EP1941056A2

EP1941056A2 - Method for controlling, section by section, enzymatic nucleic acid duplication by means of incomplete complementary strands

Info

Publication number: EP1941056A2
Application number: EP06805397A
Authority: EP
Inventors: Peter Bendzko; Stephen Heymann; Hans Joos; Beate Kraffert; Ralf Bergmann; Matthias Leiser
Original assignee: Invitek Gesellschaft fuer Biotechnik und Biodesign mbH
Current assignee: Invitek Gesellschaft fuer Biotechnik und Biodesign mbH
Priority date: 2005-10-07
Filing date: 2006-10-09
Publication date: 2008-07-09
Also published as: WO2007042003A3; WO2007042003A2; DE102005048503B4; US20070082343A1; DE102005048503A1

Abstract

The invention relates to a method for enzymatic nucleic acid duplication wherein synthetic oligonucleotides, which contain one or several structural units having a unnatural chemical structure, are used. The use of said structural units prevents enzymatic synthesis of the nucleic acid strands which are complementary to the sections which contian said structural units. The inventive methods also enables alternative split forms of genes to be detected, nucleic acid variants to be detected, marked nucleic acid molecules to be produced, and nucleic acid double strands products having single-stranded overhangs to be immediately produced for subsequent ligation reactions. Fields of application of the invention are various areas of research, the biomedical practice, nucleic-acid based analysis, in particular biotechnological, agrarian and food products, in additon to criminology.

Description

Method for controlling the sectional enzymatic nucleic acid amplification via incomplete complementary strands

The invention relates to a novel method for controlling the segmental enzymatic nucleic acid amplification via incomplete

Complementary strands. Fields of application of the invention are research, medical practice, gene-based analysis of biotechnology, agricultural and food products, as well as criminalistics.

State of the art

DNA analytics has become increasingly important for research and medical practice over the last decade and is increasingly pervading other areas of human activity. Representative of the need and the growing repertoire of DNA analysis techniques are figures from human genetics: In 2002, tests were offered worldwide for approximately 750 polymorphic loci in the human genome (EPF 2002) ¹ , so there are currently about 1870 such service Offers or proof kits available (OMIM) ¹ . Due to the unambiguousness of the causal relationship and thus the informative value, allele diagnostics are the largest and most profitable group for monogenic hereditary diseases. In contrast, the determination of combinations of hereditary predispositions and somatic mutations in the case of complex pathologies or susceptibility to such naturally far more difficult: There is no superset of correlated DNA variants to date, which taken together, the vast number of corresponding cases completely covered and Moreover, they enabled satisfactory treatment recommendations. Essentially, the diagnostic requirements of the future differ from the current state of the art in terms of complexity (number and type of aberrations to be detected simultaneously), sensitivity (extremely small mutant wild-type ratio) and robustness. This situation also applies analogously to the method and process-oriented areas of recombinant DNA technology, as well as to the biotechnology and fine chemicals industry: cost-saving and cost-saving innovations are fueling global competition. Innovations in this regard make it possible, for example, to handle gene cloning tasks in a high-throughput process.

The new and further development of universal methods of gene, genome and gene expression research covers equally the complex of RNA analysis, including the splicing and maturation processes of mRNA, RNA-based enzymes and bioactive tools of expression regulation up to the first therapeutics.

To adequately explain the diversity of the current state of the art requires the scope of several standard works of modern molecular biology, which can be unbrokenly described as a generator of method development. Please refer to the textbooks of Seyffert ² and Lewin ³ . The invention-relevant excerpt is set out below with reference to three representative base cases. To a certain extent, many established techniques go back to these basic cases:

Basic case 1

In the following, the detection of a disease-relevant somatic single nucleotide exchange will be discussed. He encounters us in a variety of monogener-specific diagnostic tasks, primarily in oncology, and returns to more complex questions:

Given is the isolated DNA of a biological source consisting of k haplogenome equivalents. The reference sequence of the chromosomal DNA section S in question is known. The sequence of S is sufficiently unique in the given isolate. We know position and type (eg A to C) of the exchanges in question in S. The mutated DNA section S 'may be strongly underrepresented, but need not be.

The common methods for distinguishing wild-type and mutant are essentially mismatch effects of synthetic primers, substrates, Signs and probes on enzyme and hybridization reactions and the selective cleavage of sequences with Restraktasen to advantage, which come in sequential assay steps to bear. Different nucleotide derivatives and biochemicals are used

Conversion possibilities in numerous varieties, which were developed as a rule for the production of freedom from defects. They can be classified as follows:

1. Increase of copy number by amplification of S and S 'by means of polymerases (PCR) ⁴ and ligases (LCR) ⁵ ,

2. position-specific incorporation of labeled and / or terminating substrate analogues (sequencing technique according to Sanger ⁶ , Pyrosequencing ⁷ ),

3. template-dependent ligation of flush half probes (OLA) or circularization (isothermal RCA or reverse padlocking) ⁸ ,

4. Beacon and Scorpion-based techniques ⁹ ,

5. Primary (capture) or secondary (reaction product) immobilization on solid phases (chip technologies) ¹⁰ ,

6. Single Strand Refolding (SSCP) ¹¹ .

7. Utilization of the different melting point of double helix and heteroduplexes of the same sequence (DNA / RNA, DNA / DNA * with * = structurally stiffened sugar [locked DNA] or substituted sugar phosphate framework [PNA]) ¹²

The nucleotide derivatives fulfill the function of substrates of the polymerases or ligases, of primers of the polymerase chain reaction and of probes in the assay systems. In detail, the rough assignment gives the following picture:

1. Several triphosphate analogs are accepted and incorporated by the polymerase as a substrate. In this way, labels (fluorescent, terminating, affine, (bio) chemically convertible or inert groups) and bonds (hydrolyzable or hydrolysis-resistant, B-form disorders) are introduced by enzymatic condensation either into the copies of S or S ', whereby they can be discriminated.

2. Terminal and internal modifications in primers influence the selectability of S vs. S. S 'due

• imprint / inactivation of restriction sites;

• alteration of the annealing temperature (mismatches);

• Preparation of the ligation ability (5'-p);

Cyclability,

• Enabling / excluding nucleolytic cleavage (proofreading, displacement, chimera cleavage).

3. Terminal modifications in probes are for selective detection purposes based on

• Fluorescence quenchem / amplifier;

Affine groups for immobilization and detection (biotin, FITC).

Increasingly, several of the aforementioned properties and purposes are used in combination. For example, Scorpions (Sigma-Aldrich) combine primer and probe function. In chip-based detection systems (Asper), substrate analogue incorporation resulting in fragmentation, primer extension with synthesis stop, and fluorescence label insertion are combined into one technological process. In the special case of detecting mutated, cancer-relevant k-ras minor components, either wild-type cleavage and differential probe thermostability for sensitive mutant detection via DNA Elisa (Invitek GmbH) or PCR plus SSCP (Nordiag SA) are carried out in succession.

From a systematic point of view, it is noticeable that among all established combinations there has hitherto been no reference to the use of nucleotide modifications for controlling polymerase activity via the template. It is only known that thymidine dimers (under the influence of UV radiation by Zykloaddition adjacent deoxythymidine-derived structural distortions) allow only the incorporation of a dAs, with subsequent termination of the synthesis. The question arises as to whether a primer that is 100% passable to an SNP site can at the same time serve the purpose of effectively inhibiting counterstrand synthesis in a PCR approach, so that it only leads to a slowed or no exponential amplification comes.

Base case 2

Direct cloning methods for PCR products

Common cloning methods for amplified dsDNA fragments are either based

1. Conventional on the use of auxiliary cloning sites that are attached as oligonucleotide extensions from the outset in primer design, subsequent restriction cleavage of the PCR product and insertion into a suitably prepared vector ¹³ or

2. on the T / A complementarity of overhanging 3 'ends of insert or vector or ^u

3. on the ligase activity of topoisomerase I, which inserts a smooth or 3'-dA-tailed PCR product extremely rapidly into a specially prepared commercial cloning vector ¹⁵ . ¹⁶ - ¹⁷ - ¹⁸ - ¹⁹ . ²⁰ . ²¹

The basic idea is to produce a PCR product fraction which receives the vector-complementary overhangs as it forms.

The split vector has two fours indentations. Accordingly, the amplification primers are 5'-sided equipped with the four complementary bases, z. B. the Hinprimer with the inner four bases AATT of EcoR I

Recognition sequence, the reverse primer with the internal four bases TCGA

Hind III recognition sequence.

The modification will be inserted only at a fraction (about 1/10 to 1/100) of the primer thereby on the one hand normal exponential amplification of the

Fragments take place between the primers. The 'normal' amplicons evade cloning by end-to-end mismatching Vector. The amplicon derivatives produced by occasional incorporation of stop variants of the primers have the desired cohesive ends.

Basic case 3

Numerous genes provide more than one mature mRNA and the associated amino acid sequence by alternative splicing. The accumulated distribution statistics of the number of transcripts and exons per gene as a function of gene length determined experimentally and bioinformatic (by EST alignment) are constantly updated for human genes (Ensembl V.32 ff) ²² .

In practice, it has been repeatedly shown that many mRNAs are mistaken for the canonical transcript of the gene in question. In fact, they are a tumor-associated special splice form of this gene (Xu and Lee 2003) ²³ . The reason is that prior to chromosome-wide DNA sequencing in the human genome project, cDNA cloning and sequencing was the tool of choice for studying gene expression from human tissue, and very often, surgically removed tumor material was used.

In the alternative splicing event, the following stereotypes are recurrent: exon skipping, multiple exon skipping, skipping of mutually exclusive exons, cryptic exons, facultative promoters, splice signal data, introns, cascade splicing, and combinations of these types.

In a large-scale, experimental study (Hiller et al., 2004) ^{24 it} has been shown that a much larger number of putative splice forms can be functionally important for many genes. The molecular 'fine tuning' of the splicing event is known to be tissue-dependent, mutational, state and context sensitive. The splice shape simulation in the computer abstracts from these many degrees of freedom and thus opened a way to collect biological arguments for the existence of further splice forms, which can then be specifically targeted, even if they are extreme minor components, which are in cDNA and EST Libraries are underrepresented by chance and therefore even rarer be found, as they are already represented in the mRNA pool of a biological source. So this analysis has predictive value.

The verification of the predicted alternative splice forms is usually carried out laboratory experimentally via Northern blots or bioinformatic, as long as the available sequence data find highly homologous sequences; Non-discovery of such homologues does not mean by any means certainty regarding the non-existence of a splice form. For that, the datiage is still too patchy. So there is a lot of room for improvement here.

It is an object of the present invention to develop a robust and rapid method for controlling the partial enzymatic nucleic acid amplification, which is used inter alia for the analysis of alternative splice forms, in the detection of nucleic acid sequence variants and gene cloning.

The invention is realized according to the main claim, the subclaims are preferred variants.

Explanation of the essence of the invention

(1) In routine molecular biological experiments of the inventors so-called chimeric oligonucleotides of the form 5 'N _k XN | come in a completely different than the context and purpose of the invention 3 'used. In 5 'N _k XNi 3', N is any of the natural deoxyribonucleotides dA, dC, dG, dT, X for any of the natural ribonucleotides A, C, G, T; k and I are the monomer numbers of the deoxyribonucleotide segments in the synthetic chimeric oligonucleotide. First, as a result of a failed experiment in which the 2'-protecting group of ribonucleotide moiety X was erroneously not removed, the surprising observation was that this peculiarity resulted in a drastic reduction in exponential DNA amplification when using this chimeric oligonucleotide with the 2'-protecting group on the X together with a second, non-protecting oligonucleotide as a primer pair in a standard PCR approach to amplify a 348 base pair section of human genomic DNA. This unexpected inhibition effect is shown in Fig. 1.

The 2'-stop function was used: c c

c ^c

The inhibition effect proved to be reproducible in repetitive experiments and finally led to the basic idea of the invention.

(2) It has been found that the inhibitory effect according to the invention tended to become stronger the more ribonucleotide building blocks with 2'-protective group are incorporated into chimeric oligonucleotides of the same length and sequence, eg 5 'NMX ₂ NI 3', 5 'N _k . ₂ X ₃ N | 3 ', 5' Nk _-3 X ₄ N, 3 ', etc. In the case of even-numbered ribonucleotide units with 2'-protective group, the inhibiting effect even proved to be quantitative (see Embodiment 1). This laid the foundation for the subtle control of the partial enzymatic nucleic acid amplification according to the invention. In fact, in the detailed analysis of the inventive control intervention in the process of selective amplification of proposed DNA segments, it could be shown that the first-strand synthesis on the DNA template, for which the chimeric oligonucleotide with protective ribonucleotide building blocks acts as a primer, is in no way impaired. The reason for the inhibitory effect was the termination of complementary strand synthesis in the subsequent cycle of the PCR reaction. Thus, this incomplete complacent strand precipitates as a template for the re-initiation of back and forth strand synthesis in all subsequent cycles, because the Nj portion of the chimeric oligonucleotide at given annealing temperature is too short for complementary binding to the incomplete synthesis products of previous cycles. The result is partial inhibition or even complete suppression of exponential DNA amplification. Both effects - partial and total inhibition - are for different applications of the invention to the basic cases 1 to 3 of crucial importance, which will be discussed separately below.

(3) In the further embodiment of the invention, other bulky appendages in the 2'-position of the ribonucleotide building blocks in the inventory chimeric oligonucleotides were also found to be suitable to bring about the control effect described under (2), for. 2'-O-triisopropylsilyl groups, 2'-O-alkyl groups and others.

(4) Nucleotide building blocks are known to have other reactive groups that can be altered in chemical and biochemical material transformation processes. The effects according to the invention described in (2) also occur in different intensities if a) the natural sugars ribose or deoxyribose are replaced by arabinose, b) the natural phosphodiester bonds are modified by modifications which render them stable to hydrolysis, c) the sugar Phosphate backbone of the synthetic oligonucleotides is replaced by intermediate base bridges of other chemical nature with a stopping effect on the complementary strand synthesis, d) on the nitrogen bases chemical changes are made, which do not affect the formation of the complementary base pairs AT and GC, but not as a template component of the polymerase be accepted / tolerated, e) between the building blocks of the synthetic oligonucleotide additional chemical bonds exist that cause structural distortions and f) in the synthetic oligonucleotide mixed changes of types (2), (3) and (4a-e) available.

(5) All embodiments of the present invention under (1) to (4) have in common that the essence of the inventive control of the partial enzymatic nucleic acid amplification incomplete complementary strands on the hitherto unknown or ignored stop effect of the synthetic oligonucleotides on the polymerase chain reaction is based neither on modified primer function, on substrate, probe or terminal effect, but solely on the dual role in the start of the forward reaction, by a synthetic Oligonucleotide of the type described above is part of the nucleic acid copies, and founding the termination of the subsequent synthesis of Komplentstränge. This is the most important delineation criterion of the invention and makes it clearly distinguishable from all common forms and special applications of the polymerase chain reaction for detection, cloning and discrimination purposes of nucleic acids.

(6) It is imperative from (1) to (5) that in the control of the partial enzymatic nucleic acid amplification by incomplete complementary strands, no complete DNA double helices are formed or complete double helices are formed in a mixture with defined incomplete ones. This delimits the invention from the usual methods for the enzymatic synthesis of nucleic acid copies with stochastic length distribution as a result of synthesis termination by means of dideoxyribonucleotide triphosphates (Sanger method). The synthesis termination in the process according to the invention takes place at a defined, predetermined position. This, in turn, makes it possible to generate cohesive-terminated nucleic acid copies without the usual expense of restriction cleavage of ancillary cloning sequences, which can then be ligated into appropriately prepared cloning vectors or recombinant constructs. This represents a significant advance over the repertoire of conventional cloning techniques (see basic case 2).

(7) The use of the oligonucleotides with stop function according to the invention makes it possible for the first time to selectively amplify alternative splice forms. This is best shown in Figure 2 below. The scheme exemplifies the approach exemplified by a three-electron gene, for the sake of clarity postulating that its long splice form (the so-called holoform, supra) is formed by including all three exons in the mature mRNA, while the short splice form is delineated by omission (Fig. Skipping ') of the middle exon in extreme stoichiometric deficit (Fig. 2). Selection and use of the primers are now as follows: The two splice forms are transcribed from the total RNA with the 3 'primer (P2) into cDNA and amplified with the primer pair P1 / P2. We expect only one band from the electrophoretic image for the long splice form; the short is by default a minor component and at best a shadow.

However, if we additionally add the exon-2-specific stop primer (P3) to the PCR approach, the exponential multiplication of the long splice form is switched off and the amplicon of the short splice form is formed after appropriate adjustment of the number of cycles (cf. 3).

Advantages:

With respect to base case 1

• Replacement of the previous multi-step process by a defect-free one-step method by omission

• the nested PCR steps;

• the restriction cleavage;

• the DNA Elisa with its own class of DNA-based detection kits less susceptible to error

• Saving of specific work and expensive accessories (enzymes, streptavidin plates, conjugate)

• Possibly. higher sensitivity (even earlier early detection)

• Backward compatibility (possibility to attach the existing Elisa or SSCP at any time)

• Applicability in terms of mass screening, possibly for preselection

• Automation

With respect to base case 2

• Elimination of the additional process step of the restriction cleavage of amplificates with attached auxiliary cloning sites

• Elimination of the risk of unwanted fragmentation in long amplicons of unknown sequence • Elimination of the reliance on commercial purchase of ready-made vectors

With regard to base case 3

• Process integration of bioinformatics prediction of alternative splice forms and targeted experimental verification of their existence in the examined tissue

• Prevention of harmful substances (formamide) by omission of conventional Northern Blot procedures

• Findability of minor component splice molds

Embodiment 1

Base case 1 is realized according to the invention by the following approach: In parallel PCR batches of 25 μl reaction volume, 50 ng of isolated genomic DNA from SW620 cells are subjected to amplification in an Eppendorf Mastercycler gradient according to the following program: 94 ° C./5 'for initial denaturation of genomic templates; 94 ° C / 30 "for the Denaturationsschritt in each cycle; 61 + 10 ⁰ C / 30" of annealing of 12 identical reaction aliquots at variable temperature in the range of 51 to 71 ⁰ C at a constant temperature raising or cooling rate of 3 ° C per second; 72 ° C / 1 "for primer elongation, 35 cycles, 72 ° C / 5 'to the final synthesis completion;. In order to ensure identical reactant was worked with a mastermix cooling to 4 ⁰ C for storage until gel electrophoretic analysis This contained O, 76xPCR-. Standard buffer, 1.5 mM MgCl ₂ , 1.5 μg / ml BSA, 76 μM of each of the four deoxyribonucleotide triphosphates, 0.5 unit Taq polymerase based on each batch aliquot, 15 pmol of common reverse primer 5 'TACCCTCTCACGAAACTCTG 3' based on each batch aliquot This primer is specific for a portion of the human k-ras gene exon 1. Five aliquots of the master mix sufficient for every 12 aliquots were spiked separately with 15 pmol of the following primer relative to each aliquot of sample, the sequence thereof is identical and specific to the genomic area around Codon 12/13 of the human k-ras gene. Together, back and forth primers span 348 base pairs on the genomic DNA:

1.1 5 'TTGGAGCTGGTGGCGTAGG 3', specific for the k-ras wild-type allele in SW620;

1.2 5 'TTGGAGCTGG * TGGCGTAGG 3', specific for the k-ras wild-type allele in SW620, G * represents the 2'-O-tert-butyldimethyl-silyl derivative of the guanosine ribonucleotide;

1.3 5 'TTGGAGCTG * G * TGGCGTAGG 3', specific for the k-ras wild-type allele in SW620, G * represents the 2'-O-tert-butyldimethyl-silyl derivative of the guanosine ribonucleotide;

1.4 5 'TTGGAGCU * G * G * TGGCGTAGG 3', specific for the k-ras wild-type allele in SW620, G * means the 2'-O-tert-butyldimethyl-silyl derivative of the guanosine ribonucleotide and U * the 2'-O-tert-butyl Dimethyl-silyl derivative of the uridine ribonucleotide;

1.5 5 'TTGGAGC * U * G * G * TGGCGTAGG 3', specific for the k-ras wild-type allele in SW620, G * represents the 2'-O-tert-butyldimethyl-silyl derivative of the guanosine ribonucleotide, U * the 2'-O tert-butyl-dimethyl-silyl derivative of the uridine ribonucleotide and C ^* the cytidine arabinoside;

A sixth identical aliquot of the master mix, which is also sufficient for 12 aliquots, was spiked with a round primer (again 15 pmol relative to each aliquot of sample), at the same genomic position in the k-ras gene as primers 1.1 to 1.5, but in difference specific to these is the chromosome in SW620, which has a glycine-to-valine mutation (G12V) in codon 12 of the k-ras gene.

1.6 5 'TTGGAGCTGTTGGCGTAGG 3', specific for the somatically mutated (G12V) DNA in SW620.

After completion of the PCR, 6 μl of each reaction mixture were mixed in the usual way with orange G in glycerol / H ₂ O and applied to a horizontal agarose gel (1.5% in TAE buffer plus 0.1 μg / ml ethidium bromide). The order of order is the following: Upper row from left to right - Series 1.1, 1.2, 1.3; bottom row from left to right - Series 1.4, 1.5, 1.6, each bounded by a DNA standard with fragments of known length. To the electrophoresis gel in submarine mode a DC voltage of 7V / cm was applied. The separation took 45 minutes. A photograph of this gel under UV light is shown in Fig. 3.

Observation:

Quantitative inhibition is observed in even series of stop functions (2 and 4), while odd numbered series (1 and 3) cause partial inhibition. The intensity of the wild type and mutant amplificates from parallel runs with primers without any stop function (top left and bottom right) is used for the comparison of quantities.

Embodiment 2

Embodiment 1 is realized according to the invention with the following changes: Instead of the primer 1.2-1.5 becomes

2.1 5 'TTGGAGCTGGTGGCGTAGG * 3' with G * = guanosine ribonucleotide with stop function used. Primer 2.1 suppresses the exponential amplification of the sequence of the k-ras wild-type allele, whereas it causes exponential amplification of the mutant allele when using a so-called proof reading polymerase, here Pfu polymerase. The Pfu polymerase removes the 3'-terminal G * of primer 2.1 after binding to the mutant template to which it is not complementary. After 42 cycles of amplification, the selectively amplified mutant signal appears in the electrophoretic detection.

The advantages of this embodiment variant are (i) in the omission of the third, mutant-specific primer, the function of which is taken over by the nucleotide truncated primer 2.1, whereby (ii) all possible mutations at this sequence position are readable.

Embodiment 3

The embodiments 1 and 2 are extended according to the invention to the effect that in the primers 1.2-1.5 and 2.1 as a stop function a bulky additional group with conjugated electron pairs is used. The advantage of this embodiment variant is the combinability of inventive control of the sectionwise enzymatic nucleic acid amplification with fluorescent detection principles.

Legend to the pictures

Fig.1

Partial inhibition according to the invention. The amount of amplicon when using a synthetic oligonucleotide with stop function (lower row) is reduced compared to the control (upper row).

Fig. 2

Schematic diagram of the application of the method according to the invention to the detection of alternative splice forms.

Fig. 3

Representative electrophoresis image of base case 1 of the method for controlling the partial enzymatic nucleic acid amplification via incomplete complementary strands.

References and explanatory remarks:

¹ OMIM: Online Mendelian Inheritance in Men, http: //www.ncbi.nlm. nih.gov/entrez/query.fcgi?db=OMIM

² Wilhelm Seyffert (ed.), Textbook of Genetics, with contribution by Rudi Balling and others, 2nd ed. - Heidelberg; Berlin: Spectrum, Akad. Verl., 2003, ISBN 3- 8274-1022-3

Benjamin Lewin, Genes VIII, Prentice Hall, 2004, ISBN: 013143981 2

⁴ Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H., Specific enzymatic amplification of DNA in vitro: the Polymerase chain reaction., Col. Spring Harb Symp Quant. Biol. 1986; 51 Pt. 1: 263-73

⁵ Barany F., The ligase chain reaction in a PCR world, PCR Methods Appl. 1991 Aug; 1 (1): 5-16

⁶ Sanger F, Nicklen S, Coulson AR, DNA sequencing with chain-terminating inhibitors, Proc Natl Acad. See US A. 1977 Dec; 74 (12): 5463-7

⁷ M. Ronaghi, M. Uhlen and P. Nyren, A sequencing method based on real-time pyrophosphates. Science 281 (1998), p. 363

⁸ Coutelle C, New DNA Analysis Techniques, Biomed Biochim Acta. 1991; 50 (1): 3-10. (Mini review)

⁹ Leone G, van Schijndel H, van Gemen B, Kramer FR, Schoen CD, Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA, Nucleic Acids Res. 1998 May 1; 26 (9): 2150 -5

¹⁰ Gilles PN, Wu DJ, Foster CB, Dillon PJ, Chanock SJ., Single nucleotide polymorphism discrimination by an electronic dot blot assay on semiconduetor microchips, Nat Biotechnol. 1999 Apr; 17 (4): 365-70

¹¹ Orita M, Ivahana H, Kanazawa H, Hayashi K, Sekiya T., Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms, Proc Natl Acad Be USA 1989 Apr; 86 (8): 2766- 70

¹² Petersen M, Wengei J., LNA: a versatile tool for therapeutics and genomics, Trends Biotechnol. 2003 Feb; 21 (2): 74-81. Review

¹³ Usually, the attached helper cloning site consists of the corresponding recognition sequence of the selected restrictase plus 3-4 arbitrary nucleotides used to ensure the full endonucleolytic Effect of the restriction enzyme can be used. This method has the serious disadvantage that the auxiliary cloning sites in the PCR product must be unique, otherwise the amplificate becomes fragmented. The unicality is a problem especially with long amplicons of unknown sequence.

¹⁴ non-proofreading polymerases depend on the type of

Nucleotidyltransferases add an additional 1 -3 nucleotides to the 3 'end of a newly synthesized complementary strand. As a rule of thumb, over 90% of the 3 'ends carry a supernatant nucleotide that is 85% dA; a second nucleotide (also usually dA) is found in about 1% of the synthesis products, a third in 0.01%. Thermostable polymerases which, depending on the ion (Mn ²⁺ / Mg ²⁺ ) show a higher template tolerance to RNA, are more prone to prolong the product with additional nucleotides. This explains why it is absolutely unsatisfactory to introduce crude PCR products into a blunt-ended vector. Partially create here 3'-T-tailed vectors remedy.

^{15 For} basic and further explanations of this time-consuming and cost-saving methodology, as well as its applications for expression, see the following 6 citations.

¹⁶ Shuman, S. (1994) J. Biol. Chem. 269: 32678-32684

¹⁷ Clark, JM (1988) Nuc. Acids Res. 16: 9677-9678

¹⁸ Mead, D. et al. (1991) Bio / Techniques 9: 657-663 ¹⁹ Bemard, P. and Couturier, M. (1992) J. Mol. Biol. 226: 735-745

²⁰ Bernard, P. et al. (1993) J. Mol. Biol. 234: 534-541

²¹ Rand, KN (1996) Elsevier Trends Technical Tips Online

²² s. http://www.ensembl.org

²³ Xu, Q. and Lee, C. (2003). Discovery of novel splice forms and functional analysis of cancer-specific alternative splicing in human expressed sequences. Nucleic Acids Res. 31, 5635-5643

²⁴ M. Hiller, R. Oven, S. Heymann, A. Busch, TM Gläßer and J. -C. Freytag's Efficient prediction of alternative splice forms using protein domain homology, In Silico Biology 4, 0017, 2004

Claims

claims:

I. A method of controlling the segmental enzymatic nucleic acid amplification via incomplete complementary strand synthesis characterized in that the in vitro synthesis of DNA double helices is stopped without the use of terminating substrate analogues prior to completion, whereby stopping polymerase activity during complementary strand synthesis by inhibiting the consistent readability of the template to predetermined In the template, and this inhibition of the consistent readability of the template at predetermined sites in the template is effected by the use of synthetic oligonucleotides with incorporated nucleotide monomers of unnatural chemical nature.

A method according to claim 1, characterized in that the unnatural chemical nature of the incorporated nucleotide monomers does not affect their base-pairing ability on complementary nucleic acid segments.

3. The method according to claim 1, characterized in that the unnatural chemical nature of the incorporated Nukleotidmonomere does not affect the primer effect of the synthetic oligonucleotides for polymerase reactions.

4. The method according to claim 1 to 3, characterized in that the unnatural nucleotide monomers in the stock of synthetic oligonucleotides contain derivatives of known sugar.

5. The method according to claim 1 to 3, characterized in that the unnatural nucleotide monomers in the inventory of synthetic oligonucleotides contain hydrolyseresistente Zwischenzuckerbindungen.

6. The method according to claim 1 to 3, characterized in that some monomers in the inventory of synthetic oligonucleotides are not linked via phosphodiester bonds.

7. The method according to claim 1 to 3, characterized in that the unnatural nucleotide monomers in the inventory of synthetic Oligonucleotides have received additional bonds to adjacent nucleotides.

8. The method according to claim 1 to 3, characterized in that the unnatural nucleotide monomers in the inventory of synthetic oligonucleotides contain additional functional groups on the mating bases.

9. The method according to claim 1, characterized in that the synthetic oligonucleotides contain additional bonds between two or each two adjacent nucleotide monomers.

10. The method according to claims 1 to 3, 7 and 9, characterized in that the additional bonds are brought about by simultaneous incorporation of adjacent, previously zykloaddierter bases.

11. The method according to claims 1 to 3, 7 and 9, characterized in that the additional bonds are subsequently brought about by Zykloaddition of the bases.

12. Process according to claims 1 to 4, characterized in that the different sugars are pentoses or derivatives of pentoses.

13. The method according to claims 1 to 4 and 12, characterized in that find use as pentoses modified deoxyriboses or modified riboses.

14. Process according to claims 1 to 4 and 12, characterized in that the arabinose is used as pentose.

15. The method according to claims 1 to 4, 12 and 13, characterized in that the modified ribose on the 2'-carbon atom bulky additional groups.

16. Process according to claims 1 to 4, 12, 13 and 15, characterized in that the bulky additional groups on the 2'-carbon atom are O-linked triisopropylsilyl groups.

17. Process according to claims 1 to 4, 12, 13 and 15, characterized in that the bulky additional groups on the 2'-carbon atom are O-linked tert-butyl-dimethylsilyl groups.

18. The method according to claims 1 to 4, 12, 13 and. 15, characterized in that the bulky additional groups on the 2'-carbon atom are O-linked alkyl groups.

19. The method according to claims 1 to 4, 9 to 18, characterized in that the synthetic oligonucleotides are mixed polymers of natural deoxyribonucleotides and the designated derivatives.

20. Process according to claims 1 to 4, 9 to 19, characterized in that the copolymers contain one or more nucleotide derivatives of the designated types.

21. The method according to claims 1 to 4, 9 to 20, characterized in that the position and sequence of the designated nucleotide derivatives in the synthetic oligonucleotide are derived from the sequence thereof.

22. The method according to claims 1 to 21, characterized in that the synthetic oligonucleotides are used for the detection of nucleic acid sequence variations.

23. The method according to claims 1 to 22, characterized in that the synthetic oligonucleotides are used for the detection of nucleic acid minor components in complex mixtures.

24. The method according to claims 1 to 21, characterized in that the synthetic oligonucleotides are used for the production of DNA molecules with defined single and double stranded sections.

25. The method according to claims 1 to 21 and 23, characterized in that the synthetic Oligonukieotide be used for the production of DNA molecules having predetermined single strand overhangs.

26. The method according to claims 1 to 21, characterized in that the synthetic oligonucleotides for the production of DNA Molecules can be used, which enter into affine bonds with mobile or stationary reactants.

27. The method according to claims 1 to 21, characterized in that the synthetic oligonucleotides are used for the production of DNA molecules that undergo chemical bonds with mobile or stationary reactants.

28. The method according to claims 1 to 21, 25 and 26, characterized in that the synthetic oligonucleotides are used for the production of labeled DNA molecules.

29. The method according to claims 1 to 21, characterized in that the synthetic oligonucleotides are used for the detection of alternative splice forms.