, or one amino acid(s) addition(s), substitution(s), and/or deletion(s). In another embodiment, the antibody heavy chain CDR3 sequence differs from SEQ ID NO:22 and SEQ ID NO:28 of the heavy chain CDR3 sequences illustrated above by no more than six, five, four, three, two, or one amino acid addition(s), substitution(s), and/or deletion(s). In a further embodiment, the antibody light chain CDR3 sequence differs from SEQ ID NO:6, SEQ ID NO:12, and SEQ ID NO:14 of the light chain CDR3 sequences illustrated above by no more than six, five, four, three, two, or one amino acid addition(s), substitution(s), and/or deletion(s), and the antibody heavy chain CDR3 sequence differs from SEQ ID NO:22 and SEQ ID NO: 28 heavy chain CDR3 sequences illustrated above with no more than six, five, four, three, two or one amino acid(s) addition(s), substitution(s) and/or deletion(s). In another embodiment, the antibody further comprises a combination of one, two, three, four, five, or six of the light and heavy chain CDR sequences illustrated above.

In one embodiment, the anti-GIPR antibody provided herein comprises a light chain variable domain amino acid sequence selected from the light chain variable domain sequences L2 (SEQ ID NO:62), L3 (SEQ ID NO:63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68) provided herein. In one embodiment, the amino acid sequence of the light chain variable domain of an anti-GIPR antibody differs from the amino acid sequence of one light chain variable domain of L2 (SEQ ID NO:62), L3 (SEQ ID NO:63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68) by fifteen, fourteen, thirteen, twelve, eleven, ten, nine, eight, seven, six, five, four, three, two, or one amino acid differences, where the difference in each sequence is independently a deletion, insertion, or substitution of an amino acid residue. In another embodiment, the light chain variable domain of an anti-GIPR antibody comprises an amino acid sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the amino acid sequence of one light chain variable domain L2 (SEQ ID NO:62), L3 (SEQ ID NO: 63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68). In another embodiment, the polynucleotide coding sequence of the light chain variable domain of an anti-GIPR antibody comprises a nucleotide coding sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to one polynucleotide coding sequence L2 (SEQ ID NO:62), L 3 (SEQ ID NO:63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68). In another embodiment, the polynucleotide coding sequence for the light chain variable domain of an anti-GIPR antibody comprises polynucleotide sequences that hybridize under moderate conditions to a single complementary polynucleotide coding sequence L2 (SEQ ID NO:62), L3 (SEQ ID NO:63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68). In a further embodiment, the polynucleotide coding sequence for a light chain variable domain of an anti-GIPR antibody comprises a polynucleotide sequence that hybridizes under stringent conditions to a complementary polynucleotide coding sequence for one light chain variable domain of L2 (SEQ ID NO:62), L3 (SEQ ID NO:63), L4 (SEQ ID NO:64), L6 (SEQ ID NO:66), L7 (SEQ ID NO:67), and L8 (SEQ ID NO:68).

In one embodiment, the anti-GIPR antibody provided herein comprises a heavy chain variable domain amino acid sequence selected from the H2 (SEQ ID NO:73), H3 (SEQ ID NO:74), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77) heavy chain variable domain sequences provided herein. In another embodiment, the amino acid sequence of the heavy chain variable domain of the anti-GIPR antibody differs from one sequence of the heavy chain variable domain H2 (SEQ ID NO:73), H3 (SEQ ID NO:74), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77) by fifteen, fourteen, thirteen, twelve, eleven, ten, nine, eight, seven, six, five, four, three, two, or one amino acid residue, where the difference in each sequence is independently a deletion, insertion, or substitution of one amino acid residue. In another embodiment, the heavy chain variable domain of an anti-GIPR antibody comprises an amino acid sequence at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to one heavy chain variable domain sequence H2 (SEQ ID NO:73), H3 (SEQ ID NO:74 ), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77). In another embodiment, the heavy chain variable domain of an anti-GIPR antibody comprises a polynucleotide coding sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or at least 99% identical to one polynucleotide coding sequence of the heavy chain variable domain H2 (SEQ ID NO:73), H 3 (SEQ ID NO:74), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77). In another embodiment, the heavy chain variable domain polynucleotide coding sequence of an anti-GIPR antibody comprises a polynucleotide sequence hybridizable to a complementary polynucleotide coding sequence of one heavy chain variable domain of H2 (SEQ ID NO:73), H3 (SEQ ID NO:74), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77) under moderately stringent conditions. In one embodiment, the polynucleotide coding sequence of the heavy chain variable domain of an anti-GIPR antibody comprises a polynucleotide sequence hybridized under stringent conditions to a complementary polynucleotide coding sequence of one heavy chain variable domain of H2 (SEQ ID NO:73), H3 (SEQ ID NO:74), H5 (SEQ ID NO:76), and H6 (SEQ ID NO:77).

In an embodiment, an antibody provided herein is an antibody comprising a combination of L1H1 (SEQ ID NO:61 and SEQ ID NO:72), L2H2 (SEQ ID NO:62 and SEQ ID NO:73), L3H3 (SEQ ID NO:63 and SEQ ID NO:74), L4H3 (SEQ ID NO:64 and SEQ ID NO:74), L5H4 (SEQ ID NO:65 and SEQ ID NO:75), L6H5 (SEQ ID NO:66 and SEQ ID NO:76), L7H6 (SEQ ID NO:67 and SEQ ID NO:77), L8H6 (SEQ ID NO:68 and SEQ ID NO:77), L9H7 (SEQ ID NO:69 and SEQ ID NO:78), L10H8 (SEQ ID NO:70 and SEQ ID NO:79), or L11H9 (SEQ ID NO:79) :71 and SEQ ID NO:80), or the desired phenotype (eg, IgA, IgG1, IgG2a, IgG2b, IgG3, IgM, IgE, or IgD) or a Fab or F(ab')2 fragment thereof.

In an embodiment, the antibody provided herein is an antibody comprising a combination of L2H2 (SEQ ID NO:62 and SEQ ID NO:73), L3H3 (SEQ ID NO:63 and SEQ ID NO:74), L4H3 (SEQ ID NO:64 and SEQ ID NO:74), L6H5 (SEQ ID NO:66 and SEQ ID NO:76), L7H6 (SEQ ID NO:67 and SEQ ID NO:77), or L8H6 (SEQ ID NO:68 and SEQ ID NO:77), or the desired phenotype (e.g., IgA, IgG1, IgG2a, IgG2b, IgG3, IgM, IgE, or IgD) or a Fab or F(ab')2 fragment thereof.

The antibodies presented in this application may contain any of the constant regions known in the art. The light chain constant region may, for example, be a κ or λ light chain constant region, such as a mouse κ or λ light chain constant region. The heavy chain constant region may, for example, be a heavy α, δ, ε, γ, or μ heavy chain constant region, such as a murine α, δ, ε, γ, or μ heavy chain constant region. In an embodiment, the light or heavy chain constant region is a fragment, derivative, variant, or mutant of a natural constant region.

In an embodiment, an antibody provided herein further comprises a human κ or λ light chain constant domain, or a fragment thereof. The amino acid sequence of the light chain constant region is as follows:

the amino acid sequence of the human κ light chain constant domain: (SEQ ID NO:101) and

amino acid sequence of human λ light chain constant domain: (SEQ ID NO:102).

In one embodiment, the antibodies provided herein further comprise a human heavy chain constant domain or fragment thereof.

The amino acid sequence of the heavy chain constant region is as follows:

amino acid sequence of human heavy chain constant region (hIgG2): (SEQ ID NO:103);

the amino acid sequence of the human heavy chain constant region (hIgG4): (SEQ ID NO:104) and

amino acid sequence of human heavy chain constant region (hIgG4): (SEQ ID NO:124).

In one embodiment, the anti-GIPR antibodies provided herein are selected from mouse-derived antibodies, humanized antibodies, chimeric antibodies, monoclonal antibodies, polyclonal antibodies, recombinant antibodies, antigen-binding antibody fragments, single chain antibodies, double chain antibodies, three chain antibodies, four chain antibodies, Fab fragments, F(ab')x fragments, structural domain antibodies, IgD antibodies, IgE antibodies, I antibodies. gM, IgG1 antibodies, IgG2 antibodies, IgG3 antibodies, or IgG4 antibodies.

In one embodiment, the anti-GIPR antibody provided herein is an anti-GIPR monoclonal antibody.

In another embodiment, the anti-GIPR antibody provided herein is a monoclonal antibody comprising a combination of amino acid sequences selected from the following list: SEQ ID NO:61 and SEQ ID NO:72, SEQ ID NO:62 and SEQ ID NO:73, SEQ ID NO:63 and SEQ ID NO:74, SEQ ID NO:64 and SEQ ID NO:74, SEQ ID NO:65 and SEQ ID NO :75, SEQ ID NO:66 and SEQ ID NO:76, SEQ ID NO:67 and SEQ ID NO:77, SEQ ID NO:68 and SEQ ID NO:77, SEQ ID NO:69 and SEQ ID NO:78, SEQ ID NO:70 and SEQ ID NO:79, and SEQ ID NO:71 and SEQ ID NO:80.

In one embodiment, the anti-GIPR antibody provided herein is a mouse anti-GIPR antibody. In another embodiment, the anti-GIPR antibody provided herein is a humanized anti-GIPR antibody.

In one embodiment, an anti-GIPR antibody provided herein reduces human GIP signal transduction with an IC50 value of about 1 nM to 200 nM, or about 1 nM to 100 nM.

Antibodies and antibody fragments

In one embodiment, an antibody provided herein is a full-length antibody (including a polyclonal, monoclonal, chimeric, humanized, or human antibody with full length heavy and/or light chains). In another embodiment, an antibody provided herein is an antibody fragment, such as a F(ab')2, Fab, Fab', Fv, Fc, or Fd fragment, which can be incorporated into single domain antibodies, single chain antibodies, maxibodies, minibodies, intrabodies, double chain antibodies, three chain antibodies, tetra chain antibodies, v-NAR, and bis-scFv (see, for example, Hollinger and Hudson, 2005, Nature Biotechnology , 23:1126-1136). In another embodiment, an antibody provided herein also includes antibody polypeptides such as those disclosed in US Pat. No. 6,703,199, including fibronectin polypeptide monobodies. In another embodiment, the antibody provided herein also includes other antibody polypeptides disclosed in US Patent Document Publication No. 2005/0238646, which are single chain polypeptides.

In one embodiment, the variable regions of the IgG gene expressing the monoclonal antibody of interest in the hybridoma are amplified using nucleotide primers. Such primers can be synthesized by any person of ordinary skill in the art, or can be purchased from commercial suppliers who synthesize primers for murine and human variable regions, including but not limited to primers for the V _Ha , V _Hb , V _Hc , V _Hd , C _H1 , V _L and _CL regions. These primers can be used to amplify heavy or light chain variable regions, which can then be inserted into vectors such as IMMUNOZAP ^TM H or IMMUNOZAP ^TM L (Stratagene), respectively. These vectors can then be introduced into E. coli, yeast, or mammalian cell systems for expression. Large amounts of single chain protein containing the fusion of the V _H and V _L regions can be obtained using such methods (see Bird et al. , 1988, Science 242:423-426).

One skilled in the art will appreciate that some proteins, such as antibodies, can be subjected to a number of post-translational modifications. The types and extent of these modifications often depend on the host cell lines used for protein expression, as well as the culture conditions. Such modifications may include variations in glycosylation, methionine oxidation, diketopiperizine formation, aspartate isomerization, and asparagine deamidation. A common modification is the loss of a basic carboxyl terminal residue (such as lysine or arginine) due to the action of carboxypeptidases (as described in Harris, 1995, Journal of Chromatography 705:129-134).

The usual way to obtain a mouse monoclonal antibody is carried out using hybridoma cells. Monoclonal antibodies can be isolated and purified using a variety of well known techniques. Such isolation techniques include protein A-sepharose affinity chromatography, size exclusion chromatography, and ion exchange chromatography (see, for example, Coligan, pp. 2.7.1-2.7.12 and pp. 2.9.1-2.9.3; Baines et al. , "Purification of Immunoglobulin G (IgG)," in Methods in Molecular Biology , Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)). A monoclonal antibody can be purified by affinity chromatography using an appropriate ligand selected based on the specific properties of the antibody (eg, heavy or light chain isotype, binding specificity, etc.). Examples of suitable ligands immobilized on a solid support include protein A, protein G, constant region (light chain or heavy chain) antibody, idiotypic antibody, and TGF-β binding protein, or fragment or variant thereof.

Molecular evolution of complementarity determining regions (CDRs) at the center of an antibody binding site has also been used to isolate antibodies with increased affinity, eg, antibodies having increased affinity for c-erbB-2, as described by Schier et al. , 1996, J. Mol. Biol. 263:551-567. Accordingly, such techniques are applicable to the production of anti-GIPR antibodies.

Anti-human GIPR antibodies can be used, for example, in assays to detect the presence of GIPR either in vitro or in vivo.

Antibodies can also be obtained by any of the traditional methods. For example, they may be purified from cells that naturally express them (eg, an antibody may be purified from a hybridoma that produces it), or generated in recombinant expression systems using any technique known in the art. For example, Monoclonal Antibodies, Hybridomas: A New Dimension in Biological Analyzes, Kennet et al. (eds.), Plenum Press, New York (1980) and Antibodies: A Laboratory Manual, Harlow and Land (eds.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1988). This is discussed in the Nucleic Acid section below.

Antibodies can be generated and screened for desired properties by any known technique. Some techniques relate to the isolation of nucleic acids encoding polypeptide chains (or portions thereof) of related antibodies (eg, anti-GIPR antibodies) and manipulation of the nucleic acid. Nucleic acids can be fused to another relevant nucleic acid, or modified by recombinant DNA techniques (eg, induced mutations or other conventional techniques) to add, remove, or replace one or more amino acid residues.

Если желательно улучшение аффинности антител по настоящему изобретению, содержащих одну или несколько из вышеупомянутых CDR, такие антитела можно получить с помощью ряда протоколов созревания аффинности, включающих в себя поддержание CDR (Yang et al. , 1995, J. Mol. Biol. , 254:392-403), шаффлинг цепей (Marks et al. , 1992, Bio/Technology , 10:779-783), применение мутантных штаммов E. coli (Low et al. , 1996, J. Mol. Biol. , 250:350-368), шаффлинг ДНК (Patten et al. , 1997, Curr. Opin. Biotechnol. , 8:724-733), фаговый дисплей (Thompson et al. , 1996, J. Mol. Biol. , 256:7-88) и дополнительные методики PCR (Crameri et al., 1998, Nature , 391:288-291). All of these modes of affinity maturation are discussed in Vaughan et al. , 1998, Nature Biotechnology , 16:535-539).

In one embodiment, provided herein are fragments of an anti-GIPR antibody. Such fragments may include sequences derived entirely from antibodies or additional sequences. Examples of antigen binding fragments include Fab, F(ab')2, single chain antibodies, diabodies, triabodies, tetrabodies, and domain antibodies. Other examples are presented in Lunde et al. , 2002, Biochem. soc. Trans. 30:500-06.

Single chain antibodies can be formed by linking heavy and light chain variable domain fragments (Fv regions) through an amino acid bridge (short peptide linker), resulting in a single polypeptide chain. Such single chain Fvs (scFvs) were generated by fusing DNA encoding a peptide linker between DNAs encoding polypeptides of two variable domains (VL and VH). The resulting polypeptides may self-fold back to form antigen-binding monomers, or they may form multimers (eg, dimers, trimers, or tetramers) depending on the length of the flexible linker between the two variable domains (Kortt et al. , 1997, Prot. Eng. 10:423; Kortt et al. , 2001, Biomol. Eng. 18:9 5-108). By combining different VL and VH containing polypeptides, multimeric scFvs can be generated that bind to different epitopes (Kriangkum et al. , 2001, Biomol. Eng. 18:31-40). Methods developed to obtain single-chain antibodies include those described in US patent No. 4946778; Bird, 1988, Science 242:423; Huston et al. , 1988, Proc. Natl. Acad. sci. USA 85:5879; Ward et al. , 1989, Nature 334:544; de Graaf et al. , 2002, Methods Mol. Biol. 178:379-87. Single chain antibodies derived from antibodies provided herein, including but not limited to scFvs containing a combination of L1H1 variable domains, are encompassed by the present invention.

Antibodies derived from an antibody can also be obtained, for example, by proteolytic hydrolysis of the antibody, for example, by cleavage of the whole antibody with pepsin or papain, in accordance with conventional methods. As an example, antibody fragments can be obtained by enzymatic cleavage of antibodies with pepsin to obtain an SS fragment, called F(ab')2. This fragment can be further cleaved using a thiol reducing agent to give 3.5S Fab' monovalent fragments. Optionally, the cleavage reaction can be performed using a blocking group for sulfhydryl groups that result from cleavage of disulfide bonds. Alternatively, enzymatic digestion using papain produces two monovalent Fab fragments and an Fc fragment directly. These methods are described, for example, in Goldenberg, US Pat. No. 4,331,647 to Nisonoffet et al. , 1960, Arch. Biochem. Biophys. 89:230; Porter, 1959, Biochem. J. 73:119; Edelman et al. , Methods in Enzymology 1:422 (Academic Press 1967); and Andrews, SM and Titus, JA in Current Protocols in Immunology (Coligan JE, et al. , eds), John Wiley & Sons, New York (2003), pages 2.8.1-2.8.10 and 2.10A.1-2.10A.5. Other antibody cleavage methods, such as separation of the heavy chains to form monovalent light-heavy chain (Fd) fragments, further cleavage of the fragments, or other enzymatic, chemical, or genetic techniques, can also be used, provided that the fragments bind to an antigen that is recognized by the intact antibody.

Another form of an antibody fragment is a peptide containing one or more complementarity determining regions (CDRs) of an antibody. CDRs can be obtained by constructing polynucleotides that encode CDRs. Такие полинуклеотиды получают, например, с использованием полимеразной цепной реакции для синтеза вариабельной области с использованием mRNA или продуцирующих антитела клеток в качестве матрицы (см., например, Larrick et al. , 1991, Methods: A Companion to Methods in Enzymology 2:106; Courtenay-Luck, "(Genetic Manipulation of Monoclonal Antibodies," в Monoclonal Antibodies: Production, Engineering and Clinical Application, Ritter et al. (eds.), page 166 (Cambridge University Press 1995) и Ward et al. , "Genetic Manipulation and Expression or Antibodies," в Monoclonal Antibodies: Principles and Applications, Birch et al. , (eds.), page 137 (Wiley-Liss, Inc. 1995). Фрагмент антитела может дополнительно содержать по меньшей мере один домен вариабельной области антитела, описываемого в настоящей заявке. Таким образом, например, домен V-области может быть мономерным и представлять собой домен V _H или V _L , который может связываться с GIPR с аффинностью, составляющей 1×10 ^-7 M или меньше, как описано ниже.

The variable region domain can be any naturally occurring variable domain or an engineered version thereof. By engineered version is meant a variable region domain that has been created using recombinant DNA construction techniques. Such engineered versions include those created, for example, from a specific variable region of an antibody by insertions, deletions, or changes in or about the amino acid sequences of a particular antibody. Specific examples include engineered variable region domains comprising at least one CDR and optionally one or more backbone amino acids from a first antibody and the remainder of a variable region domain from a second antibody.

The variable region domain may be covalently attached at the C-terminal amino acid to at least one other domain of an antibody or fragment thereof. Thus, for example, a V _H domain that is present in a variable region domain can be linked to a C _H1 domain of an immunoglobulin or fragment thereof. Likewise, a V _L domain may be associated with a C _K domain or a fragment thereof. Thus, for example, an antibody may be a Fab fragment in which the antigen-binding domain contains associated V _H and V _L domains covalently linked at their C-terminus to a C _H1 and Cκ domain, respectively. The C _H1 domain may be extended with additional amino acids, for example to provide a hinge region or a portion of a hinge region of a domain as found in the Fab' fragment, or to provide additional domains such as the C _H2 and C _H3 domains of an antibody.

Antibody derivatives and variants

The nucleotide sequences of L1 and H1 can be changed, for example, by random mutagenesis or site-directed mutagenesis (for example, oligonucleotide-directed site-specific mutagenesis) to create an altered polynucleotide containing one or more specific nucleotide substitutions, deletions or insertions compared to a wild-type polynucleotide. Examples of techniques for making such changes are described in Walderet al., 1986,Gene 42:133; baueret al., 1985,Gene 37:73; Craik, 1985,BioTechniques3:12-19; Smithet al., 1981, Genetic Engineering: Principles and Methods, Plenum Press and in U.S. Patent Nos. 4,518,584 and 4,737,462. These and other methods can be used, for example, to derive derivatives of anti-GIPR antibodies that have a desired property, such as increased affinity, avidity, or specificity for GIPR or stability.in vivo orin vitroor reduced side effectsin vivocompared to the non-derivatized antibody.

Other anti-GIPR antibody derivatives within the scope of the present invention include covalent or aggregative conjugates of anti-GIPR antibodies or fragments thereof to other proteins or polypeptides, such as by expressing recombinant fusion proteins comprising heterologous polypeptides fused to the N-terminus or C-terminus of an anti-GIPR antibody polypeptide. For example, the conjugated peptide may be a heterologous signal (or leader) polypeptide, such as a yeast alpha factor leader sequence, or a peptide such as an epitope tag. The antibody-containing fusion proteins may include peptides added to facilitate purification or identification of the antigen-binding protein (e.g., poly-His). The antibody can also be linked to the FLAG peptide as described in Hoppet al., 1988,Bio/Technology 6:1204, and US Pat. No. 5,011,912. The FLAG peptide is highly antigenic and provides an epitope that is reversibly bound by a specific monoclonal antibody (mAb), allowing rapid analysis and easy purification of the expressed recombinant protein. Reagents useful for making fusion proteins in which the FLAG peptide is fused to the polypeptide are commercially available (Sigma, St. Louis, MO, USA). In another embodiment, oligomers that contain one or more antibodies can be used as GIPR antagonists. The oligomers may be in the form of covalently bonded or non-covalently bonded dimers, trimers or higher oligomers. The use of oligomers containing two or more antibodies is contemplated, one example of which is the homodimer. Other oligomers include heterodimers, homotrimers, heterotrimers, homotetramers, heterotetramers, etc.

One embodiment is directed to oligomers containing a plurality of antibodies linked covalent or non-covalent interactions between peptide fragments fused with antibodies. Such peptides may be peptide linkers (spacers) or peptides that have the property of providing oligomerization. Leucine zippers and certain antibody-derived polypeptides are among the peptides that can provide oligomerization of antibodies attached to them, as described in more detail below.

In specific embodiments, the implementation of the oligomers contain from two to four antibodies. The antibodies of the oligomer may be in any form, such as any of the forms described above, for example options or fragments. Preferably, the oligomers contain antibodies that exhibit GIPR binding activity.

In one embodiment, the oligomer is prepared using polypeptides derived from immunoglobulins. The production of fusion proteins containing certain heterologous polypeptides fused to various portions of antibody-derived polypeptides (including the Fc domain) has been described, for example, Ashkenaziet al., 1991,PNAS USA 88:10535; Byrnet al., 1990,Nature 344:677 and Hollenbaughet al., 1992 "Construction of Immunoglobulin Fusion Proteins", in Current Protocols in Immunology, Suppl. 4, pages 10.19.1-10.19.11. One of the embodiments presented in this application relates to a dimer containing two fusion proteins created by fusing a GIPR-binding fragment of an anti-GIPR antibody to the Fc region of the antibody. A dimer can be obtained, for example, by inserting a fusion of genes encoding a fusion protein into an appropriate expression vector, expressing the fusion in host cells transformed with the recombinant expression vector, and allowing the expressed fusion protein to assemble in the same way as antibody molecules, after which interchain disulfide bonds are formed between the Fc fragments to form a dimer.

The term "Fc polypeptide" as used herein includes native and mutein forms of polypeptides derived from the Fc region of an antibody. Also included are truncated forms of such polypeptides containing a hinge region that promotes dimerization. Fc-containing fusion proteins (and oligomers formed therefrom) have the advantage of being easily purified by affinity chromatography on Protein A or Protein G columns.

One suitable Fc polypeptide described in PCT application WO 93/10151 (hereby incorporated by reference) is a single chain polypeptide extending from the N-terminal hinge region to the native C-terminus of the Fc region of a human IgG1 antibody. Another useful Fc polypeptide is the Fc mutein described in US Pat. No. 5,457,035 and Baum et al. , 1994, EMBO J . 13:3992-4001. The amino acid sequence of this mutein is identical to that of the native Fc shown in WO 93/10151, except that amino acid 19 was changed from Leu to Ala, amino acid 20 was changed from Leu to Glu, and amino acid 22 was changed from Gly to Ala. The mutein exhibits reduced affinity for Fc receptors. In other embodiments, the variable portion of the heavy and/or light chains of the anti-GIPR antibody may be replaced with the variable portion of the heavy and/or light chain of the antibody.

Alternatively, the oligomer is a fusion protein containing multiple antibodies, with or without peptidic linkers (spacer peptides). Suitable peptide linkers include those described in US Pat. Nos. 4,751,180 and 4,935,233.

Another way to obtain oligomeric antibodies involves the use of leucine zipper. Leucine zipper domains are peptides that promote oligomerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al. , 1988, Science 240:1759) and have since been found in a number of different proteins. Known leucine zippers include naturally occurring peptides and their derivatives that dimerize or trimerize. Examples of leucine zipper domains suitable for making soluble oligomeric proteins are described in PCT application WO 94/10308, and a leucine zipper derived from lung surfactant protein D (SPD) is described in Hoppe et al. , 1994, FEBS Letters 344:191, hereby incorporated by reference. The use of a modified leucine zipper that promotes stable trimerization of a heterologous protein fused to it is described in Fanslow et al. , 1994, Semin. Immunol. 6:267-78. In one method, recombinant fusion proteins containing an anti-GIPR antibody fragment or derivative fused to a leucine zipper peptide are expressed in suitable host cells and the resulting soluble oligomeric anti-GIPR antibody fragments or derivatives are recovered from the culture supernatant.

In another embodiment, antibody derivatives may contain at least one of the CDRs disclosed in this application. For example, one or more CDRs can be incorporated into known antibody framework regions (IgG1, IgG2, etc.) or conjugated to a suitable carrier to increase its half-life. Suitable carriers include, without limitation, Fc, albumin, transferrin, and the like. These and other suitable carriers are known in the art. Such conjugated CDR peptides may be in monomeric, dimeric, tetrameric, or other form. In one embodiment, one or more water-soluble polymers are linked at one or more specific positions, such as at the amino terminus, of the coupling agent. In one example, an antibody derivative includes one or more water-soluble polymeric attachments, including, without limitation, polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol. Cm., For example, U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417;N-vinylpyrrolidone)-polyethylene glycol, propylene glycol homopolymers, copolymers of polypropylene oxide and ethylene oxide, polyoxyethylated polyhydric alcohols (for example, glycerol) and polyvinyl alcohol, as well as mixtures of such polymers. In some embodiments, one or more water-soluble polymers are randomly attached to one or more side chains. In some embodiments, the PEG may act to improve the therapeutic ability of a binding agent, such as an antibody. Some such methods are discussed in, for example, US Pat. No. 6,133,426, which is hereby incorporated by reference for any purpose.

It should be appreciated that an antibody provided herein may have at least one amino acid substitution, provided that the antibody retains binding specificity. Therefore, modifications of antibody structures are within the scope of the present invention. These may include amino acid substitutions, which may be conservative or non-conservative, which do not interfere with the ability of the antibody to bind human GIPR. Conservative amino acid substitutions may include non-naturally occurring amino acid residues that are typically incorporated by chemical synthesis of peptides rather than by synthesis in biological systems. This includes peptidomimetics and other reversed or inverted forms of amino acid fragments. A conservative amino acid substitution may also include replacing a native amino acid residue with a standard residue such that it has little or no effect on the polarity or charge of the amino acid residue at that position. Non-conservative substitutions may include replacing a member of one class of amino acids or amino acid mimetics with a member from another class with different physical properties (e.g., size, polarity, hydrophobicity, charge).

Moreover, one skilled in the art can create test variants that contain a single amino acid substitution at each desired amino acid residue. Variants can then be screened using activity assays known to those skilled in the art. Such options can be used to collect information about suitable options. For example, if a change in a particular amino acid residue has been found to result in a disruption, undesirable reduction, or unacceptable activity, then variants with that change can be avoided. In other words, based on the information gathered from such routine experiments, one skilled in the art can readily determine amino acids where further substitutions should be avoided, either alone or in combination with other mutations.

One skilled in the art will be able to determine suitable polypeptide variants as set forth herein using well known techniques. In some embodiments, one of skill in the art can identify suitable regions of the molecule that can be altered without disrupting activity by targeting regions that are not important for activity. In some embodiments, residues and portions of molecules that are conserved among similar polypeptides can be identified. In some embodiments, even regions that may be important for biological activity or structure can be subject to conservative amino acid substitutions without compromising biological activity or without adversely affecting the structure of the polypeptide. In addition, one of skill in the art can review structure-function studies identifying residues in similar polypeptides that are important for activity or structure. Given this comparison, one can predict the importance of amino acid residues in a protein that correspond to amino acid residues that are important for activity or structure in similar proteins. One of skill in the art can opt for chemically similar amino acid substitutions for such predicted important amino acid residues.

One skilled in the art can also analyze the three-dimensional structure and amino acid sequence relative to that structure in such polypeptides. Given such information, one skilled in the art can predict the alignment of amino acid residues of an antibody with respect to its three-dimensional structure. In some embodiments, one of skill in the art may decide not to make radical changes to amino acid residues that are expected to be on the surface of a protein, since such residues may be involved in important interactions with other molecules. A number of scientific publications are devoted to the prediction of the secondary structure. Cm. Moult, 1996,Curr. Op. Biotech. 7:422-427; Chouet al., 1974,biochemistry 13:222-245; Chouet al., 1974,biochemistry 113:211-222; Chouet al., 1978,Adv. Enzymol. Relat. Areas Mol. Biol. 47:45-148; Chouet al., 1979,Ann. Rev. Biochem. 47:251-276 and Chouet al.,Biophys. J. 26:367-384. Moreover, computer programs are now available to assist in secondary structure prediction. For example, two polypeptides or proteins that have greater than 30% sequence identity or greater than 40% similarity often have a similar structural topology. The recent growth of the Protein Structure Database (PDB) has provided increased predictability of secondary structure, including the potential number of folds in a polypeptide or protein structure. Cm. Holmet al., 1999,Nucl. acid. Res. 27:244-247. It has been suggested (Brenneret al., 1997,Curr. Op. Struct. Biol. 7:369-376) that there is a limited number of folds in a given polypeptide or protein, and that once a critical number of structures have been found, structure prediction will become much more accurate.

Additional ways to predict secondary structure include threading (Jones, 1997,Curr. Opin. Struct. Biol. 7:377-87; Sipplet al., 1996,structure 4:15-19), "profile analysis" (Bowieet al., 1991,Science 253:164-170; Gribskovet al., 1990,Meth. enzyme. 183:146-159; Gribskovet al., 1987,Proc. Nat. Acad. sci. USA 84:4355-4358) and "evolutionary connection" (cf. holm,higher (1999) and Brenner,higher (1997)). In some embodiments, antibody variants include glycosylation variants in which the number and/or type of glycosylation sites have been changed from the amino acid sequences of the parent polypeptide. In some embodiments, the variants contain more or fewer sitesN-linked glycosylation than native protein. Alternatively, deleting such a sequence by substitutions removes the existingN-linked carbohydrate chain. There is also a restructuringN-linked carbohydrate chains, in which one or more sitesN-linked glycosylation (usually those found in nature) are excluded and one or more new ones are createdN-linked sites. Additional preferred antibody variants include cysteine variants in which one or more cysteine residues are removed or replaced with a different amino acid (e.g., serine) compared to the original amino acid sequence. Cysteine variants may be useful when antibodies need to be refolded into a biologically active conformation, such as after isolation of insoluble inclusion bodies. Cysteine variants typically have fewer cysteine residues than the native protein and are usually even in number to minimize interactions due to mismatched cysteine residues.

Desired amino acid substitutions (whether conservative or non-conservative) can be determined by those skilled in the art at the time such substitutions are desired. In some embodiments, amino acid substitutions can be used to identify important residues of human GIPR antibodies or to increase or decrease the affinity of the human GIPR antibodies described herein.

In some embodiments, preferred amino acid substitutions are those that (1) desensitize proteolysis, (2) desensitize oxidation, (3) change the binding affinity for formed protein complexes, (4) change the binding affinity values, and/or (4) impart or modify other physicochemical or functional properties in such polypeptides. In some embodiments, single or multiple amino acid substitutions (in some embodiments, conservative amino acid substitutions) can be made in a naturally occurring sequence (in some embodiments, on a portion of the polypeptide outside the domain(s) forming intramolecular contacts). In some embodiments, a conservative amino acid substitution usually cannot significantly change the structural characteristics of the original sequence (e.g., the substituting amino acid must not break the helix that is in the original sequence, or break other types of secondary structure that characterizes the original sequence). Examples of polypeptide secondary and tertiary structures known in the art are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (Branden and Tooze, Eds., Garland Publishing, New York, N.Y. (1991)) and Thorntonet al., 1991,Nature 354:105, each of which is incorporated herein by reference.

In some embodiments, the antibodies of the present invention may be chemically linked to polymers, lipids, or other moieties.

Antigen binding agents may contain at least one of the CDRs described in this application, included in a biocompatible frame structure. In one embodiment, the biocompatible scaffold comprises a polypeptide, or portion thereof, sufficient to form a conformationally stable structural backbone or scaffold or backbone that is capable of representing one or more amino acid sequences that bind to an antigen (e.g., CDR, variable region, etc.) in a localized surface region. Such structures may be a naturally occurring polypeptide or polypeptide "fold" (structural motif), or may have one or more modifications, such as amino acid additions, deletions or substitutions, relative to the naturally occurring polypeptide or fold. These backbones can be derived from a polypeptide of any species (or more than one species), such as a human, other mammal, other vertebrate, invertebrate, plant, bacterium, or virus.

Typically, biocompatible scaffolds are based on protein backbones or backbones other than immunoglobulin domains. For example, those based on fibronectin, ankyrin, lipocalin, neocarzinostaine, cytochrome b, CP1 zinc finger, PST1, double helix, LACI-D1, Z domain, and tendamistat domains can be used (see, For example, Nygren and Uhlen, 1997,Current Opinion in Structural Biology 7:463-469).

In addition, one of skill in the art will appreciate that suitable binding agents include portions of these antibodies, such as one or more of the heavy chain CDR1, CDR2, CDR3, light chain CDR1, CDR2 and CDR3 that are specifically disclosed herein. At least one of the heavy chain CDR1, CDR2, CDR3, CDR1, CDR2, and light chain CDR1, CDR2, and light chain CDR3 regions may have at least one amino acid substitution, provided that the antibody retains the binding specificity of the unsubstituted CDR. The non-CDR portion of an antibody may be a non-protein molecule, where the binding agent cross-blocks the binding of the antibody disclosed herein to human GIPR and/or inhibits the activity of GIP signaling through the receptor. The non-CDR portion of an antibody may be a non-protein molecule, wherein the antibody exhibits a similar binding pattern to human GIPR peptides in a competitive binding assay that exhibits at least one of the L2H2/L6H5 antibodies and/or neutralizes GIP activity. The non-CDR portion of an antibody may be composed of amino acids, wherein the antibody is a recombinant binding protein or a synthetic peptide, and the recombinant binding protein cross-blocks the binding of the antibody disclosed herein to human GIPR and/or neutralizes GIP activity in vitro or in vivo. The non-CDR portion of an antibody may consist of amino acids, wherein the antibody is a recombinant antibody and the recombinant antibody exhibits a similar binding pattern to human GIPR peptides in a competitive binding assay that exhibits at least one of the L2H2/L6H5 antibodies and/or neutralizes GIP activity.

Anti-GIPR and GLP-1 or reverse GLP-1 antibody fusion protein

In one embodiment, provided herein is a fusion protein of an anti-GIPR antibody to GLP-1 comprising an antibody that specifically binds to GIPR and one, two, three, four, five, six, seven, or eight GLP-1 fragments or reverse GLP-1 fragments, wherein in the fusion protein, the carboxy-terminus of the GLP-1 fragment is connected to the amino terminus of the light or heavy chain of the anti-GIPR antibody via a peptide linker sequence (lin kera) or the amino terminus of the GLP-1 reverse fragment is fused to the carboxy terminus of the light or heavy chain of an anti-GIPR antibody.

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and one, two, three, four, five, six, seven, or eight GLP-1 fragments; where in the fusion protein the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the light chain or heavy chain of the anti-GIPR antibody via a peptide linker sequence (linker) or the amino-terminus of the reverse GLP-1 fragment is connected to the carboxy-terminus of the light chain or heavy chain of the anti-GIPR antibody.

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and one, two, three, four, five, six, seven, or eight GLP-1 reverse fragments; wherein in the fusion protein, the amino terminus of the GLP-1 reverse fragment is fused to the carboxy terminus of the light chain or heavy chain of an anti-GIPR antibody.

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and one, two, three or four GLP-1 fragments; wherein in the fusion protein, the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the light chain or heavy chain of the anti-GIPR antibody via a peptide linker sequence (linker).

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and one, two, three or four GLP-1 reverse fragments; wherein in the fusion protein, the amino terminus of the GLP-1 reverse fragment is fused to the carboxy terminus of the light chain or heavy chain of an anti-GIPR antibody.

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and two GLP-1 fragments; wherein in the fusion protein, the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the light chain or heavy chain of the anti-GIPR antibody via a peptide linker sequence (linker).

In another embodiment, provided herein is an anti-GIPR and GLP-1 antibody fusion protein comprising an antibody that specifically binds to GIPR and two GLP-1 reverse fragments; wherein in the fusion protein, the amino terminus of the GLP-1 reverse fragment is fused to the carboxy terminus of the light chain or heavy chain of an anti-GIPR antibody.

In another embodiment, provided herein is a GLP-1 fusion protein comprising an anti-GIPR antibody and two GLP-1 fragments; where in the fusion protein, the carboxy-terminus of the GLP-1 fragment is connected to the amino-terminus of the light chain or heavy chain of the anti-GIPR antibody via a peptide linker sequence (linker): N'-GLP-1-linker-R-C'; or connects the carboxy-terminus of the GLP-1 fragment to the amino-terminus of the heavy chain of the anti-GIPR antibody: N'-GLP-1-linker-R-C'; where N' is the amino end of the polypeptide chain of the fusion protein, C' is the carboxy end of the polypeptide chain of the fusion protein, GLP-1 is a fragment of GLP-1, R is the amino acid sequence of the light chain or heavy chain of an anti-GIPR antibody, and the linker is a peptide linker sequence.

In another embodiment, provided herein is a GLP-1 fusion protein comprising an anti-GIPR antibody and two GLP-1 reverse fragments; where in the fusion protein, the amino end of the GLP-1 reverse fragment is connected to the carboxy end of the light chain or heavy chain of the anti-GIPR antibody: N'-R-linker-reverse GLP-1-C'; or connects the amino-terminus of the reverse GLP-1 fragment via a peptide linker sequence (linker) to the carboxy-terminus of the heavy chain of the anti-GIPR antibody: N'-R-linker-reverse GLP-1-C'; where N' is the amino end of the polypeptide chain of the fusion protein, C' is the carboxy end of the polypeptide chain of the fusion protein, and reverse GLP-1 is the reverse fragment of GLP-1, R is the amino acid sequence of the light chain or heavy chain of an anti-GIPR antibody, and the linker is a peptide linker sequence.

In a further embodiment, provided herein is a GLP-1 fusion protein comprising an anti-GIPR antibody and two GLP-1 fragments; where in the fusion protein, the carboxy-terminus of the GLP-1 fragment is connected by a peptide linker sequence (linker) to the amino-terminus of the light chain of the anti-GIPR antibody: N'-GLP-1-linker-R-C'; where N' is the amino end of the fusion protein polypeptide chain, C' is the carboxy end of the fusion protein polypeptide chain, GLP-1 is a fragment of GLP-1, R is the amino acid sequence of the anti-GIPR antibody light chain, and the linker is a peptide linker sequence.

In one embodiment, in the GLP-1 fusion protein provided herein, the GLP-1 fragment is independently selected from one of the following amino acid sequences: SEQ ID NO:105, SEQ ID NO:106, SEQ ID NO:107, SEQ ID NO:108, and SEQ ID NO:109. In one embodiment, in the GLP-1 fusion protein provided herein, the GLP-1 reverse fragment is independently selected from one of the following amino acid sequences: SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, and SEQ ID NO:123.

In one embodiment, in the GLP-1 fusion protein provided herein, the peptide linker (linker) sequence independently comprises 1 to 200 amino acid residues, 2 to 100 amino acid residues, 5 to 50 amino acid residues, 6 to 25 amino acid residues, or 10 to 20 amino acid residues.

In another embodiment, in the GLP-1 fusion protein provided herein, the peptide linker (linker) sequence is independently selected from the following amino acid sequences: SEQ ID NO:110, SEQ ID NO:111, and SEQ ID NO:112.

Nucleic acids

In one aspect, the present invention relates to selected nucleic acid molecules that encode the antibodies presented in this application. Nucleic acids include, for example, polynucleotides that encode all or part of an antibody or GLP-1 fusion protein, such as one or both chains of an antibody of the present invention, or a fragment, derivative, mutein, or variant thereof; polynucleotides sufficient for use as hybridization probes; PCR primers or sequencing primers for identifying, analyzing, mutating or amplifying a polynucleotide encoding a polypeptide; antisense nucleic acids for inhibiting the expression of a polynucleotide and sequences complementary to those listed above. Nucleic acids can be of any length. They can have lengths such as 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1.000, 1.50 0, 3,000, 5,000 or more nucleotides, and/or may contain one or more additional sequences, such as regulatory sequences, and/or be part of a larger nucleic acid, such as a vector. Nucleic acids may be single-stranded or double-stranded and may contain RNA and/or DNA nucleotides, as well as their artificial variants (for example, peptide nucleic acids).

Nucleic acids encoding antibody polypeptides (for example, heavy or light chain, variable domain only or full length) can be isolated from B cells of mice that have been immunized with the GIPR antigen. The nucleic acid of the antibody or GLP-1 fusion protein can be isolated by conventional procedures such as polymerase chain reaction (PCR).

Nucleic acid sequences encoding the heavy and light chain variable regions are shown above. The specialist will understand that due to the degeneracy of the genetic code, each of the polypeptide sequences disclosed in this application is encoded by a large number of other nucleic acid sequences. The present invention provides for each degenerate nucleotide sequence encoding each antibody or GLP-1 fusion protein provided in this application.

The present invention also relates to nucleic acids that hybridize with other nucleic acids (for example, nucleic acids containing the nucleotide sequence of any of L2H2/L6H5) under certain hybridization conditions. Nucleic acid hybridization methods are well known in the art. Cm., For example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. As defined herein, for example, under moderately stringent hybridization conditions, use a prewash solution containing 5 x sodium chloride/sodium citrate (SSC), 0.5% SDS, 1.0 mM EDTA (pH 8.0), a hybridization buffer of about 50% formamide, 6 x SSC, and a hybridization temperature of 55°C (or other similar hybridization solutions, such as a solution containing about 50% formamide, at hybridization temperature 42°C) and wash conditions 60°C in 0.5×SSC, 0.1% SDS. Under stringent hybridization conditions, hybridization is carried out in 6×SSC at 45°C followed by one or more washes in 0.1×SSC, 0.2% SDS at 68°C. In addition, one of ordinary skill in the art can control the hybridization and/or wash conditions to increase or decrease the stringency of hybridization such that nucleic acids containing nucleotide sequences that are at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identical to each other typically remain hybridized to each other. The main parameters influencing the choice of hybridization conditions and guidance on developing suitable conditions are set forth, for example, in Sambrook, Fritsch, and Maniatis (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., chapters 9 and 11 and Current Protocols in Molecular Biology, 1995, Ausubelet al., Eds., John Wiley & Sons, Inc., sections 2.10 and 6.3-6.4) and can be easily determined by those of ordinary skill in the art based on, for example, the length and/or composition of the DNA bases. Changes can be made by mutation in the nucleic acid, thereby resulting in changes in the amino acid sequence of the polypeptide (for example, antibodies) that it encodes. Mutations can be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are altered using, for example, a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are altered using, for example, a random mutagenesis protocol. Regardless of how it is made, the mutant polypeptide can be expressed and screened for the desired property.

Mutations can be introduced into a nucleic acid without significantly altering the biological activity of the polypeptide it encodes. For example, nucleotide substitutions can be made resulting in amino acid substitutions at non-essential amino acid residues. In one embodiment, the nucleotide sequences provided herein for L1 - L11 and H1 - H9 or a GLP-1 fusion protein or fragments, variants or derivatives thereof are mutated such that they encode the amino acid sequences provided herein for L1 - L11 and H1 - H9, providing one or more deletions or substitutions of amino acid residues to obtain sequences bearing two or more different amino acid residues. In another embodiment, an amino acid is inserted by mutagenesis adjacent to one or more amino acid residues shown herein for L1-L11 and H1-H9 or a GLP-1 fusion protein, producing sequences with two or more different amino acid residues. Alternatively, one or more mutations can be introduced into the nucleic acid that selectively alter biological activity (e.g., binding to GIPR) of the polypeptide it encodes. For example, a mutation can quantitatively or qualitatively change the biological activity. Examples of quantitative changes include an increase, decrease or elimination of activity. Examples of qualitative changes include changing the antigenic specificity of an antibody or GLP-1 fusion protein.

In another aspect, the present invention relates to nucleic acid molecules that are suitable for use as primers or hybridization probes to detect the nucleic acid sequences of the present invention. The nucleic acid molecule of the present invention may contain only a portion of the nucleic acid sequence encoding the full-length polypeptide of the present invention, such as a fragment that can be used as a probe or primer, or a fragment encoding the active part (for example, the GIPR binding portion) of the polypeptide of the present invention.

Probes based on the nucleic acid sequence of the present invention can be used to detect a nucleic acid or similar nucleic acids, such as transcripts encoding a polypeptide of the present invention. The probe may contain a label group, for example, a radioisotope, a fluorescent compound, an enzyme, or an enzymatic cofactor. Such probes can be used to identify a cell expressing a polypeptide.

In another aspect, the vectors provided in this application contain a nucleic acid encoding a polypeptide of the present invention, or a portion thereof. Examples of vectors include, without limitation, plasmids, viral vectors, non-episomal mammalian vectors, and expression vectors, such as recombinant expression vectors.

The recombinant expression vectors provided herein may contain the nucleic acid of the present invention in a form suitable for expression of the nucleic acid in a host cell. Recombinant expression vectors include one or more regulatory sequences selected based on the host cells to be used for expression, which are operably linked to the nucleic acid sequence to be expressed. Regulatory sequences include those that direct the constitutive expression of a nucleotide sequence in many types of host cells (e.g., SV40 early gene enhancer, Rous sarcoma virus promoter, and cytomegalovirus promoter), those that direct the expression of a nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences, see Vosset al., 1986,Trends Biochem. sci. 11:287 Maniatiset al., 1987,Science 236:1237, the disclosure of each of which is incorporated herein by reference in its entirety), and those that direct the inducible expression of a nucleotide sequence in response to a particular treatment or condition (e.g., a metallothionein promoter in mammalian cells and a tetracycline and/or streptomycin responsive promoter in both prokaryotic and eukaryotic systems (seeID.). Those skilled in the art will recognize that the structure of an expression vector may depend on factors such as the choice of host cell to be transformed, the desired level of protein expression, etc. The expression vectors of the present invention may be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides encoded by nucleic acids as described herein.

In another aspect, the present invention relates to host cells into which a recombinant expression vector of the present invention has been introduced. The host cell can be any prokaryotic cell or eukaryotic cell. Prokaryotic host cells include Gram-negative or Gram-positive organisms, for exampleE. coli or bacilli. Higher eukaryotic cells include insect cells, yeast cells, and established mammalian cell lines. Examples of suitable mammalian host cell lines include Chinese hamster ovary (CHO) cells or derivatives thereof such as Veggie CHO and related cell lines that grow in serum-free medium (see Rasmussenet al., 1998,Cytotechnology 28:31), or the DHFR-deficient CHO DXB-11 strain (see Urlaubet al., 1980,Proc. Natl. Acad. sci. USA 77:4216-20). Additional CHO cell lines include CHO-K1 (ATCC # CCL-61), EM9 (ATCC # CRL-1861), and W20 (ATCC # CRL-1862). Additional host cells include the monkey kidney cell line COS-7 (ATCC no. CRL-1651) (see Gluzmanet al., 1981,cell 23:175), L cells, C127 cells, 3T3 cells (ATCC CCL-163), AM-1/D cells (described in US Pat. No. 6,210,924), HeLa cells, BHK cell line (ATCC CRL-10), CV1/EBNA cell line derived from African green monkey kidney CV1 cell line (ATCC CCL-70) (see McMahanet al., 1991,EMBO J. 10:2821), human embryonic kidney cells such as EBNA 293, 293 or MSR 293, A431 human epidermal cells, human Colo205 cells, other transformed primate cell lines, normal diploid cells, cell strains derived from in vitro primary tissue culture, primary explants, HL-60, U937, HaK or Jurkat. Suitable cloning and expression vectors for use with bacterial, fungal, yeast and mammalian hosts are described by Pouwels.et al. (Cloning Vectors: A Laboratory Manual, Elsevier, N.Y., 1985).

Vector DNA can be introduced into prokaryotic or eukaryotic cells using traditional transformation or transfection techniques. With regard to stable transfection of mammalian cells, it is known that, depending on the expression vector and transfection technique used, only a small proportion of cells can integrate foreign DNA into their genome. To identify and select for these integrants, a gene that encodes a selectable marker (for example, antibiotic resistance) is usually introduced into host cells along with the gene of interest. Preferred selectable markers include markers that confer drug resistance such as G418, hygromycin and methotrexate. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that turn on the selectable marker gene will survive while other cells will die) along with other means.

Transformed cells can be cultured under conditions that promote expression of the polypeptide and the polypeptide is recovered using conventional protein purification procedures. One such cleaning procedure is described in the examples below. Polypeptides contemplated for use herein include substantially homogeneous recombinant mammalian GIPR antibodies or GLP-1 fusion protein polypeptides substantially free of contaminating endogenous materials.

Anti-GIPR antibody activity

The activity of an anti-GIPR antibody refers to the effect of the antibody provided herein in specifically binding to GIPR, inhibiting or blocking GIP signaling, thereby demonstrating a therapeutic biological effect, for example in the treatment of obesity, T2DM and/or non-alcoholic steatohepatitis (NASH). The term "reducing the biological activity of GIP signaling" or "inhibiting or blocking the biological activity of GIP signaling" refers to the effect of an anti-GIPR antibody or GLP-1 fusion protein in inhibiting or blocking downstream cellular responses to GIP by binding to GIPR in vivo . These responses include, but are not limited to, an insulinotropic effect that promotes fat storage and inhibition of lipolysis. In one embodiment, the mouse antibody or humanized antibody provided herein specifically binds to human GIPR. Such antibodies include antagonistic or neutralizing antibodies that reduce or neutralize GIP signaling.

In one embodiment, the K _d of an antibody provided herein that binds to human GIPR ranges from about 0.01 nM to 1000 nM, 0.1 nM to 500 nM, 0.5 nM to 200 nM, 1 nM to 200 nM, or 10 nM to 100 nM. In another embodiment, the K _d of the antibody provided herein that binds to GIPR is from about 1 nM to 200 nM. In yet another embodiment, the K _d of the antibody provided herein that binds to GIPR is from about 10 nM to 100 nM. In yet another embodiment, the K _d of an antibody provided herein that binds to GIPR is about 1 nM, 2 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM.

In one embodiment, the IC ₅₀ of the antibody provided herein in antagonizing GIP signaling is from about 0.01 nM to 500 nM, 0.1 nM to 200 nM, 0.5 nM to 200 nM, 1 nM to 200 nM, or 10 nM to 100 nM. In another embodiment, the IC ₅₀ of the antibody provided herein in antagonizing GIP signal transduction is from about 1 nM to 200 nM. In yet another embodiment, the IC ₅₀ of the antibody provided herein in antagonizing GIP signal transduction is from about 10 nM to 100 nM. In another embodiment, the IC ₅₀ of the antibody provided herein in antagonizing GIP signaling is about 1 nM, 2 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, or 100 nM .

In one embodiment, an antibody provided herein specifically binds to GIPR with one or more of the following properties:

a. providing a Kd substantially similar to that of the reference antibody when bound to GIPR;

b. providing an IC50 substantially similar to that of a reference antibody when antagonizing GIPR activated with GIP; And

c. cross-competitive binding to a reference anti-human GIPR antibody.

In one embodiment, the reference antibody comprises a combination of the light chain variable amino acid sequence of SEQ ID NO:66 and the heavy chain variable amino acid sequence of SEQ ID NO:76. In another embodiment, the reference antibody is an L2H2, L6H5, or L10H8 monoclonal antibody.

As used herein, the term "substantially similar" means about 200%, 180%, 160%, 150%, 140%, 120%, 110%, 100%, 99%, 98%, 97%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, or 50% IC _{5 0} or K _d of the reference antibody, or comparable thereto. In one embodiment, the reference antibody is, for example, an antibody comprising the combination of the heavy chain of SEQ ID NO:76 and the light chain of SEQ ID NO:66. In another embodiment, the reference antibody provides L2H2, L6H5 or L10H8.

Biological activity of anti-GIPR and GLP-1 antibody fusion protein

The biological activity of the anti-GIPR-GLP-1 antibody fusion protein provides for the biological activity of GLP-1 and the activity of the anti-GIPR antibody. The activity of antibodies to GIPR is described above. "Biological activity of GLP-1" refers to the biological activity of an anti-GIPR and GLP-1 antibody fusion protein that binds in vivo, activates the GLP-1 receptor and induces a cellular signal transduction response, and also exerts therapeutic effects, for example, on obesity, type 2 diabetes, or non-alcoholic steatohepatitis. The signal transduction response includes, without limitation, increased insulin secretion, suppression of glucagon secretion, appetite suppression, weight loss, induction of satiety, inhibition of apoptosis, induction of pancreatic β-cell proliferation, and differentiation of pancreatic β-cells. By combining the types of biological activity of GLP-1 and anti-GIPR antibodies, the GLP-1 fusion protein of the present application can be used to treat various diseases and disorders associated with GLP-1R and GIPR. The fusion protein exerts its biological effect by acting on GLP-1R and/or GIPR, so the GLP-1 fusion protein treatment provided herein can be used to treat subjects whose disease or symptom would benefit from "enhancing GLP-1R signaling" or "reducing GIPR signaling". Эти субъекты упоминаются как субъекты, которые "нуждаются в стимулирующей GLP-1R терапии" или "нуждаются в снижении стимуляции GIPR", в том числе с инсулинонезависимым диабетом, инсулинозависимым диабетом, инсультом (GLP-1R, см. WO 00/16797), инфарктом миокарда (GLP-1R, см. WO 98/08531), ожирением (GLP-1R, см. WO 98/19698; GIPR. см. Furija et al. , 2008, PLoS ONE 3: e3163; US 2017/0275370 A1), катаболическими изменениями после хирургического вмешательства (GLP-1R, см. US 6006753), функциональной диспепсией и синдромом раздраженного кишечника (GLP-1R, см. WO99/64060), стеатозом печени (GIPR, см. US 2017/0275370A1), неалкогольной жировой болезнью печени (GLP-1R, см. Debra et al. , 2016, Hepatobiliary Surg Nutr 5: 515-518; GIPR, см. US 2017/0275370 A1), неалкогольным стеатогепатитом (GLP-1, см. Armstrong et al. , 2013, BMJ Open 3:e003995; GIPR, см. US 2017/0275370 A1), также в том числе субъекты с риском развития неинсулинзависимого диабета (см. WO 00/07617), субъекты с нарушенной толерантностью к глюкозе или нарушенным уровнем глюкозы натощак, субъекты, масса тела которых на приблизительно 25% выше нормальной зависимой от роста массы, и субъекты с частичной панкреатэктомией.

In one embodiment, changes in the biological activity of the anti-GIPR antibody or its GLP-1 fusion protein are detected using a direct cAMP assay quantifying the function of the anti-GIPR antibody or GLP-1 fusion protein in inhibiting GIPR in vitro .

Pharmaceutical compositions

In one embodiment, the pharmaceutical composition provided herein comprises an anti-GIPR antibody provided herein and one or more pharmaceutically acceptable carriers.

In another embodiment, the pharmaceutical composition provided herein comprises an anti-GIPR and GLP-1 antibody fusion protein provided herein and one or more pharmaceutically acceptable carriers.

As used herein, the term "carrier" includes a carrier, pharmaceutical adjuvant, or stabilizer that is harmless when exposed to cells or mammals at the dose and concentration used.

Method of treatment

In one embodiment, the present application provides a method of treating, preventing, or ameliorating type 2 diabetes, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR antibody provided herein, or a pharmaceutical composition based on it.

In another embodiment, the present application provides a method of treating, preventing or reducing the intensity of non-alcoholic fatty liver disease, which provides for the administration to the subject of a therapeutically effective dose of an antibody to GIPR presented in this application, or a pharmaceutical composition based on it.

In another embodiment, provided herein is a method of treating, preventing, or ameliorating non-alcoholic fatty liver disease, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR antibody fusion protein provided herein and GLP-1, or a pharmaceutical composition thereof.

In another embodiment, the present application provides a method of treating, preventing or reducing the intensity of non-alcoholic steatohepatitis, which provides for the administration to the subject of a therapeutically effective dose of an antibody to GIPR presented in this application, or a pharmaceutical composition based on it.

In another embodiment, provided herein is a method of treating, preventing, or ameliorating non-alcoholic steatohepatitis, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR antibody fusion protein provided herein and GLP-1, or a pharmaceutical composition thereof.

In another embodiment, the present application provides a method of treating, preventing or ameliorating type 2 diabetes, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR antibody provided in this application, or a pharmaceutical composition based on it.

In another embodiment, the present application provides a method for the treatment, prevention, or amelioration of type 2 diabetes, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR and GLP-1 antibody fusion protein provided herein, or a pharmaceutical composition based on it.

In another embodiment, the present application provides a method of treating, preventing or reducing the intensity of obesity, which involves the introduction of a therapeutically effective dose of an antibody to GIPR presented in this application, or a pharmaceutical composition based on it, to a subject.

In a further embodiment, the present application provides a method for treating, preventing, or ameliorating obesity, which comprises administering to a subject a therapeutically effective dose of an anti-GIPR antibody fusion protein of the present application and GLP-1, or a pharmaceutical composition thereof.

In any of the uses presented in this application, the pharmaceutical composition presented in this application is intended for intravenous or subcutaneous injection.

Used in this application, the term "subject" refers to a mammal, including humans, and is used interchangeably with the term "patient".

The term "treatment" includes ameliorating or preventing at least one symptom or other aspect of a disorder, or lessening the severity of a disease. An anti-GIPR antibody or anti-GIPR and GLP-1 antibody fusion protein provided herein does not have to provide complete cure or eliminate every symptom or manifestation of a disease in order to be an effective therapeutic agent. As recognized in the relevant field, therapeutic agents can reduce the severity of a given disease state, but not necessarily eliminate all manifestations of the disease in order to be effective. Likewise, a prophylactic agent does not have to completely prevent the onset of the condition in order to be effective. It is sufficient to simply reduce the impact of the disease (for example, by reducing the number or severity of its symptoms, or by increasing the effectiveness of another treatment, or by obtaining another beneficial effect) or by reducing the likelihood that the disease will manifest or worsen in the subject. One embodiment of the present invention relates to a method comprising administering an antibody to a patient in an amount and for a period of time sufficient to induce a significant improvement from baseline in a trait that reflects the severity of a particular disorder.

The anti-GIPR antibody or anti-GIPR-GLP-1 antibody fusion protein pharmaceutical composition may be administered by any suitable route, including, without limitation, parenterally, topically, or by inhalation. When injected, the pharmaceutical composition may be administered, for example, by intra-articular, intravenous, intramuscular, intralesional, intraperitoneal or subcutaneous route, by bolus injection or continuous infusion. For example, local administration at the site of disease or injury is envisaged, such as transdermal administration and delayed release of the implant. Delivery by inhalation includes, for example, nasal or oral inhalation, use of a nebulizer, inhalation of an aerosolized antibody, and the like. Other alternatives include oral medications, including pills, syrups, or lozenges.

Preferably, the anti-GIPR antibody or anti-GIPR antibody fusion protein provided herein is administered in a composition containing one or more additional components such as a physiologically acceptable carrier, adjuvant or diluent. The composition additionally contains one or more physiologically active agents, as described below. In many specific embodiments, the composition contains one, two, three, four, five, or six physiologically active agents in addition to one or more antibodies (eg, mouse antibodies or humanized antibodies) or GLP-1 fusion protein provided herein.

In one embodiment, the pharmaceutical composition comprises a mouse antibody or a humanized antibody or GLP-1 fusion protein provided herein, together with one or more substances selected from the group consisting of a buffer suitable for the antibody at a suitable pH, an antioxidant such as ascorbic acid, a low molecular weight polypeptide (e.g., containing less than 10 amino acids), a protein, an amino acid, a carbohydrate such as dextrin, a chelating agent such as EDTA , glutathione, stabilizer and adjuvant. Preservatives may also be added according to relevant industry standards. The composition may be formulated as a lyophilisate using appropriate solutions of the excipients as diluents. Suitable components are non-toxic to recipients at the doses and concentrations used. Additional examples of ingredients that can be used in pharmaceutical formulations are provided in Remington's Pharmaceutical Sciences, 16th Ed. (1980) and 20th Ed. (2000). Mack Publishing Company kits are provided for use by practitioners that include one or more antibodies or a GLP-1 fusion protein of the present invention, as well as a label or other instructions for use in the treatment of any of the conditions discussed in this application. In one embodiment, the kit includes a sterile preparation of one or more human antibodies or GLP-1 fusion proteins, which may be in the form of a composition disclosed above and may be contained in one or more vials.

Doses and frequency of administration may vary depending on such factors as the route of administration, the particular antibody or GLP-1 fusion protein used, the nature and severity of the disease being treated, whether the condition is acute or chronic, and the size and general condition of the subject. Suitable doses may be determined using procedures known in the art, such as in clinical trials, which may include dose escalation studies.

An antibody or GLP-1 fusion protein provided herein can be administered, for example, one or more times, for example, at regular intervals over a period of time. In specific embodiments, the mouse antibody or humanized antibody or GLP-1 fusion protein is administered once over a period of at least a month or longer, such as for one, two or three months, or even indefinitely. For the treatment of chronic conditions, long-term treatment is usually most effective. However, for the treatment of acute conditions, administration over shorter periods of time, eg one to six weeks, may be sufficient. Typically, the humanized antibody is administered until the patient shows a medically meaningful degree of improvement from baseline for the selected measure or measures.

An exemplary treatment regimen provided herein includes subcutaneous injection of an antibody or GLP-1 fusion protein at an appropriate dose once a week or longer to treat symptoms caused by type 2 diabetes, obesity, or non-alcoholic steatohepatitis. The antibody or GLP-1 fusion protein can be administered weekly or monthly until the desired result is achieved, for example until the patient's symptoms disappear. If necessary, treatment can be resumed, or, alternatively, a maintenance dose can be prescribed.

The blood glucose concentration and body weight of the patient can be monitored before, during and/or after treatment with an antibody or GLP-1 fusion protein, such as a human antibody or GLP-1 fusion protein, to detect any changes in their load. Under certain conditions, changes in blood glucose levels may vary depending on factors such as the progression of the disease. The concentration of glucose in the blood can be determined using known techniques.

Specific embodiments of the methods and compositions herein involve the use of, for example, an antibody or GLP-1 fusion protein and one or more GIP antagonists, two or more antibodies or GLP-1 fusion proteins provided herein, or an antibody or GLP-1 fusion protein provided herein and one or more other GIP antagonists. In a further embodiment, the antibody or GLP-1 fusion protein is administered alone or in combination with other agents used to treat symptoms that are painful to the patient. Examples of these agents include protein and non-protein drugs. When multiple drugs are administered in combination, the dose should be adjusted accordingly, as is well known in the art. Combination therapy "combination administration" is not limited to simultaneous administration, but also includes treatment regimens in which antigen and protein are administered at least once during the course of administration, including the administration of at least one other therapeutic agent to the patient.

On the other hand, the present application provides a method for the preparation of a medicament for the treatment of type 2 diabetes, obesity and non-alcoholic steatohepatitis and related disorders, which provides a mixture of an antibody or a GLP-1 fusion protein presented in the present application and a pharmaceutically acceptable excipient for the treatment of diseases associated with the above diseases. The pharmaceutical preparation method is described above.

In addition, the present application provides compositions, kits and methods related to antibodies or GLP-1 fusion proteins that can specifically bind to human GIPR. Also provided are nucleic acid molecules, as well as their derivatives and fragments, containing polynucleotides encoding all or part of a GIPR-binding polypeptide, for example, a nucleic acid encoding all or part of an anti-GIPR antibody, an antibody fragment, an antibody derivative, or a GLP-1 fusion protein. In addition, the present application provides vectors and plasmids containing such nucleic acids, as well as cells and cell lines containing such nucleic acids and/or vectors and plasmids. The methods provided herein include, for example, methods of making, identifying, or isolating antibodies or GLP-1 fusion proteins that bind to human GIPR, a method of determining whether an antibody or GLP-1 fusion protein binds to GIPR, and a method of introducing an antibody or GLP-1 fusion protein that binds to GIPR into an animal model.

The technical solutions described in this application will be further understood with the help of the following examples.

Unless otherwise indicated, the starting materials and equipment described in this application are commercially available or commonly used in the prior art. Unless otherwise indicated, all methods in the following examples are conventional in the art.

1. Obtaining antigen for immunization

CHO-DHFR- cells were seeded in a 6-well plate. After 24 hours (h), the cells were transfected with the pTM15 plasmid containing the hGIPR gene (see SEQ ID NO:114 for nucleotide sequence and SEQ ID NO:113 for amino acid sequence). Transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommended protocol. 48 hours after transfection, the medium was replaced with complete medium containing 300 μg/ml hygromycin, and the medium was changed every 3 days (d). Within approximately two weeks of cultivation, stable clones were observed. The dispersed cell colonies were separated from the plate and continuously subcultured until they reached 100% confluence. The engineered stable cell lines were analyzed by FACS using monoclonal antibodies (Life Technologies) to the V5 tag to check for positive clones after pressure selection. Selected CHO-DHFR-hGIPR cells showed a large amount of expressed hGIPR on the cell surface. Finally, three stable cell lines with high expression of hGIPR were identified by subcloning and further validation. These cell lines were used to obtain immunogens for the production of antibodies (see example 2). In addition, in some embodiments, a fusion protein of the extracellular domain of hGIPR and hIgG Fc could also be used as an immunogen to generate antibodies. The production method was as follows: subcloning the hGIPR extracellular domain fusion protein gene, hIgG Fc, and the peptide linker (linker) into the pTM5 plasmid. Cellular supernatant was obtained by bulk transient expression using suspended HEK293 cells, and then fused to the extracellular domain of hGIPR protein was obtained by purification by affinity chromatography.

2. Obtaining antibodies.

Anti-hGIPR antibodies can be generated using an immunogen including any of the following. For example, in some embodiments, whole cells expressing hGIPR are used as immunogens to generate anti-hGIPR antibodies. In addition, in some embodiments, fusion proteins comprising the N-terminal extracellular domain of hGIPR and hFc have been used as immunogens to generate anti-hGIPR antibodies. The immunogen and aluminum hydroxide adjuvant were mixed and BALB/c mice (6-8 weeks old) were injected subcutaneously and challenged once a week. After a total of 6 rounds of immunization, blood samples were collected from the tail veins and the serum was separated by centrifugation, then the serum titer was analyzed by FACS. After reaching the highest titers, mice were sacrificed and spleen cells were collected from them under aseptic conditions. SP2/0 cells in logarithmic growth phase were harvested, centrifuged, cell pellets were resuspended in serum-free culture medium, then centrifuged, resuspended a second time and counted. Spleen cells and SP2/0 cells were mixed at a ratio of SP2/0 cells:spleen cells ≥ 1:1 followed by 3 wash-centrifuge cycles. After shaking off the pellets from the last centrifugation, 1 ml of pre-warmed PEG-1500 was added dropwise, mixed with a pipette for 1 min., 30 ml of pre-warmed serum-free medium was slowly added to stop the fusion of PEG. Cell pellets were resuspended in culture medium for confluence. Spleen cells and feeder cells were seeded at 100 μl in each well of 96-well plates. Fused hybridoma cells and feeder cells were co-cultured in 96-well plates with HAT selection (sarcin, amethopterin and thymidine) to remove unfused cells. After 10 days, supernatants of hybridoma cells in culture plates were collected for ELISA analysis.

3. Selection of antibodies using ELISA

CHO-DHFR-hGIPR cells overexpressing hGIPR and empty CHO-DHFR- cells were separately transferred to a 96-well plate and allowed to reach 90% confluency. The supernatant of the culture medium was removed and the attached cells were washed twice with PBS and 100% methanol was added to fix the cells at 4°C. Then 100 µl of freshly prepared 0.6% H ₂ O ₂ -PBS was added and after incubation at room temperature for 20 minutes (min.), the cells were washed twice with PBS. After blocking with 1% BSA solution (dissolved in PBS), the hybridoma supernatant was added and incubated for 90 minutes. at 4°C. After several washes, 100 µl of diluted goat anti-mouse Fc-HRP secondary antibody (Sigma-Aldrich) was added to each well and incubated at 37° C. for 30 min. After washing five times, 100 μl of TMB chromogenic substrate was added and incubated at 37°C for 15 min., and then 50 μl of 2 MH ₂ SO ₄ was added to stop the reaction before reading at 450 nm. In addition, in some embodiments, a fusion protein of the N-terminal extracellular domain of hGIPR and hFc was used as the coating antigen. After blocking with 1% BSA (dissolved in PBS), hybridoma cell supernatant was added and incubated at 4°C for 90 min. The subsequent steps are similar to the ELISA method described above for screening monoclonal antibodies to hGIPR. The positive control is sera from immunized mice; the negative control is the cell culture medium. After preliminary screening by ELISA, several positive hybridoma cell lines were obtained that secreted anti-hGIPR antibodies. These hybridoma cell lines secreting anti-hGIPR antibodies were selected and subcloned by extreme dilution. Finally, the supernatant of the positive hybridoma cells was checked by FACS analysis (see Example 10).

4. Cloning and subcloning of antibody genes

Collected hybridoma cells secreting antibodies. The hybridoma mRNA was extracted according to the QIAGEN mRNA extraction kit manufacturer's protocol. The extracted mRNA was then subjected to reverse transcription into cDNA. The reverse transcription primers were specific primers for mouse light and heavy chain constant regions, in particular the heavy chain reverse transcription primer was 5'-TTTGGRGGGAAGATGAAGAC-3', the light chain reverse transcription primers were 5'-TTAACACTCTCCCCTGTTGAA-3' and 5'-TTAACACTCATTCCTGTTGAA-3'. RT-PCR reaction conditions are as follows: 25°C for 5 minutes, 50°C for 60 minutes. and 70°C for 15 min. Reverse transcribed cDNA was diluted with 0.1 mM TE to 500 µl, added to an ultrafiltration centrifuge tube (Amicon Ultra-0.5) and centrifuged at 2000 g for 10 min. The filtrate was removed, 500 µl of 0.1 mM TE was added and centrifuged at 2000 g for 10 min. The filtrate was removed, the sample tube was inverted into a new centrifuge tube and centrifuged at 2000 g for 10 min. to obtain purified cDNA. Purified cDNA (10 µl) was used as a template, then 4 µl of 5-tail buffer (Promega), 4 µl of dATP (1 mM) and 10 u. end transferase (Promega), mixed until homogeneous and incubated at 37°C for 5 min., and then at 65°C for 5 min. The polyA tail cDNA was used as a template and PCR was performed to amplify the antibody light and heavy chain variable region genes. All forward primers were oligodT, where the reverse primers for the heavy chain sequence were 5'-TGGACAGGGATCCAGAGTTCC-3' and 5'-TGGACAGGGCTCCATAGTTCC-3', and the reverse primers for the light chain sequence were 5'-ACTCGTCCTTGGTCAACGTG-3'. RT-PCR reaction conditions were as follows: 95° C. for 5 minutes; 95°C for 30 seconds (s), 56°C for 30 s, 72°C for 1 min, 40 cycles; and 72°C for 7 min. PCR products were coupled to PMD 18-T vector (Takara Bio) for sequencing. PCR primers were designed based on the DNA sequences of the antibodies, thus the entire light chain, heavy chain signal peptides and variable domains, as well as the mouse IgG1 constant region were ligated into the pTM5 expression vector.

5. Humanization and optimization of the antibody

First of all, the variable region sequences of mouse antibody light and heavy chains were used as input in searching with the online NCBI Antibody Variable Region Sequence Alignment Tool (Ig Blast) to find the human antibody germline gene sequence (Ig Germline Gene sequence), the homologous mouse antibody variable region sequence for humanization, and the human gene sequence with the highest homology, excluding the CDR sequences, was used as a template for transplantation of CDRs to obtain humanized antibody variable region sequences. The humanized antibody light and heavy chain variable region genes were synthesized and combined with a human IgG2 or IgG4 constant region sequence to generate full length recombinant humanized antibody sequences. Recombinant antibodies were expressed according to Example 8 and their GIPR affinities were analyzed by FACS as described in Example 10 to select the antibody with the best affinity. The variable region sequences of the humanized antibody were constructed using site-directed mutagenesis to further improve its GIPR affinity.

6. Subcloning of Humanized Anti-hGIPR Antibody Genes

The heavy and light chain variable region gene sequences of the optimized humanized antibodies were synthesized by outsourcing. During the process, two restriction sites, NheI at the 5'end and SalI at the 3'end, were introduced into the heavy chain variable region sequence. The entire heavy chain variable region was ligated to the heavy chain constant region in the pTM5 expression vector. Similarly, by introducing NheI at the 5' end and BsiwI at the 3' end, the light chain variable region was ligated to the light chain constant region in the pTM5 expression vector.

7. Construction of Humanized Anti-hGIPR Anti-GLP-1 Antibody Fusion Protein

The optimized humanized antibody was fused to GLP-1 or its derivative sequences via the N-terminus or C-terminus of the light chain to form a GLP-1 fusion protein, and the sequences of the two molecules were linked by a peptide linker sequence (linker) as a bridge. The signal peptide-GLP-1 linker nucleotide sequence was synthesized using Genscript Biotechnology Co., Ltd. using the synthetic gene as a template, the sequence of the "signal peptide-GLP1-linker" part was amplified using PCR. In addition, using the nucleotide sequence of the humanized antibody as a template, the antibody sequence of the fusion protein sequence was amplified. The "signal peptide-GLP-1-peptide linker" portion of the nucleic acid sequence of the fusion protein was then fused to the antibody portion by overlapping PCR by introducing two restriction enzyme sites Nhe1 and Not1 at both ends of the primers, and thus the entire fusion protein sequence and the pTM5 expression vector were linked together.

8. Transient Expression of Anti-hGIPR Antibody and GLP-1 Fusion Protein

A suspension of HEK293 or CHO cells (5×10 ⁵ /ml) was inoculated into a mixing flask. After spinning at 37° C. for 24 hours, the cell density reached 1 x 10 ⁶ /ml and they were used for transfection. Polyethyleneimine (PEI) was used as a transfection reagent and mixed with DNA. The PEI/DNA mixture was added to the cell culture after 15 minutes of incubation. After obtaining the PEI/DNA mixture, the cells were continuously cultured at 37°C, 5% CO ₂ for 24 hours. Then, tryptone was added to the cell culture as an expression additive. Finally, after completion of protein expression (greater than 96 hours), the cell supernatant was collected for antibody purification.

9. Purification and separation of anti-hGIPR antibody and GLP-1 fusion protein

Cells and cell debris were removed from the culture after centrifugation (8000 rpm) and the supernatant was filtered through a 0.22 µm filter. The clarified supernatant was used for purification. The purification process was performed using a chromatograph. The supernatant first passed through the A/G proteins affinity column, during which time the antibody bound to the A/G proteins and remained in the column. The antibodies were then eluted from the chromatographic column using a low pH elution buffer (less than or equal to 3.0). The low pH eluent was immediately neutralized with 1M Tris-HCl. The purified antibody was then dialyzed against PBS or other buffer systems.

10. FACS to Test the Binding Activity of Functional Anti-hGIPR Antibodies

PBS containing 10 mM EDTA was used to separate CHO-DHFR-hGIPR cells, 10 ⁵ cells/tube were dispensed into 1.5 ml EP tubes and the supernatant was removed after centrifugation. A negative control sample was resuspended in loading buffer (PBS, 2% FBS). For a positive control, 200 µl of an anti-GIPR antibody solution of a certain concentration was added to the cells and incubated at room temperature; then after incubation the cells were centrifuged at 1500 rpm to remove the supernatant, washed with FACS loading buffer and centrifuged again. Cells were resuspended by adding (200 μl/well) FITC labeled goat fluorescent anti-mouse antibody or PE labeled goat fluorescent anti-human antibody at a 1:50 dilution and incubated at room temperature for 30 minutes in the dark. The supernatant was removed after centrifugation and the cells were washed with FACS loading buffer, centrifuged again and resuspended with FACS assay loading buffer. The recombinant functional anti-hGIPR antibody specifically binds to GIPR-expressing CHO-DHFR-GIPR cells. In the experimental results shown in Figure 1, the gray peak and the peak shown in dotted lines were negative controls; the peak shown in solid line, corresponding to 1 μm L10H8 antibody, shows a significant shift to the right, which proves the specific binding of L10H8 and CHO-DHFR-GIPR.

11. Trial Analysis of cAMP Anti-hGIPR Antibody or Anti-hGIPR/GLP-1 Antibody Fusion Protein for In Vitro GIPR Antagonistic Activity

CHO-DHFR cells stably expressing human GIPR were plated at 30,000 cells/well in 96-well cell culture plates placed in a 37° C., 5% CO ₂ incubator overnight. The next day, the supernatant was removed and hybridoma supernatant or serially diluted antibody was added at 45 μl/well. Cells were left at room temperature for 30 minutes, then GIP peptide (Phoenix Pharmaceuticals, 50 pM) was added at 45 μl/well. Then, the 96-well plate was placed in an incubator at 37°C, 5% CO ₂ for 30 minutes, 10 μl/well of 10% Triton X-100 was added to lyse the cells at room temperature, and the lysate was uniformly mixed with a pipette. A cAMP kit (CisBio) was used to detect cAMP produced in the experiment. Transfer 10 µl/well of the above cell lysate to a white 384-well plate, add 5 µl/well of 1:20 diluted cAMP-d2, and finally add 5 µl/well of 1:20 diluted anti-cAMP-Eu3±cryptate antibody, and the plate was incubated at room temperature for 1 hour. with a time resolution of 665 nm/620 nm was read on an Envision 2103 microplate reader and then used Prism5.0 to calculate the IC ₅₀ value. Figure 2 shows that L7H6 antagonizes GIPR with an IC ₅₀ =7.6 nM. Figure 3 shows that the GLP-1 linker-L7H6 antagonizes GIPR with an IC ₅₀ =14.9 nM.

12. Reporter gene assay to test the anti-hGIPR/GLP-1 antibody fusion protein for its in vitro activation of GLP-1R

CHO-DHFR-cells co-expressing hGLP1R and CRE-luciferase were seeded in a 96-well cell culture plate at 20,000 cells/well and cultured at 37° C. overnight. The next day, the culture supernatant was removed. Cells were washed twice with serum-free medium and residual liquid was also removed. Then, 100 µl of serum-free medium containing serially diluted antibodies or GLP-1 was added and incubated at 37°C for 4 hours. After stimulation, 100 µl of Bright Glo chemiluminescent substrate (Promega) was added. Finally, the cell lysates were transferred to a white 96-well plate and the relative light intensity was recorded on a SpectraMax L microplate reader (Molecular Devices). The figure 4 shows that the GLP-1-linker-L7H6 activates hGLP-1R with EC ₅₀ =0.04 nm.

13. In vivo study of the efficacy of an anti-hGIPR antibody in C57BL/6 mice with obesity caused by a high-fat diet

A model of obesity was created in C57BL/6 mice (DIO mice) induced by a 60% high fat diet. After the mice were purchased and fed a normal diet for a week, a certain number of mice were randomly selected as a normal control group to receive a normal mouse diet, and the remaining animals were fed a high fat diet. All animals were fed continuously for 8 weeks, and body weight and food intake were assessed once a week. Subsequently, mice fed a high fat diet were randomly divided into a L10H8 (10 mg/kg) treated group and a model group according to their body weight. Drugs were administered subcutaneously every two days for 6 weeks. The normal control group was not administered and the model group received the same amount of the blank formulation. Data on body weight, food intake, and behavioral observations were collected throughout the experimental period. On the last day of the experiment, after 12 hours of fasting (free access to water), orbital blood was collected from the animal to separate the blood serum, and then subjected to euthanasia, the liver was excised, weighed, and the liver morphology was examined. Tested levels of ALT, AST, GLU, TC and TG in serum and TG in the liver (see results in table 3).

Table 3. Results of biochemical tests of each group after drug administration Analytes normal group L10H8 treated group Model group ALT (IU/l) 37.88 ± 5.08 ^** 92.08 ± 30.05 ^** 158.37 ± 40.50 AST (MEU/L) 136.20 ± 24.21 ^** 157.20± 27.09 184.82± 35.49 GLU (mmol/l) 8.38± 1.15 ^** 11.67± 2.04 10.91 ± 1.87 TC (mmol/l) 3.29 ± 0.25 ^** 6.30±0.31 6.62±1.00 TG (mmol/l) 0.99 ± 0.07 ^** 1.41± 0.13 ^* 1.21 ± 0.11 TG in liver (mmol/l) 26.83± 16.96 ^** 88.23±9.61 ^* 159.08 ± 67.87 Liver index (g/100 g) 3.65±0.23 3.76±0.44 ^* 4.56 ± 1.28

Note: means ± SEM, compared with the model group, * P < 0.05, ** P <0.01; liver index=liver weight/body weight*100.

After 6 weeks of L10H8 administration, the weight gain in the L10H8 treated group was only slightly lower than that of the model group, but the liver weight was significantly lower than that of the model group and close to that of the normal control group. The liver TG level of the L10H8-treated group was significantly lower than that of the model group, and the serum TG level was significantly higher than that of the model group. These results show that L10H8 significantly slows the absorption and accumulation of fat in the liver. The figure 5 shows the percentage change in body weight in each group. Table 3 summarizes the analytical data of the liver in each group after receiving antibodies L10H8 for 6 weeks.

14. Pharmacokinetic study of anti-GIPR/GLP-1 antibody fusion protein in cynomolgus monkeys

A total of 6 cynomolgus monkeys (3 males and 3 females) received a single subcutaneous injection of GLP-1 fusion protein/hGIPR antibody at a dose of 2 mg/kg, and a 0.6 ml whole blood sample was collected from each before administration (0 min.), after 2 hours, 4 hours, 8 hours, 12 hours, 24 hours, 2 days, 4 days, 6 days, 8 days, 10 days, 12 days, 18 days, 28 days after injection through the vein of the forelimbs on the same side of the body as the injection site, and placed in a centrifuge tube on ice, then after natural coagulation, the blood samples were centrifuged to separate the blood serum and stored at low temperature (-80°C) until use. The GLP-1 portion and the anti-hGIPR antibody portion of the GLP-1/anti-hGIPR fusion protein in serum samples were quantified separately by ELISA, and the half-life of both was determined in cynomolgus monkey by software analysis.

15. In Vivo Efficacy Study of Anti-hGIPR/GLP-1 Antibody Fusion Protein in Cynomolgus Macaques on a High Fat Diet

A model of cynomolgus monkeys (cynomolgus monkey DIO) with obesity caused by a 60% high fat diet was created and then used to evaluate the in vivo efficacy of GLP-1-linker-L7H6 by subcutaneous injection. Monkeys on a high fat diet were randomly divided into a GLP-1 linker-L7H6 (10 mg/kg) treated group and a model group according to their body weight. The drug was administered subcutaneously every two days for a total of 8 weeks, and the model group received an equal volume of the blank formulation. Data on body weight, food intake, and behavioral observations were collected throughout the experimental period. After the experiment was completed, the animals were euthanized, the liver was excised, weighed, and the liver morphology was examined. Serum levels of ALT, AST, GLU, TC and TG and liver TG were tested.

The above embodiments are intended to fully disclose and explain how one of ordinary skill in the art can make and use the claimed embodiments, and are not intended to limit the scope of the present invention. Modifications obvious to those skilled in the art are within the scope of the claims in this application. All publications, patents and patent applications cited in the descriptions are incorporated herein by reference, just as if each were separately and independently incorporated by reference.

--->

SEQUENCE LIST

<110> Gmax Biopharm LLC.

<120> ANTIBODY TO GIPR AND ITS GLP-1 fusion PROTEIN AND PHARMACEUTICAL

COMPOSITION ON ITS BASIS AND ITS APPLICATION

<130> 2018

<160> 124

<170> PatentIn version 3.5

<210> 1

<211> 11

<212> PROTEIN

<213> Mus musculus

<400> 1

Lys Ala Ser Gln Asp Val Gly Thr Ala Val Ala

1 5 10

<210> 2

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 2

Trp Ala Tyr Ile Arg His Thr

15

<210> 3

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 3

Gln Gln Tyr Ser Ser Tyr Pro Trp Thr

15

<210> 4

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 4

Arg Pro Ser Glu Ser Val Asp Ser Tyr Gly Asn Ser Phe Met His

1 5 10 15

<210> 5

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 5

Leu Ala Ser Asn Leu Glu Ser

15

<210> 6

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 6

Gln Gln Asn Asn Glu Asp Pro Arg Thr

15

<210> 7

<211> 11

<212> PROTEIN

<213> Mus musculus

<400> 7

Lys Ala Ser Glu Asp Ile Tyr Asn Arg Phe Ala

1 5 10

<210> 8

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 8

Asp Ala Thr Ser Leu Glu Thr

15

<210> 9

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 9

Gln Gln Tyr Trp Ser Ile Pro Trp Thr

15

<210> 10

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 10

Arg Ala Ser Gln Ser Val Asn Thr Ser Val Tyr Ser Tyr Ile His

1 5 10 15

<210> 11

<211> 7

<212> PROTEIN

<213> Mus musculus

<400> 11

Tyr Ala Ser Asn Leu Glu Ser

15

<210> 12

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 12

Gln His Ser Trp Asp Phe Pro Tyr Thr

15

<210> 13

<211> 15

<212> PROTEIN

<213> Mus musculus

<400> 13

Arg Ala Ser Gln Ser Val Asn Thr Ala Val Tyr Ser Tyr Ile His

1 5 10 15

<210> 14

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 14

Gln His Ser Phe Asp Phe Pro Tyr Thr

15

<210> 15

<211> 11

<212> PROTEIN

<213> Mus musculus

<400> 15

Lys Ala Ser Gln Asp Ile Asn Ser Tyr Leu Ser

1 5 10

<210> 16

<211> 6

<212> PROTEIN

<213> Mus musculus

<400> 16

Ala Asn Arg Leu Val Asp

15

<210> 17

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 17

Leu Gln Tyr Asp Glu Phe Pro Phe Thr

15

<210> 18

<211> 10

<212> PROTEIN

<213> Mus musculus

<400> 18

Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser

1 5 10

<210> 19

<211> 16

<212> PROTEIN

<213> Mus musculus

<400> 19

Ser Ile Ser Ser Gly Gly Ala Thr Tyr Tyr Pro Asp Ser Val Lys Gly

1 5 10 15

<210> 20

<211> 13

<212> PROTEIN

<213> Mus musculus

<400> 20

Gly Glu Gly Gly Ser Ser Tyr Pro Ala Trp Phe Ala Phe

1 5 10

<210> 21

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 21

Glu Ile Ser Ser Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr

1 5 10 15

gly

<210> 22

<211> 17

<212> PROTEIN

<213> Mus musculus

<400> 22

Asp Lys Ala Thr Arg Thr Gly Met Gly Phe Phe Tyr His Thr Met Asp

1 5 10 15

Tyr

<210> 23

<211> 10

<212> PROTEIN

<213> Mus musculus

<400> 23

Gly Tyr Thr Phe Ser Arg Tyr Trp Ile Glu

1 5 10

<210> 24

<211> 16

<212> PROTEIN

<213> Mus musculus

<400> 24

Glu Ile Leu Pro Gly Ser Asp Ser Pro Asn Tyr Asn Glu Lys Phe Lys

1 5 10 15

<210> 25

<211> 9

<212> PROTEIN

<213> Mus musculus

<400> 25

Thr Val Val Ala Thr Arg Phe Ala Tyr

15

<210> 26

<211> 11

<212> PROTEIN

<213> Mus musculus

<400> 26

Gly Tyr Ser Ile Thr Ser Asp Tyr Ala Trp Asn

1 5 10

<210> 27

<211> 16

<212> PROTEIN

<213> Mus musculus

<400> 27

Tyr Ile Ser Tyr Arg Gly Ile Ala Thr Tyr Lys Pro Ser Leu Lys Ser

1 5 10 15

<210> 28

<211> 10

<212> PROTEIN

<213> Mus musculus

<400> 28

Gly Glu Tyr Gly Pro Gly Asn Phe Asp Phe

1 5 10

<210> 29

<211> 16

<212> PROTEIN

<213> Mus musculus

<400> 29

Tyr Met Ser Tyr Arg Gly Thr Ala Thr Tyr Asn Pro Phe Leu Lys Ser

1 5 10 15

<210> 30

<211> 10

<212> PROTEIN

<213> Mus musculus

<400> 30

Tyr Asp Tyr Asp Val Pro Arg Phe Pro Tyr

1 5 10

<210> 31

<211> 33

<212> DNA

<213> Mus musculus

<400> 31

aaggccagtc aggatgtggg tactgctgta gcc 33

<210> 32

<211> 21

<212> DNA

<213> Mus musculus

<400> 32

tgggcataca tccggcacac t 21

<210> 33

<211> 27

<212> DNA

<213> Mus musculus

<400> 33

cagcaatata gcagctatcc gtggacg 27

<210> 34

<211> 45

<212> DNA

<213> Mus musculus

<400> 34

agacccagtg aaagtgttga tagttatggc aatagtttta tgcac 45

<210> 35

<211> 21

<212> DNA

<213> Mus musculus

<400> 35

cttgcatcca acctagaatc t 21

<210> 36

<211> 27

<212> DNA

<213> Mus musculus

<400> 36

cagcaaaata atgaggatcc tcggacg 27

<210> 37

<211> 33

<212> DNA

<213> Mus musculus

<400> 37

aaggcaagtg aggacatata taatcggttc gcc 33

<210> 38

<211> 21

<212> DNA

<213> Mus musculus

<400> 38

gatgcaacca gtttggaaac t 21

<210> 39

<211> 27

<212> DNA

<213> Mus musculus

<400> 39

caacagtatt ggagtattcc gtggacg 27

<210> 40

<211> 45

<212> DNA

<213> Mus musculus

<400> 40

agggccagcc aaagtgtcaa tacatctgtc tatagttata tacac 45

<210> 41

<211> 21

<212> DNA

<213> Mus musculus

<400> 41

tatgcatcca acctagaatc t 21

<210> 42

<211> 27

<212> DNA

<213> Mus musculus

<400> 42

caacacagtt gggattttcc ttacacg 27

<210> 43

<211> 45

<212> DNA

<213> Mus musculus

<400> 43

agagccagcc agtccgtgaa cacagccgtg tactcttata tccac 45

<210> 44

<211> 27

<212> DNA

<213> Mus musculus

<400> 44

cagcacagct tcgatttccc ctacacc 27

<210> 45

<211> 33

<212> DNA

<213> Mus musculus

<400> 45

aaggcgagtc aggacattaa tagctattta agc 33

<210> 46

<211> 18

<212> DNA

<213> Mus musculus

<400> 46

gcaaacagat tggtagat 18

<210> 47

<211> 27

<212> DNA

<213> Mus musculus

<400> 47

ctacagtatg atgagtttcc attcacg 27

<210> 48

<211> 30

<212> DNA

<213> Mus musculus

<400> 48

ggattcactt tcagtagcta tgccatgtct 30

<210> 49

<211> 45

<212> DNA

<213> Mus musculus

<400> 49

tccattagta gtggtggtgc cacctactat ccagacagtg tgaag 45

<210> 50

<211> 39

<212> DNA

<213> Mus musculus

<400> 50

ggcgaggggcg gtagtagcta cccggcctgg tttgctttc 39

<210> 51

<211> 51

<212> DNA

<213> Mus musculus

<400> 51

gaaattagta gtggtggtag ttacacctac tatccagaca ctgtgacggg c 51

<210> 52

<211> 51

<212> DNA

<213> Mus musculus

<400> 52

gataaggcga ctcgaactgg catgggattt tttttaccata ctatggacta c 51

<210> 53

<211> 30

<212> DNA

<213> Mus musculus

<400> 53

ggctacacat tcagtaggta ctggatagag 30

<210> 54

<211> 51

<212> DNA

<213> Mus musculus

<400> 54

gagattttac ctggaagtga tagtcctaac tacaatgaga agttcaaggg c 51

<210> 55

<211> 27

<212> DNA

<213> Mus musculus

<400> 55

acggtagtag ctacaaggtt tgcttac 27

<210> 56

<211> 33

<212> DNA

<213> Mus musculus

<400> 56

ggctactcaa tcaccagtga ttatgcctgg aac 33

<210> 57

<211> 48

<212> DNA

<213> Mus musculus

<400> 57

tacataagct acagaggcat cgctacctat aaaccatctc tcaaaagt 48

<210> 58

<211> 30

<212> DNA

<213> Mus musculus

<400> 58

ggggaatacg gccccggcaa ctttgacttc 30

<210> 59

<211> 48

<212> DNA

<213> Mus musculus

<400> 59

tacatgagct accgtggtac cgcaacgtac aatccatttc tcaaaagt 48

<210> 60

<211> 30

<212> DNA

<213> Mus musculus

<400> 60

tatgattacg acgttccccg gttttccttac 30

<210> 61

<211> 108

<212> PROTEIN

<213> Mus musculus

<400> 61

Asp Ile Val Met Thr Gln Ser His Lys Phe Met Ser Thr Ser Val Gly

1 5 10 15

Asp Arg Val Asn Ile Thr Cys Lys Ala Ser Gln Asp Val Gly Thr Ala

20 25 30

Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile

35 40 45

Tyr Trp Ala Tyr Ile Arg His Thr Gly Val Pro Asp Arg Phe Thr Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Val Gln Ser

65 70 75 80

Glu Asp Leu Thr Asp Tyr Phe Cys Gln Gln Tyr Ser Ser Tyr Pro Trp

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 62

<211> 112

<212> PROTEIN

<213> Mus musculus

<400> 62

Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Pro Ser Glu Ser Val Asp Ser Tyr

20 25 30

Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asp

65 70 75 80

Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Asn Asn

85 90 95

Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105 110

<210> 63

<211> 112

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 63

Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Pro Gly

1 5 10 15

Gln Arg Ala Thr Ile Thr Cys Arg Pro Ser Glu Ser Val Asp Ser Tyr

20 25 30

Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn

65 70 75 80

Pro Val Glu Ala Asn Asp Thr Ala Asn Tyr Tyr Cys Gln Gln Asn Asn

85 90 95

Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

<210> 64

<211> 112

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 64

Asn Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Arg Pro Ser Glu Ser Val Asp Ser Tyr

20 25 30

Gly Asn Ser Phe Met His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser Gly Val Pro Asp

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Asn Asn

85 90 95

Glu Asp Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

<210> 65

<211> 108

<212> PROTEIN

<213> Mus musculus

<400> 65

Asp Ile Gln Met Thr Gln Ser Ser Ser Ser Phe Ser Val Ser Leu Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Glu Asp Ile Tyr Asn Arg

20 25 30

Phe Ala Trp Phe Gln Gln Lys Pro Gly Asn Ala Pro Arg Leu Leu Ile

35 40 45

Ser Asp Ala Thr Ser Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Lys Asp Tyr Thr Leu Ser Ile Thr Ser Leu Gln Thr

65 70 75 80

Glu Asp Val Ala Thr Tyr Tyr Cys Gln Gln Tyr Trp Ser Ile Pro Trp

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105

<210> 66

<211> 112

<212> PROTEIN

<213> Mus musculus

<400> 66

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Gly Thr Ile Ser Cys Arg Ala Ser Gln Ser Val Asn Thr Ser

20 25 30

Val Tyr Ser Tyr Ile His Trp Tyr Arg Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ala Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Asn Ile His

65 70 75 80

Pro Val Glu Gly Glu Asp Ser Ala Thr Tyr Tyr Cys Gln His Ser Trp

85 90 95

Asp Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

100 105 110

<210> 67

<211> 112

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 67

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Pro Gly

1 5 10 15

Gln Arg Ala Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Asn Thr Ala

20 25 30

Val Tyr Ser Tyr Ile His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ala Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Asn

65 70 75 80

Pro Val Glu Ala Asn Asp Ala Ala Asn Tyr Tyr Cys Gln His Ser Phe

85 90 95

Asp Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

<210> 68

<211> 112

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 68

Asp Ile Val Leu Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Glu Arg Ala Thr Ile Asn Cys Arg Ala Ser Gln Ser Val Asn Thr Ser

20 25 30

Val Tyr Ser Tyr Ile His Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Lys Tyr Ala Ser Asn Leu Glu Ser Gly Val Pro Asp

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln His Ser Trp

85 90 95

Asp Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

<210> 69

<211> 108

<212> PROTEIN

<213> Mus musculus

<400> 69

Asp Ile Lys Met Thr Gln Ser Pro Ser Ser Val Tyr Ala Ser Leu Gly

1 5 10 15

Glu Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asp Ile Asn Ser Tyr

20 25 30

Leu Ser Trp Phe Gln Gln Lys Pro Gly Lys Ser Pro Lys Thr Leu Ile

35 40 45

Tyr Arg Ala Asn Arg Leu Val Asp Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Gln Asp Tyr Ser Leu Thr Ile Ser Ser Leu Glu Tyr

65 70 75 80

Glu Asp Met Gly Ile Tyr Tyr Cys Leu Gln Tyr Asp Glu Phe Pro Phe

85 90 95

Thr Phe Gly Ser Gly Thr Lys Leu Glu Met Lys Arg

100 105

<210> 70

<211> 110

<212> PROTEIN

<213> Homo sapiens

<400> 70

Ser Tyr Val Leu Thr Gln Pro Ser Ala Ser Gly Thr Pro Gly Gln

1 5 10 15

Arg Val Ala Ile Ser Cys Ser Gly Ser Asn Ser Asn Ile Gly Ser Asn

20 25 30

Thr Val His Trp Tyr Gln Gln Leu Pro Gly Ala Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Ser Asn Asn Gln Arg Pro Ser Gly Val Pro Asp Arg Phe Ser

50 55 60

Gly Ser Asn Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Arg Leu Gln

65 70 75 80

Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Leu

85 90 95

Asn Gly Val Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu

100 105 110

<210> 71

<211> 110

<212> PROTEIN

<213> Homo sapiens

<400> 71

Ser Tyr Val Leu Thr Gln Pro Ser Ala Ser Gly Thr Pro Gly Gln

1 5 10 15

Arg Val Ala Ile Ser Cys Ser Gly Ser Asn Ser Asn Ile Gly Ser Asn

20 25 30

Thr Val His Trp Tyr Gln Gln Leu Pro Gly Ala Ala Pro Lys Leu Leu

35 40 45

Ile Tyr Gly Asn Asn Asp Arg Pro Ser Gly Val Pro Asp Arg Phe Ser

50 55 60

Gly Ser Asn Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Arg Leu Gln

65 70 75 80

Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Ala Ala Trp Asp Asp Ser Leu

85 90 95

Asn Gly Val Val Phe Gly Gly Gly Thr Lys Val Thr Val Leu

100 105 110

<210> 72

<211> 121

<212> PROTEIN

<213> Mus musculus

<400> 72

Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Leu Thr Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Ser Ile Ser Ser Gly Gly Ala Thr Tyr Tyr Pro Asp Ser Val Lys

50 55 60

Gly Arg Phe Thr Phe Ser Arg Asp Asn Ala Arg Asn Ile Leu Tyr Leu

65 70 75 80

Gln Met Asn Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Thr

85 90 95

Arg Gly Glu Gly Gly Ser Ser Tyr Pro Ala Trp Phe Ala Phe Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ala

115 120

<210> 73

<211> 126

<212> PROTEIN

<213> Mus musculus

<400> 73

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ser Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Glu Ile Ser Ser Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val

50 55 60

Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr

65 70 75 80

Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Val Arg Asp Lys Ala Thr Arg Thr Gly Met Gly Phe Phe Tyr His Thr

100 105 110

Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser

115 120 125

<210> 74

<211> 126

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 74

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Glu Ile Ser Ser Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val

50 55 60

Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Val Arg Asp Lys Ala Thr Arg Thr Gly Met Gly Phe Phe Tyr His Thr

100 105 110

Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210> 75

<211> 118

<212> PROTEIN

<213> Mus musculus

<400> 75

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys Pro Gly Ala

1 5 10 15

Ser Val Lys Ile Ser Cys Lys Ala Thr Gly Tyr Thr Phe Ser Arg Tyr

20 25 30

Trp Ile Glu Trp Ile Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile

35 40 45

Gly Glu Ile Leu Pro Gly Ser Asp Ser Pro Asn Tyr Asn Glu Lys Phe

50 55 60

Lys Gly Lys Ala Thr Phe Thr Ala Asn Thr Ser Ser Asn Thr Ala Tyr

65 70 75 80

Met Gln Leu Ser Ser Leu Thr Phe Glu Asp Ser Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Thr Val Val Ala Thr Arg Phe Ala Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Phe Ala

115

<210> 76

<211> 119

<212> PROTEIN

<213> Mus musculus

<400> 76

Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln

1 5 10 15

Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp

20 25 30

Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Val Glu Trp

35 40 45

Met Gly Tyr Ile Ser Tyr Arg Gly Ile Ala Thr Tyr Lys Pro Ser Leu

50 55 60

Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys Asn Gln Phe Phe

65 70 75 80

Leu Asn Phe Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys

85 90 95

Val Arg Gly Glu Tyr Gly Pro Gly Asn Phe Asp Phe Trp Gly Gln Gly

100 105 110

Thr Thr Leu Thr Val Ser Ser

115

<210> 77

<211> 119

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 77

Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln

1 5 10 15

Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile Thr Ser Asp

20 25 30

Tyr Ala Trp Asn Trp Ile Arg Gln Pro Pro Gly Lys Gly Val Glu Trp

35 40 45

Met Gly Tyr Ile Ser Tyr Arg Gly Ile Ala Thr Tyr Lys Pro Ser Leu

50 55 60

Lys Ser Arg Ile Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln Phe Ser

65 70 75 80

Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Val Arg Gly Glu Tyr Gly Pro Gly Asn Phe Asp Phe Trp Gly Gln Gly

100 105 110

Thr Thr Val Thr Val Ser Ser

115

<210> 78

<211> 119

<212> PROTEIN

<213> Mus musculus

<400> 78

Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Gln

1 5 10 15

Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr Ser Asp

20 25 30

Tyr Ala Trp Asn Trp Ile Arg Gln Phe Pro Gly Asn Lys Leu Glu Trp

35 40 45

Met Gly Tyr Met Ser Tyr Arg Gly Thr Ala Thr Tyr Asn Pro Phe Leu

50 55 60

Lys Ser Arg Ile Ser Ile Asn Arg Asp Thr Ser Lys Asn Gln Val Phe

65 70 75 80

Leu Lys Leu Asn Ser Val Thr Thr Glu Asp Thr Ala Thr Tyr Tyr Cys

85 90 95

Ala Ser Tyr Asp Tyr Asp Val Pro Arg Phe Pro Tyr Trp Gly Gln Gly

100 105 110

Thr Leu Val Ile Val Ser Ala

115

<210> 79

<211> 119

<212> PROTEIN

<213> Homo sapiens

<400> 79

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Thr Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Gln Gly Pro Ile Val Gly Ala Pro Thr Asp Tyr Trp Gly Lys Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 80

<211> 119

<212> PROTEIN

<213> Homo sapiens

<400> 80

Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Lys Ser Tyr

20 25 30

Ala Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Thr Phe Gly Thr Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Val Thr Ile Thr Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Gln Gly Pro Ile Val Gly Ala Pro Thr Asp Tyr Trp Gly Lys Gly

100 105 110

Thr Leu Val Thr Val Ser Ser

115

<210> 81

<211> 324

<212> DNA

<213> Mus musculus

<400> 81

gacattgtga tgacccagtc tcacaaattc atgtccacat cagtaggaga cagggtcaac 60

atcacctgca aggccagtca ggatgtgggt actgctgtag cctggtatca acagaaacca 120

gggcaatctc ctaaactact gatttactgg gcatacatcc ggcacactgg agtccctgat 180

cgcttcacag gcagtggatc tgggacagat ttcactctca ccattagcaa tgtgcagtct 240

gaagacttga cagattattt ctgtcagcaa tatagcagct atccgtggac gttcggtgga 300

ggcaccaagc tggaaatcaa acgg 324

<210> 82

<211> 336

<212> DNA

<213> Mus musculus

<400> 82

aacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 60

atatcctgca gacccagtga aagtgttgat agttatggca atagttttat gcactggtac 120

cagcagaaac caggacagcc acccaaactc ctcatctatc ttgcatccaa cctagaatct 180

ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caccattgat 240

cctgtggagg ctgatgatgc tgcaacctat tactgtcagc aaaataatga ggatcctcgg 300

acgttcggtg gaggcaccaa gctggaaatc aaacgg 336

<210> 83

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 83

aatatcgtgc tgacccagtc tccagccagc ctggccgtgt ctccaggaca gagggccacc 60

atcacatgca gacctagcga gtccgtggat tcctacggca actctttcat gcactggtat 120

cagcagaagc ccggccagcc ccctaagctg ctgatctacc tggccagcaa tctggagtcc 180

ggagtgcctg caaggttctc tggaagcgga tcgggaaccg actttaccct gacaatcaac 240

ccagtggagg ccaacgatac agccaattac tattgtcagc agaacaatga ggacccgg 300

acctttggcg gaggaacaaa ggtggagatc aagcgt 336

<210> 84

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 84

aacatcgtgc tgacccagtc cccagactct ctggccgtgt ccctgggaga gagggccaca 60

atcaactgca gaccctctga gagcgtggat agctacggca attccttcat gcactggtat 120

cagcagaagc ctggccagcc ccctaagctg ctgatctacc tggcctctaa tctggagagc 180

ggcgtgccag acaggttctc cggatctgga agcggaaccg acttcaccct gacaatcagc 240

tccctgcagg cagaggacgt ggccgtgtac tattgtcagc agaacaatga ggatccccgg 300

acctttggcg gcggcacaaa ggtggagatc aagcgt 336

<210> 85

<211> 324

<212> DNA

<213> Mus musculus

<400> 85

gacatccaga tgacacaatc ttcatcctcc ttttctgtat ctctaggaga cagagtcacc 60

attacttgca aggcaagtga ggacatatat aatcggttcg cctggtttca gcagaaacca 120

ggaaatgctc ctaggctctt aatatctgat gcaaccagtt tggaaactgg ggttccttca 180

agattcagtg gcagtggatc tggaaaggat tacactctca gcattaccag tcttcagact 240

gaagatgttg ctacttatta ctgtcaacag tattggagta ttccgtggac gttcggtgga 300

ggcaccaagc tggaaatcaa acgg 324

<210> 86

<211> 336

<212> DNA

<213> Mus musculus

<400> 86

gacattgtgc tgacacagtc tcctgcttcc ttagctgtat ctctggggca gaggggcacc 60

atctcatgca gggccagcca aagtgtcaat acatctgtct atagttatat acactggtac 120

cggcagaaac caggtcagcc acccaaactc ctcatcaagt atgcatccaa cctagaatct 180

ggggtccctg ccaggttcag tggcagtggg tctgggacag acttcaccct caacatccat 240

cctgtggagg gggaggattc cgcaacatac tactgtcaac acagttggga ttttccttac 300

acgttcggag gggggaccaa gctggaaata aaacgg 336

<210> 87

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 87

gacatcgtgc tgacccagtc tccagccagc ctggccgtgt ctccaggaca gagggccacc 60

atcacatgca gagccagcca gtccgtgaac acagccgtgt actcttatat ccactggtac 120

cagcagaagc ctggccagcc ccctaagctg ctgatcaagt atgccagcaa cctggagtcc 180

ggagtgcctg cacggttctc tggaagcgga tcgggaaccg acttcaccct gacaatcaat 240

ccagtggagg ccaacgacgc cgccaattac tattgtcagc acagcttcga tttcccctac 300

acctttggcg gcggcacaaa ggtggagatc aagcgt 336

<210> 88

<211> 336

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 88

gacatcgtgc tgacccagtc ccctgattct ctggccgtgt ccctgggaga gagggcaacc 60

atcaactgca gagcctctca gagcgtgaat acaagcgtgt actcctatat ccactggtac 120

cagcagaagc caggccagcc ccctaagctg ctgatcaagt atgcctctaa cctggagagc 180

ggagtgccag accggttctc cggctctggc agcggcacag acttcaccct gacaatcagc 240

tccctgcagg cagaggacgt ggccgtgtac tattgtcagc actcttggga tttcccctac 300

acctttggcg gcggcacaaa ggtggagatc aagcgt 336

<210> 89

<211> 324

<212> DNA

<213> Mus musculus

<400> 89

gacatcaaga tgacccagtc tccatcttcc gtgtatgcat ctctaggaga gagagtcact 60

atcacttgca aggcgagtca ggacattaat agctatttaa gctggttcca gcagaaacca 120

gggaaatctc ctaagaccct gatctatcgt gcaaacagat tggtagatgg ggtcccatca 180

aggttcagtg gcagtggatc tgggcaagat tattctctca ccatcagcag cctggagtat 240

gaagatatgg gaatttatta ttgtctacag tatgatgagt ttccattcac gttcggctcg 300

gggacaaagt tggaaatgaa acgg 324

<210> 90

<211> 330

<212> DNA

<213> Homo sapiens

<400> 90

agctacgtgc tgacccagcc acctagcgcc tcgggaacac caggccagag ggtggccatc 60

tcttgcagcg gctccaactc taatatcggc tccaacaccg tgcactggta ccagcagctg 120

ccaggagcag cacccaagct gctgatctat tccaacaatc agcggccttc tggcgtgcca 180

gacagattca gcggctccaa ctctggcaca agcgcctccc tggccatctc tcggctgcag 240

agcgaggacg aggccgatta ctattgtgcc gcctgggacg attctctgaa tggcgtggtg 300

tttggcggcg gcaccaaggt gacagtgctg 330

<210> 91

<211> 330

<212> DNA

<213> Homo sapiens

<400> 91

agctacgtgc tgacccagcc acctagcgcc tcgggaacac caggccagag ggtggccatc 60

tcttgcagcg gctccaactc taatatcggc tccaacaccg tgcactggta tcagcagctg 120

ccaggagcag cacccaagct gctgatctat ggcaacaatg atcggccttc tggcgtgcca 180

gacagattca gcggctccaa ctctggcaca agcgcctccc tggccatctc tcggctgcag 240

agcgaggacg aggccgatta ctattgtgcc gcctgggacg attctctgaa tggcgtggtg 300

tttggcggcg gtaccaaggt gacagtgctg 330

<210> 92

<211> 363

<212> DNA

<213> Mus musculus

<400> 92

gaagtgaagc tggtggagtc tgggggaggc ttagtgaagc ctggagggtc cctgaaactc 60

tcctgtgcag cctctggatt cactttcagt agctatgcca tgtcttgggt tcgcctgact 120

ccagaaaaaa ggctggagtg ggtcgcatcc attagtagtg gtggtgccac ctactatcca 180

gacagtgtga agggccgatt caccttctcc agagataatg cgggaacat cctgtacctg 240

caaatgaaca gtctgaggtc tgaggacacg gccatgtatt actgtacaag aggcgagggc 300

ggtagtagct acccggcctg gtttgctttc tggggccaag ggactctggt cactgtctct 360

gca 363

<210> 93

<211> 378

<212> DNA

<213> Mus musculus

<400> 93

gaagtgcagc tggtggagtc tgggggaggc ttagtgaagc ctggagggtc cctgaaactc 60

tcctgtgcag cctctggatt cactttcagt agctatgcca tgtcttgggt tcgccagtct 120

ccagagaaga ggctggagtg ggtcgcagaa attagtagtg gtggtagtta cacctactat 180

ccagacactg tgacgggccg attcaccatc tccagagaca atgccaagaa caccctgtac 240

ctggaaatga gcagtctgag gtctgaggac acggccatgt attactgtgt aagggataag 300

gcgactcgaa ctggcatggg atttttttac catactatgg actactgggg tcaaggaacc 360

tcagtcaccg tctcctca 378

<210> 94

<211> 378

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 94

gaggtgcagc tggtggagtc tggaggagga ctggtgaagc caggaggaag cctgaggctg 60

tcctgcgcag cctctggctt cacctttagc tcctacgcca tgagctgggt gaggcaggca 120

ccaggcaagg gactggagtg ggtggccgag atctctagcg gcggctccta cacctactat 180

cctgacaccg tgacaggccg gttcacaatc agcagagata acgccaagaa ttccctgtat 240

ctgcagatga actctctgcg ggccgaggac accgccgtgt actattgcgt gcgggataag 300

gccacccgca caggcatgggg cttcttttac cacacaatgg actattgggg cggggcacc 360

ctggtgacag tgtcctct 378

<210> 95

<211> 354

<212> DNA

<213> Mus musculus

<400> 95

caggttcaac tgcagcagtc tggagctgag ctgatgaagc ctggggcctc agtgaagata 60

tcctgcaagg ctactggcta cacattcagt aggtactgga tagagtggat aaagcagagg 120

cctggacatg gccttgagtg gattggagag attttacctg gaagtgatag tcctaactac 180

aatgagaagt tcaagggcaa ggccacattc actgcaaata catcctccaa cacagcctac 240

atgcaactca gcagcctgac atttgaggac tctgccgtct attactgtgc aagaacggta 300

gtagctacaa ggtttgctta ctggggccaa gggactctgg tcactgtctt tgca 354

<210> 96

<211> 357

<212> DNA

<213> Mus musculus

<400> 96

gatgtgcagc ttcaggagtc gggacctggc ctggtgaaac cttctcagtc tctgtccctc 60

acctgcactg tcactggcta ctcaatcacc agtgattatg cctggaactg gatccggcag 120

tttcctggaa acaaagtgga gtggatgggc tacataagct acagaggcat cgctacctat 180

aaaccatctc tcaaaagtcg aatctctatc actcgagaca catccaagaa ccagttcttc 240

ctgaacttta attctgtgac tactgaggac acagccacat attactgtgt aagaggggaa 300

tacggccccg gcaactttga cttctggggc caaggcacca ctctcacagt ctcctca 357

<210> 97

<211> 357

<212> DNA

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 97

caggtgcagc tgcaggagtc cggaccagga ctggtgaagc caagccagac cctgtccctg 60

acctgcacag tgtccggcta ctctatcaca agcgattatg cctggaactg gatcaggcag 120

ccacctggca agggagtgga gtggatgggc tacatctcct atcgcggcat cgccacctac 180

aagccttccc tgaagtctcg gatcaccatc tctagagaca caagcaagaa ccagttctct 240

ctgaagctga gctccgtgac cgccgccgat acagccgtgt actattgcgt gcggggcgag 300

tatggccccg gcaatttcga cttttggggc cagggcacca cagtgacagt gtctagc 357

<210> 98

<211> 357

<212> DNA

<213> Mus musculus

<400> 98

gatgtgcagc ttcaagagtc gggacctggc ctggtgaaac cttctcagtc tctgtccctc 60

acctgcactg tcactggcta ctcaatcacc agtgattatg cctggaactg gatccggcag 120

tttccaggaa acaaactgga gtggatgggc tacatgagct accgtggtac cgcaacgtac 180

aatccatttc tcaaaagtcg aatctctatc aatcgggaca catccaagaa ccaggtcttc 240

ctgaagttga attctgtgac tactgaggac acagccacat attactgtgc aagttatgat 300

tacgacgttc cccggtttcc ttactggggc caagggactc tggtcattgt ttctgca 357

<210> 99

<211> 357

<212> DNA

<213> Homo sapiens

<400> 99

caggtgcagc tgcagcagag cggagcagag gtgaagaagc caggaagctc cgtgaaggtg 60

tcctgcaagg cctctggcgg caccttctct agctacgcca tctcctgggt gcggcaggca 120

cggacagg gactggagtg gatgggagga atcatcccca ccttcggcac agccaactac 180

gcccagaagt ttcagggccg ggtgaccatc acagccgacg agtctaccag cacagcctat 240

atggagctgt cctctctgag atctgaggat accgccgtgt actattgtgc acagggacca 300

atcgtgggag cacctacaga ctattggggc aagggcaccc tggtgacagt gagctcc 357

<210> 100

<211> 357

<212> DNA

<213> Homo sapiens

<400> 100

caggtgcagc tgcagcagag cggagcagag gtgaagaagc caggaagctc cgtgaaggtg 60

tcctgcaagg cctctggcgg caccttcaag agctacgcca tctcctgggt gcggcaggca 120

cggacagg gactggagtg gatgggagga atcatcccca ccttcggcac agccaactac 180

gcccagaagt ttcagggccg ggtgaccatc acagccgacg agtctaccag cacagcctat 240

atggagctgt cctctctgag atctgaggat accgccgtgt actattgtgc acagggacca 300

atcgtgggag cacctacaga ctattggggc aagggcaccc tggtgacagt gagctcc 357

<210> 101

<211> 106

<212> PROTEIN

<213> Homo sapiens

<400> 101

Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Ser Asp Glu Gln

1 5 10 15

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr

20 25 30

Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser

35 40 45

Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr

50 55 60

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys

65 70 75 80

His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro

85 90 95

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

100 105

<210> 102

<211> 106

<212> PROTEIN

<213> Homo sapiens

<400> 102

Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser

1 5 10 15

Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp

20 25 30

Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro

35 40 45

Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn

50 55 60

Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys

65 70 75 80

Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val

85 90 95

Glu Lys Thr Val Ala Pro Thr Glu Cys Ser

100 105

<210> 103

<211> 326

<212> PROTEIN

<213> Homo sapiens

<220>

<221> OTHER SIGN

<222> (131)..(131)

<223> Xaa at position 131 is Met or Tyr

<220>

<221> OTHER SIGN

<222> (133)..(133)

<223> Xaa at position 133 is Ser or Thr

<220>

<221> OTHER SIGN

<222> (135)..(135)

<223> Xaa at position 135 is Thr or Glu

<220>

<221> OTHER SIGN

<222> (307)..(307)

<223> Xaa at position 307 is Met or Leu

<220>

<221> OTHER SIGN

<222> (313)..(313)

<223> Xaa at position 313 is Asn or Ser

<220>

<221> OTHER SIGN

<222> (326)..(326)

<223> Xaa at position 326 is Lys or absent

<400> 103

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Asn Phe Gly Thr Gln Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Thr Val Glu Arg Lys Cys Cys Val Glu Cys Pro Pro Cys Pro Ala Pro

100 105 110

Pro Val Ala Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp

115 120 125

Thr Leu Xaa Ile Xaa Arg Xaa Pro Glu Val Thr Cys Val Val Val Asp

130 135 140

Val Ser His Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly

145 150 155 160

Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn

165 170 175

Ser Thr Phe Arg Val Val Ser Val Leu Thr Val Val His Gln Asp Trp

180 185 190

Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro

195 200 205

Ala Pro Ile Glu Lys Thr Ile Ser Lys Thr Lys Gly Gln Pro Arg Glu

210 215 220

Pro Gln Val Tyr Thr Leu Pro Ser Arg Glu Glu Met Thr Lys Asn

225 230 235 240

Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile

245 250 255

Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr

260 265 270

Thr Pro Pro Met Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys

275 280 285

Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys

290 295 300

Ser Val Xaa His Glu Ala Leu His Xaa His Tyr Thr Gln Lys Ser Leu

305 310 315 320

Ser Leu Ser Pro Gly Xaa

325

<210> 104

<211> 327

<212> PROTEIN

<213> Homo sapiens

<220>

<221> OTHER SIGN

<222> (132)..(132)

<223> Xaa at position 132 is Met or Tyr

<220>

<221> OTHER SIGN

<222> (134)..(134)

<223> Xaa at position 134 is Ser or Thr

<220>

<221> OTHER SIGN

<222> (136)..(136)

<223> Xaa at position 136 is Thr or Glu

<220>

<221> OTHER SIGN

<222> (308)..(308)

<223> Xaa at position 308 is Met or Leu

<220>

<221> OTHER SIGN

<222> (314)..(314)

<223> Xaa at position 314 is Asn or Ser

<220>

<221> OTHER SIGN

<222> (327)..(327)

<223> Xaa at position 327 is Lys or absent

<400> 104

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro

100 105 110

Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Xaa Ile Xaa Arg Xaa Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Xaa His Glu Ala Leu His Xaa His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Leu Gly Xaa

325

<210> 105

<211> 29

<212> PROTEIN

<213> Homo sapiens

<400> 105

His Ala Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly

1 5 10 15

Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly

20 25

<210> 106

<211> 29

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 106

His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly

1 5 10 15

Gln Ala Ala Lys Glu Phe Ile Ala Trp Leu Val Lys Gly

20 25

<210> 107

<211> 22

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 107

His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly

1 5 10 15

Gln Ala Ala Lys Glu Phe

20

<210> 108

<211> 23

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 108

His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly

1 5 10 15

Gln Ala Ala Lys Glu Phe Ile

20

<210> 109

<211> 24

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 109

His Gly Glu Gly Thr Phe Thr Ser Asp Val Ser Ser Tyr Leu Glu Gly

1 5 10 15

Gln Ala Ala Lys Glu Phe Ile Ala

20

<210> 110

<211> 10

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 110

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10

<210> 111

<211> 15

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 111

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 112

<211> 20

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 112

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly

1 5 10 15

Gly Gly Gly Ser

20

<210> 113

<211> 466

<212> PROTEIN

<213> Homo sapiens

<400> 113

Met Thr Thr Ser Pro Ile Leu Gln Leu Leu Leu Gly Leu Ser Leu Cys

1 5 10 15

Gly Leu Leu Leu Gln Arg Ala Glu Thr Gly Ser Lys Gly Gln Thr Ala

20 25 30

Gly Glu Leu Tyr Gln Arg Trp Glu Arg Tyr Arg Arg Glu Cys Gln Glu

35 40 45

Thr Leu Ala Ala Ala Glu Pro Ser Gly Leu Ala Cys Asn Gly Ser

50 55 60

Phe Asp Met Tyr Val Cys Trp Asp Tyr Ala Ala Pro Asn Ala Thr Ala

65 70 75 80

Arg Ala Ser Cys Pro Trp Tyr Leu Pro Trp His His His Val Ala Ala

85 90 95

Gly Phe Val Leu Arg Gln Cys Arg Ser Asp Gly Gln Trp Gly Leu Trp

100 105 110

Arg Asp His Thr Gln Cys Glu Asn Pro Glu Lys Asn Glu Ala Phe Leu

115 120 125

Asp Gln Arg Leu Ile Leu Glu Arg Leu Gln Val Met Tyr Thr Val Gly

130 135 140

Tyr Ser Leu Ser Leu Ala Thr Leu Leu Leu Ala Leu Leu Ile Leu Ser

145 150 155 160

Leu Phe Arg Arg Leu His Cys Thr Arg Asn Tyr Ile His Ile Asn Leu

165 170 175

Phe Thr Ser Phe Met Leu Arg Ala Ala Ala Ile Leu Ser Arg Asp Arg

180 185 190

Leu Leu Pro Arg Pro Gly Pro Tyr Leu Gly Asp Gln Ala Leu Ala Leu

195 200 205

Trp Asn Gln Ala Leu Ala Ala Cys Arg Thr Ala Gln Ile Val Thr Gln

210 215 220

Tyr Cys Val Gly Ala Asn Tyr Thr Trp Leu Leu Val Glu Gly Val Tyr

225 230 235 240

Leu His Ser Leu Leu Val Leu Val Gly Gly Ser Glu Glu Gly His Phe

245 250 255

Arg Tyr Tyr Leu Leu Leu Gly Trp Gly Ala Pro Ala Leu Phe Val Ile

260 265 270

Pro Trp Val Ile Val Arg Tyr Leu Tyr Glu Asn Thr Gln Cys Trp Glu

275 280 285

Arg Asn Glu Val Lys Ala Ile Trp Trp Ile Ile Arg Thr Pro Ile Leu

290 295 300

Met Thr Ile Leu Ile Asn Phe Leu Ile Phe Ile Arg Ile Leu Gly Ile

305 310 315 320

Leu Leu Ser Lys Leu Arg Thr Arg Gln Met Arg Cys Arg Asp Tyr Arg

325 330 335

Val Arg Leu Ala Arg Ser Thr Leu Thr Leu Val Pro Leu Leu Gly Val

340 345 350

His Glu Val Val Phe Ala Pro Val Thr Glu Glu Gln Ala Arg Gly Ala

355 360 365

Leu Arg Phe Ala Lys Leu Gly Phe Glu Ile Phe Leu Ser Ser Phe Gln

370 375 380

Gly Phe Leu Val Ser Val Leu Tyr Cys Phe Ile Asn Lys Glu Val Gln

385 390 395 400

Ser Glu Ile Arg Arg Gly Trp His His Cys Arg Leu Arg Arg Ser Leu

405 410 415

Gly Glu Glu Gln Arg Gln Leu Pro Glu Arg Ala Phe Arg Ala Leu Pro

420 425 430

Ser Gly Ser Gly Pro Gly Glu Val Pro Thr Ser Arg Gly Leu Ser Ser

435 440 445

Gly Thr Leu Pro Gly Pro Gly Asn Glu Ala Ser Arg Glu Leu Glu Ser

450 455 460

Tyr Cys

465

<210> 114

<211> 1401

<212> DNA

<213> Homo sapiens

<400> 114

atgactacct ctccgatcct gcagctgctg ctcgggctct cactgtgcgg gctgctgctc 60

cagagggcgg agacaggctc taaggggcag actgcgggggg agctgtacca gcgctgggaa 120

cggtaccgca gggagtgcca ggagaccttg gcagccgcgg aaccgccttc aggcctcgcc 180

tgtaacgggt ccttcgatat gtacgtctgc tgggactatg ctgcacccaa tgccactgcc 240

cgtgcgtcct gcccctggta cctgccctgg caccaccatg tggctgcagg tttcgtcctc 300

cgccagtgtc ggagtgatgg ccaatgggga ctttggagag accatacaca atgtgagaac 360

ccagagaaga atgaggcctt tctggaccaa aggctcatct tggagcggtt gcaggtcatg 420

tacactgtcg gctactccct gtctctcgcc acactgctgc tagccctgct catcttgagt 480

ttgttcaggc ggctacattg cactagaaac tatatccaca tcaacctgtt cacgtctttc 540

atgctgcgag ctgcggccat tctcagccga gaccgtctgc tacctcgacc tggcccctac 600

cttggggacc aggcccttgc gctgtggaac caggccctcg ctgcctgccg cacggcccag 660

atcgtgaccc agtactgcgt gggtgccaac tacacgtggc tgctggtgga gggcgtctac 720

ctgcacagtc tcctggtgct cgtgggaggc tccgaggagg gccacttccg ctactacctg 780

ctcctcggct ggggggcccc cgcgcttttc gtcattccct gggtgatcgt caggtacctg 840

tacgagaaca cgcagtgctg ggagcgcaac gaagtcaagg ccatttggtg gattatacgg 900

acccccatcc tcatgaccat cttgattaat ttcctcattt ttatccgcat tcttggcatt 960

ctcctgtcca agctgaggac acggcaaatg cgctgccggg attaccgcgt gaggctggct 1020

1080

acagaggaac aggcccgggg cgccctgcgt ttcgccaagc tcggctttga gatcttcctc 1140

agctccttcc agggcttcct ggtcagcgtc ctctactgct tcatcaacaa ggaggtgcag 1200

tcggagatcc gccgtggctg gcaccactgc cgcctgcgcc gcagcctggg cgaggagcaa 1260

cgccagctcc cggagcgcgc cttccgggcc ctgccctccg gctccggccc gggcgaggtc 1320

cccaccagcc gcggcttgtc ctcggggacc ctcccagggc ctgggaatga ggccagccgg 1380

gagttggaaa gttactgcta g 1401

<210> 115

<211> 466

<212> PROTEIN

<213> Macaca mulatta

<400> 115

Met Thr Thr Ser Pro Ile Leu Gln Leu Leu Leu Arg Leu Ser Leu Trp

1 5 10 15

Gly Leu Leu Leu Arg Arg Ala Glu Thr Gly Ser Glu Gly Gln Thr Ala

20 25 30

Gly Glu Leu Tyr Gln Arg Trp Glu Arg Tyr Arg Arg Glu Cys Gln Glu

35 40 45

Thr Leu Ala Thr Ala Glu Pro Ser Gly Leu Ala Cys Asn Gly Ser

50 55 60

Phe Asp Met Tyr Val Cys Trp Asn Tyr Ala Ala Pro Asn Ala Thr Ala

65 70 75 80

Arg Ala Ser Cys Pro Trp Tyr Leu Pro Trp His His His Val Ala Ala

85 90 95

Gly Phe Val Leu Arg Gln Cys Gly Ser Asp Gly Gln Trp Gly Leu Trp

100 105 110

Arg Asp His Thr Gln Cys Glu Asn Pro Glu Lys Asn Glu Ala Phe Leu

115 120 125

Asp Gln Arg Leu Ile Leu Glu Arg Leu Gln Val Met Tyr Thr Val Gly

130 135 140

Tyr Ser Leu Ser Leu Ala Thr Leu Leu Leu Ala Leu Leu Ile Leu Ser

145 150 155 160

Leu Phe Arg Arg Leu His Cys Thr Arg Asn Tyr Ile His Ile Asn Leu

165 170 175

Phe Thr Ser Phe Thr Leu Arg Ala Ala Ala Ile Leu Ser Arg Asp Arg

180 185 190

Leu Leu Pro Arg Pro Gly Pro Tyr Leu Gly Asp Gln Ala Leu Val Leu

195 200 205

Trp Asn Gln Ala Leu Ala Ala Cys Arg Thr Ala Gln Ile Val Thr Gln

210 215 220

Tyr Cys Val Gly Ala Asn Tyr Thr Trp Leu Leu Val Glu Gly Val Tyr

225 230 235 240

Leu His Ser Leu Leu Val Ile Val Gly Gly Ser Glu Glu Gly His Phe

245 250 255

Arg Tyr Tyr Leu Leu Leu Gly Trp Gly Ala Pro Ala Leu Phe Val Ile

260 265 270

Pro Trp Val Ile Val Arg Tyr Leu Tyr Glu Asn Thr Gln Cys Trp Glu

275 280 285

Arg Asn Glu Val Lys Ala Ile Trp Trp Ile Ile Arg Thr Pro Ile Leu

290 295 300

Met Thr Ile Leu Ile Asn Phe Leu Ile Phe Ile Arg Ile Leu Gly Ile

305 310 315 320

Leu Leu Ser Lys Leu Arg Thr Arg Gln Met Arg Cys Arg Asp Tyr Arg

325 330 335

Leu Arg Leu Ala Arg Ser Thr Leu Thr Leu Val Pro Leu Leu Gly Val

340 345 350

His Glu Val Val Phe Ala Pro Val Thr Glu Glu Gln Ala Arg Gly Ala

355 360 365

Leu Arg Phe Ala Lys Leu Gly Phe Glu Ile Phe Leu Ser Ser Phe Gln

370 375 380

Gly Leu Leu Val Ser Val Leu Tyr Cys Phe Ile Asn Lys Glu Val Gln

385 390 395 400

Ser Glu Ile Arg Arg Gly Trp His His Cys Arg Leu Arg Arg Ser Leu

405 410 415

Gly Glu Glu Gln Arg Gln Leu Pro Glu Arg Ala Phe Arg Ala Leu Pro

420 425 430

Ser Gly Ser Gly Pro Gly Glu Val Pro Thr Gly Arg Gly Leu Ser Ser

435 440 445

Gly Thr Leu Pro Gly Pro Gly Asn Glu Ala Arg Arg Val Leu Glu Ser

450 455 460

Tyr Cys

465

<210> 116

<211> 1398

<212> DNA

<213> Macaca mulatta

<400> 116

atgactacct ctccgatcct gcagttgctg ttgcggctct cactgtgggg gctgctgctc 60

cggagggcgg agacaggctc tgaggggcag acggcggggg agctgtacca gcgctgggaa 120

cggtaccgca gggagtgcca ggagaccttg gcaaccgcgg aaccaccttc aggcctcgcc 180

tgtaacgggt ccttcgatat gtacgtctgc tggaactatg ctgcacccaa cgccactgcc 240

cgtgcctcct gcccctggta cctgccctgg caccaccacg tggctgcagg tttcgtcctc 300

cgccagtgtg gcagtgatgg ccagtgggga ctttggagag accacacaca atgtgagaac 360

ccagagaaga atgaggcctt tctggaccaa aggctcatct tggagcggct gcaggtcatg 420

tacaccgtcg gctactccct gtctctcgcc acactgctgc tagccctgct catcttgagc 480

ttgttcaggc gactacattg cactagaaac tatatccaca tcaacctgtt cacgtctttc 540

acactgcgag cggcggcgat tctcagccgg gaccgtctac tgcctcgacc tggcccctac 600

cttggggacc aggcccttgt gctgtggaac caggccctcg ctgcctgccg cacggcccag 660

atcgtgaccc agtactgcgt gggtgccaac tacacgtggc tgctggtgga gggcgtctac 720

ttgcacagtc tcctggtgat cgtgggaggc tccgaggagg gtcacttccg ctactacctg 780

ctcctcggct ggggggcccc cgcgcttttc gtcattccct gggtgatcgt caggtacctg 840

tacgagaaca cgcagtgctg ggagcgcaac gaagtcaagg ccatttggtg gattatacgg 900

acccccatcc tcatgaccat cttgattaat ttcctcattt ttatccgcat tcttggcatt 960

ctcctgtcca agctgaggac acggcaaatg cgctgccggg attaccggct gaggctggct 1020

1080

accgaggaac aggcccgggg cgccctgcgc ttcgccaagc tcggctttga gatcttcctc 1140

agctctttcc agggcttgct ggtcagcgtc ctctactgct tcatcaacaa ggaggtgcag 1200

tcggagatcc gccgtggctg gcaccactgc cgcctgcgcc gcagcctggg cgaggagcag 1260

cggcagctcc cggagcgcgc cttccgggcc ctgccctccg gctccggccc cggcgaggtc 1320

cccaccggcc gcggcttgtc ttcggggacc ctcccagggc ctgggaatga ggccagacgg 1380

gtgttggaaa gttactgc 1398

<210> 117

<211> 460

<212> PROTEIN

<213> Mus musculus

<400> 117

Met Pro Leu Arg Leu Leu Leu Leu Leu Leu Trp Leu Trp Gly Leu Gln

1 5 10 15

Trp Ala Glu Thr Asp Ser Glu Gly Gln Thr Thr Thr Gly Glu Leu Tyr

20 25 30

Gln Arg Trp Glu His Tyr Gly Gln Glu Cys Gln Lys Met Leu Glu Thr

35 40 45

Thr Glu Pro Pro Ser Gly Leu Ala Cys Asn Gly Ser Phe Asp Met Tyr

50 55 60

Ala Cys Trp Asn Tyr Thr Ala Ala Asn Thr Thr Ala Arg Val Ser Cys

65 70 75 80

Pro Trp Tyr Leu Pro Trp Phe Arg Gln Val Ser Ala Gly Phe Val Phe

85 90 95

Arg Gln Cys Gly Ser Asp Gly Gln Trp Gly Ser Trp Arg Asp His Thr

100 105 110

Gln Cys Glu Asn Pro Glu Lys Asn Gly Ala Phe Gln Asp Gln Thr Leu

115 120 125

Ile Leu Glu Arg Leu Gln Ile Met Tyr Thr Val Gly Tyr Ser Leu Ser

130 135 140

Leu Thr Thr Leu Leu Leu Ala Leu Leu Ile Leu Ser Leu Phe Arg Arg

145 150 155 160

Leu His Cys Thr Arg Asn Tyr Ile His Met Asn Leu Phe Thr Ser Phe

165 170 175

Met Leu Arg Ala Ala Ala Ile Leu Thr Arg Asp Gln Leu Leu Pro Pro

180 185 190

Leu Gly Pro Tyr Thr Gly Asp Gln Ala Pro Thr Pro Trp Asn Gln Ala

195 200 205

Leu Ala Ala Cys Arg Thr Ala Gln Ile Met Thr Gln Tyr Cys Val Gly

210 215 220

Ala Asn Tyr Thr Trp Leu Leu Val Glu Gly Val Tyr Leu His His Leu

225 230 235 240

Leu Val Ile Val Gly Arg Ser Glu Lys Gly His Phe Arg Cys Tyr Leu

245 250 255

Leu Leu Gly Trp Gly Ala Pro Ala Leu Phe Val Ile Pro Trp Val Ile

260 265 270

Val Arg Tyr Leu Arg Glu Asn Thr Gln Cys Trp Glu Arg Asn Glu Val

275 280 285

Lys Ala Ile Trp Trp Ile Ile Arg Thr Pro Ile Leu Ile Thr Ile Leu

290 295 300

Ile Asn Phe Leu Ile Phe Ile Arg Ile Leu Gly Ile Leu Val Ser Lys

305 310 315 320

Leu Arg Thr Arg Gln Met Arg Cys Pro Asp Tyr Arg Leu Arg Leu Ala

325 330 335

Arg Ser Thr Leu Thr Leu Val Pro Leu Leu Gly Val His Glu Val Val

340 345 350

Phe Ala Pro Val Thr Glu Glu Gln Val Glu Gly Ser Leu Arg Phe Ala

355 360 365

Lys Leu Ala Phe Glu Ile Phe Leu Ser Ser Phe Gln Gly Phe Leu Val

370 375 380

Ser Val Leu Tyr Cys Phe Ile Asn Lys Glu Val Gln Ser Glu Ile Arg

385 390 395 400

Gln Gly Trp Arg His Arg Arg Leu Arg Leu Ser Leu Gln Glu Gln Arg

405 410 415

Pro Arg Pro His Gln Glu Leu Ala Pro Arg Ala Val Pro Leu Ser Ser

420 425 430

Ala Cys Arg Glu Ala Ala Val Gly Asn Ala Leu Pro Ser Gly Met Leu

435 440 445

His Val Pro Gly Asp Glu Val Leu Glu Ser Tyr Cys

450 455 460

<210> 118

<211> 1380

<212> DNA

<213> Mus musculus

<400> 118

atgcccctgc ggttgctgct tctgctgctg tggttgtggg gactccagtg ggcggagaca 60

gactctgagg ggcagaccac cacgggggag ctgtaccagc gctgggagca ctacggccag 120

gagtgccaaa agatgttgga gaccacagaa cctccctcag gcctggcctg taacggttcc 180

ttcgatatgt atgcctgctg gaactacacg gccgccaaca ccactgctcg ggtgtcttgc 240

ccctggtatc tgccctggtt ccgtcaggtg tctgcaggct ttgtcttccg ccagtgtggc 300

agtgatggcc agtggggatc ttggagagac cacactcagt gtgagaatcc agagaagaat 360

ggggcttttc aggaccagac gctgatcctg gagcgcctgc agatcatgta taccgtggggc 420

tactccctgt ccctgacgac tctgctgcta gccctactca tcttaagttt gttcaggcgg 480

ctgcactgca ctcgtaatta cattcacatg aacctgttca cgtctttcat gctgcgggca 540

gcagccatcc tcacccgaga tcagctgctg cctccactgg gtccctacac tggagaccag 600

gcccctaccc cgtggaacca ggccctagct gcctgccgca cggccgat catgacccaa 660

tattgtgtgg gagccaatta cacctggcta ctggtggagg gtgtttatct gcaccatctg 720

ctggtgatcg tgggacgctc agaaaagggc cacttccgct gctacctgct tcttggctgg 780

ggggcccccg cgcttttcgt cattccctgg gtgatcgtca ggtacctgcg cgagaacaca 840

cagtgctggg agcgcaacga agtcaaagcc atttggtgga tcattcgcac tcccatccta 900

ataaccatct tgatcaattt cctcatcttc atccgcatcc ttggcatcct tgtttcaaag 960

ctgaggacac ggcagatgcg ctgccccgac taccgactaa ggctggctcg ctccacgctg 1020

1080

gttgaaggct ccctgcgctt cgccaaactg gcctttgaaa tcttcctaag ttccttccag 1140

ggtttcctgg tgagcgtgct ctactgcttc atcaacaaag aggtgcagtc ggagatccgc 1200

caggttggc gccaccgccg cctgcgtctc agtcttcaag agcagcgtcc acgtccgcac 1260

caggaactcg ccccccgggc tgtgcctttg agctctgcgt gccgagaagc tgccgttggc 1320

aacgccttgc cctctgggat gctgcatgtg cctggggatg aggtcttgga aagttactgc 1380

<210> 119

<211> 29

<212> PROTEIN

<213> Homo sapiens

<400> 119

Gly Lys Val Leu Trp Ala Ile Phe Glu Lys Ala Ala Gln Gly Glu Leu

1 5 10 15

Tyr Ser Ser Val Asp Ser Thr Phe Thr Gly Glu Ala His

20 25

<210> 120

<211> 29

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 120

Gly Lys Val Leu Trp Ala Ile Phe Glu Lys Ala Ala Gln Gly Glu Leu

1 5 10 15

Tyr Ser Ser Val Asp Ser Thr Phe Thr Gly Glu Gly His

20 25

<210> 121

<211> 22

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 121

Phe Glu Lys Ala Ala Gln Gly Glu Leu Tyr Ser Ser Val Asp Ser Thr

1 5 10 15

Phe Thr Gly Glu Gly His

20

<210> 122

<211> 23

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 122

Ile Phe Glu Lys Ala Ala Gln Gly Glu Leu Tyr Ser Ser Val Asp Ser

1 5 10 15

Thr Phe Thr Gly Glu Gly His

20

<210> 123

<211> 24

<212> PROTEIN

<213> Artificial sequence

<220>

<223> Synthetic construction

<400> 123

Ala Ile Phe Glu Lys Ala Ala Gln Gly Glu Leu Tyr Ser Ser Val Asp

1 5 10 15

Ser Thr Phe Thr Gly Glu Gly His

20

<210> 124

<211> 326

<212> PROTEIN

<213> Homo sapiens

<220>

<221> OTHER SIGN

<222> (132)..(132)

<223> Xaa at position 132 is Met or Tyr

<220>

<221> OTHER SIGN

<222> (134)..(134)

<223> Xaa at position 134 is Ser or Thr

<220>

<221> OTHER SIGN

<222> (136)..(136)

<223> Xaa at position 136 is Thr or Glu

<220>

<221> OTHER SIGN

<222> (308)..(308)

<223> Xaa at position 308 is Met or Leu

<220>

<221> OTHER SIGN

<222> (314)..(314)

<223> Xaa at position 314 is Asn or Ser

<220>

<221> OTHER SIGN

<222> (327)..(327)

<223> Xaa at position 327 is Lys or absent

<400> 124

Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg

1 5 10 15

Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr

20 25 30

Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser

35 40 45

Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser

50 55 60

Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr

65 70 75 80

Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys

85 90 95

Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro

100 105 110

Glu Ala Ala Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys

115 120 125

Asp Thr Leu Xaa Ile Xaa Arg Xaa Pro Glu Val Thr Cys Val Val Val

130 135 140

Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp

145 150 155 160

Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe

165 170 175

Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp

180 185 190

Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu

195 200 205

Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg

210 215 220

Glu Pro Gln Val Tyr Thr Leu Pro Ser Gln Glu Glu Met Thr Lys

225 230 235 240

Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp

245 250 255

Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys

260 265 270

Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser

275 280 285

Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser

290 295 300

Cys Ser Val Xaa His Glu Ala Leu His Xaa His Tyr Thr Gln Lys Ser

305 310 315 320

Leu Ser Leu Ser Leu Gly Xaa

325

<---

Claims (45)

1. An antibody or antigen-binding fragment thereof that specifically binds to the human gastric inhibitory polypeptide receptor (GIPR), wherein the antibody contains: a) light chain CDR1 with the amino acid sequence of SEQ ID NO: 13; b) a light chain CDR2 with the amino acid sequence of SEQ ID NO: 11; c) light chain CDR3 with the amino acid sequence of SEQ ID NO: 14; d) heavy chain CDR1 with the amino acid sequence of SEQ ID NO: 26; e) heavy chain CDR2 with the amino acid sequence of SEQ ID NO: 27; And f) Heavy chain CDR3 with the amino acid sequence of SEQ ID NO: 28. 2. An antibody according to claim 1, wherein the antibody comprises a light chain variable domain of SEQ ID NO: 67 and a heavy chain variable domain of SEQ ID NO: 77. 3. An antibody according to claim 1 or 2, wherein said antibody contains an amino acid sequence independently selected from the amino acid sequences listed below: a) light chain constant amino acid sequences: SEQ ID NO: 101 and SEQ ID NO: 102; And b) heavy chain constant amino acid sequences: SEQ ID NO: 103, SEQ ID NO: 104 and SEQ ID NO: 124. 4. An antibody according to any one of paragraphs. 1-3, wherein the antibody is a mouse anti-GIPR antibody or a humanized anti-GIPR antibody. 5. An antibody according to any one of paragraphs. 1-4, wherein the antibody is a GIPR monoclonal antibody. 6. An antibody according to any one of paragraphs. 1-5, wherein the antibody is selected from mouse antibodies, human antibodies, humanized antibodies, chimeric antibodies, monoclonal antibodies, polyclonal antibodies, recombinant antibodies, single chain antibodies, double chain antibodies, three chain antibodies, four chain antibodies, domain antibodies, IgD antibodies, IgE antibodies, IgM antibodies, IgG1 antibodies, IgG2 antibodies, IgG3 antibodies l or IgG4 antibodies, and the antigen-binding fragment is selected from Fab fragments, F(ab') _x fragments. 7. An antibody according to any one of paragraphs. 1-6, wherein the antibody has an IC50 of about 1 nM to 200 nM, or 1 nM to 100 nM with reduced human GIP signaling. 8. Glucagon-like peptide-1 (GLP-1) fusion protein that specifically binds to human GIPR, where the fusion protein contains a GIPR antibody according to any one of paragraphs. 1-7 and one, two, three, four, five, six, seven or eight GLP-1 fragments or reverse GLP-1 fragments; where the fusion protein connects the carboxy-terminus of the GLP-1 fragment to the amino-terminus of the light chain or heavy chain of the GIPR antibody via a peptide linker or connects the amino-terminus of the reverse GLP-1 fragment to the carboxy-terminus of the light chain or heavy chain of the GIPR antibody via a peptide linker. 9. The fusion protein according to claim 8, where the fusion protein contains a GIPR antibody and two GLP-1 fragments; the fusion protein connects the carboxy terminus of the GLP-1 fragment to the amino terminus of the light chain or heavy chain of the GIPR antibody via a peptide linker. 10. The fusion protein according to claim 8, where the fusion protein contains a GIPR antibody and two reverse fragments of GLP-1; the fusion protein connects the amino terminus of the GLP-1 reverse fragment to the carboxy terminus of the light chain or heavy chain of the GIPR antibody via a peptide linker. 11. The fusion protein of claim 8, wherein the GIPR antibody, GLP-1 fragment, and peptide linker are fused to form a fusion protein in one of the following ways: through a peptide linker, the carboxy-terminus of the GLP-1 fragment is fused to the amino-terminus of the light chain of the GIPR antibody: N'-GLP-1-linkre-R-C'; through a peptide linker, the carboxy-terminus of the GLP-1 fragment is fused to the amino-terminus of the heavy chain of the GIPR antibody: N'-GLP-1-linker-R-C'; Where: N' is the amino terminus of the polypeptide chain of the fusion protein, C' is the carboxy-terminus of the polypeptide chain of the fusion protein, GLP-1 is a fragment of GLP-1 and R is the amino acid sequence of the light or heavy chain of a GIPR antibody according to any one of paragraphs. 1-7, and the linker is a polypeptide linker. 12. GLP-1 fusion protein according to any one of paragraphs. 8-11, wherein the peptide linker contains a full, partial, or repetitive amino acid sequence independently selected from SEQ ID NO: 110, SEQ ID NO: 111, and SEQ ID NO: 112. 13. GLP-1 fusion protein according to any one of paragraphs. 8-12, where the GLP-1 fragment contains an amino acid sequence independently selected from SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, and SEQ ID NO: 109; or where the GLP-1 reverse fragment contains an amino acid sequence independently selected from SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, and SEQ ID NO: 123. 14. A polynucleotide encoding a GIPR antibody according to any one of paragraphs. 1-7. 15. A polynucleotide encoding a GLP-1 fusion protein according to any one of paragraphs. 8-13. 16. An expression vector containing a polynucleotide according to claim 14 or 15. 17. A host cell for producing a GIPR antibody according to any one of paragraphs. 1-7, containing the vector according to item 16. 18. The host cell to obtain a fused protein according to any one of paragraphs. 8-13 containing the vector of claim 16. 19. Pharmaceutical composition for the prevention or treatment of non-alcoholic fatty liver, containing a therapeutically effective amount of a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 in admixture with a pharmaceutically acceptable carrier. 20. Pharmaceutical composition for the prevention or treatment of type 2 diabetes mellitus, containing a therapeutically effective amount of a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 in admixture with a pharmaceutically acceptable carrier. 21. Pharmaceutical composition for the prevention or treatment of obesity, containing a therapeutically effective amount of a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 in admixture with a pharmaceutically acceptable carrier. 22. Pharmaceutical composition for the prevention or treatment of two or more diseases simultaneously: non-alcoholic fatty liver, obesity or type 2 diabetes, containing a therapeutically effective amount of a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 in admixture with a pharmaceutically acceptable carrier. 23. The use of a pharmaceutical composition containing a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 for the preparation of a medicament for the prevention or treatment of non-alcoholic fatty liver disease. 24. The use of a pharmaceutical composition containing a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 for the preparation of a medicament for the prevention or treatment of type 2 diabetes. 25. The use of a pharmaceutical composition containing a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 to obtain a medicament for the prevention or treatment of obesity. 26. The use of a pharmaceutical composition containing a GIPR antibody according to any one of paragraphs. 1-7 or a GLP-1 fusion protein according to any one of paragraphs. 8-13 to obtain a drug for the prevention or treatment of two or more diseases simultaneously: non-alcoholic fatty liver, obesity or type 2 diabetes. 27. The use of a pharmaceutical composition according to any one of paragraphs. 23-26 wherein the pharmaceutical composition is administered intravenously or subcutaneously.

Images