EP3759247A1 - Method for primer extension reaction with improved specificity - Google Patents

Method for primer extension reaction with improved specificity

Info

Publication number
EP3759247A1
EP3759247A1 EP19711506.6A EP19711506A EP3759247A1 EP 3759247 A1 EP3759247 A1 EP 3759247A1 EP 19711506 A EP19711506 A EP 19711506A EP 3759247 A1 EP3759247 A1 EP 3759247A1
Authority
EP
European Patent Office
Prior art keywords
primer
sequence
oligonucleotide
template
primer extension
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP19711506.6A
Other languages
German (de)
French (fr)
Inventor
Dmitry Cherkasov
Christian GRUNWALD
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
AGCT GmbH
Original Assignee
AGCT GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE102018001639.1A external-priority patent/DE102018001639A1/en
Priority claimed from EP18195189.8A external-priority patent/EP3530753A1/en
Application filed by AGCT GmbH filed Critical AGCT GmbH
Publication of EP3759247A1 publication Critical patent/EP3759247A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6853—Nucleic acid amplification reactions using modified primers or templates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/113—Modifications characterised by incorporating modified backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/121—Modifications characterised by incorporating both deoxyribonucleotides and ribonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/125—Modifications characterised by incorporating agents resulting in resistance to degradation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/161—Modifications characterised by incorporating target specific and non-target specific sites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/186—Modifications characterised by incorporating a non-extendable or blocking moiety
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10—Modifications characterised by
    • C12Q2525/204—Modifications characterised by specific length of the oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/161—A competitive reaction step
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/163—Reactions characterised by the reaction format or use of a specific feature the purpose or use of blocking probe

Definitions

  • the present invention relates to a method for the template-dependent primer extension reaction by means of a template-dependent polymerase.
  • primer extension products can be prepared which can be used in an amplification of nucleic acids.
  • the method may thus help to improve the specificity of analyzes involving a primer extension step.
  • the primer extension reaction plays a role in many genetic analyzes, e.g. in amplification methods, such as PCR, or in individual steps of the analyzes.
  • An enzymatic primer extension is carried out by means of a polymerase, whereby a synthesized strand is formed. In many processes, this strand is detached from the template by various means, independently of the sequence, and used in further process steps.
  • agents include, for example, temperature or denaturing agents such as alkalis or formamide.
  • strands can be separated by enzymes using chemical energy sources such as dNTP or ATP. These include helicases or polymerases with strand-displacing action. Such separations are predominantly sequence-unspecific.
  • the availability of free complementary positions may play a role in potential interactions with other reaction components in many processes.
  • the frequency and duration of binding of reactants to each other via complementary positions may be one Play role for the speed or yield of a certain reaction step.
  • Many reactions in the field of molecular analysis are based on the creation of more or less stable bonds between individual reaction components. The effects achieved can have an influence on the specificity of reactions.
  • Primer extension is used in many genetic analyzes.
  • the result of a correct priming formation of a primer-template complex
  • the continuation of the template-dependent enzymatic synthesis by means of a polymerase plays a role.
  • primer extension product the product of a sequence-specific primer extension reaction (primer extension product)
  • the synthesis phase is complete.
  • the primer extension product can be detached from the template and used in other procedures.
  • both the synthesis of the primer extension product per se and the provision of the synthesized primer extension product can be improved to a further use.
  • the primer extension reaction is currently optimized in most cases by adjusting the primer binding (eg, by using optimal reaction temperatures, buffer conditions and complementarity of the primers to a primer binding site).
  • Some tools have been developed to improve primer binding. These are limited only to the improvement of primer binding and do not go beyond the primer length.
  • Using a polymerase with 3 ' exonuclease activity polymerases with proofreading) one can achieve a further improvement in the quality of the synthesis result.
  • the 3 ' end of the synthesized strand is checked by polymerase-associated exonuclease.
  • primer extension reaction (priming and proofreading by the polymerase), in most cases the primer extension reaction is not further evaluated for quality.
  • a method for extension of a primer oligonucleotide comprises the steps ( Figures 1, 2):
  • Nucleic acid chain (M1) wherein the primer oligonucleotide (P1 .1) comprises the following ranges: a first region, essentially sequence-specific, to a
  • complementary segment comprising a portion of the target sequence can bind within a provided nucleic acid chain (M1),
  • a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1); c) extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase to give a primer extension product (primer extension product, P1 .1 -Ext) which has a synthesized region in addition to the primer oligonucleotide (P1.1) which is substantially complementary to a nucleic acid chain comprising a target sequence (M1), wherein the primer extension product (P1 .1 -Ext) and the nucleic acid chain (M1) form a double strand under reaction conditions;
  • controller oligonucleotide (C1.1) binding of a controller oligonucleotide (C1.1) to the primer extension product (P1.1-Tex), wherein the controller oligonucleotide (C1.1) comprises the following ranges:
  • controller oligonucleotide (C1 .1) does not serve as a template for a primer extension of the primer oligonucleotide (P1 .1) and the controller oligonucleotide (C1 .1) with its first, second and third regions to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1) can bind.
  • the second region of the primer oligonucleotide is in particular a polynucleotide tail.
  • essentially sequence-specific in the context of the invention means in particular that the mutually complementary regions of the primer oligonucleotide and the nucleic acid to be amplified have not more than 5, 4, 3, 2, or 1 mismatches.
  • substantially complementary in the sense of the invention means in particular that the mutually complementary regions of nucleic acids have not more than 5, 4, 3, 2, or 1 mismatches.
  • primer oligonucleotides and controller oligonucleotide are present at the beginning of the reaction. However, sequential addition of individual reagents is also possible.
  • PCR e.g., first carried out for 1 to 10 cycles and then further, for example, under isothermal conditions.
  • the first region of the primer oligonucleotide is completely sequence-specific, i. in particular without mismatches, to which the nucleic acid to be amplified can bind.
  • the second region (overhang) of the primer oligonucleotide remains essentially uncoupled from a polymerase used for the primer extension under the chosen reaction conditions.
  • the method further comprises the following step: hybridizing a block oligonucleotide to a region of the nucleic acid chain comprising a target sequence
  • Temporative strand located in the 5 ' direction of the region bound by the first region (primer binding site) of the primer oligonucleotide, the block oligonucleotide being designed to inhibit extension of the primer oligonucleotide at the bound region to block.
  • the block oligonucleotide is characterized by a length of about 15 nucleotides to about 60 nucleotides, and optionally modifications (eg PTO or LNA (locked nucleic acid, 2 ⁇ , 4'C methylenverb Wegte ribosyl residues in the polymer) or PNA (peptide nucleic acid, N- (2-aminoethyl) glycine backbone).
  • PTO or LNA locked nucleic acid, 2 ⁇ , 4'C methylenverb Wegte ribosyl residues in the polymer
  • PNA peptide nucleic acid, N- (2-aminoethyl) glycine backbone
  • the third region of the controller oligonucleotide is substantially complementary to the part of the synthesized region of the primer extension product which directly adjoins the primer oligonucleotide portion of the primer extension product.
  • this improves the sequence-specific displacement of the nucleic acid to be amplified.
  • the portion of the synthesized region that is substantially complementary to the third region of the controller nucleotide has a length in the range of 5 nucleotides to 50 nucleotides.
  • the part of the synthesized region which is substantially complementary to the third region of the controller nucleotide has a length in the range from 3 nucleotides to 70 nucleotides, in particular 5 nucleotides to 50 nucleotides, in particular 5 nucleotides to 50 Nucleotides, in particular 5 nucleotides to 30 nucleotides, in particular 5 nucleotides to 20 nucleotides.
  • the method further comprises the step of: hybridizing a probe to a portion of the primer extension product that is not bound by the controller oligonucleotide.
  • the method is carried out essentially isothermally.
  • substantially isothermal in the sense of the present description means in particular that the reaction temperature is carried out within a temperature range of 10 K temperature difference between the highest and the lowest temperature.
  • the target sequence of a nucleic acid has a length in the range from about 20 nucleotides to about 300 nucleotides.
  • the primer oligonucleotide has a length in the range of 15 nucleotides to 100 nucleotides.
  • the controller oligonucleotide has a length in the range from 20 nucleotides to 100 nucleotides.
  • the chosen reaction conditions comprise a reaction temperature in the range from 50 ° C to 70 ° C.
  • the primer oligonucleotide has one or more modifications in the second region, in particular immediately following the first region of the primer oligonucleotide (FIG. 26), which stops the polymerase used at the second region ,
  • the primer oligonucleotide has one or more modifications in the second region, in particular immediately following the first region of the primer oligonucleotide (FIG. 26), which stops the polymerase used at the second region .
  • the first region of the primer oligonucleotide is optionally amplified in later process steps.
  • nucleotide modifications which, although capable of complementary binding to the primer extension product, are not accepted by the polymerase as a template.
  • nucleotide Modifications provide nucleotide compounds with modified phosphate-sugar backbone units, for example 2 '-0-alkyl-RNA modifications (eg 2' OMe), LNA modifications or morpholino modifications. The presence of such modifications in a strand prevents a DNA dependent polymerase reading such a strand. The number of such modifications may be different, usually few modifications (between 1 and 20) may be sufficient to prevent a polymerase from reading such a strand.
  • nucleotide modifications can be used, for example, at or around the binding site of the primer oligonucleotide to the controller oligonucleotide and / or as constituents of the second region of the primer oligonucleotide.
  • the second primer region is uncopiable only in one of several alternative embodiments. This embodiment allows, for example, the use of identical primers in the primer extension and in an optionally subsequent amplification.
  • primers must have a "protection". This may consist of a "first blocking unit” before the second area or the entire second area consists of modifications that are uncopiable.
  • this second primer region can be quite copiable when using long matrices (see FIGS. 1-3), since the 3 ' end of the template is not immediately in front of the second region and thus can not prime a synthesis.
  • the primer extension primer can not be used as an amplification primer.
  • the second region is not allowed to bind to the template and thus is present for the interaction with the controller single-stranded.
  • (Matrix strand) (M1) b) hybridizing a primer oligonucleotide (P1 .1) to a segment comprising a portion of the target sequence (primer binding site) of the provided
  • Nucleic acid chain (M1) wherein the primer oligonucleotide (P1 .1) comprises the following ranges:
  • a first region substantially sequence-specific, capable of binding to a complementary segment (primer binding site) comprising a portion of the target sequence within a provided nucleic acid sequence (M1),
  • a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1); c) extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase to give a primer extension product (primer extension product, P1 .1 -Ext) which has a synthesized region in addition to the primer oligonucleotide (P1.1) which is substantially complementary to the nucleic acid chain comprising a target sequence (M1), wherein the primer extension product (P1 .1 -Ext) and the nucleic acid chain (M1) form a double strand under reaction conditions;
  • controller oligonucleotide (C1.1) binding of a controller oligonucleotide (C1.1) to the primer extension product (P1.1-Tex), wherein the controller oligonucleotide (C1.1) comprises the following ranges:
  • controller oligonucleotide (C1 .1) does not serve as a template for a primer extension of the primer oligonucleotide (P1 .1) and the controller oligonucleotide (C1 .1) with its first, second and third regions to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1) can bind.
  • a target sequence comprises a polymorphic locus comprising at least one nucleotide position comprising at least two characteristic sequence variants in a target sequence. In certain embodiments, a target sequence comprises a polymorphic locus comprising at least two nucleotide positions comprising at least two characteristic sequence variants in a target sequence.
  • a target sequence comprises a polymorphic locus comprising a length between one nucleotide to 100 nucleotides, such locus comprising at least two characteristic sequence variants of a target sequence.
  • step (1) at least two template strands are provided, each template strand comprising a variant of a target sequence having a specific and characteristic sequence variant of a polymorphic locus.
  • each template strand comprising its own target sequence and these
  • Target sequences of the first and another start nucleic acid chain are different.
  • Polymerase remains essentially unkopiert under the selected reaction conditions.
  • steps (b) to (d) are repeated at least once.
  • the target sequence of the nucleic acid chain (M1) comprises a length of 20 nucleotides to 200 nucleotides.
  • primer oligonucleotide (P1 .1) has a length in the range of 15 nucleotides to 100 nucleotides.
  • controller oligonucleotide (C1 .1) has a length in the range of 20 nucleotides to 100 nucleotides.
  • reaction conditions include a reaction temperature in the range of 25 ° C to 80 ° C.
  • the primer oligonucleotide (P1 .1) in the second region has a modification or several modifications, in particular immediately after the first region of the primer oligonucleotide (P1 .1), which prevents the polymerase used from copying the second area.
  • kit for carrying out a method according to one of the preceding numbers
  • a primer oligonucleotide comprising the following ranges:
  • a first region that can bind substantially sequence-specifically to a complementary segment (primer binding site) within a provided nucleic acid sequence (M1) comprising a target sequence,
  • a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1);
  • first primer oligonucleotide (P1 .1) when hybridized to the complementary segment of the target sequence, is replaced by a template-dependent polymerase can be extended to a primer extension product (P1 1-Ext) comprising a synthesized region in addition to the primer oligonucleotide (P1 .1);
  • controller oligonucleotide (C1 .1) comprising the following ranges:
  • controller oligonucleotide (C1 .1) is not used as a template for a
  • Primer extension of the primer oligonucleotide (P1 .1), and the controller oligonucleotide (C1 .1) with its first, second and third region to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1 ) can bind; and optional
  • a block oligonucleotide (B1 .1) that can bind to a segment of the nucleic acid chain (M1) that is in the 5 ' direction from the segment (primer binding site) that is located in the first region of the primer oligonucleotide (P1 .1) wherein the block oligonucleotide (B1 .1) is adapted to block the synthesis of the primer extension product (P1 1 -Ext) at the bound region and thereby to limit the length of the synthesized region of the primer extension product.
  • Kit according to No. 15, characterized in that the second region of the primer oligonucleotide (P1 .1) remains substantially uncoated by a polymerase used for the primer extension under the chosen reaction conditions.
  • a method for the specific extension of a primer oligonucleotide comprising the steps:
  • nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided
  • a first region substantially sequence-specific, capable of binding to a complementary segment (primer binding site) comprising a portion of the target sequence within a unitary segment of nucleic acid chains provided (M 1 .1 and M 1 .2), a second region (overhang) which connects to the 5 'end of the first region or is linked via a linker, which second region can be bound by a controller oligonucleotide (C 1 .1 or C 1 .2);
  • a third region which is complementary to at least part of the synthesized region of at least one expected first primer extension product (P1 .1 -Ext or P1 2-Ext); and wherein the controller oligonucleotides (C1 .1 and C1 .2) do not serve as template for primer extension of the primer oligonucleotide (P1 .1), and the controller oligonucleotide (C1 .1) with its first, second and third regions to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of the
  • Nucleic acid chain (M 1 .1) can bind and
  • controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer Extension product (P1 2-Ext) with displacement of
  • Nucleic acid chain (M 1 .2) can bind.
  • extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase using provided nucleic acid chains as templates for primer extension to give specific primer extension products (primer extension products, P1 .1-Ext and P1 2 Each) in addition to the primer oligonucleotide (P1 .1) comprises a synthesized region which is substantially complementary to the respective nucleic acid chain comprising a target sequence (M1), wherein
  • the primer extension product (P1 1 -Ext) comprises a synthesized complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
  • the primer extension product (P1 2-Ext) comprises a synthesized complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
  • step (e) binding of at least one controller oligonucleotide (C1 .1 and C 1 .2) to the primer extension products (P1 1-Ext and P1 2-Ext) formed in step (e), wherein
  • the controller oligonucleotide (C1 .1) with its first, second and third region can bind to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of the nucleic acid chain (M 1 .1) and
  • the controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer extension product (P1 2-Ext) with displacement of the nucleic acid chain (M 1 .2) can bind.
  • nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2) comprise at least two uniform segments, which is identical in M1 .1 and M1 .2.
  • the unitary segment comprises a length of 10 to 180 nucleotides.
  • a method for the specific extension of a primer oligonucleotide comprising the steps:
  • nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided nucleic acid chains
  • Nucleic acid chains can bind complementary, wherein each primer oligonucleotide
  • a first region each of which can sequence-specifically bind to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of nucleic acid chains provided (M 1 .1 and M 1 .2),
  • a second region connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C 1 .1 or C 1 .2);
  • a first region which can bind to the second region of the primer oligonucleotides (P1 .1 and / or P1 .2) (overhang), and a second region which can be bound to the first region of the respective primer oligonucleotide (P1 .1 or P1 .2) is complementary, where
  • corresponding first area of P1 .1 comprises and C 1 .2 a complementary second area to
  • controller oligonucleotides (C 1 .1 and C 1 .2) do not serve as template for a primer extension of a primer oligonucleotide used (P 1 .1 or P 1 .2),
  • the primer extension product (P1 .1 -Ext) comprises a complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
  • the primer extension product (P1 2-Ext) comprises a complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
  • step (e) binding of at least one controller oligonucleotide (C1 .1 and C 1 .2) to the primer extension products (P1 1-Ext and P1 2-Ext) formed in step (e), wherein
  • controller oligonucleotide (C1 .1) with its first, second and third region to the complementary segments of the primer Extension product (P1 1 -ext) displacing the
  • Nucleic acid chain (M 1 .1) can bind and
  • the controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer extension product (P1 2-Ext) with displacement of the nucleic acid chain (M 1 .2) can bind.
  • a method of specifically extending a primer oligonucleotide using a competitor primer comprising the steps of:
  • nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided
  • a first region capable of binding sequence-specifically to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of nucleic acid chains provided (M 1 .1), a second region (overhang) attached to the 5 'end of the first region is connected or connected via a linker, wherein the second region of a controller oligonucleotide (C 1 .1) can be bound;
  • the competitor primer oligonucleotide comprises a first region which is sequence-specific, to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of the nucleic acid chain provided ( M 1 .2), where
  • this region is not identical to the first region of the first primer oligonucleotide
  • controller oligonucleotide (C1 .1), wherein the controller oligonucleotide comprises the following ranges:
  • controller oligonucleotide (C 1 .1) does not serve as a template for a primer extension of a used first primer oligonucleotide (P 1 .1) or a competitor primer oligonucleotide,
  • the primer extension product (P1 .1 -Ext) comprises a complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
  • the primer extension product (P5.2-Ext) comprises a complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
  • the synthesized primer extension products (P1 .1-Ext and P5.2-Ext) and their corresponding template nucleic acid chain (M 1 .1 and M 1 .2) form a double strand under reaction conditions;
  • controller oligonucleotide (C1 .1) with its first, second and third region to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of
  • Nucleic acid chain (M 1 .1) can bind, wherein
  • controller oligonucleotide (C1 .1) is unable to bind to the P5.2-Ext under used reaction conditions and to separate P5.2-Ext from its template strand.
  • a first primer oligonucleotide and a corresponding controller oligonucleotide are combined to form a primer extension system.
  • a primer extension system comprises:
  • a specific controller oligonucleotide for a sequence variant of the target sequence is a specific controller oligonucleotide for a sequence variant of the target sequence
  • a first primer oligonucleotide which can bind to the sequence fragment which is the same for the target sequence (template strand) which is provided in a substantially complementary manner, and
  • the first primer oligonucleotide does not comprise sequence segments which are specific for a sequence variant of the target sequence. Rather, the first one Primer oligonucleotide fully complementary or intrinsically complementary to the target sequence bind, without distinguishing the sequence variants.
  • Such a primer extension system is thus constructed such that the polymorphic locus of the target sequence is located in the sequence segment which lies in the 3 ' primer extension direction of the first primer.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus thus lies in its third region.
  • a first primer oligonucleotide and a corresponding controller oligonucleotide are combined to form a primer extension system.
  • a primer extension system comprises:
  • a first sequence variant-specific primer oligonucleotide which can bind at least partially (for example with its 3 ' terminal nucleotide) to the specific sequence segment of a polymorphic locus of a target sequence provided fully complementary.
  • such a primer extension system is thus constructed such that the sequence of the first primer oligonucleotide overlays at least one nucleotide position with a characteristic sequence of the polymorphic locus.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus is, in certain embodiments, completely in the second region of the controller oligonucleotide.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus lies partially in the second and partially in the third region of the controller oligonucleotide.
  • a first primer oligonucleotide and a corresponding controller oligonucleotide and a competitor primer oligonucleotide are combined to form a primer extension system.
  • a primer extension system comprises:
  • a specific controller oligonucleotide for a sequence variant of the target sequence is a specific controller oligonucleotide for a sequence variant of the target sequence
  • a first primer oligonucleotide which can bind to the sequence fragment which is the same for the target sequence (template strand) which is provided in a substantially complementary manner, and
  • a specific competitor primer oligonucleotide is A specific competitor primer oligonucleotide.
  • the first primer oligonucleotide does not comprise any sequence segments which are specific for a sequence variant of the target sequence. Rather, the first primer oligonucleotide completely complementary or intrinsically complementary to the target sequence, without distinguishing the sequence variants.
  • Such a primer extension system is thus constructed such that the polymorphic locus of the target sequence is located in the sequence segment which lies in the 3 ' primer extension direction of the first primer.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus thus lies in the third region of the controller oligonucleotide.
  • the competitor oligonucleotide used may bind fully or partially to the segment of the target sequence which may bind complementary to the first region of the first primer oligonucleotide.
  • this competitor primer oligonucleotide is fully complementary to a sequence variant of a target sequence which is not identical to the sequence variant of the template strand recognized by the first primer.
  • a competitor primer oligonucleotide does not comprise a sequence segment which is capable of substantially complementary binding to the first region of the controller oligonucleotide.
  • a first primer oligonucleotide and a corresponding controller oligonucleotide and a competitor oligonucleotide are combined to form a primer extension system.
  • a primer extension system comprises:
  • a first sequence variant-specific primer oligonucleotide which can bind at least partially (for example with its 3 ' terminal nucleotide) to the specific sequence segment of a polymorphic locus of a target sequence provided fully complementary
  • such a primer extension system is thus constructed such that the sequence of the first primer oligonucleotide overlays at least one nucleotide position of a characteristic sequence of the polymorphic locus.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus is, in certain embodiments, completely in the second region of the controller oligonucleotide.
  • the segment of the controller oligonucleotide corresponding to the polymorphic locus lies partially in the second and partially in the third region of the controller oligonucleotide.
  • the competitor oligonucleotide used may bind fully or partially to the segment of the target sequence which may be complementary to the first region of the first primer oligonucleotide. In certain embodiments, this competitor primer oligonucleotide is fully complementary to a sequence variant of a target sequence which is not identical to the sequence variant of the template strand recognized by the first primer.
  • a competitor primer oligonucleotide does not comprise a sequence segment which is capable of substantially complementary binding to the first region of the controller oligonucleotide.
  • the application describes the preparation of primer extension products which can be used, for example, in an exponential amplification as starting nucleic acid.
  • the first primer oligonucleotides and controller oligonucleotides used herein may be identical to or different from those of exponential amplification.
  • the technical problems mentioned in the introduction are achieved, in particular, by the provision of methods and components (feedback system) which can check the quality of synthesized primer extension products in different phases of a template-dependent primer extension.
  • this check can take place either during the synthesis or only after completion of the synthesis.
  • the check can take place in the same reaction batch, so that the actual primer extension reaction does not have to be interrupted (online control) or only after completion of the primer extension reaction (final control).
  • these components form a feedback system for the primer extension reaction or for the release of the product of the primer extension reaction from the template.
  • the components of the feedback system can exert an influence on the primer extension reaction in such a way that it is possible to decide between a continuation of the enzymatic synthesis or an interruption of the synthesis or restart of the synthesis. Furthermore, the components of the feedback system can exert influence that the detachment of the product of the synthesis from the template is continued depending on the compliance with the controller oligonucleotide or is stopped or delayed or completely interrupted in the event of any deviations occurring in the sequence ,
  • the synthesis system in a primer extension reaction typically comprises at least one template and at least one primer capable of binding more or less specifically to the template and initiating a primer extension reaction. Furthermore, the synthesis system comprises at least one polymerase, as well as substrates (dNTPs) and Buffer conditions under which a primer extension reaction can take place. Other oligonucleotides may be added depending on the embodiment of the method, eg block oligonucleotides, for sequence-specific stop of the polymerase or probe oligonucleotides which can deliver a fluorescence signal.
  • the feedback system comprises a primer which acts as an initiator of a primer extension reaction and another oligonucleotide, a so-called controller oligonucleotide.
  • the primer of the feedback system is identical in a preferred embodiment with the primer of the synthesis system.
  • the controller oligonucleotide is capable of interacting with both the particular primer and the primer extension product sequence-specific from that primer. It is capable of forming a complementary duplex under reaction conditions upon sequence alignment with the primer extension product.
  • the controller oligonucleotide itself does not serve as a template for synthesis for the said primer / polymerase system.
  • Other oligonucleotides may be added depending on the embodiment of the method, e.g. Block oligonucleotides for sequence-specific stop of the polymerase or probe oligonucleotides which can deliver a fluorescence signal.
  • the method comprises a primer extension reaction (also called primer extension) by means of a primer in the presence of a suitable controller oligonucleotide in the same reaction mixture.
  • the controller oligonucleotide is capable of interacting with the primer extension product to form a complementary strand.
  • the progress of the formation of the double strand between the controller and the primer extension product (P1 -Ext) depends essentially on the correspondence of the sequences between the controller and the corresponding primer extension product. As a result, a sequence check or sequence check can already take place during a primer extension or immediately after a primer extension at least over partial segments of the synthesized primer extension fragment by means of controller oligonucleotides.
  • the method includes a template-dependent primer extension method in combination with subsequent control of the synthesized primer extension product by at least one controller oligonucleotide upon completion of the primer extension reaction.
  • Primer extension and controller interaction with the synthesized primer extension product are two temporally separate reactions.
  • the primer extension reaction proceeds in the same reaction mixture in the presence of a corresponding controller oligonucleotide, the reactions are temporally separated by the choice of reaction conditions in individual reaction steps.
  • the presence of the feedback system in the same reaction as the primer extension reaction makes it possible to design a homogeneous assay.
  • the components of the feedback system into the same reaction approach as the primer extension reaction per se, ie simultaneous presence of both the components of the synthesis system and the feedback system, checking or influencing the primer extension reaction and the separation of the primer extension products of if necessary, the matrix can be made in very short time intervals. This allows the feedback system to respond very quickly to any deviations that may occur.
  • the simultaneous presence of the feedback system in the primer extension approach can lead to a repeated review, so that the result of the review can be summarized as the sum of multiple verification events.
  • the frequency of the verification can be determined both by the appropriate choice of reaction conditions (eg temperature, concentration of the feedback system components) and by the structures of feedback components (eg length and complementarity or extent of the use of modified nucleotides in the design of individual structures). to be influenced.
  • the feedback system should allow for correct-running reactions (in many cases more than 99% of primer extension strands of a primer extension reaction due to a high natural specificity of an enzymatic template-dependent reaction) and falsely synthesized primer extension products (less than 1% of all primer extension products ).
  • a feedback system can be helpful, for example, in trace analysis.
  • High sequence-dependent interaction of the primer extension product (P1-Ext) with the controller can be used to individually influence equilibria between individual intermediate complexes generated during the reaction. Since these complexes have different accessibility to certain sequence segments (single-stranded segments), many reactions can be affected during a running primer extension reaction. Possible intermediate complexes include e.g.
  • Primer extension product / probe thus, one can exert greater influence on the specificity in the overall process of primer extension as well as in dependent reactions.
  • the primer extension can take place as a single synthesis in one step or as a repeated reaction (linear amplification).
  • the primer extension reaction may be performed alone or in combination with an amplification method.
  • Sequence checking by the method according to the invention takes place beyond the primer length (about 5 to 50 nucleotides of the synthesized section) and thus differs from conventional primer extension reactions, in which essentially the primer sequence is responsible for the sequence-specific binding.
  • the improved specificity of the deletion of the synthesized strand can be advantageously used in several aspects in detection methods.
  • it may be used as an alternative detection method and / or component for genetic alterations such as single nucleotide polymorphisms.
  • the sequence-specifically synthesized strand of the primer extension product is the desired product of the primer extension reaction. It can be used in various methods of analyzing genetic information, for example in: o generating one or more copies from a longer nucleic acid chain, e.g. a genomic DNA or its segments, or an RNA or its equivalents such as cDNA or segments thereof. These copies can be used as starting nucleic acid chains in amplification methods, such as PCR or other amplification methods; or.
  • nucleic acid fragment e.g. an amplification fragment
  • the components and methods should, especially in the simultaneous presence of several, very similar variants of a template sequence, eg wild-type and one or more mutated sequences, support an improvement in the specificity of individual process steps.
  • the advantages of the method are particularly evident in the simultaneous presence of several, very similar variants of a template sequence, eg wild-type and one or more mutated sequences.
  • components for a homogeneous assay are to be provided which allow a simultaneous presence of components in a reaction (one-pot reaction or homogeneous assay).
  • primer extension reaction described here and the thereby generated primer extension products can serve as starting nucleic acids in an amplification process, for example.
  • such amplification occurs as an exponential amplification in which newly synthesized products of both primers (primer extension products) occur as templates for further synthetic steps.
  • This primer sequences are at least partially copied, so that complementary primer binding sites arise, which are present immediately after their synthesis as sequence segments of a double strand.
  • synthesis steps of both strands and double-stranded opening steps of the newly synthesized sequence segments are made in mutual alternation. Adequate duplex separation after synthesis is an important prerequisite for further synthesis. Overall, such a variety of synthetic and double-stranded separation steps can lead to exponential amplification.
  • controller oligonucleotide In the amplification process, the double-stranded opening of the main products of the amplification (amplification of nucleic acid chains comprising target sequence) takes place inter alia by means of an oligonucleotide, termed controller oligonucleotide.
  • the controller oligonucleotide comprises sequence segments corresponding to the target sequence.
  • strand separation is achieved by use of the controller oligonucleotide with predefined sequences which preferentially separate a newly synthesized double strand consisting of both specific primer extension products by means of a sequence-dependent nucleic acid-mediated strand displacement.
  • the resulting single-stranded segments of primer extension products comprise the target sequence, as well as corresponding primer binding sites, which can serve as binding sites for further primer oligonucleotides, such that exponential amplification of amplicons to be amplified
  • Nucleic acid chains is achieved.
  • the primer extension reactions and Strand displacement reactions preferably take place simultaneously in the batch.
  • the amplification is preferably carried out under reaction conditions which do not permit spontaneous separation of both specific synthesized primer extension products.
  • a specific exponential amplification of a nucleic acid sequence comprising a target sequence comprises a repetition of synthesis steps and double strand opening steps (activation steps for primer binding sites) as a mandatory prerequisite for the amplification of the nucleic acid chain.
  • the opening of synthesized duplexes is implemented as a reaction step which is to be sequence-specifically influenced by the controller oligonucleotide. This opening can be complete, even to dissociation of both complementary primer extension products, or even partial.
  • the controller oligonucleotide comprises sequence segments which can interact with the target sequence and further sequence segments which bring about this interaction or facilitate or favor it.
  • double-stranded sections of the synthesized primer extension products are converted into single-stranded form via sequence-specific strand displacement. This process is sequence dependent: only when the sequence of the synthesized duplex has some degree of complementarity with the corresponding sequence of the controller oligonucleotide will there be sufficient double-stranded opening such that the sequence portions essential to the continuation of the synthesis, e.g. Primer binding sites are converted into single-stranded form, which corresponds to an "active state".
  • the controller oligonucleotide thus "specifically" activates the newly synthesized primer extension products comprising the target sequence for further synthetic steps.
  • sequence segments which do not comprise a target sequence are not converted to the single-stranded state and remain as a double strand, which corresponds to an "inactive" state.
  • the potential primer binding sites in such a duplex are less favored or completely hindered in interaction with new primers, so that further synthetic steps on such "non-activated" strands generally do not occur.
  • This lack of or decreased activation (ie conversion to a single-stranded state) of synthesized nucleic acid strands after a synthesis step results in the fact that in the subsequent synthesis step only a reduced amount of primers can successfully participate in a primer extension reaction.
  • the reaction conditions eg temperature
  • the controller oligonucleotide facilitates this double-stranded separation as a result of matching its sequence segments with predetermined sequence segments Primer extension products.
  • Predominantly sequence-specific separation of the double strand with the assistance of a controller oligonucleotide can be combined in combination with sequence-specific or less sequence-specific primers.
  • the invention is particularly useful in primer extension reactions of sequence variants of a known locus of a target sequence.
  • a locus can comprise several occurring sequence variants of a target sequence and is thus a polymorphic locus (FIGS. 12-15).
  • a polymorphic locus includes, for example, single nucleotide polymorphisms.
  • a sequence variant of a locus of the target sequence components which play an essential role in the specificity of primer extension should be placed in a specific arrangement.
  • Particularly advantageous arrangements are those which comprise a known sequence variant of a locus, wherein a predominantly sequence-specific controller oligonucleotide and corresponding primers can be designed.
  • the position of an expected sequence variant in the known locus is thus taken into account in the design of components such that at least the controller oligonucleotide, better controller oligonucleotide in combination with at least one primer, has a specific sequence composition in a primer extension system is suitable for primer extension of a desired variant of the target sequence.
  • a primer extension system comprises at least one sequence-specific primer (eg allele-discriminating primer) in combination with one specific controller oligonucleotide (eg allele-specific controller oligonucleotide).
  • a specific combination of at least one specific primer and at least one specific controller oligonucleotide may be provided. This results in a specific amplification of one of the possible sequence variants of a target sequence.
  • a primer extension system comprises at least two, in particular four sequence-specific primers (eg allel-discriminating primers) in combination with in each case one specific controller oligonucleotide (eg allele-specific controller oligonucleotide). includes.
  • sequence-specific primers eg allel-discriminating primers
  • controller oligonucleotide eg allele-specific controller oligonucleotide.
  • a primer extension system at least one sequence-specific primer (eg allele-discriminating primer) in combination with a specific controller oligonucleotide (eg allele-specific controller oligonucleotide) and at least one further primer (a competitor primer) which has a complementary sequence composition to other expected sequence variants.
  • a specific combination of at least one specific primer and at least one specific controller oligonucleotide may be provided. This results in a specific primer extension of one of the possible sequence variants of a target sequence.
  • the object of the invention is further solved by analyzing both strands of a double-stranded nucleic acid chain, wherein in one reaction the components of a primer extension system are provided for a strand of a target nucleic acid, which is used as starting nucleic acid, and in a separate Approach is provided to components for the complementary strand of the target nucleic acid chain which is used as the starting nucleic acid.
  • a primer extension system in one reaction the components of a primer extension system are provided for a strand of a target nucleic acid, which is used as starting nucleic acid
  • a separate Approach is provided to components for the complementary strand of the target nucleic acid chain which is used as the starting nucleic acid.
  • a primer extension system comprises at least one primer which can support a primer extension of several potential sequence variants (eg a target sequence specific primer, but not an allelic discriminating primer, but a target sequence specific one allele -unspecific primer) in combination with each specific controller oligonucleotide (eg, allele-specific controller oligonucleotide).
  • a specific combination of at least one allele-unspecific primer and at least one Allele-specific controller oligonucleotide can be provided for each specific composition of a target sequence and its specific variants (eg, alleles). This results in a specific primer extension of one of the possible sequence variants of a target sequence.
  • the oligonucleotides required for a primer extension are summarized as a target sequence-specific primer extension system.
  • a parallel primer extension of more than one target sequence is to be made possible by using multiple target sequence-specific primer extension systems in a reaction approach, wherein preferably target sequence-specific components are combined in each case.
  • controller oligonucleotide thus allows a sequence-dependent review of the contents of the primer extension products after single synthesis steps or during primer extension and to bring about a selection of sequences for subsequent synthesis steps.
  • active single-stranded states of newly synthesized specific primer extension products may result as a result of successful interaction with a controller oligonucleotide
  • active double-stranded states of newly synthesized non-specific primer extension products as a result of deficient and / or insufficient and / or decreased and / or slowed interaction with a controller oligonucleotide.
  • oligonucleotide as used herein with reference to primer, controller oligonucleotide, probes and the nucleic acid chain to be amplified is defined as a molecule comprising two or more, more preferably more than three deoxyribonucleotides and / or ribonucleotides and / or nucleotide Modifications and / or non-nucleotide modifications.
  • its length encompasses ranges between 3 to 300 nucleotide units (where natural bases and analogues can be used together or alone), in particular between 5 to 200 nucleotide units.
  • One skilled in the art will be able to determine the exact size depending on the ultimate function or use of the oligonucleotides.
  • primer refers to an oligonucleotide, whether naturally occurring e.g. B. occurs in a purified restriction cleavage or was produced synthetically.
  • a primer is capable of acting as the initiation point of the synthesis when used under conditions which induce the synthesis of a primer extension product complementary to a nucleic acid strand, i. H. in the presence of nucleotides and an inducing agent, e.g. DNA polymerase at a suitable temperature and pH.
  • the primer is preferably single-stranded for maximum efficiency in primer extension.
  • the primer must be long enough to initiate synthesis of the extension product in the presence of the inducing agent.
  • the exact length of the primer will depend on many factors, including reaction temperature and primer source and application of the method. For example, the length of the oligonucleotide primer in diagnostic applications, depending on the complexity of the target sequence between 5 to 100 nucleotides, in particular 6 to 40 and especially 7 to 30 nucleotides. Short primer molecules generally require lower reaction temperatures to perform their primer function to form sufficiently stable complexes with the template, or higher concentrations of other reaction components, such as DNA polymerases, such that sufficient elongation of formed primer is achieved. Template complexes can be made.
  • the primers used herein are selected to be "substantially" complementary to the different strands of each specific sequence to be amplified. That is, the primers must be sufficiently complementary to hybridize with their respective strands and initiate a primer extension reaction. Thus, for example, the primer sequence does not need to reflect the exact sequence of the target sequence.
  • a non-complementary nucleotide fragment may be attached to the 5 'end of the primer, with the remainder of the primer sequence being complementary to the strand.
  • single non-complementary bases or longer non-complementary sequences may be inserted into a primer, provided that the primer sequence has a sufficiently large complementarity with the strand sequence to be amplified to hybridize therewith and thus form a primer template. Complex able to produce the synthesis of the extension product.
  • a primer extension product is generated, which is completely complementary to the template strand.
  • sequences refers to hybridizing sequences with reverse complementary base sequence.
  • Allele-specific primers are primers which are capable of their sequence composition, preferably under stringent reaction conditions on each individual sequence variants a target sequence to be hybridized and extended by a polymerase using the target sequence.
  • Single allele-specific primers can be grouped together to cover all variants of a common target sequence.
  • Such a group of allele-specific primers comprises at least two different allele-specific primers, as a polymorphic locus at a given position in the target sequence comprises at least two sequence variants.
  • the allele-specific primers are selected to bind under stringent reaction conditions, preferably with their respective perfect-match template, and thus use this specific perfect-match template to form the respective primer extension products under the catalytic action of the polymerase.
  • 3 ' -terminal segments of allele-specific primers can be used to discriminate variants of target sequences and are thus adapted in their sequence composition to the respective variants such that such primers form a perfect match double strand under stringent conditions with the respective variant.
  • Such perfect-match double strands can usually be recognized well by a polymerase and under suitable reaction conditions a primer extension occurs.
  • the interaction of an allele-specific primer with another variant of a target sequence thus results in a mismatch double strand.
  • mismatches usually lead to a delay in the extension by a polymerase or to a slowing of the overall reaction.
  • allele-specific primers in the 3 ' segment may include at least one phosphorothioate linkage that protects allele-specific primers from 3 ' -5 ' nuclease degradation by a polymerase.
  • multiple allele-specific primers include sequence segments which are substantially identical for a group of allele-specific primers, as well as sequence segments which are different among the primers of a group and characteristic of the respective sequence variant of a target sequence.
  • Including uniform sequence segments such primers can hybridize to the respective target sequence under reaction conditions.
  • Including characteristic sequence segments a respective primer can specifically bind to a sequence variant of the target sequence to form a perfect-match double strand.
  • the primers are designed so that, under used reaction conditions, binding to a target sequence to form a perfect match double strand is preferred and binding to a target sequence to form a mismatch duplex is less preferred.
  • the first primer oligonucleotide is provided as an allele-specific primer in combination with a corresponding allele-specific controller oligonucleotide.
  • the second primer oligonucleotide is provided as an allele-specific primer in combination with a corresponding allele-specific controller oligonucleotide.
  • the melting temperature of a complementary or partially complementary double strand is generally understood to mean a measured value of a reaction temperature at which approximately half of the strands are in the form of a double strand and the other half is in the form of a single strand.
  • the system association and dissociation of strands is in equilibrium.
  • the Tm of a nucleic acid to be amplified should be determined under the same conditions, like the intended primer extension reaction.
  • melting temperature is understood to mean a value which was measured in the same reaction buffer as the exponential amplification, at concentrations of both complementary components of a double strand of about 0.1 pmol / l to about 10 pmol / in particular in a concentration of about 0.3 pmol / to about 3 pmol / l, in particular about 1 pmol / l.
  • the respective value of the melting temperature is a guideline, which correlates with the stability of a respective double strand.
  • a melting temperature for a double strand can be roughly estimated.
  • Several commercial suppliers allow a theoretical calculation of an expected melting temperature.
  • OligoAnalyzer 3.1 available online from IDT (Integrated DNA Technologies) can be used to estimate the strength of the bonds of individual oligonucleotides.
  • dNTPs deoxyribonucleoside triphosphates
  • dATP deoxyribonucleoside triphosphates
  • dCTP deoxyribonucleoside triphosphates
  • dGTP deoxyribonucleoside triphosphates
  • TTP dUTP, or dUTP / TTP mixture
  • these dNTP analogs include, in certain embodiments, a characteristic label (eg, biotin or fluorescent dye) such that when incorporated into nucleic acid strand, this label is also integrated into the nucleic acid strand.
  • this at least one modification of the sugar-phosphate moiety of the nucleotide for example, alpha-phosphorothioate 2
  • alpha-phosphorothioate 2 include dNTP analogues '-Desoxyribonukleosid triphosphates (or other modifications which impart a nucleic acid strand a nuclease resistance), 2', 3 'dideoxy-ribonucleoside triphosphates, Azyklo nucleoside triphosphates (or other leading to the termination of a synthetic modifications).
  • these dNTP analogs include at least one modification of nucleobase, eg, iso-cytosines, iso-guanosines (or other modifications of extended-genetic alphabet nucleobases), 2-amino-adenosines, 2-thiouridines, inosines, 7-deazy aadenosines, 7-deaza-guanosines, 5-Me-cytosines, 5- Propyl uridines, 5-propyl cytosines (or other modifications of nucleobases that can be incorporated into natural nucleobases by a polymerase and result in alteration of strand stability).
  • nucleobase eg, iso-cytosines, iso-guanosines (or other modifications of extended-genetic alphabet nucleobases), 2-amino-adenosines, 2-thiouridines, inosines, 7-deazy aadenosines, 7-deaza-guanosines, 5-Me-cytosines, 5-
  • a dNTP analog comprises both a modification of the nucleobase and a modification of the sugar-phosphate moiety.
  • at least one other type of dNTP analogue is added to the synthesis mixture instead of at least one natural dNTP substrate.
  • the nucleic acid synthesis-inducing agent may be an enzyme or a system that functions to cause synthesis of the primer extension products.
  • Suitable enzymes for this purpose include e.g. template-dependent DNA polymerases such as Bst polymerase and its modifications, Vent polymerase and others - particularly heat-stable DNA polymerases that allow the incorporation of the nucleotides in the correct manner, thereby forming the primer extension products that are complementary to each nucleic acid strand synthesized.
  • the synthesis is initiated at the 3 'end of each primer and proceeds along the template strand until the synthesis is complete or interrupted.
  • polymerases which are capable of strand displacement. These include, for example, the large fragment of Bst polymerase or its modifications (e.g., Bst 2.0 DNA polymerase), Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, large fragment of Bsu DNA polymerase, large fragment of Bsm DNA polymerase.
  • polymerases which have no 5 ' -3 ' -Exonuklease activity, or have no 5 ' -3 ' -FFEN activity.
  • At least two different polymerases are used, for example, polymerases capable of strand displacement and those having 3 ' -5 ' reproducing activity.
  • polymerases are used with a hot-start function, which can only perform their function when a certain temperature is reached.
  • the primer oligonucleotide comprises a first primer region and a second region.
  • the first primer region is capable of binding to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified and initiating a primer extension reaction.
  • the second region comprises a polynucleotide tail which is capable of binding a controller oligonucleotide and thereby effecting spatial proximity between the controller oligonucleotide and the other portions of the first primer extension product sufficient to induce strand displacement through the controller oligonucleotide.
  • the second region of the first primer oligonucleotide further comprises at least one modification (a nucleotide modification or a non-nucleotide modification) which prevents the polymerase from copying the polynucleotide tail by inhibiting the continuation of the polymerase-dependent synthesis.
  • This modification is located, for example, at the junction between the first and the second region of the primer oligonucleotide.
  • the first primer region of the primer oligonucleotide is thus replicable by a polymerase so that a complementary sequence to this region can be generated during synthesis of the second primer extension product from the polymerase.
  • the polynucleotide tail of the second region of the primer oligonucleotide is preferably not copied by the polymerase.
  • this is achieved by the modification in the second region, which stops the polymerase from the polynucleotide tail. In certain embodiments, this is achieved by nucleotide modifications in the second region, where the entire polynucleotide tail consists essentially of such nucleotide modifications and thus is uncopatible to the polymerase.
  • each primer oligonucleotide is specific for each nucleic acid to be amplified.
  • each primer oligonucleotide is specific for at least two of the nucleic acids to be amplified, each comprising substantially different sequences.
  • the primer oligonucleotide is labeled with a characteristic marker, e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.
  • a characteristic marker e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.
  • At least a first primer oligonucleotide is provided as an allele-specific primer in combination with at least one corresponding allele-specific controller oligonucleotide.
  • a primer extension product results from enzymatic (polymerase-dependent) extension of a primer oligonucleotide as a result of template-dependent synthesis catalyzed by a polymerase.
  • a primer extension product comprises the sequence of the primer oligonucleotide in its 5 ' segment and the sequence of the extension product (also called extension product) which has been synthesized by a polymerase in a template-dependent form. That by the Polymerase synthesized extension product is complementary to the template strand on which it was synthesized.
  • a specific primer extension product (major product) comprises sequences of the nucleic acid chain to be amplified. It is the result of a specific synthesis or a correct execution of an intended primer extension reaction in which the nucleic acid chain to be specifically amplified serves as a template.
  • the length of the extension product of a specific primer extension may be between 10 and 300 nucleotides, in particular between 10 and 180 nucleotides, in particular between 20 and 120 nucleotides, in particular between 30 and 80 nucleotides.
  • a nonspecific primer extension product includes sequences that have arisen as a result of a nonspecific or improper primer extension reaction. These include, for example, primer extension products that have resulted as a result of a false initiation event (false priming) or as a result of other side reactions, including polymerase-dependent sequence changes such as base substitution, deletion, etc.
  • the level of sequence aberrations of nonspecific primer extension products generally exceeds the ability of controller oligonucleotides to successfully displace such double-stranded by-products from their templates so that amplification of such by-products is slower or completely absent.
  • the extent of acceptance or the tolerance limit for deviations depend, for example, on the reaction temperature and the manner of the sequence deviation.
  • examples of nonspecific primer extension products are primer dimers or sequence variants which do not correspond to the nucleic acid to be amplified, e.g. Sequences which do not comprise a target sequence.
  • the assessment of a sufficient specificity of the amplification is often related to the task. In many amplification methods, some degree of unspecificity of the amplification reaction can be tolerated as long as the desired result can be achieved.
  • the proportion of nucleic acid chains to be amplified in the overall result of the reaction is more than 1%, in particular more than 10%, in particular more than 30%, based on the total amount of newly synthesized strands.
  • the sequence of the synthesized primer extension products is completely consistent with the expected sequence of a nucleic acid to be amplified. In another embodiment, deviations in the sequence obtained may be tolerated by the theoretically expected sequence. In certain embodiments, the degree of agreement of the sequence obtained is due to a Amplification with the sequence of the theoretically expected nucleic acid to be amplified, for example, between 90% and 100%, in particular, the agreement is greater than 95%, in particular, the agreement is greater than 98% (measured on the proportion of synthesized bases).
  • the first primer extension product is formed from a first primer oligonucleotide.
  • a competitor primer extension product is formed starting from a competitor primer oligonucleotide ( Figures 21-23).
  • a primer extension product in certain embodiments, may serve as a start-up nucleic acid chain comprising a target nucleic acid-comprising sequence.
  • a target sequence is a segment of a nucleic acid chain to be amplified which can serve as a characteristic sequence of the nucleic acid to be amplified. This target sequence can serve as a marker for the presence or absence of another nucleic acid.
  • This other nucleic acid thus serves as the source of the target sequence and can be for example a genomic DNA or RNA or parts of the genomic DNA or RNA (eg mRNA), or equivalents of the genomic DNA or RNA of an organism (eg cDNA, modified RNA such as rRNA, tRNA, microRNA, etc.), or defined changes in the genomic DNA or RNA of an organism, for example mutations (eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability), splice variants, rearrangement variants (eg, T-Ze II receptor variants), etc.
  • mutations eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability
  • splice variants eg, rearrangement variants (eg, T-Ze II receptor variants), etc.
  • the individual target sequences may represent a phenotypic trait, such as antibiotic resistance or prognostic information, and thus be of interest for diagnostic assays / assays.
  • a source / origin of a target sequence such a nucleic acid may comprise, for example, the target sequence as a sequence element of its strand.
  • a target sequence can thus serve as a characteristic marker for a particular sequence content of another nucleic acid.
  • the target sequence can be single-stranded or double-stranded. It may be substantially identical to the nucleic acid to be amplified or may be only part of the nucleic acid to be amplified.
  • Equivalents of the target sequence include nucleic acids with substantially identical information content.
  • complementary strands of a target sequence have identical informational content and can be said to be equivalent;
  • RNA and DNA variants of a sequence are also examples of equivalent informational content.
  • such a target sequence can be isolated from its original sequence environment and prepared for the amplification reaction.
  • Particular embodiments of the target sequence are particularly preferred:
  • a nucleic acid to be amplified comprises a target sequence.
  • the target sequence corresponds to the nucleic acid to be amplified.
  • a start-up nucleic acid chain comprises a target sequence.
  • the target sequence corresponds to a starting nucleic acid chain.
  • the nucleic acid to be amplified represents a nucleic acid chain which is to be amplified sequence-specifically or at least predominantly sequence-specifically by means of the exponential amplification using primers and controller oligonucleotide by the polymerase.
  • the length of the nucleic acid to be amplified may be between 20 and 300 nucleotides, in particular between 30 and 200 nucleotides, in particular between 40 and 150 nucleotides, in particular between 50 and 100 nucleotides.
  • the nucleic acid sequence to be amplified may comprise one or more target sequences or their equivalents.
  • a nucleic acid to be amplified may comprise sequences substantially complementary to a target sequence which are propagated with similar efficiency as a target sequence in an amplification reaction and comprise the target sequence or its portions.
  • the nucleic acid to be amplified may include additional sequence segments, for example, primer sequences, sequences with primer binding sites and / or sequence segments for binding of detection probes, and / or sequence segments for sequence encoding of strands by barcode sequences and / or sequence segments for binding to a solid phase.
  • the primer sequences or their sequence portions, as well as primer binding sites or their sequence portions may for example belong to sequence sections of a target sequence.
  • the nucleic acid to be amplified corresponds to the target sequence.
  • the target sequence forms part of the sequence of the nucleic acid chain to be amplified.
  • a target sequence may be flanked by 3 ' side and / or 5 ' side of further sequences.
  • These further sequences may include, for example, binding sites for primers or their moieties, and / or comprising primer sequences or their moieties, and / or binding sites for detection probes, and / or adapter sequences for complementary binding to a solid phase (eg, Im Frame of microarrays, or bead-based analyzes) and / or include barcoding sequences for a digital signature of sequences.
  • a nucleic acid chain In order for the amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain.
  • This start nucleic acid chain gives the arrangement of individual Sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
  • the initial template which is initially added to an amplification reaction, or which is added to the reaction mixture, corresponds to the sequence composition of the nucleic acid sequence to be amplified.
  • the respective primers In initial stages of the amplification reaction, and in its progression, the respective primers bind to the corresponding binding sites in the starting nucleic acid chain and initiate the synthesis of specific primer extension products.
  • specific primer extension products accumulate exponentially in the course of amplification and increasingly assume the role of templates for the synthesis of complementary primer extension products in exponential amplification.
  • the nucleic acid chain to be amplified is thus formed.
  • the major product of the reaction (the nucleic acid to be amplified) may be predominantly single-stranded or predominantly a complementary duplex. This can be determined, for example, by the relative concentration of both primers and corresponding reaction conditions.
  • nucleic acid to be amplified include nucleic acids having substantially identical information content.
  • complementary strands of a nucleic acid to be amplified have identical information content and can be said to be equivalent.
  • a target sequence may comprise several naturally occurring sequence variants or artificially introduced sequence changes. Such variants are often called polymorphisms of a locus or allele sequences. Furthermore, these variants of a target sequence can map specific changes in the natural state of the DNA, which arise, for example, by mutations / mutagenesis and represent characteristic features of such a clonal propagation process (eg in cancer diseases or in biotechnologically exploitable strains).
  • Single allele sequences of a target sequence may be sequence differences comprising single nucleotides (eg A-> G or T-> C substitutions or single nucleotide insertions or deletions) or a sequence difference may also comprise several nucleotides (eg 2 up to 200 nucleotides). These may, for example, be deletions / insertions / transversions / duplications etc.
  • a sequence segment comprising such sequence variants of a target sequence is often called a polymorphic locus.
  • a target sequence may include one or more polymorphic loci.
  • sequence positions of single allelic variants of a target sequence are generally known and thus allow for design of sequence-specific reaction components, eg, controller oligonucleotides or combinations comprising a controller oligonucleotide and a first primer or a controller oligonucleotide and a second primer.
  • sequence-specific reaction components eg, controller oligonucleotides or combinations comprising a controller oligonucleotide and a first primer or a controller oligonucleotide and a second primer.
  • a target sequence which may include multiple sequence variants in a polymorphic locus, further comprises at least a first target sequence segment that is characteristic and unique to all target sequence variants of a target sequence (target sequence group).
  • a target sequence comprises at least two target sequence segments (a first target sequence segment and a second target sequence segment, each target sequence segment is characteristic and uniform to all target sequence variants of a target sequence (target sequence group).)
  • Such uniform target sequence segments are preferably located and flanked on both sides of a polymorphic locus thus, a polymorphic locus (with sequence variants) of a target sequence from both sides
  • the first unitary target sequence segment in its sequence composition is different from the sequence composition of the second unitary target sequence segment in at least one nucleotide position.
  • the length of a polymorphic locus of a target sequence may comprise regions of one nucleotide up to 200 nucleotides, in particular from one nucleotide up to 100 nucleotides, in particular from one nucleotide up to 50 nucleotides, in particular from one nucleotide up to 20 nucleotides.
  • the lengths of a unitary sequence segment may comprise at least for one of the two segments: from 6 to 300 nucleotides, in particular from 10 to 200 nucleotides, in particular from 15 to 100 nucleotides, in particular from 20 to 100 nucleotides ,
  • individual sequence variants of a target sequence group may be grouped together, such variants being defined for at least one unitary and specific sequence segment for that target sequence (target sequence group). Individual sequence variants of such a target sequence (target sequence group) thus differ by sequence segments of the polymorphic locus.
  • individual sequence variants of a target sequence group may be grouped together, such variants being defined for at least two unitary and specific sequence segments for that target sequence (target sequence group).
  • Individual sequence variants of such a target sequence (target sequence group) thus differ by sequence segments of the polymorphic locus.
  • the polymorphic locus is between both unitary sequence segments.
  • two different target sequences can each be specifically amplified in an amplification reaction.
  • Different target sequences are characterized in that they are preferably differentiable among each other by sequences specific and characteristic of each target sequence.
  • different target sequences are differentiable in their entire length by specific and characteristic sequences and thus do not comprise any sequence segments which are identical for both target sequences.
  • different target sequences may comprise at least one sequence segment that is substantially similar or even identical for at least two different target sequences.
  • the length of such a sequence segment is equal to or less than 19 nucleotides (counted as coupled nucleotide positions), more preferably equal to or less than 14 nucleotides (as mutually coupled nucleotide positions), more preferably equal to or less than 9 nucleotides (as mutually coupled nucleotide positions), in particular equal to or less than 5 nucleotides (as mutually coupled nucleotide positions).
  • the start-up nucleic acid chain is a preferred embodiment of a sequence segment comprising target nucleic acid which is said to result as a product of a primer extension reaction.
  • a nucleic acid chain In order for the amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain. This start nucleic acid chain predetermines the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
  • Such a starting nucleic acid chain can be present in single-stranded or double-stranded form at the beginning of the reaction.
  • the complementary strands of the starting nucleic acid chain are separated, regardless of whether the nucleic acid was originally double- or single-stranded, the strands can serve as a template for the synthesis of specific complementary primer extension products.
  • the starting nucleic acid chain in certain embodiments, comprises a target sequence or its partial segments which comprise at least one expected sequence variant of a polymorphic locus of the target sequence.
  • a start nucleic acid further comprises at least one predominantly single-stranded sequence segment to which at least one of the primers of the amplification system can bind predominantly complementary to its 3 ' segment, so that the polymerase used such a primer, when hybridized to the starting nucleic acid chain, may extend template-specific incorporation of dNTPs.
  • a starting nucleic acid sequence in certain embodiments comprises a target sequence or its partial segments comprising at least one expected sequence variant of a polymorphic locus of the target sequence and at least one uniform sequence segment of a target sequence.
  • a starting nucleic acid sequence in certain embodiments comprises a target sequence or its partial segments comprising at least one expected sequence variant of a polymorphic locus of the target sequence and at least two unitary sequence segments of a target sequence, wherein uniform sequence segments of a target sequence comprise the polymorphic locus with possible sequence variants Flank both sides.
  • Controller oligonucleotide / Controller
  • the controller oligonucleotide is a single-stranded nucleic acid chain that includes a predefined, substantially complementary sequence in a portion of the primer extension product that is specifically generated as part of the amplification of the nucleic acid to be amplified. This allows the controller oligonucleotide to bind substantially complementary to the primer oligonucleotide and at least to the 5 ' segment of the specific extension product of the primer oligonucleotide.
  • the controller oligonucleotide in its interior sequence segment comprises nucleotide modifications that prevent the polymerase from synthesizing a complementary strand using the controller oligonucleotide as a template when the primer oligonucleotide is complementarily bound to the controller oligonucleotide.
  • identical controllers are used in the primer extension reaction as in the subsequent acid reaction.
  • the primer extension reaction uses a controller that differs from that in the subsequent acid reaction.
  • the target sequence-specific controller oligonucleotide is preferably constructed such that it is capable of participating in amplification of preferably a defined specific sequence variant of a predefined target sequence.
  • the allele-specific controller oligonucleotide is preferably constructed such that it is capable of preferentially effecting the amplification of a specific sequence variant of a target sequence (eg, allele 1), with another sequence variant of the same target sequence (eg, allele 2) the amplification proceeds with reduced efficiency or does not take place in the given time, or results in a yield of amplification products which is insufficient for a detection.
  • a target sequence eg, allele 1
  • a target sequence eg, allele 2
  • the amplification proceeds with reduced efficiency or does not take place in the given time, or results in a yield of amplification products which is insufficient for a detection.
  • there are measurable differences in the course of an amplification reaction which depend on whether the sequence of an allele variant specific controller oligonucleotide with the sequence of a provided at the beginning of the reaction nucleic acid chain, which serves as a start nucleic acid and the target sequence a polymorphic locus, specifically coincident
  • An allele-specific controller oligonucleotide is thus not only provided target-specific, but also allele-specific. Thus, depending on the complexity of a polymorphic locus of a target sequence, multiple controller oligonucleotides specific for respective allelic variants of a target sequence can be constructed.
  • a controller oligonucleotide comprises at least one sequence segment having a sequence composition complementary to a specific allelic variant of a target sequence. Furthermore, a controller oligonucleotide preferably comprises at least one sequence segment which comprises a complementary sequence which is identical for all sequence variants of a target sequence. In certain embodiments, a controller oligonucleotide comprises at least one sequence segment capable of complementarily binding to a variant of a polymorphic locus of a target sequence.
  • multiple controller oligonucleotides are provided, each comprising allele-specific sequence segments.
  • the length of a sequence segment of a controller oligonucleotide complementary to the polymorphic locus of a starting nucleic acid nucleus can comprise regions of one nucleotide up to 100 nucleotides, in particular from one nucleotide up to 50 nucleotides, in particular from one nucleotide up to 20 nucleotides.
  • the length of at least one sequence segment of a controller oligonucleotide which is complementary to uniform sequence segments of a target sequence may comprise the following ranges: from 4 to 100 nucleotides, in particular from 6 to 100 nucleotides, in particular from 8 to 50 nucleotides.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the third region of the controller oligonucleotide.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the second region of the controller oligonucleotide.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence becomes is partially and / or completely localized in the second and third regions of the controller oligonucleotide.
  • base pairs under two nucleic acid strands can be carried out essentially complementary, which means that between 70% and 100%, in particular between 90% and 100%, in particular between 95% and 100% of nucleotides of a strand can complement each other in a complementary manner.
  • a nucleotide position in a strand of 20 nucleotides may not have a complementary bond, which corresponds to 95% complementarity.
  • the formation of complementary base pairings is preferably 100% between both strands of a duplex.
  • a perfect-match duplex thus does not include a mismatch between the strands.
  • controller oligonucleotide / primer system feedback system
  • primer-template system synthesis system
  • the controller oligonucleotides preferably do not serve as templates for primer extension.
  • the extension of corresponding primers to controller oligonucleotides is preferably prevented by a modification of controller strands.
  • the controller oligonucleotide is capable of binding to an overhang on the primer (the first region of the controller oligonucleotide preferably specifically binds to the second region of the corresponding primer) and is capable of complementary binding with the primer (the second region of the controller Oligonucleotide binds to the first region of the primer). Furthermore, the controller can bind with its third region to the synthesized portion of the primer extension product predominantly sequence-specific.
  • the primers used have a tail or overhang which can not form a stable duplex with the template (the primer overhang remains completely or partially free upon primer binding to the primer binding site of the template) and thus interacts with the first Area of the controller oligonucleotide is available.
  • This primer overhang serves as a binding site for each specific controller oligonucleotide strand (first region of the controller oligonucleotide). The controller oligonucleotide binds to this overhang and is thus brought into spatial proximity with the duplex.
  • the controller oligonucleotide can undergo double-stranded invasion to form a complementary double strand (this process is also referred to as branch migration or sequence-dependent strand displacement).
  • Strand invasion occurs to form a new double strand between a controller oligonucleotide and the corresponding strand of synthesized amplification fragments. Due to a strong sequence dependence of such a double strand formation, the opening of the synthesized double strands is highly dependent on the sequence match with the respective controller sequence.
  • the primers have a tail or overhang which is not copied by a polymerase. The polymerase is prevented from copying the overhang by appropriate primer modifications.
  • a primer extension system comprises at least one target sequence-specific controller oligonucleotide and at least one first primer oligonucleotide and at least one template-dependent polymerase capable of using a template comprising at least one characteristic target sequence or target sequence variant, Under suitable reaction conditions, to support a predominantly specific amplification of the nucleic acid chain to be amplified, whereby predominantly target sequence-specific first primer extension products are synthesized.
  • An allele-specific primer extension system comprises at least one allele-specific controller oligonucleotide and at least one first primer oligonucleotide (where primers may be target sequence specific and / or allelic specific), as well as at least one template-dependent polymerase which is in is able, using a template which comprises at least one target sequence variant, under suitable reaction conditions, to support a predominantly specific amplification of the target sequence variant (one allele) of the nucleic acid chain to be amplified, wherein predominantly specific first primer extension products are synthesized.
  • a primer extension system may comprise multiple allele-specific primer extension products, wherein each allele-specific primer extension system preferably copies at least one of the target sequence variants.
  • a suitable agent leads to a complete or partial separation of a first double strand (consisting for example of A1 and B1 strand) and for the simultaneous / parallel formation of a new second double strand, wherein at least one of the strands ( A1 or B1) are involved in the formation of this new second strand.
  • the formation of a new second duplex may be accomplished using an already existing complementary strand which is generally in single-stranded form at the beginning of the reaction.
  • the means of strand displacement for example, a preformed single-stranded strand C1, which has a complementary sequence to the strand A1 acts on the first already formed double strand (A1 and B1) and goes with the strand A1 a complementary Binding, whereby the strand B1 is displaced from the bond with the strand A1.
  • the displacement of B1 is complete, the result of the C1 action is a new duplex (A1: C1) and a single-stranded strand B1.
  • the displacement of B1 is incomplete, the result depends on several factors. For example, a complex of partially double-stranded A1: B1 and A1: C1 may be present as an intermediate.
  • the formation of a new second duplex may occur under concurrent enzymatic synthesis of the complementary strand, with one strand of the first preformed duplex appearing as a template for synthesis by the polymerase.
  • the means of strand displacement acts on the first already preformed double strand (A1 and B1) and synthesizes a new strand D1 complementary strand D1, wherein at the same time the strand B1 from the bond with the strand A1 is displaced.
  • nucleic acid mediated strand displacement is meant a sum / series of intermediate steps which can be in equilibrium with one another and, as a result, the temporary or permanent opening of a first preformed duplex (consisting of complementary strands A1 and B1) and a new second one Duplex (consisting of complementary strands A1 and C1) lead, where A1 and C1 are complementary to each other.
  • an essential structural prerequisite for the initiation of strand displacement is the creation of a spatial proximity between a duplex end (preformed first duplex of A1 and B1) and a single stranded strand (C1) which initiates strand displacement (where A1 and C1 can form a complementary strand).
  • Such spatial proximity can preferably be achieved by means of a single-stranded overhang (in the literature examples are known with short overhangs, which binds the single-stranded strand (C1) temporarily or permanently complementary, and thus complementary segments of the Stranges C1 and A1 in sufficiently close, so that a successful strand displacement of the strand B1 can be initiated.
  • the efficiency of initiation of nucleic acid-mediated strand displacement is generally greater the closer the complementary segments of strand A1 and C1 are positioned to each other.
  • nucleic acid-mediated strand displacement Another essential structural prerequisite for the efficient continuation of nucleic acid-mediated strand displacement in internal segments is the high complementarity between strands (eg, between A1 and C1), which must form a new double strand.
  • strands eg, between A1 and C1
  • single nucleotide mutations in C1 can lead to disruption of strand displacement (described, for example, for branch migration).
  • the present invention makes use of the ability of complementary nucleic acids to sequence-dependent nucleic acid-mediated strand displacement.
  • the technical problem of this embodiment is the synthesis of a primer extension product and subsequent separation of the primer extension product from its template.
  • the separation of the primer extension product takes place with the assistance of a controller oligonucleotide and is thus preferably sequence-specific.
  • the synthesis of the primer extension product and the checking by means of a controller oligonucleotide preferably takes place in the same batch (homogeneous assay), the individual reactions are temporally separated.
  • the synthesis of the P1-Ext (synthesis phase) takes place (FIG. 3) and then the double strand is opened by means of a controller (controlling phase) (FIG. 4).
  • the two phases can be used for example by changing the reaction temperature of the reaction mixture in a desired sequence (in a homogeneous assay) or by sequential addition as a heterogeneous format.
  • a primer extension catalyzing agent a polymrease
  • suitable substrates require the use of a modified controller such that the first primer, when hybridized to the controller oligonucleotide, is not is extended by a polymerase.
  • a preferred form is described with a homogeneous format in which at least one template strand, at least one controller oligonucleotide, at least one primer oligonucleotide, at least one polymerase and dNTPs are present as substrates in a suitable buffer system at the beginning of the reaction.
  • the goal of the synthesis phase is to synthesize a specific primer extension product by means of a polymerase-mediated synthesis using a suitable template strand.
  • a primer extension reaction comprises a preferably specific primer binding
  • Binding site (sequence segment capable of being predominantly complementary to the first Area of the primer oligonucleotide), wherein the second area of the primer (primer overhang) preferably does not bind to the template strand, and thus is available for later interaction with the controller.
  • the primer binding site can be completely single-stranded or partially single-stranded, so that at least a portion of the first region of the primer can bind sequence-specifically to the primer binding site via complementary base pairs (Watson-Crick rule).
  • the polymerase can now extend the bound to the primer binding site primer oligonucleotides in a template-dependent synthesis of complementary Anküpfung nucleotides into the growing strand of the primer (3 'end-OH), thereby creating a template strand complementary to the primer extension product (P1 ext).
  • the synthesis of the complementary strand usually takes place under suitable reaction conditions until the polymerase finds enough substrate in the batch and sufficient sequence segments in the template strand are available in suitable form for the polymerase as template.
  • the polymerase may be one of the conditions of the sequence segments that the template strand is single-stranded (using polymerases without strand displacement properties) or even partially or even completely double-stranded (using polymerases with strand displacement properties).
  • the synthesis is often carried out over the sufficient time, so that from more than 5%, in particular more than 50%, in particular more than 90% of the template strands a primer extension product can be synthesized.
  • the primer extension product (P1-ext) is present in complex with the template strand in double-stranded form (P1-Ext / template strand complex).
  • This double-stranded complex comprising P1 -ext and template strand is preferably stable under selected reaction conditions of the primer extension phase and can not spontaneously dissociate into its constituents, or this spontaneous dissociation occurs very slowly and can thereby be neglected.
  • primer binding occurs under reaction conditions that allow thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template.
  • reaction conditions are for example at reaction temperatures which are well below the melting temperature (Tm) of such a complex (P1 / template strand).
  • Tm melting temperature
  • the Tm should have been measured under the same buffer conditions.
  • the reaction temperatures may range from Tm minus 50 ° C to Tm minus 5 ° C.
  • the complex comprising primer / controller oligonucleotide is also in double-stranded form under such reaction conditions.
  • primer oligonucleotide and controller oligonucleotide both in the first primer region and in the second Primer region (overhang / primer tail) interact, the bond between the first primer and the controller is usually more stable than between the first primer region and the template.
  • the primer should be in excess so that enough primer in single-stranded form remains in the reaction and can react with the primer binding site of the template strand so that a primer extension reaction can take place.
  • the concentration of a controller oligonucleotide is about 1 pmol / l
  • the concentration of the first primer can be about 1, 1 to 5 pmol / l.
  • the primer saturates the controller.
  • the controller oligonucleotide is thus preferably present in the complex comprising primer / controller oligonucleotide during the synthesis phase, thereby being in an inert form.
  • the controller does not interfere with the synthesis process.
  • the first and second regions of the controller oligonucleotide are occupied by the primer oligonucleotide (corresponding to the first and second regions thereof) through the formation of a complementary strand and thus are not responsible for interactions with formed primer extension products during the synthesis phase available.
  • the primer binding takes place under reaction conditions which do not permit thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template.
  • reaction conditions which do not permit thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template.
  • binding events complexes are formed which comprise the first region of the primer and the corresponding primer binding positions of the template.
  • dissociation events these complexes separate into individual components, so that no primer extension reaction can start by means of polymerase.
  • Such conditions are present, for example, at reaction temperatures which are about the melting temperature (Tm) of such a complex (P1 / template strand).
  • Tm melting temperature
  • the reaction temperatures may be in the range of Tm -5 ° C to Tm + 5 ° C, in particular embodiments in the range of Tm -5 ° C to about Tm +15 ° C, in another particular embodiment in the range of Tm -5 ° C to Tm +30 ° C.
  • extension of the primer by a polymerase can be done with sufficient complementarity of the 3 ' segment of the primer with the template.
  • the reaction can be slower or significantly slower compared to reaction conditions where stable primer binding occurs.
  • reaction temperatures above Tm + 30 ° C (P1 / template) the primer extension reaction is usually so inefficient that such conditions are rarely used in primer extension reactions.
  • the structure of the first primers and the controller oligonucleotides, as well as the reaction conditions of the synthesis phase are chosen such that the double-stranded complex comprising primer / controller oligonucleotide is present predominantly in double-stranded form.
  • the controller oligonucleotide may thereby be saturated and thus preferably excluded from interactions with formed primer extension products. Since primer oligonucleotide and controller oligonucleotide interact both in the first primer region and in the second primer region (overhang / primer tail), the bond between the primer and the controller is generally more stable than between the first primer Area and the matrix.
  • the melting temperature (Tm) of the complex comprising primer / controller oligonucleotide is generally higher than that of the complexes comprising primer / template.
  • thermostable polymerases such as Taq polymerase / Pfu polymerases and thermolabile (such as Klenow polymerase fragment or MMLV reverse transcriptase) or mesophilic polymerases (eg Bst polymerase) can be used.
  • the polymerases may comprise both a 3 'exonuclease activity (proofreading polymerases) or not.
  • DNA-dependent polymerases or RNA-dependent polymerases can be used.
  • Both polymerase can be used with (e.g., Bst polymerase and its modification such as Bst Large fragment) or without strand displacement properties (such as Taq polymerase or Pfu polymerase or MMLV reverse transcriptase).
  • Bst polymerase and its modification such as Bst Large fragment
  • strand displacement properties such as Taq polymerase or Pfu polymerase or MMLV reverse transcriptase
  • the template strand comprises a primer binding site such that under selected reaction conditions binding of the first region of the first primer can occur and polymerase mediated synthesis of the strand can occur.
  • a template strand comprises a target sequence.
  • This target sequence usually comprises the sequence segment of the template strand, which performs the template function for the synthesis of the complementary strand.
  • the template strand and the primer oligonucleotide are adapted in their design to each other such that the second region of the primer oligonucleotide does not bind to the template strand complementarily, or at least do not form stable complementary binding, and thus potentially capable of joining with the first region of the controller oligonucleotide.
  • both DNA and RNA can occur as template strands.
  • the primer binding site of the template is preferably in a single-stranded form and allows for site-specific binding of the first region of the primer oligonucleotide to the template.
  • the target sequence of the template strand comprises at least one segment of the primer binding site so that the 3 ' segment of the first primer can bind complementary to the target sequence.
  • the segment of the template strand which serves as a template for the synthesis of the complementary strand by the polymerase may, in certain embodiments, be wholly or predominantly (more than 50%) single-stranded under reaction conditions. In another embodiment, this segment is predominant (greater than 50%) or fully double-stranded.
  • the polymerases used in the synthesis must be selected accordingly: in the case of single-stranded matrices, polymerases without strand displacement can be used, e.g. Taq polymerase or Pfu polymerase.
  • polymerases having strand-displacing properties e.g. Bst polymerase Large Fragment or Vent polymerase or Klenow fragment.
  • Combinations of several polymerases may also be used, e.g. Taq polymerase and Vent polymerase or Taq polymerase and Bst polymerase, or Pfu polymerase and Bst polymerase.
  • Taq polymerase and Vent polymerase or Taq polymerase and Bst polymerase
  • Pfu polymerase and Bst polymerase e.g. Taq polymerase and Vent polymerase
  • Taq polymerase and Bst polymerase e.g., Taq polymerase and Bst polymerase
  • Pfu polymerase and Bst polymerase e.g., Pfu polymerase and Bst polymerase.
  • their selection depends on the specifications of the manufacturer. Both naturally occurring polymerases and their partial components (e.g., Klenow fragment or Bst polymerase Large Fragment) or modifications, e.g. Bst-2.0 polymerase or AmpliTaq polymerase).
  • the primer binding site may be for the primer in the 3 ' segment of the template.
  • the primer oligonucleotide comprises a modification (called the first blocking moiety) which prevents the polymerase from copying the second primer region.
  • the template in its 3 ' segment can go well beyond the primer binding site of the primer.
  • the length of such an overhang can range from a few nucleotides to several kilobases.
  • the structure of such a template strand causes the primer overhang, starting from the 3 ' end of the template, not to be copied by the polymerase. Therefore, in such an embodiment, the primer need not necessarily comprise a block group (called the first blocking unit) in the second region of the primer. The second region can thus directly transition into the first region and be linked to the 5 ' end of the first region via the 5 ' - 3 ' -phosphate link.
  • the synthesis of the primer extension product via polymerase as a template-dependent synthesis.
  • the length of the primer extension product is preferably limited by the availability of a sequence segment of the template which can be used by the polymerase for synthesis. This can be achieved, for example, by limiting the template strand in the 5 ' sequence segment, which is available as a template for the complementary synthesis. This limitation prevents the polymerase used from continuing to continue the synthesis beyond this obstacle.
  • strand termination strand termination
  • one or more modifications in the strand eg spacer or linker or abasic bound phosphate residues
  • nucleotide modifications eg nucleobase modification as Iso-C and Iso-G, or the sugar-phosphate moieties such as 2 '-0-Me, 2' MOE, morpholino, PNA etc.
  • the synthesis of the polymerase can be stopped or stopped by using additional oligonucleotides on predetermined sequence segments.
  • the progress of the synthesis of the primer extension product is limited by using at least one so-called block oligonucleotide ( Figures 3,4, 6-8). Under the reaction conditions of the synthesis phase, such a block oligonucleotide may preferably remain predominantly sequence-specifically hybridized to the template strand via complementary binding.
  • Such a block oligonucleotide when complementarily attached to the template strand, prevents the polymerase from reading the template strand in the sequence portion bound by that oligonucleotide and, correspondingly, beyond.
  • different embodiments of block oligonucleotides can be used. The selection of the oligonucleotide structure, the polymerase and the reaction conditions are based on the fact that the progressive synthesis is prevented or blocked by polymerase.
  • the length of the block oligonucleotide and the nature of the Sequence composition is directed to the fact that the block oligonucleotide must remain stably bound to its complementary position of a template strand under reaction conditions of the synthesis phase and preferably can not spontaneously dissociate from the template.
  • Such oligonucleotide is usually brought in 3 ' direction from the first primer oligonucleotide in effective concentrations in contact with the template strand prior to the start of a synthesis phase of a primer extension reaction and incubated for sufficient time at appropriate reaction conditions so that it can be bound to its can bind complementary position in the strand.
  • oligonucleotides with exonuclease-resistant modifications e.g.
  • PTO Phosphorothioate
  • 2 '-0-Me modifications which primarily in the 5' segment of the oligonucleotide are positioned lead
  • oligonucleotides complementary to the template can prevent Taq polymerase from cloning this oligonucleotide via 5 ' - '. 3-exonuclease-dependent degradation to cleave or detach from the template.
  • Such a nucleotide is usually capable of preventing a Taq polymerase from reading the template strand segment bound by the block oligonucleotide.
  • Oligonucleotides having multiple double-strand stabilizing modifications typically results in the polymerase being unable to continue synthesis via the oligonucleotide binding site.
  • LNA or PNA double-strand stabilizing modifications
  • template-complementary oligonucleotides of about 15-50 nucleotides in length with about 7-30 LNA modifications can prevent Bst polymerase (large fragment) from detaching this oligonucleotide via polymerase-dependent strand displacement from the template.
  • Bst polymerase large fragment
  • block oligonucleotides are known.
  • PNA modifications or LNA modifications have been used in clamp-PCR methods to block polymerase synthesis.
  • the length of the P1-text generated during the template-dependent synthesis and the length of the matching controller oligonucleotide can be chosen differently.
  • the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the Controller oligonucleotide covers the complete synthesized by the polymerase area.
  • a controller oligonucleotide can completely detach the P1 -ext from the template. In the 3 ' segment of the P1 -ex, no free nucleotides remain for interaction with the template during the controlling phase (see below).
  • the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide.
  • the 3 ' segment of the primer extension product thus comprises a sequence segment which is not checked by the controller oligonucleotide.
  • This double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, for example due to a temperature-induced strand opening (eg at temperatures of about 50-80 ° C).
  • the length of this 3 ' segment of the primer extension product may comprise, for example, sequence lengths which lie in the following ranges: from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides, from 50 to 70 nucleotides, from 70 to 100 nucleotides.
  • the synthesized primer extension product is now to be detached from the template by means of controller oligonucleotide and thus made available for further steps.
  • the aim of the controlling phase is to check the synthesized primer extension product for its agreement with the given sequence.
  • the sequence dependency of the double strand formation from primer extension product and controller oligonucleotide serves to check the synthesis quality during the primer extension reaction.
  • the primer extension product is completely or partially detached from the template sequence-dependently.
  • a formation of a double strand comprising primer extension product / controller oligonucleotide takes place at the same time.
  • the primer extension product / controller strand (P1-Ext / Controller) complex is a prerequisite for opening the double strand (template / primer extension fragment) after primer extension.
  • Sequence control is in this embodiment only after the synthesis of the primer extension product in a separate reaction step (controlling phase).
  • the controller oligonucleotide is to form a double strand with the now synthesized in the synthesis phase P1 -Ext.
  • controller oligonucleotide is already in the reaction mixture at the beginning of the synthesis reaction. Due to an excess of the primer oligonucleotide, the controller oligonucleotide is present as a complex comprising primer / controller.
  • the temperature of the reaction mixture can be increased so that the primer / controller complexes become thermodynamically unstable.
  • the reaction temperature should, however, be chosen so that the fully double-stranded complexes of primer extension product and template strand do not spontaneously disintegrate.
  • the controller oligonucleotides are released from complexes (primers / controllers) and are in equilibrium with the regeneration of these complexes (e.g., at temperatures around the Tm of the primer / controller complexes ⁇ 3 to 8 ° C).
  • the controller oligonucleotides which are now freely available, can interact with complexes of primer extension products and template strands in the second primer region (primer overhang). The interaction starts from the primer overhang. This establishes spatial proximity between the controller strand and the end of the double-stranded region between primer extension product / template strand. As a result, the double-stranded formation can be transferred between the controller and the first primer region (sequence-dependent strand displacement). Given the sequence identity with the synthesized portion of the primer extension product, the double strand formation between the controller oligonucleotide and the primer extension product continues to expand.
  • the progression of this interaction between the synthesized primer extension product and the controller oligonucleotide results in increasing release of the template strand from the complex with the primer extension product.
  • dissociation of the template complex and primer extension product occurs.
  • a new complex is thereby formed which comprises the primer extension product and the controller oligonucleotide.
  • a 3 ' segment of the primer extension product remains in binding with the template strand even though the controller oligonucleotide has completely bound to the primer extension product.
  • the dissociation of this complex depends on the reaction conditions chosen during the controlling phase (see below).
  • the successful interaction of components in the interaction of the controller oligonucleotide with the synthesized primer extension product and the spontaneous dissociation of the complex from the 3 ' segment of the P1 -ext and the template can be used to detach the primer extension product (in the complex of P1- Ext and COntrolelr strand) from the matrix. Discriminating effect of the controller oligonucleotide:
  • the template oligonucleotide can be completely or partially detached from the template strand by binding with the primer extension product (displacement by template). Such displacement may be accomplished completely in certain embodiments. This can be done, for example, if under the reaction conditions used in the controlling phase the stability of the complex from the second region of the primer and the first region of the controller oligonucleotide is not sufficiently high and this complex can spontaneously dissociate into its subcomponents. Thus, the template strand acts against the controller oligonucleotide.
  • Variations in the sequence of a primer extension product may be due to several causes, for example, the presence of multiple template strands with the same or similar primer binding sites and sequence variants at one or more positions in the segment of the template strand, e.g. in the presence of a polymorphic locus in the target sequence segment.
  • Another cause of deviations may be, for example, synthesis errors / incorporation errors introduced by polymerases.
  • primer extension products In the event of sequence deviations in the primer extension products from the template by the sequence composition of the controller oligonucleotide, such primer extension products preferably remain in double-stranded complexes with the template during the controlling phase.
  • double-stranded complexes comprising a template strand and a primer extension product (which could not be detached from the controller) can not be an active form for further analysis steps.
  • differentiation can be made between primer extension products: primer extension products detached from the template represent an active form of primer extension products.
  • Primer extension products in complex with their template are preferably an inactive form.
  • the use of a primer extension product in further reactions may require that certain portions of the P1-Ext be in single-stranded form. This may be necessary, for example, for binding a primer or a probe.
  • This embodiment can therefore be used, for example, to convert the sequences in the 3 ' segment of the P1-E 1 in a single-stranded state.
  • the primer extension product is only detached from the template if the synthesis is carried out correctly or only if it matches the complementarity with the controller oligonucleotide. In the case of deviations in the sequence, the primer extension product remains in complex with the template and the sequences in the 3 ' segment of the P1-Ext can not be converted into the single-stranded state (under used conditions).
  • controller oligonucleotide after a primer extension reaction (synthesis phase) can be used for several technical tasks.
  • the availability of controller oligonucleotide in the approach allows both a low-contamination integration in other methods of molecular analysis as well as a combination with other methods, such as amplification or detection methods.
  • Some embodiments are therefore to be presented in more detail.
  • a fully complementary primer extension product attached to a controller can be partially or fully protected from nuclease exposure if the nature of the controller string has been selected appropriately.
  • nuclease resistant modifications to certain sequence segments of the third region of the Contollers or continuously over the whole third area of the controller such as PTO or 2 '-0-alkyl modifications
  • the remaining primer extension products bound to the template strand can be selectively enzymatically cleaved by the action of a nuclease (e.g., restriction endonuclease or exonuclease).
  • a nuclease e.g., restriction endonuclease or exonuclease
  • a controller may further comprise an affinity tag, eg, a biotin residue (for example, covalently coupled to the 3 ' end or 5 ' end).
  • an affinity tag eg, a biotin residue (for example, covalently coupled to the 3 ' end or 5 ' end).
  • a primer extension product attached to the controller can be isolated by using a solid phase coated, for example, with streptavidin.
  • the embodiment is based on the sequence-specific detachment / separation of the primer extension product from its template strand in the simultaneous presence of several different primer extension products in the same reaction mixture.
  • template strands :
  • multiple template strands (at least two) with a substantially similar primer binding site are used, but differ in the sequence of the template segment sequence.
  • the differences between template strands are preferably in the 3 ' direction from the 3 ' end of the primer.
  • the differences may include, for example, single nucleotide variations (eg, SNVs: substitutions, deletions, insertions), or insertions, deletions, duplications, inversions of multi-nucleotide sequence segments (eg, 2 to 200 nucleotides).
  • a template strand comprises a target sequence comprising at least one polymorphic locus and further comprising at least one sequence segment which is uniform for all sequence variants of a target sequence.
  • the primer binding site may be, for example, in the unitary sequence segment.
  • the polymorphic locus is thus in the 3 ' direction from the 3 ' primer end.
  • a single primer oligonucleotide is used which is capable of predominantly complementary binding to uniform primer binding sites of all template strands present in the anneal and initiating initiation of a synthetic reaction by a polymerase.
  • At least one controller oligonucleotide constructed in its third region is used so that it is capable of binding to only a certain variant of the sequence of a possible primer extension product complementarily in the synthesized region of the primer extension product. If multiple controller oligonucleotides are used, each controller oligonucleotide is constructed sequence-specifically to a particular variant of the sequence.
  • primer binding (through the first region of the primer oligonucleotide) can occur substantially without discrimination of single template strands.
  • the polymerase is able to initiate synthesis of such bound primers and synthesizes complementary strands on the basis of the respective template strand. This results in primer extension products which are substantially complementary to the respective template strand and thus each comprise complementary segments to individual sequence variants of the template strands. During synthesis, the polymerase can not distinguish between these sequence differences of the template strands.
  • the controller oligonucleotide is in double-stranded form in the primer / controller complex during the synthesis phase and does not interfere with the synthesis process.
  • release of the controller oligonucleotide from the double-stranded complex primer / controller e.g. by raising the temperature (at a temperature at which the primer / controller complexes are at least partially dissociated, but complexes comprising primer extension products / template strands are substantially stable).
  • the controller oligonucleotide which is now at least partially in single-stranded form, can interact through its first region with the second region of the primer, thus initiating strand displacement.
  • the progress of the formation of the double strand between the first primer extension product and the controller oligonucleotide depends on the correspondence of the sequences of the third region of the controller oligonucleotide and the synthesized portion of the respective primer extension products.
  • the second area of the controller is fully complementary to the first area of the first primer.
  • the synthesis products differ depending on the template strand used. These differences can range from differences in only one nucleobase to completely different sequence composition of the primer extension product. Due to these differences in primer extension products, the outcome of the controlling phase is different. Predominantly, primer extension products with a sufficient degree of complementarity with the third region of the controller are replaced by their template strand. Thus, a differentiation between synthesized primer extension products takes place in the controlling phase:
  • the controller oligonucleotides preferably form double-stranded complexes with complementary primer extension products. In case of a sequence deviation, this double-stranded formation takes place only insufficiently.
  • primer extension products with sequence differences to the controller strands remain predominantly attached to their template strands.
  • the now completely or partially detached primer extension product can be used in further analyzes. For example, it can be isolated from the reaction mixture (in bound form to the controller oligonucleotide). Furthermore, it can be used as a binding partner for other oligonucleotides, eg probes. Furthermore, it may even occur as a template strand, for example, after binding of a new primer in the 3 ' segment of the primer extension product.
  • the embodiment is based on the sequence-specific detachment / separation of the primer extension product from its template strand in the simultaneous presence of several different primer extension products in the same reaction mixture.
  • multiple template strands are used with a primer binding site, with the primer binding site being different for individual templates.
  • the differences between template strands are preferably in a position which preferentially interacts with the 3 ' segment of the primer (e.g., positions 0, -1, -2, -3, -4, -5).
  • the differences may include, for example, single nucleotide variations (eg, SNVs: substitutions, deletions, insertions), or insertions, deletions, duplications, or inversions of sequence segments of several nucleotides (eg, 2 to 10 nucleotides).
  • first primer oligonucleotides In the primer extension reaction, several first primer oligonucleotides (more than two) are used.
  • the respective first primer oligonucleotides are constructed in their 3 ' segment of the first primer region such that each primer oligonucleotide used comprises a specific sequence complementary to a particular sequence variant of the candidate template strands (eg, allele-specific primers).
  • Such first primers are capable of predominantly complementary binding to their specific primer binding sites of the respective template strands and to initiate initiation of a synthetic reaction by a polymerase.
  • the first primer oligonucleotides may comprise uniform or different second regions (primer overhang, oligonucleotide tail).
  • the composition of the respectively specific controller oligonucleotides in the respective first region is adapted so that a specific pairing of an allele-specific first primer and a corresponding controller is possible and each controller in such a pair comprises a specific base sequence in the first region of the controller and each first primer oligonucleotide in such a pair has a correspondingly complementary sequence in the second region.
  • the primer oligonucleotides can interact with controller oligonucleotides predominantly specifically during the controlling phase.
  • At least one other primer which is not a first primer oligonucleotide can be used.
  • a primer will be competitor primer Called oligonucleotide. It is capable of complementarily binding at least one sequence variant of a polymorphic locus of a target sequence and thereby forming a perfect match duplex, this sequence variant preferably being a sequence which is at least at one point with the first primer oligonucleotide Mismatch can form.
  • each competitor primer oligonucleotide used comprises a specific sequence complementary to a particular sequence variant of the candidate template strands (eg, allele-specific primers).
  • Such competitor primers are able to predominantly complementarily bind to their specific primer binding sites of the respective template strands and to initiate initiation of a synthetic reaction by a polymerase.
  • competitor primers are also allele-specific primers which can not interact with the first region of the specific controller oligonucleotide and thus can not initiate strand separation.
  • Competitor primers are said to substantially compete for binding to the primer binding site of the template strand with the first primer oligonucleotide and to be extended upon complementary binding to its complementary variant template strand from a polymerase, thereby forming a competitor primer extension product arises.
  • the choice of the sequence of a competitor primer oligonucleotide depends primarily on the requirement to specifically exclude a specific sequence variant of a polymorphic locus from interaction with the first primer oligonucleotide and thus the non-specific interaction between a specific first primer oligonucleotide and a to prevent or minimize in the sequence deviating primer binding site of another sequence variant.
  • a competitor primer oligonucleotide preferably does not comprise a sequence segment moiety which can interact with the controller oligonucleotide specific for the first primer oligonucleotide.
  • At least one controller oligonucleotide constructed in its second region such that it is capable of having only one particular variant of the sequence of a sequence variant-specific first primer oligonucleotide, and thus only one particular variant of the invention, is used Sequence of a possible first primer extension product to bind complementarily in the first region of the primer extension product. If multiple controllers are used, each controller oligonucleotide is constructed sequence-specifically for a particular variant of the sequence. Multiple controller oligonucleotides may be used, which further differ in that they have in their first region a specific sequence which is capable of binding predominantly to the specific first primer oligonucleotide.
  • Both partners each have specific sequence sections for this pair in the first primer region and in the second primer region, as well as correspondingly in the first and in the second region of the controller oligonucleotide.
  • primer binding (through the first region of the first primer oligonucleotide) can occur substantially / preferably, discriminating the individual sequence variants of template strands.
  • suitable reaction conditions are preferably used (so-called stringent reaction conditions).
  • the polymerase is able to start synthesis from such correctly complementarily bound primers and synthesizes complementary strands on the basis of the respective template strand. This results in primer extension products which are substantially complementary to the respective template strand.
  • the polymerase can not distinguish between these differences in template strands.
  • the controller oligonucleotide is in double-stranded form in the primer / controller complex during the synthesis phase and does not interfere with the synthesis process.
  • a competitor-primer bond and extension are additionally carried out in the synthesis phase:
  • the competitor-primer binding may take place substantially / preferably with discrimination of the individual sequence variants of template strands.
  • suitable reaction conditions are preferably used (so-called stringent reaction conditions).
  • the polymerase is able to start a synthesis of such correctly complementarily bound competitor primers and synthesizes each complementary strands based on the respective template strand. This results in competitor primer extension products which are substantially complementary to the respective template strand. During synthesis, the polymerase can not distinguish between these differences in template strands.
  • the release of the controller oligonucleotide from the double-stranded complex primer / controller occurs, eg by increasing the temperature (at a temperature at which the primer / controller complexes are at least partially dissociated, but stable complexes comprising primers). Extension products / template strands are present).
  • the controller oligonucleotide which is now at least partially in single-stranded form, can through its first region to interact with the second region of the primer and thus start the strand displacement.
  • the progress of the formation of the double strand between the primer extension product and the controller depends on the correspondence of the sequences of the second region of the controller and the synthesized portion of the respective primer extension products.
  • the synthesis products differ depending on the primers and template strands used. Due to these differences in the primer extension products, the result of the controlling phase is different. Predominantly, primer extension products with a sufficient degree of complementarity with the second region of the controller oligonucleotide are detached from their template strand. Thus, there is a discrimination between the synthesized primer extension products in the controlling phase:
  • the controller oligonucleotides preferably form double-stranded complexes with complementary primer extension products. In case of a sequence deviation, this double strand formation takes place insufficiently.
  • the primer extension products with sequence differences to controller strands remain predominantly attached to their template strands.
  • the specifically formed competitor primer extension products can not be released from their template strands under the control of a controller since the competitor primers lack corresponding second regions (primer overhang) which could interact in a complementary manner with the first region of the controller.
  • the completely or partially detached sequence-specific primer extension product can be used in further analyzes. For example, it can be isolated from the reaction mixture (in bound form on the controller oligonucleotide). Furthermore, it can be used as a binding partner for other oligonucleotides, eg probes. Furthermore, it can even occur as a template strand, for example, after binding of a new primer in the 3 ' segment of the primer extension product.
  • the specific primer extension products synthesized in a primer extension reaction can be used as a starting nucleic acid in subsequent amplification procedures.
  • a defective synthesis of primer extension products by polymerases represents a significant problem for the genetic analyzes.
  • individual nucleotides are exchanged by the polymerase during the synthesis (eg instead of a correct one) C is installed a T or instead of an A, a G is installed, etc.).
  • C is installed a T or instead of an A, a G is installed, etc.
  • the present embodiment is intended to reduce synthesis errors in fully synthesized primer extension products in a primer extension reaction.
  • the technical problem of this embodiment is solved by the synthesis of a primer extension product and the elimination of the incorrectly synthesized strands occurring in parallel to synthesis.
  • the elimination of the incorrectly synthesized strands is accomplished by separating the primer extension product from its template before the primer extension product has reached its full length. This separation of the primer extension products takes place with the assistance of a controller oligonucleotide.
  • the synthesis of the primer extension product and the checking by means of a controller oligonucleotide are carried out in the same way (homogeneous assay), the individual reactions being essentially parallel to one another. This results in an influence of the controller oligonucleotides on the synthesis during the synthesis process.
  • the synthesis of the primer extension product (P1-Ext) during the synthesis phase and the opening of the double strand by means of a controller oligonucleotide (controlling phase) are adapted to one another in such a way that predominantly a processively occurring correct primer extension in a complete synthesis in resulting in a template strand complementary primer extension product.
  • the defective primer extension products comprising at least one incorporation error introduced during synthesis by a polymerase are to be selected out.
  • a preferred embodiment with a homogeneous format is described in which at least one template strand, at least one controller oligonucleotide, at least one primer oligonucleotide, at least one polymerase and dNTPs are present as substrates in a suitable buffer system at the beginning of the reaction. Synthesis phase.
  • the goal of the synthesis phase is to synthesize a specific primer extension product by polymerase-mediated synthesis using a template strand.
  • a primer extension reaction comprises a preferably specific primer binding (first region of the primer oligonucleotide) to the template strand at a suitable primer binding site (sequence segment capable of complementary binding to the first region of the primer oligonucleotide) the second region of the primer (primer overhang) preferably does not bind to the template strand and is therefore available for later interaction with the controller.
  • the primer binding site can be completely single-stranded or partially single-stranded so that at least a portion of the first region of the primer can bind sequence-specifically to the primer binding site via formation of complementary base pairs (Watson-Crick rule).
  • the polymerase can extend such bound to the primer binding site primer oligonucleotides in a template-dependent synthesis of complementary attachment nucleotides into the growing strand of the primer (3 'end-OH). This results in a complementary to the template strand primer extension product (P1-Ext).
  • the synthesis of the complementary strand usually takes place as long as the polymerase finds enough substrate in the batch and sufficient sequence segments in the template strand are available in a suitable form for the polymerase as a template.
  • one of the conditions on the template segment may be that the template strand is single-stranded (using polymerases without strand displacement properties) or else partially double-stranded (using polymerases having strand displacement properties).
  • the synthesis reaction often takes place over a sufficient time (total time of the reaction), so that at more than 1%, in particular more than 10%, in particular more than 30%, in particular more than 50% of the template strands a complete primer extension product can be synthesized.
  • primer binding occurs under reaction conditions which do not allow thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template.
  • reaction conditions which do not allow thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template.
  • binding events complexes are formed which comprise the first region of the primer and the corresponding primer binding positions on the template strand.
  • dissociation events these complexes separate into individual components so that no primer extension reaction can start by means of polymerase.
  • Such conditions are present, for example, at reaction temperatures which are about the melting temperature (Tm) of such a complex (P1 / template strand).
  • the melting temperature (Tm) should be measured under the same buffer conditions and concentrations.
  • the Reaction can be carried out under reaction temperatures in the range of Tm -5 ° C to Tm +30 ° C, in particular embodiments in the range of Tm -5 ° C to about Tm +20 ° C, in another particular embodiment in the range of Tm -5 ° C to Tm +10 ° C. Even under such conditions, extension of the primer by a polymerase can occur with sufficient complementarity of the 3 ' segment of the primer with the template.
  • the structure of the primers and the controller oligonucleotides, as well as the reaction conditions of the synthesis phase are chosen such that the complex comprising primer / controller oligonucleotide is predominantly in equilibrium with its individual components (complex formation and complex dissociation occur parallel to each other) , Such conditions are for example at reaction temperatures, which are about the melting temperature (Tm) of such a complex (primer / controller oligonucleotide).
  • Tm melting temperature
  • reaction may be carried out at reaction temperatures in the range of Tm -5 ° C to Tm + 30 ° C, in particular embodiments between about Tm -5 ° C to about Tm + 20 ° C, in another particular embodiment between about Tm - 5 ° C to about Tm + 10 ° C, in certain embodiments between about Tm -5 ° C to about Tm + 5 ° C, in another particular embodiment between about Tm - 5 ° C to about Tm -2 ° C.
  • Tm melting temperatures
  • reaction conditions formation and dissociation of primer / primer-binding site complexes as well as formation and dissociation of primer / controller-oligonucleotide complexes occur.
  • the structures and reaction conditions are adapted to each other in such a way that, under such conditions, extension of the primer by a polymerase can occur with sufficient complementarity of the 3 ' segment of the primer with the template.
  • Combinations of structures of the individual components and the reaction conditions are advantageous, which even with a primer extension of only a few nucleotides lead to the fact that even an incompletely extended primer extension product can be more tightly bound to the controller oligonucleotide than a primer that is still extender. This is usually done by allowing the controller oligonucleotide to form a complementary bond with a primer extension product with its third region, thus having additional binding positions compared to a primer / controller complex. Such a more stable binding also allows incompletely extended primers to form complexes with controller oligonucleotides and, due to sufficient stability of these complexes, be removed from the reaction.
  • controller oligonucleotide does not support matrix function (eg, by modification), incompletely extended, to the controller Oligonucleotide bound primer not completed. For this reason, preferably the entire third region of the controller oligonucleotide comprises such modifications.
  • the continuation of the synthesis of such incompletely extended primer / controller complexes can only take place when they are released again from the complex with the controller oligonucleotide. Due to advantageous selected reaction conditions, however, this is done only to a very limited extent. Thus, incompletely extended primer extension products can be bound in complexes with controller oligonucleotides during the synthesis reaction.
  • the controller oligonucleotide may interact during the ongoing primer extension reaction (in parallel with this reaction) with both primer oligonucleotides, partially extended primers, and fully extended primers. This interaction begins at the second region of the primer.
  • predominantly sufficient processive polymerases are used, e.g. Bst-Large fragment, Phi29 polymerase or polymerases with improved processivity (e.g., phage polymerase is a result of a coupling of a thermostable polymerase with a protein that extends the binding of the polymerase to the DNA) or their modifications.
  • phage polymerase is a result of a coupling of a thermostable polymerase with a protein that extends the binding of the polymerase to the DNA
  • controller oligonucleotides are used in concentrations of about 0.1 mM to about 20 pM. This allows a sufficiently frequent interaction with primer extension products so that an impact on the quality of primer extension products is expected.
  • lower processivity polymerases e.g., Taq polymerase, Vent polymerase, Pfu polymerase
  • controller concentrations of about 5 nM to about 1 pM are preferably used here.
  • Polymerases are predominantly able to attach several nucleotides (eg more than 15 nucleotides, better more than 30 nucleotides, preferably more than 50 nucleotides) to the growing end of the primer or primer in the case of only one binding event to a primer / template strand complex. Extension product to tie.
  • low-affinity polymerases such as Taq polymerase and Klenow polymerase, or entirely distributive polymerases, which bind only a few nucleotides in a binding event (usually less than 8 to 15 nucleotides).
  • a predominantly processive synthesis is thus associated with the synthesis within a binding event of the polymerase to the primer-template complex.
  • the high processivity of the polymerase is favored by sufficient complementarity of the 3 ' end of the growing primer extension product.
  • the synthesis is carried out at high speed and processively particularly advantageous when the 3 ' end of the strand to be elongated fulfills a structural requirement for complementarity given by the template (as a rule, this refers to a complementary, perfect-match situation in the case of nucleobases between the 3 ' end or 3 ' segment of the strand to be elongated and the corresponding template ).
  • This slowdown in the rate of polymerase catalysis is known to one skilled in the art.
  • the extent of such slowing or pausing in catalysis depends on both the polymerase and the reaction conditions (eg, concentration of dNTPs) as well as the nature of the mismatch.
  • the continuation of the synthesis beyond such a mismatch usually requires a longer reaction time.
  • mismatch position comprising, as a rule, one to two nucleotides
  • the polymerase can overcome the template-dependent synthesis can as a rule be continued.
  • the extent of overcoming depends on both the type of mismatch and polymerase.
  • Polymerases may or may not both comprise a 3 ' exonuclease activity (proofreading polymerases, eg, phage polymerase) (Bst-Large Fragment). Depending on the type of template used, DNA-dependent polymerases or RNA-dependent polymerases can be used.
  • the template strand comprises a primer binding site such that under selected reaction conditions binding of the first region of the primer occurs and polymerase mediated synthesis of the strand can occur.
  • a template strand comprises a target sequence.
  • This target sequence usually represents the sequence segment of the template strand, which performs the template function for the synthesis of the complementary strand.
  • the template strand and the primer oligonucleotide are adapted in their design such that the second region of the primer oligonucleotide does not bind to the template strand, or at least does not form stable binding, and thus is potentially able to interfere with the first region of the controller. Oligonucleotide to interact. In general, both DNA and RNA can occur as template strands.
  • the primer binding site of the template is preferably in a single-stranded form and allows for site-specific binding of the first region of the primer oligonucleotide to the template.
  • the segment of the template strand which serves as a template for the synthesis of the complementary strand by the polymerase may, in certain embodiments, be wholly or predominantly (more than 50%) single-stranded under reaction conditions. In another embodiment, this segment is predominantly (more than 50%) double-stranded.
  • the polymerases used in the synthesis must be selected accordingly. For single-stranded templates, polymerases can be used without marked strand displacement, e.g. Phusion polymerase. For predominantly double-stranded segments of the template, preference is given to using polymerases having strand-displacing properties, e.g. Bst polymerase Large Fragment.
  • the primer binding site may be for the primer in the 3 ' segment of the template.
  • the primer oligonucleotide comprises a modification which prevents the polymerase from copying the second primer region.
  • the template in its 3 ' segment can go well beyond the primer binding site of the primer.
  • the length of such an overhang can range from a few nucleotides to several kilobases.
  • the structure of such a template strand results in the primer overhang not being copied by the polymerase starting from the 3 ' end of the template. Therefore, in such an embodiment, the primer need not necessarily comprise a block group in the second region of the primer.
  • the synthesis of the primer extension product via polymerase as a template-dependent synthesis. It is advantageous if the progress of the synthesis of the primer extension product is limited and thus a desired primer extension product is limited in its length.
  • the length of the complete primer extension product is preferably limited by availability of a sequence segment of the template which can be used by the polymerase for synthesis. This can be achieved, for example, by limiting the matrix strand in the 5 ' segment. This limitation prevents the polymerase used from continuing the synthesis.
  • Such a limitation can be achieved, for example, by strand termination (strand termination achieved eg by physical action or by an enzyme, eg an endonuclease or a restriction endonuclease) or by using one or more modifications in the strand (eg spacer or linker) prevent the polymerase from being synthesized, or by nucleotide Modifications (eg nucleobase modification as Iso-C and Iso-G, or the sugar-phosphate moieties such as 2 '-0-Me, 2' MOE, morpholino, PNA etc.).
  • nucleotide Modifications eg nucleobase modification as Iso-C and Iso-G, or the sugar-phosphate moieties such as 2 '-0-Me, 2' MOE, morpholino, PNA etc.
  • a so-called block oligonucleotide may preferably hybridize under sequence conditions of the synthesis phase predominantly sequence-specifically to the template strand via complementary binding.
  • a block oligonucleotide when attached to the template strand, prevents the polymerase from reading the template strand beyond that oligonucleotide.
  • oligonucleotide structures are suitable for this purpose.
  • the selection of the oligonucleotide structure, the polymerase and the reaction conditions are based on the fact that the progressive synthesis is hindered or blocked by the polymerase.
  • Oligonucleotides with several double strand stabilizing modifications typically results in the polymerase being unable to continue synthesis via the oligonucleotide binding site.
  • LNA or PNA double strand stabilizing modifications
  • template-complementary oligonucleotides of about 20-50 nucleotides in length with about 7-30 LNA modifications, for example, a Bst polymerase (large fragment) can prevent this oligonucleotide from detaching via polymerase-dependent strand displacement from the template.
  • the length of the complete P1-ext generated during template-dependent synthesis and the length of the matching controller oligonucleotide can be chosen differently.
  • the length of the controller oligonucleotide and the length of the expected fully synthesized primer extension product are matched so that the controller oligonucleotide completely covers the region synthesized by the polymerase.
  • a controller oligonucleotide can completely detach the P1 -ext from the template. In the 3 ' segment of the P1 -ex, no free nucleotides remain for interaction with the template during the controlling phase (see below)
  • the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide.
  • the 3 ' segment of the primer extension product thus comprises a sequence segment which does not belong to the controller Oligonucleotide is checked. When the P1-Ext interacts with the controller, a double-stranded segment of P1-Ext and matrix remains, which is not checked by the controller.
  • this double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, eg due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C).
  • the length of this 3 ' segment of the primer extension product may comprise, for example, sequence lengths which lie in the following ranges: from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides, from 50 to 70 nucleotides, from 70 to 100 nucleotides.
  • this double-stranded segment can not spontaneously dissociate under the reaction conditions of the controlling phase, eg due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C).
  • the length of this 3 ' segment of the primer extension product may comprise, for example, sequence lengths which lie in the following ranges: more than 20 nucleotides, more than 30 nucleotides, more than 40 nucleotides, more than 50 nucleotides, more than 100 nucleotides, more than 200 nucleotides, more than 500 nucleotides.
  • the maximum length can reach up to about 10,000 nucleotides.
  • the aim of the controlling phase is to check the synthesized primer extension product for its agreement with the given sequence during the ongoing synthesis (real-time control).
  • the correct, fully complementary primer extension products are to be synthesized in full length.
  • the resulting during the synthesis of misincorporation events by the polymerase from the further extension reaction should be excluded.
  • mismatches between primer extension products resulting from a polymerase during synthesis are to be prevented from lengthening on the template strand. This is done by forming a complex of such a mismatch-containing primer extension product and a controller oligonucleotide during the primer extension reaction.
  • the terminal mismatch-containing primer extension products bound to the controller oligonucleotide should preferably remain in these complexes under reaction conditions.
  • primer extension products in which the progress of the synthesis reaction is slowed down e.g., due to polymerase mismatch incorporation, ie, polymerase errors
  • primer extension products in which the progress of the synthesis reaction is slowed down e.g., due to polymerase mismatch incorporation, ie, polymerase errors
  • polymerase mismatch incorporation ie, polymerase errors
  • controller oligonucleotide By repeated interactions between the controller oligonucleotide and the primer oligonucleotides and between the controller oligonucleotide and the primer Extension products (the interaction begins with the binding of the controller to the primer overhang) as they are generated, there is competition between the synthesis process and a strand displacement event by the controller oligonucleotide.
  • concentration of controller oligonucleotides can be varied between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 10 pmol / l.
  • the extent of the controller-dependent strand displacement can be influenced.
  • the freely available controller oligonucleotides can interact with the second primer region (primer overhang). Among other things, interactions with complexes comprising primer extension products and template strands occur. The interaction starts from the primer overhang. This provides spatial proximity between the controller strand and the end of the double-stranded region between primer extension product / template strand. As a result, the double-stranded formation can be transferred between the controller oligonucleotide and the first primer region (sequence-dependent strand displacement). Given the sequence identity with the synthesized portion of the primer extension product, the double strand formation between the controller oligonucleotide and the primer extension product continues to expand.
  • processive polymerases typically results in the primer extension reaction by the polymerase with full match of the synthesized growing strand to its template being faster than forming a double-stranded complex of primer extension product and controller oligonucleotide.
  • the time delay of the enzymatic synthesis is exploited, which usually takes place in a strand extension process, when this strand comprises a mismatch as a result of a polymerase error.
  • the perfect-match strands are generally synthesized faster than those that have a mismatch in the primer extension product. After a misincorporation into the growing strand, there is a temporary slowdown or even a pause in the synthesis, so that the process of double-stranding between the controller oligonucleotide and the primer extension product can detach this "paused strand" from the template before a further synthesis can take place.
  • the binding of such an incomplete primer extension product to the controller oligonucleotide is preferably sufficiently stable under reaction conditions used so that this incomplete product can be removed from the further template-dependent syntheses by the polymerase. Since the controller oligonucleotide does not serve as a template, such an incomplete primer extension product will remain in complex with the controller oligonucleotide.
  • the length of the controller oligonucleotide and the length of expected full primer extension product are matched so that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide.
  • the 3 ' segment of the primer extension product thus comprises a sequence segment which is not checked by the controller oligonucleotide.
  • the interaction of the P1-text with the controller thus leaves a double-stranded segment of P1-text and matrix.
  • this double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, for example due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C).
  • the length of this 3 ' segment of the primer extension product may comprise, for example, sequence lengths ranging from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides.
  • the interaction of the controller oligonucleotide interaction with the synthesized primer extension product and the spontaneous dissociation of the 3 ' segment complex of the P1 -ext and template may result in the detachment of the primer extension product (in the complex of P1 -ext and controller-strand ) from the matrix.
  • the 3 ' segment may play a functional role in subsequent analyzes / reactions.
  • the complexes formed controller oligonucleotide and incomplete primer extension product are preferably sufficiently stable under the chosen reaction conditions, so that this incomplete primer extension product can be excluded from a continuation of its synthesis at the template strand or by the complex form with the controller strongly prevented the continuation of the template-dependent synthesis reaction.
  • the synthesis of defective primer extension products can be prevented to full synthesis length. Because of insufficient length, such incomplete P1 text preferably does not include a required 3 ' sequence segment to participate in other or subsequent reactions. This missing 3 ' segment can be used, for example, for interaction with a probe or a probe another primer is missing. As a result, defective primer extension products can not develop the full functionality required in subsequent reactions, eg in a detection process or an amplification.
  • the interaction between the controller oligonucleotide and the primer extension product depends on the complementarity between the primer extension product and the controller oligonucleotide. In case of deviations, the process of sequence-dependent strand displacement can be severely hindered.
  • the higher the sequence differences between the synthesized primer extension product and the corresponding controller oligonucleotide the more the formation of a complex of controller oligonucleotide and P1 -ex is affected.
  • the degree of influence can range from slight deceleration to complete stop in the progress of complex formation. For this reason, it is advantageous if the controller oligonucleotide is adapted to the desired primer extension product and is able to enter into its third region with a substantially complementary binding to the synthesized sequence segment of the primer extension product.
  • the correctly synthesized primer extension product may be released from the template, for example as shown in the above embodiments.
  • primer extension product in further reactions may require that certain portions of the primer extension product be in single-stranded form. This may be necessary, for example, for the binding of a primer or a probe. This embodiment can therefore be used, for example, to convert the sequences in the 3 ' segment of the primer extension product into the single-stranded state.
  • controller oligonucleotides in the assay allows for both low-contamination integration into other methods of molecular analysis and combination with other methods, e.g. with amplification method or detection method.
  • the specific primer extension products synthesized in a primer extension reaction can be used as a starting nucleic acid in subsequent amplification procedures.
  • the primer extension reaction described herein comprises at least a first primer and at least one controller oligonucleotide.
  • the product of the primer extension reaction, the primer extension product can be used, for example, in a subsequent amplification reaction, which also proceeds with the assistance of a controller oligonucleotide.
  • primer extension reaction first primer and controler oligonucleotide
  • Reaction conditions include, but are not limited to, buffer conditions, temperature conditions, duration of reaction, and concentrations of respective reaction components.
  • the reaction comprising the synthesis of the extension products can be carried out for as long as necessary to produce the desired amount of the specific nucleic acid sequence.
  • the process according to the invention is preferably carried out continuously.
  • the amplification reaction proceeds at the same reaction temperature, wherein the temperature is in particular between 50 ° C and 75 ° C.
  • the reaction temperature can also be variably controlled, so that individual steps of the primer extension reaction proceed at different temperatures.
  • no helicases or recombinases are used in the reaction mixture to separate the newly synthesized duplexes of the nucleic acid to be amplified.
  • the reaction mixture does not include biochemical energy-donating compounds such as ATP.
  • the amount of nucleic acid to be amplified at the beginning of the reaction can be between a few copies and several billion copies in one run.
  • the amount of template comprising a target sequence may be unknown.
  • the reaction may also contain other nucleic acids which are not to be amplified. These nucleic acids may be derived from natural DNA or RNA or their equivalents. In certain embodiments, control sequences are in the same approach, which should also be amplified in parallel to the nucleic acid to be amplified.
  • a molar excess of about 10 3 : 1 to about 10 15 : 1 (primer: template ratio) of the primers employed and the controller oligonucleotide may be added to the reaction mixture, which comprises template strands.
  • the amount of target nucleic acids may not be known if the method of the invention is used in diagnostic applications, so that the relative amount of the primer and the controller oligonucleotide relative to the complementary strand can not be determined with certainty.
  • the amount of primer added will generally be present in molar excess relative to the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.
  • the concentrations of primer-1 and controller oligonucleotide used are, for example, in the range between 0.01 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 50 pmol / l, in particular between 0.1 pmol / l and 20 pmol / l.
  • the high concentration of components can increase the rate of amplification.
  • the respective concentrations of individual components can be varied independently of one another in order to achieve the desired reaction result.
  • the concentration of polymerase ranges between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 20 pmol / l, in particular between 0.1 pmol / l and 10 pmol / l.
  • the concentration of individual dNTP substrates is in the range between 10 pmol / l and 10 mmol / l, in particular between 50 pmol / l and 2 mmol / l, in particular between 100 pmol / l and 1 mmol / l.
  • the concentration of dNTP can affect the concentration of divalent metal cations. If necessary, this will be adjusted accordingly.
  • divalent metal cations for example, Mg 2+ are used.
  • a corresponding anion for example, CI, acetate, sulfate, glutamate, etc. can be used.
  • the concentration of divalent metal cations is adapted, for example, to the optimum range for each polymerase and comprises ranges between 0.1 mmol / l and 50 mmol / l, in particular between 0.5 mmol / l and 20 mmol / l, in particular between 1 mmol / l and 15 mmol / l.
  • the enzymatic synthesis is generally carried out in a buffered aqueous solution.
  • buffer solutions dissolved conventional buffer substances, such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, sodium glutamate in conventional concentrations can be used.
  • the pH of these solutions is usually between 7 and 9.5, in particular about 8 to 8.5.
  • the buffer conditions can be adapted, for example, according to the recommendation of the manufacturer of the polymerase used.
  • Tm depressors eg DMSO, betaines, TPAC
  • Tm depressors eg DMSO, betaines, TPAC
  • Tween 20 or Triton 100 can also be added in conventional amounts to the buffer.
  • EDTA or EGTA may be too Complexation of heavy metals can be added in conventional amounts.
  • Polymerase stabilizing substances such as trehalose or PEG 6000 may also be added to the reaction mixture.
  • the reaction mixture contains no inhibitors of the strand displacement reaction and no inhibitors of polymerase-dependent primer extension.
  • the reaction mixture contains DNA-binding dyes, especially intercalating dyes, such as e.g. EvaGreen or SybrGreen.
  • intercalating dyes such as e.g. EvaGreen or SybrGreen.
  • Such dyes may possibly enable the detection of the formation of new nucleic acid chains.
  • the reaction mixture can furthermore contain proteins or other substances which, for example, originate from an original material and which preferably do not influence the amplification.
  • the reaction temperatures of the individual steps of the amplification reaction can be in the range of about 15 ° C to about 85 ° C, in particular in the range of about 15 ° C to about 75 ° C, in particular in the range of about 25 ° C to about 70 ° C.
  • the reaction temperature can be optimally adjusted for each individual reaction step, so that such a temperature is brought about for each reaction step.
  • the amplification reaction thus comprises a repetitive change of temperatures, which are repeated cyclically.
  • reaction conditions for a plurality of reaction steps are standardized so that the number of temperature steps is less than the number of reaction steps.
  • at least one of the steps of amplification occurs at a reaction temperature which differs from the reaction temperature of other steps of the amplification. The reaction is thus not isothermal, but the reaction temperature is changed cyclically.
  • the lower temperature range includes, for example, temperatures between 25 ° C and 60 ° C, in particular between 35 ° C and 60 ° C, in particular between 50 ° C and 60 ° C and the upper temperature range includes, for example, temperatures between 60 ° C and 75 ° C, especially between 60 ° C and 70 ° C.
  • the lower temperature range includes, for example, temperatures between 15 ° C and 50 ° C, in particular between 25 ° C and 50 ° C, in particular between 30 ° C and 50 ° C and the upper temperature range includes, for example, temperatures between 50 ° C and 75 ° C, especially between 50 ° C and 65 ° C.
  • the lower temperature range includes, for example, temperatures between 15 ° C and 40 ° C, in particular between 25 ° C and 40 ° C, in particular between 30 ° C and 40 ° C and the upper temperature range includes, for example, temperatures between 40 ° C and 75 ° C, especially between 40 ° C and 65 ° C.
  • the temperature can be kept constant in the respective range or can be changed as a temperature gradient (decreasing or rising).
  • Any induced temperature can be maintained for a period of time, resulting in an incubation step.
  • the reaction mixture may thus be incubated for a period of time during amplification at a selected temperature. This time may be of different duration for the particular incubation step and may depend on the progress of the particular reaction at a given temperature (e.g., primer extension or strand displacement, etc.).
  • the time of an incubation step may comprise the following ranges: between 0.1 sec and 10,000 sec, in particular between 0.1 sec and 1000 sec, in particular between 1 sec and 300 sec, in particular between 1 sec and 100 sec.
  • a temperature change By such a temperature change, individual reaction steps can preferably be carried out at a selected temperature. As a result, yields of a particular reaction step can be improved.
  • a change in temperature or a temperature change between individual temperature ranges may be required several times.
  • a synthesis cycle may thus comprise at least one temperature change. Such a temperature change can be performed routinely, for example, in a PCR device / thermocycler as a time program.
  • an amplification method is preferred in which at least one of the steps comprising the strand displacement and at least one of the steps comprising the primer extension reactions take place simultaneously and in parallel and under the same reaction conditions.
  • a primer extension reaction of at least one primer oligonucleotide e.g., of the first primer oligonucleotide
  • the strand displacement with the aid of controller oligonucleotide and the one further primer extension reaction are preferably carried out in the reaction step in the upper temperature range.
  • an amplification method is preferred in which at least one of the steps comprising strand displacement by the controller oligonucleotide and at least one of the steps comprising the primer extension reaction are performed at different temperatures.
  • primer extension reactions of at least one primer oligonucleotide (For example, from the first primer oligonucleotide and / or second primer oligonucleotide) preferably carried out at temperature conditions in the lower temperature range.
  • the strand displacement with the assistance of controller oligonucleotide preferably takes place in the reaction step in the upper temperature range.
  • all steps of an amplification reaction proceed under identical reaction conditions.
  • the amplification process may be carried out under isothermal conditions, i. that no temperature changes are required to carry out the process.
  • the entire amplification reaction is carried out under constant temperature, i. the reaction is isothermal.
  • the time of such a reaction comprises, for example, the following ranges: between 100 sec and 30,000 sec, in particular between 100 sec and 10,000 sec, in particular between 100 sec and 1000 sec.
  • Individual process steps can each be carried out in succession by adding individual components.
  • all reaction components necessary for the execution of an amplification are present at the beginning of an amplification in a reaction mixture.
  • the start of an amplification reaction can be carried out by adding a component, e.g. by adding a nucleic acid chain comprising a target sequence (e.g., a starting nucleic acid chain), or a polymerase or divalent metal ions, or also by providing reaction conditions necessary for amplification, e.g. Setting a required reaction temperature for one or more process steps.
  • a component e.g. by adding a nucleic acid chain comprising a target sequence (e.g., a starting nucleic acid chain), or a polymerase or divalent metal ions, or also by providing reaction conditions necessary for amplification, e.g. Setting a required reaction temperature for one or more process steps.
  • the amplification can be carried out until the desired amount of nucleic acid to be amplified is reached.
  • the amplification reaction is carried out for a time which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.
  • the amplification reaction is carried out over a sufficient number of synthesis cycles (doubling times) which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.
  • the reaction can be stopped by various interventions. For example, by changing the temperature (e.g., cooling or heating, for example, interfering with the function of the polymerase) or by adding a substance which stops a polymerase reaction, e.g. EDTA or formamide.
  • a temperature e.g., cooling or heating, for example, interfering with the function of the polymerase
  • a substance which stops a polymerase reaction e.g. EDTA or formamide.
  • the amplified nucleic acid chain can be used for further analysis.
  • synthesized nucleic acid chains can be analyzed by various detection methods. For example, fluorescence-labeled oligonucleotide probes can be used or sequencing methods (Sanger sequencing or next-generation sequencing), solid-phase analysis such as microarray or bead-array analysis, etc.
  • the synthesized nucleic acid chain can be used as a substrate / template in further primer extension reactions.
  • the progress of the synthesis reaction is monitored during the reaction. This can be done, for example, by using intercalating dyes, e.g. Sybrgreen or Evagreen, or using labeled primers (e.g., Lux primer or Scorpion primer) or using fluorescently labeled oligonucleotide probes.
  • intercalating dyes e.g. Sybrgreen or Evagreen
  • labeled primers e.g., Lux primer or Scorpion primer
  • fluorescently labeled oligonucleotide probes e.g., fluorescently labeled oligonucleotide probes.
  • the detection of the change in fluorescence during amplification is implemented in a detection step of the method.
  • the temperature and the duration of this step can be adapted to the particular requirements of an oligonucleotide probe.
  • the temperatures of the detection step include, for example, ranges between 20 ° C and 75 ° C, in particular between 40 and 70 ° C, in particular between 55 and 70 ° C.
  • the reaction is illuminated with light of a wavelength capable of exciting a used fluorophore of the detection system (a donor or a fluorescent reporter).
  • a used fluorophore of the detection system a donor or a fluorescent reporter.
  • the signal detection is usually parallel to excitation, whereby the specific fluorescence signal is detected and its intensity is quantified.
  • the amplification method can be used to verify the presence of a target nucleic acid chain in a biological material or diagnostic material as part of a diagnostic procedure.
  • reaction conditions of at least one reaction step in which at least one allele-specific primer is to hybridize to an allele-specific sequence variant and a primer extension reaction by a polymerase is to be chosen such that a predominantly specific hybridization of such a primer to its Primer binding site can take place.
  • Such conditions can also be called stringent conditions.
  • the temperature in such a step is about Tm of the respective primer / primer binding site or the temperature is above such a Tm.
  • the temperature may be about Tm +5 to about Tm + 15 ° C.
  • the first primer oligonucleotide (primer-1) is a nucleic acid chain which includes at least the following regions:
  • a first primer region in the 3 ' segment of the first primer oligonucleotide capable of substantially sequence-specific binding to a strand of nucleic acid chain to be amplified
  • a second region coupled directly or via a linker, to the 5 ' end of the first primer region of the first primer oligonucleotide which has a polynucleotide Which is suitable for binding a controller oligonucleotide and promoting strand displacement (step c) by the controller oligonucleotide, wherein the polynucleotide tail remains substantially single-stranded under reaction conditions, ie, does not form a stable hairpin structure or ds structures, and preferably not copied by the polymerase.
  • the total length of the first primer oligonucleotide is between 10 and 80, more preferably between 15 and 50, more preferably between 20 and 30 nucleotides or their equivalents (e.g., nucleotide modifications).
  • the structure of the first primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions. Furthermore, the structure of the first primer oligonucleotide is adapted to its primer function. Furthermore, the structure is adapted so that a strand displacement can be performed by means of controller oligonucleotide. Overall, structures of the first and second regions are matched to each other so that exponential amplification can be performed.
  • the first and second regions of the primer are coupled in a conventional 5 ' -3 ' configuration.
  • the coupling of both sections is via a 5 ' -5 ' bond such that the second region has a reverse direction from the first region.
  • the coupling of areas between each other / each other is preferably covalent.
  • the coupling between the first and second regions is a conventional DNA for 5'-3 '-Phosphodiester coupling. In certain embodiments, it is a 5 '-5' -Phosphodiester coupling. In certain embodiments, it is a 5 '-3' - phosphodiester linkage, wherein between adjacent terminal nucleotides or nucleotide modifications of the two regions at least one linker (eg, a C3, C6, C12 or HEG linker or abasic modification) is positioned.
  • linker eg, a C3, C6, C12 or HEG linker or abasic modification
  • nucleotide modifications may include different nucleotide modifications.
  • individual elements of nucleotides can be modified: nucleobase and backbone (sugar content and / or phosphate content).
  • modifications may be used which lack or are modified at least one component of the standard nucleotide building blocks, e.g. PNA.
  • a second portion of the first primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are preferably located at the 5 ' end of the polynucleotide tail.
  • a first primer oligonucleotide may comprise a characteristic label.
  • markings are dyes (eg FAM, TAMRA, Cy3, Alexa 488 etc.) or biotin or other groups which can be specifically bound, eg digoxigenin.
  • the sequence length is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides, the sequence being predominantly complementary to the 3 ' segment of a strand of the nucleic acid chain to be amplified.
  • this primer region must be able to specifically bind to the complementary 3 ' segment of a second primer extension product.
  • This first area should be copied in the reverse synthesis and also serves as a template for the 2nd strand.
  • the nucleotide building blocks are preferably linked to each other via conventional 5 'to 3' Phosphodie bond or Phosphothioester bond.
  • the first primer region preferably includes nucleotide monomers which do not or only insignificantly influence the function of the polymerase, for example:
  • the 3 'OH end of this range preferably free of modifications and has a functional 3' -OH group, that can be recognized by the polymerase.
  • the first primer region serves as the initiator of the synthesis of the first primer extension product in the amplification.
  • the first region comprises at least one phosphorothioate compound, so that no degradation of the 3 ' end of the primer by the 3 ' exonuclease activity of polymerases can take place.
  • sequence of the first region of the first primer oligonucleotide and the sequence of the second region of the controller oligonucleotide are preferably complementary to one another.
  • the first primer region or its 3 ' segment can bind to the sequence segments of a target sequence.
  • an allele-specific first primer is used in combination with an allele-specific controller oligonucleotide.
  • the first primer region of the first primer can bind to the corresponding complementary position of a starting nucleic acid or of a nucleic acid chain to be amplified.
  • a first primer region comprises at least one sequence segment which can bind specifically under specific reaction conditions to an allele-specific sequence variant of the target nucleic acid, wherein the polymerase is able to extend a perfect-match complex formed thereby, so that a first Primer extension product results.
  • the position of an allele-specific sequence in the primer includes the 3 ' -terminal nucleotide.
  • the position of an allele-specific sequence in the primer comprises at least one of the positions -1 to -6 nucleotides in the 3 ' terminal segment of the first region of the first primer. In another embodiment, the position of an allele-specific sequence in the primer comprises at least one of the positions from -6 to at least -15 in the 3 ' terminal segment of the first region of the first primer.
  • Such a primer further comprises sequence segments which can bind in a uniform manner to all allelic variants of a target sequence in a uniform manner.
  • the first region of a first allele-specific primer comprises sequence segments which are both target sequence-specific and those which are allele-specific.
  • a combination of an allele-specific primer and an allele-specific controller oligonucleotide is used, wherein the first region of the first primer oligonucleotide is completely complementary to the second region of the controller oligonucleotide.
  • Single allele-specific primers can be grouped together to cover all variants of a target sequence.
  • Such a group of allele-specific primers comprises at least two different allele-specific primers, as a polymorphic locus at a given position in the target sequence comprises at least two sequence variants.
  • the allele-specific primers are designed to perfectly match under stringent reaction conditions, preferably with their specific template, and thus use this specific perfect-match template to form the respective primer extension products under the catalytic action of the polymerase.
  • 3 ' -terminal nucleotides and / or 3 ' -terminal segments of allele-specific primers can be used to discriminate variants of target sequences and are thus adapted in their sequence composition to the respective variants such that such primers adopt a perfect-match duplex form stringent conditions with the respective variant.
  • Such perfect-match double strands can usually be recognized well by a polymerase and under suitable reaction conditions a primer extension occurs. The interaction of an allele-specific primer with another variant of a target sequence thus results in a mismatch double strand.
  • mismatches usually lead to a delay in the extension by a polymerase or to a slowing of the overall reaction.
  • allele-specific primers in the 3 ' segment may include at least one phosphorothioate linkage that protects the allele-specific primers from 3 ' -5 ' nuclease degradation by a polymerase.
  • multiple allele-specific primers include sequence segments which are substantially identical for a group of allele-specific primers, as well as sequence segments which are different among the primers of a group and characteristic of the respective sequence variant of a target sequence. Including uniform sequence segments, such primers can hybridize to the respective target sequence under Christsbedinungen. Including characteristic sequence segments, a respective primer can specifically bind to a sequence variant of the target sequence to form a perfect-match double strand.
  • the primers are designed so that, under the reaction conditions used, binding to a target sequence to form a perfect match double strand is preferred and binding to a target sequence to form a mismatch duplex is less preferred.
  • a target sequence-specific first primer (but not an allele-specific first primer) is used in combination with an allele-specific controller oligonucleotide.
  • the first primer region of the first primer can bind to the corresponding complementary position of a starting nucleic acid or of a nucleic acid chain to be amplified.
  • a first primer region comprises at least one sequence segment, which preferably can bind sequence specifically under reaction conditions used to sequence segments of a target nucleic acid chain (for example comprising a start nucleic acid and / or the nucleic acid chain to be amplified), this binding being essentially independent of potentially existing sequence differences in the polymorphic locus, wherein the polymerase is capable of extending a perfect-match complex formed thereby resulting in a first primer extension product.
  • the binding of such a primer essentially takes place in the sequence segment of the target nucleic acid, which is uniform for at least two allelic variants of these target nucleic acid chains.
  • the primer binding preferably takes place in the sequence segment of the target nucleic acid, which is uniform for all allelic variants of this target nucleic acid.
  • a resulting first primer extension product thus comprises a complementary sequence to the polymorphic locus. This sequence is in the 3 ' direction from the first primer.
  • Such a primer thus comprises sequence segments which can preferably bind uniformly to all allelic variants of a target sequence in a uniform manner.
  • a primer For differentiation of allelic variants to take place, such a primer must be combined with at least one allele-specific controller oligonucleotide. The allele discrimination is thus effected by the action of the controller oligonucleotide.
  • the positioning of the polymorphic locus in the 3 ' direction from the primer causes its localization in the third region of the controller oligonucleotide.
  • the second region of the first primer oligonucleotide The second region of the first primer oligonucleotide
  • the second region of the first primer oligonucleotide is preferably a nucleic acid sequence comprising at least one polynucleotide tail which preferably remains uncopied during the synthesis reaction of the polymerase and which is capable of binding to the first region of the controller oligonucleotide.
  • the segment of the second region, which predominantly undergoes this binding with the controller oligonucleotide, may be referred to as the polynucleotide tail.
  • the second region of the first primer oligonucleotide must not only specifically bind the controller oligonucleotide under reaction conditions, but also participate in the process of strand displacement by means of controller oligonucleotide.
  • the structure of the second region must therefore be suitable for bringing about spatial proximity between the controller oligonucleotide and the corresponding duplex end (in particular, the 3 ' end of the second primer extension product).
  • the design of the structure of the second region of the first primer oligonucleotide is shown in more detail in several embodiments.
  • the arrangement of the oligonucleotide segments and the modifications used are taken into account, which lead to a stop in the polymerase-catalyzed synthesis.
  • the length of the second region is between 3 and 60, in particular between 5 and 40, in particular between 6 and 15 nucleotides or their equivalents.
  • the sequence of the second area may be chosen arbitrarily. Preferably, it is not complementary with the nucleic acid to be amplified and / or with the second primer oligonucleotide and / or with the first region of the first primer oligonucleotide. Furthermore, it preferably contains no self-complementary segments, such as hairpins or stemmloops.
  • sequence of the second region is preferably matched to the sequence of the first region of the controller oligonucleotide, so that both sequences can bind under reaction conditions.
  • this bond is reversible under reaction conditions: there is thus a balance between components bound together and unbound components.
  • the sequence of the second region of the first primer oligonucleotide is preferably chosen such that the number of complementary bases which can bind to the first region of the controller oligonucleotide is between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies.
  • the function of the second area is, inter alia, the binding of the controller oligonucleotide.
  • this binding is preferably specific such that a second region of a first primer oligonucleotide is a specific controller Can bind oligonucleotide.
  • a second region may bind more than one controller oligonucleotide under reaction conditions.
  • the degree of complementarity between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%.
  • the respective complementary regions may be positioned immediately adjacent to each other or may comprise non-complementary sequence segments therebetween.
  • sequence-specific and therefore characteristic sequence segments are preferably not complementary to the target nucleic acid chain and are adapted to the sequence segments of the first region of an allele-specific controller oligonucleotide so that predominantly specific complementary duplexes between the first region of the controller oligonucleotide and the second region of the first Primer oligonucleotide can be formed.
  • pair formation may be from a particular first primer and a particular controller oligonucleotide.
  • the second region of the first primer oligonucleotide can thus be used for a characteristic coding, especially in multiplex analyzes.
  • the second region of the first primer oligonucleotide may, in certain embodiments, include at least one Tm modifying modification.
  • Tm enhancing modifications nucleotide modifications or non-nucleotide modifications
  • LNA nucleotides such as LNA nucleotides, 2-amino adenosines, or MGB modifications.
  • Tm-lowering modifications may also be used, such as inosine nucleotides.
  • linkers eg C3, C6, HEG linkers
  • the controller oligonucleotide For strand displacement, the controller oligonucleotide must be placed in close proximity to the double-stranded end of the nucleic acid to be amplified.
  • This double-stranded end consists of segments of the first primer region of the first primer extension product and a correspondingly complementary 3 ' segment of the second primer extension product.
  • the polynucleotide tail predominantly complements the controller oligonucleotide under reaction conditions, thereby causing a transient approach of the second region of the controller oligonucleotide and the first region of an extended primer extension product such that a complementary bond between these elements is initiated as part of a strand displacement process can.
  • binding of the controller oligonucleotide to the polynucleotide tail of the first primer oligonucleotide immediately results in such contact.
  • the polynucleotide tail and the first primer region of the first primer oligonucleotide must be directly coupled to each other. Thanks to such an arrangement, after a binding of a controller oligonucleotide in its first region, contact between complementary bases of the second region of the controller oligonucleotide and corresponding bases of the first primer region can occur directly, so that strand displacement can be initiated.
  • structures of the second region of the first primer oligonucleotide are located between structures of the polynucleotide tail and the first primer region. After binding of a controller oligonucleotide to the polynucleotide tail, it is thus not positioned directly at the first primer region, but at a certain distance from it.
  • the structures between the uncopiable polynucleotide tail and the copiable first primer region of the primer oligonucleotide can generate such a spacing.
  • This distance has a value which is between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm.
  • Such structures represent, for example, linkers (e.g., C3 or C6 or HEG linkers) or segments that are not complementary to the controller oligonucleotide (e.g., in the form of non-complementary, non-copyable nucleotide modifications).
  • the length of these structures can generally be measured in chain atoms. This length is between 1 and 200 atoms, in particular between 1 and 50 chain atoms, in particular between 1 and 10 chain atoms.
  • the second region of the first primer oligonucleotide generally comprises sequence arrangements that cause the polymerase to stop in the synthesis of the second primer extension product after the polymerase releases the polymerase first primer area has been successfully copied. These structures are intended to allow copying of the polynucleotide Prevent tail of the second area.
  • the polynucleotide tail thus preferably remains uncoupled from the polymerase.
  • such structures are between the first primer region and the polynucleotide tail.
  • sequence of the polynucleotide tail may include nucleotide modifications that result in the termination of the polymerase.
  • a sequence segment of the second region of the first primer oligonucleotide may comprise both functions: it is both a polynucleotide tail and a polymerase-terminating sequence of nucleotide modifications.
  • first blocking moiety or first stop region Modifications in the second region of the first primer oligonucleotide which result in a synthetic stop and thus leave the polynucleotide tail uncopyable are summarized in this application by the term "first blocking moiety or first stop region".
  • oligonucleotide synthesis Several building blocks in oligonucleotide synthesis are known which prevent the polymerase from reading the template and lead to the termination of the polymerase synthesis.
  • non-copyable nucleotide modifications or non-nucleotide modifications are known.
  • There are also synthetic types / arrangements of nucleotide monomers within an oligonucleotide which result in the termination of the polymerase eg, 5 'to 5 ' or 3 'to 3 ' ).
  • Primer oligonucleotides with a non-copyable polynucleotide tail are also known in the art (eg Scorpion primer structures or primers for binding to the solid phase).
  • Both primer variants describe primer oligonucleotide structures which are capable of initiating the synthesis of a strand so that a primer extension reaction can take place.
  • the result is a first strand, which also integrates the primer structure with tail in the primer extension product.
  • the second strand is extended to the "blocking moiety / stop structure" of the primer structure.
  • Both described primer structures are designed in such a way that the 5 ' portion of the primer oligonucleotide remains single-stranded and is not copied by the polymerase.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail that has a conventional 5 ' to 3 ' array in its entire length and includes non-copyable nucleotide modifications.
  • non-copyable nucleotide modifications include, for example, 2 '-0-alkyl-RNA modifications, PNA, morpholino. These modifications may be distributed differently in the second primer region.
  • the proportion of non-copyable nucleotide modifications may be between 20% and 100% in the polynucleotide tail, in particular more than 50% of the nucleotide building blocks.
  • these nucleotide modifications are in the 3 ' segment of the second region and thus adjacent to the first region of the first primer oligonucleotide.
  • sequence of non-copyable nucleotide modifications is at least partially complementary to the sequence in the template strand such that primer binding to the template occurs involving at least a portion of these nucleotide modifications. In certain embodiments, the sequence of non-copyable nucleotide modifications is non-complementary to the sequence in the template strand.
  • the non-copyable nucleotide modifications are preferably covalently coupled to one another and thus represent a sequence segment in the second region.
  • the length of this segment comprises between 1 and 40, in particular between 1 and 20 nucleotide modifications, in particular between 3 and 10 nucleotide modifications.
  • the second region of the first primer oligonucleotide comprises a polynucleotide tail that has a conventional arrangement of 5 -3 'in its entire length and includes non-copyable nucleotide modifications (eg, 2 ' to 0 alkyl modifications). and at least one non-nucleotide linker (eg, C3, C6, HEG linker).
  • a non-nucleotide linker has the function of covalently linking adjacent nucleotides or nucleotide modifications while at the same time site-specifically disrupting the synthesis function of the polymerase.
  • non-nucleotide linker should not remove the structures of the polynucleotide tail and the first primer region too far apart. Rather, the polynucleotide tail should be in close proximity to the first primer region.
  • a non-nucleotide linker is taken to mean modifications which are no longer than 200 chain atoms in length, in particular not more than 50 chain atoms, in particular not more than 10 chain atoms. The minimum length of such a linker can be one atom.
  • An example of such non-nucleotide linkers are straight or branched alkyl linkers having an alkyl chain which includes at least one carbon atom, more preferably at least 2 to 30, especially 4 to 18.
  • Such linkers are in oligonucleotide chemistry well known (eg, C3, C6, or C12 linker) and can be introduced during solid phase synthesis of oligonucleotides between the sequence of the polynucleotide tail and the sequence of the first region of the first primer oligonucleotide.
  • Another example of such non-nucleotide linkers are linear or branched polyethylene glycol derivatives.
  • a well-known example in oligonucleotide chemistry is hexaethylene glycol (HEG).
  • Another example of such non-nucleotide linkers are abasic modifications (eg THF modification, as analog of d ribose).
  • Such modifications are integrated into a second region, they can effectively interfere with a polymerase in its copying function during its synthesis of the second primer extension product such that segments located in the 3 'direction (Fig Modification remain uncopied.
  • the number of such modifications in the second range can be between 1 and 100, in particular between 1 and 10, in particular between 1 and 3.
  • the position of such a non-nucleotide linker may be at the 3 ' end of the second region, thus representing the transition from the first region to the second region of the primer oligonucleotide.
  • the location of the non-nucleotide linker in the middle segment of the second region may also be used.
  • the 3 ' segment of the polynucleotide tail includes at least one, in particular several, for example between 2 and 20, in particular between 2 and 10 non-copyable nucleotide modifications. These non-copyable nucleotide modifications are preferably at the junction between the first and second regions of the primer oligonucleotide.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail having in its entire length an array of 5 'to 3 ' - and at least one nucleotide monomer in a "reverse" array of 3 'to 5 '- including which is positioned at the transition between the first and the second region of the first primer oligonucleotide.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail, such polynucleotide tail consisting entirely of nucleotides which are directly adjacent to the first region of the first primer oligonucleotide in reverse order such that the coupling of the first and second primer oligonucleotides of the second area through 5 ' - 5 ' position.
  • the 3 ' terminal nucleotide of the polynucleotide tail is blocked at its 3 ' OH end to prevent side reactions.
  • a terminal nucleotide can be used which has no 3 ' -OH group, for example a dideoxy nucleotide.
  • the corresponding nucleotide arrangement is to be adapted in the controller oligonucleotide.
  • the first and the second portion of the controller oligonucleotide in 3 'to 3' arrangement have to be linked.
  • the second region of the primer oligonucleotide comprises a polynucleotide tail having a conventional 5 ' to 3 ' configuration in its entire length and including at least one nucleotide modification which is not a complementary nucleobase for the polymerase, when the synthesis is performed with all natural dNTP (dATP, dCTP, dGTP, dTTP or dUTP).
  • iso-dG or iso-dC nucleotide modifications can be integrated as single, but in particular more (at least 2 to 20) nucleotide modifications in the second region of the first primer oligonucleotide.
  • nucleobase modifications are various modifications of the extended genetic alphabet.
  • Such nucleotide modifications preferably do not support complementary base pairing with natural nucleotides, such that a polymerase (at least theoretically) does not contain a nucleotide from the series (dATP, dCTP, dGTP, dTTP or dUTP).
  • nucleotide modifications should be positioned at adjacent sites.
  • the stop of polymerase synthesis is effected by the lack of suitable complementary substrates for these modifications.
  • Oligonucleotides with iso-dC and iso-dG, respectively can be synthesized by standard techniques and are available from several commercial suppliers (e.g., Trilink-Technologies, Eurogentec, Biomers GmbH).
  • the sequence of the first region of the controller oligonucleotide can also be adapted to the sequence of such a second primer region.
  • complementary nucleobases of the extended genetic alphabet can be integrated into the first region of the controller oligonucleotide accordingly during the chemical synthesis.
  • iso-dG may be integrated in the second region of the first primer nucleotide, its complementary nucleotide (iso-dC-5-Me) may be placed at the appropriate location in the first region of the controller oligonucleotide.
  • this blockade preferably takes place only when the polymerase has copied the first region of the first primer oligonucleotide. This ensures that a second primer extension product has an appropriate primer binding site in its 3 ' segment. This primer binding site is exposed as part of the strand displacement and is thus available for a new binding of another first primer oligonucleotide.
  • the primer extension reaction remains in front of the polynucleotide tail. Because this polynucleotide tail remains single-stranded for interaction with the controller oligonucleotide and thus is available for binding, it supports the initiation of the strand displacement reaction by the controller oligonucleotide by using the oligonucleotide corresponding complementary segments of the controller oligonucleotide brings in the immediate vicinity of the appropriate duplex end. The distance between the complementary part of the controller oligonucleotide (second region) and the complementary part of the extended primer oligonucleotide (first region) is thereby reduced to a minimum. Such spatial proximity facilitates the initiation of strand displacement.
  • a complementary sequence of controller oligonucleotide is now in the immediate vicinity of the appropriate duplex end. This leads to competition for binding to the first region of the first primer oligonucleotide between the strand of the controller oligonucleotide and the primer complementary template strand.
  • the initiation of the nucleic acid-mediated strand displacement process occurs.
  • distances between the 5 ' segment of the first primer region of the first primer oligonucleotide, which binds to a complementary strand of the template and forms a complementary duplex, and a correspondingly complementary sequence segment in the controller oligonucleotide when bound to the Polynucleotide tail of the second region of the first primer oligonucleotide in the following ranges: between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm. In the preferred case, this distance is less than 1 nm.
  • this distance corresponds to a distance of less than 200 atoms, in particular less than 50 atoms, in particular less than 10 atoms. In the preferred case, this distance is an atom.
  • the distance information is for guidance only and illustrates that shorter distances between these structures are preferred. The measurement of this distance is in many cases only possible by analyzing the exact structures of oligonucleotides and measuring sequence distances or linker lengths.
  • the first primer may also include additional sequence segments that are not required for interaction with the controller oligonucleotide or template strand. Such sequence segments may, for example, bind further oligonucleotides which are used as detection probes or immobilization partners when bound to the solid phase. Primer function of the first primer oligonucleotide
  • the first primer oligonucleotide can be used in several partial steps. First and foremost, it performs a primer function in the amplification.
  • the primer extension reaction is carried out using the second primer extension product as a template.
  • the first primer oligonucleotide may use the starting nucleic acid chain as a template at the beginning of the amplification reaction. In certain embodiments, the first primer oligonucleotide may be used in the preparation / provision of a starting nucleic acid chain.
  • the first primer serves as the initiator of the synthesis of the first primer extension product using the second primer extension product as template.
  • the 3 ' segment of the first primer comprises a sequence which can bind predominantly complementary to the second primer extension product. Enzymatic extension of the first primer oligonucleotide using the second primer extension product as template results in the formation of the first primer extension product.
  • Such a first primer extension product comprises the target sequence or its sequence parts.
  • the sequence of the copiable portion of the first primer oligonucleotide is recognized as a template by the polymerase, whereby a corresponding complementary sequence is synthesized to result in a corresponding primer binding site for the first primer oligonucleotide.
  • the synthesis of the first primer extension product occurs up to and including the 5 ' segment of the second primer oligonucleotide.
  • this product is bound to the second primer extension product to form a double-stranded complex.
  • the second primer extension product is sequence-specifically displaced from this complex by the controller oligonucleotide.
  • the controller oligonucleotide binds to the first primer extension product.
  • the second primer extension product can itself serve as a template for the synthesis of the first primer extension product.
  • the now vacated 3 ' segment of the first primer extension product can bind another second primer oligonucleotide so that a new synthesis of the second primer extension product can be initiated.
  • the first primer oligonucleotide can serve as the initiator of the synthesis of the first primer extension product starting from the starting nucleic acid chain at the beginning of the amplification.
  • the sequence of the first primer is completely complementary to the corresponding sequence segment of a starting nucleic acid chain.
  • the sequence of the first primer oligonucleotide is only partially complementary to the corresponding sequence segment of a starting nucleic acid chain.
  • this divergent complementarity is not intended to prevent the first primer oligonucleotide to start a predominantly sequence-specific primer extension reaction.
  • the respective differences in the complementarity of the first primer oligonucleotide to the respective position in the starting nucleic acid chain are preferably in the 5 ' segment of the first region of the first primer oligonucleotide, so that in the 3 ' segment a predominantly complementary base pairing and an initiation of the Synthesis is possible.
  • the first 4-10 positions in the 3 ' segment should be fully complementary to the template (starting nucleic acid chain).
  • the remaining nucleotide positions may differ from a perfect complementarity.
  • the extent of perfect complementarity in the remaining 5 ' segment of the first region of the first primer oligonucleotide may thus range between 50% to 100%, in particular between 80% and 100%, of the base composition.
  • the sequence deviations comprise 1 to a maximum of 15 positions, in particular 1 to a maximum of 5 positions.
  • the first primer oligonucleotide may thus initiate synthesis from a startup nucleic acid chain.
  • copyable sequence portions of the first primer oligonucleotide are copied from the polymerase such that, in subsequent synthesis cycles, a fully complementary primer binding site within the second primer extension product for binding of the first primer oligonucleotide is formed and available in subsequent synthesis cycles.
  • the first primer oligonucleotide may be used in the preparation of a starting nucleic acid chain.
  • a first primer oligonucleotide can bind to a nucleic acid (for example a single-stranded genomic DNA or RNA or its equivalents comprising a target sequence) predominantly / preferably sequence-specifically and initiate a template-dependent primer extension reaction in the presence of a polymerase.
  • the binding position is chosen such that the primer extension product comprises a desired target sequence.
  • the extension of the first primer oligonucleotide results in a nucleic acid strand which has a sequence complementary to the template.
  • Such a strand can be detached from the template (eg by heat or alkali) and thus converted into a single-stranded form.
  • a single-stranded nucleic acid chain can serve as a starting nucleic acid chain at the beginning of the amplification.
  • Such a start nucleic acid chain comprises in its 5 ' segment the sequence portions of the first primer oligonucleotide, furthermore it comprises a target sequence or its equivalents and a primer binding site for the second primer oligonucleotide. Further steps are explained in the section "Starting nucleic acid chain".
  • the synthesis of the first primer extension product is a primer extension reaction and forms a partial step in the amplification.
  • the reaction conditions during this step are adjusted accordingly.
  • the reaction temperature and the reaction time are chosen so that the reaction can take place successfully.
  • the particular preferred temperature in this step depends on the polymerase used and the binding strength of the respective first primer oligonucleotide to its primer binding site and includes, for example, ranges from 15 ° C to 75 ° C, in particular from 20 to 65 ° C, in particular from 25 ° C to 65 ° C.
  • the concentration of the first primer oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
  • all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / byproducts.
  • stringent conditions include, for example, higher temperatures, for example above 50 ° C.
  • sequence-specific primer oligonucleotides are preferably used in each case for the amplification of corresponding respective target sequences.
  • sequences of the first primer oligonucleotide, the second primer oligonucleotide, and the controller oligonucleotide are matched to one another such that side reactions, e.g. Primer-dimer formation, minimized.
  • the sequence of the first and second primer oligonucleotides are adapted to each other such that both primer oligonucleotides are incapable of undergoing an amplification reaction in the absence of an appropriate template and / or target sequence and / or starting sequence. Start or support nucleic acid chain.
  • the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide.
  • the primer sequences comprise extended self-complementary structures (self-complement).
  • the synthesis of the first and second primer extension products proceeds at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products proceeds at different temperatures. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide proceeds at the same temperature. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide proceeds at different temperatures.
  • a first competitor primer oligonucleotide competes with the first primer oligonucleotide for binding to a sequence segment of a nucleic acid sequence sequence segment comprising at least two variants of a target nucleic acid chain.
  • the first primer oligonucleotide binds to the desired or expected sequence variant and is preferably extended under stringent Christsbedinungen by a polymerase.
  • the first competitor oligonucleotide binds to the second potential or expected sequence variant and is preferably extended under stringent reaction conditions by a polymerase.
  • the two primers thus represent allele-specific primers with regard to potential or expected sequence variants.
  • the essential difference is that the competitor primer is not able to involving a allele-specific controller oligonucleotide to initiate strand separation.
  • a first competitor primer oligonucleotide comprises a nucleic acid chain which includes at least the following properties:
  • a first competitor primer region in the 3 ' segment of the first competitor primer oligonucleotide capable of substantially sequence-specific binding to a strand of a nucleic acid chain to be amplified, and thus capable of competing with the first primer oligonucleotide for its primer binding site ,
  • a 3 ' end of the competitor primer which, following binding to the primer binding site in the target sequence, can be sequence-specifically extended by the polymerase to form a competitor-primer extension product
  • the total length of the first competitor primer oligonucleotide is between 10 and 80, in particular between 15 and 50, in particular between 20 and 30 nucleotides or their equivalents (eg nucleotide modifications).
  • the length of the 3 ' segment which may undergo complementary binding to an expected sequence variant of a target sequence, comprises substantially the same regions as the first region of the first primer. This ensures that both primers can competitively bind to the target sequence and this binding occurs approximately in the same temperature range.
  • the competitive binding and especially the competing primer extension using allele-specific sequence segments of the target nucleic acid usually leads to a further increase in specificity.
  • the structure of the first competitor primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions.
  • the first competitor primer comprises sequence segments which are said to be complementary to the first region of the controller oligonucleotide.
  • this first competitor oligonucleotide can not occur as an initiator of strand displacement by a controller oligonucleotide.
  • the first competitor primer oligonucleotide is a DNA oligonucleotide with a conventional 5 'to 3' arrangement of nucleotides.
  • a competitor primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are preferably located at the 5 ' end of the 3 ' segment.
  • the sequence length is between about 15-30 nucleotides, in particular between 5 and 20 nucleotides, wherein the sequence is predominantly complementary to the 3 ' segment of a strand of the amplification to be repressed allele variant of a target nucleic acid.
  • the first primer region may include nucleotide monomers which do not or only insignificantly affect the function of the polymerase, for example:
  • an allele-specific first primer is used in combination with an allele-specific controller oligonucleotide and an allele-specific competitor primer oligonucleotide.
  • a controller oligonucleotide ( Figures 2, 7-24, 29) comprises:
  • a first single-stranded region which can bind to the polynucleotide tail of the second region of the first primer oligonucleotide A second single-stranded region which can bind to the first region of the first primer oligonucleotide essentially complementary
  • a third single-stranded region which is substantially complementary to at least one segment of the extension product of the first primer extension product
  • controller oligonucleotide does not serve as a template for primer extension of the first or second primer oligonucleotide.
  • the sequence of the third region of the controller oligonucleotide is adapted to the sequence of the nucleic acid to be amplified, since this is a template for the order of the nucleotides in the extension product of a first primer.
  • the sequence of the second region of the controller oligonucleotide is adapted to the sequence of the first primer region.
  • the structure of the first region of the controller oligonucleotide is adapted to the sequence of the second region of the first primer oligonucleotide, especially the nature of the polynucleotide tail.
  • a controller oligonucleotide may also include other sequence segments that do not belong to the first, second or third region.
  • these sequences can be attached as flanking sequences at the 3 ' and 5 ' ends.
  • these sequence segments do not interfere with the function of the controller oligonucleotide.
  • the structure of the controller oligonucleotide preferably has the following properties:
  • the individual areas are covalently bonded to each other.
  • the binding can be done for example via conventional 5 ' -3 ' bond.
  • a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
  • a controller oligonucleotide may bind by its first region to the polynucleotide tail of the first primer oligonucleotide, which binding is mediated primarily by hybridization of complementary bases.
  • the length of this first region is 3 to 80 nucleotides, in particular 4 to 40 nucleotides, in particular 6 to 20 nucleotides.
  • the degree of sequence match between the sequence of the first region of the controller oligonucleotide and the sequence of the second region of the first primer oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%.
  • the binding of the first region of the controller oligonucleotide should preferably be made specifically to the second region of the first primer oligonucleotide under reaction conditions.
  • the sequence of the first region of the controller oligonucleotide is preferably chosen such that the number of complementary bases that can bind to the second region of the first primer oligonucleotide complementary between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies. Since the controller oligonucleotide is not a template for the polymerase, it may include nucleotide modifications that do not support polymerase function, which may be both base modifications and / or sugar-phosphate backbone modifications.
  • the controller oligonucleotide may include, for example, in its first region nucleotides and / or nucleotide modifications selected from the following list: DNA, RNA, LNA ("locked nucleic acids”: analogs having 2 ' -4 ' bridge linkage in the sugar moiety).
  • UNA locked Nucleic acids: no bond between 2 '-3' -atoms of the sugar moiety
  • PNA "peptide nucleic acids” analogs
  • PTO phosphorothioate
  • morpholino analogs 2 '-0-alkyl-RNA modifications (such as 2 '-OMe, 2' -0 propargyl, 2 '-0- (2-methoxyethyl), 2' -0-propyl-amine), 2 - halogen-RNA, 2 '-amino-RNA, etc.
  • Nucleotides or nucleotide modifications are linked to one another, for example, by conventional 5 ' -3 ' or 5 ' -2 ' binding.
  • a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
  • the controller oligonucleotide may include nucleotides and / or nucleotide modifications in its first region, the nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and its analogues, iso-guanines and its analogues.
  • nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and
  • the controller oligonucleotide may include in its first region non-nucleotide compounds selected from the following list: Intercalating substances which may affect the binding strength between the controller oligonucleotide and the first primer oligonucleotide, e.g. MGB, naphthalene etc. The same elements can also be used in the second region of the first primer.
  • the controller oligonucleotide may include in its first region non-nucleotide compounds, e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.
  • non-nucleotide compounds e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.
  • the controller oligonucleotide may bind by means of its second region to the first primer region of the first primer oligonucleotide, the binding being mediated essentially by hybridization of complementary bases.
  • the length of the second region of the controller oligonucleotide is matched to the length of the first region of the first primer oligonucleotide and is preferably consistent therewith. It is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides.
  • the sequence of the second region of the controller oligonucleotide is preferably complementary to the first region of the first primer oligonucleotide. The degree of complementarity is between 80% and 100%, in particular between 95% and 100%, in particular at 100%.
  • the second region of the controller oligonucleotide preferably includes nucleotide modifications which prevent the polymerase on the extension of the first primer oligonucleotide, but do not block the formation of complementary double strands, or not substantially prevent, for example, 2 '-0-alkyl-RNA analogues (eg, 2' -0-Me, 2 '-0- ( 2-methoxyethyl), 2 '-0- propyl, 2' -0-propargyl nucleotide modifications), LNA, PNA or morpholino nucleotide modifications.
  • Single nucleotide monomers are preferably linked via 5 ' -3 ' bond, but an alternative 5 ' -2 ' bond between nucleotide monomers may also be used.
  • the sequence length and nature of the first and second regions of the controller oligonucleotide are preferably selected such that binding of these regions to the first primer oligonucleotide is reversible under reaction conditions, at least in one reaction step of the process. This means that the controller oligonucleotide and the first primer oligonucleotide can bind specifically to each other, but this bond should not lead to the formation of a permanently stable under reaction conditions complex of both elements.
  • an equilibrium between a bound complex form of controller oligonucleotide and the first primer oligonucleotide and a free form of individual components under reaction conditions should be sought or made possible at least in one reaction step. This ensures that at least a portion of the first primer oligonucleotides can be in free form under reaction conditions and can interact with the template to initiate a primer extension reaction. On the other hand, it will be ensured that corresponding sequence regions of the controller oligonucleotide are available for binding with an extended primer oligonucleotide.
  • the proportion of free, single-stranded and thus reactive components can be influenced: by lowering the temperature, first primer oligonucleotides bind to the controller oligonucleotides, so that both participants bind a complementary double-stranded complex.
  • concentration of single-stranded forms of individual components can be lowered.
  • An increase in temperature can lead to the dissociation of both components into single-stranded form.
  • the concentration of single-stranded forms in the reaction mixture can thus be influenced.
  • desired reaction conditions can be brought about during corresponding reaction steps. For example, by using temperature ranges approximately at the level of the melting temperature of complexes of controller oligonucleotide / first primer oligonucleotide portions of each free forms of individual components can be influenced.
  • the temperature used increases destabilizing complexes comprising controller oligonucleotide / first primer oligonucleotide such that, during this reaction step, individual complex components become, at least temporarily, single-stranded, thereby being able to interact with other reactants.
  • a first sequence region of the controller oligonucleotide may be released from the double-stranded complex with a non-extended first primer, and thus may interact with the second sequence region of an extended first primer oligonucleotide, thereby initiating strand displacement.
  • release of a first, non-extended primer oligonucleotide from a complex comprising controller oligonucleotide / first primer oligonucleotide results in the first primer region becoming single-stranded and thus able to interact with the template such that primer extension by a polymerase can be initiated.
  • the temperature used does not have to correspond exactly to the melting temperature of the complex of controller oligonucleotide / first primer oligonucleotide. It is sufficient if the temperature in a reaction step is approximately in the range of the melting temperature.
  • the temperature in one of the reaction steps comprises ranges of Tm +/- 10 ° C, in particular Tm +/- 5 ° C, in particular Tm +/- 3 ° C of the complex of controller oligonucleotide / first primer oligonucleotide.
  • Such a temperature can be set, for example, in the context of the reaction step, which comprises a sequence-specific strand displacement by the controller oligonucleotide.
  • reaction conditions are maintained over the entire duration of the amplification reaction in which there is equilibrium between a complex oligonucleotide-controller design and the first primer Oligonucleotide and a free form of individual components is possible.
  • the ratio between a complex form of controller oligonucleotide and the first primer oligonucleotide and free forms of individual components can be influenced both by reaction conditions (eg temperature and Mg 2+ concentration) and by structures and concentrations of individual components.
  • the sequence length and nature of the first and second regions of the controller oligonucleotide are, in certain embodiments, chosen such that under given reaction conditions (eg, in the strand displacement displacement step by the controller oligonucleotide) the ratio between a proportion of free controller oligonucleotide and a portion of a controller oligonucleotide complexed with a first primer oligonucleotide comprises the following ranges: from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, more preferably from 1:10 to 10: 1.
  • the ratio between a proportion of a free first primer oligonucleotide and a proportion of a first primer oligonucleotide complexed with a controller oligonucleotide comprises ranges of from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, more preferably from 1:10 to 10: 1.
  • the concentration of the first primer oligonucleotide is higher than the concentration of the controller oligonucleotide. This results in an excess of the first primer in the reaction and the controller oligonucleotide must be released for its effect of binding with the first primer by choosing the appropriate reaction temperature. In general, this is done by raising the temperature to sufficient levels of free forms of the controller oligonucleotide.
  • the concentration of the first primer oligonucleotide is lower than the concentration of the controller oligonucleotide.
  • the concentration of the first primer oligonucleotide is lower than the concentration of the controller oligonucleotide.
  • the controller oligonucleotide may bind by means of its third region to at least one segment of the specifically synthesized extension product of the first primer oligonucleotide. Binding is preferably by hybridization of complementary bases between the controller oligonucleotide and the extension product synthesized by the polymerase.
  • the sequence of the third region should preferably have a high complementarity to the extension product. In certain embodiments, the sequence of the third region is 100% complementary to the extension product.
  • the binding of the third region is preferably carried out on the segment of the extension product, which connects directly to the first region of the first primer oligonucleotide.
  • the segment of the extension product is preferably in the 5 ' segment of the entire extension product of the first primer oligonucleotide.
  • the binding of the third region of the controller oligonucleotide preferably does not occur over the entire length of the extension product of the first primer oligonucleotide.
  • a segment remains unbound at the 3 ' end of the extension product.
  • This 3 ' -terminal segment is necessary for the binding of the second primer oligonucleotide.
  • the length of the third region is adapted accordingly so that the third region binds to the 5 ' -terminal segment of the extension product on the one hand, while on the other hand does not bind the 3 ' -step segment of the extension product.
  • the total length of the third region of the controller oligonucleotide is from 2 to 100, in particular from 6 to 60, in particular from 10 to 40 nucleotides or their equivalents.
  • the controller oligonucleotide may enter into a complementary bond with the segment of the extension product over that length, thereby displacing this 5 ' segment of the extension product from binding with its complementary template strand.
  • the length of the 3 ' -terminal segment of the extension product which is not bound by the controller oligonucleotide comprises, for example, ranges between 5 and 200, in particular between 5 and 100, in particular between 5 and 60 nucleotides, in particular between 10 and 40, in particular between 15 and 30 nucleotides.
  • This 3 ' segment of the extension product is not displaced from the controller oligonucleotide from binding with the template strand. Even with a fully bound third region of the controller oligonucleotide to its complementary segment of the extension product, the first primer extension product may remain bound to the template strand via its 3 ' -terminal segment.
  • the bond strength of this complex is preferably chosen so that it can dissociate spontaneously under reaction conditions (step e), for example. This may be recordable, be achieved by that the melting temperature of the complex is from the 3 '- perennialn segment of the extension product of the first primer oligonucleotide and its template strand approximately in the range of the reaction temperature or below the reaction temperature at a corresponding reaction step (reaction step e). With little stability of this complex in the 3 ' segment of the extension product, complete binding of the third region of the controller oligonucleotide to the 5 ' segment of the extension product results in rapid dissociation of the first primer extension product from its template strand.
  • the controller oligonucleotide as a whole has a suitable structure to perform its function: under appropriate reaction conditions, it is capable of sequence-specific displacement of the extended first primer oligonucleotide from binding with the template strand, thereby converting the template strand into single-stranded form, and thus for further binding with a novel first primer oligonucleotide and its target sequence-specific extension by the polymerase.
  • regions one, two and three of the controller oligonucleotide should be predominantly in single-stranded form under reaction conditions. Therefore, double-stranded self-complementary structures (eg hairpins) should be included in these As far as possible, they can be avoided since they can reduce the functionality of the controller oligonucleotide.
  • double-stranded self-complementary structures eg hairpins
  • the controller oligonucleotide should not appear as a template in the method of the invention, therefore the first primer oligonucleotide, when attached to the controller oligonucleotide under reaction conditions, should not be extended by the polymerase.
  • the 3 ' end of the first primer oligonucleotide does not remain elongated when the first primer oligonucleotide binds to the controller oligonucleotide under reaction conditions.
  • the degree of blockage / inhibition / slowing / aggravation of the reaction may be between complete expression of this property (e.g., 100% blockage under given reaction conditions) and a partial expression of this property (e.g., 30-90% blockade under given reaction conditions).
  • the nucleotide modifications may include base modifications and / or sugar-phosphate-residue modifications.
  • the sugar-phosphate modifications are preferred because any complementary sequence of a controller oligonucleotide can be assembled by combining with conventional nucleobases.
  • the nucleotides with modifications in the sugar-phosphate residue, which can lead to hindrance or blockage of the synthesis of the polymerase include, for example: 2 '-0-alkyl modifications (eg, 2' -0-methyl, 2 '-0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications), 2 '-amino-2' -Deoxy- nucleotide modifications, 2 'amino-alkyl-2' -Deoxy- Nucleotide modifications, PNA, morpholino modifications, etc.
  • 2 '-0-alkyl modifications eg, 2' -0-methyl, 2 '-0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications
  • 2 '-amino-2' -Deoxy- nucleotide modifications e.g, 2'-alkyl modifications
  • the blockade can be accomplished by either a single nucleotide modification or only by coupling multiple nucleotide modifications in series (e.g., as a sequence fragment consisting of modified nucleotides). For example, at least 2, in particular at least 5, in particular at least 10, of such nucleotide modifications can be coupled side by side in the controller oligonucleotide.
  • a controller oligonucleotide may comprise a uniform type of nucleotide modifications or may comprise at least two different types of nucleotide modification.
  • nucleotide modifications in the controller oligonucleotide is preferably intended to prevent the polymerase from extending the 3 ' end of a first primer oligonucleotide bound to the controller oligonucleotide.
  • nucleotide modifications are located in the second region of the controller oligonucleotide.
  • nucleotide modifications are located in the third region of the controller oligonucleotide.
  • nucleotide modifications are located in the second and third regions of the controller oligonucleotide.
  • the second region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%.
  • the third region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%, in particular at least 90%.
  • the entire third region comprises nucleotide modifications that prevent a polymerase from extending a primer bound to such a region using the controller oligonucleotide as a template.
  • the entire third and second regions include such nucleotide modifications.
  • the entire first, second, and third regions include such nucleotide modifications.
  • the controller oligonucleotide may consist entirely of such nucleotide modifications.
  • Such modified controller oligonucleotides can be used, for example, in multiplex analyzes in which further primers are used. This is to prevent inadvertent primer extension reactions on one or more controller oligonucleotides.
  • sequence of nucleobases from these nucleotide modifications is adapted to the requirements of the sequence in each area.
  • the remaining portion may be natural nucleotides, or nucleotide modifications that do not or only marginally inhibit polymerase function, eg, DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides.
  • further modifications for example base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or non-nucleotide modifications such as dyes, or MGB modifications, etc.
  • base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or
  • a segment of the controller oligonucleotide having nucleotide modifications that prevent extension of the 3 ' end of a first primer oligonucleotide bound to the controller oligonucleotide by the polymerase is termed a "second blocking moiety".
  • the length of this segment may include from 1 to 50 nuclide modifications, especially between 4 and 30.
  • this segment may be located in the controller oligonucleotide such that the 3 ' end of the bound first primer Oligonucleotide lies in this segment.
  • this segment can span regions two and three.
  • additional blocking moieties may be introduced, for example, a fourth blocking moiety which may be at the same position in the controller oligonucleotide as the second blocking unit or a deviating position.
  • the fourth blocking unit may lie in the 5 ' direction from the second blocking unit.
  • the primer blockade by such a fourth blocking moiety follows the same principle as that of the second blocking moiety: a primer which is capable of complementarily binding to the controller oligonucleotide is not extended by polymerase.
  • the controller oligonucleotide is prevented from serving as a template for other primers, eg a competitor primer.
  • a segment of the controller oligonucleotide with nucleotide modifications which prevent the extension of the 3 ' end of a further primer oligonucleotide bound to the controller oligonucleotide (eg a competitor primer oligonucleotide) by the polymerase is termed a “fourth blocking" Unit ".
  • the composition of such a "fourth blocking unit” can be carried out analogously to the "second blocking unit".
  • no linker structures or spacer structures such as C3, C6, HEG linkers, are used to prevent the 3 ' end extension of a first primer oligonucleotide bound to the controller oligonucleotide.
  • the controller oligonucleotide may comprise, in addition to regions one, two and three, further sequence segments which, for example, flank the abovementioned regions in the 5 ' segment or 3 ' segment of the controller oligonucleotide.
  • sequence elements may be used, for example, for other functions, such as interaction with probes, binding to a solid phase, etc. Such regions preferably do not interfere with the function of regions one to three.
  • the length of these flanking sequences may be, for example, between 1 to 50 nucleotides.
  • a controller oligonucleotide may comprise at least one element for immobilization on a solid phase, eg a biotin residue.
  • a controller oligonucleotide may include at least one element for detection, eg, a fluorescent dye.
  • the strand displacement of the template strands is influenced by newly synthesized strands.
  • the strand displacement and / or separation is either slowed down quantitatively or completely eliminated. It is thus not at all or less often the transfer of primer binding sites in the single-stranded state. Thus, there are no or fewer primer binding sites available for a new interaction with primers. Thus, the system of both primer extension products is rarely put into an active state or an active state is not reached.
  • the efficiency of the double-stranded opening of the newly synthesized primer extension products after each individual synthesis step affects the potentially achievable yields in subsequent cycles: the fewer free / single-stranded primer binding sites of a nucleic acid chain to be amplified at the beginning of a synthesis step The lower the number of newly synthesized strands of the nucleic acid chain to be amplified in this step. In other words, the yield of a synthesis cycle is proportional to the amount of primer binding sites available for interaction with corresponding complementary primers. Overall, this can be realized a control circuit.
  • This control circuit corresponds to a real-time / on-line control of synthesized fragments: the sequence control takes place in the reaction mixture while the amplification takes place.
  • This sequence control follows a predetermined pattern and the oligonucleotide system (by strand-opening action of controller oligonucleotide) can decide between "correct” and "non-correct” states without external interference. In the correct state, the synthesis of sequences is continued; in the incorrect state, the synthesis is either slowed down or completely prevented. The resulting differences in the yields of "correct” and “incorrect” sequences after each step affect the entire amplification comprising a variety of such steps.
  • a target sequence specific controller oligonucleotide is preferably constructed in such a way that it is able to participate in the amplification of at least one predefined sequence variant of a target sequence.
  • an amplification system comprising at least one controller oligonucleotide is designed such that the expected position of an allelic variant of a target sequence corresponds to a corresponding segment or a corresponding position in the controller oligonucleotide.
  • An allele-specific controller oligonucleotide is preferably constructed such that it is capable of preferentially effecting the amplification of a sequence variant of a target sequence (eg, allele 1), wherein in another sequence variant of the same target sequence (eg, allele 2 ) the amplification does not proceed at all or only with reduced efficiency or does not take place in the given time, or results in a yield of amplification products which is insufficient for a detection.
  • a target sequence eg, allele 1
  • another sequence variant of the same target sequence eg, allele 2
  • An allele-specific controller oligonucleotide is thus not only target-specific, but also allele-specific.
  • Such a controller oligonucleotide thus comprises target sequence-specific sequence segments as well as allele-specific sequence segments.
  • a controller oligonucleotide comprises at least one sequence segment having a sequence composition complementary to a specific allelic variant of a target sequence. Furthermore, a controller oligonucleotide preferably comprises at least one sequence segment which comprises a complementary sequence which is identical for all sequence variants of a target sequence. In certain embodiments, a controller oligonucleotide comprises at least one sequence segment capable of complementarily binding to a variant of a polymorphic locus of a target sequence.
  • multiple controller oligonucleotides are provided, each comprising allele-specific sequence segments.
  • the length of a sequence segment of a controller oligonucleotide which is completely complementary to the polymorphic locus of a starting nucleic acid chain can comprise regions of one nucleotide of up to 100 nucleotides, in particular of one nucleotide of up to 50 nucleotides, in particular of one nucleotide of up to 20 nucleotides.
  • the length of at least one sequence segment of a controller oligonucleotide which is complementary to uniform sequence segments of a target sequence may comprise the following ranges: from 4 to 100 nucleotides, in particular from 6 to 100 nucleotides, in particular from 8 to 50 nucleotides.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the third region of the controller oligonucleotide.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the second region of the controller oligonucleotide.
  • a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is partially and / or completely located in the second and third regions of the controller oligonucleotide.
  • the position of allele-specific sequence segments of a controller oligonucleotide can thus be divided into three groups.
  • the first group comprises allele-specific sequence segments which are detected in both the first primer oligonucleotide and the controller oligonucleotide. This position thus at least partially encompasses the second region of the controller oligonucleotide and the first region of the first primer oligonucleotide.
  • the second group comprises allele-specific corresponding sequence segments which are only covered by the controller oligonucleotide, both primers (the first primer and the second primer) are only target sequence specific but not allele specific.
  • the position thus comprises, at least in part, the third region of the controller oligonucleotide which is intended to bind complementarily to the 5 ' segment of the portion of the first primer extension product synthesized by the polymerase.
  • the third group comprises allele-specific sequence segments which are detected in both the second primer oligonucleotide and the controller oligonucleotide. This position thus at least partially encompasses the third region of the controller oligonucleotide predominantly in the 5 ' segment of the controller oligonucleotide.
  • allelic variants of a target sequence encompasses different mechanisms in these groups, which, for example, must be taken into account when choosing reaction conditions.
  • primers play an essential role in discrimination.
  • the complementary primer binding to a corresponding primer binding site of an allelic variant of the target sequence and initiation of a synthesis of a primer extension product by the polymerase determine the extent of the different amplifications.
  • the controller oligonucleotide interacts only with the first primer (first group) and with the complementary sequence segment to the 3 ' segment of the second primer (third group).
  • the successful strand displacement by the controller oligonucleotide thus depends primarily on the corresponding complementary design of these moieties of primers and the controller oligonucleotide.
  • the synthesized segment content of the respective primer Extension product which lies between both primers represents a uniform sequence composition for an allelic variant of a common target sequence. For this reason, it is advantageous to carry out the amplification under stringent hybridization conditions which promote allele-specific initiation of a synthesis. Use of another allele-specific competitor primer can further enhance specific initiation of the synthesis.
  • the initiation of primer extension product synthesis plays a secondary role, as the primers used bind to primer binding sites that are a consistent composition for all potential allelic variants of a target sequence.
  • the discrimination takes place only with the participation of the controller oligonucleotide, which participates by sequence-specific or predominantly specific strand displacement in the separation of the first and the second primer extension product.
  • a fully complementary sequence of the third region of the controller oligonucleotide is preferably used which can form a perfect match with at least one allelic variant of the target sequence.
  • the amplification of different allelic variants thus requires in this embodiment a combination of one allele-specific controller oligonucleotide.
  • a deviation from fully-complementary sequence compositions leads to deviating amplification efficiencies.
  • the first primer extension product consisting predominantly of DNA
  • the second primer extension product also comprising DNA. Allele-specific sequence design of this sequence segment of the controller oligonucleotide corresponding to an allelic variant allows a perfect match / perfect binding to the first primer extension product for both competing strands.
  • a controller oligonucleotide is capable of successfully displacing the second primer extension product from its binding with the first primer extension product with its corresponding sequence segment. The separation of both primer extension products allows for exponential amplification.
  • the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises predominantly or exclusively DNA monomers.
  • sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises both DNA and DNA modifications.
  • the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises predominantly or exclusively DNA modifications.
  • the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises predominantly or exclusively DNA modifications.
  • modifications can have an effect on binding of the controller oligonucleotide to allele-specific variates of primer - exercise extension products.
  • the segment of a controller oligonucleotide that corresponds to an allele variant lies in the third region of the controller oligonucleotide, wherein this segment of the strand of the controller oligonucleotide is predominantly composed of DNA nucleotides.
  • this segment lies in the 5 ' direction of the second blocking unit.
  • the length of this segment corresponding to the polymorphic locus comprises in particular 1 to 20 nucleotides.
  • the composition of the nucleotides in this fully complementary corresponding segment of the controller oligonucleotide comprises at least 70% of DNA nucleotides, in particular 80%, in particular more than 95% of DNA nucleotides.
  • the corresponding position in the central region of the controller oligonucleotide strand which on both sides to this corresponding position of DNA complementary to the target sequence Surrounded by the strand of the controller oligonucleotide at least 4 DNA monomers, in particular at least 6 DNA nucleotides, in particular at least 10 DNA nucleotides in both directions of the expected SNP or point mutation.
  • Such arrangements of DNA monomers around an expected SNP site or point mutation or single nucleotide allelic variant makes it possible to maintain a single-stranded conformation which is characteristic for the B-shape (so-called single strand persistence length).
  • strand displacement occurs through the controller oligonucleotide using a corresponding segment comprising DNA monomers.
  • a controller oligonucleotide which can form a complementary bond with the first primer extension product with its 5 ' end.
  • allelic variants which comprise only one nucleobase, eg SNP or Point mutations
  • the corresponding sequence segment is preferably arranged at a distance from the 5 ' end of the controller oligonucleotide, which comprises lengths of 10 to 60 nucleotides, in particular 20 to 50 nucleotides, in particular 30 to 40 nucleotides.
  • DNA nucleotides as monomers of controller oligonucleotides must not result in the controller oligonucleotide being used as a template for primer extension using one of the primers employed by a polymerase used.
  • DNA nucleotides for example A, C, T or G
  • controller oligonucleotides which can form complementary base pairs (A: T, G: C) with the first primer extension products, generally lead to amplification reactions in good Exploit.
  • the effect of a mismatch on amplification can be estimated by determining stabilities of potential duplexes comprising an allele-specific controller oligonucleotide having a defined sequence and a potential primer extension product or its moieties, eg, only the synthesized moiety of a primer extension product.
  • the duplexes are formed in the absence of second primer extension products.
  • the binding of such duplexes is more stable than the binding of duplexes comprising at least one mismatch position. This stability can be detected by melting temperature measurement.
  • Differences between amplification reactions of allelic variants are generally greater the greater the difference in stability between a perfect-match duplex and a mismatch duplex comprising an allele-specific controller oligonucleotide and a potential first primer extension product. Such differences between reactions, for example, by those for a reaction required time to reach a certain amount of products. Such differences in the time between amplification reactions of perfect-match and mismatch allele variants can also be seen as a capacity for discrimination: the greater the time difference, the higher the discrimination between each allele variants.
  • modifications in the controller oligonucleotide eg in the region of the second blocking unit for preventing the extension of the first primer or a competitor primer, a different discrimination or even tolerance to certain mismatches can take place.
  • 2 '-0-alkyl modifications may be employed within the second blocking unit.
  • Such nucleotide modifications can alter the conformation of a duplex (from B-form of a DNA: DNA duplex to A-like form of a DNA: RNA or DNA: mod. DNA duplex). In this case, especially in the base pairing between G: C and G: U or G: T, a change in the discrimination can take place.
  • RNA the behavior of the G: U changes depending on the strand-form: in the case of RNA, a G: U base pair usually forms a sufficiently stable base pairing, in the case of DNA a G: U Mismatch usually leads to a weakening of the binding of both strands.
  • 2 ' alkyl nucleotide-comprising modifications are used in the controller oligonucleotide (eg, within the second blocking moiety).
  • a 2 '-0-Me Cytosine (C *) or 2' -0-Me Adenosine (A *) is used.
  • Such modified nucleotides allow good discrimination between individual sequence variants (where perfectly match binding comprises C * : dG and A * : U or A * : T and mismatch includes, for example, C * : dA or A * : dC).
  • allelic variants When using nucleotide modifications that allow inadequate discrimination of allelic variants, multiple allelic variants can thus be amplified simultaneously.
  • a 2 '-0-Me guanosine or 2' -0-Me Uridine also universal bases such as inosine, or 5-nitro-indole monomers to be candidates for the tolerance allele composition belong.
  • Such modifications of a controller oligonucleotide strand can be arranged at expected corresponding positions to particular allelic variants. Thus, this lack of discrimination in some modifications can be considered as follows:
  • the variant is an allelic sequence corresponding segment in the third area of the controller oligonucleotide which 'comprises predominantly or exclusively 2 -0-alkyl modifications.
  • the segment of a controller oligonucleotide corresponding to an allelic variant lies in the third region of the controller oligonucleotide, this segment of the strand of the controller oligonucleotide being composed predominantly of 2 'to 0 alkyl modifications.
  • this segment is within the second blocking unit or in the 5 ' direction of the second blocking unit.
  • the length of this segment corresponding to the polymorphic locus comprises in particular 1 to 20 nucleotides.
  • the composition of the nucleotides in this fully complementary corresponding segment of the controller oligonucleotide comprises at least 50% while 2 '-0-alkyl modifications, more preferably 80%, in particular more than 95% 2' -0-alkyl modifications.
  • the corresponding position is in the middle region of the controller oligonucleotide strand.
  • This controller oligonucleotide strand is 'surrounded -0-alkyl modifications, the strand of the controller oligonucleotide at least four 2' on both sides to this position corresponding of complementary to the target sequence 2 -0-alkyl modifications, in particular at least six 2 ' -O-Alkyl modifications, in particular at least 10 2 ' -O-alkyl modifications in both directions of the expected SNP or point mutation comprises such an arrangement of DNA monomers to an expected SNP site or point
  • Mutation or single nucleotide allele variant allows the maintenance of a single-stranded conformation, which can be referred to as A-like form.
  • strand displacement occurs through the controller oligonucleotide using a corresponding segment comprising nucleotides with 2 'to O alkyl
  • a controller oligonucleotide which can form a complementary bond with the first primer extension product with its 5 ' end.
  • allelic variants which comprise only one nucleobase, eg SNP or point mutations, the corresponding sequence segment is preferably arranged at a distance from the 5 ' end of the controller oligonucleotide, which lengths of 10 to 60 nucleotides, in particular 20 to 50 nucleotides, in particular 30 to 40 nucleotides.
  • Controller oligonucleotides comprising 2 '-0-alkyl modifications of cytosine can form a sufficient base pairing with dG-nucleotide at corresponding locations in the first primer extension product and thus support the amplification of such allelic variants generally.
  • Controller oligonucleotides comprising 2 '-0-alkyl modifications of adenosine able to form a sufficient base pairing with dT or dU nucleotide at corresponding locations in the first primer extension product and thus support the amplification of such allelic variants generally.
  • Controller oligonucleotides comprising 2 '-0-alkyl modifications of guanosine can form a sufficient base pairing with dC and dU nucleotide at corresponding locations in the first primer extension product and thus support the amplification of both allelic variants generally.
  • Controller oligonucleotides comprising 2 '-0-alkyl modifications of uridine can form a sufficient base pairing with dA and dG-nucleotide at corresponding locations in the first primer extension product and thus support the amplification of both allelic variants generally.
  • the displacement of the second primer extension product from binding with the first primer extension product by means of a sequence-dependent strand displacement by the controller oligonucleotide forms a partial step in the amplification.
  • the reaction conditions during this step are adjusted accordingly.
  • the reaction temperature and the reaction time are chosen so that the reaction can take place successfully.
  • the strand displacement by the controller oligonucleotide until detachment / dissociation of the second primer extension product from binding with the first primer extension product may be spontaneous in the context of temperature dependent / temperature related separation of both primer extension products.
  • Such a dissociation has a favorable effect on the kinetics of the amplification reaction and can be influenced by the choice the reaction conditions are influenced, for example by means of temperature conditions. The temperature conditions are therefore chosen such that successful strand displacement by complementary binding of the controller oligonucleotide favors dissociation of the second primer extension product from the 3 ' segment of the first primer extension product.
  • the strand displacement by the controller oligonucleotide proceeds until the dissociation / dissociation of a 3 ' segment of the second primer extension product (P2.1-Ext) or the template strand (M1) from the complementary binding with the first primer.
  • Extension product (P1 .1-text) In this case, this 3 ' segment of the second primer extension product (P2.1-Ext) or the template strand (M1) comprises at least one complementary region to the first primer and a complementary segment to the first primer extension product (P1 1-Ext) the enzymatic synthesis has arisen.
  • the 3 ' segment of the first primer extension product (P1 .1-Ext) is in such a complex complementary hybridized to the second primer extension product (P2.1 -Ext) or to a template strand (M1).
  • a new primer extension product (P1 .2) can be attached to this single-stranded sequence segment of the complex (P2.1 Ext) under reaction conditions and thus initiate a synthesis of a new first primer extension product (P1 .2-Ext) by a polymerase.
  • P2.1 Ext single-stranded sequence segment of the complex
  • P1 .2-Ext first primer extension product
  • polymerase-induced strand displacement can also dissociate the complex (C1.1 / P1 1 -Ext / P2.1. -Ext) lead.
  • the controller oligonucleotide, the temperature-dependent double strand destabilization and the strand displacement by the polymerase act synergistically and complementarily. This results in a dissociation of the 3 ' segment of the first primer Extension product (P1 .1 -EX) of complementary portions of the second primer extension product (P2.1-Ext).
  • Such dissociation has a favorable effect on the kinetics of the amplification reaction and may be influenced by the choice of reaction conditions, e.g. by means of temperature conditions.
  • the involvement of the polymerase-mediated synthesis-dependent strand displacement in the dissociation of P1 .1-Ext and P2.1 -xt has a favorable effect on strand separation.
  • the temperature in this step includes, for example, ranges from 15 ° C to 75 ° C, especially from 30 ° C to 70 ° C, especially from 50 ° C to 70 ° C.
  • the controller oligonucleotide Given the length of the first region of the controller oligonucleotide and the second region of the first primer oligonucleotide (including, for example, ranges of from 3 to 25 nucleotide monomers, more preferably from 5 to 15 nucleotide monomers), a strand displacement reaction can generally be successfully initiated. With complete complementarity of the controller oligonucleotide to corresponding portions of the first primer extension product, the controller oligonucleotide can bind to the first primer extension product except for the 3 ' segment of the first primer extension product and displace the second primer extension product. The second primer extension product thus remains in association with the 3 ' segment of the first primer extension product.
  • the strength of this compound can be influenced by temperature. Upon reaching a critical temperature, this compound can decay and dissociate both primer extension products. The shorter the sequence of the 3 ' segment, the more unstable this compound and the lower the temperature which causes spontaneous dissociation.
  • a spontaneous dissociation can be achieved for example in the temperature range, which is approximately at the melting temperature.
  • the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 3 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by the controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
  • the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 5 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
  • the temperature of the strand displacement steps through the controller oligonucleotide is above the melting temperature of the complex comprising the 3 ' segment of the first primer extension product other than controller oligonucleotide and the second primer oligonucleotide and the second primer extension product, respectively.
  • a temperature includes temperature ranges from about Tm + 5 ° C to Tm + 20 ° C, especially from Tm + 5 ° C to Tm + 10 ° C.
  • a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
  • Sequence lengths from 9 to about 18 nucleotides.
  • spontaneous dissociation can usually be achieved already at temperature ranges between 40 ° C and 65 ° C. Higher temperatures also lead to dissociation.
  • a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
  • Sequence lengths from 15 to about 25 nucleotides.
  • spontaneous dissociation can usually be achieved already at temperature ranges between 50 ° C and 70 ° C. Higher temperatures also lead to dissociation.
  • a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
  • Sequence lengths from 20 to about 40 nucleotides.
  • a spontaneous dissociation usually already at temperature ranges between 50 ° C and 75 ° C can be achieved. Higher temperatures also lead to dissociation.
  • composition of the 3 ' segment of the first primer extension product and optionally an introduction of melting temperature-influencing oligonucleotide modifications (eg MGB) or reaction conditions (eg TPAC, betaine) can influence the choice of temperature.
  • An appropriate adaptation can therefore be made.
  • all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / byproducts.
  • stringent conditions include, for example, higher temperatures, for example above 50 ° C.
  • the single steps of strand displacement by controller oligonucleotides proceed at the same temperature as the synthesis of the first and second primer extension products. In certain embodiments, the single steps of strand displacement by controller oligonucleotides occur at a temperature that is different from the temperature of the particular synthesis of the first and second primer extension products. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide is included same temperature. In certain embodiments, synthesis of the second primer extension product and strand displacement by the controller oligonucleotide proceeds at the same temperature.
  • the concentration of the controller oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
  • Primer oligonucleotides comprising additional sequence segments:
  • first primer and the second primer can be considered as so-called “base structure of the primer” or “minimal structure of the primer”.
  • Such basic structures of oligonucleotides with primer function comprise sequence segments which are essential for the execution of the amplification reaction.
  • Method are advantageous, for example, the first and second region of the first primer.
  • Such a basic structure of the primer can be extended by additional, additional sequence segments.
  • additional sequence segments include structures which, while not necessary for the performance of the amplification process, may nevertheless be useful for other tasks.
  • Such additional sequence segments may optionally be introduced into a primer and used for further functions or reactions. This can be done by the
  • Polymerase synthesized primer extension products (starting, for example, from the first and / or the second primer) can be linked to such sequences segments. This achieves integration of such additional sequence segments and primer extension products into a molecular structure. Such integration may be advantageous in certain embodiments.
  • probes may be designed according to such a principle of intra-molecular binding, e.g. as part of Scorpion primers.
  • sequence segments can be used to bind further
  • a sequence-specific intermolecular binding can be achieved using stringent conditions. Such interactions can for example, for the binding of amplification products to a solid phase by complementary binding to immobilized oligonucleotides.
  • primer barcoding Use of further sequence segments for the unique coding or sequence-specific labeling of primers and primer extension products emanating therefrom (so-called primer barcoding). This is used, for example, for NGS library preparation (Stählberg et al Nucleic Acids Res. 2016 Jun 20; 44 (11): e105). In the sequence analysis of primer extension products, such a label can be used to assign sequences later.
  • spacer-sequence sequences which are not intended to bind a specific interaction partner, but serve primarily to increase the distance between adjacent sequences.
  • Such additional sequences may either be positioned on the copiable portion of the primer or added to the non-clippable portion of the primer. Several factors play a role in judging whether a sequence segment is copied or not.
  • nucleotide modifications used eg C3, HEG, 2 ' -Ome etc.
  • positioning of the sequence segment in the respective oligonucleotide, nucleotide modifications used can decide whether or not a sequence segment is used as a template during a process step.
  • an additional sequence segment is introduced into the copyable region of the primer, eg, at the 5 ' segment of the copiable portion of the second primer, so that, for example, in reading the primer sequence during a synthesis of a target sequence, additional sequence Segments are also read from the polymerase.
  • the length of such additional sequence segment includes ranges of 3 to 50 nucleotides. The composition of these sequence segments leaves at this
  • this sequence segment thus serves as a template for polymerase-dependent synthesis.
  • this sequence segment will be
  • nucleotides e.g. dA, dG, dC, dT.
  • additional sequence segments may be positioned, for example, at the 5 ' terminus of the primer, which is not useful in the synthesis of specific
  • Amplification fragments comprising a target sequence to be copied.
  • This can be achieved, for example, by positioning one or more modifications or chemical groups which prevents polymerase from the synthesis of a complementary strand (eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 'to- Ome modifications Etc.).
  • a complementary strand eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 'to- Ome modifications Etc.
  • Such modification may for example be positioned at the 5 'terminus of the copyable portion of the second primer and obstruct the continuation of the synthesis.
  • an HEG group may be introduced at the 5 ' end of the copiable segment of the second primer, followed by an additional sequence segment.
  • an additional sequence segment may be positioned at the 5 ' terminus of the second region of the first primer. Such localization of additional sequence segments prevents synthesis of a complementary strand during regular synthesis of specific amplification products comprising a target sequence.
  • the length of such additional sequence segment includes ranges of 3 to 50 nucleotides.
  • the base composition may comprise, for example, natural nucleobases (A, G, C, T, U, inosine) or modifications at different positions of nucleotides (eg at the bases such as 2-amino-adenine, iso-guanine, iso-cytosines, 5-propargyl-Uridine, 5- propargyl cytosines or the sugar-phosphate backbone, such as LNA, 2 '-OMe, 2 - halogen, etc.).
  • a first primer and additional sequence segments are combined to form an oligonucleotide.
  • a second primer and additional sequence segments are combined to form an oligonucleotide.
  • additional structures may be chosen from among
  • such additional sequence segments do not interact with the first or second primer region of the first primer. In certain embodiments, such additional sequence segments do not interact with the controller oligonucleotide. In certain embodiments, such additional sequence segments do not interact with other primers in the reaction. In certain embodiments, such additional sequence segments do not interact with P1.1 ext or P2.1 ext or other amplification fragments comprising a target sequence. In certain embodiments, such additional sequence segments do not form reaction-stable double-stranded portions with the first or second region of the first primer that completely inhibit the function of the first or second region.
  • such additional sequence segments do not interact with the second primer.
  • such additional sequence segments do not interact with the 3 ' segment of the second primer.
  • the first primer comprises at its 5 ' terminus of the second region an additional sequence segment of the first primer (variant sequence variant P1).
  • This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers).
  • this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copiable first region of the first primer.
  • the additional sequence variant P1 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
  • the second primer comprises at its 5 ' terminus an additional sequence segment of the second primer (variant sequence variant P2).
  • This segment optionally includes a sequence of 10-50 nucleotides which does not match the
  • this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copyable region of the second primer.
  • the additional sequence variant P2 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
  • oligonucleotides comprise a first primer and
  • Oligonucleotides comprising only a first primer, or oligonucleotides comprising only a second primer.
  • the generation and / or amplification of nonspecific primer-dimer structures may be delayed.
  • the formation of by-products comprising no target sequence can be reduced or retarded.
  • the premature consumption of primers can be reduced or delayed.
  • the use of such oligonucleotides is advantageous if primer dimers comprising first primers (PD P1) or primer dimers comprising second primers (PD P2) are produced by secondary reactions and lead to premature consumption of primers in the reaction.
  • primers having such additional structures are advantageous in certain embodiments if nonspecific reactions are observed in an amplification reaction.
  • Such side reactions may be favored by several factors, including but not limited to:
  • oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2 represent a further possibility for delaying certain side reactions.
  • primer oligonucleotides with additional sequence segments are shown.
  • additional sequence segments are used which do not participate in the specific amplification of a target sequence and contribute to the delay of side reactions.
  • oligonucleotides comprising a first primer and additional sequence variant P1 and oligonucleotides comprising a second primer and additional sequence variant P2 are used.
  • an oligonucleotide in addition to a primer structure that is advantageous for the specific amplification of a target sequence (this structure may also be referred to as a "base structure” or “minimal structure”), also includes additional, additional sequence sequences. Segments may include (eg additional sequence variant P1 or additional sequence variant P2). Such additional sequence segments may provide a variety of different other beneficial properties.
  • Fig. 1 shows the sequence components of a preferred embodiment of the invention.
  • Primer 1 .1 can bind with its first region (in 3 ' segments) to the respective primer binding site on the template strand (M1 .1) predominantly complementary.
  • the polynucleotide tail (primer overhang) of the second region does not bind to the template strand (M1 .1).
  • the controller (1 .1.) Comprises a first, second and third area.
  • FIG. 2 schematically illustrates the topography of the complete primer extension product (P1-Ext.), Wherein the extension product comprises a region formed by primer 1 .1 and a segment synthesized by the polymerase.
  • the synthesis of a P1-ext primer extension product is shown schematically in FIG.
  • the synthesis progress is in this case stopped by a block oligonucleotide sequence-specific.
  • the primer / controller complex is stable under the reaction conditions used during the synthesis phase.
  • the synthesis of the P1-Ext by the polymerase goes to the block oligonucleotide (B 1.1), so that the length of the synthesized segment of the P1-Ext is limited.
  • the sequence-specific control of primer extension is mediated in particular by the binding of the controller oligonucleotide.
  • the controller binding to the primer extension product during the control phase is shown schematically in Figure 4, where A) the release of the controller from the complex: primer / controller; B-C), the binding of the controller to the second region of the primer on the primer extension product, and D-E) illustrates the sequence-specific strand displacement by the controller to release the template strand.
  • FIG. 5 schematically shows a probe binding to the primer extension product after its release from the template strand. Release from the template strand allows the 3 ' segment of the P1-Ext to interact with another oligonucleotide, such as a fluorescent probe (S1 .1), or other primers or an affinity probe. For example, a binding can lead to the increase of a fluorescence signal.
  • a fluorescent probe S1 .1
  • an affinity probe for example, a binding can lead to the increase of a fluorescence signal.
  • a complementary to the 3 ' segment of the primer extension product formed oligonucleotide with a quencher (eg BHQ1) and a reporter (eg FAM) can be used.
  • a reporter for example, a molecular beacon with self-quenching properties can be used. The signal is generated only when a complementary bond. This allows, for example, complete P1-text to be distinguished from incomplete ones.
  • the synthesis phase and the controlling phase may take place simultaneously, as illustrated by the reaction approach illustrated in FIG. Controller and primer as well as their complex are in equilibrium during the reaction ( Figure 6 A)).
  • the synthesis of the primer extension product is initiated by the addition of a polymerase.
  • the polymerase can start the synthesis of a complementary primer extension product ( Figure 6B)).
  • the polymerase-catalyzed synthesis of fully complementary products occurs faster than the synthesis of products that involve a mismatch due to an error arising during the synthesis.
  • the mismatch strands are synthesized more slowly.
  • Fig. 7 and 8 further schematic representations of a reaction mixture with simultaneous synthesis phase and controlling phase are shown. Controller and primer as well as their complex are in equilibrium during the reaction before (Fig. 7 A), Fig. 8 B)).
  • the free-of-charge controllers can interact with the primer extension products during the synthesis phase. The interaction starts at the second primer area of a respective primer extension product ( Figure 7B), Figure 8B)).
  • the result of the controller's interaction with the primer extension products will be different depending on the progress of the synthesis of the primer extension product: with fully synthesized P1-Ext, this product may be released.
  • a fully synthesized P1 -ex can interact through its 3 ' segment with other oligonucleotides, eg probes, primers etc.
  • Figures 9A-C schematically show the topography of a template strand (comprising a target sequence) with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3).
  • the template strand with the first variant (M 1.1) and the template strand with the second variant (M 1 .2) schematically show the topography of a target sequence within template strands.
  • Both template strands comprise target sequence segments N1 and N3, which are identical and uniform in both template strands.
  • the respective sequence segment N2 is characteristic and specific in each template strand, so that both template streaks can be distinguished by it.
  • N2 comprises at least two sequence variants of a polymorphic locus of a target sequence.
  • M 1 .1 template with the first variant of the target sequence.
  • M 1.2 template with the second variant of the target sequence.
  • N1 first unified target sequence segment in which S1.1 is identical to S1 .2.
  • N2 polymorphic locus, in which S1.1 is not identical to S1.2.
  • N3 second uniform target sequence segment, in which S1 .1 is identical to S1 .2.
  • B1.1 block oligonucleotide for limiting a primer extension.
  • a target sequence which may comprise a plurality of sequence variants in a polymorphic locus (N2), furthermore comprises at least a first target sequence segment (N1) which is suitable for all target sequence variants of a target sequence (target sequence group comprising M 1 .1 and M 1 .2 ) is characteristic and uniform.
  • a target sequence comprises at least one second target sequence segment (N3) which is characteristic and uniform for all target sequence variants of a target sequence (target sequence group comprising M 1 .1 and M 1 .2 here).
  • Such uniform target sequence segments are preferably located on either side of a polymorphic locus and thus flank a polymorphic locus (with sequence variants) of a target sequence from both sides.
  • the first uniform target sequence segment (N1) differs in its sequence composition from the Sequence composition of the second unitary target sequence segment (N3) in at least one nucleotide position.
  • Figures 10 show schematically the topography of a template strand with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3) as shown in Figure 9.
  • Figure 10D shows the result of strand separation after primer extension by two specific and unique controller oligonucleotides (C1.1 and C1 .2), each of which controller oligonucleotides provides a polymorphic locus of the target sequence (N2) corresponding sequence segment, wherein C1 .1 and C1 .2 differ in this sequence segment.
  • both primer extension products formed during synthesis both comprise fully-complementary sequences. Binding of such fully complementary sequences to each other is more effective than in sequences involving a mismatch. The strand separation thus runs only over a shorter distance and is less effective than with fully complementary strands.
  • Fig. 11 schematically shows another topography of an N2 of a target nucleic acid chain with respect to the controller oligonucleotide and the first primer.
  • the N2-corresponding sequence segment of the controller oligonucleotide partially comprises the third region as well as partially the second region.
  • the 3 ' segment of the first primer is designed to be sequence specific and characteristic of a specific and characteristic sequence variant of the target nucleic acid.
  • both the controller oligonucleotide and the first primer oligonucleotide participate in allele discrimination.
  • both a specific controller oligonucleotide and a specific first primer oligonucleotide can be constructed.
  • Figure 12 shows schematically potential positions of a polymorphic locus within a target sequence (positions 1 to 6) and their corresponding sequence segment positions in the individual components of a primer extension system.
  • the polymorphic loci of a target sequence shown schematically comprise 2 to 50 nucleotides, in particular 4 to 30 nucleotides, which are characteristic and specific for an allelic variant of a target sequence.
  • the arrangement of individual amplification components can be designed so that several variants / combinations are possible:
  • Arrangement 1 A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region).
  • Sequence variate of the target sequence can be constructed.
  • Array 2 A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region).
  • Sequence variate of the target sequence can be constructed.
  • Arrangement P2 differs from P1 mainly in that N2 lies predominantly in the 3 ' terminal sequence segment of the first primer. As a result, if necessary, a better specificity of the amplification can be achieved.
  • Arrangement 3 A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region) with the corresponding sequence segment of the controller oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product.
  • the controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence.
  • a target sequence specific first primer is used, which is not sequence variant specific. Because of the possible proximity of the second blocking moiety, the binding of the controller oligonucleotides to the first primer extension product can be affected by nucleotide modifications of the second blocking moiety.
  • Arrangement 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region).
  • the controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence.
  • a target sequence specific first primer is used, but which are not sequence variant specific.
  • This sequence segment of the controller oligonucleotide lies in the 5 ' direction from the second blocking unit and may comprise several DNA nucleotide monomers, eg from 5 to 30.
  • Figures 13-14 show schematically the topography of a target nucleic acid chain with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3), where the polymorphic locus comprises only one nucleotide position (eg an SNV or an SNP or a point mutation Etc.).
  • the differences between individual sequence variants thus amount to only one nucleotide (here referred to as 4.1 and 4.2).
  • Such a locus (N2) can lead to similar arrangements of individual components as a locus with at least 2 nukeotids.
  • the controller oligonucleotide is bound to a complementary first primer extension product (perfect match), strand separation following a primer can thus be achieved. Extension done. In the formation of a mismatch strand separation is inhibited or slowed down or even interrupted.
  • Fig. 15 shows schematically potential positions of a polymorphic locus with sequence variance of only one nucleotide within a target sequence (positions 1 to 6) of a template strand and their corresponding sequence segment positions in individual components of a primer extension system.
  • Arrangement 1 A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region).
  • Sequence variate of the target sequence can be constructed.
  • Array 2 A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region).
  • Sequence variate of the target sequence can be constructed.
  • Arrangement P2 differs from P1 primarily in that N2 may be predominantly in the 3 ' terminal sequence segment of the first primer or even comprises the 3 ' terminal nucleotide. This may possibly result in a further increase in the specificity of the amplification.
  • Arrangement 3 A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region) with the corresponding sequence segment of the controller oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product.
  • the controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence.
  • a target sequence specific first primer is used, but which are not sequence variant specific. Because of the possible proximity of the second blocking moiety, the binding of the controller oligonucleotides to the first primer extension product can be affected by nucleotide modifications of the second blocking moiety.
  • Arrangement 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region).
  • the controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence.
  • a target sequence specific first primer is used, which is not sequence variant specific.
  • This sequence segment of the controller oligonucleotide lies in the 5 ' direction of the second blocking unit.
  • This segment of the controller oligonucleotide may comprise multiple DNA nucleotide monomers, eg from 5 to 30, wherein the N2-corresponding sequence segment may be flanked by at least 3 to 15 DNA nucleotide building blocks on both sides.
  • a specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the template strand (S1.1) under reaction conditions and initiate the synthesis of the P1.1 -ext. No competitor primer is used.
  • P1 .1 -Ext can bind complementarily to C1 .1 and be released from the template strand with its participation.
  • a specific P1 .1 can preferentially bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1.1 -ext.
  • M 1 .1 a specific sequence variant of the template strand
  • P1.1-Ext. No competitor primer is used.
  • the binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1 .2.
  • the primer extension is thus started less efficiently under stringent reaction conditions.
  • Fig. 18 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the segment of the controller oligonucleotide corresponding to N2 lies in the second region (2).
  • the N2 locus includes the 3 '- terminal nucleotide of the first primer.
  • a specific P1.1 with a complementary 3 '- terminal nucleotide under the reaction conditions can preferably specifically bind to the complementary position of a specific sequence variant of the template strand (M 1 .1) bind and initiate synthesis of P1 .1-Ext.
  • M 1 .1 specific sequence variant of the template strand
  • No competitor primer is used.
  • the binding to another sequence variant (SN 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1.2.
  • the primer extension is thus started less efficiently under stringent reaction conditions.
  • Fig. 19 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the segment of the controller oligonucleotide corresponding to N2 lies in the third region (Fig. 3).
  • Target sequence specific but not sequence variant specific first primers are used.
  • One for all sequence variants of one Target nucleic acid unitary P1 .1 can bind to the template strand and initiate the synthesis of the P1 1 -ext.
  • P1 .1-Ext is formed.
  • No competitor primer is used.
  • the separation of primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1.1 -Ext to the controller oligonucleotide.
  • the separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide.
  • the position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking unit, so that the interaction between the controller oligonucleotide and the respective first primer extension product are affected by modifications used in the second blocking unit can.
  • Fig. 20 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments, in which the N2-corresponding segment of the controller oligonucleotide lies in the third region (4).
  • Target sequence specific but not sequence variant specific first primers are used.
  • a P1.1 unitary for all sequence variants of a target nucleic acid can bind to the template strands and initiate the synthesis of the P1 1 -text. In the course of primer extension, this results in the formation of P1 1- Ext. No competitor primer is used.
  • the separation of primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1.1 -Ext to the controller oligonucleotide.
  • the separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide.
  • the position of the sequence segment (4) corresponding to N2 of the target sequence is at a distance from the second blocking moiety, so that the interaction between the controller oligonucleotide and the respective first primer extension product of modifications used in the second blocking moiety in FIG Essentially unaffected.
  • the segment of the controller oligonucleotide corresponding to N2 is preferably made up of DNA monomers using between 4 to 20 DNA monomers and at least 4 to 10 DNA monomers located around position-4 on both sides.
  • Fig. 21 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region.
  • a specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1.1 -ext. In the course of primer extension, this leads to the formation of P1 1-Ext.
  • the binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1.2.
  • the primer extension is thus started less efficiently under stringent conditions.
  • the P5.1 forms a perfect match with M 1 .2 and can be extended by the polymerase to form a competitor primer extension product P5.1-Ext.
  • Figure 21 shows variants of competitor primer P5.1 for P1 .1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.1 binding within the second blocking unit.
  • a competitor primer oligonucleotide (P 5.1) is added to the reaction which is capable of binding predominantly complementarily to the sequence variants of the target sequence and whose copy formation with subsequent separation from the template strand is suppressed must become. Due to a complementary binding with such primer binding sites, a competitor primer may preferentially bind and be extended by the polymerase. The resulting product (here P5.1 -Ext) blocks the single-stranded primer binding sites for an interaction of the first primer.
  • the 3 ' end of a competitor primer binds within the second blocking unit of the controller oligonucleotide so that extension of this primer on the controller oligonucleotide can not occur.
  • the competitor primer does not include a sequence segment that can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
  • FIG. 22 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region (FIG. 2).
  • the N2 locus includes the 3 '- terminal nucleotide of the first primer.
  • a specific P1 .1 having a complementary 3 ' -terminal nucleotide can preferably bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1 1 -text.
  • P1 .1-Ext P1 .1-Ext.
  • the binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1.2.
  • the primer extension is thus started less efficiently under stringent conditions.
  • a competitor primer (P5.2) is added to the reaction which is capable of binding predominantly complementarily to the sequence variants of the target sequence and whose primer extension and subsequent separation from the template strand must be suppressed , Due to a complementary binding with such primer binding sites, a competitor primer can preferably bind to particular sequence variants (designated here by N) and extended by the polymerase.
  • the resulting product (P5.2-Ext) blocks the single-stranded primer binding sites for interaction with the first primer.
  • the 3 ' end of a competitor primer binds within the second blocking unit of the controller oligonucleotide so that extension of this primer on the controller oligonucleotide can not occur.
  • the competitor primer does not include a sequence segment with which it can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
  • Figure 22 shows variants of competitor primer 5.2 for P1.1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.2 binding within the second blocking unit.
  • the 3 ' -terminal segment of P5.2 forms a perfect match with M 1.2 and can be extended by the polymerase.
  • FIG. 23 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the third region (FIG. 3).
  • Target sequence specific but not sequence variant specific first primers are used.
  • a P1 .1 unitary to all sequence variants of a target nucleic acid can bind to the template strands and initiate the synthesis of P1.1-Ext.
  • P1 .1-Ext During primer extension, P1 .1-Ext.
  • the separation of synthesized primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1 .1-Ext to the controller oligonucleotide.
  • the separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide.
  • the position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking unit, so that the interaction between the controller oligonucleotide and the respective first primer extension product are affected by modifications used in the second blocking unit can.
  • a competitor primer P5.3 is added to the reaction which is able to bind predominantly complementarily to the sequence variants of the target sequence (N) and whose copy generation and subsequent strand separation must be suppressed. Due to a complementary binding with such primer binding sites, a competitor primer may preferentially bind to certain sequence variants (designated here by N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction with the first primer.
  • the competitor primer oligonucleotide (P5.3) is longer than the first primer oligonucleotide such that its 3 ' end is within the fourth blocking moiety of the Controller oligonucleotide can bind (the fourth blocking unit is assembled analogously to the second blocking unit and blocks a primer extension on the controller oligonucleotide), so that no extension of this primer can be done on the controller oligonucleotide.
  • the competitor primer does not include a sequence segment which can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
  • Figure 23 shows variants of competitor primer 5.3 for P1.1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.3 binding within the fourth blocking unit.
  • the 3 ' -terminal segment of P5.3 forms a perfect match with M 1.2 and can be extended by the polymerase.
  • Figure 24 shows schematically a selective primer extension reaction of several sequence variants using multiple selective controller oligonucleotides (C1.1 and C1.2).
  • Figures 25-29 show schematically the structure of the first primer oligonucleotide and the controller oligonucleotide, as well as the interaction between the first primer oligonucleotide and the template, as well as the synthesis of the first primer extension product.
  • Figure 30 shows schematically the interaction between structures during primer extension of the first primer oligonucleotide.
  • Fig. 33 shows schematically some embodiments of structures of a starting nucleic acid chain and their use as template at the beginning of the reaction. Using P1.1, without block oligonucleotide.
  • Fig. 34 shows schematically some embodiments of structures of a starting nucleic acid chain and their use as a template at the beginning of the reaction. Using P1.1, with block oligonucleotide.
  • FIG. 35 shows schematically the interaction of the structures during the nucleic acid amplification by, on the one hand, the amplification of the first primer oligonucleotide and of the second primer oligonucleotide and furthermore the action of the controller oligonucleotide and the resulting strand displacement.
  • FIGS. 36-38 show results from Example 4.
  • Fig. 39 shows schematically an embodiment with topography of a specific primer extension system and a template strand with a polymorphic locus (N2) in certain embodiments, in addition to other illustrations the following nomenclature of reaction components and sequence segments is used: a) a sample comprising a nucleic acid polymer comprising the target sequence M, wherein the target sequence in 5'-3 'orientation comprises the sequence sections MS and MP and MP is located directly in 3' of MS, with the following
  • an oligonucleotide primer P which comprises the sequence sections PC and PM in the 5'-3 'orientation and PM is arranged directly in 3' of PC, wherein PM has the sequence [MPa] complementary to the sequence section MP [that binds] in a substantially sequence-specific manner can] and PC can not bind to M [or a sequence immediately adjacent to MP in 3 '];
  • Sequence sections CS, CP and CC where CP is located immediately in the 3 'direction of CS and immediately in the 5' direction of CC, and where CS is at least to the 3 ' segment of MS (immediately in the 5' direction of MP lying) and CP and CC to the sequence section PM and PC
  • CS comprises modified nucleotide building blocks such that CS can not serve as a template for the activity of the template-dependent nucleic acid polymerase;
  • a template-dependent nucleic acid polymerase in particular a DNA polymerase, as well as substrates of the DNA polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, a primer extension product P 'being obtained which, besides the
  • Sequence areas PC and PM comprises a synthesized area PS, which is substantially complementary to the target sequence MS,
  • reaction conditions are chosen, and / or
  • the lengths and the melting temperature of PC and possibly MS are selected so that P 'can form a double strand with M and P' can form a double strand with C and the formation of the double strand from P 'and C opposite the formation of the double strand from P 'is preferred with M.
  • Sequence section CS 'of 5 to 15 nucleotide positions contains length, which consists of nucleic acid analogs, in particular of 2'0-alkyl ribonucleotides.
  • M comprises a sequence portion MB immediately in 5 'of MS, and further wherein a block oligonucleotide B capable of hybridizing to MB is contacted with the sample, and wherein a.
  • B comprises nucleoside analogs selected such that a B hybrid to MB does not permit the MB-dependent nucleic acid polymerase reaction on MB or
  • the template-dependent nucleic acid polymerase is selected such that a
  • a nucleic acid polymer (one embodiment of the template) comprises the target sequence M, which comprises the sequence segments MS and MP and MP in the 5'-3 'orientation and is located directly in 3' of MS.
  • the target sequence comprises a polymorphic locus (N2).
  • An oligonucleotide primer P (corresponding to a first primer oligonucleotide) comprises, in 5'-3 'orientation, the sequence segments PC (corresponding to a second region of the first primer oligonucleotide) and PM (corresponding to a first region of the first primer oligonucleotide).
  • a controller oligonucleotide C comprises, in 5'-3 'orientation, the sequence sections CS (corresponding to a third region of the controller oligonucleotide), CP (corresponding to a second region of the controller oligonucleotide) and CC (corresponding to a first region of the controller oligonucleotide )
  • a primer extension product P ' (corresponding to a first primer extension product) is obtained by template-dependent extension of the first primer oligonucleotide.
  • the primer extension product comprises a synthesized region PS which is essentially complementary to the target sequence MS
  • a variant VM of the target sequence M is different from the sequence M in at least one position VMM.
  • this position has one or more substitution (s), insertion (s) and / or deletion (s).
  • This position VMM in this embodiment is a sequence variant of the polymorphic locus (N2) of the target sequence.
  • VMM is at the 5 'end of VMP. in other words, the 3 'end of VPM hybridizes with VMM.
  • a second controller oligonucleotide VC comprises in the 5'-3 'orientation the sequence sections VCS (corresponding to a third area of the controller oligonucleotide), VCP (corresponding to a second area of the controller oligonucleotide) and VCC (corresponding to a first area of the controller). oligonucleotide).
  • a second oligonucleotide primer VP (corresponding to a variant of a first primer oligonucleotide) comprises, in the 5'-3 'orientation, the sequence segments VPC (corresponding to a second region of the first primer oligonucleotide) and VPM (corresponds to a first region the first primer oligonucleotide) and VPM is located immediately in 3 'of VPC, where VPM has [the hybridizing] sequence complementary to the sequence portion VMP of the target sequence VM and can not bind VPC to VM [or one in 3 'immediately following VMP sequence] can bind.
  • VMM polymorphic locus N2 of the target sequence resides at the 5 'end of VMP and the 3' end of VPM (of the first primer oligonucleotide) can be specifically hybridized with VMM.
  • a competitor oligonucleotide KP can hybridize to the target sequence.
  • KP can hybridize with VMP of the target sequence.
  • a block oligonucleotide B can hybridize to a sequence portion of the target sequence MB immediately adjacent to the 5 'direction of MS, where B comprises nucleoside analogs selected such that a hybrid (complex) of B with MB is the response of a template-dependent one Nucleic acid polymerase not allowed on MB.
  • Figures 40-58 schematically show certain embodiments for using a primer extension product as a starting nucleic acid chain for an amplification method.
  • P5.1 does not contain an overhang for binding to the activator oligonucleotide.
  • P5.1 has the same length as the first range of P1 .1
  • FIG. 53 shows variants of competitor primer P 5.2 for P1 .1:
  • P5.2 does not contain an overhang for binding to the activator oligonucleotide.
  • P5.2 has a longer binding segment at SN 1 .2 than the first region of P1.1
  • FIG. 54 shows variants of competitor primer P 5.3 or P5.4 for P1 .1:
  • Figures 59-60 schematically show certain topographical embodiments of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments, in addition to other illustrations, the following are Nomenclature of reaction components and sequence segments used (see nomenclature Fig. 39).
  • P3.1-Ext part 1 extension product of P3.1 synthesized on P2.1 -EX as template.
  • P4.1 Ext Part 1 Extension product of P4.1 synthesized on P1.1 -xt as template.
  • P3.1-Ext extension product of P3.1 synthesized using P4.1 -Ext part 1 or at the P4.1 -Ext as template.
  • P4.1 -Ext extension product of P4.1 synthesized using P3.1 Ext part 1 or at the P3.1 text as template.
  • Potassium glutamate 50 mmol / l, pH 8.0; Magnesium acetate, 10 mmol / l; dNTP (dATP, dCTP, dTTP, dGTP), 200 pmol / l each; Polymerase (Bst 2.0 warm start, 120,000 U / ml NEB), 12 units / 10 pl;
  • Triton X-100 0.1% (v / v); EDTA, 0.1 mmol / l; TPAC (tetrapropylammonium chloride), 50 mmol / l, pH 8.0; EvaGreen dye (dye was according to manufacturer's instructions in
  • 1x isothermal buffer (New England Biolabs); in simple concentration, the buffer contains: 20 mM Tris-HCl; 10mM (NH 4 ) 2 S0 4 ; 50 mM KCl; 2mM MgSO 4 ; 0.1% Tween® 20; pH 8.8@25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;
  • the melting temperature (Tm) of the components involved was determined at concentration of 1 pmol / l of respective components in solution 1 or 2. Different parameters are indicated in each case.
  • Primer extension reactions and amplification were performed by default at two reaction temperatures of 55 ° C and / or 65 ° C. Deviations are indicated.
  • the start of the reaction was carried out by heating the reaction solutions to reaction temperature, since Bst 2.0 polymerase warm start at lower temperatures is largely inhibited in their function by a temperature-sensitive oligonucleotide (an "aptamer” according to the manufacturer).
  • the polymerase becomes increasingly more active from a temperature of about 45 ° C, at a temperature of 65 ° C, no differences between Polymerase Bst 2.0 and Bst 2.0 warm start were found.
  • Polymerase Bst 2.0 Warmstart was used. Deviations are specified.
  • the reaction was stopped by heating the reaction solution to above 80 ° C, e.g. 10 min at 95 ° C. At this temperature, the polymerase Bst 2.0 is irreversibly denatured and the result of the synthesis reaction can not be subsequently changed.
  • reactions were carried out in a thermostat with a fluorescence measuring device.
  • a commercial real-time PCR device was used, StepOne Plus (Applied Biosystems, Thermofischer).
  • the reaction volume was 10 pl by default. Deviations are indicated.
  • endpoint determinations the signal was registered by nucleic acids bound to nucleic acids, e.g. TMR (tetramethyl-rhodamine, also called TAMRA) or FAM (fluorescein).
  • TMR tetramethyl-rhodamine
  • FAM fluorescein
  • the wavelengths for excitation and measurement of the fluorescence signals of FAM and TMR are stored as factory settings in the StepOne Plus Real-Time PCR device.
  • an intercalating dye (EvaGreen) was used in end point measurements, e.g. when measuring a melting curve).
  • EvaGreen is an intercalating dye and is an analog of the commonly used dye Sybrgreen, but with slightly less inhibition of polymerases.
  • the wavelengths for excitation and measurement of the fluorescence signals of SybrGreen and EvaGreen are identical and are stored as factory settings in the StepOne Plus Real-Time PCR device. Fluorescence can be monitored continuously by means of built-in detectors, i. "online” or “real-time” are detected. Since the polymerase synthesizes a double strand during its synthesis, this technique could be used for kinetic measurements (real-time monitoring) of the reaction. Due to some cross-talk between color channels in the StepOne Plus device, partially increased basal signal intensity was observed in measurements where e.g. TMR-labeled primers in concentrations greater than 1 pmol / L (e.g., 10 pmol / L) were used. It has been observed that the TMR signal in the SybrGreen channel leads to increased baselines. These increased baseline values were taken into account in calculations.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a method for extending a primer oligonucleotide having improved specificity using a particular primer oligonucleotide and a controller nucleotide sequence, wherein the controller oligonucleotide enables a strand opening in a double strand of the extension product and die in a sequence-specific manner. The invention furthermore relates to a corresponding kit for carrying out the method according to the invention.

Description

Verfahren zur Primer-Verlängerungsreaktion mit verbesserter Spezifität  Method for primer extension reaction with improved specificity
Die vorliegende Erfindung betrifft ein Verfahren zur matrizenabhängigen Primer- Verlängerungsreaktion mittels einer matrizenabhängigen Polymerase. Bei dem Verfahren können Primer-Verlängerungsprodukte hergestellt werden, welche in einer Amplifikation von Nukleinsäuren eingesetzt werden können. Das Verfahren kann somit zur Verbesserung der Spezifität von Analysen umfassend eines Primer-Verlängerungs-Schritts beitragen. The present invention relates to a method for the template-dependent primer extension reaction by means of a template-dependent polymerase. In the method, primer extension products can be prepared which can be used in an amplification of nucleic acids. The method may thus help to improve the specificity of analyzes involving a primer extension step.
Die vorliegende Anmeldung beansprucht die Priorität der folgenden Anmeldungen: Europäische Patentanmeldungen EP18158720.5 vom 26.02.18; EP18195189.8 vom 18.09.2018; Deutsche Patentanmeldung 10 2018 001639.1 vom 28.02.2018; diese und alle anderen hier erwähnten Patentdokumente sollen durch die Referenzierung als in die vorliegende Beschreibung aufgenommen gelten (incorporation by reference).  The present application claims priority from the following applications: European Patent Applications EP18158720.5 dated 26.02.18; EP18195189.8 from 18.09.2018; German Patent Application 10 2018 001639.1 dated 28.02.2018; These and all other patent documents mentioned herein are to be incorporated by reference into the present specification (incorporation by reference).
Hintergrund background
Die Primerverlängerungsreaktion spielt bei sehr vielen genetischen Analysen eine Rolle, z.B. in Amplifikationsverfahren, wie PCR, oder in Einzelschritten der Analysen. Es wird eine enzymatische Primerverlängerung mittels einer Polymerase durchgeführt, wobei ein synthetisierter Strang gebildet wird. In vielen Verfahren wird dieser Strang durch verschiedene Mittel sequenzunabhängig von der Matrize abgelöst und in weiteren Verfahrensschritten verwendet. Zu solchen Mitteln zählen beispielsweise Temperatur oder denaturierende Agenzien wie Laugen oder Formamid. Weiterhin können Stränge mittels Enzymen unter Aufwendung von chemischen Energiequellen, wie dNTP oder ATP, getrennt werden. Dazu zählen Helicasen oder Polymerasen mit strangverdrängender Wirkung. Solche Trennungen erfolgen vorwiegend sequenzunspezifisch.  The primer extension reaction plays a role in many genetic analyzes, e.g. in amplification methods, such as PCR, or in individual steps of the analyzes. An enzymatic primer extension is carried out by means of a polymerase, whereby a synthesized strand is formed. In many processes, this strand is detached from the template by various means, independently of the sequence, and used in further process steps. Such agents include, for example, temperature or denaturing agents such as alkalis or formamide. Furthermore, strands can be separated by enzymes using chemical energy sources such as dNTP or ATP. These include helicases or polymerases with strand-displacing action. Such separations are predominantly sequence-unspecific.
Viele Reaktionen in genetischen Analysen benötigen einzelstränge oder doppelsträngige, komplementäre Zustände von Nukleinsäureketten oder Nukleinsäurekettensegmenten, um bestimmte Effekte zu erzielen. Ein Wechsel zwischen der einzelsträngigen Form und der doppelsträngigen Form wird häufig zur An/Aus-Schaltung einer Reaktion oder der Herbeiführung einer Funktionalität benötigt. Die Bindung von gewissen Elementen der Reaktionen (z.B. Primer/Matrize oder Sonde/Matrize, etc.) hängen von der Herbeiführung einer dauerhaften oder vorübergehenden sequenzspezifischen Bindung von Komponenten aneinander ab. Diese Bindung erfolgt in vielen Fällen unter Ausbildung von Wasserstoffbindungen unter komplementären Strängen (bei Watson-Crick-Basenpaarung). Dabei kann ein Strang an einer bestimmten Position zu einem konkreten Zeitpunkt nur mit einem anderen Strang eine Bindung einhergehen. Ein dritter Strang ist somit zu diesem Zeitpunkt von der Interaktion ausgeschlossen. Somit kann die Verfügbarkeit von freien komplementären Positionen für potenzielle Interaktionen mit anderen Reaktionskomponenten in vielen Verfahren eine Rolle spielen. Weiterhin kann die Häufigkeit und die Dauer der Bindung von Reaktionspartnern aneinander via komplementäre Positionen eine Rolle für die Geschwindigkeit oder Ausbeute eines gewissen Reaktionsschrittes spielen. Viele Reaktionen im Feld molekularer Analysen basieren auf Herbeiführung von mehr oder weniger stabilen Bindungen zwischen einzelnen Reaktionskomponenten. Die dabei erzielten Effekte können Einfluss auf die Spezifität von Reaktionen haben. Many reactions in genetic analyzes require single-stranded or double-stranded, complementary states of nucleic acid chains or nucleic acid chain segments to achieve certain effects. Switching between the single-stranded form and the double-stranded form is often required to turn on / off a reaction or to provide functionality. The binding of certain elements of the reactions (eg, primer / template or probe / template, etc.) depend on the generation of a permanent or transient sequence-specific binding of components to each other. This bonding occurs in many cases with formation of hydrogen bonds under complementary strands (in Watson-Crick base pairing). In this case, a strand at a particular position at a specific time can only be accompanied by a bond with another strand. A third strand is thus excluded from the interaction at this time. Thus, the availability of free complementary positions may play a role in potential interactions with other reaction components in many processes. Furthermore, the frequency and duration of binding of reactants to each other via complementary positions may be one Play role for the speed or yield of a certain reaction step. Many reactions in the field of molecular analysis are based on the creation of more or less stable bonds between individual reaction components. The effects achieved can have an influence on the specificity of reactions.
Die Primerverlängerung wird in vielen genetischen Analysen verwendet. Dabei spielt das Ergebnis eines korrekten Primings (Ausbildung eines Primer-Matrizen-Komplexes) als auch die Fortführung der matrizenabhängigen enzymatischen Synthese mittels einer Polymerase eine Rolle. Mit der Erstellung des Produktes einer sequenzspezifischen Primerverlängerungsreaktion (Primerverlängerungsprodukt) ist die Synthese-Phase abgeschlossen. Nach Abschluss der Primerverlängerung kann das Primerverlängerungsprodukt von der Matrize abgelöst werden und in anderen Verfahrensschritten verwendet werden.  Primer extension is used in many genetic analyzes. The result of a correct priming (formation of a primer-template complex) as well as the continuation of the template-dependent enzymatic synthesis by means of a polymerase plays a role. With the preparation of the product of a sequence-specific primer extension reaction (primer extension product), the synthesis phase is complete. Upon completion of primer extension, the primer extension product can be detached from the template and used in other procedures.
In jedem dieser Schritte können Fehler oder Abweichungen stattfinden, welche die Spezifität der jeweiligen Verfahren beeinflussen können und schließlich auch bestimmte Grenzen der Einsetzbarkeit von jeweiligen Verfahren bedeuten. Viele Beispiele dafür sind bekannt, z.B. falsches Priming, polymerasebedingte Fehler, fehlerhafte Bindung von Sonden, etc..  In each of these steps, errors or deviations may take place which may influence the specificity of the respective methods and ultimately also impose certain limits on the applicability of respective methods. Many examples are known, e.g. incorrect priming, polymerase-related defects, defective binding of probes, etc.
Genetische Analyseverfahren müssen häufig unter mehreren Varianten einer bekannten Sequenz unterscheiden (z.B. Allel-spezifische Nachweismethoden oder Mutations-Analyse in Gegenwart von Wildtyp-Sequenzen). Die Anwesenheit von mehreren Sequenzen im gleichen Reaktionsansatz führt häufig dazu, dass es zu Interferenzen (ungewollten Interaktionen bzw. parallel laufenden Nebenreaktionen, etc.) zwischen den Sequenzen kommen kann. Solche Interferenzen können zu unterschiedlichen Zeiten eines Verfahrens entstehen, angefangen bei der Herstellung der ersten Kopien bis hin zur Detektion. Im Allgemeinen können Interferenzen zwischen sehr ähnlichen Sequenzen zur Fehlinterpretation von Ergebnissen führen. Eine hohe Spezifität bei solchen Verfahren spielt daher eine große Rolle.  Genetic analysis methods must often differentiate among several variants of a known sequence (e.g., allele-specific detection methods or mutation analysis in the presence of wild-type sequences). The presence of multiple sequences in the same reaction mixture often leads to interference (unwanted interactions or parallel side reactions, etc.) can occur between the sequences. Such interferences can arise at different times of a process, from the production of the first copies to detection. In general, interference between very similar sequences can lead to misinterpretation of results. High specificity in such processes therefore plays a major role.
Besonders bei geringfügigen genetischen Unterschieden, wie Einzelnukleotid-Veränderungen (SNV) und kurzen Insertionen/Deletionen (2 - 10 Nukleotide) wäre es von Vorteil, wenn die Spezifität von primerverlängerungsabhängigen Verfahren bzw. Verfahrensschritten verbessert werden kann.  Especially with minor genetic differences, such as single nucleotide changes (SNV) and short insertions / deletions (2-10 nucleotides), it would be advantageous if the specificity of primer extension-dependent methods or procedures can be improved.
Dabei kann sowohl die Synthese des Primerverlängerungsproduktes an sich als auch die Bereitstellung des synthetisierten Primer-Verlängerungsproduktes zu einer weiteren Verwendung verbessert werden.  In this case, both the synthesis of the primer extension product per se and the provision of the synthesized primer extension product can be improved to a further use.
Die Primerverlängerungsreaktion wird zur Zeit in den meisten Fällen durch Einstellung der Primerbindung (z.B. durch Verwendung optimaler Reaktionstemperaturen, Pufferbedingungen und Komplementarität der Primer zu einer Primerbindungsstelle) optimiert. Einige Tools wurden zur Verbesserung der Primerbindung entwickelt. Diese beschränken sich lediglich auf die Verbesserung der Primerbindung und gehen nicht über die Primerlänge hinaus. Unter Verwendung einer Polymerase mit einer 3'-Exonuklease-Aktivität (Polymerasen mit proofreading) kann man eine weitere Verbesserung der Qualität des Syntheseergebnisses erreichen. Dabei wird das 3'- Ende des synthetisierten Stranges von mit der Polymerase assoziierten Exonuklease überprüft.The primer extension reaction is currently optimized in most cases by adjusting the primer binding (eg, by using optimal reaction temperatures, buffer conditions and complementarity of the primers to a primer binding site). Some tools have been developed to improve primer binding. These are limited only to the improvement of primer binding and do not go beyond the primer length. Using a polymerase with 3 ' exonuclease activity (polymerases with proofreading) one can achieve a further improvement in the quality of the synthesis result. The 3 ' end of the synthesized strand is checked by polymerase-associated exonuclease.
Bis auf diese Phasen der Primerverlängerungsreaktion (Priming und proofreading durch die Polymerase) wird die Primerverlängerungsreaktion in den meisten Fällen gar nicht weiter auf ihre Qualität überprüft. Except for these phases of primer extension reaction (priming and proofreading by the polymerase), in most cases the primer extension reaction is not further evaluated for quality.
Insbesondere für Spurenanalysen in Anwesenheit starker Interferenzen (z.B. Nachweis von ctDNA in liquid biopsy-Ve rfahren) stoßen heutige Verfahren an ihre Grenzen, was die Steigerung der Spezifität von Analysen erschwert bzw. unmöglich macht.  In particular, for trace analysis in the presence of strong interference (e.g., detection of ctDNA in liquid biopsy methods), current methods are reaching their limits, making it difficult to increase the specificity of analyzes.
Es ist daher eine Aufgabe der vorliegenden Erfindung, Mittel und Verfahren zur Verbesserung der Spezifität bei genetischen Analyseverfahren bereitzustellen, welche eine Primerverlängerungsreaktion umfassen oder voraussetzen.  It is therefore an object of the present invention to provide means and methods for improving specificity in genetic analysis methods which include or presuppose a primer extension reaction.
Es ist eine weitere Aufgabe der vorliegenden Erfindung, Verfahren und Komponenten zur Verbesserung der Spezifität insbesondere in Verfahren bereitzustellen, welche eine enzymatische, matrizenabhängige Synthese bei einer Primerverlängerungsreaktion umfassen.  It is another object of the present invention to provide methods and components for improving specificity, particularly in methods involving enzymatic, template-dependent synthesis in a primer extension reaction.
Es ist eine weitere Aufgabe der vorliegenden Erfindung, Verfahren und Komponenten zur Verbesserung der Spezifität bei Verfahren bereitzustellen, welche eine Ablösung bzw. Trennung eines synthetisierten Nukleinsäurestranges von seiner Matrize umfassen.  It is a further object of the present invention to provide methods and components for improving specificity in methods involving separation of a synthesized nucleic acid strand from its template.
Es ist insbesondere weiterhin eine Aufgabe der vorliegenden Erfindung, Verfahren und Komponenten für eine sequenzspezifische bzw. selektive Trennung eines synthetisierten Nukleinsäurestrangs von seiner Matrize bei einer matrizenabhängigen Primerverlängerungs reaktion bereitzustellen, besonders bei gleichzeitiger Anwesenheit sehr ähnlicher Matrizensequenzen.  It is more particularly an object of the present invention to provide methods and components for sequence-specific or selective separation of a synthesized nucleic acid strand from its template in a template-dependent primer extension reaction, especially in the coexistence of very similar template sequences.
Diese Aufgaben werden durch die Gegenstände der unabhängigen Ansprüche erfüllt. Weitere vorteilhafte Ausgestaltungen der Erfindung sind in den abhängigen Ansprüchen und der folgenden Beschreibung aufgeführt.  These objects are fulfilled by the subject matters of the independent claims. Further advantageous embodiments of the invention are set forth in the dependent claims and the following description.
Zusammenfassung der Erfindung Summary of the invention
Gemäß einem ersten Aspekt wird ein Verfahren zur Verlängerung (Extension) eines Primer- Oligonukleotids zur Verfügung gestellt. Das Verfahren zur spezifischen Verlängerung eines Primer-Oligonukleotids umfasst die Schritte (Fig. 1 , 2):  According to a first aspect, a method for extension of a primer oligonucleotide is provided. The method of specifically extending a primer oligonucleotide comprises the steps (Figures 1, 2):
a) Bereitstellung einer Nukleinsäurekette umfassend eine Zielsequenz  a) providing a nucleic acid chain comprising a target sequence
(Matrizenstrang) (M1 )  (Matrix strand) (M1)
b) Hybridisieren eines Primer-Oligonukleotids (P1 .1 ) an ein Segment umfassend einen Anteil der Zielsequenz (Primer-Bindungsstelle) der bereitgestellten  b) hybridizing a primer oligonucleotide (P1 .1) to a segment comprising a portion of the target sequence (primer binding site) of the provided
Nukleinsäurekette (M1 ), wobei das Primer-Oligonukleotid (P1 .1 ) folgende Bereiche umfasst: einen ersten Bereich, der im Wesentlichen sequenzspezifisch, an ein Nucleic acid chain (M1), wherein the primer oligonucleotide (P1 .1) comprises the following ranges: a first region, essentially sequence-specific, to a
komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb einer bereitgestellten Nukleinsäurekette (M1 ) binden kann,  complementary segment (primer binding site) comprising a portion of the target sequence can bind within a provided nucleic acid chain (M1),
einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C1 .1 ) gebunden werden kann; c) Verlängerung des Primer-Oligonukleotids (P.1 .1 ) durch eine matrizenabhängige Polymerase unter Erhalt eines Primer-Verlängerungsprodukts (Primer- Extensionsprodukt, P1 .1 -Ext), welches neben dem Primer-Oligonukleotid (P1 .1 ) einen synthetisierten Bereich umfasst, der im Wesentlichen komplementär zu Nukleinsäurekette umfassend eine Zielsequenz (M1 ) ist, wobei das Primer- Verlängerungsprodukt (P1 .1 -Ext) und die Nukleinsäurekette (M1 ) unter Reaktionsbedinungen einen Doppelstrang bilden;  a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1); c) extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase to give a primer extension product (primer extension product, P1 .1 -Ext) which has a synthesized region in addition to the primer oligonucleotide (P1.1) which is substantially complementary to a nucleic acid chain comprising a target sequence (M1), wherein the primer extension product (P1 .1 -Ext) and the nucleic acid chain (M1) form a double strand under reaction conditions;
d) Bindung eines Controller-Oligonukleotids (C1 .1 ) an das Primer- Verlängerungsprodukt (P1 .1 -Ext), wobei das Controller-Oligonukleotid (C1 .1 ) folgende Bereiche umfasst:  d) binding of a controller oligonucleotide (C1.1) to the primer extension product (P1.1-Tex), wherein the controller oligonucleotide (C1.1) comprises the following ranges:
einen ersten Bereich, der an den zweiten Bereich (Überhang) des ersten Primer-Verlängerungsprodukts (P1 .1 -Ext) binden kann,  a first region that can bind to the second region (overhang) of the first primer extension product (P1 .1 -Ext),
einen zweiten Bereich, der zum ersten Bereich des Primer-Oligonukleotid (P1 .1 ) komplementär ist, und  a second region complementary to the first region of the primer oligonucleotide (P1 .1), and
einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches des Primer- Verlängerungsprodukts (P1 1-Ext) im Wesentlichen komplementär ist; und  a third region which is substantially complementary to at least a portion of the synthesized region of the primer extension product (P1 1-Ext); and
wobei das Controller-Oligonukleotid (C1 .1 ) nicht als Matrize für eine Primerverlängerung des Primer-Oligonukleotids (P1 .1 ) dient, und das Controller- Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an das Primer-Verlängerungsprodukt (P1 1 -Ext) unter Verdrängung von komplementären Segmenten der Nukleinsäurekette (M1 ) binden kann.  wherein the controller oligonucleotide (C1 .1) does not serve as a template for a primer extension of the primer oligonucleotide (P1 .1) and the controller oligonucleotide (C1 .1) with its first, second and third regions to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1) can bind.
Bei dem zweiten Bereich des Primer-Oligonukleotids handelt es sich insbesondere um einen Polynukleotidschwanz.  The second region of the primer oligonucleotide is in particular a polynucleotide tail.
Der Begriff "im Wesentlichen sequenzspezifisch" bedeutet im Sinne der Erfindung insbesondere, dass die zueinander komplementären Bereiche des Primer-Oligonukleotids und der zu amplifizierenden Nukleinsäure nicht mehr als 5, 4, 3, 2, oder 1 Mismatches aufweisen. Der Begriff "im Wesentlichen komplementär" bedeutet im Sinne der Erfindung insbesondere, dass die zueinander komplementären Bereiche von Nukleinsäuren nicht mehr als 5, 4, 3, 2, oder 1 Mismatches aufweisen. The term "essentially sequence-specific" in the context of the invention means in particular that the mutually complementary regions of the primer oligonucleotide and the nucleic acid to be amplified have not more than 5, 4, 3, 2, or 1 mismatches. The term "substantially complementary" in the sense of the invention means in particular that the mutually complementary regions of nucleic acids have not more than 5, 4, 3, 2, or 1 mismatches.
Die oben genannten Schritte können in einem Ansatz oder in getrennten Ansätzen ausgeführt werden. Wenn die Vorgänge in einem Ansatz durchgeführt werden sollen, so können diese unter gleichen Bedingungen, z.B. isothermal, oder unter unterschiedlichen Bedingungen, z.B. als Thermocycling, ausgeführt werden. In bestimmten Ausführungsformen sind Primer- Oligonukleotide und Controller-Oligonukleotid zu Beginn der Reaktion präsent. Eine sequenzielle Zugabe einzelner Reagenzien ist allerdings auch möglich.  The above steps can be carried out in one approach or in separate approaches. If the operations are to be carried out in one batch, they may be treated under the same conditions, e.g. isothermal, or under different conditions, e.g. as thermocycling. In certain embodiments, primer oligonucleotides and controller oligonucleotide are present at the beginning of the reaction. However, sequential addition of individual reagents is also possible.
Ebenfalls sind Kombinationen mit anderen Amplifikationsverfahren möglich, z.B. mit PCR, wobei die PCR beispielsweise erst über 1 bis 10 Zyklen durchgeführt und anschließend beispielsweise unter isothermalen Bedingungen weitergearbeitet wird.  Also, combinations with other amplification methods are possible, e.g. with PCR, wherein the PCR, for example, first carried out for 1 to 10 cycles and then further, for example, under isothermal conditions.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass der erste Bereich des Primer-Oligonukleotids vollständig sequenzspezifisch, d.h. insbesondere ohne Mismatches, an die zu amplifizierende Nukleinsäure binden kann.  In certain embodiments of the method according to the invention, it is provided that the first region of the primer oligonucleotide is completely sequence-specific, i. in particular without mismatches, to which the nucleic acid to be amplified can bind.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass der zweite Bereich (Überhang) des Primer-Oligonukleotids von einer für die Primerextension verwendeten Polymerase unter den gewählten Reaktionsbedingungen im Wesentlichen unkopiert bleibt.  In certain embodiments of the method according to the invention, it is provided that the second region (overhang) of the primer oligonucleotide remains essentially uncoupled from a polymerase used for the primer extension under the chosen reaction conditions.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens (Fig. 3, 4) ist vorgesehen, dass das Verfahren weiterhin folgenden Schritt umfasst: Hybridisieren eines Block- Oligonukleotids an einen Bereich der Nukleinsäurekette umfassend eine Zielsequenz  In certain embodiments of the method according to the invention (FIGS. 3, 4) it is provided that the method further comprises the following step: hybridizing a block oligonucleotide to a region of the nucleic acid chain comprising a target sequence
(Matrizenstrang) (M1 ), der sich in 5'-Richtung des Bereichs befindet, der vom ersten Bereich (Primerbindungsstelle) des Primer-Oligonukleotids gebunden wird, wobei das Block- Oligonukleotid dazu ausgebildet ist, die Extension des Primer-Oligonukleotids am gebunden Bereich zu blockieren. (Template strand) (M1) located in the 5 ' direction of the region bound by the first region (primer binding site) of the primer oligonucleotide, the block oligonucleotide being designed to inhibit extension of the primer oligonucleotide at the bound region to block.
In bestimmten Ausführungsformen der Erfindung ist vorgesehen, dass das Block-Oligonukleotid durch eine Länge von etwa 15 Nukleotiden bis etwa 60 Nukleotiden gekennzeichnet ist, und optional Modifikationen (z.B. PTO oder LNA ( locked nucleic acid, 2Ό, 4’C methylenverbrückte Ribosylreste im Polymer) oder PNA ( peptide nucleic acid, N-(2-Aminoethyl) glycine-Rückgrat) aufweist.  In certain embodiments of the invention, it is provided that the block oligonucleotide is characterized by a length of about 15 nucleotides to about 60 nucleotides, and optionally modifications (eg PTO or LNA (locked nucleic acid, 2Ό, 4'C methylenverbrückte ribosyl residues in the polymer) or PNA (peptide nucleic acid, N- (2-aminoethyl) glycine backbone).
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass der dritte Bereich des Controller-Oligonukleotids zum dem Teil des synthetisierten Bereiches des Primer-Verlängerungsproduktes im Wesentlichen komplementär ist, der sich unmittelbar an den Primer-Oligonukleotidanteil des Primer-Verlängerungsproduktes anschließt. Vorteilhafterweise wird dadurch die sequenzspezifische Verdrängung der zu amplifizierenden Nukleinsäure verbessert. In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens weist der Teil des synthetisierten Bereiches, der im Wesentlichen komplementär zum dritten Bereich des Controller- Nukleotids ist, eine Länge im Bereich von 5 Nukleotiden bis 50 Nukleotiden auf. In certain embodiments of the method according to the invention, it is provided that the third region of the controller oligonucleotide is substantially complementary to the part of the synthesized region of the primer extension product which directly adjoins the primer oligonucleotide portion of the primer extension product. Advantageously, this improves the sequence-specific displacement of the nucleic acid to be amplified. In certain embodiments of the method of the invention, the portion of the synthesized region that is substantially complementary to the third region of the controller nucleotide has a length in the range of 5 nucleotides to 50 nucleotides.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens weist der Teil des synthetisierten Bereiches, der im Wesentlichen komplementär zum dritten Bereich des Controller- Nukleotids ist, eine Länge im Bereich von 3 Nukleotide bis 70 Nukleotide auf, insbesondere 5 Nukleotide bis 50 Nukleotide, insbesondere 5 Nukleotide bis 50 Nukleotide, insbesondere 5 Nukleotide bis 30 Nukleotide, insbesondere 5 Nukleotide bis 20 Nukleotide.  In certain embodiments of the method according to the invention, the part of the synthesized region which is substantially complementary to the third region of the controller nucleotide has a length in the range from 3 nucleotides to 70 nucleotides, in particular 5 nucleotides to 50 nucleotides, in particular 5 nucleotides to 50 Nucleotides, in particular 5 nucleotides to 30 nucleotides, in particular 5 nucleotides to 20 nucleotides.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass das Verfahren weiterhin folgenden Schritt umfasst: Hybridisierung einer Sonde an einen Bereich des Primer-Extensionsproduktes, der nicht von dem Controller-Oligonukleotid gebunden wird.  In certain embodiments of the method of the invention, it is contemplated that the method further comprises the step of: hybridizing a probe to a portion of the primer extension product that is not bound by the controller oligonucleotide.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass das Verfahren im Wesentlichen isothermal durchgeführt wird.  In certain embodiments of the method according to the invention, it is provided that the method is carried out essentially isothermally.
Der Begriff "im Wesentlichen isothermal" bedeutet im Sinne der vorliegenden Beschreibung insbesondere, dass die Reaktionstemperatur innerhalb eines Temperaturbereichs von 10 K Temperaturdifferenz zwischen der höchsten und der niedrigsten Temperatur durchgeführt wird. The term "substantially isothermal" in the sense of the present description means in particular that the reaction temperature is carried out within a temperature range of 10 K temperature difference between the highest and the lowest temperature.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass die Zielsequenz einer Nukleinsäure eine Länge im Bereich von etwa 20 Nukleotiden bis etwa 300 Nukleotiden aufweist. In certain embodiments of the method according to the invention, it is provided that the target sequence of a nucleic acid has a length in the range from about 20 nucleotides to about 300 nucleotides.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass das Primer-Oligonukleotid eine Länge im Bereich von 15 Nukleotiden bis 100 Nukleotiden aufweist. In certain embodiments of the method according to the invention it is provided that the primer oligonucleotide has a length in the range of 15 nucleotides to 100 nucleotides.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass das Controller-Oligonukleotid eine Länge im Bereich von 20 Nukleotiden bis 100 Nukleotiden aufweist. In certain embodiments of the method according to the invention, it is provided that the controller oligonucleotide has a length in the range from 20 nucleotides to 100 nucleotides.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass die gewählten Reaktionsbedingungen eine Reaktionstemperatur im Bereich von 50 °C bis 70 °C umfassen.  In certain embodiments of the process according to the invention, it is provided that the chosen reaction conditions comprise a reaction temperature in the range from 50 ° C to 70 ° C.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens ist vorgesehen, dass das Primer-Oligonukleotid im zweiten Bereich eine Modifikation oder mehrere Modifikationen aufweist, insbesondere unmittelbar im Anschluss an den ersten Bereich des Primer-Oligonukleotids (Fig. 26), welche die verwendete Polymerase am zweiten Bereich stoppt. Vorteilhafterweise wird dadurch nur der erste Bereich des Primer-Oligonukleotids ggf. in späteren Verfahrensschritten amplifiziert.  In certain embodiments of the method according to the invention, it is provided that the primer oligonucleotide has one or more modifications in the second region, in particular immediately following the first region of the primer oligonucleotide (FIG. 26), which stops the polymerase used at the second region , Advantageously, only the first region of the primer oligonucleotide is optionally amplified in later process steps.
Dies kann bevorzugt durch Verwendung von Nukleotid-Modifikationen erreicht werden, welche zwar eine komplementäre Bindung mit dem Primer-Verlängerungsprodukt eingehen können, nicht aber von der Polymerase als Matrize akzeptiert werden. Beispiele für solche Nukleotid- Modifikationen stellen Nukleotid-Verbindungen mit modifizierten Phosphat-Zucker-Rückgrat- Anteilen, z.B. 2'-0-Alkyl-RNA Modifikationen (z.B. 2'-OMe), LNA-Modifikationen oder Morpholino- Modifikationen dar. Die Anwesenheit solcher Modifikationen in einem Strang hindert eine DNA abhängige Polymerase am Ablesen eines solchen Stranges. Die Anzahl von solchen Modifikationen kann unterschiedlich groß sein, in der Regel können wenige Modifikationen (zwischen 1 und 20) hinreichend sein, um eine Polymerase am Ablesen eines solchen Stranges zu hindern. Solche Nukleotid-Modifikationen können beispielsweise an oder um die Bindungsstelle des Primer-Oligonukleotides an das Controller-Oligonukleotid verwendet werden und/oder als Bestandteile des zweiten Bereichs des Primer-Oligonukleotides. This can preferably be achieved by using nucleotide modifications which, although capable of complementary binding to the primer extension product, are not accepted by the polymerase as a template. Examples of such nucleotide Modifications provide nucleotide compounds with modified phosphate-sugar backbone units, for example 2 '-0-alkyl-RNA modifications (eg 2' OMe), LNA modifications or morpholino modifications. The presence of such modifications in a strand prevents a DNA dependent polymerase reading such a strand. The number of such modifications may be different, usually few modifications (between 1 and 20) may be sufficient to prevent a polymerase from reading such a strand. Such nucleotide modifications can be used, for example, at or around the binding site of the primer oligonucleotide to the controller oligonucleotide and / or as constituents of the second region of the primer oligonucleotide.
Dank der Verwendung solcher Modifikationen kommt es zu einer lokalen Hinderung der Polymerasefunktion, so dass bestimmte Segmente der verwendeten Strukturen nicht durch die Polymerase kopiert werden können und vorwiegend einzelsträngig bleiben. In dieser einzelsträngigen Form können sie weitere Reaktionskomponenten binden und somit ihre Funktion ausführen.  Thanks to the use of such modifications, there is a local inhibition of the polymerase function, so that certain segments of the structures used can not be copied by the polymerase and remain predominantly single-stranded. In this single-stranded form they can bind further reaction components and thus perform their function.
Der zweite Primerbereich ist nur in einer von mehreren alternativen Ausführungsformen unkopierbar. Diese Ausführungsform ermöglicht beispielsweise die Verwendung von gleichen Primern in der Primer-Extension und in einer gegebenenfalls nachfolgenden Amplifikation.  The second primer region is uncopiable only in one of several alternative embodiments. This embodiment allows, for example, the use of identical primers in the primer extension and in an optionally subsequent amplification.
Nur bei Verwendung von kurzen Matrizen sollte dieser zweite Primberbereich unbedingt unkopierbar sein, da das 3'-Ende von solch kurzen Matrizen unmittelbar vor dem zweiten Bereich stehen kann und somit eine Synthese primen kann (Matrizenstrang wird somit ebenfalls verlängert, siehe Figuren 16 - 18: das 3'-Ende einer Matrize kann unmittelbar vor dem 2. Bereich liegen). Um das Kopieren des 2. Bereichs des Primers zu verhindern, müssen Primer einen "Schutz" haben. Dieser kann darin bestehen, dann eine "erste Blockierungseinheit" vor dem zweiten Bereich steht oder der gesamte zweite Bereich aus Modifikationen besteht, welche unkopierbar sind. Only when short matrices are used, should this second primer region be uncopiable, since the 3 ' end of such short matrices can be immediately before the second region and thus prime a synthesis (template strand is thus also extended, see FIGS. 16-18: the 3 ' end of a template may be just before the 2nd range). To prevent copying the second area of the primer, primers must have a "protection". This may consist of a "first blocking unit" before the second area or the entire second area consists of modifications that are uncopiable.
Dieser zweite Primer-Bereich kann bei Verwendung von langen Matrizen aber durchaus kopierbar sein (siehe Fig. 1 - 3), da das 3'-Ende von der Matrize nicht unmittelbar vor dem zweiten Bereich steht und somit eine Synthese nicht primen kann. Bei dieser Ausführungsform kann der Primer- Extension Primer nicht als Amplifikations-Primer verwendet werden. However, this second primer region can be quite copiable when using long matrices (see FIGS. 1-3), since the 3 ' end of the template is not immediately in front of the second region and thus can not prime a synthesis. In this embodiment, the primer extension primer can not be used as an amplification primer.
Weiterhin ist von Bedeutung, dass der zweite Bereich nicht an die Matrize binden darf und somit für die Interaktion mit dem Controller einzelsträngig vorliegt.  Furthermore, it is important that the second region is not allowed to bind to the template and thus is present for the interaction with the controller single-stranded.
Nachfolgend sind einige Aspekte der Erfindung zusammengefasst:  Some aspects of the invention are summarized below:
1 . Das Verfahren zur spezifischen Verlängerung eines Primer-Oligonukleotids, umfassend die Schritte:  1 . The method of specifically extending a primer oligonucleotide, comprising the steps of:
a) Bereitstellung einer Nukleinsäurekette umfassend eine Zielsequenz  a) providing a nucleic acid chain comprising a target sequence
(Matrizenstrang) (M1 ) b) Hybridisieren eines Primer-Oligonukleotids (P1 .1 ) an ein Segment umfassend einen Anteil der Zielsequenz (Primer-Bindungsstelle) der bereitgestellten (Matrix strand) (M1) b) hybridizing a primer oligonucleotide (P1 .1) to a segment comprising a portion of the target sequence (primer binding site) of the provided
Nukleinsäurekette (M1 ), wobei das Primer-Oligonukleotid (P1 .1 ) folgende Bereiche umfasst:  Nucleic acid chain (M1), wherein the primer oligonucleotide (P1 .1) comprises the following ranges:
einen ersten Bereich, der im Wesentlichen sequenzspezifisch, an ein komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb einer bereitgestellten Nukleinsäurekette (M1 ) binden kann,  a first region, substantially sequence-specific, capable of binding to a complementary segment (primer binding site) comprising a portion of the target sequence within a provided nucleic acid sequence (M1),
einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C1 .1 ) gebunden werden kann; c) Verlängerung des Primer-Oligonukleotids (P.1 .1 ) durch eine matrizenabhängige Polymerase unter Erhalt eines Primer-Verlängerungsprodukts (Primer- Extensionsprodukt, P1 .1 -Ext), welches neben dem Primer-Oligonukleotid (P1 .1 ) einen synthetisierten Bereich umfasst, der im Wesentlichen komplementär zur Nukleinsäurekette umfassend eine Zielsequenz (M1 ) ist, wobei das Primer- Verlängerungsprodukt (P1 .1 -Ext) und die Nukleinsäurekette (M1 ) unter Reaktionsbedinungen einen Doppelstrang bilden;  a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1); c) extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase to give a primer extension product (primer extension product, P1 .1 -Ext) which has a synthesized region in addition to the primer oligonucleotide (P1.1) which is substantially complementary to the nucleic acid chain comprising a target sequence (M1), wherein the primer extension product (P1 .1 -Ext) and the nucleic acid chain (M1) form a double strand under reaction conditions;
d) Bindung eines Controller-Oligonukleotids (C1 .1 ) an das Primer- Verlängerungsprodukt (P1 .1 -Ext), wobei das Controller-Oligonukleotid (C1 .1 ) folgende Bereiche umfasst:  d) binding of a controller oligonucleotide (C1.1) to the primer extension product (P1.1-Tex), wherein the controller oligonucleotide (C1.1) comprises the following ranges:
einen ersten Bereich, der an den zweiten Bereich (Überhang) des ersten Primer-Verlängerungsprodukts (P1 .1 -Ext) binden kann,  a first region that can bind to the second region (overhang) of the first primer extension product (P1 .1 -Ext),
einen zweiten Bereich, der zum ersten Bereich des Primer-Oligonukleotids (P1 .1 ) komplementär ist, und  a second region complementary to the first region of the primer oligonucleotide (P1 .1), and
einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches des Primer- Verlängerungsprodukts (P1 1-Ext) im Wesentlichen komplementär ist; und  a third region which is substantially complementary to at least a portion of the synthesized region of the primer extension product (P1 1-Ext); and
wobei das Controller-Oligonukleotid (C1 .1 ) nicht als Matrize für eine Primerverlängerung des Primer-Oligonukleotids (P1 .1 ) dient, und das Controller- Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an das Primer-Verlängerungsprodukts (P1 1 -Ext) unter Verdrängung von komplementären Segmenten der Nukleinsäurekette (M1 ) binden kann.  wherein the controller oligonucleotide (C1 .1) does not serve as a template for a primer extension of the primer oligonucleotide (P1 .1) and the controller oligonucleotide (C1 .1) with its first, second and third regions to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1) can bind.
In bestimmten Ausführungsformen umfasst eine Zielsequenz einen polymorphen Lokus, welcher mindestens eine Nukleotid-Position umfasst, welche mindestens zwei charakteristische Sequenz- Varianten bei einer Zielsequenz umfasst. In bestimmten Ausführungsformen umfasst eine Zielsequenz einen polymorphen Lokus, welcher mindestens zwei Nukleotid-Positionen umfasst, welche mindestens zwei charakteristische Sequenz-Varianten bei einer Zielsequenz umfassen. In certain embodiments, a target sequence comprises a polymorphic locus comprising at least one nucleotide position comprising at least two characteristic sequence variants in a target sequence. In certain embodiments, a target sequence comprises a polymorphic locus comprising at least two nucleotide positions comprising at least two characteristic sequence variants in a target sequence.
In bestimmten Ausführungsformen umfasst eine Zielsequenz einen polymorphen Lokus, welcher eine Länge zwischen ein Nukleotid bis 100 Nukleotiden umfasst, wobei ein solcher Lokus mindestens zwei charakteristische Sequenz-Varianten einer Zielsequenz umfasst.  In certain embodiments, a target sequence comprises a polymorphic locus comprising a length between one nucleotide to 100 nucleotides, such locus comprising at least two characteristic sequence variants of a target sequence.
In bestimmten Ausführungsformen in Schritt (1 ) werden mindestens zwei Matrizenstränge bereitgestellt, wobei jeder Matrizenstrang eine Variante einer Zielsequenz mit einer spezifischen und charakteristischen Sequenzvariante eines polymorphen Lokus umfasst.  In certain embodiments in step (1), at least two template strands are provided, each template strand comprising a variant of a target sequence having a specific and characteristic sequence variant of a polymorphic locus.
In bestimmten Ausführungsformen werden in Schritt (1 ) mindestens zwei Matrizenstränge bereitgestellt, wobei jeder Matrizenstrang eine eigene Zielsequenz umfasst und diese  In certain embodiments, at least two template strands are provided in step (1), each template strand comprising its own target sequence and these
Zielsequenzen der ersten und einer weiteren Start-Nukleinsäurekette unterschiedlich sind. Target sequences of the first and another start nucleic acid chain are different.
2. Verfahren nach Nr. 1 , dadurch gekennzeichnet, dass der zweite Bereich (Überhang) des Primer-Oligonukleotids (P1 .1 ) von einer für die Primerverlängerung verwendeten  2. The method according to no. 1, characterized in that the second region (overhang) of the primer oligonucleotide (P1 .1) of a used for the primer extension
Polymerase unter den gewählten Reaktionsbedingungen im Wesentlichen unkopiert bleibt. Polymerase remains essentially unkopiert under the selected reaction conditions.
3. Verfahren nach einer der vorstehenden Nummern, wobei die Primer-Verlängerung des an die Nukleinsäurekette (M 1 ) hybridisierten Primers (P1 .1 ) durch eine matrizenabhängige Polymerase in Anwesenheit des Controller-Oligonukleotides (C 1 .1 ) im gleichen 3. Method according to one of the preceding numbers, wherein the primer extension of the hybridized to the nucleic acid chain (M 1) primer (P1 .1) by a template-dependent polymerase in the presence of the controller oligonucleotide (C 1 .1) in the same
Reaktionsansatz erfolgt.  Reaction approach takes place.
4. Verfahren nach einer der vorstehenden Nummern, wobei das gebildete Primer- Verlängerungsprodukt von der Nukleinsäurekette (M 1 ) unter Mitwirkung des Controller- Oligonukleotides (C1 .1 ) getrennt wird.  4. Method according to one of the preceding numbers, wherein the primer extension product formed is separated from the nucleic acid chain (M 1) with the assistance of the controller oligonucleotide (C1 .1).
5. Verfahren nach einer der vorstehenden Nummern, wobei Schritte (b) bis (d) mindestens einmal wiederholt werden.  5. The method according to any one of the preceding numbers, wherein steps (b) to (d) are repeated at least once.
6. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass das Verfahren weiterhin folgenden Schritt umfasst:  6. The method according to any one of the preceding numbers, characterized in that the method further comprises the following step:
Hybridisieren eines Block-Oligonukleotids (B1 .1 ) an ein Sequenzsegment der Nukleinsäurekette (M1 ), das sich in 5'-Richtung von dem Segment (Primerbindungsstelle) befindet, der vom ersten Bereich des Primer- Oligonukleotids (P1 .1 ) gebunden wird, wobei das Block-Oligonukleotid (B1 .1 ) dazu ausgebildet ist, die Synthese des Primer-Verlängerungsproduktes (P1 1 -Ext) am gebunden Segment zu verhindern, so dass dadurch die Länge des Hybridizing a block oligonucleotide (B1 .1) to a sequence segment of the nucleic acid chain (M1) that is in the 5 ' direction of the segment (primer binding site) bound by the first region of the primer oligonucleotide (P1 .1), wherein the block oligonucleotide (B1 .1) is designed to prevent the synthesis of the primer extension product (P1 1 -Ext) on the bound segment, thereby reducing the length of the
synthetisierten Bereichs des Primer-Verlängerungsproduktes begrenzt wird.  is limited to the synthesized region of the primer extension product.
7. Verfahren nach Nr. 6, wobei der Schritt der Hybridisierung eines Block-Oligonukleotides (B1 .1 ) vor dem Schritt der Primer-Verlängerung erfolgt. 8. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass der dritte Bereich des Controller-Oligonukleotids (C1 .1 ) zum dem Teil des synthetisierten Bereiches des Primer-Verlängerungsproduktes im Wesentlichen komplementär ist und sich unmittelbar an den Primer-Oligonukleotidanteil des Primer-Verlängerungsproduktes (P1 1-Ext) anschließt. 7. The method of claim 6, wherein the step of hybridizing a block oligonucleotide (B1 .1) occurs prior to the step of primer extension. 8. Method according to one of the preceding numbers, characterized in that the third region of the controller oligonucleotide (C1.1) is substantially complementary to the part of the synthesized region of the primer extension product and is directly connected to the primer oligonucleotide portion of the primer. Extension product (P1 1-Ext) connects.
9. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass das Verfahren im Wesentlichen isothermal durchgeführt wird.  9. The method according to any one of the preceding numbers, characterized in that the method is carried out substantially isothermally.
10. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass die Zielsequenz der Nukleinsäurekette (M1 ) eine Länge von 20 Nukleotiden bis 200 Nukleotiden umfasst.  10. The method according to any one of the preceding numbers, characterized in that the target sequence of the nucleic acid chain (M1) comprises a length of 20 nucleotides to 200 nucleotides.
1 1 . Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass das Primer-Oligonukleotid (P1 .1 ) eine Länge im Bereich von 15 Nukleotiden bis 100 Nukleotiden aufweist.  1 1. Method according to one of the preceding numbers, characterized in that the primer oligonucleotide (P1 .1) has a length in the range of 15 nucleotides to 100 nucleotides.
12. Verfahren nach einer der vorstehenden Nummern, durch gekennzeichnet, dass das Controller-Oligonukleotid (C1 .1 ) eine Länge im Bereich von 20 Nukleotiden bis 100 Nukleotiden aufweist.  12. The method according to any one of the preceding numbers, characterized in that the controller oligonucleotide (C1 .1) has a length in the range of 20 nucleotides to 100 nucleotides.
13. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass die gewählten Reaktionsbedingungen eine Reaktionstemperatur im Bereich von 25 °C bis 80 °C umfassen.  13. The method according to any one of the preceding numbers, characterized in that the selected reaction conditions include a reaction temperature in the range of 25 ° C to 80 ° C.
14. Verfahren nach einer der vorstehenden Nummern, dadurch gekennzeichnet, dass das Primer-Oligonukleotid (P1 .1 ) im zweiten Bereich eine Modifikation oder mehrere Modifikationen aufweist, insbesondere unmittelbar im Anschluss an den ersten Bereich des Primer-Oligonukleotid (P1 .1 ), welche die verwendete Polymerase am Kopieren des zweiten Bereichs hindert.  14. The method according to any one of the preceding numbers, characterized in that the primer oligonucleotide (P1 .1) in the second region has a modification or several modifications, in particular immediately after the first region of the primer oligonucleotide (P1 .1), which prevents the polymerase used from copying the second area.
15. Kit zur Durchführung eines Verfahrens nach einer der vorstehenden Nummern,  15. kit for carrying out a method according to one of the preceding numbers,
umfassend:  full:
ein Primer-Oligonukleotid (P1 .1 ) umfassend folgende Bereiche:  a primer oligonucleotide (P1 .1) comprising the following ranges:
o einen ersten Bereich, der im Wesentlichen sequenzspezifisch, an ein komplementäres Segment (Primer-Bindungsstelle) innerhalb einer bereitgestellten Nukleinsäurekette (M1 ) umfassend eine Zielsequenz binden kann,  o a first region that can bind substantially sequence-specifically to a complementary segment (primer binding site) within a provided nucleic acid sequence (M1) comprising a target sequence,
o einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C1 .1 ) gebunden werden kann;  o a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C1 .1);
wobei das erste Primer-Oligonukleotid (P1 .1 ), wenn hybridisiert an komplementäres Segment der Zielsequenz, durch eine matrizenabhängige Polymerase zu einem Primer-Verlängerungsprodukt (P1 1-Ext) verlängert werden kann, welches neben dem Primer- Oligonukleotid (P1 .1 ) einen synthetisierten Bereich umfasst; wherein the first primer oligonucleotide (P1 .1), when hybridized to the complementary segment of the target sequence, is replaced by a template-dependent polymerase can be extended to a primer extension product (P1 1-Ext) comprising a synthesized region in addition to the primer oligonucleotide (P1 .1);
ein Controller-Oligonukleotid (C1 .1 ) umfassend folgende Bereiche:  a controller oligonucleotide (C1 .1) comprising the following ranges:
o einen ersten Bereich, der an den zweiten Bereich (Überhang) des ersten Primer-Verlängerungsprodukts (P1 .1 -Ext) binden kann, o einen zweiten Bereich, der zum ersten Bereich des Primer- Oligonukleotids (P1 .1 ) komplementär ist, und  o a first region that can bind to the second region (overhang) of the first primer extension product (P1 .1 -Ext), o a second region that is complementary to the first region of the primer oligonucleotide (P1 .1), and
o einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches des Primer- Verlängerungsprodukts (P1 1-Ext) im Wesentlichen komplementär ist; und  o a third region which is substantially complementary to at least part of the synthesized region of the primer extension product (P1 1-Ext); and
wobei das Controller-Oligonukleotid (C1 .1 ) nicht als Matrize für eine  wherein the controller oligonucleotide (C1 .1) is not used as a template for a
Primerverlängerung des Primer-Oligonukleotids (P1 .1 ) dient, und das Controller- Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an das Primer-Verlängerungsprodukt (P1 1 -Ext) unter Verdrängung von komplementären Segmenten der Nukleinsäurekette (M1 ) binden kann; und optional  Primer extension of the primer oligonucleotide (P1 .1), and the controller oligonucleotide (C1 .1) with its first, second and third region to the primer extension product (P1 1 -Ext) with displacement of complementary segments of the nucleic acid chain (M1 ) can bind; and optional
ein Block-Oligonukleotid (B1 .1 ), das an ein Segment der Nukleinsäurekette (M1 ) binden kann, das sich in 5'-Richtung von dem Segment (Primerbindungsstelle) befindet, das vom ersten Bereich des Primer-Oligonukleotids (P1 .1 ) gebunden wird, wobei das Block-Oligonukleotid (B1 .1 ) dazu ausgebildet ist, die Synthese des Primer-Verlängerungsproduktes (P1 1 -Ext) am gebunden Bereich zu blockieren und dadurch die Länge des synthetisierten Bereichs des Primer- Verlängerungsproduktes zu limitieren. a block oligonucleotide (B1 .1) that can bind to a segment of the nucleic acid chain (M1) that is in the 5 ' direction from the segment (primer binding site) that is located in the first region of the primer oligonucleotide (P1 .1) wherein the block oligonucleotide (B1 .1) is adapted to block the synthesis of the primer extension product (P1 1 -Ext) at the bound region and thereby to limit the length of the synthesized region of the primer extension product.
Kit nach Nr. 15, dadurch gekennzeichnet, dass der zweite Bereich des Primer- Oligonukleotids (P1 .1 ) von einer für die Primerverlängerung verwendeten Polymerase unter den gewählten Reaktionsbedingungen im Wesentlichen unkopiert bleibt. Kit according to No. 15, characterized in that the second region of the primer oligonucleotide (P1 .1) remains substantially uncoated by a polymerase used for the primer extension under the chosen reaction conditions.
Verwendung eines Kits nach Nr. 15 oder 16 für die Durchführung eines Verfahrens nach einem der Nr. 1 bis 14. Use of a kit according to No. 15 or 16 for carrying out a method according to one of the No. 1 to 14.
Verfahren zur spezifischen Verlängerung eines Primer-Oligonukleotids, umfassend die Schritte: A method for the specific extension of a primer oligonucleotide, comprising the steps:
a) Bereitstellung von mindesten zwei Nukleinsäureketten umfassend Varianten einer Zielsequenz (Matrizenstrang) (M 1 .1 und M 1 .2), wobei bereitgestellte  a) providing at least two nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided
Nukleinsäureketten  nucleic acid chains
mindestens ein einheitliches Segment umfassen, welches für M 1 .1 und M 1 .2 spezifisch ist und bei M 1 .1 und M 1 .2 identisch ist, und mindestens ein charakteristisches, für jede Nukleinsäurekette spezifisches Segment umfassen comprise at least one unitary segment which is specific for M 1 .1 and M 1 .2 and is identical for M 1 .1 and M 1 .2, and at least one characteristic segment specific for each nucleic acid chain
b) Bereitstellung eines ersten Primer-Oligonukleotids (P1 .1 ), welches an das b) providing a first primer oligonucleotide (P1 .1) attached to the
einheitliche Segment von mindestens zwei bereitgestellten Nukleinsäureketten komplementär binden kann, wobei das Primer-Oligonukleotid  unitary segment of at least two provided nucleic acid chains can complementarily bind, wherein the primer oligonucleotide
einen ersten Bereich, der im Wesentlichen sequenzspezifisch, an ein komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb eines einheitlichen Segments von bereitgestellten Nukleinsäureketten (M 1 .1 und M 1 .2) binden kann, einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C 1 .1 oder C 1 .2) gebunden werden kann;  a first region, substantially sequence-specific, capable of binding to a complementary segment (primer binding site) comprising a portion of the target sequence within a unitary segment of nucleic acid chains provided (M 1 .1 and M 1 .2), a second region (overhang) which connects to the 5 'end of the first region or is linked via a linker, which second region can be bound by a controller oligonucleotide (C 1 .1 or C 1 .2);
wobei die Bindung an das einheitliche Segment der bereitgestellten  being the binding to the unitary segment of the provided
Nukleinsäureketten dermaßen erfolgt, dass das jeweils charakteristische und spezifische Segment in 5'-Richtung der bereitgestellten Nukleinsäurekette vom hybridisierten Primer (P 1 .1 ) liegt; Nucleic acid chains carried out so that each characteristic and specific segment in the 5 ' direction of the nucleic acid chain provided by the hybridized primer (P 1 .1);
c) Bereitstellung von mindestens zwei Controller-Oligonukleotiden (C1 .1 und C1 .2), wobei jedes folgende Bereiche umfasst: c) providing at least two controller oligonucleotides (C1 .1 and C1 .2), each comprising the following ranges:
einen ersten Bereich, der an den zweiten Bereich des Primer- Oligonukleotids (P1 .1 ) (Überhang) binden kann, und  a first region which can bind to the second region of the primer oligonucleotide (P1 .1) (overhang), and
einen zweiten Bereich, der zum ersten Bereich des Primer-Oligonukleotids (P1 .1 ) komplementär ist, und  a second region complementary to the first region of the primer oligonucleotide (P1 .1), and
einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches von mindestens einem zu erwartenden ersten Primer- Verlängerungsprodukt (P1 .1 -Ext oder P1 2-Ext) komplementär ist; und wobei die Controller-Oligonukleotide (C1 .1 und C1 .2) nicht als Matrize für eine Primerverlängerung des Primer-Oligonukleotids (P1 .1 ) dienen, und das Controller-Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 1 -Ext) unter Verdrängung der  a third region which is complementary to at least part of the synthesized region of at least one expected first primer extension product (P1 .1 -Ext or P1 2-Ext); and wherein the controller oligonucleotides (C1 .1 and C1 .2) do not serve as template for primer extension of the primer oligonucleotide (P1 .1), and the controller oligonucleotide (C1 .1) with its first, second and third regions to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of the
Nukleinsäurekette (M 1 .1 ) binden kann und  Nucleic acid chain (M 1 .1) can bind and
das Controller-Oligonukleotid (C1 .2) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 2-Ext) unter Verdrängung der the controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer Extension product (P1 2-Ext) with displacement of
Nukleinsäurekette (M 1 .2) binden kann.  Nucleic acid chain (M 1 .2) can bind.
d) Hybridisieren eines Primer-Oligonukleotids (P1 .1 ) an ein Segment umfassend einen Anteil der Zielsequenz (Primer-Bindungsstelle) von mindestens zwei bereitgestellten Nukleinsäureketten (M 1 .1 und M 1 .2),  d) hybridizing a primer oligonucleotide (P1 .1) to a segment comprising a portion of the target sequence (primer binding site) of at least two nucleic acid chains provided (M 1 .1 and M 1 .2),
e) Verlängerung des Primer-Oligonukleotids (P.1 .1 ) durch eine matrizenabhängige Polymerase unter Verwendung von bereitgestellten Nukleinsäureketten als Matrizen für die Primer-Verlängerung unter Erhalt von spezifischen Primer- Verlängerungsprodukten (Primer-Extensionsprodukte, P1 .1-Ext und P1 2-Ext), wobei jedes neben dem Primer-Oligonukleotid (P1 .1 ) einen synthetisierten Bereich umfasst, der im Wesentlichen komplementär zu der jeweiligen Nukleinsäurekette umfassend eine Zielsequenz (M1 ) ist, wobei  e) extension of the primer oligonucleotide (P.1.1) by a template-dependent polymerase using provided nucleic acid chains as templates for primer extension to give specific primer extension products (primer extension products, P1 .1-Ext and P1 2 Each) in addition to the primer oligonucleotide (P1 .1) comprises a synthesized region which is substantially complementary to the respective nucleic acid chain comprising a target sequence (M1), wherein
das Primer-Verlängerungsprodukt (P1 1 -Ext) einen synthetisierten komplementären Bereich zum charakteristischen und spezifischen Segment der einen Nukleinsäure (M 1 .1 ) umfasst und  the primer extension product (P1 1 -Ext) comprises a synthesized complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
das Primer-Verlängerungsprodukt (P1 2-Ext) einen synthetisierten komplementären Bereich zum charakteristischen und spezifischen Segment der zweiten Nukleinsäure (M 1 .2) umfasst und  the primer extension product (P1 2-Ext) comprises a synthesized complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
die synthetisierten Primer-Verlängerungsprodukte (P1 .1-Ext und P1 2-Ext) und ihre entsprechende als Matrize dienende Nukleinsäurekette (M 1 .1 und M 1 .2) unter the synthesized primer extension products (P1 .1-Ext and P1 2-Ext) and their corresponding template nucleic acid chain (M 1 .1 and M 1 .2)
Reaktionsbedingungen je einen Doppelstrang bilden; Reaction conditions each form a double strand;
f) Bindung mindestens eines Controller-Oligonukleotids (C1 .1 und C 1 .2) an die im Schritt (e) gebildeten Primer-Verlängerungsprodukte (P1 1-Ext und P1 2-Ext), wobei  f) binding of at least one controller oligonucleotide (C1 .1 and C 1 .2) to the primer extension products (P1 1-Ext and P1 2-Ext) formed in step (e), wherein
das Controller-Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 1 -Ext) unter Verdrängung der Nukleinsäurekette (M 1 .1 ) binden kann und  the controller oligonucleotide (C1 .1) with its first, second and third region can bind to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of the nucleic acid chain (M 1 .1) and
das Controller-Oligonukleotid (C1 .2) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 2-Ext) unter Verdrängung der Nukleinsäurekette (M 1 .2) binden kann.  the controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer extension product (P1 2-Ext) with displacement of the nucleic acid chain (M 1 .2) can bind.
Verfahren nach Nr. 18, wobei Nukleinsäureketten umfassend Varianten einer Zielsequenz (Matrizenstrang) (M 1 .1 und M 1 .2), mindestens zwei einheitliche Segmente umfassen, welches bei M1 .1 und M1 .2 identisch ist. 20. Verfahren nach Nr. 19, wobei das einheitliche Segment eine Länge von 10 bis 180 Nukleotiden umfasst. Method according to No. 18, wherein nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2) comprise at least two uniform segments, which is identical in M1 .1 and M1 .2. 20. The method of no. 19, wherein the unitary segment comprises a length of 10 to 180 nucleotides.
21 . Verfahren nach Nr. 18 bis 20, wobei das charakteristische und spezifische Segment eine Länge von einem Nukleotid bis zu 50 Nukleotiden umfasst.  21. The method according to Nos. 18 to 20, wherein the characteristic and specific segment comprises a length of one nucleotide up to 50 nucleotides.
22. Verfahren zur spezifischen Verlängerung eines Primer-Oligonukleotids, umfassend die Schritte:  22. A method for the specific extension of a primer oligonucleotide, comprising the steps:
a) Bereitstellung von mindesten zwei Nukleinsäureketten umfassend Varianten einer Zielsequenz (Matrizenstrang) (M 1 .1 und M 1 .2), wobei bereitgestellte Nukleinsäureketten  a) providing at least two nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided nucleic acid chains
mindestens ein einheitliches Segment umfassen, welches für M 1 .1 und M 1 .2 spezifisch ist und bei M 1 .1 und M 1 .2 identisch ist, und  comprise at least one unitary segment which is specific for M 1 .1 and M 1 .2 and is identical for M 1 .1 and M 1 .2, and
mindestens ein charakteristisches, für jede Nukleinsäurekette spezifisches Segment umfassen  at least one characteristic segment specific for each nucleic acid chain
b) Bereitstellung von mindestens zwei ersten Primer-Oligonukleotiden (P1 .1 und P 1 .2), welche jeweils vollständig oder teilweise an das korrespondierende charakteristische und spezifische Segment jeder der bereitgestellten  b) providing at least two first primer oligonucleotides (P1 .1 and P 1 .2) each fully or partially attached to the corresponding characteristic and specific segment of each of the provided
Nukleinsäureketten komplementär binden können, wobei jedes Primer- Oligonukleotid  Nucleic acid chains can bind complementary, wherein each primer oligonucleotide
einen ersten Bereich umfasst, der jeweils sequenzspezifisch an ein komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb eines charakteristischen und spezifischen Segments von bereitgestellten Nukleinsäureketten (M 1 .1 und M 1 .2) binden kann,  a first region, each of which can sequence-specifically bind to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of nucleic acid chains provided (M 1 .1 and M 1 .2),
einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C 1 .1 oder C 1 .2) gebunden werden kann;  a second region (overhang) connected to the 5 'end of the first region or connected via a linker, which second region can be bound by a controller oligonucleotide (C 1 .1 or C 1 .2);
c) Bereitstellung von mindestens zwei Controller-Oligonukleotiden (C1 .1 und C1 .2), wobei jedes folgende Bereiche umfasst:  c) providing at least two controller oligonucleotides (C1 .1 and C1 .2), each comprising the following ranges:
einen ersten Bereich, der an den zweiten Bereich der Primer- Oligonukleotide (P1 .1 und / oder P1 .2) (Überhang) binden kann, und einen zweiten Bereich, der zum ersten Bereich des jeweiligen Primer- Oligonukleotids (P1 .1 oder P1 .2) komplementär ist, wobei  a first region which can bind to the second region of the primer oligonucleotides (P1 .1 and / or P1 .2) (overhang), and a second region which can be bound to the first region of the respective primer oligonucleotide (P1 .1 or P1 .2) is complementary, where
C 1 .1 einen komplementären zweiten Bereich zum  C 1 .1 a complementary second area to
korrespondierenden ersten Bereich des P1 .1 umfasst und C 1 .2 einen komplementären zweiten Bereich zum corresponding first area of P1 .1 comprises and C 1 .2 a complementary second area to
korrespondierenden ersten Bereich des P1 .2 umfasst  corresponding first area of P1 .2 includes
und  and
einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches von mindestens einem zu erwartenden ersten Primer- Verlängerungsprodukt (P 1 1 -Ext oder P 1 2-Ext) komplementär ist;  a third region which is complementary to at least part of the synthesized region of at least one expected first primer extension product (P 1 1 -xt or P 1 2-Ext);
wobei die Controller-Oligonukleotide (C 1 .1 und C 1 .2) nicht als Matrize für eine Primerverlängerung eines verwendeten Primer-Oligonukleotids (P 1 .1 oder P 1 .2) dienen,  wherein the controller oligonucleotides (C 1 .1 and C 1 .2) do not serve as template for a primer extension of a primer oligonucleotide used (P 1 .1 or P 1 .2),
d) Hybridisieren von mindestens einem Primer-Oligonukleotid (P1 .1 und / oder P1 .2) an das jeweils komplementäre Segment umfassend einen Anteil der Zielsequenz (Primer-Bindungsstelle) von mindestens einer der bereitgestellten d) hybridizing at least one primer oligonucleotide (P1 .1 and / or P1 .2) to the respective complementary segment comprising a portion of the target sequence (primer binding site) of at least one of the provided
Nukleinsäureketten (M 1 .1 und M 1 .2),  Nucleic acid chains (M 1 .1 and M 1 .2),
e) Verlängerung mindestens eines Primer-Oligonukleotids (P1 .1 und / oder P1 .2) durch eine matrizenabhängige Polymerase unter Verwendung von bereitgestellten Nukleinsäureketten als Matrizen für die Primer-Verlängerung unter Erhalt von mindestens einem spezifischen Primer-Verlängerungsprodukt (Primer- Extensionsprodukte, P1 1 -Ext und P1 2-Ext), wobei jedes neben dem Primer- Oligonukleotid (P1 .1 oder P1 .2) einen synthetisierten Bereich umfasst, der im Wesentlichen komplementär zu der jeweiligen Nukleinsäurekette umfassend eine Zielsequenz (M1 ) ist, wobei e) extension of at least one primer oligonucleotide (P1 .1 and / or P1 .2) by a template-dependent polymerase using provided nucleic acid chains as templates for primer extension to give at least one specific primer extension product (primer extension products, P1 1 -xt and P1 2-Ext), each comprising in addition to the primer oligonucleotide (P1 .1 or P1 .2) a synthesized region which is substantially complementary to the respective nucleic acid chain comprising a target sequence (M1), wherein
das Primer-Verlängerungsprodukt (P1 .1 -Ext) einen komplementären Bereich zum charakteristischen und spezifischen Segment der einen Nukleinsäure (M 1 .1 ) umfasst und  the primer extension product (P1 .1 -Ext) comprises a complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
das Primer-Verlängerungsprodukt (P1 2-Ext) einen komplementären Bereich zum charakteristischen und spezifischen Segment der zweiten Nukleinsäure (M 1 .2) umfasst und  the primer extension product (P1 2-Ext) comprises a complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
die synthetisierten Primer-Verlängerungsprodukte (P1 .1-Ext und P1 2-Ext) und ihre entsprechende als Matrize dienende Nukleinsäurekette (M 1 .1 und M 1 .2) unterthe synthesized primer extension products (P1 .1-Ext and P1 2-Ext) and their corresponding template nucleic acid chain (M 1 .1 and M 1 .2)
Reaktionsbedinungen je einen Doppelstrang bilden; Reaction conditions each form a double strand;
f) Bindung mindestens eines Controller-Oligonukleotids (C1 .1 und C 1 .2) an die im Schritt (e) gebildeten Primer-Verlängerungsprodukte (P1 1-Ext und P1 2-Ext), wobei f) binding of at least one controller oligonucleotide (C1 .1 and C 1 .2) to the primer extension products (P1 1-Ext and P1 2-Ext) formed in step (e), wherein
das Controller-Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 1 -Ext) unter Verdrängung der the controller oligonucleotide (C1 .1) with its first, second and third region to the complementary segments of the primer Extension product (P1 1 -ext) displacing the
Nukleinsäurekette (M 1 .1 ) binden kann und  Nucleic acid chain (M 1 .1) can bind and
das Controller-Oligonukleotid (C1 .2) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 2-Ext) unter Verdrängung der Nukleinsäurekette (M 1 .2) binden kann.  the controller oligonucleotide (C1 .2) with its first, second and third region to the complementary segments of the primer extension product (P1 2-Ext) with displacement of the nucleic acid chain (M 1 .2) can bind.
Verfahren nach Nr. 22, wobei die Bindung eines jeweiligen ersten Primers an das charakteristische und spezifische Segment der bereitgestellen Nukleinsäureketten dermaßen erfolgt, dass das jeweils charakteristische und spezifische Segment der Nukleinsäurekette vom 3'-terminalen Nukleotid des jeweiligen ersten Primers Method according to No. 22, wherein the binding of a respective first primer to the characteristic and specific segment of the provided nucleic acid chains takes place in such a way that the respective characteristic and specific segment of the nucleic acid chain from the 3 ' -terminal nucleotide of the respective first primer
komplementär gebunden wird. is bound complementary.
Verfahren nach Nr. 22, wobei die Bindung eines jeweiligen ersten Primers an das charakteristische und spezifische Segment der bereitgestellen Nukleinsäureketten dermaßen erfolgt, dass das jeweils charakteristische und spezifische Segment der Nukleinsäurekette vom 3'-Segment des jeweiligen ersten Primers komplementär gebunden wird. Method according to No. 22, wherein the binding of a respective first primer to the characteristic and specific segment of the provided nucleic acid chains takes place such that the respectively characteristic and specific segment of the nucleic acid chain is bound in a complementary manner by the 3 ' segment of the respective first primer.
Verfahren zur spezifischen Verlängerung eines Primer-Oligonukleotids unter Verwendung eines Kompetitor-Primers (Fig. 21 - 23), umfassend die Schritte: A method of specifically extending a primer oligonucleotide using a competitor primer (Figures 21-23), comprising the steps of:
a) Bereitstellung von mindesten zwei Nukleinsäureketten umfassend Varianten einer Zielsequenz (Matrizenstrang) (M 1 .1 und M 1 .2), wobei bereitgestellte  a) providing at least two nucleic acid chains comprising variants of a target sequence (template strand) (M 1 .1 and M 1 .2), wherein provided
Nukleinsäureketten  nucleic acid chains
mindestens ein einheitliches Segment umfassen, welches für M 1 .1 und M 1 .2 spezifisch ist und bei M 1 .1 und M 1 .2 identisch ist, und mindestens ein charakteristisches, für jede Nukleinsäurekette spezifisches Segment umfassen  comprise at least one unitary segment which is specific for M 1 .1 and M 1 .2 and is identical in M 1 .1 and M 1 .2, and comprise at least one characteristic segment specific for each nucleic acid chain
b) Bereitstellung von einem ersten Primer-Oligonukleotid (P1 .1 ), welches vollständig oder teilweise an das korrespondierende charakteristische und spezifische Segment einer der bereitgestellten Nukleinsäureketten komplementär binden kann, wobei das erste Primer-Oligonukleotid  b) providing a first primer oligonucleotide (P1 .1) which is capable of fully or partially complementary binding to the corresponding characteristic and specific segment of one of the provided nucleic acid chains, wherein the first primer oligonucleotide
einen ersten Bereich umfasst, der sequenzspezifisch, an ein komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb eines charakteristischen und spezifischen Segments von bereitgestellten Nukleinsäureketten (M 1 .1 ) binden kann, einen zweiten Bereich (Überhang), der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid (C 1 .1 ) gebunden werden kann; a first region capable of binding sequence-specifically to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of nucleic acid chains provided (M 1 .1), a second region (overhang) attached to the 5 'end of the first region is connected or connected via a linker, wherein the second region of a controller oligonucleotide (C 1 .1) can be bound;
c) Bereitstellung von einem Kompetitor-Primer-Oligonukleotid (P 5.2), welches c) provision of a competitor primer oligonucleotide (P 5.2), which
vollständig oder teilweise an das korrespondierende charakteristische und spezifische Segment einer zweiten bereitgestellten Nukleinsäurekette  completely or partially to the corresponding characteristic and specific segment of a second nucleic acid chain provided
komplementär binden kann (M 1 .2), wobei das Kompetitor-Primer-Oligonukleotid einen ersten Bereich umfasst, der sequenzspezifisch, an ein komplementäres Segment (Primer-Bindungsstelle) umfassend einen Anteil der Zielsequenz innerhalb eines charakteristischen und spezifischen Segments von der bereitgestellten Nukleinsäurekette (M 1 .2) binden kann, wobei  (M 1 .2), wherein the competitor primer oligonucleotide comprises a first region which is sequence-specific, to a complementary segment (primer binding site) comprising a portion of the target sequence within a characteristic and specific segment of the nucleic acid chain provided ( M 1 .2), where
dieser Bereich nicht identisch ist zum ersten Bereich des ersten Primer- Oligonukleotides  this region is not identical to the first region of the first primer oligonucleotide
d) Bereitstellung eines Controller-Oligonukleotids (C1 .1 ), wobei das Controller- Oligonukleotid folgende Bereiche umfasst: d) providing a controller oligonucleotide (C1 .1), wherein the controller oligonucleotide comprises the following ranges:
einen ersten Bereich, der an den zweiten Bereich des ersten Primer- Oligonukleotids (P1 .1 ) (Überhang) binden kann, und  a first region capable of binding to the second region of the first primer oligonucleotide (P1 .1) (overhang), and
einen zweiten Bereich, der zum ersten Bereich des ersten Primer- Oligonukleotids (P1 .1 ) komplementär ist, und  a second region complementary to the first region of the first primer oligonucleotide (P1 .1), and
einen dritten Bereich, der zumindest zu einem Teil des synthetisierten Bereiches von einem zu erwartenden ersten Primer-Verlängerungsprodukt (P 1 .1 -Ext) komplementär ist;  a third region that is complementary to at least a portion of the synthesized region of an expected first primer extension product (P 1 .1 -Ext);
wobei das Controller-Oligonukleotid (C 1 .1 ) nicht als Matrize für eine Primerverlängerung eines verwendeten ersten Primer-Oligonukleotids (P 1 .1 ) oder eines Kompetitor-Primer-Oligonukleotids dient,  wherein the controller oligonucleotide (C 1 .1) does not serve as a template for a primer extension of a used first primer oligonucleotide (P 1 .1) or a competitor primer oligonucleotide,
e) gleichzeitiges Hybridisieren des ersten Primer-Oligonukleotids (P1 .1 ) und des Kompetitor-Primer-Oligonukleotids an das jeweils komplementäre Segment umfassend einen Anteil der Zielsequenz (Primer-Bindungsstelle) von mindestens einer der bereitgestellten Nukleinsäureketten (M 1 .1 und M 1 .2), e) simultaneously hybridizing the first primer oligonucleotide (P1 .1) and the competitor primer oligonucleotide to the respective complementary segment comprising a portion of the target sequence (primer binding site) of at least one of the provided nucleic acid chains (M 1 .1 and M 1 .2)
f) gleichzeitige Verlängerung des ersten Primer-Oligonukleotids (P1 .1 ) und des f) simultaneous extension of the first primer oligonucleotide (P1 .1) and of the
Kompetitor-Oligonukleotides durch eine matrizenabhängige Polymerase unter Verwendung von bereitgestellten Nukleinsäureketten als Matrizen für die Primer- Verlängerung unter Erhalt von mindestens einem spezifischen Primer- Verlängerungsprodukt (Primer-Extensionsprodukte, P1 1 -Ext und P5.2-Ext), wobei jedes neben dem Primer-Oligonukleotid (P1 .1 oder P5.2) einen synthetisierten Bereich umfasst, der im Wesentlichen komplementär zu der jeweiligen Nukleinsäurekette umfassend eine Zielsequenz (M1 ) ist, wobei A competitor oligonucleotide by a template-dependent polymerase using provided nucleic acid chains as templates for primer extension to give at least one specific primer extension product (primer extension products, P1 1 -Ext and P5.2-Ext), each adjacent to the primer Oligonucleotide (P1 .1 or P5.2) synthesized Area which is substantially complementary to the respective nucleic acid chain comprising a target sequence (M1), wherein
das Primer-Verlängerungsprodukt (P1 .1 -Ext) einen komplementären Bereich zum charakteristischen und spezifischen Segment der einen Nukleinsäure (M 1 .1 ) umfasst und  the primer extension product (P1 .1 -Ext) comprises a complementary region to the characteristic and specific segment of the one nucleic acid (M 1 .1) and
das Primer-Verlängerungsprodukt (P5.2-Ext) einen komplementären Bereich zum charakteristischen und spezifischen Segment der zweiten Nukleinsäure (M 1 .2) umfasst und  the primer extension product (P5.2-Ext) comprises a complementary region to the characteristic and specific segment of the second nucleic acid (M 1 .2) and
die synthetisierten Primer-Verlängerungsprodukte (P1 .1-Ext und P5.2-Ext) und ihre entsprechende als Matrize dienende Nukleinsäurekette (M 1 .1 und M 1 .2) unter Reaktionsbedinungen je einen Doppelstrang bilden;  the synthesized primer extension products (P1 .1-Ext and P5.2-Ext) and their corresponding template nucleic acid chain (M 1 .1 and M 1 .2) form a double strand under reaction conditions;
g) Selektive Bindung des Controller-Oligonukleotids (C1 .1 ) an die im Schritt (e)  g) Selective binding of the controller oligonucleotide (C1 .1) to the in step (e)
gebildeten Primer-Verlängerungsprodukte (P1 .1-Ext), wobei  formed primer extension products (P1 .1-Ext), wherein
das Controller-Oligonukleotid (C1 .1 ) mit seinem ersten, zweiten und dritten Bereich an die komplementären Segmente des Primer- Verlängerungsprodukts (P1 1 -Ext) unter Verdrängung von  the controller oligonucleotide (C1 .1) with its first, second and third region to the complementary segments of the primer extension product (P1 1 -Ext) with displacement of
Nukleinsäurekette (M 1 .1 ) binden kann, wobei  Nucleic acid chain (M 1 .1) can bind, wherein
das Controller-Oligonukleotid (C1 .1 ) nicht in der Lage ist, unter verwendeten Reaktionsbedinungen an das P5.2-Ext zu binden und P5.2- Ext von seinem Matrizenstrang zu trennen.  the controller oligonucleotide (C1 .1) is unable to bind to the P5.2-Ext under used reaction conditions and to separate P5.2-Ext from its template strand.
26. Verfahren nach Nr. 25, wobei das 3'-terminale Nukleotid des Kompetitor-Primers 26. The method of no. 25, wherein the 3 ' -terminal nucleotide of the competitor primer
innerhalb der zweiten Blockierungs-Einheit des Controller-Oligonukleotide binden kann. within the second blocking unit of the controller oligonucleotide can bind.
27. Verfahren nach Nr. 25, wobei das 3'-terminale Nukleotid des Kompetitor-Primers 27. Method according to no. 25, wherein the 3 ' -terminal nucleotide of the competitor primer
innerhalb der vierten Blockierungs-Einheit des Controller-Oligonukleotids binden kann, wobei die vierte Blockierungs-Einheit im dritten Bereich des Controller-Oligonukleotides liegt.  within the fourth blocking unit of the controller oligonucleotide, with the fourth blocking unit located in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein erstes Primer-Oligonukleotid und ein dazu korrespondierendes Controller-Oligonukleotid zu einem Primer-Verlängerungs-System zusammengefasst. Ein solches Primer-Verlängerungs-System umfasst:  In certain embodiments, a first primer oligonucleotide and a corresponding controller oligonucleotide are combined to form a primer extension system. Such a primer extension system comprises:
• ein spezifisches Controller-Oligonukleotid für eine Sequenz-Variante der Zielsequenz, A specific controller oligonucleotide for a sequence variant of the target sequence,
• ein erstes Primer-Oligonukleotid, welches an das für die bereitgestelle Zielsequenz (Matrizenstrang) einheitliche Sequenzfragment im Wesentlichen komplementär binden kann und A first primer oligonucleotide which can bind to the sequence fragment which is the same for the target sequence (template strand) which is provided in a substantially complementary manner, and
wobei das erste Primer-Oligonukleotid keine Sequenzsegmente umfasst, welche spezifisch für eine Sequenzvariante der Zielsequenz sind. Vielmehr kann das erste Primer-Oligonukleotid vollständig komplementär oder im Wesenlichen komplementär an die Zielsequenz binden, ohne die Sequenzvarianten zu unterscheiden.wherein the first primer oligonucleotide does not comprise sequence segments which are specific for a sequence variant of the target sequence. Rather, the first one Primer oligonucleotide fully complementary or intrinsically complementary to the target sequence bind, without distinguishing the sequence variants.
Ein solches Primer-Verlängerungs-System ist somit dermaßen konstruiert, dass der polymorphe Lokus der Zielsequenz im Sequenzsegment lokalisiert ist, welches in 3'- Primer-Verlängerungs-Richtung des ersten Primers liegt. Das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides liegt somit in dessen dritten Bereich. Such a primer extension system is thus constructed such that the polymorphic locus of the target sequence is located in the sequence segment which lies in the 3 ' primer extension direction of the first primer. The segment of the controller oligonucleotide corresponding to the polymorphic locus thus lies in its third region.
In bestimmten Ausführungsformen wird ein erstes Primer-Oligonukleotid und ein dazu korrespondierendes Controller-Oligonukleotid zu einem Primer-Verlängerungs-System zusammengefasst. Ein solches Primer-Verlängerungs-System umfasst:  In certain embodiments, a first primer oligonucleotide and a corresponding controller oligonucleotide are combined to form a primer extension system. Such a primer extension system comprises:
• ein spezifisches Controller-Oligonukleotid für eine Sequenz-Variante der Zielsequenz A specific controller oligonucleotide for a sequence variant of the target sequence
• ein erstes Sequenzvarianten spezifisches Primer-Oligonukleotid, welches zumindest teilweise (z.B. mit seinem 3'-terminalen Nukleotid) an das spezifische Sequenz- Segment eines polymorphen Lokus einer bereitgestellen Zielsequenz voll komplementär binden kann. A first sequence variant-specific primer oligonucleotide which can bind at least partially (for example with its 3 ' terminal nucleotide) to the specific sequence segment of a polymorphic locus of a target sequence provided fully complementary.
In bestimmten Ausführungsformen ist ein solches Primer-Verlängerungs-System somit dermaßen konstruiert, dass die Sequenz des ersten Primer-Oligonukleotides zumindest mit einer Nukleotid- Position mit einer charakteristischen Sequenz des polymorphen Lokus überlagert.  In certain embodiments, such a primer extension system is thus constructed such that the sequence of the first primer oligonucleotide overlays at least one nucleotide position with a characteristic sequence of the polymorphic locus.
Das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides liegt in bestimmten Ausführungsformen vollständig im zweiten Bereich des Controller-Oligonukeotides. The segment of the controller oligonucleotide corresponding to the polymorphic locus is, in certain embodiments, completely in the second region of the controller oligonucleotide.
In bestimmten Ausführungsformen liegt das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides partiell im zweiten und partiell im dritten Bereich des Controller- Oligonukeotides. In certain embodiments, the segment of the controller oligonucleotide corresponding to the polymorphic locus lies partially in the second and partially in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein erstes Primer-Oligonukleotid und ein dazu korrespondierendes Controller-Oligonukleotid sowie ein Kompetitor-Primer-Oligonukleotid zu einem Primer-Verlängerungs-System zusammengefasst. Ein solches Primer-Verlängerungs- System umfasst:  In certain embodiments, a first primer oligonucleotide and a corresponding controller oligonucleotide and a competitor primer oligonucleotide are combined to form a primer extension system. Such a primer extension system comprises:
• ein spezifisches Controller-Oligonukleotid für eine Sequenz-Variante der Zielsequenz, A specific controller oligonucleotide for a sequence variant of the target sequence,
• ein erstes Primer-Oligonukleotid, welches an das für die bereitgestelle Zielsequenz (Matrizenstrang) einheitliche Sequenzfragment im Wesentlichen komplementär binden kann und A first primer oligonucleotide which can bind to the sequence fragment which is the same for the target sequence (template strand) which is provided in a substantially complementary manner, and
• ein spezifisches Kompetitor-Primer-Oligonukleotid.  A specific competitor primer oligonucleotide.
Dabei umfasst das erste Primer-Oligonukleotid keine Sequenzsegmente, welche spezifisch für eine Sequenzvariante der Zielsequenz sind. Vielmehr kann das erste Primer-Oligonukleotid vollständig komplementär oder im Wesenlichen komplementär an die Zielsequenz binden, ohne die Sequenzvarianten zu unterscheiden. In this case, the first primer oligonucleotide does not comprise any sequence segments which are specific for a sequence variant of the target sequence. Rather, the first primer oligonucleotide completely complementary or intrinsically complementary to the target sequence, without distinguishing the sequence variants.
Ein solches Primer-Verlängerungs-System ist somit dermaßen konstruiert, dass der polymorphe Lokus der Zielsequenz im Sequenzsegment lokalisiert ist, welches in 3 '-Primer- Verlängerungs- Richtung des ersten Primers liegt. Das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides liegt somit im dritten Bereich des Controller-Oligonukeotides. Such a primer extension system is thus constructed such that the polymorphic locus of the target sequence is located in the sequence segment which lies in the 3 ' primer extension direction of the first primer. The segment of the controller oligonucleotide corresponding to the polymorphic locus thus lies in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen kann das verwendete Kompetitor-Oligonukleotid vollständig oder teilweise an das Segment der Zielsequenz binden, welches mit dem ersten Bereich des ersten Primer-Oligonukleotids komplementäre Bindung eingehen kann.  In certain embodiments, the competitor oligonucleotide used may bind fully or partially to the segment of the target sequence which may bind complementary to the first region of the first primer oligonucleotide.
In bestimmten Ausführungsformen ist dieses Kompetitor-Primer-Oligonukleotid voll-komplementär zu einer Sequenz-Variante einer Zielsequenz, welche nicht identisch ist mit der Sequenz-Variante des Matrizenstranges, welcher vom ersten Primer erkannt wird.  In certain embodiments, this competitor primer oligonucleotide is fully complementary to a sequence variant of a target sequence which is not identical to the sequence variant of the template strand recognized by the first primer.
In bestimmten Ausführungsformen des Verfahrens umfasst ein Kompetitor-Primer-Oligonukleotid kein Sequenzsegment, welches mit dem ersten Bereich des Controller-Oligonukleotides im Wesentlichen komplementär binden kann.  In certain embodiments of the method, a competitor primer oligonucleotide does not comprise a sequence segment which is capable of substantially complementary binding to the first region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein erstes Primer-Oligonukleotid und ein dazu korrespondierendes Controller-Oligonukleotid und ein Kompetitor-Oligonukleotid zu einem Primer- Verlängerungs-System zusammengefasst. Ein solches Primer-Verlängerungs-System umfasst: In certain embodiments, a first primer oligonucleotide and a corresponding controller oligonucleotide and a competitor oligonucleotide are combined to form a primer extension system. Such a primer extension system comprises:
• ein spezifisches Controller-Oligonukleotid für eine Sequenz-Variante der ZielsequenzA specific controller oligonucleotide for a sequence variant of the target sequence
• ein erstes Sequenzvarianten spezifisches Primer-Oligonukleotid, welches zumindest teilweise (z.B. mit seinem 3'-terminalen Nukleotid) an das spezifische Sequenz- Segment eines polymorphen Lokus einer bereitgestellen Zielsequenz voll komplementär binden kann A first sequence variant-specific primer oligonucleotide which can bind at least partially (for example with its 3 ' terminal nucleotide) to the specific sequence segment of a polymorphic locus of a target sequence provided fully complementary
• ein spezifisches Kompetitor-Primer-Oligonukleotid  A specific competitor primer oligonucleotide
In bestimmten Ausführungsformen ist ein solches Primer-Verlängerungs-System somit dermaßen konstruiert, dass die Sequenz des ersten Primer-Oligonukleotides zumindest mit einer Nukleotid- Position einer charakteristischen Sequenz des polymorphen Lokus überlagert.  In certain embodiments, such a primer extension system is thus constructed such that the sequence of the first primer oligonucleotide overlays at least one nucleotide position of a characteristic sequence of the polymorphic locus.
Das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides liegt in bestimmten Ausführungsformen vollständig im zweiten Bereich des Controller-Oligonukeotides. The segment of the controller oligonucleotide corresponding to the polymorphic locus is, in certain embodiments, completely in the second region of the controller oligonucleotide.
In bestimmten Ausführungsformen liegt das zum polymorphen Lokus korrespondierende Segment des Controller-Oligonukleotides partiell im zweiten und partiell im dritten Bereich des Controller- Oligonukeotides. In certain embodiments, the segment of the controller oligonucleotide corresponding to the polymorphic locus lies partially in the second and partially in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen kann das verwendete Kompetitor-Oligonukleotid vollständig oder teilweise an das Segment der Zielsequenz binden, welches mit dem ersten Bereich des ersten Primer-Oligonukleotids eine komplementäre Bindung eingehen kann. In bestimmten Ausführungsformen ist dieses Kompetitor-Primer-Oligonukleotid voll-komplementär zu einer Sequenz-Variante einer Zielsequenz, welche nicht identisch ist mit der Sequenz-Variante des Matrizenstranges, welcher vom ersten Primer erkannt wird. In certain embodiments, the competitor oligonucleotide used may bind fully or partially to the segment of the target sequence which may be complementary to the first region of the first primer oligonucleotide. In certain embodiments, this competitor primer oligonucleotide is fully complementary to a sequence variant of a target sequence which is not identical to the sequence variant of the template strand recognized by the first primer.
In bestimmten Ausführungsformen des Verfahrens umfasst ein Kompetitor-Primer-Oligonukleotid kein Sequenzsegment, welches mit dem ersten Bereich des Controller-Oligonukleotides im Wesentlichen komplementär binden kann.  In certain embodiments of the method, a competitor primer oligonucleotide does not comprise a sequence segment which is capable of substantially complementary binding to the first region of the controller oligonucleotide.
Die Anmeldung beschreibt die Herstellung von Primer-Verlängerungsprodukten, welche beispielsweise in einer exponentiellen Amplifikation als Start-Nukleinsäure verwendet werden können.  The application describes the preparation of primer extension products which can be used, for example, in an exponential amplification as starting nucleic acid.
Die hier verwendeten erste Primer-Oligonukleotide und Controller-Oligonukleotide können mit solchen einer exponentiellen Amplifikation identisch sein oder sich von denen unterscheiden.  The first primer oligonucleotides and controller oligonucleotides used herein may be identical to or different from those of exponential amplification.
Detaillierte Beschreibung der Erfindung Detailed description of the invention
Die eingangs erwähnten technischen Aufgaben werden insbesondere durch die Bereitstellung von Verfahren und Komponenten (Feedback-System) gelöst, welche die Qualität von synthetisierten Primer-Verlängerungsprodukten in unterschiedlichen Phasen einer matrizenabhängigen Primer- Verlängerung überprüfen können. Diese Überprüfung kann je nach Ausführungsform entweder während der Synthese stattfinden oder erst nach Abschluss der Synthese. Die Überprüfung kann im gleichen Reaktionsansatz stattfinden, so dass die eigentliche Primerverlängerungsreaktion nicht unterbrochen werden muss (online-Kontrolle) oder erst nach Abschluss der Primerverlängerungsreaktion (End-Kontrolle).  The technical problems mentioned in the introduction are achieved, in particular, by the provision of methods and components (feedback system) which can check the quality of synthesized primer extension products in different phases of a template-dependent primer extension. Depending on the embodiment, this check can take place either during the synthesis or only after completion of the synthesis. The check can take place in the same reaction batch, so that the actual primer extension reaction does not have to be interrupted (online control) or only after completion of the primer extension reaction (final control).
Durch Überprüfung der Qualität kann Einfluss auf die Primerverlängerungsreaktion selbst oder auf die Trennung des Produktes von der Matrize genommen werden. Dieser Einfluss wird durch die bereitgestellten Komponenten genommen. Somit bilden diese Komponenten ein Feedback- System für die Primerverlängerungsreaktion bzw. für die Ablösung des Produktes der Primer- Verlängerungsreaktion von der Matrize.  By checking the quality, it is possible to influence the primer extension reaction itself or the separation of the product from the template. This influence is taken by the provided components. Thus, these components form a feedback system for the primer extension reaction or for the release of the product of the primer extension reaction from the template.
Die Komponenten des Feedback-Systems können dahingehend Einfluss auf die Primerverlängerungsreaktion ausüben, dass es zwischen einer Fortführung der enzymatischen Synthese oder einer Unterbrechung der Synthese bzw. Neustart der Synthese entschieden werden kann. Weiterhin können die Komponenten des Feedback-Systems Einfluss dahingehend ausüben, dass die Ablösung des Produktes der Synthese von der Matrize von der Übereinstimmung mit dem Controller-Oligonukleotid abhängig fortgeführt wird oder bei ggf. auftretenden Abweichungen in der Sequenz angehalten bzw. verzögert oder vollständig unterbrochen wird.  The components of the feedback system can exert an influence on the primer extension reaction in such a way that it is possible to decide between a continuation of the enzymatic synthesis or an interruption of the synthesis or restart of the synthesis. Furthermore, the components of the feedback system can exert influence that the detachment of the product of the synthesis from the template is continued depending on the compliance with the controller oligonucleotide or is stopped or delayed or completely interrupted in the event of any deviations occurring in the sequence ,
Das Synthesesystem bei einer Primer-Verlängerungsreaktion umfasst in der Regel mindestens eine Matrize und mindestens einen Primer, welcher in der Lage ist, sich mehr oder weniger spezifisch an die Matrize zu binden und eine Primer-Verlängerungsreaktion zu initiieren. Weiterhin umfasst das Synthesesystem mindestens eine Polymerase, sowie Substrate (dNTPs) und Pufferbedingungen, unter welchen eine Primerverlängerungsreaktion stattfinden kann. Weitere Oligonukleotide können je nach Ausführungsform des Verfahrens hinzugefügt werden, z.B. Block- Oligonukleotide, zum sequenzspezifischen Stopp der Polymerase oder Sonden-Oligonukleotide, welche ein Fluoreszenzsignal abgeben können. The synthesis system in a primer extension reaction typically comprises at least one template and at least one primer capable of binding more or less specifically to the template and initiating a primer extension reaction. Furthermore, the synthesis system comprises at least one polymerase, as well as substrates (dNTPs) and Buffer conditions under which a primer extension reaction can take place. Other oligonucleotides may be added depending on the embodiment of the method, eg block oligonucleotides, for sequence-specific stop of the polymerase or probe oligonucleotides which can deliver a fluorescence signal.
Das Feedback-System umfasst einen Primer, welcher als Initiator einer Primer- Verlängerungsreaktion auftritt, sowie ein weiteres Oligonukleotid, ein so genanntes Controller- Oligonukleotid. Der Primer des Feedback-Systems ist in bevorzugter Ausführungsform mit dem Primer des Synthesesystems identisch. Das Controller-Oligonukleotid ist in der Lage, sowohl mit dem jeweiligen Primer als auch mit dem ausgehend von diesem Primer sequenzspezifischen Primerverlängerungsprodukt zu interagieren. Es ist in der Lage, bei Sequenzübereinstimmung mit dem Primerverlängerungsprodukt einen komplementären Doppelstrang unter Reaktionsbedingungen auszubilden. Das Controller-Oligonukleotid dient selbst nicht als Matrize zur Synthese für das genannte Primer/Polymerase-System. Weitere Oligonukleotide können je nach Ausführungsform des Verfahrens hinzugefügt werden, z.B. Block-Oligonukleotide, zum sequenzspezifischen Stopp der Polymerase oder Sonden-Oligonukleotide, welche ein Fluoreszenzsignal abgeben können.  The feedback system comprises a primer which acts as an initiator of a primer extension reaction and another oligonucleotide, a so-called controller oligonucleotide. The primer of the feedback system is identical in a preferred embodiment with the primer of the synthesis system. The controller oligonucleotide is capable of interacting with both the particular primer and the primer extension product sequence-specific from that primer. It is capable of forming a complementary duplex under reaction conditions upon sequence alignment with the primer extension product. The controller oligonucleotide itself does not serve as a template for synthesis for the said primer / polymerase system. Other oligonucleotides may be added depending on the embodiment of the method, e.g. Block oligonucleotides for sequence-specific stop of the polymerase or probe oligonucleotides which can deliver a fluorescence signal.
Das Verfahren umfasst in bestimmten Ausführungsformen eine Primerverlängerungsreaktion (auch Primer-Extension genannt) mittels eines Primers in Anwesenheit eines passenden Controller-Oligonukleotides im gleichen Reaktionsansatz. Das Controller-Oligonukleotid ist hierbei in der Lage, mit dem Primerverlängerungsprodukt unter Ausbildung eines komplementären Stranges zu interagieren. Der Fortschritt der Ausbildung des Doppelstranges zwischen dem Controller und dem Primerverlängerungsprodukt (P1 -Ext) hängt im Wesentlichen von der Übereinstimmung der Sequenzen zwischen dem Controller und dem korrespondierenden Primerverlängerungsprodukt ab. Dadurch kann eine Sequenzkontrolle bzw. Sequenzüberprüfung bereits während einer Primer-Extension oder unmittelbar nach einer Primer-Extension zumindest über Teilsegmente des synthetisierten Primer-Extension-Fragments mittels Controller- Oligonukleotides erfolgen.  The method, in certain embodiments, comprises a primer extension reaction (also called primer extension) by means of a primer in the presence of a suitable controller oligonucleotide in the same reaction mixture. The controller oligonucleotide is capable of interacting with the primer extension product to form a complementary strand. The progress of the formation of the double strand between the controller and the primer extension product (P1 -Ext) depends essentially on the correspondence of the sequences between the controller and the corresponding primer extension product. As a result, a sequence check or sequence check can already take place during a primer extension or immediately after a primer extension at least over partial segments of the synthesized primer extension fragment by means of controller oligonucleotides.
Weiterhin umfasst das Verfahren in bestimmten Ausführungsformen ein Verfahren zu einer matrizenabhängigen Primer-Extension in Kombination mit einer anschließenden Kontrolle des synthetisierten Primerverlängerungsproduktes durch mindestens ein Controller-Oligonukleotid nach Abschluss der Primer-Extension Reaktion. Primer-Extension und Controller-Interaktion mit dem synthetisierten Primerverlängerungsprodukt sind zwei zeitlich getrennte Reaktionen. Die Primerverlängerungsreaktion verläuft zwar in Anwesenheit eines entsprechenden Controller- Oligonukleotides im gleichen Reaktionsansatz, die Reaktionen sind aber durch Wahl von Reaktionsbedingungen in einzelne Reaktionsschritte zeitlich separiert.  Further, in certain embodiments, the method includes a template-dependent primer extension method in combination with subsequent control of the synthesized primer extension product by at least one controller oligonucleotide upon completion of the primer extension reaction. Primer extension and controller interaction with the synthesized primer extension product are two temporally separate reactions. Although the primer extension reaction proceeds in the same reaction mixture in the presence of a corresponding controller oligonucleotide, the reactions are temporally separated by the choice of reaction conditions in individual reaction steps.
Durch Präsenz des Feedback-Systems im gleichen Reaktionsansatz wie die Primerverlängerungsreaktion ist es möglich, einen homogenen Assay zu gestalten. Durch Einbringen bzw. Zusammenführung der Komponenten des Feedback-Systems in den gleichen Reaktionsansatz wie die Primerverlängerungsreaktion an sich, d.h. gleichzeitiger Präsenz von sowohl der Komponenten des Synthesesystems als auch des Feedback-Systems, kann die Überprüfung oder Beeinflussung der Primerverlängerungsreaktion und der Trennung der Primerverlängerungsprodukte von der Matrize ggf. in sehr kurzen Zeitabständen erfolgen. Dadurch kann das Feedback-System sehr schnell auf ggf. auftretende Abweichungen reagieren. The presence of the feedback system in the same reaction as the primer extension reaction makes it possible to design a homogeneous assay. By incorporating the components of the feedback system into the same reaction approach as the primer extension reaction per se, ie simultaneous presence of both the components of the synthesis system and the feedback system, checking or influencing the primer extension reaction and the separation of the primer extension products of if necessary, the matrix can be made in very short time intervals. This allows the feedback system to respond very quickly to any deviations that may occur.
Die gleichzeitige Präsenz des Feedback-Systems im Primerverlängerungsansatz kann zu einer wiederholten Überprüfung führen, so dass das Ergebnis der Überprüfung als Summe multipler Überprüfungsereignisse zusammengefasst werden kann. Die Häufigkeit der Überprüfung kann sowohl mittels der geeigneten Wahl von Reaktionsbedingungen (z.B. Temperatur, Konzentration der Feedback-System-Komponenten) als auch durch die Strukturen von Feedback-Komponenten (z.B. Länge und Komplementarität bzw. Ausmaß der Verwendung modifizierter Nukleotide beim Design einzelner Strukturen) beeinflusst werden.  The simultaneous presence of the feedback system in the primer extension approach can lead to a repeated review, so that the result of the review can be summarized as the sum of multiple verification events. The frequency of the verification can be determined both by the appropriate choice of reaction conditions (eg temperature, concentration of the feedback system components) and by the structures of feedback components (eg length and complementarity or extent of the use of modified nucleotides in the design of individual structures). to be influenced.
In bestimmten Fällen soll dabei das Feedback-System zwischen korrekt ablaufenden Reaktionen (in vielen Fällen mehr als 99% aller Primerverlängerungsstränge einer Primer- Verlängerungsreaktion aufgrund einer hohen natürlichen Spezifität einer enzymatischen matrizenabhängigen Reaktion) und fälschlich synthetisierten Primerverlängerungsprodukten (geringer als 1 % aller Primer-Verlängerungsprodukte) unterscheiden. Somit kann ein Feedback- System beispielsweise bei Spurenanalysen hilfreich sein.  In certain cases, the feedback system should allow for correct-running reactions (in many cases more than 99% of primer extension strands of a primer extension reaction due to a high natural specificity of an enzymatic template-dependent reaction) and falsely synthesized primer extension products (less than 1% of all primer extension products ). Thus, a feedback system can be helpful, for example, in trace analysis.
Durch eine hohe Sequenzabhängigkeit der Interaktion des Primerverlängerungsprodukts (P1-Ext) mit dem Controller können Gleichgewichte zwischen einzelnen Zwischenkomplexen, welche während der Reaktion generiert werden, individuell beeinflusst werden. Da diese Komplexe unterschiedliche Zugänglichkeiten zu bestimmten Sequenzsegmenten (einzelsträngige Segmente) aufweisen, können viele Reaktionen während einer laufenden Primerverlängerungsreaktion beeinflusst werden. Mögliche Zwischenkomplexe umfassen z.B. High sequence-dependent interaction of the primer extension product (P1-Ext) with the controller can be used to individually influence equilibria between individual intermediate complexes generated during the reaction. Since these complexes have different accessibility to certain sequence segments (single-stranded segments), many reactions can be affected during a running primer extension reaction. Possible intermediate complexes include e.g.
Primerverlängerungsprodukt/Matrize, Primerverlängerungsprodukt/Controller-Oligonukleotid und Primerverlängerungsprodukt/Matrize/Controller-Oligonukleotid und/oderPrimer extension product / template, primer extension product / controller oligonucleotide and primer extension product / template / controller oligonucleotide and / or
Primerverlängerungsprodukt/Sonde. Damit kann man stärkeren Einfluss auf die Spezifität im Gesamtvorgang der Primerverlängerung als auch in davon abhängigen Reaktionen ausüben.Primer extension product / probe. Thus, one can exert greater influence on the specificity in the overall process of primer extension as well as in dependent reactions.
Als Folge der sequenzabhängigen Interaktion zwischen dem Controller-Oligonukleotid und dem synthetisierten Strang des Primerverlängerungsproduktes (P1-Ext) können mehrere technische Effekte erzielt werden: Several technical effects can be achieved as a consequence of the sequence-dependent interaction between the controller oligonucleotide and the synthesized strand of the primer extension product (P1-Ext):
o Vollständige oder partielle sequenzabhängige T rennung, Dissoziation oder Ablösung des P1 - Ext vom Matrizenstrang;  Complete or partial sequence-dependent separation, dissociation or detachment of P1-Ext from the template strand;
o Sequenzspezifische Detektion von bestimmten Varianten der Sequenz des P1 .Ext.  o Sequence-specific detection of certain variants of the sequence of the P1 .Ext.
o Sequenzspezifische Aufrechterhaltung eines Doppelstranges bzw. umgekehrt sequenzspezifische Überführung von Strangsegmenten in eine einzelsträngige Form, und eine damit zusammenhängende Zugänglichkeit von bestimmten Sequenzsegmenten für die Interaktion mit anderen System-Komponenten, z.B. Sonden, Primern, etc. sequence-specific maintenance of a double strand or, conversely, sequence-specific conversion of strand segments into a single-stranded form, and a related accessibility of certain sequence segments for interaction with other system components, eg, probes, primers, etc.
In bestimmten Ausführungsformen des erfindungsgemäßen Verfahrens kann die Primer-Extension als einmalige Synthese in einem Schritt ablaufen oder als wiederholte Reaktion (lineare Amplifikation).  In certain embodiments of the method according to the invention, the primer extension can take place as a single synthesis in one step or as a repeated reaction (linear amplification).
Die Primerverlängerungsreaktion kann an sich alleine durchgeführt werden oder in Kombination mit einem Amplifikationsverfahren.  The primer extension reaction may be performed alone or in combination with an amplification method.
Besonders bei gleichzeitiger Anwesenheit von mehreren sehr ähnlichen Sequenzen, welche potenziell für eine Primerverlängerungsreaktion ausgehend von einem Primer auftreten können, ist es daher von Vorteil, ein Feedback-System innerhalb des Reaktionsansatzes unterzubringen. Dadurch können Unterschiede in der Regel viel stärker bzw. schärfer getrennt werden. Vorteilhaft kann dies beispielsweise bei Allel-Diskriminierungsverfahren oder bei der gezielten Amplifikation von wenigen Kopien mit Mutationen haben, welche in weit geringerem Ausmaß als der Wildtyp vorliegen.  Thus, especially in the coexistence of several very similar sequences, which may potentially occur for a primer extension reaction starting from a primer, it is advantageous to accommodate a feedback system within the reaction approach. As a result, differences can usually be separated much more sharply or sharply. This can be advantageous for example in allelic discrimination methods or in the targeted amplification of a few copies with mutations which are present to a much lesser extent than the wild type.
Die Sequenzüberprüfung durch das erfindungsgemäße Verfahren erfolgt über die Primerlänge hinaus (ca. 5 - 50 Nukleotide des synthetisierten Abschnittes) und unterscheidet sich somit von üblichen Primer-Verlängerungsreaktionen, bei welchen im Wesentlichen die Primer-Sequenz für die sequenzspezifische Bindung verantwortlich ist.  Sequence checking by the method according to the invention takes place beyond the primer length (about 5 to 50 nucleotides of the synthesized section) and thus differs from conventional primer extension reactions, in which essentially the primer sequence is responsible for the sequence-specific binding.
Die verbesserte Spezifität der Ablösung des synthetisierten Stranges kann unter mehreren Aspekten in Nachweisverfahren vorteilhaft verwendet werden.  The improved specificity of the deletion of the synthesized strand can be advantageously used in several aspects in detection methods.
• Sie kann beispielsweise als alternatives Detektionsverfahren und/oder Komponente für genetische Veränderungen, wie Einzelnukleotidpolymorphismen, verwendet werden. For example, it may be used as an alternative detection method and / or component for genetic alterations such as single nucleotide polymorphisms.
• Der sequenzspezifisch synthetisierte Strang des Primerverlängerungsprodukts (P1 -Ext) ist das gewünschte Produkt der Primerverlängerungsreaktion. Es kann in verschiedenen Verfahren der Analyse genetischer Information eingesetzt werden, beispielsweise in: o der Generierung einer oder mehreren Kopien ausgehend von einer längeren Nukleinsäurekette, z.B. einer genomischen DNA oder deren Segmenten, oder einer RNA oder ihrer Äquivalenten wie cDNA oder deren Segmente. Diese Kopien können als Start-Nukleinsäureketten in Amplifikationsverfahren eingesetzt werden, wie PCR oder anderen Amplifikationsverfahren; oder. The sequence-specifically synthesized strand of the primer extension product (P1-Ext) is the desired product of the primer extension reaction. It can be used in various methods of analyzing genetic information, for example in: o generating one or more copies from a longer nucleic acid chain, e.g. a genomic DNA or its segments, or an RNA or its equivalents such as cDNA or segments thereof. These copies can be used as starting nucleic acid chains in amplification methods, such as PCR or other amplification methods; or.
o dem Nachweis einer bestimmten Veränderung einer Sequenz in einem Nukleinsäurefragment, z.B. eines Amplifikationsfragmentes  o detecting a particular change in a sequence in a nucleic acid fragment, e.g. an amplification fragment
• Die Komponenten und Verfahren sollen besonders bei gleichzeitiger Anwesenheit von mehreren, sehr ähnlichen Varianten einer Matrizensequenz, z.B. Wildtyp und einer oder mehreren mutierten Sequenzen, eine Verbesserung der Spezifität bei einzelnen Verfahrensschritten unterstützen. • Die Vorteile des Verfahrens sind besonders bei gleichzeitiger Anwesenheit von mehreren, sehr ähnlichen Varianten einer Matrizensequenz, z.B. Wildtyp und einer oder mehreren mutierten Sequenzen, zu sehen. The components and methods should, especially in the simultaneous presence of several, very similar variants of a template sequence, eg wild-type and one or more mutated sequences, support an improvement in the specificity of individual process steps. The advantages of the method are particularly evident in the simultaneous presence of several, very similar variants of a template sequence, eg wild-type and one or more mutated sequences.
• Besonders bei geringfügigen genetischen Unterschieden, wie Einzelnukleotid- Veränderungen (SNV) und kurzen InDels (2 - 10 Nukleotide) kann die Spezifität der Primer-Verlängerungs-abhängigen Verfahren / Verfahrensschritte verbessert werden. Especially with minor genetic differences, such as single nucleotide changes (SNV) and short InDels (2-10 nucleotides), the specificity of primer extension-dependent procedures / steps can be improved.
• In einigen Ausführungsformen des Verfahrens sollen Komponenten für ein homogenes Assay bereitgestellt werden, welche eine gleichzeitige Anwesenheit von Komponenten in einer Reaktion (Eintopfreaktion bzw. homogener Assay) ermöglichen. In some embodiments of the method, components for a homogeneous assay are to be provided which allow a simultaneous presence of components in a reaction (one-pot reaction or homogeneous assay).
Die hier beschriebene Primer-Verlängerungsreaktion und die dabei generierten Primer- Verlängerungsprodukte können beispielsweise in einem Amplifikationsverfahren als Start- Nukleinsäuren dienen.  The primer extension reaction described here and the thereby generated primer extension products can serve as starting nucleic acids in an amplification process, for example.
Ein solches Amplifikations-Verfahren wurde in der PCT Anmeldung (PCT/EP2017/07101 1 ) und der europäischen Anmeldung (EP-A 16185624.0) bereits beschrieben. Zu Details der Ausführung der Amplifikation wird der Fachmann an diese Anmeldung verwiesen.  Such an amplification method has already been described in the PCT application (PCT / EP2017 / 07101 1) and the European application (EP-A 16185624.0). For details of the execution of the amplification, the skilled person is referred to this application.
Vorzugsweise erfolgt eine solche Amplifikation als exponentielle Amplifikation, bei welcher neusynthetisierte Produkte beider Primer (Primer-Verlängerungsprodukte) als Matrizen für weitere Syntheseschritte auftreten. Dabei werden Primersequenzen zumindest teilweise kopiert, so dass komplementäre Primer-Bindungsstellen entstehen, welche unmittelbar nach ihrer Synthese als Sequenzsegmente eines Doppelstranges vorliegen. Im Amplifikatonsverfahren erfolgen Synthese- Schritte von beiden Strängen und Doppelstrang-Öffnungs-Schritten der neusynthetisierten Sequenzabschnitte in gegenseitiger Abwechselung. Eine hinreichende Doppelstrang-Trennung nach einer Synthese stellt eine wichtige Voraussetzung für die weitere Synthese dar. Insgesamt kann eine solche Abwechslung aus Synthese- und Doppelstrang-Trennungsschritten zu einer exponentiellen Amplifikation führen.  Preferably, such amplification occurs as an exponential amplification in which newly synthesized products of both primers (primer extension products) occur as templates for further synthetic steps. This primer sequences are at least partially copied, so that complementary primer binding sites arise, which are present immediately after their synthesis as sequence segments of a double strand. In the amplification process, synthesis steps of both strands and double-stranded opening steps of the newly synthesized sequence segments are made in mutual alternation. Adequate duplex separation after synthesis is an important prerequisite for further synthesis. Overall, such a variety of synthetic and double-stranded separation steps can lead to exponential amplification.
Im Amplifikationsverfahren erfolgt die Doppelstrang-Öffnung von Hauptprodukten der Amplifikation (Amplifikation von Zielsequenz umfassenden Nukleinsäureketten) unter anderem mittels eines Oligonukleotides, genannt Controller-Oligonukleotid. Das Controller-Oligonukleotid umfasst Sequenzsegmente, welche der Zielsequenz entsprechen.  In the amplification process, the double-stranded opening of the main products of the amplification (amplification of nucleic acid chains comprising target sequence) takes place inter alia by means of an oligonucleotide, termed controller oligonucleotide. The controller oligonucleotide comprises sequence segments corresponding to the target sequence.
Im Einzelnen, wird die Strangtrennung durch Einsatz vom Controller-Oligonukleotid mit vordefinierten Sequenzen erreicht, welche vorzugsweise mittels einer sequenzabhängigen nukleinsäurevermittelten Strangverdrängung einen neusynthetisierten Doppelstrang bestehend aus beiden spezifischen Primer-Verlängerungsprodukten trennen. Die dabei entstehenden einzelsträngigen Segmente von Primer-Verlängerungsprodukten umfassen die Zielsequenz, sowie entsprechende Primer-Bindungsstellen, welche als Bindungsstellen für weitere Primer- Oligonukleotide dienen können, so dass eine exponentielle Amplifikation von zu amplifizierenden Specifically, strand separation is achieved by use of the controller oligonucleotide with predefined sequences which preferentially separate a newly synthesized double strand consisting of both specific primer extension products by means of a sequence-dependent nucleic acid-mediated strand displacement. The resulting single-stranded segments of primer extension products comprise the target sequence, as well as corresponding primer binding sites, which can serve as binding sites for further primer oligonucleotides, such that exponential amplification of amplicons to be amplified
Nukleinsäureketten erreicht wird. Die Primer-Verlängerungsreaktionen und Strangverdrängungsreaktionen finden vorzugsweise im Ansatz gleichzeitig statt. Die Amplifikation erfolgt vorzugsweise unter Reaktionsbedingungen, welche eine spontane Trennung von beiden spezifischen synthetisierten Primer-Verlängerungsprodukten nicht zulassen. Nucleic acid chains is achieved. The primer extension reactions and Strand displacement reactions preferably take place simultaneously in the batch. The amplification is preferably carried out under reaction conditions which do not permit spontaneous separation of both specific synthesized primer extension products.
Eine spezifische exponentielle Amplifikation einer Zielsequenz-umfassenden Nukleinsäurekette umfasst eine Wiederholung aus Synthese-Schritten und Doppelstrang-Öffnungs-Schritten (Aktivierungs-Schritten für Primer-Bindungsstellen) als zwingende Voraussetzung für die Vermehrung der Nukleinsäurekette.  A specific exponential amplification of a nucleic acid sequence comprising a target sequence comprises a repetition of synthesis steps and double strand opening steps (activation steps for primer binding sites) as a mandatory prerequisite for the amplification of the nucleic acid chain.
Die in dieser Anmeldung beschriebenen Mechanismen der Strang-Trennung mittels eines Controllers ähneln solchen Mechanismen, wie für das „Controller-Oligonukleotid“ in der PCT Anmeldung (PCT/EP2017/07101 1 ) beschrieben. Nachfolgend wird dieser Mechanismus kurz zusammengefasst.  The mechanisms of strand separation by means of a controller described in this application are similar to those mechanisms described for the "Controller Oligonucleotide" in the PCT Application (PCT / EP2017 / 07101 1). The following briefly summarizes this mechanism.
Die Öffnung von synthetisierten Doppelsträngen wird als Reaktions-Schritt umgesetzt, welcher sequenzspezifisch durch das Controller-Oligonukleotid beeinflusst werden soll. Diese Öffnung kann vollständig erfolgen, bis hin zu Dissoziation von beiden komplementären Primer- Verlängerungsprodukten, oder auch partiell sein.  The opening of synthesized duplexes is implemented as a reaction step which is to be sequence-specifically influenced by the controller oligonucleotide. This opening can be complete, even to dissociation of both complementary primer extension products, or even partial.
Das Controller-Oligonukleotid umfasst erfindungsgemäß Sequenzabschnitte, welche mit der Zielsequenz interagieren können und weitere Sequenzabschnitte, welche diese Interaktion herbeiführen, bzw. ermöglichen, bzw. begünstigen. Im Rahmen der Interaktion mit dem Controller- Oligonukleotid werden doppelsträngige Abschnitte der synthetisierten Primer- Verlängerungsprodukte via sequenzspezifischer Strangverdrängung in einzelsträngige Form überführt. Dieser Vorgang ist sequenzabhängig: erst wenn die Sequenz des synthetisieren Doppelstranges ein gewisses Maß an Komplementarität mit der entsprechenden Sequenz des Controller-Oligonukleotides aufweist, kommt es zu einer hinreichenden Doppelstrang-Öffnung, so dass die für die Fortführung der Synthese wesentlichen Sequenzabschnitte, wie z.B. Primer- Bindungsstellen, in einzelsträngige Form überführt werden, was einem "aktiven Zustand" entspricht. Das Controller-Oligonukleotid "aktiviert" somit spezifisch die neusynthetisierten Primer- Verlängerungsprodukte, welche die Zielsequenz umfassen, für weitere Synthese-Schritte.  According to the invention, the controller oligonucleotide comprises sequence segments which can interact with the target sequence and further sequence segments which bring about this interaction or facilitate or favor it. In the context of the interaction with the controller oligonucleotide, double-stranded sections of the synthesized primer extension products are converted into single-stranded form via sequence-specific strand displacement. This process is sequence dependent: only when the sequence of the synthesized duplex has some degree of complementarity with the corresponding sequence of the controller oligonucleotide will there be sufficient double-stranded opening such that the sequence portions essential to the continuation of the synthesis, e.g. Primer binding sites are converted into single-stranded form, which corresponds to an "active state". The controller oligonucleotide thus "specifically" activates the newly synthesized primer extension products comprising the target sequence for further synthetic steps.
Hingegen werden Sequenzabschnitte, welche keine Zielsequenz umfassen, nicht in den einzelsträngigen Zustand überführt und verbleiben als Doppelstrang, was einem "inaktiven" Zustand entspricht. Die potenziellen Primerbindungsstellen sind in einem solchen Doppelstrang in der Interaktion mit neuen Primern benachteiligt bzw. vollständig gehindert, so dass weitere Synthese-Schritte an solchen "nicht aktivierten" Strängen im Allgemeinen nicht stattfinden. Diese fehlende oder verminderte Aktivierung (d.h. Überführung in einen einzelsträngigen Zustand) von synthetisierten Nukleinsäuresträngen nach einem Synthese-Schritt führt dazu, dass im darauffolgenden Synthese-Schritt nur eine verminderte Menge an Primern an einer Primer- Verlängerungsreaktion erfolgreich teilnehmen kann. Die Reaktionsbedingungen (z.B. Temperatur) werden dabei dermaßen gestaltet, dass eine spontane Trennung von komplementären Primer-Verlängerungsprodukten in Abwesenheit eines Controller-Oligonukleotides unwahrscheinlich oder signifikant verlangsamt ist. In contrast, sequence segments which do not comprise a target sequence are not converted to the single-stranded state and remain as a double strand, which corresponds to an "inactive" state. The potential primer binding sites in such a duplex are less favored or completely hindered in interaction with new primers, so that further synthetic steps on such "non-activated" strands generally do not occur. This lack of or decreased activation (ie conversion to a single-stranded state) of synthesized nucleic acid strands after a synthesis step results in the fact that in the subsequent synthesis step only a reduced amount of primers can successfully participate in a primer extension reaction. The reaction conditions (eg temperature) are designed in such a way that a spontaneous separation of complementary primer extension products in the absence of a controller oligonucleotide is unlikely or significantly slowed down.
Die anzustrebende Erhöhung der Spezifität einer Primer-Verlängerungsreaktion resultiert somit aus der Sequenzabhängigkeit der Trennung von komplementären Primer- Verlängerungsprodukten, welche eine vordefinierte Zielsequenz umfassen: das Controller- Oligonukleotid ermöglicht bzw. begünstigt diese Doppelstrang-Trennung als Folge der Übereinstimmung seiner Sequenzabschnitte mit vorgegebenen Sequenzabschnitten der Primer- Verlängerungsprodukte.  The desired enhancement of the specificity of a primer extension reaction thus results from the sequence dependency of the separation of complementary primer extension products comprising a predefined target sequence: the controller oligonucleotide facilitates this double-stranded separation as a result of matching its sequence segments with predetermined sequence segments Primer extension products.
Vorwiegend sequenzspezifische Trennung des Doppelstrangs unter Mitwirkung eines Controller- Oligonukleotides kann in Kombination mit Sequenz-spezifischen oder weniger Sequenz spezifischen Primern kombiniert werden.  Predominantly sequence-specific separation of the double strand with the assistance of a controller oligonucleotide can be combined in combination with sequence-specific or less sequence-specific primers.
Verwendung von vorwiegend spezifischen Controller-Oligonukleotiden, welche in der Lage sind, zwischen einzelnen Varianten zu unterscheiden, ermöglicht beispielsweise die Zusammenstellung von Allel-spezifischen bzw. Mutations-spezifischen Assays.  For example, use of predominantly specific controller oligonucleotides capable of distinguishing between variants allows for the assembly of allele-specific and mutation-specific assays, respectively.
Die Erfindung eignet sich besonders bei Primer-Verlängerungsreaktionen von Sequenzvarianten eines bekannten Lokus einer Zielsequenz. Ein solcher Lokus kann mehrere vorkommenden Sequenzvarianten einer Zielsequenz umfassen und ist somit ein polymorpher Lokus (Fig. 12 - 15). Ein solcher polymorpher Lokus umfasst beispielsweise Einzelnukleotid-Polymorphismen.  The invention is particularly useful in primer extension reactions of sequence variants of a known locus of a target sequence. Such a locus can comprise several occurring sequence variants of a target sequence and is thus a polymorphic locus (FIGS. 12-15). Such a polymorphic locus includes, for example, single nucleotide polymorphisms.
Um die Sequenzspezifität einer Sequenzvariante eines Lokus der Zielsequenz zu erreichen, sollten Komponenten, welche für die Spezifität der Primer-Verlängerung eine wesentliche Rolle spielen in eine spezifische Anordnung gebracht werden. Besonders vorteilhaft sind Anordnungen, welche eine bekannte Sequenzvariante eines Lokus umfassen, wobei ein vorwiegend Sequenz spezifisches Controller-Oligonukleotid sowie entsprechende Primer designt werden können. In order to achieve the sequence specificity of a sequence variant of a locus of the target sequence, components which play an essential role in the specificity of primer extension should be placed in a specific arrangement. Particularly advantageous arrangements are those which comprise a known sequence variant of a locus, wherein a predominantly sequence-specific controller oligonucleotide and corresponding primers can be designed.
Die Position einer zu erwartenden Sequenzvariante im bekannten Lokus wird somit bei dem Design von Komponenten dahingehend berücksichtigt, dass zumindest das Controller-Oligonukleotid, besser Controller-Oligonukleotid in Kombination mit mindestens einem Primer, eine spezifische Sequenzzusammensetzung in einem Primer-Verlängerungs-System aufweisen, welches für die Primer-Verlängerung einer gewünschten Variante der Zielsequenz geeignet ist. The position of an expected sequence variant in the known locus is thus taken into account in the design of components such that at least the controller oligonucleotide, better controller oligonucleotide in combination with at least one primer, has a specific sequence composition in a primer extension system is suitable for primer extension of a desired variant of the target sequence.
Die Aufgabe der Erfindung wird weiterhin dadurch gelöst, dass ein Primer-Verlängerungs-System zumindest einen Sequenz-spezifischen Primer (z.B. Allel-diskriminierender Primer) in Kombination mit jeweils einem spezifischen Controller-Oligonukleotid (z.B. Allel-spezifisches Controller- Oligonukleotid) umfasst. Somit kann für jede spezifische Zusammensetzung einer Zielsequenz und ihre spezifische Varianten (z.B. Allele) jeweils eine spezifische Kombination aus mindestens einem spezifischen Primer und mindestens einem spezifischen Controller-Oligonukleotid bereitgestellt werden. Dabei resultiert eine spezifische Amplifikation einer der möglichen Sequenzvarianten einer Zielsequenz. Weiterhin wird die Aufgabe der Erfindung dadurch gelöst, dass ein Primer-Verlängerungs-System zumindest zwei, insbesondere vier sequenz-spezifische Primer (z.B. allel-diskriminierende Primer) in Kombination mit jeweils einem spezifischen Controller-Oligonukleotid (z.B. allel-spezifisches Controller-Oligonukleotid) umfasst. Somit kann für jede spezifische Zusammensetzung einer Zielsequenz und ihre spezifische Varienten (z.B. Allele) jeweils eine spezifische Kombination aus mindestens einem spezifischen Primer und mindestens einem spezifischen Controller- Oligonukleotid bereitgestellt werden, wobei für alle vier Nukleotid-Varianten an einer bestimmten Position ein spezifisches Primer-Controller-Oligonukleotid bereitgestellt wird. Bei Anwesenheit von mindestens einer Sequenzvariante der Zielsequenz im Reaktions-Ansatz resultiert eine spezifische Primer-Verlängerung einer der möglichen Sequenzvarianten einer Zielsequenz. The object of the invention is further achieved in that a primer extension system comprises at least one sequence-specific primer (eg allele-discriminating primer) in combination with one specific controller oligonucleotide (eg allele-specific controller oligonucleotide). Thus, for each specific composition of a target sequence and its specific variants (eg, alleles), a specific combination of at least one specific primer and at least one specific controller oligonucleotide may be provided. This results in a specific amplification of one of the possible sequence variants of a target sequence. Furthermore, the object of the invention is achieved in that a primer extension system comprises at least two, in particular four sequence-specific primers (eg allel-discriminating primers) in combination with in each case one specific controller oligonucleotide (eg allele-specific controller oligonucleotide). includes. Thus, for each specific composition of a target sequence and its specific varients (eg alleles), a specific combination of at least one specific primer and at least one specific controller oligonucleotide can be provided, with a specific primer for all four nucleotide variants at a particular position. Controller oligonucleotide is provided. In the presence of at least one sequence variant of the target sequence in the reaction mixture, a specific primer extension results in one of the possible sequence variants of a target sequence.
Weiterhin wird die Aufgabe der Erfindung dadurch gelöst, dass ein Primer-Verlängerungs-System zumindest einen Sequenz-spezifischen Primer (z.B. Allel-diskriminierender Primer) in Kombination mit jeweils einem spezifischen Controller-Oligonukleotid (z.B. Allel-spezifisches Controller- Oligonukleotid) und mindestens einen weiteren Primer (einen Kompetitor-Primer) umfasst, welcher zu anderen zu erwartenden Sequenzvarianten eine komplementäre Sequenzzusammensetzung aufweist. Somit kann für jede spezifische Zusammensetzung einer Zielsequenz und ihre spezifischen Varianten (z.B. Allele) jeweils eine spezifische Kombination aus mindestens einem spezifischen Primer und mindestens einem spezifischen Controller-Oligonukleotid bereitgestellt werden. Daraus resultiert eine spezifische Primer-Verlängerung einer der möglichen Sequenzvarianten einer Zielsequenz.  Furthermore, the object of the invention is achieved in that a primer extension system at least one sequence-specific primer (eg allele-discriminating primer) in combination with a specific controller oligonucleotide (eg allele-specific controller oligonucleotide) and at least one further primer (a competitor primer) which has a complementary sequence composition to other expected sequence variants. Thus, for each specific composition of a target sequence and its specific variants (e.g., alleles), a specific combination of at least one specific primer and at least one specific controller oligonucleotide may be provided. This results in a specific primer extension of one of the possible sequence variants of a target sequence.
Die Aufgabe der Erfindung wird weiterhin dadurch gelöst, dass beide Stränge einer doppelsträngigen Nukleinsäurekette analysiert werden, wobei in einer Reaktion die Komponenten eines Primer-Verlängerungs-Systems für einen Strang einer Zielnukleinsäure bereitgestellt werden, welche als Start-Nukleinsäure verwendet wird, und in einem getrennten Ansatz werden Komponenten für den komplementären Strang der Zielnukleinsäurekette bereitgestellt, welche als Start-Nukleinsäue verwendet wird. Somit werden mindestens zwei Controller-Oligonukleotide verwendet, welche je an einen Strang der Zielnukleinsäurekette binden können (als erstes Primer- Verlängerungsprodukt). Beide Controller-Oligonukleotide werden in getrennten Reaktions- Ansätzen verwendet.  The object of the invention is further solved by analyzing both strands of a double-stranded nucleic acid chain, wherein in one reaction the components of a primer extension system are provided for a strand of a target nucleic acid, which is used as starting nucleic acid, and in a separate Approach is provided to components for the complementary strand of the target nucleic acid chain which is used as the starting nucleic acid. Thus, at least two controller oligonucleotides are used, each of which can bind to one strand of the target nucleic acid chain (as the first primer extension product). Both controller oligonucleotides are used in separate reaction mixtures.
Weiterhin wird die Aufgabe der Erfindung dadurch gelöst, dass ein Primer-Verlängerungs-System umfasst zumindest einen Primer, welcher eine Primer-Verlängerung von mehreren potenziellen Sequenzvarianten unterstützen kann (z.B. ein zielsequenzspezifischer Primer, aber kein Allel- diskriminierender Primer, ein zielsequenzspezifischer aber ein Allel-unspezifischer Primer) in Kombination mit jeweils einem spezifischen Controller-Oligonukleotid (z.B. Allel-spezifisches Controller-Oligonukleotid) bereitgestellt werden. Somit kann für jede spezifische Zusammensetzung einer Zielsequenz und ihre spezifischen Varianten (z.B. Allele) jeweils eine spezifische Kombination aus mindestens einem Allel-unspezifischen Primer und mindestens einem Allel-spezifischen Controller-Oligonukleotid bereitgestellt werden. Dabei resultiert eine spezifische Primer-Verlängerung einer der möglichen Sequenzvarianten einer Zielsequenz. Furthermore, the object of the invention is achieved in that a primer extension system comprises at least one primer which can support a primer extension of several potential sequence variants (eg a target sequence specific primer, but not an allelic discriminating primer, but a target sequence specific one allele -unspecific primer) in combination with each specific controller oligonucleotide (eg, allele-specific controller oligonucleotide). Thus, for each specific composition of a target sequence and its specific variants (eg, alleles), a specific combination of at least one allele-unspecific primer and at least one Allele-specific controller oligonucleotide can be provided. This results in a specific primer extension of one of the possible sequence variants of a target sequence.
Die für eine Primer-Verlängerung erforderlichen Oligonukleotide (mindestens ein zielsequenzspezifischer erster Primer und mindestens ein zielsequenzspezifischer Controller- Oligonukleotid) werden als zielsequenzspezifisches Primer-Verlängerungs-System zusammengefasst.  The oligonucleotides required for a primer extension (at least one target sequence-specific first primer and at least one target sequence-specific controller oligonucleotide) are summarized as a target sequence-specific primer extension system.
Da im Ansatz auch mehrere Zielsequenzen vorliegen können, soll durch Verwendung von mehreren zielsequenzspezifischen Primer-Verlängerungs-Systemen in einem Reaktions-Ansatz eine parallele Primer-Verlängerung von mehr als einer Zielsequenz ermöglicht werden, wobei bevorzugt jeweils zielsequenzspezifische Komponenten kombiniert werden.  Since several target sequences can also be present in the batch, a parallel primer extension of more than one target sequence is to be made possible by using multiple target sequence-specific primer extension systems in a reaction approach, wherein preferably target sequence-specific components are combined in each case.
Der Einsatz von vordefiniertem Controller-Oligonukleotid ermöglicht somit eine sequenzabhängige Überprüfung der Inhalte der Primer-Verlängerungsprodukte nach einzelnen Synthese-Schritten oder während der Primer- Verlängerung und Herbeiführung einer Selektion bzw. einer Auswahl von Sequenzen für nachfolgende Synthese-Schritte. Dabei kann zwischen "aktiven", einzelsträngigen Zuständen von neusynthetisierten spezifischen Primer-Verlängerungsprodukten als Folge einer erfolgreichen Interaktion mit einem Controller-Oligonukleotid, und "inaktiven" doppelsträngigen Zuständen von neusynthetisierten unspezifischen Primer-Verlängerungsprodukten als Folge einer mangelhaften und / oder unzureichenden und /oder verminderten und / oder verlangsamten Interaktion mit einem Controller-Oligonukleotid unterschieden werden.  The use of a pre-defined controller oligonucleotide thus allows a sequence-dependent review of the contents of the primer extension products after single synthesis steps or during primer extension and to bring about a selection of sequences for subsequent synthesis steps. Here, "active" single-stranded states of newly synthesized specific primer extension products may result as a result of successful interaction with a controller oligonucleotide, and "inactive" double-stranded states of newly synthesized non-specific primer extension products as a result of deficient and / or insufficient and / or decreased and / or slowed interaction with a controller oligonucleotide.
Definitionen und bestimmte Ausführungsformen: Definitions and Particular Embodiments:
Soweit nicht anders definiert, haben alle hierin verwendeten technischen und wissenschaftlichen Begriffe die gleiche Bedeutung, wie sie üblicherweise von einem Durchschnittsfachmann verstanden werden. Standardtechniken werden für molekularboiologische oder biochemische Verfahren verwandt (siehe z.B. Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. und Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.).  Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Standard techniques are used for molecular biology or biochemistry (see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.).
Im Rahmen der vorliegenden Erfindung haben die verwendeten Begriffe folgende Bedeutung: In the context of the present invention, the terms used have the following meanings:
Soweit die in der Beschreibung und im Sequenzprotokoll gezeigten Sequenzen von einander abweichen, gilt im Zweifel die in der Beschreibung gezeigte Sequenz. Insofar as the sequences shown in the description and in the sequence listing deviate from one another, the sequence shown in the description applies in case of doubt.
Der Begriff "Oligonukleotid", wie er hier bezugnehmend auf Primer, Controller-Oligonukleotid, Sonden und die zu amplifizierende Nukleinsäurekette verwendet wird, ist als ein Molekül definiert, das zwei oder mehr, insbesondere mehr als drei Desoxyribonukleotide und / oder Ribonukleotide und / oder Nukleotid-Modifikationen und / oder Nicht-Nukleotid-Modifikationen umfasst. Seine Länge umfasst insbesondere Bereiche zwischen 3 bis 300 Nukleotid-Einheiten (wobei natürliche Basen und Analoga zusammen oder jeweils allein verwendet werden können), insbesondere zwischen 5 bis 200 Nukleotid-Einheiten. Der Fachmann versteht, die genaue Größe abhängend von der letztendlichen Funktion oder Verwendung der Oligonukleotide zu bestimmen. The term "oligonucleotide" as used herein with reference to primer, controller oligonucleotide, probes and the nucleic acid chain to be amplified is defined as a molecule comprising two or more, more preferably more than three deoxyribonucleotides and / or ribonucleotides and / or nucleotide Modifications and / or non-nucleotide modifications. In particular, its length encompasses ranges between 3 to 300 nucleotide units (where natural bases and analogues can be used together or alone), in particular between 5 to 200 nucleotide units. One skilled in the art will be able to determine the exact size depending on the ultimate function or use of the oligonucleotides.
Der Begriff "Primer", wie er hier verwendet wird, betrifft ein Oligonukleotid, unabhängig davon, ob es natürlicherweise z. B. in einer gereinigten Restriktionsspaltung vorkommt oder synthetisch produziert wurde. Ein Primer ist fähig, als Initiationspunkt der Synthese zu wirken, wenn er unter Bedingungen eingesetzt wird, bei denen die Synthese eines zu einem Nukleinsäurestrang komplementären Primer-Verlängerungsproduktes induziert wird, d. h. in Gegenwart von Nukleotiden und einem induzierenden Agens, wie z.B. DNA-Polymerase bei einer geeigneten Temperatur und einem geeigneten pH-Wert. Der Primer ist für eine maximale Wirksamkeit bei der Primer-Verlängerung bevorzugt einzelsträngig. Der Primer muss genügend lang sein, um in Gegenwart des induzierenden Agens die Synthese des Verlängerungsproduktes zu initiieren. Die genaue Länge des Primers hängt von vielen Faktoren ab, einschließlich der Reaktions-Temperatur und der Primerquelle und der Anwendung des Verfahrens. Beispielsweise beträgt die Länge der Oligonukleotid-Primer bei diagnostischen Anwendungen, je nach Komplexität der Zielsequenz zwischen 5 bis 100 Nukleotide, insbesondere 6 bis 40 und insbesondere 7 bis 30 Nukleotide. Kurze Primer-Moleküle erfordern im Allgemeinen für Ausübung ihrer Primer-Funktion niedrigere Reaktions-Temperaturen, um genügend stabile Komplexe mit der Matrize zu bilden, oder höhere Konzentrationen von anderen Reaktionskomponenten, beispielsweise von DNA-Polymerasen, so dass eine ausreichende Verlängerung von gebildeten Primer-Matrizen-Komplexen erfolgen kann. As used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring e.g. B. occurs in a purified restriction cleavage or was produced synthetically. A primer is capable of acting as the initiation point of the synthesis when used under conditions which induce the synthesis of a primer extension product complementary to a nucleic acid strand, i. H. in the presence of nucleotides and an inducing agent, e.g. DNA polymerase at a suitable temperature and pH. The primer is preferably single-stranded for maximum efficiency in primer extension. The primer must be long enough to initiate synthesis of the extension product in the presence of the inducing agent. The exact length of the primer will depend on many factors, including reaction temperature and primer source and application of the method. For example, the length of the oligonucleotide primer in diagnostic applications, depending on the complexity of the target sequence between 5 to 100 nucleotides, in particular 6 to 40 and especially 7 to 30 nucleotides. Short primer molecules generally require lower reaction temperatures to perform their primer function to form sufficiently stable complexes with the template, or higher concentrations of other reaction components, such as DNA polymerases, such that sufficient elongation of formed primer is achieved. Template complexes can be made.
Die hier verwendeten Primer sind so ausgewählt, das sie "im Wesentlichen" komplementär zu den verschiedenen Strängen jeder spezifischen zu amplifizierenden Sequenz sind. Das bedeutet, dass die Primer genügend komplementär sein müssen, um mit ihren betreffenden Strängen zu hybridisieren und eine Primer-Verlängerungsreaktion zu initiieren. Somit braucht die Primersequenz beispielsweise nicht die genaue Sequenz der Zielsequenz wiederzuspiegeln. Zum Beispiel kann ein nicht-komplementäres Nukleotidfragment an dem 5'-Ende des Primers angeheftet sein, wobei der Rest der Primersequenz komplementär zu dem Strang ist. In einer anderen Ausführungsform können einzelne nicht-komplementäre Basen oder längere nicht komplementäre Sequenzen in einen Primer eingefügt sein, vorausgesetzt, dass die Primersequenz eine genügend große Komplementarität mit der zu amplifizierenden Sequenz des Stranges aufweist, um damit zu hybridisieren und so einen Primer-Matrizen-Komplex fähig zur Synthese des Verlängerungsproduktes zu erzeugen. The primers used herein are selected to be "substantially" complementary to the different strands of each specific sequence to be amplified. That is, the primers must be sufficiently complementary to hybridize with their respective strands and initiate a primer extension reaction. Thus, for example, the primer sequence does not need to reflect the exact sequence of the target sequence. For example, a non-complementary nucleotide fragment may be attached to the 5 'end of the primer, with the remainder of the primer sequence being complementary to the strand. In another embodiment, single non-complementary bases or longer non-complementary sequences may be inserted into a primer, provided that the primer sequence has a sufficiently large complementarity with the strand sequence to be amplified to hybridize therewith and thus form a primer template. Complex able to produce the synthesis of the extension product.
Im Rahmen der enzymatischen Synthese eines zur Matrize komplementären Stranges wird ein Primer-Verlängerungsprodukt erzeugt, was vollständig zum Matrizen-Strang komplementär ist. As part of the enzymatic synthesis of a template-complementary strand, a primer extension product is generated, which is completely complementary to the template strand.
Der Begriff komplementär im Bezug auf Sequenzen bezieht sich auf hybridisierende Sequenzen mit revers komplementärer Basensequenz. The term complementary with respect to sequences refers to hybridizing sequences with reverse complementary base sequence.
Allel-spezifische Primer sind Primer, welche durch ihre Sequenzzusammensetzung in der Lage sind, bevorzugt unter stringenten Reaktionsbedingungen an jeweils einzelnen Sequenzvarianten einer Zielsequenz zu hybridisieren und durch eine Polymerase unter Verwendung der Zielsequenz verlängert zu werden. Einzelne Allel-spezifische Primer können zu einer Gruppe zusammengefasst werden, welche sämtliche Varianten einer gemeinsamen Zielsequenz abdecken. Eine solche Gruppe von Allel-spezifischen Primern umfasst zumindest zwei unterschiedliche Allel-spezifische Primer, da ein polymorpher Lokus an einer vorgegebenen Position in der Zielsequenz mindestens zwei Sequenzvarianten umfasst. Die Allel-spezifischen Primer sind dahingehend ausgewählt, dass sie unter stringenten Reaktionsbedinungen vorzugsweise mit ihrer jeweils spezifischen perfekt- match Matrize eine Bindung eingehen und somit diese spezifische perfekt-match Matrize zur Ausbildung der jeweiligen Primer-Verlängerungsprodukte unter katalytischer Wirkung der Polymerase verwenden. Vorzugsweise können 3'-terminale Segmente von Allel-spezifischen Primern zur Diskriminierung von Varianten von Zielsequenzen verwendet werden und sind dabei dermaßen in ihrer Sequenzzusammensetzung an die jeweiligen Varianten angepasst, dass solche Primer einen perfekt-match Doppelstrang unter stringenten Bedingungen mit der jeweiligen Variante ausbilden. Solche perfekt-match Doppelstränge können in der Regel von einer Polymerase gut erkannt werden und unter geeigneten Reaktionsbedingungen kommt es zu einer Primer-Verlängerung. Bei der Interaktion eines Allel-spezifischen Primers mit einer anderen Variante einer Zielsequenz entsteht somit ein Mismatch-Doppelstrang. Solche Mismatches führen in der Regel zu einer Verzögerung der Verlängerung durch eine Polymerase bzw. zu einer Verlangsamung der Gesamtreaktion. In bestimmten Ausführungsformen können Allel-spezifische Primer im 3'-Segment mindestens eine phosphoro-thioat-Bindung umfassen, welche Allel- spezifische Primer vor dem 3'-5'-Nuklease-Abbau durch eine Polymerase schützt. Allele-specific primers are primers which are capable of their sequence composition, preferably under stringent reaction conditions on each individual sequence variants a target sequence to be hybridized and extended by a polymerase using the target sequence. Single allele-specific primers can be grouped together to cover all variants of a common target sequence. Such a group of allele-specific primers comprises at least two different allele-specific primers, as a polymorphic locus at a given position in the target sequence comprises at least two sequence variants. The allele-specific primers are selected to bind under stringent reaction conditions, preferably with their respective perfect-match template, and thus use this specific perfect-match template to form the respective primer extension products under the catalytic action of the polymerase. Preferably, 3 ' -terminal segments of allele-specific primers can be used to discriminate variants of target sequences and are thus adapted in their sequence composition to the respective variants such that such primers form a perfect match double strand under stringent conditions with the respective variant. Such perfect-match double strands can usually be recognized well by a polymerase and under suitable reaction conditions a primer extension occurs. The interaction of an allele-specific primer with another variant of a target sequence thus results in a mismatch double strand. Such mismatches usually lead to a delay in the extension by a polymerase or to a slowing of the overall reaction. In certain embodiments, allele-specific primers in the 3 ' segment may include at least one phosphorothioate linkage that protects allele-specific primers from 3 ' -5 ' nuclease degradation by a polymerase.
Mehrere Allel-spezifische Primer umfassen somit Sequenzsegmente, welche für eine Gruppe von Allel-spezifischen Primern im Wesentlichen identisch bzw. einheitlich sind, sowie Sequenzsegmente, welche unter den Primern einer Gruppe unterschriedlich sind und charakteristisch für die jeweilige Sequenzvariante einer Zielsequenz. Unter Einbeziehung von einheitlichen Sequenzsegmenten können solche Primer an die jeweilige Zielsequenz unter Reaktionsbedinungen hybridisieren. Unter Einbeziehung von charakteristischen Sequenzsegmenten kann ein jeweiliger Primer spezifisch an eine Sequenzvariante der Zielsequenz unter Ausbildung eines perfekt-match Doppelstranges binden. Vorzugsweise sind die Primer dermaßen konstruiert, dass unter verwendeten Reaktionsbedinungen die Bindung an eine Zielsequenz unter Ausbildung eines perfekt-match Doppelstranges bevorzugt wird und die Bindung an einer Zielsequenz unter Ausbildung eines Mismatch-Doppelstranges weniger bevorzugt wird. Thus, multiple allele-specific primers include sequence segments which are substantially identical for a group of allele-specific primers, as well as sequence segments which are different among the primers of a group and characteristic of the respective sequence variant of a target sequence. Including uniform sequence segments, such primers can hybridize to the respective target sequence under reaction conditions. Including characteristic sequence segments, a respective primer can specifically bind to a sequence variant of the target sequence to form a perfect-match double strand. Preferably, the primers are designed so that, under used reaction conditions, binding to a target sequence to form a perfect match double strand is preferred and binding to a target sequence to form a mismatch duplex is less preferred.
In bestimmten Ausführungsformen wird das erste Primer-Oligonukleotid als Allel-spezifischer Primer in Kombination mit einem entsprechenden Allel-spezifischen Controller-Oligonukleotid bereitgestellt. In bestimmten Ausführungsformen wird das zweite Primer-Oligonukleotid als Allel- spezifischer Primer in Kombination mit einem entsprechenden Allel-spezifischen Controller- Oligonukleotid bereitgestellt. Tm-Schmelztemperatur In certain embodiments, the first primer oligonucleotide is provided as an allele-specific primer in combination with a corresponding allele-specific controller oligonucleotide. In certain embodiments, the second primer oligonucleotide is provided as an allele-specific primer in combination with a corresponding allele-specific controller oligonucleotide. Tm melting temperature
Als Schmelztemperatur eines komplementären oder partiell komplementären Doppelstranges wird im Allgemeinen ein Messwert einer Reaktionstemperatur verstanden, bei welchem ca. die Hälfte der Stränge als Doppelstrang vorliegt und die andere Hälfte als Einzelstrang vorliegt. Das System (Assoziation und Dissoziation von Strängen) befindet sich im Gleichgewicht.  The melting temperature of a complementary or partially complementary double strand is generally understood to mean a measured value of a reaction temperature at which approximately half of the strands are in the form of a double strand and the other half is in the form of a single strand. The system (association and dissociation of strands) is in equilibrium.
Aufgrund einer Vielzahl von Faktoren, welche die Tm eines Doppelstranges beeinflussen können (z.B. Sequenzlänge, CG-Gehalt der Sequenz, Puffer-Bedingungen, Konzentration von divalenten Metal-Kationen etc.) sollte die Bestimmung der Tm einer zu amplifizierenden Nukleinsäure unter gleichen Bedinungen erfolgen, wie die beabsichtigte Primer-Verlängerungsreaktion.  Due to a large number of factors which can influence the Tm of a double strand (eg sequence length, CG content of the sequence, buffer conditions, concentration of divalent metal cations, etc.), the Tm of a nucleic acid to be amplified should be determined under the same conditions, like the intended primer extension reaction.
Wegen Abhängigkeit der messbaren Schmelztemperatur von multiplen Reaktions-Parametern, z.B. von jeweiligen Puffer-Bedingungen und jeweiligen Konzentrationen der Reaktionsteilnehmer, wird unter Schmelztemperatur ein Wert verstanden, welcher in gleichem Reaktionspuffer gemessen wurde wie die exponentielle Amplifikation, bei Konzentrationen von beiden komplementären Komponenten eines Doppelstranges von etwa 0,1 pmol/l bis etwa 10 pmol/l, insbesondere in Konzentration von etwa 0,3 pmol/ bis ca. 3 pmol/l, insbesondere bei ca. 1 pmol/l. Bei dem jeweiligen Wert der Schmelztemperatur handelt sich um einen Richtwert, welcher mit der Stabilität eines jeweiligen Doppelstranges korreliert.  Because of the dependence of the measurable melting temperature on multiple reaction parameters, e.g. of respective buffer conditions and respective concentrations of the reactants, melting temperature is understood to mean a value which was measured in the same reaction buffer as the exponential amplification, at concentrations of both complementary components of a double strand of about 0.1 pmol / l to about 10 pmol / in particular in a concentration of about 0.3 pmol / to about 3 pmol / l, in particular about 1 pmol / l. The respective value of the melting temperature is a guideline, which correlates with the stability of a respective double strand.
Eine Schmelztemperatur für einen Doppelstrang kann grob abgeschätzt werden. Mehrere kommerzielle Anbieter ermöglichen eine theoretische Berechnung einer zu erwartenden Schmelztemperatur. Beispielsweise kann Software-Packet OligoAnalyzer 3.1 (online zugängig bei IDT (Integrated DNA-Technologies ) zur Abschätzung der Stärke der Bindungen einzelner Oligonukleotide verwendet werden.  A melting temperature for a double strand can be roughly estimated. Several commercial suppliers allow a theoretical calculation of an expected melting temperature. For example, software package OligoAnalyzer 3.1 (available online from IDT (Integrated DNA Technologies) can be used to estimate the strength of the bonds of individual oligonucleotides.
Die Desoxyribonukleosid-Triphosphate (dNTPs) dATP, dCTP, dGTP und TTP (oder dUTP, oder dUTP/TTP-Gemisch) werden in adäquaten Mengen zum Synthesegemisch gegeben. In bestimmten Ausführungsformen können zusätzlich zu dNTPs mindestens eine weitere Art von dNTP-Analoga zum Synthesegemisch zugegeben werden. Diese dNTP-Analoga umfassen in bestimmten Ausführungsformen beispielsweise eine charakteristische Markierung (z.B. Biotin oder Fluoreszenzfarbstoff), so dass wenn in Nukleinsäurestrang eingebaut, auch diese Markierung in den Nukleinsäurestrang integriert ist. In einer anderen Ausführungsform umfassen diese dNTP- Analoga mindestens eine Modifikation von Zucker-Phosphat-Anteil des Nukleotids, z.B. alpha- Phosphorothioat-2'-Desoxyribonukleosid-Triphosphate (oder andere Modifikationen, welche einem Nukleinsäurestrang eine Nuklease-Resistenz verleihen), 2',3'-Dideoxy-Ribonukleosid- Triphosphate, Azyklo-Nukleosid-Triphosphate (oder andere zur Termination einer Synthese führende Modifikationen). In bestimmten Ausführungsformen umfassen diese dNTP-Analoga mindestens eine Modifikation von Nukleobase, z.B. Iso-Cytosine, Iso-Guanosine (oder auch andere Modifikationen der Nukleobasen des erweiterten genetischen Alphabets), 2-Amino- Adenosine, 2-Thiouridine, Inosine, 7-deazy-adenosine, 7-deaza-guanosine, 5-Me-Cytosine, 5- Propyl-Uridine, 5-Propyl-Cytosine (oder auch andere Modifikationen von Nukleobasen, welche gegenüber natürlichen Nukleobasen durch eine Polymerase eingebaut werden können und zur Änderung der Strang-Stabilität führen). In bestimmten Ausführungsformen umfasst ein dNTP- Analog sowohl eine Modifikation der Nukleobase als auch eine Modifikation des Zucker-Phosphat- Anteils. In bestimmten Ausführungsformen wird statt mindestens eines natürlichen dNTP- Substrates mindestens eine weitere Art von dNTP-Analoga zum Synthesegemisch zugegeben.The deoxyribonucleoside triphosphates (dNTPs) dATP, dCTP, dGTP and TTP (or dUTP, or dUTP / TTP mixture) are added in adequate amounts to the synthesis mixture. In certain embodiments, in addition to dNTPs, at least one other type of dNTP analogs can be added to the synthesis mixture. For example, these dNTP analogs include, in certain embodiments, a characteristic label (eg, biotin or fluorescent dye) such that when incorporated into nucleic acid strand, this label is also integrated into the nucleic acid strand. In another embodiment, this at least one modification of the sugar-phosphate moiety of the nucleotide, for example, alpha-phosphorothioate 2 include dNTP analogues '-Desoxyribonukleosid triphosphates (or other modifications which impart a nucleic acid strand a nuclease resistance), 2', 3 'dideoxy-ribonucleoside triphosphates, Azyklo nucleoside triphosphates (or other leading to the termination of a synthetic modifications). In certain embodiments, these dNTP analogs include at least one modification of nucleobase, eg, iso-cytosines, iso-guanosines (or other modifications of extended-genetic alphabet nucleobases), 2-amino-adenosines, 2-thiouridines, inosines, 7-deazy aadenosines, 7-deaza-guanosines, 5-Me-cytosines, 5- Propyl uridines, 5-propyl cytosines (or other modifications of nucleobases that can be incorporated into natural nucleobases by a polymerase and result in alteration of strand stability). In certain embodiments, a dNTP analog comprises both a modification of the nucleobase and a modification of the sugar-phosphate moiety. In certain embodiments, at least one other type of dNTP analogue is added to the synthesis mixture instead of at least one natural dNTP substrate.
Das die Nukleinsäure-Synthese induzierende Agens kann ein Enzym oder ein System sein, das so wirkt, dass dadurch die Synthese der Primer-Verlängerungsprodukte bewirkt wird. Geeignete Enzyme für diesen Zweck umfassen z.B. matrizenabhängige DNA-Polymerasen wie Bst Polymerase und ihre Modifikationen, Vent Polymerase und andere - insbesondere hitzestabile DNA-Polymerasen, die den Einbau der Nukleotide in der korrekten Weise ermöglichen, wodurch die Primer-Verlängerungsprodukte gebildet werden, die zu jedem synthetisierten Nukleinsäurestrang komplementär sind. Im Allgemeinen wird die Synthese am 3'-Ende eines jeden Primers initiiert und schreitet entlang des Matrizenstranges fort, bis die Synthese beendet ist oder unterbrochen wird. The nucleic acid synthesis-inducing agent may be an enzyme or a system that functions to cause synthesis of the primer extension products. Suitable enzymes for this purpose include e.g. template-dependent DNA polymerases such as Bst polymerase and its modifications, Vent polymerase and others - particularly heat-stable DNA polymerases that allow the incorporation of the nucleotides in the correct manner, thereby forming the primer extension products that are complementary to each nucleic acid strand synthesized. In general, the synthesis is initiated at the 3 'end of each primer and proceeds along the template strand until the synthesis is complete or interrupted.
Bevorzugt werden Polymerasen verwendet, welche zur Strangverdrängung fähig sind. Dazu zählen beispielsweise das große Fragment der Bst Polymerase oder ihre Modifikationen (z.B. Bst 2.0 DNA Polymerase), Klenow Fragment, Vent exo minus Polymerase, Deepvent exo minus DNA Polymerase, großes Fragment der Bsu DNA Polymerase, großes Fragment der Bsm DNA Polymerase.  Preference is given to using polymerases which are capable of strand displacement. These include, for example, the large fragment of Bst polymerase or its modifications (e.g., Bst 2.0 DNA polymerase), Klenow fragment, Vent exo minus polymerase, Deepvent exo minus DNA polymerase, large fragment of Bsu DNA polymerase, large fragment of Bsm DNA polymerase.
In bestimmten Ausführungsformen werden insbesondere Polymerasen eingesetzt, welche keine 5'-3'-Exonuklease-Aktivität aufweisen, bzw. keine 5'-3'-FEN-Aktivität aufweisen. In certain embodiments, in particular polymerases are used which have no 5 ' -3 ' -Exonuklease activity, or have no 5 ' -3 ' -FFEN activity.
In bestimmten Ausführungsformen werden mindestens zwei verschiedene Polymerasen eingesetzt, beispielsweise Polymerasen welche zu Strangverdrängung fähig sind und solche, welche eine 3'-5'-Proofreading Aktivität aufweisen. In certain embodiments, at least two different polymerases are used, for example, polymerases capable of strand displacement and those having 3 ' -5 ' reproducing activity.
In bevorzugten Ausführungsformen werden Polymerasen mit einer Hotstart-Funktion eingesetzt, welche erst beim Erreichen einer bestimmten Temperatur ihre Funktion entfalten können.  In preferred embodiments, polymerases are used with a hot-start function, which can only perform their function when a certain temperature is reached.
Erstes Primer-Oligonukleotid: First primer oligonucleotide:
Das Primer-Oligonukleotid umfasst einen ersten Primer-Bereich und einen zweiten Bereich. Der erste Primer-Bereich ist in der Lage, an eine im Wesentlichen komplementäre Sequenz innerhalb der zu amplifizierenden Nukleinsäure oder ihrer Äquivalente zu binden und eine Primer- Verlängerungsreaktion zu initiieren. Der zweite Bereich umfasst einen Polynukleotid-Schwanz, welcher in der Lage ist, ein Controller-Oligonukleotid zu binden und damit eine räumliche Nähe zwischen dem Controller-Oligonukleotid und den anderen Teilen des ersten Primer- Verlängerungsproduktes zu bewirken, welche ausreichend ist, um eine Strangverdrängung durch das Controller-Oligonukleotid zu initiieren. Der zweite Bereich des ersten Primer-Oligonukleotids umfasst weiterhin mindestens eine Modifikation (eine Nukleotid-Modifikation oder eine nicht- Nukleotid-Modifikation), welche die Polymerase am Kopieren des Polynukleotid-Schwanzes hindert, indem die Fortführung der polymeraseabhängigen Synthese gehemmt wird. Diese Modifikation ist beispielsweise am Übergang zwischen dem ersten und dem zweiten Bereich des Primer-Oligonukleotids lokalisiert. Der erste Primer-Bereich des Primer-Oligonukleotides ist folglich durch eine Polymerase kopierbar, so dass eine komplementäre Sequenz zu diesem Bereich während der Synthese des zweiten Primer-Verlängerungsproduktes von der Polymerase erzeugt werden kann. Der Polynukleotid-Schwanz des zweiten Bereichs des Primer-Oligonukleotides wird vorzugsweise durch die Polymerase nicht kopiert. The primer oligonucleotide comprises a first primer region and a second region. The first primer region is capable of binding to a substantially complementary sequence within the nucleic acid or its equivalents to be amplified and initiating a primer extension reaction. The second region comprises a polynucleotide tail which is capable of binding a controller oligonucleotide and thereby effecting spatial proximity between the controller oligonucleotide and the other portions of the first primer extension product sufficient to induce strand displacement through the controller oligonucleotide. The second region of the first primer oligonucleotide further comprises at least one modification (a nucleotide modification or a non-nucleotide modification) which prevents the polymerase from copying the polynucleotide tail by inhibiting the continuation of the polymerase-dependent synthesis. This modification is located, for example, at the junction between the first and the second region of the primer oligonucleotide. The first primer region of the primer oligonucleotide is thus replicable by a polymerase so that a complementary sequence to this region can be generated during synthesis of the second primer extension product from the polymerase. The polynucleotide tail of the second region of the primer oligonucleotide is preferably not copied by the polymerase.
Bestimmte Ausführungsformen des ersten Primer-Oligonukleotids Certain embodiments of the first primer oligonucleotide
In bestimmten Ausführungsformen wird dies durch die Modifikation im zweiten Bereich erreicht, welche die Polymerase vor dem Polynukleotid-Schwanz stoppt. In bestimmten Ausführungsformen wird dies durch Nukleotid-Modifikationen im zweiten Bereich erreicht, wobei der gesamte Polynukleotid-Schwanz im Wesentlichen aus solchen Nukleotid-Modifikationen besteht und somit für die Polymerase unkopierbar ist.  In certain embodiments, this is achieved by the modification in the second region, which stops the polymerase from the polynucleotide tail. In certain embodiments, this is achieved by nucleotide modifications in the second region, where the entire polynucleotide tail consists essentially of such nucleotide modifications and thus is uncopatible to the polymerase.
In bestimmten Ausführungsformen ist ein jedes Primer-Oligonukleotid spezifisch für je eine zu amplifizierende Nukleinsäure.  In certain embodiments, each primer oligonucleotide is specific for each nucleic acid to be amplified.
In bestimmten Ausführungsformen ist ein jedes Primer-Oligonukleotid spezifisch für mindestens zwei der zu amplifizierenden Nukleinsäuren, welche jeweils im Wesentlichen unterschiedliche Sequenzen umfassen.  In certain embodiments, each primer oligonucleotide is specific for at least two of the nucleic acids to be amplified, each comprising substantially different sequences.
In bestimmten Ausführungsformen ist das Primer-Oligonukleotid mit einem charakteristischen Marker markiert, z.B. einem Fluoreszenzfarbstoff (z.B. TAMRA, Fluoreszein, Cy3, Cy5) oder einem Affinitätsmarker (z.B. Biotin, Digoxigenin) oder einem zusätzlichen Sequenzfragment, z.B. zur Bindung einer spezifischen Oligonukleotid-Sonde für Detektion oder Immobilisierung oder zur Barcode-Markierung.  In certain embodiments, the primer oligonucleotide is labeled with a characteristic marker, e.g. a fluorescent dye (e.g., TAMRA, fluorescein, Cy3, Cy5) or an affinity tag (e.g., biotin, digoxigenin) or an additional sequence fragment, e.g. for binding a specific oligonucleotide probe for detection or immobilization or barcode labeling.
In bestimmten Ausführungsformen wird mindestens ein erstes Primer-Oligonukleotid als Allel- spezifischer Primer in Kombination mit mindestens einem entsprechenden Allel-spezifischen Controller-Oligonukleotid bereitgestellt.  In certain embodiments, at least a first primer oligonucleotide is provided as an allele-specific primer in combination with at least one corresponding allele-specific controller oligonucleotide.
Primerverlängerungsprodukt: Primer extension product:
Ein Primerverlängerungsprodukt (auch Primer-Extensionsprodukt genannt) entsteht durch enzymatische (polymeraseabhängige) Verlängerung eines Primer-Oligonukleotides als Ergebnis einer matrizenabhängigen Synthese, welche durch eine Polymerase katalysiert wird.  A primer extension product (also called a primer extension product) results from enzymatic (polymerase-dependent) extension of a primer oligonucleotide as a result of template-dependent synthesis catalyzed by a polymerase.
Ein Primerverlängerungsprodukt umfasst die Sequenz des Primer-Oligonukleotids in seinem 5'- Segment und die Sequenz des Verlängerungsproduktes (auch Extensions-Produkt genannt), welches durch eine Polymerase in matrizenabhängiger Form synthetisiert wurde. Das durch die Polymerase synthetisierte Verlängerungsprodukt ist komplementär zum Matrizenstrang, an welchem es synthetisiert wurde. A primer extension product comprises the sequence of the primer oligonucleotide in its 5 ' segment and the sequence of the extension product (also called extension product) which has been synthesized by a polymerase in a template-dependent form. That by the Polymerase synthesized extension product is complementary to the template strand on which it was synthesized.
Ein spezifisches Primerverlängerungsprodukt (Hauptprodukt) umfasst Sequenzen der zu amplifizierenden Nukleinsäurekette. Es ist Ergebnis einer spezifischen Synthese bzw. einer korrekten Ausführung einer beabsichtigten Primerverlängerungsreaktion bei welcher die spezifisch zu amplifizierende Nukleinsäurekette als Matrize dient.  A specific primer extension product (major product) comprises sequences of the nucleic acid chain to be amplified. It is the result of a specific synthesis or a correct execution of an intended primer extension reaction in which the nucleic acid chain to be specifically amplified serves as a template.
Die Länge des Verlängerungsproduktes einer spezifischen Primerverlängerung kann zwischen 10 und 300 Nukleotiden, insbesondere zwischen 10 und 180 Nukleotiden liegen, insbesondere zwischen 20 und 120 Nukleotiden, insbesondere zwischen 30 und 80 Nukleotiden.  The length of the extension product of a specific primer extension may be between 10 and 300 nucleotides, in particular between 10 and 180 nucleotides, in particular between 20 and 120 nucleotides, in particular between 30 and 80 nucleotides.
Ein unspezifisches Primerverlängerungsprodukt (Nebenprodukt) umfasst beispielsweise Sequenzen, welche als Ergebnis einer unspezifischen bzw. inkorrekten bzw. nicht beabsichtigten Primer-Verlängerungsreaktion entstanden sind. Diese schließen beispielsweise Primer- Verlängerungsprodukte ein, welche als Folge eines falschen Initiierungs-Ereignisses (falsches Priming) oder als Folge anderer Nebenreaktionen, einschließlich polymeraseabhängigen Sequenzveränderungen wie Basen-Substitution, Deletion etc., entstanden sind. Das Ausmaß an Sequenzabweichungen von unspezifischen Primer-Verlängerungsprodukten übersteigt im Allgemeinen die Fähigkeit von Controller-Oligonukleotiden, solche doppelsträngigen Nebenprodukte erfolgreich von ihren Matrizen zu verdrängen, so dass die Amplifikation von solchen Nebenprodukten langsamer verläuft oder vollständig ausbleibt. Das Ausmaß der Akzeptanz bzw. die Toleranzgrenze zu Abweichungen sind abhängig beispielsweise von Reaktionstemperatur und Art und Weise der Sequenzabweichung. Beispiele für unspezifische Primer-Verlängerungsprodukte bilden Primer-Dimere oder Sequenzvarianten, welche nicht der zu amplifizierenden Nukleinsäure entsprechen, z.B. Sequenzen, welche keine Zielsequenz umfassen. For example, a nonspecific primer extension product (by-product) includes sequences that have arisen as a result of a nonspecific or improper primer extension reaction. These include, for example, primer extension products that have resulted as a result of a false initiation event (false priming) or as a result of other side reactions, including polymerase-dependent sequence changes such as base substitution, deletion, etc. The level of sequence aberrations of nonspecific primer extension products generally exceeds the ability of controller oligonucleotides to successfully displace such double-stranded by-products from their templates so that amplification of such by-products is slower or completely absent. The extent of acceptance or the tolerance limit for deviations depend, for example, on the reaction temperature and the manner of the sequence deviation. Examples of nonspecific primer extension products are primer dimers or sequence variants which do not correspond to the nucleic acid to be amplified, e.g. Sequences which do not comprise a target sequence.
Die Beurteilung einer hinreichenden Spezifität der Amplifikation hängt häufig mit der Aufgabenstellung zusammen. In vielen Amplifikationsverfahren kann ein gewisses Maß der Unspezifität der Amplifikationsreaktion toleriert werden, solange das gewünschte Ergebnis erreicht werden kann. The assessment of a sufficient specificity of the amplification is often related to the task. In many amplification methods, some degree of unspecificity of the amplification reaction can be tolerated as long as the desired result can be achieved.
Bestimmte Ausführungsformen des ersten Primerverlängerungsprodukts: Particular embodiments of the first primer extension product:
In bestimmten Ausführungsformen beträgt der Anteil von zu amplifizierenden Nukleinsäureketten am Gesamtergebnis der Reaktion mehr als 1 %, insbesondere mehr als 10 %, insbesondere mehr als 30 % gemessen an der Gesamtmenge von neusynthetisierten Strängen.  In certain embodiments, the proportion of nucleic acid chains to be amplified in the overall result of the reaction is more than 1%, in particular more than 10%, in particular more than 30%, based on the total amount of newly synthesized strands.
In bestimmten Ausführungsformen stimmt die Sequenz der synthetisierten Primer- Verlängerungsprodukte mit der zu erwartenden Sequenz einer zu amplifizierenden Nukleinsäure komplett überein. In einer anderen Ausführungsform können Abweichungen in der erhaltenen Sequenz von der theoretisch zu erwartenden Sequenz toleriert werden. In bestimmten Ausführungsformen liegt das Ausmaß der Übereinstimmung der erhaltenen Sequenz infolge einer Amplifikation mit der Sequenz der theoretisch zu erwartenden zu amplifizierenden Nukleinsäure beispielsweise zwischen 90 % und 100 %, insbesondere liegt die Übereinstimmung bei über 95 %, insbesondere liegt die Übereinstimmung über 98 % (gemessen am Anteil der synthetisierten Basen). In certain embodiments, the sequence of the synthesized primer extension products is completely consistent with the expected sequence of a nucleic acid to be amplified. In another embodiment, deviations in the sequence obtained may be tolerated by the theoretically expected sequence. In certain embodiments, the degree of agreement of the sequence obtained is due to a Amplification with the sequence of the theoretically expected nucleic acid to be amplified, for example, between 90% and 100%, in particular, the agreement is greater than 95%, in particular, the agreement is greater than 98% (measured on the proportion of synthesized bases).
Das erste Primer-Verlängerungsprodukt wird ausgehend von einem ersten Primer-Oligonukleotid gebildet. Ein Kompetitor-Primer-Verlängerungsprodukt wird ausgehend von einem Kompetitor- Primer-Oligonukleotid gebildet (Fig. 21 - 23).  The first primer extension product is formed from a first primer oligonucleotide. A competitor primer extension product is formed starting from a competitor primer oligonucleotide (Figures 21-23).
Ein Primerverlängerungsprodukt kann in bestimmten Ausführungsformen als eine Start- Nukleinsäurekette dienen, welche eine Zielnukleinsäure-umfassende Sequenz umfasst.  A primer extension product, in certain embodiments, may serve as a start-up nucleic acid chain comprising a target nucleic acid-comprising sequence.
Zielsequenz: Target sequence:
Eine Zielsequenz ist in bestimmten Ausführungsformen ein Segment einer zu amplifizierenden Nukleinsäurekette, welches als charakteristische Sequenz der zu amplifizierenden Nukleinsäure dienen kann. Diese Zielsequenz kann als Marker für die Anwesenheit oder Abwesenheit einer anderen Nukleinsäure dienen. Diese andere Nukleinsäure dient somit als Quelle der Zielsequenz und kann beispielsweise eine genomische DNA oder RNA oder Teile der genomischen DNA oder RNA (z.B. mRNA), oder Äquivalente der genomischen DNA oder RNA eines Organismus sein (z.B. cDNA, modifizierte RNA wie rRNA, tRNA, microRNA etc.), oder definierte Veränderungen der genomischen DNA oder RNA eines Organismus umfassen, beispielsweise Mutationen (z.B. Deletionen, Insertionen, Substitutionen, Additionen, Sequenzvermehrung, z.B. Repeat- Vermehrung im Rahmen von Mikrosatellit-Instabilität), Splice-Varianten, Rearrangement-varianten (z.B. T-Ze II- Rezeptor Varianten) usw. Die einzelnen Zielsequenzen können für ein phänotypisches Merkmal stehen, beispielsweise für Antibiotika-Resistenz oder prognostische Information haben und somit für diagnostische Assays / Tests von Interesse sein. Als Quelle / Ursprung einer Zielsequenz kann eine solche Nukleinsäure beispielsweise die Zielsequenz als Sequenz-Element ihres Stranges umfassen. Eine Zielsequenz kann somit als charakteristischer Marker für einen bestimmten Sequenzinhalt einer anderen Nukleinsäure dienen.  In certain embodiments, a target sequence is a segment of a nucleic acid chain to be amplified which can serve as a characteristic sequence of the nucleic acid to be amplified. This target sequence can serve as a marker for the presence or absence of another nucleic acid. This other nucleic acid thus serves as the source of the target sequence and can be for example a genomic DNA or RNA or parts of the genomic DNA or RNA (eg mRNA), or equivalents of the genomic DNA or RNA of an organism (eg cDNA, modified RNA such as rRNA, tRNA, microRNA, etc.), or defined changes in the genomic DNA or RNA of an organism, for example mutations (eg deletions, insertions, substitutions, additions, sequence amplification, eg repeat propagation in the context of microsatellite instability), splice variants, rearrangement variants (eg, T-Ze II receptor variants), etc. The individual target sequences may represent a phenotypic trait, such as antibiotic resistance or prognostic information, and thus be of interest for diagnostic assays / assays. As a source / origin of a target sequence, such a nucleic acid may comprise, for example, the target sequence as a sequence element of its strand. A target sequence can thus serve as a characteristic marker for a particular sequence content of another nucleic acid.
Die Zielsequenz kann einzelsträngig oderdoppelsträngig sein. Sie kann mit der zu amplifizierenden Nukleinsäure im Wesentlichen identisch sein oder nur einen Teil der zu amplifizierenden Nukleinsäure darstellen.  The target sequence can be single-stranded or double-stranded. It may be substantially identical to the nucleic acid to be amplified or may be only part of the nucleic acid to be amplified.
Äquivalente der Zielsequenz umfassen Nukleinsäuren mit im Wesentlichen identischen Informationsgehalt. Beispielsweise haben komplementäre Stränge einer Zielsequenz identischen Informationsgehalt und können als äquivalent bezeichnet werden, RNA und DNA Varianten einer Sequenz sind ebenfalls Beispiele für äquivalenten Informationsgehalt.  Equivalents of the target sequence include nucleic acids with substantially identical information content. For example, complementary strands of a target sequence have identical informational content and can be said to be equivalent; RNA and DNA variants of a sequence are also examples of equivalent informational content.
Im Rahmen der Material-Vorbereitung vor der Amplifikations-Reaktion kann eine solche Zielsequenz aus ihrer ursprünglichen Sequenzumgebung isoliert werden und für die Amplifikationsreaktion vorbereitet werden. Bestimmte Ausführungsformen der Zielsequenz: As part of the material preparation prior to the amplification reaction, such a target sequence can be isolated from its original sequence environment and prepared for the amplification reaction. Particular embodiments of the target sequence:
In bestimmten Ausführungsformen umfasst eine zu amplifizierende Nukleinsäure eine Zielsequenz. In bestimmten Ausführungsformen entspricht die Zielsequenz der zu amplifizierenden Nukleinsäure. In einer weiteren bestimmten Ausführungsform umfasst eine Start- Nukleinsäurekette eine Zielsequenz. In bestimmten Ausführungsformen entspricht die Zielsequenz einer Start-Nukleinsäurekette.  In certain embodiments, a nucleic acid to be amplified comprises a target sequence. In certain embodiments, the target sequence corresponds to the nucleic acid to be amplified. In another specific embodiment, a start-up nucleic acid chain comprises a target sequence. In certain embodiments, the target sequence corresponds to a starting nucleic acid chain.
Die zu amplifizierende Nukleinsäure stellt eine Nukleinsäurekette dar, welche sequenzspezifisch oder zumindest vorwiegend sequenzspezifisch mit Hilfe der exponentiellen Amplifikation unter Einsatz von Primern und Controller-Oligonukleoid durch die Polymerase amplifiziert werden soll. The nucleic acid to be amplified represents a nucleic acid chain which is to be amplified sequence-specifically or at least predominantly sequence-specifically by means of the exponential amplification using primers and controller oligonucleotide by the polymerase.
Die Länge der zu amplifizierenden Nukleinsäure kann zwischen 20 und 300 Nukleotiden, insbesondere zwischen 30 und 200 Nukleotiden liegen, insbesondere zwischen 40 und 150 Nukleotiden, insbesondere zwischen 50 und 100 Nukleotiden. The length of the nucleic acid to be amplified may be between 20 and 300 nucleotides, in particular between 30 and 200 nucleotides, in particular between 40 and 150 nucleotides, in particular between 50 and 100 nucleotides.
Die zu amplifizierende Nukleinsäurekette kann eine oder mehrere Zielsequenzen oder ihre Äquivalente umfassen. Weiterhin kann eine zu amplifizierende Nukleinsäure die im Wesentlichen zu einer Zielsequenz komplementären Sequenzen umfassen, welche mit ähnlicher Effizienz wie eine Zielsequenz in einer Amplifikationsreaktion vermehrt werden und die Zielsequenz oder ihre Abschnitte umfassen. Zusätzlich zu einer Zielsequenz kann die zu amplifizierende Nukleinsäure weitere Sequenzsegmente einschließen, beispielsweise Primer-Sequenzen, Sequenzen mit Primer-Bindungsstellen und /oder Sequenzsegmente für Bindung von Detektions-Sonden, und / oder Sequenzsegmente für Sequenz-Kodierung von Strängen durch Barcode-Sequenzen und / oder Sequenzsegmente für Bindung an eine feste Phase. Die Primer-Sequenzen oder ihre Sequenzanteile, sowie Primer-Bindungsstellen oder ihre Sequenzanteile können beispielsweise zu Sequenzabschnitten einer Zielsequenz gehören.  The nucleic acid sequence to be amplified may comprise one or more target sequences or their equivalents. Furthermore, a nucleic acid to be amplified may comprise sequences substantially complementary to a target sequence which are propagated with similar efficiency as a target sequence in an amplification reaction and comprise the target sequence or its portions. In addition to a target sequence, the nucleic acid to be amplified may include additional sequence segments, for example, primer sequences, sequences with primer binding sites and / or sequence segments for binding of detection probes, and / or sequence segments for sequence encoding of strands by barcode sequences and / or sequence segments for binding to a solid phase. The primer sequences or their sequence portions, as well as primer binding sites or their sequence portions, may for example belong to sequence sections of a target sequence.
In bestimmten Ausführungsformen entspricht die zu amplifizierende Nukleinsäure der Zielsequenz. In certain embodiments, the nucleic acid to be amplified corresponds to the target sequence.
In einer anderen Ausführungsform bildet die Zielsequenz einen Teil der Sequenz der zu amplifizierenden Nukleinsäurekette. Eine solche Zielsequenz kann von 3'-Seite und / oder von 5'- Seite von weiteren Sequenzen flankiert sein. Diese weiteren Sequenzen können beispielsweise Bindungsstellen für Primer oder ihre Anteile umfassen, und / oder Primer-Sequenzen oder ihre Anteile umfassen, und/ oder Bindungsstellen für Detektions-Sonden umfassen, und / oder Adaptor- Sequenzen für komplementäre Bindung an eine feste Phase (z.B. Im Rahmen von Microarrays, oder Bead-basierten Analysen) umfassen und / oder Barcoding-Sequenzen für eine digitale Signatur von Sequenzen umfassen. In another embodiment, the target sequence forms part of the sequence of the nucleic acid chain to be amplified. Such a target sequence may be flanked by 3 ' side and / or 5 ' side of further sequences. These further sequences may include, for example, binding sites for primers or their moieties, and / or comprising primer sequences or their moieties, and / or binding sites for detection probes, and / or adapter sequences for complementary binding to a solid phase (eg, Im Frame of microarrays, or bead-based analyzes) and / or include barcoding sequences for a digital signature of sequences.
Damit die Amplifikation starten kann, muss zu Beginn der Reaktion eine Nukleinsäurekette in das Reaktionsgemisch gegeben werden, welche als initiale Matrize für die Synthese der zu amplifizierenden Nukleinsäurekette auftritt. Diese Nukleinsäurekette wird als Start- Nukleinsäurekette bezeichnet. Diese Start-Nukleinsäurekette gibt die Anordnung einzelner Sequenz-Elemente vor, welche für die Bildung / Synthese / exponentielle Amplifikation einer zu amplifizierenden Nukleinsäurekette von Bedeutung sind. In order for the amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain. This start nucleic acid chain gives the arrangement of individual Sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
In bestimmten Ausführungsformen entspricht die initiale Matrize (Start-Nukleinsäurekette), welche einer Amplifikationsreaktion zu Beginn zugeführt wird, bzw. welche in das Reaktionsgemisch gegeben wird, der Sequenz-Zusammensetzung der zu amplifizierenden Nukleinsäurekette.  In certain embodiments, the initial template (starting nucleic acid chain), which is initially added to an amplification reaction, or which is added to the reaction mixture, corresponds to the sequence composition of the nucleic acid sequence to be amplified.
In anfänglichen Stadien der Amplifikatons-Reaktion und in ihrem weiteren Verlauf binden diejeweiligen Primer an die entsprechenden Bindungsstellen in der Start-Nukleinsäurekette und initiieren die Synthese von spezifischen Primer-Verlängerungsprodukten. Solche spezifischen Primer-Verlängerungsprodukte akkumulieren im Verlauf der Amplifikation in exponentieller Art und Weise und übernehmen zunehmend die Rolle von Matrizen für die Synthese komplementärer Primer-Verlängerungsprodukte bei einer exponentiellen Amplifikation.  In initial stages of the amplification reaction, and in its progression, the respective primers bind to the corresponding binding sites in the starting nucleic acid chain and initiate the synthesis of specific primer extension products. Such specific primer extension products accumulate exponentially in the course of amplification and increasingly assume the role of templates for the synthesis of complementary primer extension products in exponential amplification.
Durch die wiederholten matrizen-abhängigen Synthese- Vorgänge im Rahmen einer exponentiellen Amplifikation wird somit die zu amplifizierende Nukleinsäurekette gebildet.  As a result of the repeated template-dependent synthesis processes in the context of an exponential amplification, the nucleic acid chain to be amplified is thus formed.
Gegen Ende einer Amplifikationsreaktion kann das Hauptprodukt der Reaktion (die zu amplifizierende Nukleinsäure) vorwiegend einzelsträngig sein oder vorwiegend einen komplementären Doppelstrang bilden. Dies kann beispielsweise durch die relative Konzentration von beiden Primern und entsprechende Reaktionsbedingungen bestimmt werden.  Towards the end of an amplification reaction, the major product of the reaction (the nucleic acid to be amplified) may be predominantly single-stranded or predominantly a complementary duplex. This can be determined, for example, by the relative concentration of both primers and corresponding reaction conditions.
Äquivalente der zu amplifizierenden Nukleinsäure umfassen Nukleinsäuren mit im Wesentlichen identischen Informationsgehalt. Beispielsweise haben komplementäre Stränge einer zu amplifizierenden Nukleinsäure identischen Informationsgehalt und können als äquivalent bezeichnet werden.  Equivalents of the nucleic acid to be amplified include nucleic acids having substantially identical information content. For example, complementary strands of a nucleic acid to be amplified have identical information content and can be said to be equivalent.
Allel-Varianten einer Zielsequenz / Polymorpher Lokus einer Zielsequenz (Fig. 12 - 24) Allelic variants of a target sequence / polymorphic locus of a target sequence (FIGS. 12-24)
Eine Zielsequenz (z.B. ein charakteristisches Segment einer DNA oder RNA) kann mehrere in der Natur vorkommende Sequenzvarianten oder künstlich eingeführte Sequenzveränderungen umfassen. Solche Varianten werden häufig Polymorphismen eines Lokus oder Allel-Sequenzen genannt. Weiterhin können diese Varianten einer Zielsequenz spezifische Veränderungen des natürlichen Zustandes der DNA abbilden, welche z.B. durch Mutationen / Mutagenese enstehen und bei Vermehrung einer Zellmasse charakteristische Merkmale eines solchen klonalen Vermehrungvorgangs darstellen (z.B. bei Krebs-Erkrankungen oder bei biotechnologisch verwertbaren Stämmen). Bei einzelnen Allel-Sequenzen einer Zielsequenz kann es sich dabei um Sequenzunterschiede handeln, welche einzelne Nukleotide umfassen (z.B. A-> G oder T->C Substitutionen oder Einzelnukleotid-Insertionen bzw. Deletionen) oder ein Sequenzunterschied kann auch mehrere Nukleotide umfassen (z.B. 2 bis 200 Nukleotide). Dabei kann es sich beispielsweise um Deletionen / Insertionen / Transversionen / Duplikationen etc. handeln. Ein Sequenzsegment umfassend solche Sequenzvarianten einer Zielsequenz wird häufig polymorpher Lokus genannt. Eine Zielsequenz kann einen oder auch mehrere polymorphe Loci umfassen. Die Sequenz-Positionen von einzelnen Allel-Varianten einer Zielsequenz sind in der Regel bekannt und erlauben somit ein Design von sequenzspezifischen Reaktions-Komponenten, z.B. Controller- Oligonukleotide oder von Kombinationen umfassend ein Controller-Oligonukleotid und einen ersten Primer oder ein Controller-Oligonukleotid und einen zweiten Primer. A target sequence (eg a characteristic segment of a DNA or RNA) may comprise several naturally occurring sequence variants or artificially introduced sequence changes. Such variants are often called polymorphisms of a locus or allele sequences. Furthermore, these variants of a target sequence can map specific changes in the natural state of the DNA, which arise, for example, by mutations / mutagenesis and represent characteristic features of such a clonal propagation process (eg in cancer diseases or in biotechnologically exploitable strains). Single allele sequences of a target sequence may be sequence differences comprising single nucleotides (eg A-> G or T-> C substitutions or single nucleotide insertions or deletions) or a sequence difference may also comprise several nucleotides (eg 2 up to 200 nucleotides). These may, for example, be deletions / insertions / transversions / duplications etc. A sequence segment comprising such sequence variants of a target sequence is often called a polymorphic locus. A target sequence may include one or more polymorphic loci. The sequence positions of single allelic variants of a target sequence are generally known and thus allow for design of sequence-specific reaction components, eg, controller oligonucleotides or combinations comprising a controller oligonucleotide and a first primer or a controller oligonucleotide and a second primer.
Die Ausführungsformen von Ziel Sequenzen: The embodiments of target sequences:
In bestimmten Ausführungsformen umfasst eine Zielsequenz, welche mehrere Sequenzvarianten in einem polymorphen Lokus umfassen kann, weiterhin mindestens ein erstes Zielsequenzsegment, welches für alle Zielsequenzvarianten einer Zielsequenz (Zielsequenz- Gruppe) charakteristisch und einheitlich ist. In bestimmten Ausführungsformen umfasst eine Zielsequenz mindestens zwei Zielsequenzsegmente (ein erstes Zielsequenzsegment und ein zweites Zielsequenzsegment, jedes dieser Zielsequenzsegmente für alle Zielsequenzvarianten einer Zielsequenz (Zielsequenz-Gruppe) charakteristisch und einheitlich ist. Solche einheitlichen Zielsequenzsegmente sind vorzugsweise auf beiden Seiten eines polymorphen Lokus lokalisiert und flankieren somit einen polymorphen Lokus (mit Sequenzvarianten) einer Zielsequenz von beiden Seiten. Vorzugsweise unterscheiden sich das erste einheitliche Zielsequenzsegment in seiner Sequenzzusammensetzung von der Sequenzzusammensetzung des zweiten einheitlichen Zielsequenzsegments in mindestens einer Nukleotid-Position.  In certain embodiments, a target sequence, which may include multiple sequence variants in a polymorphic locus, further comprises at least a first target sequence segment that is characteristic and unique to all target sequence variants of a target sequence (target sequence group). In certain embodiments, a target sequence comprises at least two target sequence segments (a first target sequence segment and a second target sequence segment, each target sequence segment is characteristic and uniform to all target sequence variants of a target sequence (target sequence group).) Such uniform target sequence segments are preferably located and flanked on both sides of a polymorphic locus thus, a polymorphic locus (with sequence variants) of a target sequence from both sides Preferably, the first unitary target sequence segment in its sequence composition is different from the sequence composition of the second unitary target sequence segment in at least one nucleotide position.
Die Länge eines polymorphen Lokus einer Zielsequenz kann Bereiche von einem Nukleotid bis zu 200 Nukleotiden, insbesondere von einem Nukleotid bis zu 100 Nukleotiden, insbesondere von einem Nukleotid bis zu 50 Nukleotiden, insbesondere von einem Nukleotid bis zu 20 Nukleotiden umfassen. Die Längen von einem einheitlichen Sequenzsegment (erstes und zweites einheitliches Sequenzsegment) kann zumindest für eines der beiden Segmente folgende Bereiche umfassen: von 6 bis 300 Nukleotiden, insbesondere von 10 bis 200 Nukleotiden, insbesondere von 15 bis 100 Nukleotiden, insbesondere von 20 bis 100 Nukleotiden.  The length of a polymorphic locus of a target sequence may comprise regions of one nucleotide up to 200 nucleotides, in particular from one nucleotide up to 100 nucleotides, in particular from one nucleotide up to 50 nucleotides, in particular from one nucleotide up to 20 nucleotides. The lengths of a unitary sequence segment (first and second unitary sequence segment) may comprise at least for one of the two segments: from 6 to 300 nucleotides, in particular from 10 to 200 nucleotides, in particular from 15 to 100 nucleotides, in particular from 20 to 100 nucleotides ,
In bestimmten Ausführungsformen können einzelne Sequenz-Varianten einer Zielsequenz-Gruppe zusammengefasst werden, wobei solche Varianten mindestens für ein für diese Zielsequenz (Zielsequenz-Gruppe) einheitliches und spezifisches Sequenzsegment definiert sind. Einzelne Sequenzvarianten einer solchen Zielsequenz (Zielsequenz-Gruppe) unterscheiden sich somit durch Sequenz-Segmente des polymorphen Lokus.  In certain embodiments, individual sequence variants of a target sequence group may be grouped together, such variants being defined for at least one unitary and specific sequence segment for that target sequence (target sequence group). Individual sequence variants of such a target sequence (target sequence group) thus differ by sequence segments of the polymorphic locus.
In bestimmten Ausführungsformen können einzelne Sequenz-Varianten einer Zielsequenz-Gruppe zusammengefasst werden, wobei solche Varianten für mindestens zwei für diese Zielsequenz (Zielsequenz-Gruppe) einheitlichen und spezifischen Sequenzsegmente definiert sind. Einzelne Sequenzvarianten einer solchen Zielsequenz (Zielsequenz-Gruppe) unterscheiden sich somit durch Sequenz-Segmente des polymorphen Lokus. Vorzugsweise liegt der polymorphe Lokus zwischen beiden einheitlichen Sequenzsegmenten. In bestimmten Ausführungsformen können zwei unterschiedliche Zielsequenzen in einer Amplifikations-Reaktion jeweils spezifisch amplifiziert werden. In certain embodiments, individual sequence variants of a target sequence group may be grouped together, such variants being defined for at least two unitary and specific sequence segments for that target sequence (target sequence group). Individual sequence variants of such a target sequence (target sequence group) thus differ by sequence segments of the polymorphic locus. Preferably, the polymorphic locus is between both unitary sequence segments. In certain embodiments, two different target sequences can each be specifically amplified in an amplification reaction.
Unterschiedliche Zielsequenzen sind dadurch charakterisiert, dass sie vorzugsweise durch für jede Zielsequenz spezifische und charakteristische Sequenzen untereinander differenzierbar sind. Vorzugsweise sind unterschiedliche Zielsequenzen in ihrer gesamten Länge durch jeweils spezifische und charakteristische Sequenzen differenzierbar und umfassen somit keine Sequenzsegmente, welche für beide Zielsequenzen identisch sind. In bestimmten Ausführungsformen können unterschiedliche Zielsequenzen mindesten ein Sequenzsegment umfassen, welches für mindestens zwei unterschiedliche Zielsequenzen im Wesentlichen ähnlich oder sogar identisch ist. Die Länge eines solchen Sequenzsegmentes beträgt gleich / oder weniger als 19 Nukleotide (gezählt als aneinander gekoppelte Nukleotid-Positionen), insbesondere gleich / oder weniger als 14 Nukleotide (als aneinander gekoppelte Nukleotid-Positionen), insbesondere gleich / oder weniger als 9 Nukleotide (als aneinander gekoppelte Nukleotid-Positionen), insbesondere gleich / oder weniger als 5 Nukleotide (als aneinander gekoppelte Nukleotid- Positionen).  Different target sequences are characterized in that they are preferably differentiable among each other by sequences specific and characteristic of each target sequence. Preferably, different target sequences are differentiable in their entire length by specific and characteristic sequences and thus do not comprise any sequence segments which are identical for both target sequences. In certain embodiments, different target sequences may comprise at least one sequence segment that is substantially similar or even identical for at least two different target sequences. The length of such a sequence segment is equal to or less than 19 nucleotides (counted as coupled nucleotide positions), more preferably equal to or less than 14 nucleotides (as mutually coupled nucleotide positions), more preferably equal to or less than 9 nucleotides (as mutually coupled nucleotide positions), in particular equal to or less than 5 nucleotides (as mutually coupled nucleotide positions).
Die Start-Nukleinsäurekette stellt eine bevorzugte Ausführungsform eines Zielnukleinsäure umfassenden Sequenzsegmentes dar, welches als Produkt einer Primer-Verlängerungs-Reaktion resultieren soll.  The start-up nucleic acid chain is a preferred embodiment of a sequence segment comprising target nucleic acid which is said to result as a product of a primer extension reaction.
Damit die Amplifikation starten kann, muss zu Beginn der Reaktion eine Nukleinsäurekette in das Reaktionsgemisch gegeben werden, welche als initiale Matrize für die Synthese der zu amplifizierenden Nukleinsäurekette auftritt. Diese Nukleinsäurekette wird als Start- Nukleinsäurekette bezeichnet. Diese Start-Nukleinsäurekette gibt die Anordnung einzelner Sequenz-Elemente vor, welche für die Bildung / Synthese / exponentielle Amplifikation einer zu amplifizierenden Nukleinsäurekette von Bedeutung sind.  In order for the amplification to start, a nucleic acid chain must be added to the reaction mixture at the beginning of the reaction, which occurs as an initial template for the synthesis of the nucleic acid chain to be amplified. This nucleic acid chain is called the start nucleic acid chain. This start nucleic acid chain predetermines the arrangement of individual sequence elements which are important for the formation / synthesis / exponential amplification of a nucleic acid chain to be amplified.
Eine solche Start-Nukleinsäurekette kann einzelsträngig oder doppelsträngig zu Beginn der Reaktion vorliegen. Wenn die komplementären Stränge der Start-Nukleinsäurekette voneinander getrennt sind, können die Stränge unabhängig davon, ob die Nukleinsäure ursprünglich doppel- oder einzelsträngig vorlag, als Matrize für die Synthese von spezifischen komplementären Primer- Verlängerungsprodukten dienen.  Such a starting nucleic acid chain can be present in single-stranded or double-stranded form at the beginning of the reaction. When the complementary strands of the starting nucleic acid chain are separated, regardless of whether the nucleic acid was originally double- or single-stranded, the strands can serve as a template for the synthesis of specific complementary primer extension products.
Die Start-Nukleinsäurekette umfasst in bestimmten Ausführungsformen eine Zielsequenz oder ihre Teil-Segmente, welche zumindest eine zu erwartende Sequenz- Variante eines polymorphen Lokus der Zielsequenz umfassen.  The starting nucleic acid chain, in certain embodiments, comprises a target sequence or its partial segments which comprise at least one expected sequence variant of a polymorphic locus of the target sequence.
Eine Start-Nukleinsäure umfasst weiterhin zumindest ein vorwiegend einzelsträngiges Sequenzsegment, zu welchem mindestens eines der Primer des Amplifikations-Systems mit seinem 3'-Segment vorwiegend komplementär binden kann, so dass die verwendete Polymerase einen solchen Primer, wenn hybridisiert an die Start-Nukleinsäurekette, matrizenspezifisch unter Einbau von dNTPs verlängern kann. Eine Start-Nukleinsäurekette umfasst in bestimmten Ausführungsformen eine Zielsequenz oder ihre Teil-Segmente, welche zumindest eine zu erwartende Sequenz-Variante eines polymorphen Lokus der Zielsequenz und mindestens ein einheitliches Sequenzsegment einer Zielsequenz umfassen. A start nucleic acid further comprises at least one predominantly single-stranded sequence segment to which at least one of the primers of the amplification system can bind predominantly complementary to its 3 ' segment, so that the polymerase used such a primer, when hybridized to the starting nucleic acid chain, may extend template-specific incorporation of dNTPs. A starting nucleic acid sequence in certain embodiments comprises a target sequence or its partial segments comprising at least one expected sequence variant of a polymorphic locus of the target sequence and at least one uniform sequence segment of a target sequence.
Eine Start-Nukleinsäurekette umfasst in bestimmten Ausführungsformen eine Zielsequenz oder ihre Teil-Segmente, welche zumindest eine zu erwartende Sequenz-Variante eines polymorphen Lokus der Zielsequenz und mindestens zwei einheitliche Sequenzsegmente einer Zielsequenz umfassen, wobei einheitliche Sequenzsegmente einer Zielsequenz den polymorphen Lokus mit möglichen Sequenzvarianten auf beiden Seiten flankieren.  A starting nucleic acid sequence in certain embodiments comprises a target sequence or its partial segments comprising at least one expected sequence variant of a polymorphic locus of the target sequence and at least two unitary sequence segments of a target sequence, wherein uniform sequence segments of a target sequence comprise the polymorphic locus with possible sequence variants Flank both sides.
Controller-Oligonukleotid/Controller: Controller oligonucleotide / Controller:
Das Controller-Oligonukleotid ist eine einzelsträngige Nukleinsäurekette, welche eine vordefinierte im Wesentlichen komplementäre Sequenz in einem Teil des Primer- Verlängerungsprodukts einschließt, welches im Rahmen der Amplifikation der zu amplifizierenden Nukleinsäure spezifisch generiert wird. Dadurch kann das Controller-Oligonukleotid an das Primer-Oligonukleotid und mindestens an das 5'-Segment des spezifischen Verlängerungsprodukts des Primer- Oligonukleotids im Wesentlichen komplementär binden. Das Controller-Oligonukleotid umfasst in seinem inneren Sequenzsegment in bestimmten Ausführungsformen Nukleotid-Modifikationen, welche die Polymerase daran hindern, einen komplementären Strang unter Verwendung des Controller-Oligonukleotides als Matrize zu synthetisieren, wenn das Primer-Oligonukleotid an das Controller-Oligonukleotid komplementär gebunden ist. The controller oligonucleotide is a single-stranded nucleic acid chain that includes a predefined, substantially complementary sequence in a portion of the primer extension product that is specifically generated as part of the amplification of the nucleic acid to be amplified. This allows the controller oligonucleotide to bind substantially complementary to the primer oligonucleotide and at least to the 5 ' segment of the specific extension product of the primer oligonucleotide. The controller oligonucleotide in its interior sequence segment, in certain embodiments, comprises nucleotide modifications that prevent the polymerase from synthesizing a complementary strand using the controller oligonucleotide as a template when the primer oligonucleotide is complementarily bound to the controller oligonucleotide.
In bestimmten Ausführungsformen wird bei der Primer-Verlängerungsreaktion identischer Controller verwendet, wie bei der nachfolgenden Säure-Reaktion.  In certain embodiments, identical controllers are used in the primer extension reaction as in the subsequent acid reaction.
In bestimmten Ausführungsformen wird bei der Primer-Verlängerungsreaktion ein Controller verwendet, welcher sich von dem in der nachfolgenden Säure- Reaktion unterscheidet.  In certain embodiments, the primer extension reaction uses a controller that differs from that in the subsequent acid reaction.
Das Zielsequenz-spezifische Controller-Oligonukleotid wird vorzugsweise dermaßen konstruiert, dass es in der Lage ist, bei Amplifikation von bevorzugt einer definierten spezifischen Sequenz- Variante einer vordefinierten Zielsequenz mitzuwirken.  The target sequence-specific controller oligonucleotide is preferably constructed such that it is capable of participating in amplification of preferably a defined specific sequence variant of a predefined target sequence.
Das Allel-spezifische Controller-Oligonukleotid wird vorzugsweise dermaßen konstruiert, dass es in der Lage ist, die Amplifikation einer spezifischen Sequenz-Variante einer Zielsequenz (z.B. Allel 1 ) bevorzugt zu bewirken, wobei bei einer anderen Sequenz-Variante der gleichen Zielsequenz (z.B. Allel 2) die Amplifikation mit verminderter Effizient verläuft bzw. in der vorgegebener Zeit gar nicht stattfindet, bzw. in einer nicht für eine Detektion hinreichende Ausbeute an Amplifikationsprodukten resultiert. Somit ergeben sich messbare Unterschiede im Verlauf einer Amplifikations-Reaktion, welche davon abhängen, ob die Sequenz eines für eine Allel-Variante spezifischen Controller-Oligonukleotid mit der Sequenz einer zu Beginn der Reaktion bereitgestellten Nukleinsäurekette, welche als Start-Nukleinsäure dient und die Zielsequenz mit einem polymorphen Lokus umfasst, spezifisch übereinstimmt oder nicht. Bei Übereinstimmung bzw. perfekt-match Komplementarität zwischen der Sequenzzusammensetzung des polymorphen Lokus einer Start-Nukleinsäurekette und einem korrespondierenden Sequenzsegment im Controller-Oligonukleotid erfolgt eine spezifische charakteristische Amplifikation. Bei fehlender Übereinstimmung bzw. mismatch Komplementarität zwischen der Sequenzzusammensetzung des polymorphen Lokus einer Start-Nukleinsäurekette und einem korrespondierenden Sequenzsegment im Controller-Oligonukleotid verläuft die Amplifikation anders als eine spezifische charakteristische Amplifikation. The allele-specific controller oligonucleotide is preferably constructed such that it is capable of preferentially effecting the amplification of a specific sequence variant of a target sequence (eg, allele 1), with another sequence variant of the same target sequence (eg, allele 2) the amplification proceeds with reduced efficiency or does not take place in the given time, or results in a yield of amplification products which is insufficient for a detection. Thus, there are measurable differences in the course of an amplification reaction, which depend on whether the sequence of an allele variant specific controller oligonucleotide with the sequence of a provided at the beginning of the reaction nucleic acid chain, which serves as a start nucleic acid and the target sequence a polymorphic locus, specifically coincident or not. If there is agreement or perfect-match complementarity between the sequence composition of the polymorphic locus of a starting nucleic acid chain and a corresponding sequence segment in the controller oligonucleotide, a specific characteristic amplification takes place. In the absence of mismatch complementarity between the sequence composition of the polymorphic locus of a starting nucleic acid chain and a corresponding sequence segment in the controller oligonucleotide, the amplification proceeds differently than a specific characteristic amplification.
Ein Allel-spezifisches Controller-Oligonukleotid wird somit nicht nur zielsequenzspezifisch, sonder auch Allel-spezifisch bereitgestellt. Je nach Komplexität eines polymorphen Lokus einer Zielsequenz können somit mehrere, für jeweilige Allel-Varianten einer Zielsequenz spezifische Controller-Oligonukleotide konstruiert werden.  An allele-specific controller oligonucleotide is thus not only provided target-specific, but also allele-specific. Thus, depending on the complexity of a polymorphic locus of a target sequence, multiple controller oligonucleotides specific for respective allelic variants of a target sequence can be constructed.
Vorzugsweise umfasst ein Controller-Oligonukleotid mindestens ein Sequenzsegment, welches eine zu einer spezifischen Allel-Variante einer Zielsequenz komplementäre Sequenzzusammensetzung aufweist. Weiterhin umfasst ein Controller-Oligonukleotid vorzugsweise mindestens ein Sequenzsegment, welches eine für alle Sequenzvarianten einer Zielsequenz einheitliche komplementäre Sequenz umfasst. In bestimmten Ausführungsformen umfasst ein Controller-Oligonukleotid mindestens ein Sequenzsegment, welches komplementär an eine Variante eines polymorphen Lokus einer Zielsequenz komplementär binden kann.  Preferably, a controller oligonucleotide comprises at least one sequence segment having a sequence composition complementary to a specific allelic variant of a target sequence. Furthermore, a controller oligonucleotide preferably comprises at least one sequence segment which comprises a complementary sequence which is identical for all sequence variants of a target sequence. In certain embodiments, a controller oligonucleotide comprises at least one sequence segment capable of complementarily binding to a variant of a polymorphic locus of a target sequence.
In bestimmten Ausführungsformen werden mehrere Controller-Oligonukleotide bereitgestellt, welche jeweils Allel-spezifische Sequenzsegmente umfassen.  In certain embodiments, multiple controller oligonucleotides are provided, each comprising allele-specific sequence segments.
Die Länge eines zum polymorphen Lokus einer Start-Nukleinsäureke komplementären Sequenzsegmentes eines Controller-Oligonukleotide kann Bereiche von einem Nukleotid bis zu 100 Nukleotiden, insbesondere von einem Nukleotid bis zu 50 Nukleotiden, insbesondere von einem Nukleotid bis zu 20 Nukleotiden umfassen. Die Länge von mindestens einem Sequenzsegment eines Controller-Oligonukleotides, welches zu einheitlichen Sequenzsegmenten einer Zielsequenz (erstes und zweite einheitliches Sequenzsegment einer Start-Nukleinsäure) komplementär ist, kann folgende Bereiche umfassen: von 4 bis 100 Nukleotide, insbesondere von 6 bis 100 Nukleotide, insbesondere von 8 bis 50 Nukleotide.  The length of a sequence segment of a controller oligonucleotide complementary to the polymorphic locus of a starting nucleic acid nucleus can comprise regions of one nucleotide up to 100 nucleotides, in particular from one nucleotide up to 50 nucleotides, in particular from one nucleotide up to 20 nucleotides. The length of at least one sequence segment of a controller oligonucleotide which is complementary to uniform sequence segments of a target sequence (first and second unit sequence segment of a starting nucleic acid) may comprise the following ranges: from 4 to 100 nucleotides, in particular from 6 to 100 nucleotides, in particular from 8 to 50 nucleotides.
In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, im dritten Bereich des Controller-Oligonukleotides lokalisiert.  In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, im zweiten Bereich des Controller-Oligonukleotides lokalisiert.  In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the second region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, teilweise und / oder vollständig im zweiten und im dritten Bereich des Controller- Oligonukleotides lokalisiert. In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence becomes is partially and / or completely localized in the second and third regions of the controller oligonucleotide.
Die Ausbildung von Basenpaaren unter zwei Nukleinsäuresträngen kann im Wesentlichen komplementär erfolgen, das bedeutet, dass zwischen 70% und 100%, insbesondere zwischen 90% und 100%, insbesondere zwischen 95% und 100% von Nukleotiden eines Stranges komplementär aneinander binden können. Bespielsweise kann eine Nukleotid-Position in einem Strang von 20 Nukleotiden keine komplementäre Bindung aufweisen, das entspricht 95% Komplementarität. The formation of base pairs under two nucleic acid strands can be carried out essentially complementary, which means that between 70% and 100%, in particular between 90% and 100%, in particular between 95% and 100% of nucleotides of a strand can complement each other in a complementary manner. For example, a nucleotide position in a strand of 20 nucleotides may not have a complementary bond, which corresponds to 95% complementarity.
Bei Perfekt-Match-Bindung von zwei Sequenzen erfolgt vorzugsweise die Ausbildung von komplementären Basenpaarungen zu 100% zwischen beiden Strängen einer Duplex. Eine perfekt- match Duplex umfasst somit keinen Mismatch zwischen den Strängen. In the case of perfect match binding of two sequences, the formation of complementary base pairings is preferably 100% between both strands of a duplex. A perfect-match duplex thus does not include a mismatch between the strands.
Allgemeine Strukturmerkmale eines Controller-Oligonukleotid/Primer-Systems (Feedback- System) und eines Primer-Matrize-Systems (Synthesesystem). General structural features of a controller oligonucleotide / primer system (feedback system) and a primer-template system (synthesis system).
Die Controller-Oligonukleotide dienen vorzugsweise nicht als Matrizen für Primer-Verlängerung. Die Verlängerung von korrespondierenden Primern an Controller-Oligonukleotiden wird vorzugsweise durch eine Modifikation von Controller-Strängen verhindert. Das Controller- Oligonukleotid ist in der Lage, an einen Überhang am Primer zu binden (der erster Bereich des Controller-Oligonukleotides bindet vorzugsweise spezifisch an den zweiten Bereich des entsprechenden Primers) und kann mit dem Primer eine komplementäre Bindung eingehen (der zweiter Bereich des Controller-Oligonukleotids bindet an den ersten Bereich des Primers). Weiter kann der Controller mit seinem dritten Bereich an den synthetisierten Anteil des Primerverlängerungsproduktes vorwiegend sequenzspezifisch binden.  The controller oligonucleotides preferably do not serve as templates for primer extension. The extension of corresponding primers to controller oligonucleotides is preferably prevented by a modification of controller strands. The controller oligonucleotide is capable of binding to an overhang on the primer (the first region of the controller oligonucleotide preferably specifically binds to the second region of the corresponding primer) and is capable of complementary binding with the primer (the second region of the controller Oligonucleotide binds to the first region of the primer). Furthermore, the controller can bind with its third region to the synthesized portion of the primer extension product predominantly sequence-specific.
In einer besonderen Ausführungsform haben die verwendeten Primer einen Schwanz bzw. Überhang, welcher mit der Matrize keinen stabilen Doppelstrang bildet kann (der Primerüberhang verbleibt bei einer Primerbindung an die Primer-Bindungsstelle der Matrize vollständig oder teilweise frei) und damit für die Interaktion mit dem ersten Bereich des Controller-Oligonukleotides zur Verfügung steht. Dieser Primerüberhang dient als Bindungsstelle für jeweils einen spezifischen Controller-Oligonukleotidstrang (erster Bereich des Controller-Oligonukleotides). Das Controller- Oligonukleotid bindet an diesen Überhang und wird damit in eine räumliche Nähe mit dem Doppelstrang gebracht. Damit werden die Voraussetzungen geschaffen, bei welchen das Controller-Oligonukleotid eine Doppelstrang-Invasion unter Bildung eines komplementären Doppelstranges eingehen kann (dieser Vorgang wird auch als branch migration bezeichnet oder sequenzabhängige Strang-Verdrängung). Die Stranginvasion erfolgt unter Bildung eines neuen Doppelstranges zwischen einem Controller-Oligonukleotid und dem korrespondierenden Strang der synthetisierten Amplifikationsfragmente. Aufgrund einer starken Sequenzabhängigkeit einer solchen Doppelstrangbildung erfolgt die Öffnung der synthetisierten Doppelstränge mit hoher Abhängigkeit von der Sequenzübereinstimmung mit der jeweiligen Controller-Sequenz. In einer besonderen Ausführungsform haben die Primer einen Schwanz bzw. Überhang, welcher nicht von einer Polymerase kopiert wird. Die Polymerase wird durch entsprechende Primer- Modifikationen am Kopieren des Überhangs gehindert. In a particular embodiment, the primers used have a tail or overhang which can not form a stable duplex with the template (the primer overhang remains completely or partially free upon primer binding to the primer binding site of the template) and thus interacts with the first Area of the controller oligonucleotide is available. This primer overhang serves as a binding site for each specific controller oligonucleotide strand (first region of the controller oligonucleotide). The controller oligonucleotide binds to this overhang and is thus brought into spatial proximity with the duplex. This creates the conditions in which the controller oligonucleotide can undergo double-stranded invasion to form a complementary double strand (this process is also referred to as branch migration or sequence-dependent strand displacement). Strand invasion occurs to form a new double strand between a controller oligonucleotide and the corresponding strand of synthesized amplification fragments. Due to a strong sequence dependence of such a double strand formation, the opening of the synthesized double strands is highly dependent on the sequence match with the respective controller sequence. In a particular embodiment, the primers have a tail or overhang which is not copied by a polymerase. The polymerase is prevented from copying the overhang by appropriate primer modifications.
Primer- Verlängerungs-System: Primer extension system:
Ein Primer-Verlängerungs-System umfasst mindestens ein Zielsequenz-spezifisches Controller- Oligonukleotid und mindestens ein erstes Primer-Oligonukleotid sowie mindestens eine matrizenabhängige Polymerase, welche in der Lage ist, unter Verwendung einer Matrize, welche mindestens eine charakteristische Zielsequenz oder Zielsequenz-Variante umfasst, unter geeigneten Reaktionsbedingungen eine vorwiegend spezifische Amplifikation der zu amplifizierenden Nukleinsäurekette zu unterstützen, wobei vorwiegend Zielsequenz-spezifische erste Primer-Verlängerungsprodukte synthetisiert werden.  A primer extension system comprises at least one target sequence-specific controller oligonucleotide and at least one first primer oligonucleotide and at least one template-dependent polymerase capable of using a template comprising at least one characteristic target sequence or target sequence variant, Under suitable reaction conditions, to support a predominantly specific amplification of the nucleic acid chain to be amplified, whereby predominantly target sequence-specific first primer extension products are synthesized.
Ein Allel-spezifisches Primer-Verlängerungs-System umfasst mindestens ein Allel-spezifisches Controller-Oligonukleotid und mindestens ein erstes Primer-Oligonukleotid (wobei Primer können je nach Design zielsequenzspezifisch und / oder allel-spezifisch sein), sowie mindestens eine matrizenabhängige Polymerase, welche in der Lage ist, unter Verwendung einer Matrize, welche mindestens eine Zielsequenz-Variante umfasst, unter geeigneten Reaktionsbedingungen eine vorwiegend spezifische Amplifikation der Zielsequenz-Variante (ein Allel) der zu amplifizierenden Nukleinsäurekette zu unterstützen, wobei vorwiegend spezifische erste Primer- Verlängerungsprodukte synthetisiert werden.  An allele-specific primer extension system comprises at least one allele-specific controller oligonucleotide and at least one first primer oligonucleotide (where primers may be target sequence specific and / or allelic specific), as well as at least one template-dependent polymerase which is in is able, using a template which comprises at least one target sequence variant, under suitable reaction conditions, to support a predominantly specific amplification of the target sequence variant (one allele) of the nucleic acid chain to be amplified, wherein predominantly specific first primer extension products are synthesized.
Ein Primer-Verlängerungs-System kann mehrere Allel-spezifische Primer-Verlängerungs-Produkte umfassen, wobei jedes Allel-spezifische Primer-Verlängerungs-System bevorzugt mindestens eine der Zielsequenz-Varianten kopiert.  A primer extension system may comprise multiple allele-specific primer extension products, wherein each allele-specific primer extension system preferably copies at least one of the target sequence variants.
Strangverdrängung (Strand Displacement): Strand displacement (Strand Displacement):
Hiermit wird ein Vorgang bezeichnet, welcher durch Einwirkung eines geeigneten Mittels zu einer vollständigen oder partiellen Trennung eines ersten Doppelstranges (bestehend beispielsweise aus A1 und B1 -Strang) führt, und zur gleichzeitigen / parallelen Ausbildung eines neuen zweiten Doppelstranges, wobei mindestens einer der Stränge (A1 oder B1 ) an der Ausbildung dieses neuen zweiten Stranges beteiligt sind. Man kann hier zwei Formen der Strangverdrängung unterschieden.  This is a process which, by the action of a suitable agent, leads to a complete or partial separation of a first double strand (consisting for example of A1 and B1 strand) and for the simultaneous / parallel formation of a new second double strand, wherein at least one of the strands ( A1 or B1) are involved in the formation of this new second strand. One can distinguish two forms of strand displacement here.
In einer ersten Form der Strangverdrängung kann die Ausbildung eines neuen zweiten Doppelstranges unter Verwendung eines bereits existierenden komplementären Stranges erfolgen, welcher zu Beginn der Reaktion im Allgemeinen in einzelsträngiger Form vorliegt. Dabei wirkt das Mittel der Strangverdrängung (beispielsweise ein vorgebildeter einzelsträngiger Strang C1 , welcher eine komplementäre Sequenz zum Strang A1 aufweist), auf den ersten bereits ausgebildeten Doppelstrang (A1 und B1 ) und geht mit dem Strang A1 eine komplementäre Bindung ein, wodurch der Strang B1 aus der Bindung mit dem Strang A1 verdrängt wird. Falls die Verdrängung des B1 vollständig abläuft, so ist das Ergebnis der C1 -Wirkung ein neuer Doppelstrang (A1 :C1 ) und ein einzelsträngiger Strang B1 . Falls die Verdrängung von B1 unvollständig abläuft, so hängt das Ergebnis von mehreren Faktoren ab. Beispielsweise kann ein Komplex aus partiell doppelsträngigen A1 :B1 und A1 :C1 als Zwischenprodukt vorliegen. In a first form of strand displacement, the formation of a new second duplex may be accomplished using an already existing complementary strand which is generally in single-stranded form at the beginning of the reaction. In this case, the means of strand displacement (for example, a preformed single-stranded strand C1, which has a complementary sequence to the strand A1) acts on the first already formed double strand (A1 and B1) and goes with the strand A1 a complementary Binding, whereby the strand B1 is displaced from the bond with the strand A1. If the displacement of B1 is complete, the result of the C1 action is a new duplex (A1: C1) and a single-stranded strand B1. If the displacement of B1 is incomplete, the result depends on several factors. For example, a complex of partially double-stranded A1: B1 and A1: C1 may be present as an intermediate.
In einer zweiten Form der Strangverdrängung kann die Ausbildung eines neuen zweiten Doppelstranges unter einer gleichzeitig ablaufenden enzymatischen Synthese des komplementären Stranges erfolgen, wobei ein Strang des ersten vorgebildeten Doppelstranges als Matrize für die Synthese durch die Polymerase auftritt. Dabei wirkt das Mittel der Strangverdrängung (beispielsweise Polymerase mit einer Strangverdrängungs-Fähigkeit), auf den ersten bereits vorgebildeten Doppelstrang (A1 und B1 ) und synthetisiert einen zu Strang A1 neuen komplementären Strang D1 , wobei gleichzeitig der Strang B1 aus der Bindung mit dem Strang A1 verdrängt wird.  In a second form of strand displacement, the formation of a new second duplex may occur under concurrent enzymatic synthesis of the complementary strand, with one strand of the first preformed duplex appearing as a template for synthesis by the polymerase. In this case, the means of strand displacement (for example polymerase with a strand displacement ability) acts on the first already preformed double strand (A1 and B1) and synthesizes a new strand D1 complementary strand D1, wherein at the same time the strand B1 from the bond with the strand A1 is displaced.
Unter dem Begriff „nukleinsäurevermittelte Strang-Verdrängung" wird eine Summe / Reihe von Zwischenschritten zusammengefasst, welche untereinander im Gleichgewicht stehen können und im Ergebnis zur vorübergehenden oder dauerhaften Öffnung einer ersten vorgeformten Duplex (bestehend aus komplementären Strängen A1 und B1 ) und Ausbildung einer neuen zweiten Duplex (bestehend aus komplementären Strängen A1 und C1 ) führen, wobei A1 und C1 einander komplementär sind.  By the term "nucleic acid mediated strand displacement" is meant a sum / series of intermediate steps which can be in equilibrium with one another and, as a result, the temporary or permanent opening of a first preformed duplex (consisting of complementary strands A1 and B1) and a new second one Duplex (consisting of complementary strands A1 and C1) lead, where A1 and C1 are complementary to each other.
Es ist bekannt, dass eine wesentliche strukturelle Voraussetzung für die Initiierung einer Strangverdrängung die Herbeiführung einer räumlichen Nähe zwischen einem Duplex-Ende (vorgeformter erster Duplex aus A1 und B1 ) und einem einzelsträngigen Strang (C1 ) ist, welcher die Strangverdrängung initiiert (wobei A1 und C1 einen komplementären Strang bilden können). Eine solche räumliche Nähe kann vorzugsweise mittels eines einzelsträngigen Überhanges (in der Literatur sind Beispiele mit kurzen Überhängen bekannt, im Englischen genannt "Toehold",) herbeigeführt werden, welcher den einzelsträngigen Strang (C1 ) vorübergehend oder dauerhaft komplementär bindet, und somit komplementäre Segmente des Stranges C1 und A1 in hinreichende Nähe bringt, so dass eine erfolgreiche Strangverdrängung des Stranges B1 initiiert werden kann. Die Effizienz der Initiierung der nukleinsäurevermittelten Strang-Verdrängung ist im Allgemeinen um so höher, je näher die komplementären Segmente des Stranges A1 und C1 zueinander positioniert werden.  It is known that an essential structural prerequisite for the initiation of strand displacement is the creation of a spatial proximity between a duplex end (preformed first duplex of A1 and B1) and a single stranded strand (C1) which initiates strand displacement (where A1 and C1 can form a complementary strand). Such spatial proximity can preferably be achieved by means of a single-stranded overhang (in the literature examples are known with short overhangs, which binds the single-stranded strand (C1) temporarily or permanently complementary, and thus complementary segments of the Stranges C1 and A1 in sufficiently close, so that a successful strand displacement of the strand B1 can be initiated. The efficiency of initiation of nucleic acid-mediated strand displacement is generally greater the closer the complementary segments of strand A1 and C1 are positioned to each other.
Eine weitere wesentliche strukturelle Voraussetzung für die effiziente Fortführung einer nukleinsäurevermittelten Strangverdrängung in inneren Segmenten liegt in hoher Komplementarität zwischen Strängen (z.B. zwischen A1 und C1 ), welche einen neuen Doppelstrang ausbilden müssen. So können beispielsweise einzelne Nukleiotid-Mutationen (in C1 ) zur Unterbrechung einer Strangverdrängung (beschrieben z.B. für Branch-Migration) führen. Die vorliegende Erfindung macht Gebrauch von der Fähigkeit komplementärer Nukleinsäuren zu einer sequenzabhängigen nukleinsäurevermittelten Strangverdrängung. Another essential structural prerequisite for the efficient continuation of nucleic acid-mediated strand displacement in internal segments is the high complementarity between strands (eg, between A1 and C1), which must form a new double strand. For example, single nucleotide mutations (in C1) can lead to disruption of strand displacement (described, for example, for branch migration). The present invention makes use of the ability of complementary nucleic acids to sequence-dependent nucleic acid-mediated strand displacement.
Ausführungsformen für das Zusammenwirken von einzelnen Komponenten bei Primer- Verlängerungsreaktionen Embodiments for the interaction of individual components in primer extension reactions
Synthese des Primer-Verlängerungsproduktes und Interaktion mit dem Controller in vorwiegend sequenzieller Reihenfolge: Synthesis of the primer extension product and interaction with the controller in a predominantly sequential order:
Die technische Aufgabe dieser Ausführungsform besteht in der Synthese eines Primer- Verlängerungsproduktes und einer anschließenden Trennung des Primer- Verlängerungsproduktes von seiner Matrize. Die Trennung des Primer-Verlängerungsprodukts erfolgt unter Mitwirkung eines Controller-Oligonukleotides und ist somit vorzugsweise sequenzspezifisch.  The technical problem of this embodiment is the synthesis of a primer extension product and subsequent separation of the primer extension product from its template. The separation of the primer extension product takes place with the assistance of a controller oligonucleotide and is thus preferably sequence-specific.
Die Synthese des Primer-Verlängerungsproduktes und die Überprüfung mittels eines Controller- Oligonukleotides erfolgt zwar vorzugsweise im gleichen Ansatz (homogener Assay), wobei die einzelnen Reaktionen allerdings zeitlich getrennt sind. Zunächst erfolgt die Synthese des P1-Ext (Synthese-Phase) (Fig. 3) und anschließend erfolgt die Öffnung des Doppelstranges mittels eines Controllers (Controlling-Phase) (Fig. 4). Die beiden Phasen können beispielsweise durch Änderung der Reaktions-Temperatur des Reaktionsansatzes in eine gewünschte Abfolge gebraucht werden (bei homogenem Assay) oder durch sequenzielle Zugabe auch als heterogenes Format.  Although the synthesis of the primer extension product and the checking by means of a controller oligonucleotide preferably takes place in the same batch (homogeneous assay), the individual reactions are temporally separated. First, the synthesis of the P1-Ext (synthesis phase) takes place (FIG. 3) and then the double strand is opened by means of a controller (controlling phase) (FIG. 4). The two phases can be used for example by changing the reaction temperature of the reaction mixture in a desired sequence (in a homogeneous assay) or by sequential addition as a heterogeneous format.
Gleichzeitige Präsenz von einem ersten Primer und einem Controller in einem Ansatz in Anwesenheit eines Primer-Verlängerung-katalysierenden Agentes (einer Polymrease) und geeigneten Substraten erfordert die Verwendung eines dahingehend modifizierten Controllers, dass der erste Primer, wenn hybridisiert an das Controller-Oligonukleotid, nicht von einer Polymerase verlängert wird.  Simultaneous presence of a first primer and a controller in one approach in the presence of a primer extension catalyzing agent (a polymrease) and suitable substrates requires the use of a modified controller such that the first primer, when hybridized to the controller oligonucleotide, is not is extended by a polymerase.
Im Folgenden wird eine bevorzugte Form beschrieben mit homogenem Format, bei welchem mindestens ein Matrizenstrang, mindestens ein Controller-Oligonukleotid, mindestens ein Primer- Oligonukleotid, mindestens eine Polymerase und dNTPs als Substrate in einem geeigneten Puffer- System zu Beginn der Reaktion vorliegen.  In the following, a preferred form is described with a homogeneous format in which at least one template strand, at least one controller oligonucleotide, at least one primer oligonucleotide, at least one polymerase and dNTPs are present as substrates in a suitable buffer system at the beginning of the reaction.
Synthese-Phase: Synthesis phase:
Das Ziel der Synthese-Phase ist es, ein spezifisches Primer-Verlängerungsprodukt mittels einer durch eine Polymerase vermittelten Synthese unter Verwendung eines geeigneten Matrizenstranges zu synthetisieren.  The goal of the synthesis phase is to synthesize a specific primer extension product by means of a polymerase-mediated synthesis using a suitable template strand.
Eine Primer-Verlängerungs-Reaktion umfasst eine vorzugsweise spezifische Primerbindung A primer extension reaction comprises a preferably specific primer binding
(erster Bereich des Primer-Oligonukleotides) an den Matrizenstrang an einer geeigneten Primer-(first region of the primer oligonucleotide) to the template strand on a suitable primer
Bindungsstelle (Sequenzsegment, welches in der Lage ist, vorwiegend komplementär zum ersten Bereich des Primer-Oligonukleotides zu binden), wobei der zweite Bereich des Primers (Primer- Überhang) bevorzugt nicht an den Matrizenstrang bindet, und somit für eine spätere Interaktion mit dem Controller zur Verfügung steht. Die Primer-Bindungsstelle kann vollständig einzelsträngig oder partiell einzelsträngig sein, so dass zumindest ein Teil des ersten Bereichs des Primers vorwiegend sequenzspezifisch an die Primer-Bindungsstelle via Ausbildung komplementärer Basenpaare (Watson-Crick-Regel) binden kann. Binding site (sequence segment capable of being predominantly complementary to the first Area of the primer oligonucleotide), wherein the second area of the primer (primer overhang) preferably does not bind to the template strand, and thus is available for later interaction with the controller. The primer binding site can be completely single-stranded or partially single-stranded, so that at least a portion of the first region of the primer can bind sequence-specifically to the primer binding site via complementary base pairs (Watson-Crick rule).
Die Polymerase kann nun die an die Primer-Bindungsstelle gebundenen Primer-Oligonukleotide in einer matrizenabhängigen Synthese unter Anküpfung von komplementären Nukleotiden in den wachsenden Strang des Primers (3'-OH Ende) verlängern, dabei entsteht ein zum Matrizenstrang komplementäres Primer- Verlängerungsprodukt (P1-Ext). Die Synthese des komplementären Stranges erfolgt unter geeigneten Reaktionsbedinungen in der Regel solange bis die Polymerase genügend Substrat im Ansatz vorfindet und bis genügende Sequenzsegmente im Matrizenstrang in geeigneter Form für die Polymerase als Matrize zur Verfügung stehen. Je nach Polymerase kann dabei eine der Bedingungen an die Sequenzsegmente sein, dass der Matrizenstrang einzelsträngig ist (unter Verwendung von Polymerasen ohne Strang-Verdrängungseigenschaften) oder auch partiell oder gar vollständig doppelstängig sein (unter Verwendung von Polymerasen mit Strang-Verdrängungseigenschaften). Die Synthese erfolgt häufig unter über die hinreichende Zeit, so dass aus mehr als 5%, insbesondere mehr als 50%, insbesondere mehr als 90% der Matrizenstränge ein Primer-Verlängerungsprodukt synthetisiert werden kann. The polymerase can now extend the bound to the primer binding site primer oligonucleotides in a template-dependent synthesis of complementary Anküpfung nucleotides into the growing strand of the primer (3 'end-OH), thereby creating a template strand complementary to the primer extension product (P1 ext). The synthesis of the complementary strand usually takes place under suitable reaction conditions until the polymerase finds enough substrate in the batch and sufficient sequence segments in the template strand are available in suitable form for the polymerase as template. Depending on the polymerase may be one of the conditions of the sequence segments that the template strand is single-stranded (using polymerases without strand displacement properties) or even partially or even completely double-stranded (using polymerases with strand displacement properties). The synthesis is often carried out over the sufficient time, so that from more than 5%, in particular more than 50%, in particular more than 90% of the template strands a primer extension product can be synthesized.
Unmittelbar nach der Synthese liegt das Primer- Verlängerungsprodukt (P1 -Ext) im Komplex mit dem Matrizenstrang in doppelsträngiger Form vor (P1-Ext / Matrizenstrang-Komplex). Dieser doppelsträngige Komplex umfassend P1 -Ext und Matrizenstrang ist vorzugsweise unter gewählten Reaktionsbedingungen der Primer-Verlängerungsphase stabil und kann nicht spontan in seine Bestandteile dissoziieren, oder diese spontane Dissoziation erfolgt sehr langsam und kann dadurch vernachlässigt werden.  Immediately after the synthesis, the primer extension product (P1-ext) is present in complex with the template strand in double-stranded form (P1-Ext / template strand complex). This double-stranded complex comprising P1 -ext and template strand is preferably stable under selected reaction conditions of the primer extension phase and can not spontaneously dissociate into its constituents, or this spontaneous dissociation occurs very slowly and can thereby be neglected.
In bestimmten Ausführungsformen erfolgt die Primer-Bindung unter Reaktionsbedingungen, welche eine thermodynamisch stabile Bindung des ersten Bereichs des Primer-Oligonukleotids an die entsprechende komplementäre Position in der Matrize zulassen. Solche Bedingungen liegen beispielsweise bei Reaktionstemperaturen vor, welche deutlich unter der Schmelztemperatur (Tm) eines solchen Komplexes (P1 / Matrizen-Strang) liegen. Die Tm soll dabei unter gleichen Pufferbedingungen gemessen worden sein. Beispielsweise können die Reaktionstemperaturen im Bereich von Tm minus 50 °C bis Tm minus 5 °C liegen. Bei hinreichender Komplementarität des 3'-Segmentes des Primers mit der Matrize erfolgt die Verlängerung des Primers durch eine Polymerase in der Regel schnell und problemlos, wenn die Reaktionsbedingungen auch für die Polymerase gut geeignet sind und hinreichende Mengen an dNTPs im Ansatz vorhanden sind.In certain embodiments, primer binding occurs under reaction conditions that allow thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template. Such conditions are for example at reaction temperatures which are well below the melting temperature (Tm) of such a complex (P1 / template strand). The Tm should have been measured under the same buffer conditions. For example, the reaction temperatures may range from Tm minus 50 ° C to Tm minus 5 ° C. With sufficient complementarity of the 3 ' segment of the primer with the template, the extension of the primer by a polymerase usually takes place quickly and easily, if the reaction conditions are also well suited for the polymerase and sufficient amounts of dNTPs are present in the batch.
In einer bevorzugten Ausführungsform liegt auch der Komplex umfassend Primer/Controller- Oligonukleotid unter solchen Reaktions-Bedingungen in doppelsträngiger Form vor. Da Primer- Oligonukleotid und Controller-Oligonukleotid sowohl im ersten Primer-Bereich als auch im zweiten Primer-Bereich (Überhang / Primer-Schwanz) interagieren, ist die Bindung zwischen dem ersten Primer und dem Controller in der Regel stabiler, als zwischen dem ersten Primer-Bereich und der Matrize. Bei solchen Reaktionsbedingungen sollte der Primer im Überschuss vorliegen, damit genügend Primer in einzelsträngiger Form im Ansatz verbleibt und mit der Primerbindungs-Stelle des Matrizenstrangs reagieren kann, so dass eine Primer-Verlängerungsreaktion stattfinden kann. Beispielsweise beträgt die Konzentration eines Controller-Oligonukleotides ca. 1 pmol/l, dann kann die Konzentration des ersten Primers von ca. 1 ,1 bis 5 pmol/l betragen. Bei Reaktionsbedingungen, welche eine stabile Duplex-Formation zwischen einem Controller und einem ersten Primer bedingen, wird der Controller vom Primer abgesättigt. Es verbleiben allerdings immer noch genügend freie einzelsträngige erste Primer-Oligonukleotide in der Lösung, welche mit einer geeigneten Matrize interagieren können. In a preferred embodiment, the complex comprising primer / controller oligonucleotide is also in double-stranded form under such reaction conditions. As primer oligonucleotide and controller oligonucleotide both in the first primer region and in the second Primer region (overhang / primer tail) interact, the bond between the first primer and the controller is usually more stable than between the first primer region and the template. Under such reaction conditions, the primer should be in excess so that enough primer in single-stranded form remains in the reaction and can react with the primer binding site of the template strand so that a primer extension reaction can take place. For example, the concentration of a controller oligonucleotide is about 1 pmol / l, then the concentration of the first primer can be about 1, 1 to 5 pmol / l. Under reaction conditions that require a stable duplex formation between a controller and a first primer, the primer saturates the controller. However, there are still enough free single-stranded first primer oligonucleotides in the solution that can interact with a suitable template.
Das Controller-Oligonukleotid liegt somit während der Synthese-Phase vorzugsweise im Komplex umfassend Primer/Controller-Oligonukleotid vor und ist dadurch in einer inerten Form. In dieser Ausführungsform interferiert der Controller nicht mit dem Synthese- Vorgang. In diesem Zustand sind der erste und der zweite Bereich des Controller-Oligonukleotides vom Primer-Oligonukleotid (entsprechend dessen erstem und zweitem Bereich) durch Ausbildung eines komplementären Stranges besetzt und stehen somit für die Interaktionen mit gebildeten Primer- Verlängerungsprodukten während der Synthese-Phase nicht zur Verfügung.  The controller oligonucleotide is thus preferably present in the complex comprising primer / controller oligonucleotide during the synthesis phase, thereby being in an inert form. In this embodiment, the controller does not interfere with the synthesis process. In this state, the first and second regions of the controller oligonucleotide are occupied by the primer oligonucleotide (corresponding to the first and second regions thereof) through the formation of a complementary strand and thus are not responsible for interactions with formed primer extension products during the synthesis phase available.
In einer weiteren bevorzugten Ausführungsform erfolgt die Primer-Bindung unter Reaktions- Bedingungen, welche keine thermodynamisch stabile Bindung des ersten Bereichs des Primer- Oligonukleotids an die entsprechende komplementäre Position in der Matrize zulassen. Es besteht somit ein Gleichgewicht aus Bindungsereignissen und Dissoziierungsereignissen. Bei Bindungsereignissen werden Komplexe gebildet, die den ersten Bereich des Primers und die entsprechenden Primer-Bindungspositionen der Matrize umfassen. Bei Dissoziierungsereignissen trennen sich diese Komplexe in einzelne Komponenten auf, so dass keine Primer- Verlängerungsreaktion mittels Polymerase starten kann. Solche Bedingungen liegen beispielsweise bei Reaktionstemperaturen vor, welche etwa um die Schmelztemperatur (Tm) eines solchen Komplexes (P1 / Matrizenstrang) liegen. Die Schmelztemperatur (Tm) sollte dabei unter gleichen Pufferbedingungen und Konzentrationen gemessen werden. Beispielsweise können die Reaktionstemperaturen im Bereich von Tm -5 °C bis Tm +5 °C liegen, in besonderen Ausführungsformen im Bereich von Tm -5 °C bis etwa Tm +15 °C, in einer weiteren besonderen Ausführungsform im Bereich von Tm -5 °C bis Tm +30 °C. Auch unter solchen Bedingungen kann die Verlängerung des Primers durch eine Polymerase bei hinreichender Komplementarität des 3'- Segmentes des Primers mit der Matrize erfolgen. Die Reaktion kann allerdings etwas langsamer oder auch signifikant langsamer verlaufen, verglichen mit Reaktionsbedingungen, bei welchen eine stabile Primer-Bindung erfolgt. Bei Reaktionstemperaturen über Tm +30 °C (P1 / Matrize) verläuft die Primer-Verlängerungs-Reaktion in der Regel dermaßen ineffizient, dass solche Bedingungen selten bei Primer-Verlängerungsreaktionen zum Einsatz kommen. Auch bei Reaktionstemperaturen von Tm -5 °C bis etwa Tm +15 °C kann es vorteilhaft sein, wenn die Primer im Überschuss vorliegen, damit genügend Primer in einzelsträngiger Form verbleibt und mit dem Matrizenstrang reagieren kann, so dass eine Primer-Verlängerungsreaktion stattfinden kann.In a further preferred embodiment, the primer binding takes place under reaction conditions which do not permit thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template. There is thus a balance of binding events and dissociation events. In binding events, complexes are formed which comprise the first region of the primer and the corresponding primer binding positions of the template. In dissociation events, these complexes separate into individual components, so that no primer extension reaction can start by means of polymerase. Such conditions are present, for example, at reaction temperatures which are about the melting temperature (Tm) of such a complex (P1 / template strand). The melting temperature (Tm) should be measured under the same buffer conditions and concentrations. For example, the reaction temperatures may be in the range of Tm -5 ° C to Tm + 5 ° C, in particular embodiments in the range of Tm -5 ° C to about Tm +15 ° C, in another particular embodiment in the range of Tm -5 ° C to Tm +30 ° C. Even under such conditions, extension of the primer by a polymerase can be done with sufficient complementarity of the 3 ' segment of the primer with the template. However, the reaction can be slower or significantly slower compared to reaction conditions where stable primer binding occurs. At reaction temperatures above Tm + 30 ° C (P1 / template), the primer extension reaction is usually so inefficient that such conditions are rarely used in primer extension reactions. Also at Reaction temperatures from Tm -5 ° C to about Tm +15 ° C, it may be advantageous if the primers are in excess, so that enough primer remains in single-stranded form and can react with the template strand, so that a primer extension reaction can take place.
Die Struktur der ersten Primers und der Controller-Oligonukleotide, sowie die Reaktionsbedingungen der Synthese-Phase sind dermaßen gewählt, dass der doppelsträngige Komplex umfassend Primer/Controller-Oligonukleotid vorwiegend in doppelsträngiger Form vorliegt. Durch Primer-Überschuss kann das Controller-Oligonukleotid dadurch abgesättigt sein und somit aus Interaktionen mit gebildeten Primer-Verlängerungsprodukten vorzugsweise ausgeschlossen werden. Da Primer-Oligonukleotid und Controller-Oligonukleotid sowohl im ersten Primer-Bereich als auch im zweiten Primer-Bereich (Überhang/Primer-Schwanz) interagieren, ist die Bindung zwischen dem Primer und dem Controller in der Regel stabiler, als zwischen dem ersten Primer-Bereich und der Matrize. Dadurch ist die Schmelztemperatur (Tm) des Komplexes umfassend Primer/ Controller-Oligonukleotid in der Regel höher als die der Komplexe umfassend Primer / Matrize. The structure of the first primers and the controller oligonucleotides, as well as the reaction conditions of the synthesis phase are chosen such that the double-stranded complex comprising primer / controller oligonucleotide is present predominantly in double-stranded form. By primer excess, the controller oligonucleotide may thereby be saturated and thus preferably excluded from interactions with formed primer extension products. Since primer oligonucleotide and controller oligonucleotide interact both in the first primer region and in the second primer region (overhang / primer tail), the bond between the primer and the controller is generally more stable than between the first primer Area and the matrix. As a result, the melting temperature (Tm) of the complex comprising primer / controller oligonucleotide is generally higher than that of the complexes comprising primer / template.
Polymerasen: polymerases:
Es können sowohl thermostabile Polymerasen wie Taq Polymerase / Pfu Polymerasen als auch thermolabile (wie Klenow Polymerase-Fragment oder MMLV Reverse Transcriptase) oder mesophile Polymerasen (z.B. Bst Polymerase) verwendet werden. Die Polymerasen können sowohl eine 3'-Exonuklease-Aktivität (Proofreading Polymerasen) umfassen oder auch nicht. Je nach Art der verwendeten Matrize können DNA-abhängige Polymerasen oder RNA-abhängige Polymerasen verwendet werden. Both thermostable polymerases such as Taq polymerase / Pfu polymerases and thermolabile (such as Klenow polymerase fragment or MMLV reverse transcriptase) or mesophilic polymerases (eg Bst polymerase) can be used. The polymerases may comprise both a 3 'exonuclease activity (proofreading polymerases) or not. Depending on the type of template used, DNA-dependent polymerases or RNA-dependent polymerases can be used.
Bei Polymerasen können sowohl Enzyme verwendet werden, welche den natürlichen Enzymen gleich sind (z.B. Pfu Polymerase oder Bst DNA Polymerase) als auch ihre Modifikationen oder Fragmente oder Fusionen mit anderen Proteinen (z.B. AmpliTaq, Bst Large Fragment Polymerase, Klenow Large Fragment oder Phusion Polymerase).  For polymerases, it is possible to use both enzymes which are identical to the natural enzymes (eg Pfu polymerase or Bst DNA polymerase) and also their modifications or fragments or fusions with other proteins (eg AmpliTaq, Bst Large Fragment Polymerase, Klenow Large Fragment or Phusion Polymerase). ,
Es kann sowohl Polymerase mit (z.B. Bst-Polymerase und ihre Modifikation, wie z.B. Bst Large- Fragment) oder ohne Strangverdrängungs-Eigenschaften (wie z.B. Taq-Polymerase oder Pfu- Polymerase oder MMLV reverse Transcriptase) verwendet werden.  Both polymerase can be used with (e.g., Bst polymerase and its modification such as Bst Large fragment) or without strand displacement properties (such as Taq polymerase or Pfu polymerase or MMLV reverse transcriptase).
Es können sowohl vorwiegend prozessive Polymerasen oder deren Modifikationen (z.B. Bst-Large Fragment oder Phusion Polymerase) als auch weniger prozessive Polymerasen verwendet werden (Taq Polymerase bzw. Pfu Polymerase).  Both predominantly processive polymerases or their modifications (for example Bst-Large Fragment or Phusion Polymerase) and less processive polymerases can be used (Taq Polymerase or Pfu Polymerase).
Da die Synthese-Phase und Controlling-Phase zeitlich getrennt sind, wird die Synthesereaktion so lange durchgeführt (Synthese-Phase) (Fig. 3), bis die gewünschte Menge an Primer- Verlängerungsprodukt vorliegt. Erst danach erfolgt die Controlling-Phase (Fig. 4). Dadurch hat die Reaktion genügend Zeit, eine hinreichende Menge an Produkt zu bilden, wobei die Polymerasen in der Regel in katalytischen Mengen vorliegen können. Matrizenstrang: Since the synthesis phase and controlling phase are separated in time, the synthesis reaction is carried out (synthesis phase) (Figure 3) until the desired amount of primer extension product is obtained. Only then does the controlling phase take place (FIG. 4). As a result, the reaction has sufficient time to form a sufficient amount of product, the polymerases can be present usually in catalytic amounts. template strand:
Der Matrizenstrang umfasst eine Primer-Bindungsstelle, so dass unter gewählten Reaktionsbedingungen eine Bindung des ersten Bereichs des ersten Primers stattfinden kann und eine durch die Polymerase vermittelte Synthese des Stranges stattfinden kann. Weiterhin umfasst ein Matrizenstrang eine Zielsequenz. Diese Zielsequenz umfasst in der Regel das Sequenzsegment des Matrizenstranges, welcher die Matrizenfunktion für die Synthese des komplementären Stranges übernimmt. Vorzugsweise ist der Matrizenstrang und das Primer- Oligonukleotid in ihrem Design an einander dermaßen angepasst, dass der zweite Bereich des Primer-Oligonukleotids nicht an den Matrizenstrang komplementär bindet oder zumindest keine stabile komplementäre Bindung eingeht und somit potenziell in der Lage ist, mit dem ersten Bereich des Controller-Oligonukleotids zu interagieren. Im Allgemeinen können sowohl DNA als auch RNA als Matrizenstränge auftreten.  The template strand comprises a primer binding site such that under selected reaction conditions binding of the first region of the first primer can occur and polymerase mediated synthesis of the strand can occur. Furthermore, a template strand comprises a target sequence. This target sequence usually comprises the sequence segment of the template strand, which performs the template function for the synthesis of the complementary strand. Preferably, the template strand and the primer oligonucleotide are adapted in their design to each other such that the second region of the primer oligonucleotide does not bind to the template strand complementarily, or at least do not form stable complementary binding, and thus potentially capable of joining with the first region of the controller oligonucleotide. In general, both DNA and RNA can occur as template strands.
Die Primer-Bindungsstelle der Matrize liegt vorzugsweise in einer einzelsträngigen Form vor und lässt eine sequenzspezifische Bindung des ersten Bereichs des Primer-Oligonukleotids an die Matrize zu. In bestimmten Ausführungsformen umfasst die Zielsequenz des Matrizenstrangs zumindest ein Segment der Primer-Bindungsstelle, so dass das 3'-Segment des ersten Primers komplementär zur Zielsequenz binden kann. The primer binding site of the template is preferably in a single-stranded form and allows for site-specific binding of the first region of the primer oligonucleotide to the template. In certain embodiments, the target sequence of the template strand comprises at least one segment of the primer binding site so that the 3 ' segment of the first primer can bind complementary to the target sequence.
Das Segment des Matrizen-Stranges, welches als Matrize für die Synthese des komplementären Stranges durch die Polymerase dient, kann in bestimmten Ausführungsformen vollständig oder überwiegend (zu mehr als 50%) einzelsträngig unter Reaktionsbedingungen vorliegen. In einer anderen Ausführungsform ist dieses Segment überwiegend (zu mehr als 50%) oder vollständig doppelsträngig. Die bei der Synthese verwendeten Polymerasen müssen entsprechend gewählt werden: bei einzelsträngigen Matrizen können Polymerasen ohne Strangverdrängung verwendet werden, z.B. Taq-Polymerase oder Pfu-Polymerase. Bei überwiegend doppelsträngigen Segmenten der Matrize werden bevorzugt Polymerasen mit strangverdrängenden Eigenschaften verwendet, z.B. Bst-Polymerase Large Fragment oder Vent-Polymerase oder Klenow-Fragment. Es können auch Kombinationen aus mehreren Polymerasen verwendet werden, z.B. Taq- Polymerase und Vent-Polymerase oder Taq-Polymerase und Bst-Polymerase, oder Pfu- Polymerase und Bst-Polymerase. Bei verwendeten Polymerasen richtet sich ihre Auswahl nach Vorgaben der Hersteller. Dabei können sowohl in der Natur vorkommende Polymerasen als auch ihre Teilkomponenten (z.B. Klenow-Fragment oder Bst-Polymerase Large Fragment) oder auch Modifikationen, z.B. Bst-2.0 Polymerase oder AmpliTaq-Polymerase) verwendet werden.  The segment of the template strand which serves as a template for the synthesis of the complementary strand by the polymerase may, in certain embodiments, be wholly or predominantly (more than 50%) single-stranded under reaction conditions. In another embodiment, this segment is predominant (greater than 50%) or fully double-stranded. The polymerases used in the synthesis must be selected accordingly: in the case of single-stranded matrices, polymerases without strand displacement can be used, e.g. Taq polymerase or Pfu polymerase. For predominantly double-stranded segments of the template, preference is given to using polymerases having strand-displacing properties, e.g. Bst polymerase Large Fragment or Vent polymerase or Klenow fragment. Combinations of several polymerases may also be used, e.g. Taq polymerase and Vent polymerase or Taq polymerase and Bst polymerase, or Pfu polymerase and Bst polymerase. For polymerases used, their selection depends on the specifications of the manufacturer. Both naturally occurring polymerases and their partial components (e.g., Klenow fragment or Bst polymerase Large Fragment) or modifications, e.g. Bst-2.0 polymerase or AmpliTaq polymerase).
In bestimmten Ausführungsformen kann die Primerbindungsstelle für den Primer im 3'-Segment der Matrize liegen. In einer solchen Ausführungsform ist es vorteilhaft, wenn das Primer- Oligonukleotid eine Modifikation umfasst (genannt erste Blockierungs-Einheit), welche die Polymerase am Kopieren des zweiten Primer-Bereichs hindert. In einer anderen Ausführungsform kann die Matrize in ihrem 3'-Segment deutlich über die Primer- Bindungsstelle des Primers hinausgehen. Die Länge eines solchen Überhangs kann von wenigen Nukleotiden bis hin zu mehreren Kilobasen reichen. Die Struktur eines solchen Matrizenstranges führt dazu, dass der Primer-Überhang, ausgehend vom 3'-Ende der Matrize, nicht von der Polymerase kopiert wird. Daher muss der Primer bei einer solchen Ausführungsform nicht zwingend eine Block-Gruppe (genannt erste Blockierungs-Einheit) im zweiten Bereich des Primers umfassen. Der zweite Bereich kann somit unmittelbar in den ersten Bereich übergehen und via 5'- 3 '-Phosphat- Verknüpfung an das 5'-Ende des ersten Bereichs angeknüpft sein. In certain embodiments, the primer binding site may be for the primer in the 3 ' segment of the template. In such an embodiment, it is advantageous if the primer oligonucleotide comprises a modification (called the first blocking moiety) which prevents the polymerase from copying the second primer region. In another embodiment, the template in its 3 ' segment can go well beyond the primer binding site of the primer. The length of such an overhang can range from a few nucleotides to several kilobases. The structure of such a template strand causes the primer overhang, starting from the 3 ' end of the template, not to be copied by the polymerase. Therefore, in such an embodiment, the primer need not necessarily comprise a block group (called the first blocking unit) in the second region of the primer. The second region can thus directly transition into the first region and be linked to the 5 ' end of the first region via the 5 ' - 3 ' -phosphate link.
Die Synthese des Primer-Verlängerungsproduktes erfolgt via Polymerase als matrizenabhängige Synthese. In manchen Ausführungsformen ist es vorteilhaft, wenn der Fortschritt der Synthese des Primer-Verlängerungsproduktes begrenzt wird und somit ein gewünschtes Primer- Verlängerungsprodukt in seiner Länge begrenzt wird.  The synthesis of the primer extension product via polymerase as a template-dependent synthesis. In some embodiments, it is advantageous to limit the progress of the synthesis of the primer extension product and thus limit a length of the desired primer extension product.
Die Länge des Primer-Verlängerungsproduktes wird vorzugsweise durch Verfügbarkeit eines Sequenzsegmentes der Matrize begrenzt, welcher von der Polymerase zur Synthese verwendet werden kann. Das kann beispielsweise durch die Begrenzung des Matrizenstranges im 5'- Sequenzsegment, welches als Matrize für die komplementäre Synthese zur Verfügung steht, erreicht werden. Diese Begrenzung hindert dabei die verwendete Polymerase daran, eine Fortsetzung der Synthese über dieses Hindernis hinaus fortzuführen. Diese Begrenzung kann beispielsweise durch ein Strang-Ende (Strang-Abbruch) erreicht werden oder durch Verwendung einer oder mehrerer Modifikationen im Strang (z.B. Spacer oder Linker oder abasische Zurcker- Phosphat Reste), welche die Polymerase an der Synthese hindern, oder durch Nukleotid- Modifikationen (z.B. Nukleobasen-Modifikation, wie Iso-C oder Iso-G, oder der Zucker-Phosphat- Anteile, wie 2'-0-Me, 2'-MOE, Morpholino, PNA etc.). The length of the primer extension product is preferably limited by the availability of a sequence segment of the template which can be used by the polymerase for synthesis. This can be achieved, for example, by limiting the template strand in the 5 ' sequence segment, which is available as a template for the complementary synthesis. This limitation prevents the polymerase used from continuing to continue the synthesis beyond this obstacle. This limitation can be achieved, for example, by strand termination (strand termination) or by use of one or more modifications in the strand (eg spacer or linker or abasic bound phosphate residues) which prevent the polymerase from being synthesized or by nucleotide modifications (eg nucleobase modification as Iso-C and Iso-G, or the sugar-phosphate moieties such as 2 '-0-Me, 2' MOE, morpholino, PNA etc.).
Unter Verwendung von langen Matrizensträngen, z.B. genomischer DNA oder mRNA oder langen PCR-Fragmenten, kann die Synthese der Polymerase durch Verwendung von zusätzlichen Oligonukleotiden an vorbestimmten Sequenz-Segmenten angehalten bzw. gestoppt werden. In einer solchen Ausführungsform wird der Fortschritt der Synthese des Primer- Verlängerungsproduktes durch Verwendung von mindest einem sogenannten Block- Oligonukleotid (Fig. 3,4, 6 - 8) limitiert. Ein solches Block-Oligonukleotid kann unter den Reaktionsbedingungen der Synthese-Phase vorzugsweise vorwiegend sequenzspezifisch an den Matrizenstrang via komplementäre Bindung hybridisiert verbleiben. Ein solches Block- Oligonukleotid, wenn komplementär gebunden an den Matrizenstrang, hindert die Polymerase daran, den Matrizenstrang im von diesem Oligonukleotid gebundenen Sequenzabschnitt und entsprechend darüber hinaus abzulesen. Je nach verwendeter Art der Polymerase und ihrer Ausstattung kommen dafür verschiedene Ausführungsformen von Block-Oligonukleotiden in Frage. Die Auswahl der Oligonukleotid-Struktur, der Polymerase und der Reaktionsbedingungen richten sich dabei danach, dass die fortschreitende Synthese durch Polymerase gehindert bzw. blockiert wird. Die Länge des Block-Oligonukleotides und die Beschaffenheit der Sequenzzusammensetzung richten sich darauf, dass das Block-Oligonukleotid unter Reaktionsbedingungen der Synthese-Phase stabil an seine komplementäre Position eines Matrizenstranges gebunden bleiben muss und vorzugsweise nicht spontan von der Matrize dissoziieren kann. Ein solches Oligonukleotid wird in der Regel in 3'-Richtung vom ersten Primer- Oligonukleotid vor Beginn einer Synthese-Phase einer Primer-Verlängerungsreaktion in wirksamen Konzentrationen in Kontakt mit dem Matrizenstrang gebracht und für hinreichende Zeit bei geeigneten Reaktionsbedingungen inkubiert, so dass es an seine komplementäre Position im Strang binden kann. Using long template strands, eg genomic DNA or mRNA or long PCR fragments, the synthesis of the polymerase can be stopped or stopped by using additional oligonucleotides on predetermined sequence segments. In such an embodiment, the progress of the synthesis of the primer extension product is limited by using at least one so-called block oligonucleotide (Figures 3,4, 6-8). Under the reaction conditions of the synthesis phase, such a block oligonucleotide may preferably remain predominantly sequence-specifically hybridized to the template strand via complementary binding. Such a block oligonucleotide, when complementarily attached to the template strand, prevents the polymerase from reading the template strand in the sequence portion bound by that oligonucleotide and, correspondingly, beyond. Depending on the type of polymerase used and its equipment, different embodiments of block oligonucleotides can be used. The selection of the oligonucleotide structure, the polymerase and the reaction conditions are based on the fact that the progressive synthesis is prevented or blocked by polymerase. The length of the block oligonucleotide and the nature of the Sequence composition is directed to the fact that the block oligonucleotide must remain stably bound to its complementary position of a template strand under reaction conditions of the synthesis phase and preferably can not spontaneously dissociate from the template. Such oligonucleotide is usually brought in 3 ' direction from the first primer oligonucleotide in effective concentrations in contact with the template strand prior to the start of a synthesis phase of a primer extension reaction and incubated for sufficient time at appropriate reaction conditions so that it can be bound to its can bind complementary position in the strand.
Beispiele für solche zum Stopp einer polymerasen-abhängigen Synthese führenden Oligonukleotide (Fig. 3,4, 6 - 8) sind einem Fachmann bekannt.  Examples of such oligonucleotides leading to the termination of a polymerase-dependent synthesis (FIGS. 3, 4, 6 - 8) are known to a person skilled in the art.
• Beispielsweise können Oligonukleotide mit exonuklease-resistenten Modifikationen (z.B.  For example, oligonucleotides with exonuclease-resistant modifications (e.g.
Phosphorothioate (PTO) oder 2'-0-Me Modifikationen, welche vorwiegend im 5'-Segment des Oligonukleotids positioniert sind) dazu führen, dass, beispielsweise, die Taq- Polymerase das Block-Oligonukleotid nicht abbauen kann (mit ihrer 5'-3'-Exonuklease- Aktivität) und somit die Synthese über die Bindungsstelle des Oligonukleotids nicht fortführen kann. Beispielsweise können zur Matrize komplementäre Oligonukleotide mit einer Länge von ca. 15 - 70 Nukleotiden mit ca. 2 - 50 PTO-Modifikationen lokalisiert vorwiegend im 5'-Segment eines solchen Block-Oligonukleotides die Taq Polymerase daran hindern, dieses Oligonukleotid via 5'-'3-Exonuklease-abhängige Degradation zu spalten bzw. von der Matrize abzulösen. Ein solches Nukleotid ist in der Regel in der Lage, eine Taq-Polymerase daran zu hindern, das vom Block-Oligonukleotid gebundenes Matrizenstrang-Segment abzulesen. Phosphorothioate (PTO) or 2 '-0-Me modifications which primarily in the 5' segment of the oligonucleotide are positioned lead) to the fact that, for example, the Taq polymerase can not degrade the block oligonucleotide (with their 5 '-3 ' -Exonuklease- activity) and thus the synthesis via the binding site of the oligonucleotide can not continue. For example, oligonucleotides complementary to the template, approximately 15-70 nucleotides in length, with approximately 2-50 PTO modifications localized predominantly in the 5 ' segment of such a block oligonucleotide, can prevent Taq polymerase from cloning this oligonucleotide via 5 ' - '. 3-exonuclease-dependent degradation to cleave or detach from the template. Such a nucleotide is usually capable of preventing a Taq polymerase from reading the template strand segment bound by the block oligonucleotide.
• Ein weiteres Beispiel stellt die Hinderung von Polymerasen mit Strang- • Another example is the prevention of polymerases with strand
Verdrängungseigenschaften dar. Oligonukleotide mit mehreren doppelstrangstabilisierenden Modifikationen, z.B. LNA oder PNA, führen in der Regel dazu, dass die Polymerase die Synthese über die Bindungsstelle des Oligonukleotids nicht fortführen kann. Beispielsweise können zur Matrize komplementäre Oligonukleotide mit einer Länge von ca. 15 - 50 Nukleotiden mit ca. 7 - 30 LNA-Modifikationen, beispielsweise, die Bst Polymerase ( large fragment) daran hindern, dieses Oligonukleotid via polymerase abhängiger Strangverdrängung von der Matrize abzulösen. Weitere Beispiele für solche Block-Oligonukleotide sind bekannt. Beispielsweise wurden PNA-Modifikationen oder LNA-Modifikationen bei Clamping-PCR Verfahren zur Blockade der Polymerase-Synthese verwendet. Displacement properties. Oligonucleotides having multiple double-strand stabilizing modifications, e.g. LNA or PNA typically results in the polymerase being unable to continue synthesis via the oligonucleotide binding site. For example, template-complementary oligonucleotides of about 15-50 nucleotides in length with about 7-30 LNA modifications, for example, can prevent Bst polymerase (large fragment) from detaching this oligonucleotide via polymerase-dependent strand displacement from the template. Further examples of such block oligonucleotides are known. For example, PNA modifications or LNA modifications have been used in clamp-PCR methods to block polymerase synthesis.
Die Länge des während der matrizenabhängigen Synthese entstandenen P1 -Ext und die Länge des dazu passenden Controller-Oligonukleotids kann unterschiedlich gewählt werden.  The length of the P1-text generated during the template-dependent synthesis and the length of the matching controller oligonucleotide can be chosen differently.
In bestimmten Ausführungsformen wird die Länge des Controller-Oligonukleotids und die Länge des zu erwartenden Primer-Verlängerungsproduktes dermaßen aufeinander abgestimmt, dass das Controller-Oligonukleotid den vollständigen von der Polymerase synthetisierten Bereich abdeckt. In dieser Ausführungsform kann ein Controller-Oligonukleotid das P1 -Ext von der Matrize vollständig ablösen. Im 3'-Segment des P1 -Ext verbleiben keine freien Nukleotide zur Interaktion mit der Matrize während der Controlling-Phase (s.u.). In certain embodiments, the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the Controller oligonucleotide covers the complete synthesized by the polymerase area. In this embodiment, a controller oligonucleotide can completely detach the P1 -ext from the template. In the 3 ' segment of the P1 -ex, no free nucleotides remain for interaction with the template during the controlling phase (see below).
In bestimmten Ausführungsformen wird die Länge des Controller-Oligonukleotids und die Länge des zu erwartenden Primer-Verlängerungsproduktes dermaßen aufeinander abgestimmt, dass die Länge des synthetisierten Bereichs des Primer-Verlängerungsproduktes über die Länge des Controller-Oligonukleotids hinausgeht. Das 3'-Segment des Primer-Verlängerungsproduktes umfasst somit ein Sequenzsegment, welches nicht vom Controller-Oligonukleotid überprüft wird. Bei der Interaktion des P1-Ext mit dem Controller-Oligonukleotid verbleibt somit ein doppelsträngiges Segment aus P1-Ext und Matrize, welcher nicht vom Controller-Oligonukleotid überprüft wird. Dieses doppelsträngige Segment kann unter den Reaktionsbedingungen der Controlling-Phase spontan dissoziieren, z.B. infolge einer temperaturbedingten Strang-Öffnung (z.B. bei Temperaturen von ca. 50 - 80°C). Die Länge dieses 3'-Segmentes des Primer- Verlängerungsproduktes (ohne Interaktion mit Controller-Oligonukleotid) kann beispielsweise Sequenzlängen umfassen, welche in folgenden Bereichen liegen: von 1 bis 10 Nukleotiden, von 10 bis 20 Nukleotiden, von 30 bis 40 Nukleotiden, von 40 bis 50 Nukleotiden, von 50 bis 70 Nukleotiden, von 70 bis 100 Nukleotiden. In certain embodiments, the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide. The 3 ' segment of the primer extension product thus comprises a sequence segment which is not checked by the controller oligonucleotide. Thus, when P1-Ext interacts with the controller oligonucleotide, a double-stranded segment of P1-Ext and template remains unchecked by the controller oligonucleotide. This double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, for example due to a temperature-induced strand opening (eg at temperatures of about 50-80 ° C). The length of this 3 ' segment of the primer extension product (without interaction with the controller oligonucleotide) may comprise, for example, sequence lengths which lie in the following ranges: from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides, from 50 to 70 nucleotides, from 70 to 100 nucleotides.
Das synthetisierte Primer-Verlängerungsprodukt soll nun mittels Controller-Oligonukleotid von der Matrize abgelöst und damit für weitere Schritte zur Verfügung gestellt werden.  The synthesized primer extension product is now to be detached from the template by means of controller oligonucleotide and thus made available for further steps.
Controlling-Phase (Fig. 4, 7 - 11): Controlling phase (FIGS. 4, 7 - 11):
Das Ziel der Controlling-Phase besteht darin, das synthetisierte Primer-Verlängerungsprodukt auf seine Übereinstimmung mit der vorgegebenen Sequenz zu überprüfen. Dabei dient die Sequenzabhängigkeit der Doppelstrangausbildung aus Primer-Verlängerungsprodukt und Controller-Oligonukleotid zur Überprüfung der Synthese-Qualität während der Primer- Verlängerungsreaktion.  The aim of the controlling phase is to check the synthesized primer extension product for its agreement with the given sequence. The sequence dependency of the double strand formation from primer extension product and controller oligonucleotide serves to check the synthesis quality during the primer extension reaction.
Als Ergebnis der Controlling-Phase wird das Primer-Verlängerungsprodukt vollständig oder partiell von der Matrize sequenzabhängig abgelöst. Dabei erfolgt gleichzeitig eine Ausbildung eines Doppelstrangs umfassend Primer-Verlängerungsprodukt/ Controller-Oligonukleotid.  As a result of the controlling phase, the primer extension product is completely or partially detached from the template sequence-dependently. At the same time, a formation of a double strand comprising primer extension product / controller oligonucleotide takes place at the same time.
Somit stellt die erfolgreiche Ausbildung des Komplexes aus Primer-Verlängerungsprodukt und Controller-Strang (P1-Ext / Controller) eine Voraussetzung für die Öffnung des Doppelstranges (aus Matrize / Primer-Verlängerungsfragment) nach der Primer-Extension dar. Die Kontrolle der Sequenzen erfolgt in dieser Ausführungsform erst nach der Synthese des Primer- Verlängerungsproduktes in einem separaten Reaktionsschritt (Controlling-Phase). Dabei soll das Controller-Oligonukleotid einen Doppelstrang mit dem nun in der Synthese-Phase synthetisierten P1 -Ext ausbilden. Vorzugsweise befindet sich Controller-Oligonukleotid bereits zu Beginn der Synthese-Reaktion im Reaktions-Ansatz. Aufgrund eines Überschusses des Primer-Oligonukleotids, liegt das Controller- Oligonukleotid als Komplex umfassend Primer/ Controller vor. Thus, successful formation of the primer extension product / controller strand (P1-Ext / Controller) complex is a prerequisite for opening the double strand (template / primer extension fragment) after primer extension. Sequence control is in this embodiment only after the synthesis of the primer extension product in a separate reaction step (controlling phase). The controller oligonucleotide is to form a double strand with the now synthesized in the synthesis phase P1 -Ext. Preferably, controller oligonucleotide is already in the reaction mixture at the beginning of the synthesis reaction. Due to an excess of the primer oligonucleotide, the controller oligonucleotide is present as a complex comprising primer / controller.
Die Ausbildung des Komplexes aus Controller-Oligonukleotid/Primer-Verlängerungsprodukt erfordert eine Freisetzung des Controller-Oligonukleotids aus dem Primer-/Controller-Komplex. Zu diesem Zweck kann beispielsweise die Temperatur des Reaktions-Ansatzes erhöht werden, so dass die Primer/Controller-Komplexe thermodynamisch instabil werden. Die Reaktionstemperatur soll allerdings dermaßen gewählt werden, dass die vollständig doppelsträngigen Komplexe aus Primer-Verlängerungsprodukt und Matrizenstrang nicht spontan zerfallen.  Formation of the controller oligonucleotide / primer extension product complex requires release of the controller oligonucleotide from the primer / controller complex. For this purpose, for example, the temperature of the reaction mixture can be increased so that the primer / controller complexes become thermodynamically unstable. The reaction temperature should, however, be chosen so that the fully double-stranded complexes of primer extension product and template strand do not spontaneously disintegrate.
Durch Erhöhung der Reaktionstemperatur werden die Controller-Oligonukleotide aus Komplexen (Primer/Controller) freigesetzt und stehen im Gleichgewicht mit der Neubildung dieser Komplexe (z.B. bei Temperaturen um den Tm der Komplexen aus Primer/Controller ± 3 bis 8 °C).  By raising the reaction temperature, the controller oligonucleotides are released from complexes (primers / controllers) and are in equilibrium with the regeneration of these complexes (e.g., at temperatures around the Tm of the primer / controller complexes ± 3 to 8 ° C).
Die nun frei im Ansatz verfügbaren Controller-Oligonukleotide können mit Komplexen aus Primer- Verlängerungsprodukten und Matrizensträngen im zweiten Primer-Bereich (Primer-Überhang) interagieren. Die Interaktion beginnt ausgehend vom Primer-Überhang. Damit wird eine räumliche Nähe zwischen dem Controller-Strang und dem Ende des doppelsträngigen Bereichs zwischen Primer-Verlängerungsprodukt / Matrizenstrang herbeigeführt. Dadurch kann sich die Doppelstrang-Bildung zwischen dem Controller und dem ersten Primer-Bereich übertragen (sequenzabhängige Strang-Verdrängung). Bei gegebener Sequenz-Übereinstimmung mit dem synthetisierten Bereich des Primer-Verlängerungsproduktes breitet sich die Doppelstrang-Bildung zwischen dem Controller-Oligonukleotid und dem Primer-Verlängerungsprodukt weiter aus.  The controller oligonucleotides, which are now freely available, can interact with complexes of primer extension products and template strands in the second primer region (primer overhang). The interaction starts from the primer overhang. This establishes spatial proximity between the controller strand and the end of the double-stranded region between primer extension product / template strand. As a result, the double-stranded formation can be transferred between the controller and the first primer region (sequence-dependent strand displacement). Given the sequence identity with the synthesized portion of the primer extension product, the double strand formation between the controller oligonucleotide and the primer extension product continues to expand.
Das Fortschreiten dieser Interaktion zwischen dem synthetisierten Primer-Verlängerungsprodukt und dem Controller-Oligonukleotid führt zu einer zunehmenden Freisetzung des Matrizenstranges aus dem Komplex mit dem Primer-Verlängerungsprodukt. Vorzugsweise kommt es bei hinreichender Übereinstimmung in der Komplementarität zu einer Dissoziation des Komplexes der Matrize und Primer-Verlängerungsprodukt. Es wird dabei ein neuer Komplex gebildet, welcher das Primer-Verlängerungsprodukt und das Controller-Oligonukleotid umfasst.  The progression of this interaction between the synthesized primer extension product and the controller oligonucleotide results in increasing release of the template strand from the complex with the primer extension product. Preferably, with sufficient compliancy in complementarity, dissociation of the template complex and primer extension product occurs. A new complex is thereby formed which comprises the primer extension product and the controller oligonucleotide.
In bestimmten Ausführungsformen verbleibt ein 3'-Segment des Primer-Verlängerungsproduktes in der Bindung mit dem Matrizenstrang, auch wenn das Controller-Oligonukleotid vollständig an das Primer-Verlängerungsprodukt gebunden hat. Die Dissoziierung dieses Komplexes (umfassend das 3'-Segment des Primer-Verlängerungsproduktes und die entsprechenden komplementären Bereiche der Matrize) hängt von den gewählten Reaktionsbedingungen während der Controlling- Phase (s.u.) ab. Das erfolgreiche Zusammenwirken von Komponenten bei der Interaktion des Controller-Oligonukleotids mit dem synthetisierten Primer-Verlängerungsprodukt und die spontane Dissoziation des Komplexes aus dem 3'-Segment des P1 -Ext und der Matrize können zur Ablösung des Primer-Verlängerungsproduktes (im Komplex aus P1 -Ext und COntrolelr-Strang) von der Matrize führen. Diskriminierende Wirkung des Controller-Oligonukleotids: In certain embodiments, a 3 ' segment of the primer extension product remains in binding with the template strand even though the controller oligonucleotide has completely bound to the primer extension product. The dissociation of this complex (comprising the 3 ' segment of the primer extension product and the corresponding complementary regions of the template) depends on the reaction conditions chosen during the controlling phase (see below). The successful interaction of components in the interaction of the controller oligonucleotide with the synthesized primer extension product and the spontaneous dissociation of the complex from the 3 ' segment of the P1 -ext and the template can be used to detach the primer extension product (in the complex of P1- Ext and COntrolelr strand) from the matrix. Discriminating effect of the controller oligonucleotide:
Bei ggf. auftretenden Abweichungen in der Komplementarität zwischen dem P1-Ext und dem Controller-Oligonukleotid kann der Vorgang der sequenzabhängigen Strangverdrängung allerdings massiv gehindert werden. Je höher die Sequenzunterschiede zwischen dem synthetisierten Primer-Verlängerungsprodukt und dem entsprechenden Controller-Oligonukleotid sind, umso stärker wird die Ausbildung eines Komplexes aus Controller-Oligonukleotid und P1 -Ext beeinflusst. Das Ausmaß des Einflusses kann von geringfügiger Verlangsamung bis zum vollständigen Stopp im Fortschritt der Komplex-Bildung kommen.  However, if deviations occur in the complementarity between the P1-Ext and the controller oligonucleotide, the process of sequence-dependent strand displacement can be severely hindered. The higher the sequence differences between the synthesized primer extension product and the corresponding controller oligonucleotide, the more the formation of a complex of controller oligonucleotide and P1 text is affected. The degree of influence can be from slight slowing to complete stop in the progress of complex formation.
Aufgrund einer Reversibilität in der Doppelstrang-Ausbildung kann das Controller-Oligonukleotid durch den Matrizenstrang aus der Bindung mit dem Primer-Verlängerungsprodukt vollständig oder teilweise abgelöst werden (Verdrängung durch Matrize). Eine solche Verdrängung kann in bestimmten Ausführungsformen vollständig erfolgen. Dies kann beispielsweise dann erfolgen, wenn unter den verwendeten Reaktionsbedingungen in der Controlling-Phase die Stabilität des Komplexes aus dem zweiten Bereich des Primers und dem ersten Bereich des Controller- Oligonukleotids nicht hinreichend hoch ist und dieser Komplex in seine Teilkomponenten spontan dissoziieren kann. Damit wirkt der Matrizenstrang entgegen dem Controller-Oligonukleotid. Da die Reaktionsbedingungen dermaßen gewählt sind, dass der Komplex aus Matrize und P1-Ext nicht spontan dissoziieren soll, können nur solche Primer-Verlängerungsprodukte aus diesem Komplex durch das Controller-Oligonukleotid abgelöst werden, welche eine hinreichend komplementäre Bindung mit dem Controller-Oligonukleotid aufweisen. Eine solche diskriminierende Wirkung kann unter mehreren Gesichtspunkten ausgenutzt werden.  Due to reversibility in the double-stranded formation, the template oligonucleotide can be completely or partially detached from the template strand by binding with the primer extension product (displacement by template). Such displacement may be accomplished completely in certain embodiments. This can be done, for example, if under the reaction conditions used in the controlling phase the stability of the complex from the second region of the primer and the first region of the controller oligonucleotide is not sufficiently high and this complex can spontaneously dissociate into its subcomponents. Thus, the template strand acts against the controller oligonucleotide. Since the reaction conditions are such that the template and P1-Ext complex should not spontaneously dissociate, only such primer extension products can be detached from this complex by the controller oligonucleotide that has sufficiently complementary binding to the controller oligonucleotide. Such a discriminatory effect can be exploited under several aspects.
Beispiele für potenzielle Quellen der Abweichungen in Primer-Verlängerungsprodukten. Examples of potential sources of variation in primer extension products.
Abweichungen in der Sequenz eines Primer-Verlängerungsproduktes können durch mehrere Ursachen bedingt sein, beispielsweise durch das Vorliegen von mehreren Matrizensträngen mit gleichen oder ähnlichen Primer-Bindungsstellen und Sequenzvarianten an einer oder mehreren Positionen im Segment des Matrizenstranges, z.B. bei Anwesenheit eines polymorphen Lokus im Zielsequenz-Segment. Eine andere Ursache für Abweichungen können beispielsweise durch Polymerasen eingeführte Synthesefehler / Einbaufehler sein.  Variations in the sequence of a primer extension product may be due to several causes, for example, the presence of multiple template strands with the same or similar primer binding sites and sequence variants at one or more positions in the segment of the template strand, e.g. in the presence of a polymorphic locus in the target sequence segment. Another cause of deviations may be, for example, synthesis errors / incorporation errors introduced by polymerases.
Bei Vorliegen von Sequenzabweichungen in den Primer- Verlängerungsprodukten von der Vorgabe durch die Sequenzzusammensetzung des Controller-Oligonukleotids verbleiben solche Primer- Verlängerungsprodukte während der Controlling-Phase vorzugsweise in doppelsträngigen Komplexen mit der Matrize. Somit können solche doppelsträngigen Komplexe umfassend einen Matrizenstrang und ein Primer-Verlängerungsprodukt (welches nicht vom Controller abgelöst werden konnte) für weitere Analyse-Schritte keine aktive Form darstellen. Damit kann eine Differenzierung zwischen Primer-Verlängerungsprodukten erfolgen: von Matrize abgelöste Primer- Verlängerungsprodukte stellen eine aktive Form von Primer-Verlängerungsprodukten dar. Primer- Verlängerungsprodukte im Komplex mit ihrer Matrize stellen vorzugsweise eine inaktive Form dar. Die Verwendung eines Primer-Verlängerungsproduktes in weiteren Reaktionen kann beispielsweise erforderlich machen, dass bestimmte Bereiche des P1-Ext in einzelsträngiger Form vorliegen. Dies kann beispielsweise für Bindung eines Primers oder einer Sonde notwendig sein. Diese Ausführungsform kann daher beispielsweise zu Überführung der Sequenzen im 3'- Segments des P1 -Ext in einzelsträngigen Zustand verwendet werden. In the event of sequence deviations in the primer extension products from the template by the sequence composition of the controller oligonucleotide, such primer extension products preferably remain in double-stranded complexes with the template during the controlling phase. Thus, such double-stranded complexes comprising a template strand and a primer extension product (which could not be detached from the controller) can not be an active form for further analysis steps. Thus, differentiation can be made between primer extension products: primer extension products detached from the template represent an active form of primer extension products. Primer extension products in complex with their template are preferably an inactive form. For example, the use of a primer extension product in further reactions may require that certain portions of the P1-Ext be in single-stranded form. This may be necessary, for example, for binding a primer or a probe. This embodiment can therefore be used, for example, to convert the sequences in the 3 ' segment of the P1-E 1 in a single-stranded state.
Das Primer-Verlängerungsprodukt wird nur bei korrekter Ausführung der Synthese bzw. nur bei einer bestimmten Übereinstimmung in der Komplementarität mit dem Controller-Oligonukleotid von der Matrize abgelöst. Bei Abweichungen in der Sequenz verbleibt das Primer- Verlängerungsprodukt im Komplex mit der Matrize und die Sequenzen im 3'-Segment des P1-Ext können nicht in den einzelsträngigen Zustand überführt werden (unter verwendeten Bedingungen).The primer extension product is only detached from the template if the synthesis is carried out correctly or only if it matches the complementarity with the controller oligonucleotide. In the case of deviations in the sequence, the primer extension product remains in complex with the template and the sequences in the 3 ' segment of the P1-Ext can not be converted into the single-stranded state (under used conditions).
Diese diskriminierende Wirkung des Controller-Oligonukleotids nach einer Primer-Verlängerungs- Reaktion (Synthese-Phase) kann für mehrere technische Aufgaben verwendet werden. Die Verfügbarkeit von Controller-Oligonukleotid im Ansatz (homogenes Assay-Format) ermöglicht sowohl eine kontaminationsarme Integration in andere Verfahren der molekularen Analysen als auch eine Kombination mit anderen Verfahren, z.B. mit Amplifikations-Verfahren oder Detektionsverfahren. Einige Ausführungsformen sollen daher in mehr Detail dargestellt werden. Ein an einen Controller gebundenes vollkomplementäres Primer-Verlängerungsprodukt kann beispielsweise vor Nuklease-Einwirkung partiell oder vollständig geschützt werden, wenn die Beschaffenheit des Controller-Stranges entsprechend gewählt wurde. Beispielsweise bei Verwendung von Nuklease-resistenten Modifikationen an bestimmten Sequenz-Segmenten des dritten Bereichs des Contollers oder durchgehend über den gesamten dritten Bereich des Controllers, z.B. PTO oder 2'-0-Alkyl Modifikationen, kann ein solcher Kontroller das This discriminatory effect of the controller oligonucleotide after a primer extension reaction (synthesis phase) can be used for several technical tasks. The availability of controller oligonucleotide in the approach (homogeneous assay format) allows both a low-contamination integration in other methods of molecular analysis as well as a combination with other methods, such as amplification or detection methods. Some embodiments are therefore to be presented in more detail. For example, a fully complementary primer extension product attached to a controller can be partially or fully protected from nuclease exposure if the nature of the controller string has been selected appropriately. For example, when using nuclease resistant modifications to certain sequence segments of the third region of the Contollers or continuously over the whole third area of the controller, such as PTO or 2 '-0-alkyl modifications, such a controller can
komplementäre Primer-Verlängerungsprodukt vor einer Nuklease-Spaltung schützen. protect complementary primer extension product from nuclease cleavage.
Die an den Matrizenstrang gebundenen verbleibenden Primer-Verlängerungsprodukte können dagegen selektiv durch Einwirkung einer Nuklease (z.B. Restriktions-Endonuklease oder einer Exonuklease) enzymatsich gespalten werden. Dadurch können spezifische Primer- Verlängerungsprodukte mit vorgegebener Sequenz mit höherer Spezifität isoliert werden.  On the other hand, the remaining primer extension products bound to the template strand can be selectively enzymatically cleaved by the action of a nuclease (e.g., restriction endonuclease or exonuclease). Thereby, specific primer extension products of predetermined sequence with higher specificity can be isolated.
Ein Controller kann weiterhin einen Affinitäts-Marker umfassen, z.B. ein Biotin-Rest (beispielseise kovalent an das 3'-Ende oder 5'-Ende gekoppelt). Damit kann ein an Controller gebundenes Primer-Verlängerungsprodukt durch Verwendung einer festen Phase, beschichtet beispielsweise mit Streptavidin, isoliert werden. A controller may further comprise an affinity tag, eg, a biotin residue (for example, covalently coupled to the 3 ' end or 5 ' end). Thus, a primer extension product attached to the controller can be isolated by using a solid phase coated, for example, with streptavidin.
Mehrere unterschiedliche Matrizenstränge mit im Wesentlichen einheitlicher Several different template strands with essentially uniform
Primerbindungsstelle und einem einheitlichen Primer Primer binding site and a uniform primer
Die Ausführungsform beruht auf der sequenzspezifischen Ablösung/ Trennung des Primer- Verlängerungsproduktes von seinem Matrizenstrang bei gleichzeitigem Vorliegen von mehreren unterschiedlichen Primer-Verlängerungsprodukten im gleichen Reaktionsansatz. Matrizenstränge: The embodiment is based on the sequence-specific detachment / separation of the primer extension product from its template strand in the simultaneous presence of several different primer extension products in the same reaction mixture. template strands:
In dieser Ausführungsform werden mehrere Matrizenstränge (mindestens zwei) mit einer im Wesentlichen gleichen Primer-Bindungsstelle verwendet, die sich aber in der Sequenz des als Matrize dienenden Sequenzsegments unterscheiden. Die Unterschiede zwischen Matrizensträngen liegen vorzugsweise in 3'-Richtung vom 3'-Ende des Primers. Die Unterschiede können beispielsweise Einzelnukleotid-Variationen (z.B. SNVs: Substitutionen, Deletionen, Insertionen) umfassen, oder auch Insertionen, Deletionen, Duplikationen, Inversionen von Sequenzsegmenten mit mehreren Nukleotiden (z.B. 2 bis 200 Nukleotiden). In this embodiment, multiple template strands (at least two) with a substantially similar primer binding site are used, but differ in the sequence of the template segment sequence. The differences between template strands are preferably in the 3 ' direction from the 3 ' end of the primer. The differences may include, for example, single nucleotide variations (eg, SNVs: substitutions, deletions, insertions), or insertions, deletions, duplications, inversions of multi-nucleotide sequence segments (eg, 2 to 200 nucleotides).
Somit umfasst ein Matrizenstrang eine Zielsequenz, welche mindestens einen polymorphen Lokus umfasst und weiterhin mindestens ein Sequenzsegment umfasst, welches für alle Sequenz- Vaianten einer Zielsequenz einheitlich ist. Die Primer-Bindungsstelle kann beispielsweise im einheitlichen Sequenz-Segment liegen. Der polymorphe Lokus liegt somit in 3'-Richtung vom 3'- Primer-Ende. Thus, a template strand comprises a target sequence comprising at least one polymorphic locus and further comprising at least one sequence segment which is uniform for all sequence variants of a target sequence. The primer binding site may be, for example, in the unitary sequence segment. The polymorphic locus is thus in the 3 ' direction from the 3 ' primer end.
Primer: primer:
Es wird vorzugsweise ein einheitliches Primer-Oligonukleotid verwendet, welches in der Lage ist, an einheitliche Primer-Bindungsstellen aller im Ansatz vorliegenden Matrizenstränge vorwiegend komplementär zu binden und einen Start einer Synthese-Reaktion durch eine Polymerase zu initiieren.  Preferably, a single primer oligonucleotide is used which is capable of predominantly complementary binding to uniform primer binding sites of all template strands present in the anneal and initiating initiation of a synthetic reaction by a polymerase.
Controller: controller:
Es wird mindestens ein Controller-Oligonukleotid verwendet, welches dermaßen in seinem dritten Bereich konstruiert ist, dass es in der Lage ist, nur mit einer bestimmen Variante der Sequenz eines möglichen Primer-Verlängerungsproduktes komplementär im synthetisierten Bereich des Primer- Verlängerungsprodukts zu binden. Falls mehrere Controller-Oligonukleotide verwendet werden, wird jedes Controller-Oligonukleotid sequenzspezifisch zu einer bestimmten Variante der Sequenz konstruiert.  At least one controller oligonucleotide constructed in its third region is used so that it is capable of binding to only a certain variant of the sequence of a possible primer extension product complementarily in the synthesized region of the primer extension product. If multiple controller oligonucleotides are used, each controller oligonucleotide is constructed sequence-specifically to a particular variant of the sequence.
Synthese-Phase: Synthesis phase:
Während der Synthese-Phase kann die Primer-Bindung (durch den ersten Bereich des Primer- Oligonukleotids) im Wesentlichen ohne Diskriminierung von einzelnen Matrizensträngen stattfinden. Die Polymerase ist in der Lage von solchen gebundenen Primern eine Synthese zu starten und synthetisiert jeweils komplementäre Stränge anhand des jeweiligen Matrizenstranges. Dabei resultieren Primer-Verlängerungsprodukte, welche zum jeweiligen Matrizenstrang im Wesentlichen komplementär sind und somit jeweils komplementäre Segmente zu einzelnen Sequenz-Varianten der Matrizenstränge umfassen. Während der Synthese kann die Polymerase zwischen diesen Sequenz-Unterschieden der Matrizenstränge nicht unterscheiden. Das Controller-Oligonukleotid liegt während der Synthese-Phase in doppelsträngiger Form im Primer/Controller-Komplex vor und interferiert nicht mit dem Synthese-Vorgang. During the synthesis phase, primer binding (through the first region of the primer oligonucleotide) can occur substantially without discrimination of single template strands. The polymerase is able to initiate synthesis of such bound primers and synthesizes complementary strands on the basis of the respective template strand. This results in primer extension products which are substantially complementary to the respective template strand and thus each comprise complementary segments to individual sequence variants of the template strands. During synthesis, the polymerase can not distinguish between these sequence differences of the template strands. The controller oligonucleotide is in double-stranded form in the primer / controller complex during the synthesis phase and does not interfere with the synthesis process.
Controlling-Phase (Fig. 4, 7 - 11): Controlling phase (FIGS. 4, 7 - 11):
Nach Abschluss der Synthese-Phase erfolgt die Freisetzung des Controller-Oligonukleotids aus dem doppelsträngigen Komplex Primer/Controller, z.B. durch Temperatur-Erhöhung (bei einer Temperatur, bei welcher die Primer/Controller-Komplexe zumindest teilweise dissoziiert sind, aber Komplexe umfassend Primer-Verlängerungsprodukte/Matrizenstränge im Wesentlich stabil sind). Das Controller-Oligonukleotid, was nun zumindest teilweise in einzelsträngiger Form vorliegt, kann durch seinen ersten Bereich mit dem zweiten Bereich des Primers interagieren, und somit die Strang-Verdrängung starten. Der Fortschritt der Ausbildung des Doppelstranges zwischen dem ersten Primer-Verlängerungsprodukt und dem Controller-Oligonukleotid hängt von der Übereinstimmung der Sequenzen des dritten Bereichs des Controller-Oligonukleotids und des synthetisierten Anteils der jeweiligen Primer-Verlängerungsprodukte. Der zweite Bereich des Controllers ist dabei voll-komplementär zum ersten Bereich des ersten Primers.  Upon completion of the synthesis phase, release of the controller oligonucleotide from the double-stranded complex primer / controller, e.g. by raising the temperature (at a temperature at which the primer / controller complexes are at least partially dissociated, but complexes comprising primer extension products / template strands are substantially stable). The controller oligonucleotide, which is now at least partially in single-stranded form, can interact through its first region with the second region of the primer, thus initiating strand displacement. The progress of the formation of the double strand between the first primer extension product and the controller oligonucleotide depends on the correspondence of the sequences of the third region of the controller oligonucleotide and the synthesized portion of the respective primer extension products. The second area of the controller is fully complementary to the first area of the first primer.
Die Synthese-Produkte (Primer-Verlängerungsprodukte) unterscheiden sich je nach verwendetem Matrizenstrang. Diese Unterschiede können von Unterschieden an nur einer Nukleobase bis hin zu vollständig unterschiedlicher Sequenzzusammensetzung des Primer-Verlängerungsproduktes reichen. Aufgrund dieser Unterschiede in den Primer-Verlängerungsprodukten ist das Ergebnis der Controlling-Phase unterschiedlich. Vorwiegend werden Primer-Verlängerungsprodukte mit einer hinreichenden Übereinstimmung in der Komplementarität mit dem dritten Bereich des Controllers von ihrem Matrizenstrang abgelöst. Damit findet eine Differenzierung zwischen synthetisierten Primer-Verlängerungsprodukten in der Controlling-Phase statt: Die Controller-Oligonukleotide bilden vorzugsweise mit komplementären Primer-Verlängerungsprodukten doppelsträngige Komplexe. Bei einer Sequenzabweichung findet diese Doppelstrang-Bildung nur unzureichend statt. Aufgrund gewählter Reaktionsbedingungen (eine Temperatur, bei welcher Primer/Controller- Komplexe zumindest teilweise dissoziiert sind, aber stabile Komplexe umfassend Primer- Verlängerungsprodukte/Matrizenstränge vorliegen), verbleiben Primer-Verlängerungsprodukte mit Sequenzunterschieden zu den Controller-Strängen vorwiegend an ihre Matrizenstränge gebunden. The synthesis products (primer extension products) differ depending on the template strand used. These differences can range from differences in only one nucleobase to completely different sequence composition of the primer extension product. Due to these differences in primer extension products, the outcome of the controlling phase is different. Predominantly, primer extension products with a sufficient degree of complementarity with the third region of the controller are replaced by their template strand. Thus, a differentiation between synthesized primer extension products takes place in the controlling phase: The controller oligonucleotides preferably form double-stranded complexes with complementary primer extension products. In case of a sequence deviation, this double-stranded formation takes place only insufficiently. Due to selected reaction conditions (a temperature at which primer / controller complexes are at least partially dissociated, but stable complexes comprising primer extension products / template strands), primer extension products with sequence differences to the controller strands remain predominantly attached to their template strands.
Das nun vollständig oder teilweise abgelöste Primer-Verlängerungsprodukt kann in weiteren Analysen verwendet werden. Beispielsweise kann es aus dem Reaktionsansatz isoliert werden (in gebundener Form an das Controller-Oligonukleotid). Weiterhin kann es als Bindungspartner für andere Oligonukleotide verwendet werden, z.B. Sonden. Weiterhin kann es selbst als Matrizen Strang auftreten, z.B. nach Bindung eines neuen Primers im 3'-Segment des Primerverlängerungsprodukts. Mehrere unterschiedliche Matrizenstränge mit Allel-diskriminierenden Primern The now completely or partially detached primer extension product can be used in further analyzes. For example, it can be isolated from the reaction mixture (in bound form to the controller oligonucleotide). Furthermore, it can be used as a binding partner for other oligonucleotides, eg probes. Furthermore, it may even occur as a template strand, for example, after binding of a new primer in the 3 ' segment of the primer extension product. Several different template strands with allele-discriminating primers
Die Ausführungsform beruht auf der sequenzspezifischen Ablösung/ Trennung des Primer- Verlängerungsproduktes von seinem Matrizenstrang bei gleichzeitigem Vorliegen von mehreren unterschiedlichen Primer-Verlängerungsprodukten im gleichen Reaktionsansatz.  The embodiment is based on the sequence-specific detachment / separation of the primer extension product from its template strand in the simultaneous presence of several different primer extension products in the same reaction mixture.
Matrizenstränge: template strands:
Auch in dieser Ausführungsform werden mehrere Matrizenstränge (mindestens zwei) mit einer Primer-Bindungsstelle verwendet, wobei sich die Primer-Bindungsstelle bei einzelnen Matrizen unterscheidet. Die Unterschiede zwischen Matrizensträngen liegen vorzugsweise in an einer Position, welche bevorzugt mit dem 3'-Segment des Primers interagiert (beispielsweise Positionen 0, -1 , -2, -3, -4, -5). Die Unterschiede können beispielswiese Einzelnukleotid-Variationen (z.B. SNVs: Substitutionen, Deletionen, Insertionen), oder Insertionen, Deletionen, Duplikationen, oder Inversionen von Sequenzsegmenten von mehreren Nukleotiden (z.B. 2 bis 10 Nukleotiden) umfassen. Also in this embodiment, multiple template strands (at least two) are used with a primer binding site, with the primer binding site being different for individual templates. The differences between template strands are preferably in a position which preferentially interacts with the 3 ' segment of the primer (e.g., positions 0, -1, -2, -3, -4, -5). The differences may include, for example, single nucleotide variations (eg, SNVs: substitutions, deletions, insertions), or insertions, deletions, duplications, or inversions of sequence segments of several nucleotides (eg, 2 to 10 nucleotides).
Erstes Primer-Oligonukleotid: First primer oligonucleotide:
In der Primer- Verlängerungsreaktion werden mehrere erste Primer-Oligonukleotide (mehr als zwei) verwendet. Die jeweiligen ersten Primer-Oligonukleotide sind in ihrem 3'-Segment des ersten Primer-Bereichs dermaßen konstruiert, dass jedes verwendete Primer-Oligonukleotid eine spezifische für eine bestimmte Sequenz-Variante der in Frage kommenden Matrizenstränge komplementäre Sequenz umfasst (z.B. allel-spezifische Primer). Solche ersten Primer sind in der Lage, an ihre spezifische Primer-Bindungsstellen der jeweiligen Matrizenstränge vorwiegend komplementär zu binden und einen Start einer Synthese-Reaktion durch eine Polymerase zu initiieren. In the primer extension reaction, several first primer oligonucleotides (more than two) are used. The respective first primer oligonucleotides are constructed in their 3 ' segment of the first primer region such that each primer oligonucleotide used comprises a specific sequence complementary to a particular sequence variant of the candidate template strands (eg, allele-specific primers). , Such first primers are capable of predominantly complementary binding to their specific primer binding sites of the respective template strands and to initiate initiation of a synthetic reaction by a polymerase.
Die ersten Primer-Oligonukleotide können einheitliche oder unterschiedliche zweite Bereiche umfassen (Primer-Überhang, Oligonukleotid-Schwanz). Dabei wird die Zusammensetzung der jeweils spezifischen Controller-Oligonukleotide im jeweiligen ersten Bereich dermaßen angepasst, dass eine spezifische Paarbildung aus einem Allel-spezifischen ersten Primer und einem entsprechenden Controller möglich ist und jedes Controller in einem solchen Paar eine spezifische Basensequenz im ersten Bereich des Controllers umfasst und jedes erste Primer-Oligonukleotid in einem solchen Paar eine entsprechend komplementäre Sequenz im zweiten Bereich. Damit können die Primer-Oligonukleotide mit Controller-Oligonukleotiden vorwiegend spezifisch während der Controlling-Phase interagieren.  The first primer oligonucleotides may comprise uniform or different second regions (primer overhang, oligonucleotide tail). In this case, the composition of the respectively specific controller oligonucleotides in the respective first region is adapted so that a specific pairing of an allele-specific first primer and a corresponding controller is possible and each controller in such a pair comprises a specific base sequence in the first region of the controller and each first primer oligonucleotide in such a pair has a correspondingly complementary sequence in the second region. Thus, the primer oligonucleotides can interact with controller oligonucleotides predominantly specifically during the controlling phase.
Kompetitor-Primer-Oligonukleotid (Fig. 21 - 24): Competitor primer oligonucleotide (Figures 21-24):
In der Primer-Verlängerungsreaktion kann mindestens ein weiterer Primer verwendet werden, welcher kein erstes Primer-Oligonukleotid ist. Ein solcher Primer wird Kompetitor-Primer- Oligonukleotid genannt. Er ist in der Lage an mindestens eine Sequenz-Variante eines polymorphen Lokus einer Zielsequenz komplementär zu binden und dabei ein perfekt match Duplex zu bilden, wobei diese Sequenz-Variante vorzugsweise eine Sequenz ist, welche mit dem ersten Primer-Oligonukleotid mindestens an einer Stelle ein Mismatch ausbilden kann. In the primer extension reaction, at least one other primer which is not a first primer oligonucleotide can be used. Such a primer will be competitor primer Called oligonucleotide. It is capable of complementarily binding at least one sequence variant of a polymorphic locus of a target sequence and thereby forming a perfect match duplex, this sequence variant preferably being a sequence which is at least at one point with the first primer oligonucleotide Mismatch can form.
Die jeweiligen Kompetitor-Primer-Oligonukleotide sind vorzugsweise in ihrem 3'-Segment dermaßen konstruiert, dass jedes verwendete Kompetitor-Primer-Oligonukleotid eine spezifische für eine bestimmte Sequenz-Variante der in Frage kommenden Matrizenstränge komplementäre Sequenz umfasst (z.B. Allel-spezifische Primer). Solche Kompetitor-Primer sind in der Lage, an ihre spezifischen Primer-Bindungsstellen der jeweiligen Matrizenstränge vorwiegend komplementär zu binden und einen Start einer Synthese-Reaktion durch eine Polymerase zu initiieren. The respective competitor primer oligonucleotides are preferably constructed in their 3 ' segment such that each competitor primer oligonucleotide used comprises a specific sequence complementary to a particular sequence variant of the candidate template strands (eg, allele-specific primers). Such competitor primers are able to predominantly complementarily bind to their specific primer binding sites of the respective template strands and to initiate initiation of a synthetic reaction by a polymerase.
Im Wesentlichen sind Kompetitor-Primer ebenfalls Allel-spezifische Primer, welche nicht mit dem ersten Bereich des jeweils spezifischen Controller-Oligonukleotides interagieren und somit keine Strang-Trennung initiieren können.  In essence, competitor primers are also allele-specific primers which can not interact with the first region of the specific controller oligonucleotide and thus can not initiate strand separation.
Kompetitor-Primer sollen im Wesentlichen um die Bindung an die Primer-Bindungs-Stelle des Matrizenstranges mit dem ersten Primer-Oligonukleotid konkurrieren und bei komplementärer Bindung an seine komplementäre Variante des Matrizenstranges von einer Polymerase verlängert werden, so dass dabei ein Kompetitor-Primer-Verlängerungsprodukt entsteht.  Competitor primers are said to substantially compete for binding to the primer binding site of the template strand with the first primer oligonucleotide and to be extended upon complementary binding to its complementary variant template strand from a polymerase, thereby forming a competitor primer extension product arises.
Die Wahl der Sequenz eines Kompetitor-Primer-Oligonukleotides richtet sich hauptsächlich nach der Erfordernis, eine spezifische Sequenz-Variante eines polymorphen Lokus spezifisch aus der Interaktion mit dem ersten Primer-Oligonukleotid auszugrenzen und somit die unspezifische Interaktion zwischen einem spezifischen ersten Primer-Oligonukleotid und einer in der Sequenz abweichenden Primer-Bindungsstelle einer anderen Sequenz-Variante zu verhindern bzw. zu minimieren.  The choice of the sequence of a competitor primer oligonucleotide depends primarily on the requirement to specifically exclude a specific sequence variant of a polymorphic locus from interaction with the first primer oligonucleotide and thus the non-specific interaction between a specific first primer oligonucleotide and a to prevent or minimize in the sequence deviating primer binding site of another sequence variant.
Ein Kompetitor-Primer-Oligonukleotid umfasst vorzugsweise kein Sequenzsegment-Anteil, welches mit dem für das erste Primer-Oligonukleotid spezifischen Controller-Oligonukleotid interagieren kann.  A competitor primer oligonucleotide preferably does not comprise a sequence segment moiety which can interact with the controller oligonucleotide specific for the first primer oligonucleotide.
Controller: controller:
Es wird mindestens ein Controller-Oligonukleotid verwendet, welches derartig in seinem zweiten Bereich konstruiert ist, dass es in der Lage ist, nur mit einer bestimmen Variante der Sequenz eines Sequenz-Varianten-spezifischen ersten Primer-Oligonukleotides und somit nur mit einer bestimmten Variante der Sequenz eines möglichen ersten Primer-Verlängerungsproduktes komplementär im ersten Bereich des Primer-Verlängerungsprodukts zu binden. Falls mehrere Controller verwendet werden, wird jedes Controller-Oligonukleotid sequenzspezifisch für eine bestimmte Variante der Sequenz konstruiert. Es können mehrere Controller-Oligonukleotide verwendet werden, welche sich weiterhin dadurch unterscheiden, dass sie in ihrem ersten Bereich eine spezifische Sequenz aufweisen, welche in der Lage ist, vorwiegend an das spezifische erste Primer-Oligonukleotid komplementär zu binden. Somit besteht eine Möglichkeit zu einer Multiplexing-Kodierung mit verschiedenen Primer/ Controlling-Oligonukleotid-Paaren. Beide Partner weisen jeweils für dieses Paar spezifische Sequenzabschnitte im ersten Primer-Bereich und im zweiten Primer-Bereich, sowie entsprechend im ersten und im zweiten Bereich des Controller-Oligonukleotids auf. At least one controller oligonucleotide constructed in its second region such that it is capable of having only one particular variant of the sequence of a sequence variant-specific first primer oligonucleotide, and thus only one particular variant of the invention, is used Sequence of a possible first primer extension product to bind complementarily in the first region of the primer extension product. If multiple controllers are used, each controller oligonucleotide is constructed sequence-specifically for a particular variant of the sequence. Multiple controller oligonucleotides may be used, which further differ in that they have in their first region a specific sequence which is capable of binding predominantly to the specific first primer oligonucleotide. Thus, there is a possibility for multiplexing coding with different primer / controlling oligonucleotide pairs. Both partners each have specific sequence sections for this pair in the first primer region and in the second primer region, as well as correspondingly in the first and in the second region of the controller oligonucleotide.
Synthese-Phase: Synthesis phase:
Während der Synthese-Phase kann die Primer-Bindung (durch den ersten Bereich des ersten Primer-Oligonukleotids) im Wesentlichen / bevorzugt unter Diskriminierung der einzelnen Sequenz-Varianten von Matrizensträngen stattfinden. Dazu werden bevorzugt geeignete Reaktionsbedingungen verwendet (sogenannte stringente Reaktionsbedingungen). Die Polymerase ist in der Lage, von solchen korrekt komplementär gebundenen Primern eine Synthese zu starten und synthetisiert jeweils komplementäre Stränge anhand des jeweiligen Matrizenstranges. Dabei resultieren Primer-Verlängerungsprodukte, welche zum jeweiligen Matrizenstrang im Wesentlichen komplementär sind. Während der Synthese kann die Polymerase zwischen diesen Unterschieden der Matrizenstränge nicht unterscheiden. Das Controller- Oligonukleotid liegt während der Synthese-Phase in doppelsträngiger Form im Primer/Controller- Komplex vor und interferiert nicht mit dem Synthese-Vorgang.  During the synthesis phase, primer binding (through the first region of the first primer oligonucleotide) can occur substantially / preferably, discriminating the individual sequence variants of template strands. For this purpose, suitable reaction conditions are preferably used (so-called stringent reaction conditions). The polymerase is able to start synthesis from such correctly complementarily bound primers and synthesizes complementary strands on the basis of the respective template strand. This results in primer extension products which are substantially complementary to the respective template strand. During synthesis, the polymerase can not distinguish between these differences in template strands. The controller oligonucleotide is in double-stranded form in the primer / controller complex during the synthesis phase and does not interfere with the synthesis process.
In der Ausführungsform mit Kompetitor-Oligonukleotiden erfolgt in der Synthese-Phase ergänzend eine Kompetitor-Primer-Bindung und Verlängerung:  In the embodiment with competitor oligonucleotides, a competitor-primer bond and extension are additionally carried out in the synthesis phase:
Während der Synthese-Phase kann die Kompetitor-Primer-Bindung im Wesentlichen / bevorzugt unter Diskriminierung der einzelnen Sequenz-Varianten von Matrizensträngen stattfinden. Dazu werden bevorzugt geeignete Reaktionsbedingungen verwendet (sogenannte stringente Reaktionsbedingungen). Die Polymerase ist dabei in der Lage, von solchen korrekt komplementär gebundenen Kompetitor-Primern eine Synthese zu starten und synthetisiert jeweils komplementäre Stränge anhand des jeweiligen Matrizenstranges. Dabei resultieren Kompetitor- Primer-Verlängerungsprodukte, welche zum jeweiligen Matrizenstrang im Wesentlichen komplementär sind. Während der Synthese kann die Polymerase zwischen diesen Unterschieden der Matrizenstränge nicht unterscheiden.  During the synthesis phase, the competitor-primer binding may take place substantially / preferably with discrimination of the individual sequence variants of template strands. For this purpose, suitable reaction conditions are preferably used (so-called stringent reaction conditions). The polymerase is able to start a synthesis of such correctly complementarily bound competitor primers and synthesizes each complementary strands based on the respective template strand. This results in competitor primer extension products which are substantially complementary to the respective template strand. During synthesis, the polymerase can not distinguish between these differences in template strands.
Controlling-Phase (Fig. 4, 7 - 11): Controlling phase (FIGS. 4, 7 - 11):
Nach Abschluss der Synthese-Phase erfolgt die Freisetzung des Controller-Oligonukleotides aus dem doppelsträngigen Komplex Primer/Controller, z.B. durch Temperatur-Erhöhung (bei einer Temperatur, bei welcher die Primer/Controller-Komplexe zumindest teilweise dissoziiert sind, aber stabile Komplexe umfassend Primer-Verlängerungsprodukte/Matrizenstränge vorliegen). Das Controller-Oligonukleotid, welches nun zumindest teilweise in einzelsträngiger Form vorliegt, kann durch seinen ersten Bereich mit dem zweiten Bereich des Primers interagieren und somit die Strang-Verdrängung starten. Der Fortschritt der Ausbildung des Doppelstranges zwischen dem Primer-Verlängerungsprodukt und dem Controller hängt von der Übereinstimmung der Sequenzen des zweiten Bereichs des Controllers und des synthetisierten Anteils der jeweiligen Primer- Verlängerungsprodukte ab. Upon completion of the synthesis phase, the release of the controller oligonucleotide from the double-stranded complex primer / controller occurs, eg by increasing the temperature (at a temperature at which the primer / controller complexes are at least partially dissociated, but stable complexes comprising primers). Extension products / template strands are present). The controller oligonucleotide, which is now at least partially in single-stranded form, can through its first region to interact with the second region of the primer and thus start the strand displacement. The progress of the formation of the double strand between the primer extension product and the controller depends on the correspondence of the sequences of the second region of the controller and the synthesized portion of the respective primer extension products.
Die Synthese-Produkte (Primer-Verlängerungsprodukte) unterscheiden sich je nach verwendeten Primern und Matrizensträngen. Aufgrund dieser Unterschiede in den Primer- Verlängerungsprodukten ist das Ergebnis der Controlling-Phase unterschiedlich. Vorwiegend werden Primer-Verlängerungsprodukte mit einer hinreichenden Übereinstimmung in der Komplementarität mit dem zweiten Bereich des Controller-Oligonukleotids von ihrem Matrizenstrang abgelöst. Damit findet eine Diskrimierung zwischen den synthetisierten Primer- Verlängerungsprodukten in der Controlling-Phase statt: Die Controller-Oligonukleotide bilden vorzugsweise mit komplementären Primer-Verlängerungsprodukten doppelsträngige Komplexe. Bei einer Sequenzabweichung findet diese Doppelstrang-Bildung unzureichend statt. Aufgrund der gewählten Reaktionsbedingungen (bei einer Temperatur, bei welcher Primer/Controller-Komplexe zumindest teilweise dissoziiert sind, und stabile Komplexe umfassend Primer- Verlängerungsprodukte/Matrizenstränge vorliegen), verbleiben die Primer-Verlängerungsprodukte mit Sequenzunterschieden zu Controller-Strängen vorwiegend an ihre Matrizensträngen gebunden.  The synthesis products (primer extension products) differ depending on the primers and template strands used. Due to these differences in the primer extension products, the result of the controlling phase is different. Predominantly, primer extension products with a sufficient degree of complementarity with the second region of the controller oligonucleotide are detached from their template strand. Thus, there is a discrimination between the synthesized primer extension products in the controlling phase: The controller oligonucleotides preferably form double-stranded complexes with complementary primer extension products. In case of a sequence deviation, this double strand formation takes place insufficiently. Due to the reaction conditions chosen (at a temperature at which primer / controller complexes are at least partially dissociated and stable complexes comprising primer extension products / template strands), the primer extension products with sequence differences to controller strands remain predominantly attached to their template strands.
Die spezifisch gebildeten Kompetitor-Primer-Verlängerungsprodukte können nicht unter Mirwirkung eines Controllers von ihren Matrizensträngen gelöst werden, da den Kompetitor- Primern entsprechende zweite Bereiche (Primer-Überhang) fehlen, welche komplementär mit dem ersten Bereich des Controllers interagieren könnten.  The specifically formed competitor primer extension products can not be released from their template strands under the control of a controller since the competitor primers lack corresponding second regions (primer overhang) which could interact in a complementary manner with the first region of the controller.
Das nun vollständig oder teilweise abgelöste sequenzspezifische Primer-Verlängerungsprodukt kann in weiteren Analysen verwendet werden. Beispielsweise kann es aus dem Reaktionsansatz isoliert werden (in gebundener Form am Controller-Oligonukleotid). Weiterhin kann es als Bindungspartner für andere Oligonukleotide verwendet werden, z.B. Sonden. Weiterhin kann es selbst als Matrizen Strang auftreten, z.B. nach Bindung eines neuen Primers im 3'-Segment des Primerverlängerungsproduktes. The completely or partially detached sequence-specific primer extension product can be used in further analyzes. For example, it can be isolated from the reaction mixture (in bound form on the controller oligonucleotide). Furthermore, it can be used as a binding partner for other oligonucleotides, eg probes. Furthermore, it can even occur as a template strand, for example, after binding of a new primer in the 3 ' segment of the primer extension product.
Die in einer Primer-Verlängerungsreaktion synthetisierten spezifischen Primer- Verlängerungsprodukte können beispielsweise als eine Start-Nukleinsäure in nachfolgenden Amplifikations-Verfahren verwendet werden.  For example, the specific primer extension products synthesized in a primer extension reaction can be used as a starting nucleic acid in subsequent amplification procedures.
Synthese des Primerverlängerungsproduktes und Interaktion mit dem Controller erfolgen parallel zueinander (on-line Controlling) Synthesis of the primer extension product and interaction with the controller take place in parallel (on-line controlling)
Eine fehlerhafte Synthese von Primer-Verlängerungsprodukten durch Polymerasen stellt eine signifikante Problematik für die genetischen Analysen dar. Dabei werden beispielsweise einzelne Nukleotide durch die Polymerase während der Synthese ausgetauscht (z.B. statt eines korrekten C wird ein T eingebaut oder statt eines A wird ein G eingebaut, etc.). Diese Polymerase-Fehler können zur Verfälschung des Ergebnisses der Analyse führen, da sie den Inhalt der Sequenzen verändern. Die vorliegende Ausführungsform soll zur Verringerung der Synthese-Fehler in vollständig synthetisierten Primer-Verlängerungsprodukten bei einer Primer- Verlängerungsreaktion führen. A defective synthesis of primer extension products by polymerases represents a significant problem for the genetic analyzes. For example, individual nucleotides are exchanged by the polymerase during the synthesis (eg instead of a correct one) C is installed a T or instead of an A, a G is installed, etc.). These polymerase errors can falsify the result of the analysis as they alter the content of the sequences. The present embodiment is intended to reduce synthesis errors in fully synthesized primer extension products in a primer extension reaction.
Die technische Aufgabe dieser Ausführungsform wird dadurch gelöst, dass die Synthese eines Primer-Verlängerungsproduktes und die Elimination der fehlerhaft synthetisierten Stränge parallel zu Synthese stattfindet. Die Eliminierung der fehlerhaft synthetisierten Stränge erfolgt durch Trennung des Primer- Verlängerungsproduktes von seiner Matrize bevor das Primer- Verlängerungsprodukt seine volle Länge erreicht hat. Diese Trennung der Primer- Verlängerungsprodukte erfolgt unter Mitwirkung eines Controller-Oligonukleotids.  The technical problem of this embodiment is solved by the synthesis of a primer extension product and the elimination of the incorrectly synthesized strands occurring in parallel to synthesis. The elimination of the incorrectly synthesized strands is accomplished by separating the primer extension product from its template before the primer extension product has reached its full length. This separation of the primer extension products takes place with the assistance of a controller oligonucleotide.
Die Synthese des Primer-Verlängerungsproduktes und die Überprüfung mittels eines Controller- Oligonukleotides erfolgen im gleichen Ansatz (homogenes Assay), wobei die einzelnen Reaktionen im Wesentlichen parallel zu einander verlaufen. Damit erfolgt eine Einflussnahme der Controller- Oligonukleotide auf die Synthese während des Synthese-Vorganges. Die Synthese des Primer- Verlängerungsproduktes (P1 -Ext) während der Synthese-Phase und die Öffnung des Doppelstranges mittels eines Controller-Oligonukleotids (Controlling-Phase) sind derartig aneinander angepasst, dass vorwiegend eine prozessiv stattfindende korrekte Primer- Verlängerung in einer vollständigen Synthese in einem zum Matrizenstrang komplementären Primer-Verlängerungsprodukt resultiert. Bei einer nicht-prozessiven, vor allem fehlerhaften Primerverlängerung bzw. bei einer Synthese mit einem durch die Polymerase eingeführten Fehler in den synthetisierten Strang kommt es dagegen vorwiegend zu einer frühzeitigen Ablösung des teilweise verlängerten Primers vom Matrizenstrang durch das Controller-Oligonukleotid, wobei die Synthese des jeweiligen Primer-Verlängerungsproduktes dadurch vorzeitig unterbrochen wird. Das Produkt der vorzeitig abgebrochenen Synthese ist vorzugsweise an ein Controller-Oligonukleotid gebunden und bildet mit diesem einen unter Reaktionsbedingungen stabilen doppelsträngigen Komplex. Damit wird dieses unvollständige Produkt der weiteren Primer-Verlängerungsreaktion entzogen. Bevorzugt sollen dabei vollständige Primer-Verlängerungsprodukte bereitgestellt werden, welche eine höhere Komplementarität zum Matrizenstrang aufweisen.  The synthesis of the primer extension product and the checking by means of a controller oligonucleotide are carried out in the same way (homogeneous assay), the individual reactions being essentially parallel to one another. This results in an influence of the controller oligonucleotides on the synthesis during the synthesis process. The synthesis of the primer extension product (P1-Ext) during the synthesis phase and the opening of the double strand by means of a controller oligonucleotide (controlling phase) are adapted to one another in such a way that predominantly a processively occurring correct primer extension in a complete synthesis in resulting in a template strand complementary primer extension product. In a non-processive, especially faulty primer extension or in a synthesis with an introduced by the polymerase error in the synthesized strand, however, it comes mainly to an early detachment of the partially extended primer from the template strand by the controller oligonucleotide, the synthesis of respective primer extension product is thereby prematurely interrupted. The product of the prematurely terminated synthesis is preferably bound to a controller oligonucleotide and forms a double-stranded complex which is stable under reaction conditions. Thus, this incomplete product is removed from the further primer extension reaction. In this case, complete primer extension products should preferably be provided which have a higher complementarity with the template strand.
Im Ergebnis sollen vollständige Primer-Verlängerungsprodukte mit höherer Genauigkeit synthetisiert werden. Die fehlerhaften Primer-Verlängerungsprodukte umfassend mindestens einen Einbau-Fehler, der während der Synthese durch eine Polymerase eingeführt wird, sollen ausselektiert werden.  As a result, complete primer extension products are to be synthesized with higher accuracy. The defective primer extension products comprising at least one incorporation error introduced during synthesis by a polymerase are to be selected out.
Im Folgenden wird eine bevorzugte Ausführungsform mit homogenem Format beschrieben, bei welcher mindestens ein Matrizenstrang, mindestens ein Controller-Oligonukleotid, mindestens ein Primer-Oligonukleotid, mindestens eine Polymerase und dNTPs als Substrate in einem geeigneten Puffer-System zu Beginn der Reaktion vorliegen. Synthese-Phase. A preferred embodiment with a homogeneous format is described in which at least one template strand, at least one controller oligonucleotide, at least one primer oligonucleotide, at least one polymerase and dNTPs are present as substrates in a suitable buffer system at the beginning of the reaction. Synthesis phase.
Das Ziel der Synthese-Phase ist ein spezifisches Primer-Verlängerungsprodukt mittels einer Polymerase-vermittelten Synthese unter Verwendung eines Matrizenstranges zu synthetisieren. The goal of the synthesis phase is to synthesize a specific primer extension product by polymerase-mediated synthesis using a template strand.
Eine Primer-Verlängerungs-Reaktion umfasst eine vorzugsweise spezifische Primerbindung (erster Bereich des Primer-Oligonukleotides) an den Matrizenstrang an einer geeigneten Primer- Bindungsstelle (Sequenzsegment, welches in der Lage ist, komplementär den ersten Bereich des Primer-Oligonukleotides zu binden), wobei der zweite Bereich des Primers (Primer-Überhang) bevorzugt nicht an den Matrizenstrang bindet und somit für eine spätere Interaktion mit dem Controller zur Verfügung steht. Die Primer-Bindungsstelle kann vollständig einzelsträngig oder partiell einzelsträngig sein, so dass zumindest ein Teil des ersten Bereichs des Primers sequenzspezifisch an die Primer-Bindungsstelle binden kann via Ausbildung komplementärer Basenpaare (Watson-Crick-Regel). A primer extension reaction comprises a preferably specific primer binding (first region of the primer oligonucleotide) to the template strand at a suitable primer binding site (sequence segment capable of complementary binding to the first region of the primer oligonucleotide) the second region of the primer (primer overhang) preferably does not bind to the template strand and is therefore available for later interaction with the controller. The primer binding site can be completely single-stranded or partially single-stranded so that at least a portion of the first region of the primer can bind sequence-specifically to the primer binding site via formation of complementary base pairs (Watson-Crick rule).
Die Polymerase kann solche an die Primer-Bindungsstelle gebundenen Primer-Oligonukleotide in einer matrizenabhängigen Synthese unter Anknüpfung von komplementären Nukleotiden in den wachsenden Strang des Primers (3'-OH Ende) verlängern. Dabei entsteht ein zum Matrizenstrang komplementäres Primer- Verlängerungsprodukt (P1-Ext). Die Synthese des komplementären Stranges erfolgt in der Regel solange die Polymerase genügend Substrat im Ansatz vorfindet und bis genügende Sequenzsegmente im Matrizenstrang in geeigneter Form für die Polymerase als Matrize zur Verfügung stehen. Je nach Polymerase kann dabei eine der Bedingungen an das Sequenzsegment der Matrize sein, dass der Matrizenstrang einzelsträngig ist (unter Verwendung von Polymerasen ohne Strang-Verdrängungseigenschaften) oder auch partiell doppelsträngig (unter Verwendung von Polymerasen mit Strang-Verdrängungseigenschaften). Die Synthesereaktion erfolgt häufig unter über eine hinreichende Zeit (Gesamtzeit der Reaktion), so dass an mehr als 1 %, insbesondere an mehr als 10%, insbesondere an mehr als 30%, insbesondere an mehr als 50% der Matrizenstränge ein vollständiges Primer- Verlängerungsprodukt synthetisiert werden kann. The polymerase can extend such bound to the primer binding site primer oligonucleotides in a template-dependent synthesis of complementary attachment nucleotides into the growing strand of the primer (3 'end-OH). This results in a complementary to the template strand primer extension product (P1-Ext). The synthesis of the complementary strand usually takes place as long as the polymerase finds enough substrate in the batch and sufficient sequence segments in the template strand are available in a suitable form for the polymerase as a template. Depending on the polymerase, one of the conditions on the template segment may be that the template strand is single-stranded (using polymerases without strand displacement properties) or else partially double-stranded (using polymerases having strand displacement properties). The synthesis reaction often takes place over a sufficient time (total time of the reaction), so that at more than 1%, in particular more than 10%, in particular more than 30%, in particular more than 50% of the template strands a complete primer extension product can be synthesized.
In einer bevorzugten Ausführungsform erfolgt die Primer-Bindung unter Reaktions-Bedingungen, welche keine thermodynamisch stabile Bindung des ersten Bereichs der Primer-Oligonukleotides an die entsprechende komplementäre Position in der Matrize zulassen. Es besteht somit ein Gleichgewicht aus Bindungsereignissen und Dissoziierungsereignissen zwischen dem ersten Bereich des Primer-Oligonukleotides und der entsprechenden Primer-Bindungsstelle im Matrizenstrang. Bei Bindungsereignissen werden Komplexe gebildet, die den ersten Bereich des Primers und die entsprechenden Primer-Bindungspositonen am Matrizenstrang umfassen. Bei Dissoziierungsereignissen trennen sich diese Komplexe in einzelne Komponenten auf, so dass keine Primer-Verlängerungsreaktion mittels Polymerase starten kann. Solche Bedingungen liegen beispielsweise bei Reaktionstemperaturen vor, welche etwa um die Schmelztemperatur (Tm) eines solchen Komplexes (P1 /Matrizenstrang) liegen. Die Schmelztemperatur (Tm) sollte dabei unter gleichen Pufferbedingungen und Konzentrationen gemessen werden. Beispielsweise kann die Reaktion unter Reaktionstemperaturen im Bereich von Tm -5 °C bis Tm +30 °C durchgeführt werden, in besonderen Ausführungsformen im Bereich von Tm -5 °C bis etwa Tm +20 °C, in einer weiteren besonderen Ausführungsform im Bereich von Tm -5 °C bis Tm +10 °C. Auch unter solchen Bedingungen kann die Verlängerung des Primers durch eine Polymerase bei hinreichender Komplementarität des 3'-Segmentes des Primers mit der Matrize erfolgen. In a preferred embodiment, primer binding occurs under reaction conditions which do not allow thermodynamically stable binding of the first region of the primer oligonucleotide to the corresponding complementary position in the template. Thus, there is a balance of binding events and dissociation events between the first region of the primer oligonucleotide and the corresponding primer binding site in the template strand. In binding events, complexes are formed which comprise the first region of the primer and the corresponding primer binding positions on the template strand. In dissociation events, these complexes separate into individual components so that no primer extension reaction can start by means of polymerase. Such conditions are present, for example, at reaction temperatures which are about the melting temperature (Tm) of such a complex (P1 / template strand). The melting temperature (Tm) should be measured under the same buffer conditions and concentrations. For example, the Reaction can be carried out under reaction temperatures in the range of Tm -5 ° C to Tm +30 ° C, in particular embodiments in the range of Tm -5 ° C to about Tm +20 ° C, in another particular embodiment in the range of Tm -5 ° C to Tm +10 ° C. Even under such conditions, extension of the primer by a polymerase can occur with sufficient complementarity of the 3 ' segment of the primer with the template.
Die Struktur der Primer und der Controller-Oligonukleotide, sowie die Reaktionsbedingungen der Synthese-Phase sind derartig gewählt, dass der Komplex umfassend Primer/Controller- Oligonukleotid vorwiegend im Gleichgewicht mit seinen Einzelkomponenten liegt (Komplex- Bildung und Komplex-Dissoziation erfolgen parallel zu einander). Solche Bedingungen liegen beispielsweise bei Reaktionstemperaturen vor, welche etwa um die Schmelztemperatur (Tm) eines solchen Komplexes (Primer/Controller-Oligonukleotid) liegen. Die Schmelztemperatur (Tm) sollte dabei unter gleichen Pufferbedingungen und Konzentrationen gemessen werden. Beispielsweise kann die Reaktion unter Reaktionstemperaturen im Bereich von Tm -5 °C bis Tm +30 °C durchgeführt werden, in besonderen Ausführungsformen zwischen etwa Tm -5 °C bis etwa Tm +20 °C, in einer weiteren bestimmten Ausführungsform zwischen etwa Tm -5 °C bis etwa Tm + 10 °C, in bestimmten Ausführungsformen zwischen etwa Tm -5 °C bis etwa Tm +5 °C, in einer weiteren bestimmten Ausführungsform zwischen etwa Tm - 5°C bis etwa Tm -2 °C. Die Wahl solcher Bedingungen kann im Einzelfall experimentell durch Messung der Schmelztemperaturen (Tm) für solche Komplexe ermittelt werden.  The structure of the primers and the controller oligonucleotides, as well as the reaction conditions of the synthesis phase are chosen such that the complex comprising primer / controller oligonucleotide is predominantly in equilibrium with its individual components (complex formation and complex dissociation occur parallel to each other) , Such conditions are for example at reaction temperatures, which are about the melting temperature (Tm) of such a complex (primer / controller oligonucleotide). The melting temperature (Tm) should be measured under the same buffer conditions and concentrations. For example, the reaction may be carried out at reaction temperatures in the range of Tm -5 ° C to Tm + 30 ° C, in particular embodiments between about Tm -5 ° C to about Tm + 20 ° C, in another particular embodiment between about Tm - 5 ° C to about Tm + 10 ° C, in certain embodiments between about Tm -5 ° C to about Tm + 5 ° C, in another particular embodiment between about Tm - 5 ° C to about Tm -2 ° C. The choice of such conditions can be determined experimentally in individual cases by measuring the melting temperatures (Tm) for such complexes.
Auch wenn der Primer im Überschuss zum Controller-Oligonukleotid eingesetzt wird, erfolgt vorzugsweise keine vollständige Absättigung des Controller-Oligonukleotids durch das Primer- Oligonukleotid.  Even if the primer is used in excess of the controller oligonucleotide, preferably no complete saturation of the controller oligonucleotide by the primer oligonucleotide takes place.
Bei solchen Reaktionsbedingungen erfolgt sowohl Bildung und Dissoziation von Primer / Primer- Bindungsstelle-Komplexen als auch Bildung und Dissoziation von Primer/ Controller- Oligonukleotid-Komplexen. Die Strukturen und Reaktionsbedingungen sind derartig aufeinander angepasst, dass bei solchen Bedingungen die Verlängerung des Primers durch eine Polymerase bei hinreichender Komplementarität des 3'-Segmentes des Primers mit der Matrize erfolgen kann.Under such reaction conditions, formation and dissociation of primer / primer-binding site complexes as well as formation and dissociation of primer / controller-oligonucleotide complexes occur. The structures and reaction conditions are adapted to each other in such a way that, under such conditions, extension of the primer by a polymerase can occur with sufficient complementarity of the 3 ' segment of the primer with the template.
Vorteilhaft sind dabei Kombinationen von Strukturen der einzelnen Komponenten und der Reaktionsbedingungen, welche bereits bei einer Primer-Verlängerung von nur wenigen Nukleotiden dazu führen, dass sogar ein unvollständig verlängertes Primer-Verlängerungsprodukt an das Controller-Oligonukleotid fester gebunden werden kann als ein noch unverlängerter Primer. Dies erfolgt in der Regel dadurch, dass das Controller-Oligonukleotid mit seinem dritten Bereich eine komplementäre Bindung mit einem Primer-Verlängerungsprodukt eingehen kann und somit zusätzliche Bindungspositionen verglichen mit einem Primer/ Controller-Komplex aufweist. Dank einer solchen stabileren Bindung können auch unvollständig verlängerte Primer mit Controller- Oligonukleotiden Komplexe bilden und werden dank einer hinreichenden Stabilität dieser Komplexe der Reaktion entzogen. Da das Controller-Oligonukleotid keine Matrizenfunktion unterstützt (z.B. durch Modifikation), werden unvollständig verlängerte, an das Controller- Oligonukleotid gebundene Primer nicht vervollständigt. Aus diesem Grund umfasst vorzugsweise der gesamte dritte Bereich des Controller-Oligonukleotides solche Modifikationen. Die Fortführung der Synthese an solchen unvollständig verlängerten Primer-/Controller-Komplexen kann erst dann erfolgen, wenn diese erneut aus dem Komplex mit dem Controller-Oligonukleotid freigesetzt werden. Aufgrund vorteilhaft gewählter Reaktionsbedingungen erfolgt dies allerdings nur in einem sehr begrenzten Maß. Somit können unvollständig verlängerte Primer-Verlängerungsprodukte während der Synthese-Reaktion in Komplexen mit Controller-Oligonukleotiden gebunden werden.Combinations of structures of the individual components and the reaction conditions are advantageous, which even with a primer extension of only a few nucleotides lead to the fact that even an incompletely extended primer extension product can be more tightly bound to the controller oligonucleotide than a primer that is still extender. This is usually done by allowing the controller oligonucleotide to form a complementary bond with a primer extension product with its third region, thus having additional binding positions compared to a primer / controller complex. Such a more stable binding also allows incompletely extended primers to form complexes with controller oligonucleotides and, due to sufficient stability of these complexes, be removed from the reaction. Since the controller oligonucleotide does not support matrix function (eg, by modification), incompletely extended, to the controller Oligonucleotide bound primer not completed. For this reason, preferably the entire third region of the controller oligonucleotide comprises such modifications. The continuation of the synthesis of such incompletely extended primer / controller complexes can only take place when they are released again from the complex with the controller oligonucleotide. Due to advantageous selected reaction conditions, however, this is done only to a very limited extent. Thus, incompletely extended primer extension products can be bound in complexes with controller oligonucleotides during the synthesis reaction.
Das Controller-Oligonukleotid kann während der ablaufenden Primer-Verlängerungsreaktion (parallel zu dieser Reaktion) sowohl mit Primer-Oligonukleotiden, mit teilweise verlängerten Primern als auch mit vollständig verlängerten Primern interagieren. Diese Interaktion beginnt am zweiten Bereich des Primers. The controller oligonucleotide may interact during the ongoing primer extension reaction (in parallel with this reaction) with both primer oligonucleotides, partially extended primers, and fully extended primers. This interaction begins at the second region of the primer.
Polymerasen: polymerases:
In dieser bevorzugten Ausführungsform werden vorwiegend hinreichend prozessive Polymerasen verwendet, z.B. Bst-Large-Fragment, Phi29 Polymerase oder Polymerasen mit verbesserter Prozessivität (z.B. Phusion Polymerase ist ein Ergebnis einer Kopplung einer thermostabilen Polymerase mit einem Protein, welches die Bindung der Polymerase an die DNA verlängert) oder ihre Modifikationen. Dadurch erfolgt eine Strang-Synthese rasch, so dass auch während der Synthese entstehende Einbaufehler zügig überwunden werden. Bevorzugt werden Controller- Oligonukleotide in Konzentrationen von etwa 0,1 mM bis etwa 20 pM eingesetzt. Dies ermöglich eine hinreichend häufige Interaktion mit Primer-Verlängerungsprodukten, so dass ein Einfluss auf die Qualität der Primer-Verlängerungsprodukte zu erwarten ist.  In this preferred embodiment, predominantly sufficient processive polymerases are used, e.g. Bst-Large fragment, Phi29 polymerase or polymerases with improved processivity (e.g., phage polymerase is a result of a coupling of a thermostable polymerase with a protein that extends the binding of the polymerase to the DNA) or their modifications. This results in a strand synthesis quickly, so that even during the synthesis resulting installation errors are overcome quickly. Preferably, controller oligonucleotides are used in concentrations of about 0.1 mM to about 20 pM. This allows a sufficiently frequent interaction with primer extension products so that an impact on the quality of primer extension products is expected.
In einer anderen Ausführungsform werden Polymerasen mit geringerer Prozessivität (z.B. Taq Polymerase, Vent-Polymerase, Pfu-Polymerase) verwendet. Dadurch verläuft die Synthese in der Regel langsamer und erfordert wiederholte Bindungsereignisse der Polymerase. Aus diesem Grund werden hier bevorzugt Controller-Konzentrationen von etwa 5 nM bis etwa 1 pM verwendet. In another embodiment, lower processivity polymerases (e.g., Taq polymerase, Vent polymerase, Pfu polymerase) are used. As a result, the synthesis generally proceeds more slowly and requires repeated binding events of the polymerase. For this reason, controller concentrations of about 5 nM to about 1 pM are preferably used here.
Polymerasen sind vorwiegend in der Lage, bei nur einem Bindungsereignis an einen Primer-/ Matrizenstrang-Komplex mehrere Nukleotide (z.B. mehr als 15 Nukleotide, besser mehr als 30 Nukleotide, bevorzugt mehr als 50 Nukleotide) an das wachsende Ende des Primers bzw. Primer- Verlängerungsproduktes anzuknüpfen. Im Gegensatz dazu stehen gering-prozessive Polymerasen, wie Taq Polymerase und Klenow Polymerase, oder gänzlich distributive Polymerasen, welche nur wenige Nukleotide bei einem Bindungsereignis anknüpfen (in der Regel unter 8 bis 15 Nukleotide). Eine vorwiegend prozessive Synthese ist somit mit der Synthese innerhalb eines Bindungsereignisses der Polymerase an den Primer-Matrizen-Komplex assoziiert.Polymerases are predominantly able to attach several nucleotides (eg more than 15 nucleotides, better more than 30 nucleotides, preferably more than 50 nucleotides) to the growing end of the primer or primer in the case of only one binding event to a primer / template strand complex. Extension product to tie. In contrast, low-affinity polymerases, such as Taq polymerase and Klenow polymerase, or entirely distributive polymerases, which bind only a few nucleotides in a binding event (usually less than 8 to 15 nucleotides). A predominantly processive synthesis is thus associated with the synthesis within a binding event of the polymerase to the primer-template complex.
Weiterhin wird die hohe Prozessivität der Polymerase durch ausreichende Komplementarität des 3'-Endes des wachsenden Primer-Verlängerungsproduktes begünstigt. In der Regel erfolgt die Synthese mit hoher Geschwindigkeit und prozessiv besonders dann vorteilhaft, wenn das 3'-Ende des zu verlängernden Stranges eine durch die Matrize vorgegebene Strukturanforderung hinsichtlich der Komplementarität erfüllt (in der Regel sind damit komplementäre, Perfekt-Match- Situation bei Nukleobasen zwischen dem 3'-Ende bzw. 3'-Segment des zu verlängernden Stranges und der entsprechenden Matrize gemeint). Abweichungen davon, d.h. Mismatches zwischen dem 3'-Ende oder 3'-Segment des zu verlängernden Stranges (z.B. Positionen -1 bis - 5) und dem Matrizenstrang führen in der Regel zu einer mehr oder weniger ausgeprägten Verlangsamung bzw. gar Pausieren der Synthese durch die Polymerase. Diese Verlangsamung in der Katalysegeschwindigkeit der Polymerase ist einem Fachmann bekannt. Das Ausmaß einer solchen Verlangsamung bzw. Pausieren in der Katalyse hängt sowohl von der Polymerase als auch von den Reaktionsbedingungen (z.B. Konzentration von dNTPs) sowie von der Art des Mismatches ab. Die Fortführung der Synthese über ein solches Mismatch hinaus erfordert in der Regel eine längere Reaktionszeit. Furthermore, the high processivity of the polymerase is favored by sufficient complementarity of the 3 ' end of the growing primer extension product. In general, the synthesis is carried out at high speed and processively particularly advantageous when the 3 ' end of the strand to be elongated fulfills a structural requirement for complementarity given by the template (as a rule, this refers to a complementary, perfect-match situation in the case of nucleobases between the 3 ' end or 3 ' segment of the strand to be elongated and the corresponding template ). Deviations from this, ie mismatches between the 3 ' end or 3 ' segment of the strand to be extended (eg positions -1 to - 5) and the template strand usually lead to a more or less pronounced slowing down or even pausing of the synthesis the polymerase. This slowdown in the rate of polymerase catalysis is known to one skilled in the art. The extent of such slowing or pausing in catalysis depends on both the polymerase and the reaction conditions (eg, concentration of dNTPs) as well as the nature of the mismatch. The continuation of the synthesis beyond such a mismatch usually requires a longer reaction time.
Da alle Polymerasen mit nur einer beschränkten Präzision die matrizenabhängige Katalyse durchführen, erfolgt bei jeder Primer-Verlängerung eine mehr oder weniger ausgeprägte Fehlsynthese eines Primerverlängerungsproduktes. Während einer matrizenabhängigen Synthese finden Fehl-Einbau-Ereignisse statt (z.B. es wird ein dCTP eingebaut statt eines dTTP gegenüber eines Adenosines im Matrizenstrang). Dabei kommt es zu mehr oder weniger ausgeprägten Pausen in der Synthese.  Since all polymerases perform the template-dependent catalysis with only limited precision, a more or less pronounced false synthesis of a primer extension product occurs with each primer extension. During a template-dependent synthesis, misincorporation events take place (e.g., a dCTP is incorporated instead of a dTTP over an adenosine in the template strand). This leads to more or less pronounced breaks in the synthesis.
Bei Verwendung einer ausreichend langen Reaktionszeit kann eine solche Mismatch-Position (umfassend in der Regel ein bis zwei Nukleotide) von der Polymerase überwunden werden und die matrizenabhängige Synthese kann in der Regel fortgeführt werden. Das Ausmaß der Überwindung hängt sowohl von der Art des Mismatches als auch von Polymerase ab.  By using a sufficiently long reaction time, such a mismatch position (comprising, as a rule, one to two nucleotides) can be overcome by the polymerase and the template-dependent synthesis can as a rule be continued. The extent of overcoming depends on both the type of mismatch and polymerase.
Polymerasen können sowohl eine 3'-Exonuklease-Aktivität (Proofreading Polymerasen, z.B. Phusion Polymerase) umfassen oder auch nicht (Bst-Large Fragment). Je nach Art der verwendeten Matrize können DNA-abhängige Polymerasen oder RNA-abhängige Polymerasen verwendet werden. Polymerases may or may not both comprise a 3 ' exonuclease activity (proofreading polymerases, eg, phage polymerase) (Bst-Large Fragment). Depending on the type of template used, DNA-dependent polymerases or RNA-dependent polymerases can be used.
Matrizenstrang: template strand:
Der Matrizenstrang umfasst eine Primer-Bindungsstelle, so dass unter gewählten Reaktionsbedingungen eine Bindung des ersten Bereichs des Primers stattfinden und eine durch die Polymerase vermittelte Synthese des Stranges stattfinden kann. Weiterhin umfasst ein Matrizenstrang eine Zielsequenz. Diese Zielsequenz stellt in der Regel das Sequenzsegment des Matrizenstranges dar, welcher die Matrizenfunktion für die Synthese des komplementären Stranges übernimmt. Vorzugsweise ist der Matrizenstrang und das Primer-Oligonukleotid in ihrem Design derartig einander angepasst, dass der zweite Bereich des Primer-Oligonukleotides nicht an den Matrizenstrang bindet oder zumindest keine stabile Bindung eingeht und somit potenziell in der Lage ist, mit dem ersten Bereich des Controller-Oligonukleotides zu interagieren. Im Allgemeinen können sowohl DNA als auch RNA als Matrizenstränge auftreten. Die Primer-Bindungsstelle der Matrize liegt vorzugsweise in einer einzelsträngigen Form vor und lässt eine sequenzspezifische Bindung des ersten Bereichs des Primer-Oligonukleotides an die Matrize zu. The template strand comprises a primer binding site such that under selected reaction conditions binding of the first region of the primer occurs and polymerase mediated synthesis of the strand can occur. Furthermore, a template strand comprises a target sequence. This target sequence usually represents the sequence segment of the template strand, which performs the template function for the synthesis of the complementary strand. Preferably, the template strand and the primer oligonucleotide are adapted in their design such that the second region of the primer oligonucleotide does not bind to the template strand, or at least does not form stable binding, and thus is potentially able to interfere with the first region of the controller. Oligonucleotide to interact. In general, both DNA and RNA can occur as template strands. The primer binding site of the template is preferably in a single-stranded form and allows for site-specific binding of the first region of the primer oligonucleotide to the template.
Das Segment des Matrizen-Stranges, welches als Matrize für die Synthese des komplementären Stranges durch die Polymerase dient, kann in bestimmten Ausführungsformen vollständig oder überwiegend (zu mehr als 50%) einzelsträngig unter Reaktionsbedingungen vorliegen. In einer anderen Ausführungsform ist dieses Segment überwiegend (zu mehr als 50%) doppelsträngig. Die bei der Synthese verwendeten Polymerasen müssen entsprechend gewählt werden. Bei einzelsträngigen Matrizen können Polymerasen ohne ausgeprägte Strangverdrängung verwendet werden, z.B. Phusion Polymerase. Bei überwiegend doppelsträngigen Segmenten der Matrize werden bevorzugt Polymerasen mit strangverdrängenden Eigenschaften verwendet, z.B. Bst- Polymerase Large Fragment.  The segment of the template strand which serves as a template for the synthesis of the complementary strand by the polymerase may, in certain embodiments, be wholly or predominantly (more than 50%) single-stranded under reaction conditions. In another embodiment, this segment is predominantly (more than 50%) double-stranded. The polymerases used in the synthesis must be selected accordingly. For single-stranded templates, polymerases can be used without marked strand displacement, e.g. Phusion polymerase. For predominantly double-stranded segments of the template, preference is given to using polymerases having strand-displacing properties, e.g. Bst polymerase Large Fragment.
Primer: primer:
In bestimmten Ausführungsformen kann die Primerbindungsstelle für den Primer im 3'-Segment der Matrize liegen. In einer solchen Ausführungsform ist es vorteilhaft, wenn das Primer- Oligonukleotid eine Modifikation umfasst, welche die Polymerase am Kopieren des zweiten Primer- Bereichs hindert. In certain embodiments, the primer binding site may be for the primer in the 3 ' segment of the template. In such an embodiment, it is advantageous if the primer oligonucleotide comprises a modification which prevents the polymerase from copying the second primer region.
In einer anderen Ausführungsform kann die Matrize in ihrem 3'-Segment deutlich über die Primer- Bindungsstelle des Primers hinausgehen. Die Länge eines solchen Überhangs kann von wenigen Nukleotiden bis hin zu mehreren Kilobasen reichen. Die Struktur eines solchen Matrizenstranges führt dazu, dass der Primer-Überhang nicht von der Polymerase kopiert wird, ausgehend vom 3'- Ende der Matrize. Daher muss der Primer bei einer solchen Ausführungsform nicht zwingend eine Block-Gruppe im zweiten Bereich des Primers umfassen. In another embodiment, the template in its 3 ' segment can go well beyond the primer binding site of the primer. The length of such an overhang can range from a few nucleotides to several kilobases. The structure of such a template strand results in the primer overhang not being copied by the polymerase starting from the 3 ' end of the template. Therefore, in such an embodiment, the primer need not necessarily comprise a block group in the second region of the primer.
Die Synthese des Primer-Verlängerungsproduktes erfolgt via Polymerase als matrizenabhängige Synthese. Es ist vorteilhaft, wenn der Fortschritt der Synthese des Primer- Verlängerungsproduktes begrenzt wird und somit ein gewünschtes Primer-Verlängerungsprodukt in seiner Länge begrenzt wird.  The synthesis of the primer extension product via polymerase as a template-dependent synthesis. It is advantageous if the progress of the synthesis of the primer extension product is limited and thus a desired primer extension product is limited in its length.
Die Länge des vollständigen Primer-Verlängerungsproduktes wird vorzugsweise durch Verfügbarkeit eines Sequenzsegmentes der Matrize begrenzt, welcher von der Polymerase zur Synthese verwendet werden kann. Das kann beispielsweise durch die Begrenzung des Matrizenstranges im 5'-Segment erreicht werden. Diese Begrenzung hindert dabei die verwendete Polymerase daran, eine Fortsetzung der Synthese fortzuführen. Eine solche Begrenzung kann beispielsweise durch ein Strang-Ende (Strang-Abbruch erreicht z.B. durch physikalische Einwirkung oder durch ein Enzym, z.B. eine Endonuklease oder eine Restriktionsendonuklease) erreicht werden oder durch Verwendung einer oder mehrerer Modifikationen im Strang (z.B. Spacer oder Linker), welche die Polymerase an der Synthese hindern, oder durch Nukleotid- Modifikationen (z.B. Nukleobasen-Modifikation, wie Iso-C oder Iso-G, oder der Zucker-Phosphat- Anteile, wie 2'-0-Me, 2'-MOE, Morpholino, PNA etc.). The length of the complete primer extension product is preferably limited by availability of a sequence segment of the template which can be used by the polymerase for synthesis. This can be achieved, for example, by limiting the matrix strand in the 5 ' segment. This limitation prevents the polymerase used from continuing the synthesis. Such a limitation can be achieved, for example, by strand termination (strand termination achieved eg by physical action or by an enzyme, eg an endonuclease or a restriction endonuclease) or by using one or more modifications in the strand (eg spacer or linker) prevent the polymerase from being synthesized, or by nucleotide Modifications (eg nucleobase modification as Iso-C and Iso-G, or the sugar-phosphate moieties such as 2 '-0-Me, 2' MOE, morpholino, PNA etc.).
Unter Verwendung von langen Matrizensträngen, z.B. genomische DNA oder mRNA oder langen PCR-Fragmenten, ist es vorteilhaft, wenn die Synthese der Polymerase durch Verwendung von zusätzlichen Oligonukleotiden an vorbestimmten Segmenten angehalten bzw. gestoppt wird. In einer solchen Ausführungsform wird der Fortschritt der Synthese des Primer- Verlängerungsproduktes durch Verwendung eines sogenannten Block-Oligonukleotides limitiert. Ein solches Block-Oligonukleotid kann unter Reaktionsbedingungen der Synthese-Phase vorzugsweise vorwiegend sequenzspezifisch an den Matrizenstrang via komplementäre Bindung hybridisieren. Ein solches Block-Oligonukleotid, wenn gebunden an den Matrizenstrang, hindert die Polymerase daran, den Matrizenstrang über dieses Oligonukleotid hinaus abzulesen. Je nach verwendeter Art der Polymerase und ihre Ausstattung kommen dafür verschiedene Oligonukleotide in Frage. Die Auswahl der Oligonukleotid-Struktur, der Polymerase und der Reaktionsbedingungen richten sich dabei danach, dass die fortschreitende Synthese durch die Polymerase gehindert bzw. blockiert wird.  Using long template strands, e.g. genomic DNA or mRNA or long PCR fragments, it is advantageous if the synthesis of the polymerase is stopped or stopped by using additional oligonucleotides on predetermined segments. In such an embodiment, the progress of the synthesis of the primer extension product is limited by using a so-called block oligonucleotide. Such a block oligonucleotide may preferably hybridize under sequence conditions of the synthesis phase predominantly sequence-specifically to the template strand via complementary binding. Such a block oligonucleotide, when attached to the template strand, prevents the polymerase from reading the template strand beyond that oligonucleotide. Depending on the type of polymerase used and its equipment, different oligonucleotides are suitable for this purpose. The selection of the oligonucleotide structure, the polymerase and the reaction conditions are based on the fact that the progressive synthesis is hindered or blocked by the polymerase.
Beispiele für solche zum Stopp führenden Oligonukleotide sind einem Fachmann bekannt.  Examples of such oligonucleotides leading to the stop are known to a person skilled in the art.
• Ein Beispiel stellt die Hinderung von Polymerasen mit Strang-Verdrängungseigenschaften dar. Oligonukleotide mit mehreren doppelstrangstabilisierenden Modifikationen, z.B. LNA oder PNA, führen in der Regel dazu, dass die Polymerase die Synthese über die Bindungsstelle des Oligonukleotids nicht fortführen kann. Beispielsweise können zur Matrize komplementäre Oligonukleotide mit einer Länge von ca. 20 - 50 Nukleotiden mit ca. 7 - 30 LNA-Modifikationen, beispielsweise eine Bst Polymerase (Large Fragment) daran hindern, dieses Oligonukleotid via polymeraseabhängiger Strangverdrängung von der Matrize abzulösen.  An example is the prevention of polymerases with strand displacement properties. Oligonucleotides with several double strand stabilizing modifications, e.g. LNA or PNA typically results in the polymerase being unable to continue synthesis via the oligonucleotide binding site. For example, template-complementary oligonucleotides of about 20-50 nucleotides in length with about 7-30 LNA modifications, for example, a Bst polymerase (large fragment), can prevent this oligonucleotide from detaching via polymerase-dependent strand displacement from the template.
Die Länge des vollständigen während der matrizenabhängigen Synthese entstandenen P1-Ext und die Länge des dazu passenden Controller-Oligonukleotides kann unterschiedlich gewählt werden. The length of the complete P1-ext generated during template-dependent synthesis and the length of the matching controller oligonucleotide can be chosen differently.
In bestimmten Ausführungsformen wird die Länge des Controller-Oligonukleotides und die Länge des zu erwartenden vollständig synthetisierten Primer-Verlängerungsproduktes derartig aufeinander abgestimmt, dass das Controller-Oligonukleotid vollständig den von der Polymerase synthetisierten Bereich abdeckt. Bei dieser Ausführungsform kann ein Controller-Oligonukleotid das P1 -Ext von der Matrize vollständig ablösen. Im 3'-Segment des P1 -Ext verbleiben keine freien Nukleotide zur Interaktion mit der Matrize während der Controlling-Phase (s.u.) In certain embodiments, the length of the controller oligonucleotide and the length of the expected fully synthesized primer extension product are matched so that the controller oligonucleotide completely covers the region synthesized by the polymerase. In this embodiment, a controller oligonucleotide can completely detach the P1 -ext from the template. In the 3 ' segment of the P1 -ex, no free nucleotides remain for interaction with the template during the controlling phase (see below)
In einer weiteren bevorzugten Ausführungsform wird die Länge des Controller-Oligonukleotides und die Länge des zu erwartenden Primer-Verlängerungsproduktes derartig aufeinander abgestimmt, dass die Länge des synthetisierten Bereichs des Primer-Verlängerungsproduktes über die Länge des Controller-Oligonukleotids hinausgeht. Das 3'-Segment des Primer- Verlängerungsproduktes umfasst damit ein Sequenzsegment, welches nicht vom Controller- Oligonukleotides überprüft wird. Bei der Interaktion des P1-Ext mit dem Controller verbleibt somit ein doppelsträngiges Segment aus P1-Ext und Matrize, welcher nicht von Controller überprüft wird.In a further preferred embodiment, the length of the controller oligonucleotide and the length of the expected primer extension product are matched to one another such that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide. The 3 ' segment of the primer extension product thus comprises a sequence segment which does not belong to the controller Oligonucleotide is checked. When the P1-Ext interacts with the controller, a double-stranded segment of P1-Ext and matrix remains, which is not checked by the controller.
In bestimmten Ausführungsformen kann dieses doppelsträngige Segment unter den Reaktionsbedingungen der Controlling-Phase spontan dissoziieren, z.B. infolge einer temperaturbedingten Strangöffnung (z.B. bei Temperaturen von ca. 50 - 70°C). Die Länge dieses 3'-Segmentes des Primer-Verlängerungsproduktes (ohne Interaktion mit Controller- Oligonukleotid) kann beispielsweise Sequenzlängen umfassen, welche in folgenden Bereichen liegen: von 1 bis 10 Nukleotiden, von 10 bis 20 Nukleotiden, von 30 bis 40 Nukleotiden, von 40 bis 50 Nukleotiden, von 50 bis 70 Nukleotiden, von 70 bis 100 Nukleotiden. In certain embodiments, this double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, eg due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C). The length of this 3 ' segment of the primer extension product (without interaction with controller oligonucleotide) may comprise, for example, sequence lengths which lie in the following ranges: from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides, from 50 to 70 nucleotides, from 70 to 100 nucleotides.
In bestimmten Ausführungsformen kann dieses doppelsträngige Segment unter den Reaktionsbedingungen der Controlling-Phase nicht spontan dissoziieren, z.B. infolge einer temperaturbedingten Strangöffnung (z.B. bei Temperaturen von ca. 50 - 70°C). Die Länge dieses 3'-Segmentes des Primer-Verlängerungsproduktes (ohne Interaktion mit Controller- Oligonukleotid) kann beispielsweise Sequenzlängen umfassen, welche in folgenden Bereichen liegen: mehr als 20 Nukleotide, mehr als 30 Nukleotide, mehr als 40 Nukleotide, mehr als 50 Nukleotide, mehr als 100 Nukleotide, mehr als 200 Nukleotide, mehr als 500 Nukleotide. Die Maximallänge kann bis zu etwa 10.000 Nukleotide reichen. In certain embodiments, this double-stranded segment can not spontaneously dissociate under the reaction conditions of the controlling phase, eg due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C). The length of this 3 ' segment of the primer extension product (without interaction with controller oligonucleotide) may comprise, for example, sequence lengths which lie in the following ranges: more than 20 nucleotides, more than 30 nucleotides, more than 40 nucleotides, more than 50 nucleotides, more than 100 nucleotides, more than 200 nucleotides, more than 500 nucleotides. The maximum length can reach up to about 10,000 nucleotides.
Controlling-Phase (Fig. 4, 7 - 11). Controlling phase (Fig. 4, 7 - 11).
Das Ziel der Controlling-Phase besteht darin, das synthetisierte Primer-Verlängerungsprodukt auf seine Übereinstimmung mit der vorgegebenen Sequenz während der ablaufenden Synthese zu überprüfen (Real-Time Kontrolle). Die korrekten, vollkomplementären Primer- Verlängerungsprodukte sollen in voller Länge synthetisiert werden. Dabei sollen die während der Synthese entstehenden Fehl-Einbauereignisse durch die Polymerase aus der weiteren Verlängerungsreaktion ausgeschlossen sein. Insbesondere sollen während der Synthese durch eine Polymerase entstehende Mismatches zwischen Primer-Verlängerungsprodukten an ihrer Verlängerung am Matrizenstrang gehindert werden. Dazu dient die Bildung eines Komplexes aus einem solchen mismatch umfassenden Primer-Verlängerungsprodukt und einem Controller- Oligonukleotid während der Primer-Verlängerungsreaktion. Die an das Controller-Oligonukleotid gebundenen terminales-mismatch-umfassenden Primer-Verlängerungsprodukte sollen unter Reaktionsbedingungen vorzugsweise in diesen Komplexen verbleiben. Damit werden Primer- Verlängerungsprodukte, bei welchen der Fortschritt der Synthese-Reaktion verlangsamt ist (z.B. infolge eines Mismatch-Einbaus durch Polymerase, dh. Polymerase-Fehler) von ihrem Matrizenstrang vorzeitig abgelöst werden, noch bevor ihre Synthese in voller Länge abgeschlossen werden kann. Dadurch wird verhindert, dass es zu einer vollständigen Synthese eines fehlerhaften Primer-Verlängerungsproduktes kommt.  The aim of the controlling phase is to check the synthesized primer extension product for its agreement with the given sequence during the ongoing synthesis (real-time control). The correct, fully complementary primer extension products are to be synthesized in full length. The resulting during the synthesis of misincorporation events by the polymerase from the further extension reaction should be excluded. In particular, mismatches between primer extension products resulting from a polymerase during synthesis are to be prevented from lengthening on the template strand. This is done by forming a complex of such a mismatch-containing primer extension product and a controller oligonucleotide during the primer extension reaction. The terminal mismatch-containing primer extension products bound to the controller oligonucleotide should preferably remain in these complexes under reaction conditions. Thus, primer extension products in which the progress of the synthesis reaction is slowed down (e.g., due to polymerase mismatch incorporation, ie, polymerase errors) are prematurely released from their template strand even before their full length synthesis can be completed. This prevents complete synthesis of a defective primer extension product.
Durch wiederholte Interaktionen zwischen dem Controller-Oligonukleotid und den Primer- Oligonukleotiden sowie zwischen dem Controller-Oligonukleotid und den Primer- Verlängerungsprodukten (die Interaktion beginnt mit der Bindung des Controllers an den Primer- Überhang) während ihrer Entstehung kommt es zur Konkurrenz zwischen Synthese-Vorgang und einem Strang-Verdrängungsvorgang durch das Controller-Oligonukleotid. Diese Reaktionen können durch Veränderung der Konzentrationen der einzelnen Komponenten einander angepasst werden. So kann beispielsweise die Konzentration von Controller-Oligonukleotiden variiert werden zwischen 0.001 pmol/l und 50 pmol/l, insbesondere zwischen 0,01 pmol/ 1 und 10 pmol/l. Damit kann beispielsweise bei konstant gehaltener Primer-Verlängerungsreaktion das Ausmaß der Controller-abhängigen Strang-Verdrängung beeinflusst werden. By repeated interactions between the controller oligonucleotide and the primer oligonucleotides and between the controller oligonucleotide and the primer Extension products (the interaction begins with the binding of the controller to the primer overhang) as they are generated, there is competition between the synthesis process and a strand displacement event by the controller oligonucleotide. These reactions can be adjusted by changing the concentrations of the individual components. Thus, for example, the concentration of controller oligonucleotides can be varied between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 10 pmol / l. Thus, for example, with constant held primer extension reaction, the extent of the controller-dependent strand displacement can be influenced.
Die im Ansatz frei verfügbaren Controller-Oligonukleotide können mit dem zweiten Primer-Bereich (Primer-Überhang) interagieren. Dabei kommt es unter anderem zu Interaktionen mit Komplexen, die Primer-Verlängerungsprodukte und Matrizenstränge umfassen. Die Interaktion beginnt ausgehend vom Primer-Überhang. Damit wird eine räumliche Nähe zwischen dem Controller- Strang und dem Ende des doppelsträngigen Bereichs zwischen Primer-Verlängerungsprodukt / Matrizenstrang herbeigeführt. Dadurch kann sich die Doppelstrang-Bildung zwischen dem Controller-Oligonukleotid und dem ersten Primer-Bereich übertragen (sequenzabhängige Strang- Verdrängung). Bei gegebener Sequenz-Übereinstimmung mit dem synthetisierten Bereich des Primer-Verlängerungsproduktes breitet sich die Doppelstrang-Bildung zwischen dem Controller- Oligonukleotid und dem Primer-Verlängerungsprodukt weiter aus.  The freely available controller oligonucleotides can interact with the second primer region (primer overhang). Among other things, interactions with complexes comprising primer extension products and template strands occur. The interaction starts from the primer overhang. This provides spatial proximity between the controller strand and the end of the double-stranded region between primer extension product / template strand. As a result, the double-stranded formation can be transferred between the controller oligonucleotide and the first primer region (sequence-dependent strand displacement). Given the sequence identity with the synthesized portion of the primer extension product, the double strand formation between the controller oligonucleotide and the primer extension product continues to expand.
Das Fortschreiten dieser Interaktion zwischen dem synthetisierten Primer-Verlängerungsprodukt und dem Controller-Oligonukleotid führt zu zunehmender Freisetzung des Matrizenstranges aus dem Komplex mit dem Primer-Verlängerungsprodukt. Bei einem unvollständigen Primer- Verlängerungsprodukt kommt es zu einer Dissoziation des Komplexes aus Matrize und unvollständigem Primer-Verlängerungsprodukt. Es wird dabei ein neuer Komplex aus Primer- Verlängerungsprodukt und dem Controller-Oligonukleotid gebildet. Die Fortführung der matrizenabhängigen Synthese eines solchen Primer-Verlängerungsproduktes wird somit gehindert.  The progression of this interaction between the synthesized primer extension product and the controller oligonucleotide results in increasing release of the template strand from the complex with the primer extension product. An incomplete primer extension product will dissociate the template and incomplete primer extension product complex. A new complex of primer extension product and the controller oligonucleotide is thereby formed. The continuation of the template-dependent synthesis of such a primer extension product is thus hindered.
Die Verwendung von prozessiven Polymerasen führt in der Regel dazu, dass die Primer- Verlängerungsreaktion durch die Polymerase mit vollständiger Übereinstimmung des synthetisierten wachsenden Strangs mit seiner Matrize schneller verlaufen kann, als die Ausbildung eines doppelsträngigen Komplexes aus Primer-Verlängerungsprodukt und Controller- Oligonukleotid.  The use of processive polymerases typically results in the primer extension reaction by the polymerase with full match of the synthesized growing strand to its template being faster than forming a double-stranded complex of primer extension product and controller oligonucleotide.
Weiterhin wird die zeitliche Verzögerung der enzymatischen Synthese ausgenutzt, welche in der Regel bei einem Strangverlängerungsprozess stattfindet, wenn dieser Strang einen Mismatch als Folge eines Polymerase-Fehlers umfasst. Die Perfekt-Match umfassenden Stränge werden in der Regel schneller synthetisiert, als solche, welche im Primer-Verlängerungsprodukt einen Mismatch aufweisen. Dabei kommt es nach einem Fehleinbau in den wachsenden Strang zu einer vorübergehenden Verlangsamung bzw. gar einer Pause in der Synthese, so dass der Vorgang der Doppelstrangbildung zwischen Controller-Oligonukleotid und Primer- Verlängerungsprodukt diesen „pausierten Strang“ von der Matrize ablösen kann, bevor eine weitere Synthese stattfinden kann. Die Bindung eines solchen unvollständigen Primer-Verlängerungsproduktes an das Controller- Oligonukleotid ist vorzugsweise hinreichend stabil unter verwendeten Reaktionsbedingungen, so dass dieses unvollständige Produkt den weiteren matrizenabhängigen Synthesen durch die Polymerase entzogen werden kann. Da das Controller-Oligonukleotid nicht als Matrize dient, verbleibt ein solches unvollständiges Primer-Verlängerungsprodukt im Komplex mit dem Controller-Oligonukleotid. Furthermore, the time delay of the enzymatic synthesis is exploited, which usually takes place in a strand extension process, when this strand comprises a mismatch as a result of a polymerase error. The perfect-match strands are generally synthesized faster than those that have a mismatch in the primer extension product. After a misincorporation into the growing strand, there is a temporary slowdown or even a pause in the synthesis, so that the process of double-stranding between the controller oligonucleotide and the primer extension product can detach this "paused strand" from the template before a further synthesis can take place. The binding of such an incomplete primer extension product to the controller oligonucleotide is preferably sufficiently stable under reaction conditions used so that this incomplete product can be removed from the further template-dependent syntheses by the polymerase. Since the controller oligonucleotide does not serve as a template, such an incomplete primer extension product will remain in complex with the controller oligonucleotide.
In einer bevorzugten Ausführungsform wird die Länge des Controller-Oligonukleotides und die Länge des zu erwartenden, vollständigen Primer-Verlängerungsproduktes derartig aufeinander abgestimmt, dass die Länge des synthetisierten Bereichs des Primer-Verlängerungsproduktes über die Länge des Controller-Oligonukleotids hinausgeht. Das 3'-Segment des Primer- Verlängerungsproduktes umfasst somit ein Sequenzsegment, welches nicht vom Controller- Oligonukleotid überprüft wird. Bei der Interaktion des P1 -Ext mit dem Controller verbleibt somit ein doppelsträngiges Segment aus P1 -Ext und Matrize. In dieser Ausführungsform kann dieses doppelsträngige Segment unter den Reaktionsbedingungen der Controlling-Phase spontan dissoziieren, z.B. infolge einer temperaturbedingten Strangöffnung (z.B. bei Temperaturen von ca. 50 - 70°C). Die Länge dieses 3'-Segmentes des Primer-Verlängerungsproduktes (ohne Interaktion mit dem Controller-Oligonukleotid) kann beispielsweise Sequenzlängen umfassen, welche in folgenden Bereichen liegen: von 1 bis 10 Nukleotiden, von 10 bis 20 Nukleotiden, von 30 bis 40 Nukleotiden, von 40 bis 50 Nukleotiden. Das Zusammenwirken der Interaktion des Controller- Oligonukleotides mit dem synthetisierten Primer-Verlängerungsprodukt und der spontanen Dissoziation des Komplexes aus 3'-Segment des P1 -Ext und der Matrize kann zur Ablösung des Primer-Verlängerungsproduktes (im Komplex aus P1 -Ext und Controller-Strang) von der Matrize führen. In a preferred embodiment, the length of the controller oligonucleotide and the length of expected full primer extension product are matched so that the length of the synthesized region of the primer extension product extends beyond the length of the controller oligonucleotide. The 3 ' segment of the primer extension product thus comprises a sequence segment which is not checked by the controller oligonucleotide. The interaction of the P1-text with the controller thus leaves a double-stranded segment of P1-text and matrix. In this embodiment, this double-stranded segment can spontaneously dissociate under the reaction conditions of the controlling phase, for example due to a temperature-induced strand opening (eg at temperatures of about 50-70 ° C). The length of this 3 ' segment of the primer extension product (without interaction with the controller oligonucleotide) may comprise, for example, sequence lengths ranging from 1 to 10 nucleotides, from 10 to 20 nucleotides, from 30 to 40 nucleotides, from 40 to 50 nucleotides. The interaction of the controller oligonucleotide interaction with the synthesized primer extension product and the spontaneous dissociation of the 3 ' segment complex of the P1 -ext and template may result in the detachment of the primer extension product (in the complex of P1 -ext and controller-strand ) from the matrix.
Das 3'-Segment kann in nachfolgenden Analysen / Reaktionen eine funktionelle Rolle spielen. In einer bevorzugten Ausführungsform sind die gebildeten Komplexe Controller-Oligonukleotid und unvollständiges Primer-Verlängerungsprodukt unter den gewählten Reaktionsbedingungen vorzugsweise hinreichend stabil, so dass dieses unvollständige Primer-Verlängerungsprodukt von einer Fortsetzung seiner Synthese am Matrizenstrang ausgeschlossen werden kann bzw. es wird durch die Komplex-Form mit dem Controller stark an der Fortsetzung der matrizenabhängigen Synthesereaktion gehindert. Damit kann die Synthese von fehlerhaften Primer- Verlängerungsprodukten bis zur vollen Synthese-Länge verhindert werden. Wegen einer unzureichenden Länge umfassen solche unvollständigen P1 -Ext vorzugsweise nicht ein erforderliches 3 '-Sequenzsegment, um an anderen oder folgenden Reaktionen teilzunehmen. Dieses fehlende 3'-Segment kann beispielsweise für eine Interaktion mit einer Sonde oder einem weiteren Primer fehlen. Dadurch können fehlerhafte Primer-Verlängerungsprodukte nicht die volle erforderliche Funktionalität in nachfolgenden Reaktionen entfalten, z.B. in einem Detektionsvorgang oder einer Amplifikation. The 3 ' segment may play a functional role in subsequent analyzes / reactions. In a preferred embodiment, the complexes formed controller oligonucleotide and incomplete primer extension product are preferably sufficiently stable under the chosen reaction conditions, so that this incomplete primer extension product can be excluded from a continuation of its synthesis at the template strand or by the complex form with the controller strongly prevented the continuation of the template-dependent synthesis reaction. Thus, the synthesis of defective primer extension products can be prevented to full synthesis length. Because of insufficient length, such incomplete P1 text preferably does not include a required 3 ' sequence segment to participate in other or subsequent reactions. This missing 3 ' segment can be used, for example, for interaction with a probe or a probe another primer is missing. As a result, defective primer extension products can not develop the full functionality required in subsequent reactions, eg in a detection process or an amplification.
Diskriminierende Wirkung des Controller-Oligonukleotides:  Discriminating effect of the controller oligonucleotide:
Auch bei gleichzeitiger Synthese-Reaktion und Controlling-Phase hängt die Interaktion zwischen dem Controller-Oligonukleotid und dem Primer-Verlängerungsprodukt von der Komplementarität zwischen dem Primer-Verlängerungsprodukt und dem Controller-Oligonukleotid ab. Bei Abweichungen kann der Vorgang der sequenzabhängigen Strangverdrängung massiv gehindert werden. Je höher die Sequenzunterschiede zwischen dem synthetisierten Primer- Verlängerungsprodukt und dem entsprechenden Controller-Oligonukleotid ist, umso stärker wird die Ausbildung eines Komplexes aus Controller-Oligonukleotid und P1 -Ext beeinflusst. Das Ausmaß des Einflusses kann von geringfügiger Verlangsamung bis zum vollständigen Stopp im Fortschritt der Komplex-Bildung reichen. Aus diesem Grund ist es vorteilhaft, wenn das Controller- Oligonukleotid an das gewünschte Primer-Verlängerungsprodukt angepasst wird und in der Lage ist, mit seinem dritten Bereich eine im Wesentlichen komplementäre Bindung an das synthetisierte Sequenzsegment des Primer-Verlängerungsproduktes einzugehen.  Even with concurrent synthesis reaction and controlling phase, the interaction between the controller oligonucleotide and the primer extension product depends on the complementarity between the primer extension product and the controller oligonucleotide. In case of deviations, the process of sequence-dependent strand displacement can be severely hindered. The higher the sequence differences between the synthesized primer extension product and the corresponding controller oligonucleotide, the more the formation of a complex of controller oligonucleotide and P1 -ex is affected. The degree of influence can range from slight deceleration to complete stop in the progress of complex formation. For this reason, it is advantageous if the controller oligonucleotide is adapted to the desired primer extension product and is able to enter into its third region with a substantially complementary binding to the synthesized sequence segment of the primer extension product.
Nach Abschluss der Primer-Verlängerungsreaktion kann das korrekt synthetisierte Primer- Verlängerungsprodukt von der Matrize abgelöst werden, beispielsweise wie in obigen Ausführungsformen dargestellt.  Upon completion of the primer extension reaction, the correctly synthesized primer extension product may be released from the template, for example as shown in the above embodiments.
Die Verwendung eines Primer-Verlängerungsproduktes in weiteren Reaktionen kann beispielsweise erforderlich machen, dass bestimmte Bereiche des Primer- Verlängerungsproduktes in einzelsträngiger Form vorliegen. Dies kann beispielsweise für die Bindung eines Primers oder einer Sonde notwendig sein. Diese Ausführungsform kann daher beispielsweise zur Überführung der Sequenzen im 3'-Segment des Primer- Verlängerungsproduktes in den einzelsträngigen Zustand verwendet werden. For example, the use of a primer extension product in further reactions may require that certain portions of the primer extension product be in single-stranded form. This may be necessary, for example, for the binding of a primer or a probe. This embodiment can therefore be used, for example, to convert the sequences in the 3 ' segment of the primer extension product into the single-stranded state.
Diese diskriminierende Wirkung vom Controller nach einer Primer-Verlängerungs-Reaktion kann für mehrere technische Aufgaben verwendet werden. Die Verfügbarkeit von Controller- Oligonukleotiden im Ansatz (homogenes Assay-Format) ermöglicht sowohl eine kontaminationsarme Integration in andere Verfahren der Molekularen Analysen als auch eine Kombination mit anderen Verfahren, z.B. mit Amplifikations-Verfahren oder Detektionsverfahren. This discriminating effect from the controller after a primer extension reaction can be used for several technical tasks. The availability of controller oligonucleotides in the assay (homogeneous assay format) allows for both low-contamination integration into other methods of molecular analysis and combination with other methods, e.g. with amplification method or detection method.
Die in einer Primer-Verlängerungsreaktion synthetisierten spezifischen Primer- Verlängerungsprodukte können beispielsweise als eine Start-Nukleinsäure in nachfolgenden Amplifikations-Verfahren verwendet werden. For example, the specific primer extension products synthesized in a primer extension reaction can be used as a starting nucleic acid in subsequent amplification procedures.
Bevorzugte Ausführungsformen von Strukturen einzelner Komponenten: Preferred Embodiments of Structures of Individual Components:
Die hier beschriebene Primer-Verlängerungsreaktion umfasst mindestens einen ersten Primer und mindestens ein Controller-Oligonukleotid. Das Produkt der Primer-Verlängerungsreaktion, das Primer-Verlängerungsprodukt, kann beispielsweise in einer nachfolgenden Amplifikationsreaktion verwendet werden, welche ebenfalls unter Mitwirkung eines Controller-Oligonukleotids abläuft. The primer extension reaction described herein comprises at least a first primer and at least one controller oligonucleotide. The product of the primer extension reaction, the primer extension product, can be used, for example, in a subsequent amplification reaction, which also proceeds with the assistance of a controller oligonucleotide.
Aus diesem Grund ist es vorteilhaft, dass Komponenten der Primer-Verlängerungsreaktion (erster Primer und Controler-Oligonukleotid) auch bei einer Amplifikationsreaktion verwendet werden können.  For this reason, it is advantageous that components of the primer extension reaction (first primer and controler oligonucleotide) can also be used in an amplification reaction.
Nachfolgend werden daher Ausführungsformen beschrieben, welche für beide Reaktionen, sowohl für eine Primer-Verlängerungsreaktion als auch für eine spezifische Amplifikation, geeignet sein können. Bei Bedarf können allerdings auch unterschiedliche Komponenten in einzelnen Reaktionen verwendet werden.  In the following, therefore, embodiments will be described which may be suitable for both reactions, both for a primer extension reaction and for a specific amplification. If required, however, different components can also be used in individual reactions.
Reaktionsbedingungen  reaction conditions
Reaktionsbedingungen umfassen unter anderem Puffer-Bedingungen, Temperatur-Bedingungen, Zeitdauer der Reaktion und Konzentrationen von jeweiligen Reaktionskomponenten.  Reaction conditions include, but are not limited to, buffer conditions, temperature conditions, duration of reaction, and concentrations of respective reaction components.
Die Reaktion umfassend die Synthese der Verlängerungsprodukte kann zur Produktion der gewünschten Menge der spezifischen Nukleinsäurequenz so lange wie nötig durchgeführt werden. Das erfindungsgemäße Verfahren wird bevorzugt kontinuierlich durchgeführt. In bevorzugter Ausführungsform läuft die Amplifikations-Reaktion bei gleicher Reaktionstemperatur ab, wobei die Temperatur insbesondere zwischen 50°C und 75°C liegt. In einer anderen Ausführungsform kann die Reaktions-Temperatur auch variabel gesteuert werden, so dass einzelne Schritte der Primer- Verlängerungsreaktion bei jeweils unterschiedlichen Temperaturen verlaufen.  The reaction comprising the synthesis of the extension products can be carried out for as long as necessary to produce the desired amount of the specific nucleic acid sequence. The process according to the invention is preferably carried out continuously. In a preferred embodiment, the amplification reaction proceeds at the same reaction temperature, wherein the temperature is in particular between 50 ° C and 75 ° C. In another embodiment, the reaction temperature can also be variably controlled, so that individual steps of the primer extension reaction proceed at different temperatures.
Insbesondere werden keine Helicasen oder Recombinasen in der Reaktionsmischung zur Trennung der neu synthetisieren Doppelstränge der zu amplifizierenden Nukleinsäure verwendet. In particular, no helicases or recombinases are used in the reaction mixture to separate the newly synthesized duplexes of the nucleic acid to be amplified.
In einer bevorzugten Ausführungsform beinhaltet die Reaktionsmischung keine biochemischen Energie-spendenden Verbindungen wie ATP. In a preferred embodiment, the reaction mixture does not include biochemical energy-donating compounds such as ATP.
Die Menge der zu Beginn der Reaktion vorliegenden zu amplifizierenden Nukleinsäure kann zwischen wenigen Kopien und mehreren Milliarden Kopien in einem Ansatz vorliegen. Bei diagnostischen Einsätzen kann die Menge einer Zielsequenz umfassenden Matrize unbekannt sein.  The amount of nucleic acid to be amplified at the beginning of the reaction can be between a few copies and several billion copies in one run. For diagnostic applications, the amount of template comprising a target sequence may be unknown.
In der Reaktion können auch weitere, nicht zu amplifizierende Nukleinsäuren vorliegen. Diese Nukleinsäuren können von natürlicher DNA oder RNA oder ihren Äquivalenten abstammen. In bestimmten Ausführungsformen liegen Kontroll-Sequenzen im gleichen Ansatz vor, welche parallel zu der zu amplifizierenden Nukleinsäure ebenfalls amplifiziert werden sollen.  The reaction may also contain other nucleic acids which are not to be amplified. These nucleic acids may be derived from natural DNA or RNA or their equivalents. In certain embodiments, control sequences are in the same approach, which should also be amplified in parallel to the nucleic acid to be amplified.
Es kann ein molarer Überschuss von ungefähr 103: 1 bis ungefähr 1015: 1 (Verhältnis Primer:Matrize) der eingesetzten Primer und des Controller-Oligonukleotides zu der Reaktionsmischung gegeben werden, welche Matrizen-Stränge umfasst. Es kann die Menge der Zielnukleinsäuren nicht bekannt sein, wenn das erfindungsgemäße Verfahren in diagnostischen Anwendungen benutzt wird, so dass die relative Menge des Primers und des Controller-Oligonukleotides bezüglich des komplementären Stranges nicht mit Sicherheit bestimmt werden kann. Die Menge des zugefügten Primers wird im Allgemeinen im molaren Überschuss bezüglich der Menge des komplementären Stranges (Matrize) vorhanden sein, wenn die zu amplifizierende Sequenz in einem Gemisch von komplizierten langkettigen Nukleinsäuresträngen enthalten ist. Ein großer molarer Überschuss wird bevorzugt, um die Effizienz des Verfahrens zu verbessern. A molar excess of about 10 3 : 1 to about 10 15 : 1 (primer: template ratio) of the primers employed and the controller oligonucleotide may be added to the reaction mixture, which comprises template strands. The amount of target nucleic acids may not be known if the method of the invention is used in diagnostic applications, so that the relative amount of the primer and the controller oligonucleotide relative to the complementary strand can not be determined with certainty. The amount of primer added will generally be present in molar excess relative to the amount of complementary strand (template) when the sequence to be amplified is contained in a mixture of complicated long-chain nucleic acid strands. A large molar excess is preferred to improve the efficiency of the process.
Die verwendeten Konzentrationen von Primer-1 und Controller-Oligonukleotid liegen beispielsweise in Bereichen zwischen 0,01 pmol/l und 100 pmol/l, insbesondere zwischen 0,1 pmol/l und 100 pmol/l, insbesondere zwischen 0,1 pmol/l und 50 pmol/l, insbesondere zwischen 0,1 pmol/l und 20 pmol/l. Die hohe Konzentration von Komponenten kann die Geschwindigkeit der Amplifikation erhöhen. Die jeweiligen Konzentrationen einzelner Komponenten können unabhängig von einander variiert werden, um das gewünschte Reaktionsergebnis zu erzielen. The concentrations of primer-1 and controller oligonucleotide used are, for example, in the range between 0.01 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 100 pmol / l, in particular between 0.1 pmol / l and 50 pmol / l, in particular between 0.1 pmol / l and 20 pmol / l. The high concentration of components can increase the rate of amplification. The respective concentrations of individual components can be varied independently of one another in order to achieve the desired reaction result.
Die Konzentration von Polymerase liegt in Bereichen zwischen 0,001 pmol/l und 50 pmol/l, insbesondere zwischen 0,01 pmol/l und 20 pmol/l, insbesondere zwischen 0,1 pmol/l und 10 pmol/l.The concentration of polymerase ranges between 0.001 pmol / l and 50 pmol / l, in particular between 0.01 pmol / l and 20 pmol / l, in particular between 0.1 pmol / l and 10 pmol / l.
Die Konzentration von einzelnen dNTP-Substraten liegt in Bereichen zwischen 10 pmol/l und 10 mmol/l, insbesondere zwischen 50 pmol/l und 2 mmol/l, insbesondere zwischen 100 pmol/l und 1 mmol/l. Die Konzentration von dNTP kann die Konzentration von divalenten Metal-Kationen beeinflußen. Gegebenenfalls wird diese entsprechend angepasst. The concentration of individual dNTP substrates is in the range between 10 pmol / l and 10 mmol / l, in particular between 50 pmol / l and 2 mmol / l, in particular between 100 pmol / l and 1 mmol / l. The concentration of dNTP can affect the concentration of divalent metal cations. If necessary, this will be adjusted accordingly.
Als divalente Metal-Kationen werden beispielsweise Mg2+ verwendet. Als entsprechendes Anion können beispielsweise CI, Acetat, Sulfat, Glutamat etc. verwendet werden. As divalent metal cations, for example, Mg 2+ are used. As a corresponding anion, for example, CI, acetate, sulfate, glutamate, etc. can be used.
Die Konzentration von divalente Metal-Kationen wird beispielsweise an den für jeweilige Polymerase optimalen Bereich angepasst und umfasst Bereiche zwischen 0,1 mmol/l und 50 mmol/l, insbesondere zwischen 0,5 mmol/l und 20 mmol/l, insbesondere zwischen 1 mmol/l und 15 mmol/l.  The concentration of divalent metal cations is adapted, for example, to the optimum range for each polymerase and comprises ranges between 0.1 mmol / l and 50 mmol / l, in particular between 0.5 mmol / l and 20 mmol / l, in particular between 1 mmol / l and 15 mmol / l.
Die enzymatische Synthese erfolgt im Allgemeinen in einer gepufferten wässrigen Lösung. Als Puffer-Lösungen können gelöste konventionelle Puffer-Substanzen, wie Tris-HCI, Tris-Acetat, Kalium-Glutamat, HEPES-Puffer, Natrium-Glutamat in gängigen Konzentrationen verwendet werden. Der pH-Wert dieser Lösungen liegt üblicherweise zwischen 7 und 9,5, insbesondere etwa bei 8 bis 8,5. Die Puffer-Bedingungen können beispielsweise nach Empfehlung des Herstellers der verwendeten Polymerase angepasst werden.  The enzymatic synthesis is generally carried out in a buffered aqueous solution. As buffer solutions, dissolved conventional buffer substances, such as Tris-HCl, Tris-acetate, potassium glutamate, HEPES buffer, sodium glutamate in conventional concentrations can be used. The pH of these solutions is usually between 7 and 9.5, in particular about 8 to 8.5. The buffer conditions can be adapted, for example, according to the recommendation of the manufacturer of the polymerase used.
Weitere Substanzen, wie sogenannte Tm-Depressoren (z.B. DMSO, Betaine, TPAC) etc. können zum Puffer zugegeben werden. Solche Substanzen verringern die Schmelztemperatur („Tm- Depressoren“) von Doppelsträngen und können somit einen positiven Einfluss auf die Öffnung von Doppelsträngen haben. Auch Polymerase-stabilisierende Komponenten, wie Tween 20 oder Triton 100 können in üblichen Mengen zum Puffer zugegeben werden. EDTA oder EGTA kann zu Komplexierung von Schwermetallen in konventionellen Mengen zugegeben werden. Polymerase stabilisierende Substanzen, wie Trehalose oder PEG 6000 können ebenfalls zum Reaktionsgemisch zugegeben werden. Other substances, such as so-called Tm depressors (eg DMSO, betaines, TPAC) etc. can be added to the buffer. Such substances reduce the melting temperature ("Tm depressors") of double strands and can thus have a positive influence on the opening of double strands. Polymerase stabilizing components such as Tween 20 or Triton 100 can also be added in conventional amounts to the buffer. EDTA or EGTA may be too Complexation of heavy metals can be added in conventional amounts. Polymerase stabilizing substances such as trehalose or PEG 6000 may also be added to the reaction mixture.
Vorzugsweise enthält die Reaktionsmischung keine Inhibitoren der Strangverdrängungsreaktion und keine Inhibitoren einer Polymerasen-abhängigen Primer-Verlängerung.  Preferably, the reaction mixture contains no inhibitors of the strand displacement reaction and no inhibitors of polymerase-dependent primer extension.
In bestimmten Ausführungsformen enthält die Reaktionsmischung DNA-bindende Farbstoffe, insbesondere interkalierende Farbstoffe, wie z.B. EvaGreen oder SybrGreen. Solche Farbstoffe können ggf. die Detektion der Neubildung von Nukleinsäureketten ermöglichen.  In certain embodiments, the reaction mixture contains DNA-binding dyes, especially intercalating dyes, such as e.g. EvaGreen or SybrGreen. Such dyes may possibly enable the detection of the formation of new nucleic acid chains.
Die Reaktionsmischung kann weiterhin Proteine bzw. andere Substanzen enthalten, welche beispielsweise aus einem Original-Material stammen und welche die Amplifikation vorzugsweise nicht beeinflussen.  The reaction mixture can furthermore contain proteins or other substances which, for example, originate from an original material and which preferably do not influence the amplification.
Die Reaktionstemperaturen der einzelnen Schritte der Amplifikationsreaktion können im Bereich von ca. 15°C bis ca. 85°C, insbesondere im Bereich von ca. 15°C bis ca. 75°C, insbesondere im Bereich von ca. 25°C bis ca. 70°C liegen.  The reaction temperatures of the individual steps of the amplification reaction can be in the range of about 15 ° C to about 85 ° C, in particular in the range of about 15 ° C to about 75 ° C, in particular in the range of about 25 ° C to about 70 ° C.
Im Allgemeinen kann die Reaktionstemperatur für jeden einzelnen Reaktionsschritt optimal eingestellt werden, so dass für jeden Reaktionsschritt eine solche Temperatur herbeigeführt wird. Die Amplifikationsreaktion umfasst somit eine sich wiederholende Änderung von Temperaturen, welche zyklisch wiederholt werden. In bestimmten Ausführungsformen des Verfahrens werden Reaktionsbedingungen für mehrere Reaktionsschritte vereinheitlicht, so dass die Anzahl von Temperatur-Schritten geringer ist als die Anzahl von Reaktionsschritten. In einer solchen bestimmten Ausführungsform der Erfindung erfolgt mindestens einer der Schritte der Amplifikation bei einer Reaktionstemperatur, welche sich von der Reaktionstemperatur anderer Schritte der Amplifikation unterscheidet. Die Reaktion verläuft somit nicht isothermal, sondern die Reaktionstemperatur wird zyklisch geändert.  In general, the reaction temperature can be optimally adjusted for each individual reaction step, so that such a temperature is brought about for each reaction step. The amplification reaction thus comprises a repetitive change of temperatures, which are repeated cyclically. In certain embodiments of the method, reaction conditions for a plurality of reaction steps are standardized so that the number of temperature steps is less than the number of reaction steps. In such a particular embodiment of the invention, at least one of the steps of amplification occurs at a reaction temperature which differs from the reaction temperature of other steps of the amplification. The reaction is thus not isothermal, but the reaction temperature is changed cyclically.
Es werden beispielsweise während der Amplifikation mindestens zwei Temperatur-Bereiche verwendet, welche abwechselnd herbeigeführt werden (zyklische Änderung von Temperaturen zwischen einzelnen Temperatur-Bereichen). In bestimmten Ausführungsformen umfasst der untere Temperatur-Bereich beispielsweise Temperaturen zwischen 25°C und 60°C, insbesondere zwischen 35°C und 60°C, insbesondere zwischen 50°C und 60°C und der obere Temperatur- Bereich umfasst beispielsweise Temperaturen zwischen 60°C und 75°C, insbesondere zwischen 60°C und 70°C.  For example, during the amplification at least two temperature ranges are used, which are brought about alternately (cyclic change of temperatures between individual temperature ranges). In certain embodiments, the lower temperature range includes, for example, temperatures between 25 ° C and 60 ° C, in particular between 35 ° C and 60 ° C, in particular between 50 ° C and 60 ° C and the upper temperature range includes, for example, temperatures between 60 ° C and 75 ° C, especially between 60 ° C and 70 ° C.
In bestimmten Ausführungsformen umfasst der untere Temperatur-Bereich beispielsweise Temperaturen zwischen 15°C und 50°C, insbesondere zwischen 25°C und 50°C, insbesondere zwischen 30°C und 50°C und der obere Temperatur-Bereich umfasst beispielsweise Temperaturen zwischen 50°C und 75°C, insbesondere zwischen 50°C und 65°C. In bestimmten Ausführungsformen umfasst der untere Temperatur-Bereich beispielsweise Temperaturen zwischen 15°C und 40°C, insbesondere zwischen 25°C und 40°C, insbesondere zwischen 30°C und 40°C und der obere Temperatur-Bereich umfasst beispielsweise Temperaturen zwischen 40°C und 75°C, insbesondere zwischen 40°C und 65°C. In certain embodiments, the lower temperature range includes, for example, temperatures between 15 ° C and 50 ° C, in particular between 25 ° C and 50 ° C, in particular between 30 ° C and 50 ° C and the upper temperature range includes, for example, temperatures between 50 ° C and 75 ° C, especially between 50 ° C and 65 ° C. In certain embodiments, the lower temperature range includes, for example, temperatures between 15 ° C and 40 ° C, in particular between 25 ° C and 40 ° C, in particular between 30 ° C and 40 ° C and the upper temperature range includes, for example, temperatures between 40 ° C and 75 ° C, especially between 40 ° C and 65 ° C.
Die Temperatur kann im jeweiligen Bereich konstant gehalten werden oder als Temperatur- Gradient (abfallend oder aufsteigend) geändert werden.  The temperature can be kept constant in the respective range or can be changed as a temperature gradient (decreasing or rising).
Weitere Erläuterungen zu Temperatur-Einstellungen werden in folgenden Abschnitten bei Ausführungsformen im Einzelnen angeführt.  Further explanations on temperature settings are detailed in the following sections of embodiments.
Jede herbeigeführte Temperatur kann eine gewisse Zeit aufrechterhalten werden, so dass dabei ein Inkubations-Schritt resultiert. Das Reaktionsgemisch kann somit während einer Amplifikation bei einer ausgewählten Temperatur eine gewisse Zeit inkubiert werden. Diese Zeit kann unterschiedlich lange für den jeweiligen Inkubations-Schritt sein und kann sich nach dem Fortschritt der jeweiligen Reaktion bei gegebener Temperatur richten (z.B. Primer-Verlängerung oder Strangverdrängung usw.). Die Zeit eines Inkubationsschrittes kann folgende Bereiche umfassen: zwischen 0,1 sec und 10.000 sec, insbesondere zwischen 0,1 sec und 1000 sec, insbesondere zwischen 1 sec und 300 sec, insbesondere zwischen 1 sec und 100 sec.  Any induced temperature can be maintained for a period of time, resulting in an incubation step. The reaction mixture may thus be incubated for a period of time during amplification at a selected temperature. This time may be of different duration for the particular incubation step and may depend on the progress of the particular reaction at a given temperature (e.g., primer extension or strand displacement, etc.). The time of an incubation step may comprise the following ranges: between 0.1 sec and 10,000 sec, in particular between 0.1 sec and 1000 sec, in particular between 1 sec and 300 sec, in particular between 1 sec and 100 sec.
Durch eine solche Temperatur-Änderung können einzelne Reaktionsschritte bevorzugt bei einer ausgewählten Temperatur ausgeführt werden. Dadurch können Ausbeuten von einem jeweiligen Reaktionsschritt verbessert werden. Innerhalb eines Synthese-Zyklus kann eine Temperatur- Änderung bzw. ein Temperatur-Wechsel zwischen einzelnen Temperatur-Bereichen ggf. mehrmals herbeigeführt werden. Ein Synthese-Zyklus kann somit mindestens einen Temperatur- Wechsel umfassen. Ein solcher Temperatur-Wechsel kann beispielsweise in einem PCR-Gerät / Thermocycler routinemäßig als zeitliches Programm ausgeführt werden.  By such a temperature change, individual reaction steps can preferably be carried out at a selected temperature. As a result, yields of a particular reaction step can be improved. Within a synthesis cycle, a change in temperature or a temperature change between individual temperature ranges may be required several times. A synthesis cycle may thus comprise at least one temperature change. Such a temperature change can be performed routinely, for example, in a PCR device / thermocycler as a time program.
In bestimmten Ausführungsformen wird ein Amplifikationsverfahren bevorzugt, bei welchem mindestens einer der Schritte, welche die Strangverdrängung umfassen, und mindestens einer der Schritte, welche die Primer-Verlängerungsreaktionen umfassen, gleichzeitig bzw. parallel stattfinden und unter gleichen Reaktionsbedingungen erfolgen. In einer solchen Ausführungsform kann beispielsweise eine Primer-Verlängerungsreaktion von mindestens einem Primer- Oligonukleotid (z.B. vom ersten Primer-Oligonukleotid) bevorzugt bei Temperaturbedingungen im unteren Temperatur-Bereich erfolgen. Hingegen erfolgt die Strangverdrängung unter Mitwirkung von Controller-Oligonukletid und die eine weitere Primer-Verlängerungsreaktion (z.B. vom zweiten Primer-Oligonukleotid) bevorzugt im Reaktionsschritt im oberen Temperatur-Bereich.  In certain embodiments, an amplification method is preferred in which at least one of the steps comprising the strand displacement and at least one of the steps comprising the primer extension reactions take place simultaneously and in parallel and under the same reaction conditions. For example, in such an embodiment, a primer extension reaction of at least one primer oligonucleotide (e.g., of the first primer oligonucleotide) may preferably be performed at temperature conditions in the lower temperature range. On the other hand, the strand displacement with the aid of controller oligonucleotide and the one further primer extension reaction (for example, of the second primer oligonucleotide) are preferably carried out in the reaction step in the upper temperature range.
In bestimmten Ausführungsformen wird ein Amplifikationsverfahren bevorzugt, bei welchem mindestes einer der Schritte, welche die Strangverdrängung durch das Controller-Oligonukleotid umfassen, und mindestens einer der Schritte, welche die Primer-Verlängerungsreaktion umfassen, bei unterschiedlichen Temperaturen durchgeführt. In einer solchen Ausführungsform können beispielsweise Primer-Verlängerungsreaktionen von mindestens einem Primer-Oligonukleotid (z.B. vom ersten Primer-Oligonukleotid und / oder von zweiten Primer-Oligonukleotid) bevorzugt bei Temperaturbedingungen im unteren Temperatur-Bereich erfolgen. Hingegen erfolgt die Strangverdrängung unter Mitwirkung von Controller-Oligonukletid bevorzugt im Reaktionsschritt im oberen Temperatur-Bereich. In certain embodiments, an amplification method is preferred in which at least one of the steps comprising strand displacement by the controller oligonucleotide and at least one of the steps comprising the primer extension reaction are performed at different temperatures. In such an embodiment, for example, primer extension reactions of at least one primer oligonucleotide (For example, from the first primer oligonucleotide and / or second primer oligonucleotide) preferably carried out at temperature conditions in the lower temperature range. By contrast, the strand displacement with the assistance of controller oligonucleotide preferably takes place in the reaction step in the upper temperature range.
In einer weiteren bevorzugten Ausführungsform verlaufen sämtliche Schritte einer Amplifikatons- Reaktion unter gleichen Reaktionsbedingungen.  In a further preferred embodiment, all steps of an amplification reaction proceed under identical reaction conditions.
In einer solchen Ausführungsform kann das Amplifikationsverfahren unter isothermalen Bedingungen durchgeführt werden, d.h. dass keine Temperaturänderungen für die Ausführung des Verfahrens erforderlich sind. In einer solchen bestimmten Ausführungsform der Erfindung erfolgt die gesamte Amplifikationsreaktion unter konstanter Temperatur, d.h. die Reaktion ist isothermal. Die Zeit einer solchen Reaktion umfasst beispielsweise folgende Bereiche: zwischen 100 sec und 30.000 sec, insbesondere zwischen 100 sec und 10.000 sec, insbesondere zwischen 100 sec und 1000 sec.  In such an embodiment, the amplification process may be carried out under isothermal conditions, i. that no temperature changes are required to carry out the process. In such a particular embodiment of the invention, the entire amplification reaction is carried out under constant temperature, i. the reaction is isothermal. The time of such a reaction comprises, for example, the following ranges: between 100 sec and 30,000 sec, in particular between 100 sec and 10,000 sec, in particular between 100 sec and 1000 sec.
Einzelne Verfahrensschritte können jeweils hintereinander durch Zugabe von einzelnen Komponenten ausgeführt werden. Bei einer vorteilhaften Ausführungsform liegen sämtliche für die Ausführung einer Amplifikation notwendigen Reaktions-Komponenten zu Beginn einer Amplifikation in einem Reaktionsgemisch vor.  Individual process steps can each be carried out in succession by adding individual components. In an advantageous embodiment, all reaction components necessary for the execution of an amplification are present at the beginning of an amplification in a reaction mixture.
Der Start einer Amplifikations-Reaktion kann durch Zugabe einer Komponente erfolgen, z.B. durch Zugabe einer Nukleinsäurekette umfassend eine Zielsequenz (z.B. eine Start-Nukleinsäurekette), oder einer Polymerase oder divalenten Metal-Ionen, oder auch durch Herbeiführung von Reaktions-Bedingungen, welche für die Amplifikation notwendig sind, z.B. Einstellung einer erforderlichen Reaktionstemperatur für einen oder mehrere Verfahrensschritte.  The start of an amplification reaction can be carried out by adding a component, e.g. by adding a nucleic acid chain comprising a target sequence (e.g., a starting nucleic acid chain), or a polymerase or divalent metal ions, or also by providing reaction conditions necessary for amplification, e.g. Setting a required reaction temperature for one or more process steps.
Die Amplifikation kann so lange ausgeführt werden, bis die gewünschte Menge an zu amplifizierender Nukleinsäure erreicht ist. In einer anderen Ausführungsform wird die Amplifikationsreaktion über eine Zeit ausgeführt, welche bei Vorliegen einer zu amplifizierenden Nukleinsäure ausgereicht hätte, um eine ausreichende Menge zu bekommen. In einer anderen Ausführungsform wird die Amplifikationsreaktion über eine hinreichede Anzahl von Synthese- Zyklen (Verdoppelungszeiten) ausgeführt, welche bei Vorliegen einer zu amplifizierenden Nukleinsäure ausgereicht hätte, um eine ausreichende Menge zu bekommen.  The amplification can be carried out until the desired amount of nucleic acid to be amplified is reached. In another embodiment, the amplification reaction is carried out for a time which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount. In another embodiment, the amplification reaction is carried out over a sufficient number of synthesis cycles (doubling times) which would have been sufficient in the presence of a nucleic acid to be amplified in order to obtain a sufficient amount.
Die Reaktion kann durch verschiedene Eingriffe gestoppt werden. Beispielsweise durch Änderung der Temperatur (z.B. Abkühlen oder Erhitzen, wobei beispielsweise die Polymerase in ihrer Funktion gestört wird) oder durch Zugabe einer Substanz, welche eine Polymerase-Reaktion stoppt, z.B. EDTA oder Formamid.  The reaction can be stopped by various interventions. For example, by changing the temperature (e.g., cooling or heating, for example, interfering with the function of the polymerase) or by adding a substance which stops a polymerase reaction, e.g. EDTA or formamide.
Im Anschluss an die Amplifikation kann die amplifizierte Nukleinsäurekette für weitere Analysen verwendet werden. Dabei können synthetisierte Nukleinsäureketten durch verschiedene Detektionsverfahren analysiert werden. Beispielsweise können fluoreszenzmarkierte Oligonukleotid-Sonden verwendet werden oder Sequenzierungsverfahren (Sanger-Sequenzierung oder Next-Generation Sequenzierung), fest-Phasen-Analysen wie Microarray oder Bead-Array- Analysen usw. Die synthetisierte Nukleinsäurekette kann als Substrat / Matrize in weiteren Primer- Verlängerungsreaktionen verwendet werden. Following amplification, the amplified nucleic acid chain can be used for further analysis. In this case, synthesized nucleic acid chains can be analyzed by various detection methods. For example, fluorescence-labeled oligonucleotide probes can be used or sequencing methods (Sanger sequencing or next-generation sequencing), solid-phase analysis such as microarray or bead-array analysis, etc. The synthesized nucleic acid chain can be used as a substrate / template in further primer extension reactions.
In bestimmten Ausführungsformen wird der Fortschritt der Synthese-Reaktion während der Reaktion überwacht. Das kann beispielsweise durch Einsatz von interkalierenden Farbstoffen erfolgen, z.B. Sybrgreen oder Evagreen, oder unter Einsatz von markierten Primern (z.B. Lux- Primer oder Scorpion-Primer) oder unter Einsatz von fluoreszenzmarkierten Oligonukleotid- Sonden.  In certain embodiments, the progress of the synthesis reaction is monitored during the reaction. This can be done, for example, by using intercalating dyes, e.g. Sybrgreen or Evagreen, or using labeled primers (e.g., Lux primer or Scorpion primer) or using fluorescently labeled oligonucleotide probes.
Die Detektion der Veränderung der Fluoreszenz während der Amplifikation wird in einem Detektions-Schritt des Verfahrens umgesetzt. Dabei kann die Temperatur und die Dauer dieses Schrittes an die jeweiligen Erfordernisse einer Oligonukleotid-Sonde angepasst werden. Die Temperaturen des Detektions-Schrittes umfassen beispielsweise Bereiche zwischen 20°C und 75°C, insbesondere zwischen 40 und 70°C, insbesondere zwischen 55 und 70°C.  The detection of the change in fluorescence during amplification is implemented in a detection step of the method. The temperature and the duration of this step can be adapted to the particular requirements of an oligonucleotide probe. The temperatures of the detection step include, for example, ranges between 20 ° C and 75 ° C, in particular between 40 and 70 ° C, in particular between 55 and 70 ° C.
Während des Detektionschrittes erfolgt eine Beleuchtung der Reaktion mit Licht einer Wellenlänge, welche in der Lage ist, ein verwendetes Fluorophor des Detektions-Systems (ein Donor oder ein Fluoreszenzreporter) anzuregen. Die Signal-Erfassung erfolgt in der Regel parallel zu Anregung, wobei das spezifische Fluoreszenzsignal detektiert wird und seine Intensität quantifiziert wird. During the detection step, the reaction is illuminated with light of a wavelength capable of exciting a used fluorophore of the detection system (a donor or a fluorescent reporter). The signal detection is usually parallel to excitation, whereby the specific fluorescence signal is detected and its intensity is quantified.
Das Amplifikationsverfahren kann zur Überprüfung der Anwesenheit einer Zielnukleinsäurekette in einem biologischen Material oder einem diagnostischen Material im Rahmen eines diagnostischen Verfahrens eingesetzt werden. The amplification method can be used to verify the presence of a target nucleic acid chain in a biological material or diagnostic material as part of a diagnostic procedure.
In bestimmten Ausführungsformen werden Reaktionsbedinungen von mindestens einem Reaktionsschritt, bei welchem mindestens ein Allel-spezifischer Primer an eine Allel-spezifische Sequenzvariante hybridisieren soll und eine Primer-Verlängerungsreaktion durch eine Polymerase stattfinden soll, dermaßen gewählt, dass eine vorwiegend spezifische Hybridisierung eines solchen Primers an seine Primer-Bindungsstelle stattfinden kann. Solche Bedinungen können auch als stringente Bedingungen bezeichnet werden. Beispielsweise liegt die Temperatur in einem solchen Schritt etwa bei Tm der respektiven Primer / Primerbindungsstelle oder die Temperatur liegt über einer solchen Tm. Beispielsweise kann die Temperatur bei etwa Tm +5 bis etwa Tm + 15°C liegen.  In certain embodiments, reaction conditions of at least one reaction step in which at least one allele-specific primer is to hybridize to an allele-specific sequence variant and a primer extension reaction by a polymerase is to be chosen such that a predominantly specific hybridization of such a primer to its Primer binding site can take place. Such conditions can also be called stringent conditions. For example, the temperature in such a step is about Tm of the respective primer / primer binding site or the temperature is above such a Tm. For example, the temperature may be about Tm +5 to about Tm + 15 ° C.
Bevorzugte Ausführungsformen des ersten Primer-Oligonukleotids (Primer-1) Preferred Embodiments of the First Primer Oligonucleotide (Primer-1)
Das erste Primer-Oligonukleotid (Primer-1 ) ist eine Nukleinsäurekette welche mindestens folgende Bereiche einschließt:  The first primer oligonucleotide (primer-1) is a nucleic acid chain which includes at least the following regions:
• Einen ersten Primer-Bereich im 3'-Segment des ersten Primer-Oligonukleotides, der an einen Strang einer zu amplifizierenden Nukleinsäurekette im Wesentlichen sequenzspezifisch binden kann A first primer region in the 3 ' segment of the first primer oligonucleotide capable of substantially sequence-specific binding to a strand of nucleic acid chain to be amplified
• Einen zweiten Bereich, gekoppelt direkt oder via einen Linker an das 5'-Ende des ersten Primer-Bereichs des ersten Primer-Oligonukleotides, welcher einen Polynukleotid- Schwanz umfasst, welcher zur Bindung eines Controller-Oligonukleotids und Unterstützung der Strangverdrängung (Schritt c) durch das Controller-Oligonukleotid geeignet ist, wobei der Polynukleotid-Schwanz unter Reaktionsbedingungen im Wesentlichen einzelsträngig bleibt, d.h. keine stabile Hairpin-Struktur oder ds-Strukturen ausbildet, und vorzugsweise nicht von der Polymerase kopiert wird. A second region, coupled directly or via a linker, to the 5 ' end of the first primer region of the first primer oligonucleotide which has a polynucleotide Which is suitable for binding a controller oligonucleotide and promoting strand displacement (step c) by the controller oligonucleotide, wherein the polynucleotide tail remains substantially single-stranded under reaction conditions, ie, does not form a stable hairpin structure or ds structures, and preferably not copied by the polymerase.
Die Gesamtlänge des ersten Primer-Oligonukleotides liegt zwischen 10 und 80, insbesondere zwischen 15 und 50, insbesondere zwischen 20 und 30 Nukleotiden oder ihren Äquivalenten (z.B. Nukleotid-Modifikationen). Die Struktur des ersten Primer-Oligonukleotids ist dermaßen angepasst, dass es unter gewählten Reaktionsbedinungen eine reversible Bindung an das Controller-Oligonukleotid eingehen kann. Weiterhin ist die Struktur des ersten Primer- Oligonukletides an seine Primer-Funktion angepasst. Weiterhin ist die Struktur so angepasst, dass eine Strangverdrängung mittels Controller-Oligonukleotid ausgeführt werden kann. Insgesamt sind Strukturen des ersten und des zweiten Bereichs aneinander angepasst, so dass eine exponentielle Amplifikation ausgeführt werden kann.  The total length of the first primer oligonucleotide is between 10 and 80, more preferably between 15 and 50, more preferably between 20 and 30 nucleotides or their equivalents (e.g., nucleotide modifications). The structure of the first primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions. Furthermore, the structure of the first primer oligonucleotide is adapted to its primer function. Furthermore, the structure is adapted so that a strand displacement can be performed by means of controller oligonucleotide. Overall, structures of the first and second regions are matched to each other so that exponential amplification can be performed.
In bestimmten Ausführungsformen der Erfindung sind der erste und der zweite Bereich des Primers in einer konventionellen 5'-3' Anordnung gekoppelt. In bestimmten Ausführungsformen der Erfindung erfolgt die Kopplung von beiden Abschnitten über eine 5'-5 '-Bindung, so dass der zweite Bereich eine umgekehrte Richtung hat als der erste Bereich. In certain embodiments of the invention, the first and second regions of the primer are coupled in a conventional 5 ' -3 ' configuration. In certain embodiments of the invention, the coupling of both sections is via a 5 ' -5 ' bond such that the second region has a reverse direction from the first region.
Die Kopplung von Bereichen zwischeneinander/untereinander erfolgt vorzugsweise kovalent. In bestimmten Ausführungsformen ist die Kopplung zwischen dem ersten und zweiten Bereich eine für DNA konventionelle 5'-3'-Phosphodiester-Kopplung. In bestimmten Ausführungsformen ist es eine 5'-5'-Phosphodiester-Kopplung. In bestimmten Ausführungsformen ist es eine 5'-3'- Phosphodiester-Kopplung, wobei zwischen benachbarten endständigen Nukleotiden bzw. Nukleotid-Modifikationen der beiden Bereiche mindestens ein Linker (z.B. ein C3, C6, C12 oder ein HEG-Linker oder eine abasische Modifikation) positioniert ist. The coupling of areas between each other / each other is preferably covalent. In certain embodiments, the coupling between the first and second regions is a conventional DNA for 5'-3 '-Phosphodiester coupling. In certain embodiments, it is a 5 '-5' -Phosphodiester coupling. In certain embodiments, it is a 5 '-3' - phosphodiester linkage, wherein between adjacent terminal nucleotides or nucleotide modifications of the two regions at least one linker (eg, a C3, C6, C12 or HEG linker or abasic modification) is positioned.
Einzelne Bereiche können unterschiedliche Nukleotid-Modifikationen einschließen. Dabei können individuelle Elemente von Nukleotiden modifiziert sein: Nukleobase und Rückgrad (Zucker-Anteil und / oder Phosphat-Anteil). Weiterhin können Modifikationen verwendet werden, welchen mindestens eine Komponente der Standard-Nukleotid-Bausteine fehlt oder modifiziert ist, z.B. PNA.  Individual regions may include different nucleotide modifications. In this case, individual elements of nucleotides can be modified: nucleobase and backbone (sugar content and / or phosphate content). Furthermore, modifications may be used which lack or are modified at least one component of the standard nucleotide building blocks, e.g. PNA.
In bestimmten Ausführungsformen umfasst ein zweiter Bereich des ersten Primer-Oligonukleotides weitere Sequenzen, die nicht an das Controller-Oligonukleotid binden. Diese Sequenzen können zu anderen Zwecken verwendet werden, z.B. zur Bindung an die feste Phase. Diese Sequenzen sind vorzugsweise am 5'-Ende des Polynukleotid-Schwanzes lokalisiert. In certain embodiments, a second portion of the first primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are preferably located at the 5 ' end of the polynucleotide tail.
In bestimmten Ausführungsformen kann ein erstes Primer-Oligonukleotid eine charakteristische Markierung umfassen. Beispiele für eine solche Markierungen stellen Farbstoffe dar (z.B. FAM, TAMRA, Cy3, Alexa 488 etc.) oder Biotin bzw. andere Gruppen, die spezifisch gebunden werden können, z.B. Digoxigenin. In certain embodiments, a first primer oligonucleotide may comprise a characteristic label. Examples of such markings are dyes (eg FAM, TAMRA, Cy3, Alexa 488 etc.) or biotin or other groups which can be specifically bound, eg digoxigenin.
Der erste Primer-Bereich des ersten Primer-Oligonukleotides The first primer region of the first primer oligonucleotide
Die Sequenz-Länge liegt zwischen ca. 3-30 Nukleotiden, insbesondere zwischen 5 und 20 Nukleotiden, wobei die Sequenz vorwiegend komplementär zum 3'-Segment eines Stranges der zu amplifizierenden Nukleinsäurekette ist. Im Einzelnen, muss dieser Primer-Bereich in der Lage sein, an das komplementäre 3'-Segment eines zweiten Primer-Verlängerungsproduktes spezifisch zu binden. Dieser erste Bereich soll bei der Rücksynthese kopiert werden können und dient auch als Matrize für den 2. Strang. Die Nukleotid-Bausteine sind vorzugsweise untereinander via übliche 5'-3' Phosphodieser-Bindung oder Phosphothioester-Bindung verknüpft. The sequence length is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides, the sequence being predominantly complementary to the 3 ' segment of a strand of the nucleic acid chain to be amplified. In particular, this primer region must be able to specifically bind to the complementary 3 ' segment of a second primer extension product. This first area should be copied in the reverse synthesis and also serves as a template for the 2nd strand. The nucleotide building blocks are preferably linked to each other via conventional 5 'to 3' Phosphodieser bond or Phosphothioester bond.
Der erste Primer-Bereich schließt bevorzugt Nukleotid-Monomere ein, welche die Funktion der Polymerase nicht oder nur unwesentlich beeinflussen, dazu gehöhren beispielsweise:  The first primer region preferably includes nucleotide monomers which do not or only insignificantly influence the function of the polymerase, for example:
• natürliche Nukleotide (dA, dT, dC, dG etc.) oder deren Modifikationen ohne veränderte Basen-Paarung  • natural nucleotides (dA, dT, dC, dG etc.) or their modifications without altered base pairing
• Modifizierte Nukleotide, 2-Amino-dA, 2-thio-dT oder andere Nukleotid-Modifikationen mit abweichender Basen-Paarung.  • Modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with deviant base pairing.
In einer bevorzugten Ausführungsform ist das 3'-OH-Ende dieses Bereichs vorzugsweise frei von Modifikationen und hat eine funktionsfähige 3'-OH Gruppe, welche von der Polymerase erkannt werden kann. Der erste Primer-Bereich dient als Initiator der Synthese des ersten Primer- Verlängerungsproduktes in der Amplifikation. In einer weiteren bevorzugten Ausführungsform umfasst der erste Bereich mindestens eine Phosphorothioat-Verbindung, so dass kein Abbau vom 3'-Ende des Primers durch die 3'-Exonuclease Aktivität von Polymerasen erfolgen kann. In a preferred embodiment, the 3 'OH end of this range preferably free of modifications and has a functional 3' -OH group, that can be recognized by the polymerase. The first primer region serves as the initiator of the synthesis of the first primer extension product in the amplification. In a further preferred embodiment, the first region comprises at least one phosphorothioate compound, so that no degradation of the 3 ' end of the primer by the 3 ' exonuclease activity of polymerases can take place.
Die Sequenz des ersten Bereichs des ersten Primer-Oligonukleotids und die Sequenz des zweiten Bereichs des Controller-Oligonukleotides sind vorzugsweise zueinander komplementär.  The sequence of the first region of the first primer oligonucleotide and the sequence of the second region of the controller oligonucleotide are preferably complementary to one another.
In bestimmten Ausführungsformen kann der erste Primer-Bereich oder sein 3'-Segment an die Sequenzsegmente einer Zielsequenz binden. In certain embodiments, the first primer region or its 3 ' segment can bind to the sequence segments of a target sequence.
In bestimmten Ausführungsformen wird ein Allel-spezifischer erster Primer in Kombination mit einem Allel-spezifischen Controller-Oligonukleotid verwendet.  In certain embodiments, an allele-specific first primer is used in combination with an allele-specific controller oligonucleotide.
Der erste Primer-Bereich des ersten Primers kann an die ensprechende komplementäre Position einer Start-Nukleinsäure oder einer zu amplifizierenden Nukleinsäurekette binden. Insbesondere umfasst ein erster Primer Bereich zumindest eine Sequenzsegment, welches bevorzugt spezifisch unter verwendeten Reaktionsbedinungen an eine Allel-spezifische Sequenzvariante der Zielnukleinsäure binden kann, wobei die Polymerase in der Lage ist, einen dabei gebildeten perfekt-match Komplex zu verlängeren, so dass dabei ein erstes Primer-Verlängerungsprodukt resultiert. Die Position einer Allel-spezifischen Sequenz im Primer umfasst in bestimmten Ausführungsformen das 3'-terminale Nukleotid. In einer weiteren Ausführungsfrom umfasst die Position einer Allel-spezifischen Sequenz im Primer mindestens eine der Positionen -1 bis -6 Nukleotide im 3'-terminalen Segment des ersten Bereichs des ersten Primers. In einer weiteren Ausführungsfrom umfasst die Position einer Allel-spezifischen Sequenz im Primer mindestens eine der Positionen von -6 bis mindestens -15 im 3 '-terminalen Segment des ersten Bereichs des ersten Primers. The first primer region of the first primer can bind to the corresponding complementary position of a starting nucleic acid or of a nucleic acid chain to be amplified. In particular, a first primer region comprises at least one sequence segment which can bind specifically under specific reaction conditions to an allele-specific sequence variant of the target nucleic acid, wherein the polymerase is able to extend a perfect-match complex formed thereby, so that a first Primer extension product results. The position of an allele-specific sequence in the primer, in certain embodiments, includes the 3 ' -terminal nucleotide. In another embodiment, the position of an allele-specific sequence in the primer comprises at least one of the positions -1 to -6 nucleotides in the 3 ' terminal segment of the first region of the first primer. In another embodiment, the position of an allele-specific sequence in the primer comprises at least one of the positions from -6 to at least -15 in the 3 ' terminal segment of the first region of the first primer.
Ein solcher Primer umfasst weiterhin Sequenzsegmente, welche komplementär an alle Allel- Varianten einer Zielsequenz einheitlich binden können. Somit umfasst der erste Bereich eines ersten Allel-spezifischen Primers Sequenzsegmente, welche sowohl zielsequenzspezifisch sind als auch solche, welche Allel-spezifisch sind.  Such a primer further comprises sequence segments which can bind in a uniform manner to all allelic variants of a target sequence in a uniform manner. Thus, the first region of a first allele-specific primer comprises sequence segments which are both target sequence-specific and those which are allele-specific.
Bevorzugt wird eine Kombination eines Allel-spezifischen Primers und eines Allel-spezifischen Controller-Oligonukleotides verwendet, wobei der erste Bereich des ersten Primer-Oligonukleotids vollständig komplementär ist zum zweiten Bereich des Controller-Oligonukleotides.  Preferably, a combination of an allele-specific primer and an allele-specific controller oligonucleotide is used, wherein the first region of the first primer oligonucleotide is completely complementary to the second region of the controller oligonucleotide.
Einzelne Allel-spezifische Primer können zu einer Gruppe zusammengefasst werden, welche sämtliche Varianten einer Zielsequenz abdecken. Eine solche Gruppe von Allel-spezifischen Primern umfasst zumindest zwei unterschiedliche Allel-spezifische Primer, da ein polymorpher Lokus an einer vorgegebenen Position in der Zielsequenz mindestens zwei Sequenzvarianten umfasst. Die Allel-spezifischen Primer sind dahingehend konstruiert, dass sie unter stringenten Reaktionsbedinungen vorzugsweise mit ihrer jeweils spezifischen Matrize eine perfekt-match Bindung eingehen und somit diese spezifische perfekt-Match Matrize zur Ausbildung der jeweiligen Primer-Verlängerungsprodukte unter katalytischer Wirkung der Polymerase verwenden. Vorzugsweise können 3'-terminale Nukleotide und / oder 3'-terminale Segmente von Allel- spezifischen Primern zur Diskriminierung von Varianten von Zielsequenzen verwendet werden und sind dabei dermaßen in ihrer Sequenzzusammensetzung an die jeweiligen Varianten angepasst, dass solche Primer einen perfekt-match Doppelstrang unter stringenten Bedingungen mit der jeweiligen Variante ausbilden. Solche perfekt-match Doppelstränge können in der Regel von einer Polymerase gut erkannt werden und unter geeigneten Reaktionsbedingungen kommt es zu einer Primer-Verlängerung. Bei der Interaktion eines Allel-spezifischen Primers mit einer anderen Variante einer Zielsequenz entsteht somit ein Mismatch- Doppelstrang. Solche Mismatches führen in der Regel zu einer Verzögerung der Verlängerung durch eine Polymerase bzw. zu einer Verlangsamung der Gesamtreaktion. In bestimmten Ausführungsformen können Allel-spezifische Primer im 3'-Segment mindestens eine phosphoro-thioat-Bindung umfassen, welche die Allel- spezifischen Primer vor dem 3'-5'-Nuklease-Abbau durch eine Polymerase schützt. Single allele-specific primers can be grouped together to cover all variants of a target sequence. Such a group of allele-specific primers comprises at least two different allele-specific primers, as a polymorphic locus at a given position in the target sequence comprises at least two sequence variants. The allele-specific primers are designed to perfectly match under stringent reaction conditions, preferably with their specific template, and thus use this specific perfect-match template to form the respective primer extension products under the catalytic action of the polymerase. Preferably, 3 ' -terminal nucleotides and / or 3 ' -terminal segments of allele-specific primers can be used to discriminate variants of target sequences and are thus adapted in their sequence composition to the respective variants such that such primers adopt a perfect-match duplex form stringent conditions with the respective variant. Such perfect-match double strands can usually be recognized well by a polymerase and under suitable reaction conditions a primer extension occurs. The interaction of an allele-specific primer with another variant of a target sequence thus results in a mismatch double strand. Such mismatches usually lead to a delay in the extension by a polymerase or to a slowing of the overall reaction. In certain embodiments, allele-specific primers in the 3 ' segment may include at least one phosphorothioate linkage that protects the allele-specific primers from 3 ' -5 ' nuclease degradation by a polymerase.
Mehrere Allel-spezifische Primer umfassen somit Sequenzsegmente, welche für eine Gruppe von Allel-spezifischen Primern im Wesentlichen identisch bzw. einheitlich sind, sowie Sequenzsegmente, welche unter den Primern einer Gruppe unterschiedlich sind und charakteristisch für die jeweilige Sequenzvariante einer Zielsequenz. Unter Einbeziehung von einheitlichen Sequenzsegmenten können solche Primer an die jeweilige Zielsequenz unter Reaktionsbedinungen hybridisieren. Unter Einbeziehung von charakteristischen Sequenzsegmenten kann ein jeweiliger Primer spezifisch an eine Sequenzvariante der Zielsequenz unter Ausbildung eines perfekt-match Doppelstranges binden. Vorzugsweise sind die Primer dermaßen konstruiert, dass unter verwendeten Reaktionsbedingungen die Bindung an eine Zielsequenz unter Ausbildung eines perfekt-match Doppelstranges bevorzugt wird und die Bindung an einer Zielsequenz unter Ausbildung eines Mismatch-Doppelstranges weniger bevorzugt wird.Thus, multiple allele-specific primers include sequence segments which are substantially identical for a group of allele-specific primers, as well as sequence segments which are different among the primers of a group and characteristic of the respective sequence variant of a target sequence. Including uniform sequence segments, such primers can hybridize to the respective target sequence under Reaktionsbedinungen. Including characteristic sequence segments, a respective primer can specifically bind to a sequence variant of the target sequence to form a perfect-match double strand. Preferably, the primers are designed so that, under the reaction conditions used, binding to a target sequence to form a perfect match double strand is preferred and binding to a target sequence to form a mismatch duplex is less preferred.
In bestimmten Ausführungsformen wird ein Zielsequenz-spezifischer erster Primer, (aber kein Allel- spezifischer erster Primer) in Kombination mit einem Allel-spezifischen Controller-Oligonukleotid verwendet. In certain embodiments, a target sequence-specific first primer (but not an allele-specific first primer) is used in combination with an allele-specific controller oligonucleotide.
Der erste Primer-Bereich des ersten Primers kann an die entsprechende komplementäre Position einer Start-Nukleinsäure oder einer zu amplifizierenden Nukleinsäurekette binden. Bevozugt umfasst ein erster Primer-Bereich zumindest ein Sequenzsegment, welches bevorzugt Sequenz spezifisch unter verwendeten Reaktionsbedingungen an Sequenzsegmente einer Zielnukleinsäurekette (beispielsweise umfassend eine Start-Nukleinsäure und / oder die zu amplifizierende Nukleinsäurekette) binden kann, wobei diese Bindung im Wesentlichen unabhängig von potenziell vorhandenen Sequenzunterschieden im polymorphen Lokus erfolgt, wobei die Polymerase in der Lage ist, einen dabei gebildeten perfekt-match Komplex zu verlängeren, so dass dabei ein erstes Primer-Verlängerungsprodukt resultiert.  The first primer region of the first primer can bind to the corresponding complementary position of a starting nucleic acid or of a nucleic acid chain to be amplified. Preferably, a first primer region comprises at least one sequence segment, which preferably can bind sequence specifically under reaction conditions used to sequence segments of a target nucleic acid chain (for example comprising a start nucleic acid and / or the nucleic acid chain to be amplified), this binding being essentially independent of potentially existing sequence differences in the polymorphic locus, wherein the polymerase is capable of extending a perfect-match complex formed thereby resulting in a first primer extension product.
Die Bindung eines solchen Primers erfolgt im Wesentlichen im Sequenzsegment der Zielnukleinsäure, welches für mindestens zwei Allel-Varianten dieser Zielnukleinsäureketten einheitlich ist. Bevorzugt erfolgt die Primer-Bindung im Sequenzsegment der Zielnukleinsäure, welches für alle Allel-Varianten dieser Zielnukleinsäure einheitlich ist.  The binding of such a primer essentially takes place in the sequence segment of the target nucleic acid, which is uniform for at least two allelic variants of these target nucleic acid chains. The primer binding preferably takes place in the sequence segment of the target nucleic acid, which is uniform for all allelic variants of this target nucleic acid.
Die Bindung erfolgt dabei dermaßen, dass der polymorphe Lokus der Zielsequenz in 3'-Richtung vom ersten Bereich des ersten Primers liegt, so dass bei einer Primer-Verlängerungsreaktion dieser polymorphe Lokus von der Polymerase kopiert wird. Ein resultierendes erstes Primer- Verlängerungsprodukt umfasst somit eine komplementäre Sequenz zum polymorphen Lokus. Diese Sequenz liegt in 3'-Richtung vom ersten Primer. The binding takes place to such an extent that the polymorphic locus of the target sequence lies in the 3 ' direction from the first region of the first primer, so that in a primer extension reaction this polymorphic locus is copied by the polymerase. A resulting first primer extension product thus comprises a complementary sequence to the polymorphic locus. This sequence is in the 3 ' direction from the first primer.
Ein solcher Primer umfasst somit Sequenzsegmente, welche bevorzugt komplementär an alle Allel- Varianten einer Zielsequenz einheitlich binden können. Damit eine Differenzierung von Allel- Varianten stattfinden kann, muss ein solcher Primer mit mindestens mit einem Allel-spezifischen Controller-Oligonukleotid kombiniert werden. Die Allel-Diskriminierung erfolgt somit durch Wirkung des Controller-Oligonukleotids. Die Positionierung des polymorphen Lokus in 3'-Richtung vom Primer bedingt seine Lokalisation im dritten Bereich des Controller-Oligonukleotides. Der zweite Bereich des ersten Primer-Oligonukleotides Such a primer thus comprises sequence segments which can preferably bind uniformly to all allelic variants of a target sequence in a uniform manner. For differentiation of allelic variants to take place, such a primer must be combined with at least one allele-specific controller oligonucleotide. The allele discrimination is thus effected by the action of the controller oligonucleotide. The positioning of the polymorphic locus in the 3 ' direction from the primer causes its localization in the third region of the controller oligonucleotide. The second region of the first primer oligonucleotide
Der zweite Bereich des ersten Primer-Oligonukleotides ist vorzugsweise eine Nukleinsäurequenz, welche mindestens einen Polynukleotid-Schwanz umfasst, welcher vorzugsweise während der Synthesereaktion von der Polymerase unkopiert bleibt und welcher zur Bindung mit dem ersten Bereich des Controller-Oligonukleotides fähig ist. Das Segment des zweiten Bereichs, welches überwiegend diese Bindung mit dem Controller-Oligonukleotid eingeht, kann als Polynukleotid- Schwanz bezeichnet werden.  The second region of the first primer oligonucleotide is preferably a nucleic acid sequence comprising at least one polynucleotide tail which preferably remains uncopied during the synthesis reaction of the polymerase and which is capable of binding to the first region of the controller oligonucleotide. The segment of the second region, which predominantly undergoes this binding with the controller oligonucleotide, may be referred to as the polynucleotide tail.
Weiterhin muss der zweite Bereich des ersten Primer-Oligonukleotids nicht nur das Controller- Oligonukleotid unter Reaktionsbedingungen spezifisch binden, sondern auch beim Vorgang der Strangverdrängung mittels Controller-Oligonukleotid mitwirken. Die Struktur des zweiten Bereichs muß folglich für die Herbeiführung einer räumlichen Nähe zwischen dem Controller-Oligonukleotid und dem entsprechenden Doppelstrang-Ende (im Einzelnen, dem 3'-Ende des zweiten Primer- Verlängerungsproduktes) geeignet sein. Furthermore, the second region of the first primer oligonucleotide must not only specifically bind the controller oligonucleotide under reaction conditions, but also participate in the process of strand displacement by means of controller oligonucleotide. The structure of the second region must therefore be suitable for bringing about spatial proximity between the controller oligonucleotide and the corresponding duplex end (in particular, the 3 ' end of the second primer extension product).
Die Gestaltung der Struktur des zweiten Bereichs des ersten Primer-Oligonukleotids wird in mehreren Ausführungsformen genauer dargestellt. Dabei werden die Anordnung der Oligonukleotid-Segmente und die verwendeten Modifikationen berücksichtigt, welche zu einem Stopp in der Polymerase-katalysierten Synthese führen.  The design of the structure of the second region of the first primer oligonucleotide is shown in more detail in several embodiments. The arrangement of the oligonucleotide segments and the modifications used are taken into account, which lead to a stop in the polymerase-catalyzed synthesis.
Die Länge des zweiten Bereichs liegt zwischen 3 und 60, insbesondere zwischen 5 und 40, insbesondere zwischen 6 und 15 Nukleotiden oder ihren Äquivalenten.  The length of the second region is between 3 and 60, in particular between 5 and 40, in particular between 6 and 15 nucleotides or their equivalents.
Die Sequenz des zweiten Bereichs kann willkürlich gewählt sein. Vorzugsweise ist sie nicht komplementär mit der zu amplifizierenden Nukleinsäure und/oder mit dem zweiten Primer- Oligonukleotid und/oder mit dem ersten Bereich des ersten Primer-Oligonukleotids. Weiterhin enthält sie vorzugsweise keine selbstkomplementären Segmente, wie Hairpins oder Stemmloops. The sequence of the second area may be chosen arbitrarily. Preferably, it is not complementary with the nucleic acid to be amplified and / or with the second primer oligonucleotide and / or with the first region of the first primer oligonucleotide. Furthermore, it preferably contains no self-complementary segments, such as hairpins or stemmloops.
Die Sequenz des zweiten Bereichs ist vorzugsweise auf die Sequenz des ersten Bereichs des Controller-Oligonukleotids abgestimmt, so dass beide Sequenzen unter Reaktionsbedingungen eine Bindung eingehen können. In einer bevorzugten Ausführungsform ist diese Bindung unter Reaktionsbedingungen reversibel: es besteht somit ein Gleichgewicht zwischen aneinander gebundenen Komponenten und nicht-gebundenen Komponenten. The sequence of the second region is preferably matched to the sequence of the first region of the controller oligonucleotide, so that both sequences can bind under reaction conditions. In a preferred embodiment, this bond is reversible under reaction conditions: there is thus a balance between components bound together and unbound components.
Die Sequenz des zweiten Bereichs des ersten Primer-Oligonukleotides ist vorzugsweise dermaßen gewählt, dass die Anzahl von komplementären Basen, welche mit dem ersten Bereich des Controller-Oligonukleotid binden können, zwischen 1 und 40, insbesondere zwischen 3 und 20, insbesondere zwischen 6 und 15 liegt.  The sequence of the second region of the first primer oligonucleotide is preferably chosen such that the number of complementary bases which can bind to the first region of the controller oligonucleotide is between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies.
Die Funktion des zweiten Bereichs besteht unter anderem in der Bindung des Controller- Oligonukleotides. In bestimmten Ausführungsformen ist diese Bindung vorzugsweise spezifisch, so dass ein zweiter Bereich eines ersten Primer-Oligonukleotides ein spezifisches Controller- Oligonukleotid binden kann. In einer anderen Ausführungsform kann ein zweiter Bereich mehr als nur ein Controller-Oligonukleotid unter Reaktionsbedinungen binden. The function of the second area is, inter alia, the binding of the controller oligonucleotide. In certain embodiments, this binding is preferably specific such that a second region of a first primer oligonucleotide is a specific controller Can bind oligonucleotide. In another embodiment, a second region may bind more than one controller oligonucleotide under reaction conditions.
Es besteht im Allgemeinen keine Notwendigkeit in einer perfekten Übereinstimmung in der Sequenz zwischen dem zweiten Bereich des ersten Primer-Oligonukleotides und dem ersten Bereich des Controller-Oligonukleotides. Das Maß der Komplementarität zwischen dem zweiten Bereich des ersten Primer-Oligonukleotides und dem ersten Bereich des Controller- Oligonukleotides kann zwischen 20 % und 100 %, insbesondere zwischen 50 % und 100 %, insbesondere zwischen 80 % und 100 % liegen. Die jeweils komplementären Bereiche können unmittelbar aneinander anschließend positioniert sein oder auch nicht-komplementäre Sequenz- Segmente dazwischen umfassen.  There is generally no need for a perfect match in sequence between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide. The degree of complementarity between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%. The respective complementary regions may be positioned immediately adjacent to each other or may comprise non-complementary sequence segments therebetween.
In bestimmten Ausführungsformen werden vorzugsweise spezifische Sequenzsegmente im zweiten Bereich des ersten Primers verwendet. Diese sequenzspezifischen und damit charakteristischen Sequenzsegmente sind vorzugsweise nicht komplementär zur Zielnukleinsäurekette und werden dermaßen an die Sequenzsegmente des ersten Bereichs eines Allel-spezifischen Controller-Oligonukleotides angepasst, dass dabei vorwiegend spezifische komplementäre Duplexe zwischen dem ersten Bereich des Controller-Oligonukleotides und dem zweiten Bereich des ersten Primer-Oligonukleotdies gebildet werden können. Dadurch kann beispielsweise bei Anwesenheit von mehreren Controller-Oligonukleotiden (z.B. welche Allel- spezifisch sind), eine Paar-Bildung aus einem bestimmten ersten Primer und einem bestimmten Controller-Oligonukleotid erfolgen. Der zweite Bereich des ersten Primer-Oligonukleotides kann somit zu einer charakteristischen Kodierung besonders bei multiplexen Analysen verwendet werden.  In certain embodiments, specific sequence segments are preferably used in the second region of the first primer. These sequence-specific and therefore characteristic sequence segments are preferably not complementary to the target nucleic acid chain and are adapted to the sequence segments of the first region of an allele-specific controller oligonucleotide so that predominantly specific complementary duplexes between the first region of the controller oligonucleotide and the second region of the first Primer oligonucleotide can be formed. Thus, for example, in the presence of multiple controller oligonucleotides (e.g., which are allele-specific), pair formation may be from a particular first primer and a particular controller oligonucleotide. The second region of the first primer oligonucleotide can thus be used for a characteristic coding, especially in multiplex analyzes.
Durch Verwendung von vorwiegend sequenzspezifischen Sequenzsegmenten im zweiten Primer- Bereich und einer gleichzeitigen Verwendung von entsprechend komplementären Sequenzsegmenten im ersten Bereich des Controller-Oligonukleotides, kann somit eine verbesserte Zuordnung von potenziell resultierenden Primer-Verlängerungsprodukten und charakteristischen Controller-Oligonukleotiden erfolgen.  By using predominantly sequence-specific sequence segments in the second primer region and a simultaneous use of correspondingly complementary sequence segments in the first region of the controller oligonucleotide, thus an improved assignment of potentially resulting primer extension products and characteristic controller oligonucleotides can take place.
Der zweite Bereich des ersten Primer-Oligonukleotides kann in bestimmten Ausführungsformen mindestens eine Tm-modifizierende Modifikation einschließen. Durch Einführung solcher Modifikationen kann die Stabilität der Bindung zwischen dem zweiten Bereich des ersten Primer- Oligonukleotides und dem ersten Bereich des Controller-Oligonukleotides modifiziert werden. Beispielsweise können Tm-erhöhende Modifikationen (Nukleotid-Modifikationen oder nicht- Nukleotid-Modifikationen) verwendet werden, wie LNA-Nukleotide, 2-Amino-Adenosine oder MGB- Modifikationen. Andererseits können auch Tm-senkende Modifikationen verwendet werden, wie beispielsweise Inosine-Nukleotide. In der Struktur des zweiten Bereichs können auch Linker (z.B. C3, C6, HEG-Linker) integriert werden. Für die Strangverdrängung muss das Controller-Oligonukleotid in räumliche Nähe des Doppelstrang-Endes der zu amplifizierenden Nukleinsäure gebracht werden. Dieses Doppelstrang-Ende besteht aus Segmenten des ersten Primer-Bereichs des ersten Primer- Verlängerungsproduktes und einem entsprechend dazu komplementären 3'-Segment des zweiten Primer-Verlängerungsproduktes. The second region of the first primer oligonucleotide may, in certain embodiments, include at least one Tm modifying modification. By introducing such modifications, the stability of the binding between the second region of the first primer oligonucleotide and the first region of the controller oligonucleotide can be modified. For example, Tm enhancing modifications (nucleotide modifications or non-nucleotide modifications) may be used, such as LNA nucleotides, 2-amino adenosines, or MGB modifications. On the other hand, Tm-lowering modifications may also be used, such as inosine nucleotides. In the structure of the second region also linkers (eg C3, C6, HEG linkers) can be integrated. For strand displacement, the controller oligonucleotide must be placed in close proximity to the double-stranded end of the nucleic acid to be amplified. This double-stranded end consists of segments of the first primer region of the first primer extension product and a correspondingly complementary 3 ' segment of the second primer extension product.
Der Polynukleotid-Schwanz bindet vorwiegend komplementär das Controller-Oligonukleotid unter Reaktionsbedingungen und bewirkt damit eine vorübergehende Annäherung des zweiten Bereichs des Controller-Oligonukleotides und des ersten Bereichs eines verlängerten Primer- Verlängerungsproduktes, so dass eine komplementäre Bindung zwischen diesen Elementen im Rahmen eines Strangverdrängungsvorgangs initiiert werden kann.  The polynucleotide tail predominantly complements the controller oligonucleotide under reaction conditions, thereby causing a transient approach of the second region of the controller oligonucleotide and the first region of an extended primer extension product such that a complementary bond between these elements is initiated as part of a strand displacement process can.
In bestimmten Ausführungsformen führt die Bindung des Controller-Oligonukleotides an den Polynukleotid-Schwanz des ersten Primer-Oligonukleotides unmittelbar zu einem solchen Kontakt. Das bedeutet, dass der Polynukleotid-Schwanz und der erste Primer-Bereich des ersten Primer- Oligonukleotides unmittelbar aneinander gekoppelt sein müssen. Dank einer solchen Anordnung kann es nach einer Bindung eines Controller-Oligonukleotids im seinem ersten Bereich unmittelbar zu einem Kontakt zwischen komplementären Basen des zweiten Bereichs des Controller- Oligonukleotides und zu entsprechenden Basen des ersten Primer-Bereichs kommen, so dass eine Strangverdrängung initiiert werden kann.  In certain embodiments, binding of the controller oligonucleotide to the polynucleotide tail of the first primer oligonucleotide immediately results in such contact. This means that the polynucleotide tail and the first primer region of the first primer oligonucleotide must be directly coupled to each other. Thanks to such an arrangement, after a binding of a controller oligonucleotide in its first region, contact between complementary bases of the second region of the controller oligonucleotide and corresponding bases of the first primer region can occur directly, so that strand displacement can be initiated.
In bestimmten Ausführungsformen liegen zwischen Strukturen des Polynukleotid-Schwanzes und des ersten Primer-Bereichs andere Strukturen des zweiten Bereichs des ersten Primer- Oligonukleotides. Nach einer Bindung eines Controller-Oligonukleotids an den Polynukleotid- Schwanz ist dieser somit nicht unmittelbar an den ersten Primer-Bereich positioniert, sondern in einer gewissen Distanz dazu. Die Strukturen zwischen dem unkopierbarem Polynukleotid- Schwanz und dem kopierbaren ersten Primer-Bereich des Primer-Oligonukleotides können einen solchen Abstand generieren. Dieser Abstand hat einen Wert, welcher zwischen 0,1 und 20 nm, insbesondere zwischen 0,1 und 5 nm, insbesondere zwischen 0,1 und 1 nm liegt.  In certain embodiments, structures of the second region of the first primer oligonucleotide are located between structures of the polynucleotide tail and the first primer region. After binding of a controller oligonucleotide to the polynucleotide tail, it is thus not positioned directly at the first primer region, but at a certain distance from it. The structures between the uncopiable polynucleotide tail and the copiable first primer region of the primer oligonucleotide can generate such a spacing. This distance has a value which is between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm.
Solche Strukturen stellen beispielsweise Linker (z.B. C3 oder C6 oder HEG-Linker) oder nicht zum Controller-Oligonukleotid komplementäre Segmente dar (z.B. in Form von nicht-komplementären, nicht-kopierbaren Nukleotid-Modifikationen). Die Länge dieser Strukturen kann im Allgemeinen in Ketten-Atomen ausgemessen werden. Diese Länge beträgt zwischen 1 und 200 Atomen, insbesondere zwischen 1 und 50 Kettenatomen, insbesondere zwischen 1 und 10 Kettenatomen. Such structures represent, for example, linkers (e.g., C3 or C6 or HEG linkers) or segments that are not complementary to the controller oligonucleotide (e.g., in the form of non-complementary, non-copyable nucleotide modifications). The length of these structures can generally be measured in chain atoms. This length is between 1 and 200 atoms, in particular between 1 and 50 chain atoms, in particular between 1 and 10 chain atoms.
Damit der Polynukleotid-Schwanz von der Polymerase unter Amplifikationsbedingungen unkopierbar bleibt, umfasst der zweite Bereich des ersten Primer-Oligonukleotides im Allgemeinen Sequenz-Anordnungen bzw. Strukturen, welche einen Stopp der Polymerase in der Synthese des zweiten Primer-Verlängerungsproduktes bewirken, nachdem die Polymerase den ersten Primer- Bereich erfolgreich kopiert hat. Diese Strukturen sollen das Kopieren des Polynukleotid- Schwanzes des zweiten Bereichs verhindern. Der Polynukleotid-Schwanz bleibt somit vorzugsweise von der Polymerase unkopiert. In order for the polynucleotide tail to remain uncopable from the polymerase under amplification conditions, the second region of the first primer oligonucleotide generally comprises sequence arrangements that cause the polymerase to stop in the synthesis of the second primer extension product after the polymerase releases the polymerase first primer area has been successfully copied. These structures are intended to allow copying of the polynucleotide Prevent tail of the second area. The polynucleotide tail thus preferably remains uncoupled from the polymerase.
In bestimmten Ausführungsformen liegen solche Strukturen zwischen dem ersten Primer-Bereich und dem Polynukleotid-Schwanz.  In certain embodiments, such structures are between the first primer region and the polynucleotide tail.
In bestimmten Ausführungsformen kann die Sequenz des Polynukleotid-Schwanzes Nukleotid- Modifikationen einschließen, welche zum Stopp der Polymerase führen. Dadurch kann ein Sequenzsegment des zweiten Bereichs des ersten Primer-Oligonukleotids beide Funktionen umfassen: es ist sowohl ein Polynukleotid-Schwanz als auch eine zum Stopp der Polymerase führende Sequenz aus Nukleotid-Modifikationen.  In certain embodiments, the sequence of the polynucleotide tail may include nucleotide modifications that result in the termination of the polymerase. Thus, a sequence segment of the second region of the first primer oligonucleotide may comprise both functions: it is both a polynucleotide tail and a polymerase-terminating sequence of nucleotide modifications.
Modifikationen im zweiten Bereich des ersten Primer-Oligonukleotid, welche zu einem Synthese- Stopp führen und somit den Polynukleotid-Schwanz unkopierbar lassen, werden in dieser Anmeldung unter dem Begriff "erste Blockierungs-Einheit oder erster Stopp-Bereich" zusammengefasst.  Modifications in the second region of the first primer oligonucleotide which result in a synthetic stop and thus leave the polynucleotide tail uncopyable are summarized in this application by the term "first blocking moiety or first stop region".
Nachfolgend sind weitere Ausführungsformen von Strukturen angeführt, welche zum Stopp in der Synthese des zweiten Stranges führen können. In the following, further embodiments of structures are given, which can lead to a stop in the synthesis of the second strand.
Mehrere Bausteine bei der Oligonukleotid-Synthese sind bekannt, welche die Polymerase beim Ablesen der Matrize hindern und zur Termination der Polymerase-Synthese führen. Beispielsweise sind nicht-kopierbare Nukleotid-Modifikationen oder Nicht-Nukleotid-Modifikationen bekannt. Es gibt auch Synthese-Arten/Anordnungen von Nukleotid-Monomeren innerhalb eines Oligonukleotides, welche zum Stopp der Polymerase führen (z.B. 5'-5-Anordnung oder 3'- 3'Anordnung). Primer-Oligonukleotide mit einem nicht kopierbaren Polynukleotid-Schwanz sind ebenfalls im Stand der Technik bekannt (z.B. Scorpion-Primer-Strukturen bzw. Primer für Bindung an die feste Phase). Beide Primer-Varianten beschreiben Primer-Oligonukleotid-Strukturen, welche in der Lage sind, die Synthese eines Stranges zu initiieren, so dass eine Primer- Verlängerungsreaktion stattfinden kann. Es resultiert ein erster Strang, welcher im Primer- Verlängerungs-Produkt auch die Primer-Struktur mit Schwanz integriert. Bei der Synthese eines komplementären Stranges zum ersten Primer-Verlängerungs-Produkt, z.B. im Rahmen einer PCR- Reaktion, wird der zweite Strang bis zur "Blockierungs-Einheit/Stopp-Struktur" der Primer-Struktur verlängert. Beide beschriebenen Primer-Strukturen sind dermaßen konzipiert, dass der 5'-Anteil des Primer-Oligonukleotides einzelsträngig bleibt und nicht von der Polymerase kopiert wird.Several building blocks in oligonucleotide synthesis are known which prevent the polymerase from reading the template and lead to the termination of the polymerase synthesis. For example, non-copyable nucleotide modifications or non-nucleotide modifications are known. There are also synthetic types / arrangements of nucleotide monomers within an oligonucleotide which result in the termination of the polymerase (eg, 5 'to 5 ' or 3 'to 3 ' ). Primer oligonucleotides with a non-copyable polynucleotide tail are also known in the art (eg Scorpion primer structures or primers for binding to the solid phase). Both primer variants describe primer oligonucleotide structures which are capable of initiating the synthesis of a strand so that a primer extension reaction can take place. The result is a first strand, which also integrates the primer structure with tail in the primer extension product. In the synthesis of a complementary strand to the first primer extension product, eg as part of a PCR reaction, the second strand is extended to the "blocking moiety / stop structure" of the primer structure. Both described primer structures are designed in such a way that the 5 ' portion of the primer oligonucleotide remains single-stranded and is not copied by the polymerase.
In bestimmten Ausführungsformen umfasst der zweite Bereich des Primer-Oligonukleotides einen Polynukleotid-Schwanz, welcher in seiner gesamten Länge eine konventionelle Anordnung von 5'- nach 3'- aufweist und nicht-kopierbare Nukleotid-Modifikationen einschließt. Zu solchen nicht- kopierbaren Nukleotid-Modifikationen zählen beispielsweise 2'-0-Alkyl-RNA Modifikationen, PNA, Morpholino. Diese Modifikationen können unterschiedlich im zweiten Primer-Bereich verteilt sein. Der Anteil von nicht-kopierbaren Nukleotid-Modifikationen kann im Polynukleotid-Schwanz zwischen 20 % und 100 % liegen, insbesondere beträgt er mehr als 50% der Nukleotid-Bausteine. Insbesondere liegen diese Nukleotid-Modifikationen im 3'-Segment des zweiten Bereichs und grenzen somit an den ersten Bereich des ersten Primer-Oligonukleotides an. In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail that has a conventional 5 ' to 3 ' array in its entire length and includes non-copyable nucleotide modifications. Such non-copyable nucleotide modifications include, for example, 2 '-0-alkyl-RNA modifications, PNA, morpholino. These modifications may be distributed differently in the second primer region. The proportion of non-copyable nucleotide modifications may be between 20% and 100% in the polynucleotide tail, in particular more than 50% of the nucleotide building blocks. In particular, these nucleotide modifications are in the 3 ' segment of the second region and thus adjacent to the first region of the first primer oligonucleotide.
In bestimmten Ausführungsformen ist die Sequenz der nicht-kopierbaren Nukleotid-Modifikationen zumindest teilweise komplementär zu der Sequenz im Matrizenstrang, so dass die Primer-Bindung an die Matrize unter Einbeziehung von zumindest einem Teil dieser Nukleotid-Modifikationen stattfindet. In bestimmten Ausführungsformen ist die Sequenz der nicht-kopierbaren Nukleotid- Modifikationen nicht-komplementär zu der Sequenz im Matrizenstrang.  In certain embodiments, the sequence of non-copyable nucleotide modifications is at least partially complementary to the sequence in the template strand such that primer binding to the template occurs involving at least a portion of these nucleotide modifications. In certain embodiments, the sequence of non-copyable nucleotide modifications is non-complementary to the sequence in the template strand.
Die nicht-kopierbaren Nukleotid-Modifikationen werden vorzugsweise aneinander kovalent gekoppelt und stellen somit ein Sequenz-Segment im zweiten Bereich dar. Die Länge dieses Segments umfasst zwischen 1 und 40, insbesondere zwischen 1 und 20 Nukleotid-Modifikationen, insbesondere zwischen 3 und 10 Nukleotid-Modifikationen.  The non-copyable nucleotide modifications are preferably covalently coupled to one another and thus represent a sequence segment in the second region. The length of this segment comprises between 1 and 40, in particular between 1 and 20 nucleotide modifications, in particular between 3 and 10 nucleotide modifications.
In bestimmten Ausführungsformen umfasst der zweite Bereich des ersten Primer-Oligonukleotides einen Polynukleotid-Schwanz, welcher in seiner gesamten Länge eine konventionelle Anordnung von 5 -3' aufweist und nicht-kopierbare Nukleotid-Modifikationen einschließt (z.B. 2'-0-Alkyl- Modifikationen) und mindestens einen Nicht-Nukleotid-Linker (z.B. C3, C6, HEG-Linker) einschließt. Ein Nicht-Nukleotid-Linker hat die Funktion, benachbarte Nukleotide oder Nukleotid- Modifikationen kovalent zu verbinden und gleichzeitig die Synthese-Funktion der Polymerase ortsspezifisch zu unterbrechen. In certain embodiments, the second region of the first primer oligonucleotide comprises a polynucleotide tail that has a conventional arrangement of 5 -3 'in its entire length and includes non-copyable nucleotide modifications (eg, 2 ' to 0 alkyl modifications). and at least one non-nucleotide linker (eg, C3, C6, HEG linker). A non-nucleotide linker has the function of covalently linking adjacent nucleotides or nucleotide modifications while at the same time site-specifically disrupting the synthesis function of the polymerase.
Ein solcher Nicht-Nukleotid-Linker soll die Strukturen des Polynukleotid-Schwanzes und des ersten Primer-Bereichs nicht zu weit voneinander entfernen. Vielmehr sollte der Polynukleotid-Schwanz in einer räumlichen Nähe vom ersten Primer-Bereich sein. Unter einem Nicht-Nukleotid-Linker werden Modifikationen zusammengefasst, welche in ihrer Länge nicht länger sind als 200 Ketten- Atome, insbesondere nicht länger als 50 Ketten-Atome, insbesondere nicht länger als 10 Ketten- Atome. Die Minimal-Länge eines solchen Linkers kann ein Atom betragen. Ein Beispiel für solche Nicht-Nukleotid-Linker stellen gerade oder verzweigte Alkyl-Linker mit einer Alkyl-Kette dar, welche mindestens ein Kohlenstoff-Atom einschließt, insbesondere mindestens 2 bis 30, insbesondere 4 bis 18. Solche Linker sind in der Oligonukleotid-Chemie hinreichend bekannt (z.B. C3, C6 oder C12 Linker) und können während einer Festphasen-Synthese von Oligonukleotiden zwischen der Sequenz des Polynukleotid-Schwanzes und der Sequenz des ersten Bereichs des ersten Primer- Oligonukleotides eingeführt werden. Ein anderes Beispiel für solche Nicht-Nukleotid-Linker stellen lineare oder verzweigte Polyethylen-Glykol-Derivate dar. Ein bekanntes Beispiel in der Oligonukleotid-Chemie stellt Hexaethylenglycol (HEG) dar. Ein weiteres Beispiel für solche Nicht- Nukleotid-Linker stellen abasische Modifikationen dar (z.B. THF-Modifikation, als Analog von d Ribose). Wenn eine oder mehrere solcher Modifikationen in einen zweiten Bereich integriert sind, können sie eine Polymerase in ihrer Kopier-Funktion während ihrer Synthese des zweiten Primer- Verlängerungsprodukts effektiv stören, so dass in 3‘-Richtung (Fig. 40) gelegene Segmente nach einer solchen Modifikation unkopiert bleiben. Die Anzahl von solchen Modifikationen im zweiten Bereich kann zwischen 1 und 100 liegen, insbesondere zwischen 1 und 10, insbesondere zwischen 1 und 3. Such a non-nucleotide linker should not remove the structures of the polynucleotide tail and the first primer region too far apart. Rather, the polynucleotide tail should be in close proximity to the first primer region. A non-nucleotide linker is taken to mean modifications which are no longer than 200 chain atoms in length, in particular not more than 50 chain atoms, in particular not more than 10 chain atoms. The minimum length of such a linker can be one atom. An example of such non-nucleotide linkers are straight or branched alkyl linkers having an alkyl chain which includes at least one carbon atom, more preferably at least 2 to 30, especially 4 to 18. Such linkers are in oligonucleotide chemistry well known (eg, C3, C6, or C12 linker) and can be introduced during solid phase synthesis of oligonucleotides between the sequence of the polynucleotide tail and the sequence of the first region of the first primer oligonucleotide. Another example of such non-nucleotide linkers are linear or branched polyethylene glycol derivatives. A well-known example in oligonucleotide chemistry is hexaethylene glycol (HEG). Another example of such non-nucleotide linkers are abasic modifications (eg THF modification, as analog of d ribose). If one or more of such modifications are integrated into a second region, they can effectively interfere with a polymerase in its copying function during its synthesis of the second primer extension product such that segments located in the 3 'direction (Fig Modification remain uncopied. The number of such modifications in the second range can be between 1 and 100, in particular between 1 and 10, in particular between 1 and 3.
Die Position eines solchen Nicht-Nukleotid-Linkers kann am 3'-Ende des zweiten Bereichs liegen und somit den Übergang vom ersten Bereich zum zweiten Bereich des Primer-Oligonukleotid darstellen. The position of such a non-nucleotide linker may be at the 3 ' end of the second region, thus representing the transition from the first region to the second region of the primer oligonucleotide.
Die Lage des Nicht-Nukleotid-Linkers im mittleren Segment des zweiten Bereichs kann ebenfalls verwendet werden. Damit wird ein Polynukleotid-Schwanz in mindestens zwei Segmente geteilt. In dieser Ausführungsform schließt das 3'-Segment des Polynukleotid-Schwanzes mindestens eine, insbesondere mehrere, z.B. zwischen 2 und 20, insbesondere zwischen 2 und 10 nicht- kopierbare Nukleotid-Modifikationen ein. Diese nicht-kopierbaren Nukleotid-Modifikationen liegen vorzugsweise am Übergang zwischen dem ersten und dem zweiten Bereich des Primer- Oligonukleotid es. The location of the non-nucleotide linker in the middle segment of the second region may also be used. This divides a polynucleotide tail into at least two segments. In this embodiment, the 3 ' segment of the polynucleotide tail includes at least one, in particular several, for example between 2 and 20, in particular between 2 and 10 non-copyable nucleotide modifications. These non-copyable nucleotide modifications are preferably at the junction between the first and second regions of the primer oligonucleotide.
In bestimmten Ausführungsformen umfasst der zweite Bereich des Primer-Oligonukleotides einen Polynukleotid-Schwanz, welcher in seiner gesamten Länge eine Anordnung von 5'-nach 3'- aufweist und zumindest ein Nukleotid-Monomer in einer "umgekehrten" Anordnung von 3'-nach 5'- einschließt, welches am Übergang zwischen dem ersten und dem zweiten Bereich des ersten Primer-Oligonukleotides positioniert ist. In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail having in its entire length an array of 5 'to 3 ' - and at least one nucleotide monomer in a "reverse" array of 3 'to 5 '- including which is positioned at the transition between the first and the second region of the first primer oligonucleotide.
In bestimmten Ausführungsformen umfasst der zweite Bereich des Primer-Oligonukleotides einen Polynukleotid-Schwanz, wobei ein solcher Polynukleotid-Schwanz vollständig aus Nukleotiden besteht, welche in umgekehrter Anordnung direkt an den ersten Bereich des ersten Primer- Oligonukleotides angrenzen, so dass die Kopplung des ersten und des zweiten Bereichs durch 5'- 5' Position erfolgt. Ein Vorteil einer solchen Anordnung ist, dass die Polymerase nach einer Kopierung des ersten Bereichs an eine "umgekehrte" Anordnung von Nukleotiden trifft, was typischerweise zur Termination der Synthese an dieser Stelle führt. In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail, such polynucleotide tail consisting entirely of nucleotides which are directly adjacent to the first region of the first primer oligonucleotide in reverse order such that the coupling of the first and second primer oligonucleotides of the second area through 5 ' - 5 ' position. An advantage of such an arrangement is that after copying the first region, the polymerase encounters a "reverse" arrangement of nucleotides, which typically results in termination of the synthesis at that site.
Bei einer "umgekehrten" Anordnung von Nukleotiden in der Gesamtlänge des Polynukleotid- Schwanzes soll vorzugsweise das 3'-terminale Nukleotid des Polynukleotid-Schwanzes an seinem 3'-OH-Ende blockiert sein, um Nebenreaktionen vorzubeugen. Alternativ kann auch ein terminales Nukleotid verwendet werden, welches gar keine 3'-OH Gruppe aufweist, z.B. ein Dideoxy- Nukleotid. In a "reverse" array of nucleotides in the total length of the polynucleotide tail, preferably the 3 ' terminal nucleotide of the polynucleotide tail is blocked at its 3 ' OH end to prevent side reactions. Alternatively, a terminal nucleotide can be used which has no 3 ' -OH group, for example a dideoxy nucleotide.
In einer solchen Ausführungsform soll natürlich auch die entsprechende Nukleotid-Anordnung im Controller-Oligonukleotid angepasst werden. In einem solchen Fall müssen der erste und der zweite Bereich des Controller-Oligonukleotids in 3'-3' Anordnung verknüpft werden. In bestimmten Ausführungsformen umfasst der zweite Bereich des Primer-Oligonukleotides einen Polynukleotid-Schwanz, welcher in seiner gesamten Länge eine konventionelle Anordnung von 5'- nach 3'- aufweist und mindestens eine Nukleotid-Modifikation einschließt, welche für die Polymerase keine komplementäre Nukleobase darstellt, wenn die Synthese mit ausschließlich natürlichen dNTP (dATP, dCTP, dGTP, dTTP oder dUTP) durchgeführt wird. In such an embodiment, of course, the corresponding nucleotide arrangement is to be adapted in the controller oligonucleotide. In such a case, the first and the second portion of the controller oligonucleotide in 3 'to 3' arrangement have to be linked. In certain embodiments, the second region of the primer oligonucleotide comprises a polynucleotide tail having a conventional 5 ' to 3 ' configuration in its entire length and including at least one nucleotide modification which is not a complementary nucleobase for the polymerase, when the synthesis is performed with all natural dNTP (dATP, dCTP, dGTP, dTTP or dUTP).
Beispielsweise können Iso-dG bzw. Iso-dC Nukleotid-Modifikationen als einzelne, insbesondere aber mehrere (mindestens 2 bis 20) Nukleotid-Modifikationen im zweiten Bereich des ersten Primer-Oligonukleotids integriert sein. Weitere Beispiele für Nukleobasen-Modifikationen stellen verschiedene Modifikationen des erweiterten genetischen Alphabets dar. Solche Nukleotid- Modifikationen unterstützen vorzugsweise keine komplementäre Basen-Paarung mit natürlichen Nukleotiden, so dass eine Polymerase (zumindest theoretisch) kein Nukleotid aus der Reihe (dATP, dCTP, dGTP, dTTP oder dUTP) einbaut. In der Realität kann es dennoch zum rudimentären Einbau kommen, insbesondere bei höheren Konzentrationen von dNTP-Substraten und prolongierten Inkubationszeiten (z.B. 60 min oder länger). Daher sollen insbesondere mehrere solche Nukleotid-Modifikationen positioniert an benachbarten Stellen zum Einsatz kommen. Der Stopp der Polymerase-Synthese wird durch Fehlen von passenden komplementären Substraten für diese Modifikationen bewirkt. Oligonukleotide mit Iso-dC bzw. Iso-dG können mit Standardverfahren synthetisiert werden und sind von mehreren kommerziellen Anbietern erhältlich (z.B. Trilink-Technologies, Eurogentec, Biomers GmbH). Wahlweise kann auch die Sequenz des ersten Bereichs des Controller-Oligonukleotids an die Sequenz eines solchen zweiten Primer- Bereichs angepasst werden. Dabei können komplementäre Nukleobasen des erweiterten genetischen Alphabets in den ersten Bereich des Controller-Oligonukleotides entsprechend während der chemischen Synthese intergriert werden. Beispielsweise kann Iso-dG im zweiten Bereich des ersten Primer-Nukleotids integriert sein, sein komplementäres Nukleotid (lso-dC-5- Me) kann an der passenden Stelle im ersten Bereich des Controller-Oligonukleotids platziert werden.  For example, iso-dG or iso-dC nucleotide modifications can be integrated as single, but in particular more (at least 2 to 20) nucleotide modifications in the second region of the first primer oligonucleotide. Other examples of nucleobase modifications are various modifications of the extended genetic alphabet. Such nucleotide modifications preferably do not support complementary base pairing with natural nucleotides, such that a polymerase (at least theoretically) does not contain a nucleotide from the series (dATP, dCTP, dGTP, dTTP or dUTP). However, in reality, rudimentary incorporation may occur, especially at higher concentrations of dNTP substrates and prolonged incubation times (e.g., 60 minutes or longer). Therefore, in particular, several such nucleotide modifications should be positioned at adjacent sites. The stop of polymerase synthesis is effected by the lack of suitable complementary substrates for these modifications. Oligonucleotides with iso-dC and iso-dG, respectively, can be synthesized by standard techniques and are available from several commercial suppliers (e.g., Trilink-Technologies, Eurogentec, Biomers GmbH). Optionally, the sequence of the first region of the controller oligonucleotide can also be adapted to the sequence of such a second primer region. In this case, complementary nucleobases of the extended genetic alphabet can be integrated into the first region of the controller oligonucleotide accordingly during the chemical synthesis. For example, iso-dG may be integrated in the second region of the first primer nucleotide, its complementary nucleotide (iso-dC-5-Me) may be placed at the appropriate location in the first region of the controller oligonucleotide.
Zusammenfassend, kann die Termination der Synthese der Polymerase im zweiten Bereich auf verschiedene Art und Weise erreicht werden. Diese Blockade erfolgt bevorzugt allerdings erst, wenn die Polymerase den ersten Bereich des ersten Primer-Oligonukleotides kopiert hat. Damit wird sichergestellt, dass ein zweites Primer-Verlängerungsprodukt eine passende Primer- Bindungsstelle in seinem 3'-Segment besitzt. Diese Primer-Bindungsstelle wird im Rahmen der Strangverdrängung freigelegt und steht somit für eine erneute Bindung eines weiteren ersten Primer-Oligonukleotids zur Verfügung. In conclusion, the termination of the synthesis of the polymerase in the second region can be achieved in various ways. However, this blockade preferably takes place only when the polymerase has copied the first region of the first primer oligonucleotide. This ensures that a second primer extension product has an appropriate primer binding site in its 3 ' segment. This primer binding site is exposed as part of the strand displacement and is thus available for a new binding of another first primer oligonucleotide.
Bei der Synthese des komplementären Stranges zum ersten Primer-Verlängerungsprodukt bleibt die Primer-Verlängerungsreaktion vor dem Polynukleotid-Schwanz stehen. Da dieser Polynukleotid-Schwanz für die Interaktion mit dem Controller-Oligonukleotid dadurch einzelsträngig bleibt und somit für die Bindung zur Verfügung steht, unterstützt dieser die Initiierung der Strangverdrängungs-Reaktion durch das Controller-Oligonukleotid, indem er die entsprechenden komplementäre Segmente des Controller-Oligonukleotids in unmittelbare Nähe des passenden Duplex-Endes bringt. Der Abstand zwischen dem komplementären Teil des Controller-Oligonukleotides (zweiter Bereich) und dem komplementären Teil des verlängerten Primer-Oligonukleotid (erster Bereich) wird dadurch auf ein Minimum reduziert. Solche räumliche Nähe erleichtert die Initiierung der Strangverdrängung. In the synthesis of the complementary strand to the first primer extension product, the primer extension reaction remains in front of the polynucleotide tail. Because this polynucleotide tail remains single-stranded for interaction with the controller oligonucleotide and thus is available for binding, it supports the initiation of the strand displacement reaction by the controller oligonucleotide by using the oligonucleotide corresponding complementary segments of the controller oligonucleotide brings in the immediate vicinity of the appropriate duplex end. The distance between the complementary part of the controller oligonucleotide (second region) and the complementary part of the extended primer oligonucleotide (first region) is thereby reduced to a minimum. Such spatial proximity facilitates the initiation of strand displacement.
Im Rahmen einer schematischen Darstellung einer nukleinsäurevermittelten Strangverdrängungs- Reaktion liegt nun eine komplementäre Sequenz von Controller-Oligonukleotid unmittelbar in der Nähe des passenden Duplex-Endes. Dabei kommt es zur Konkurrenz um die Bindung an den ersten Bereich des ersten Primer-Oligonukleotids zwischen dem Strang des Controller- Oligonukleotides und dem zum Primer komplementären Matrizenstrang. Durch repetetive Schließung und Formierung der Basenpaarung zwischen dem Primer-Bereich und dem komplementären Segment des Controller-Oligonukleotids (zweiter Bereich des Controller- Nukleotides) bzw. dem komplementären Segment des Matrizenstranges kommt es zur Initiierung des nukleinsäurevermittelten Strangverdrängungs-Vorgangs.  In the context of a schematic representation of a nucleic acid-mediated strand displacement reaction, a complementary sequence of controller oligonucleotide is now in the immediate vicinity of the appropriate duplex end. This leads to competition for binding to the first region of the first primer oligonucleotide between the strand of the controller oligonucleotide and the primer complementary template strand. By repetetive closure and formation of the base pairing between the primer region and the complementary segment of the controller oligonucleotide (second region of the controller nucleotide) or the complementary segment of the template strand, the initiation of the nucleic acid-mediated strand displacement process occurs.
Im Allgemeinen ist die Ausbeute der Initiierung der Strang-Verdrängung umso höher, je näher der entsprechende komplementäre Sequenzabschnitt des Controller-Oligonukleotides zum komplementären Segment des Primer-Bereichs liegt. Bei Vergrößerung dieses Abstandes sinkt dagegen die Ausbeute der Initiierung der Strangverdrängung.  Generally, the closer the corresponding complementary sequence portion of the controller oligonucleotide to the complementary segment of the primer region is, the higher the yield of initiation of strand displacement. By increasing this distance, however, the yield of the initiation of the strand displacement decreases.
Im Rahmen der vorliegenden Erfindung ist es nicht zwingend notwendig, dass die Initiierung der Strangverdrängung mit maximaler Ausbeute funktioniert. Daher können Abstände zwischen dem 5'-Segment des ersten Primer-Bereichs des ersten Primer-Oligonukleotid, welcher eine Bindung mit einem komplementären Strang der Matrize eingeht und eine komplementäre Duplex bildet, und einem entsprechend komplementären Sequenzabschnitt im Controller-Oligonukleotid, wenn gebunden an den Polynukleotid-Schwanz des zweiten Bereichs des ersten Primer- Oligonukleotides in folgenden Bereichen liegen: zwischen 0,1 und 20 nm, insbesondere zwischen 0,1 und 5 nm, insbesondere zwischen 0,1 und 1 nm. Im bevorzugten Fall beträgt diese Distanz weniger als 1 nm. In anderen Einheiten ausgedruckt entspricht dieser Abstand einer Strecke von weniger als 200 Atomen, insbesondere weniger als 50 Atomen, insbesondere weniger als 10 Atomen. Im bevorzugten Fall ist diese Distanz ein Atom. Die Angaben zur Distanz sollen lediglich zur Orientierung dienen und veranschaulichen, dass kürzere Distanzen zwischen diesen Strukturen bevorzugt werden. Die Messung dieser Distanz ist in vielen Fällen nur durch Analyse der genauen Strukturen von Oligonukleotiden und Messung von Sequenzabständen bzw. von Linker-Längen möglich. In the context of the present invention, it is not absolutely necessary for the initiation of the strand displacement to work with maximum yield. Therefore, distances between the 5 ' segment of the first primer region of the first primer oligonucleotide, which binds to a complementary strand of the template and forms a complementary duplex, and a correspondingly complementary sequence segment in the controller oligonucleotide when bound to the Polynucleotide tail of the second region of the first primer oligonucleotide in the following ranges: between 0.1 and 20 nm, in particular between 0.1 and 5 nm, in particular between 0.1 and 1 nm. In the preferred case, this distance is less than 1 nm. In other units, this distance corresponds to a distance of less than 200 atoms, in particular less than 50 atoms, in particular less than 10 atoms. In the preferred case, this distance is an atom. The distance information is for guidance only and illustrates that shorter distances between these structures are preferred. The measurement of this distance is in many cases only possible by analyzing the exact structures of oligonucleotides and measuring sequence distances or linker lengths.
Der erste Primer kann auch noch weitere Sequenzabschnitte umfassen, welche nicht zur Interaktion mit dem Controller-Oligonukleotid oder dem Matrizen-Strang benötigt werden. Solche Sequenzabschnitte können beispielsweise weitere Oligonukleotide binden, welche als Detektionssonden oder Immobilisierungspartner bei einer Bindung an die feste Phase verwendet werden. Primer-Funktion des ersten Primer-Oligonukleotides The first primer may also include additional sequence segments that are not required for interaction with the controller oligonucleotide or template strand. Such sequence segments may, for example, bind further oligonucleotides which are used as detection probes or immobilization partners when bound to the solid phase. Primer function of the first primer oligonucleotide
Das erste Primer-Oligonukleotid kann in mehreren Teil-Schritten verwendet werden. In erster Linie übernimmt es eine Primer-Funktion in der Amplifikation. Dabei wird die Primer- Verlängerungsreaktion unter Verwendung des zweiten Primer- Verlängerungsproduktes als Matrize ausgeführt. In bestimmten Ausführungsformen kann das erste Primer-Oligonukleotid zu Beginn der Amplifikationsreaktion die Start-Nukleinsäurekette als Matrize verwenden. In bestimmten Ausführungsformen kann das erste Primer-Oligonukleotid bei der Erstellung / Bereitstellung einer Start-Nukleinsäurekette verwendet werden.  The first primer oligonucleotide can be used in several partial steps. First and foremost, it performs a primer function in the amplification. The primer extension reaction is carried out using the second primer extension product as a template. In certain embodiments, the first primer oligonucleotide may use the starting nucleic acid chain as a template at the beginning of the amplification reaction. In certain embodiments, the first primer oligonucleotide may be used in the preparation / provision of a starting nucleic acid chain.
Im Rahmen der Amplifikation dient der erste Primer als Initiator der Synthese des ersten Primer- Verlängerungsproduktes unter Verwendung des zweiten Primer-Verlängerungsproduktes als Matrize. Das 3 '-Segment des ersten Primers umfasst eine Sequenz, welche vorwiegend komplementär an das zweite Primer-Verlängerungsprodukt binden kann. Die enzymatische Verlängerung des ersten Primer-Oligonukleotids unter Verwendung des zweiten Primer- Verlängerungsproduktes als Matrize führt zur Ausbildung des ersten Primer- Verlängerungsproduktes. Ein solches erstes Primer-Verlängerungsprodukt umfasst die Zielsequenz bzw. ihre Sequenz-Anteile. Im Verlauf der Synthese des zweiten Primer- Verlängerungsproduktes wird die Sequenz des kopierbaren Anteils des ersten Primer- Oligonukleotids von der Polymerase als Matrize erkannt, wobei eine entsprechende komplementäre Sequenz synthetisiert wird, so dass eine entsprechende Primer-Bindungsstelle für das erste Primer-Oligonukleotid resultiert. Die Synthese des ersten Primer- Verlängerungsproduktes erfolgt bis einschließlich des 5'-Segments des zweiten Primer- Oligonukleotids. Unmittelbar nach der Synthese des ersten Primer-Verlängerungsproduktes ist dieses Produkt an das zweite Primer-Verlängerungsprodukt gebunden und bildet einen doppelsträngigen Komplex. Das zweite Primer-Verlängerungsprodukt wird aus diesem Komplex sequenzspezifisch durch das Controller-Oligonukleotid verdrängt. Dabei bindet das Controller- Oligonukleotid an das erste Primer-Verlängerungsprodukt. Nach einer erfolgreichen Strangverdrängung durch das Controller-Oligonukleotid kann das zweite Primer- Verlängerungsprodukt wiederum selbst als Matrize für die Synthese des ersten Primer- Verlängerungsproduktes dienen. Das nun frei gewordene 3'-Segment des ersten Primer- Verlängerungsproduktes kann ein weiteres zweites Primer-Oligonukleotid binden, so dass eine neue Synthese des zweiten Primer-Verlängerungsproduktes initiiert werden kann. As part of the amplification, the first primer serves as the initiator of the synthesis of the first primer extension product using the second primer extension product as template. The 3 ' segment of the first primer comprises a sequence which can bind predominantly complementary to the second primer extension product. Enzymatic extension of the first primer oligonucleotide using the second primer extension product as template results in the formation of the first primer extension product. Such a first primer extension product comprises the target sequence or its sequence parts. In the course of the synthesis of the second primer extension product, the sequence of the copiable portion of the first primer oligonucleotide is recognized as a template by the polymerase, whereby a corresponding complementary sequence is synthesized to result in a corresponding primer binding site for the first primer oligonucleotide. The synthesis of the first primer extension product occurs up to and including the 5 ' segment of the second primer oligonucleotide. Immediately after the synthesis of the first primer extension product, this product is bound to the second primer extension product to form a double-stranded complex. The second primer extension product is sequence-specifically displaced from this complex by the controller oligonucleotide. The controller oligonucleotide binds to the first primer extension product. Again, after successful strand displacement by the controller oligonucleotide, the second primer extension product can itself serve as a template for the synthesis of the first primer extension product. The now vacated 3 ' segment of the first primer extension product can bind another second primer oligonucleotide so that a new synthesis of the second primer extension product can be initiated.
Weiterhin kann das erste Primer-Oligonukleotid als Initiator der Synthese des ersten Primer- Verlängerungsproduktes ausgehend von der Start-Nukleinsäurekette zu Beginn der Amplifikation dienen. In bestimmten Ausführungsformen ist die Sequenz des ersten Primers vollständig komplementär zum entsprechenden Sequenzsegment einer Start-Nukleinsäurekette. In bestimmten Ausführungsformen ist die Sequenz des ersten Primer-Oligonukleotides nur teilweise komplementär zum entsprechenden Sequenzsegment einer Start-Nukleinsäurekette. Diese abweichende Komplementarität soll das erste Primer-Oligonukleotid allerdings nicht daran hindern, eine vorwiegend sequenzspezifische Primer-Verlängerungsreaktion zu starten. Die jeweiligen Unterschiede in der Komplementarität des ersten Primer-Oligonukleotides zur jeweiligen Position in der Start-Nukleinsäurekette liegen vorzugsweise im 5'-Segment des ersten Bereichs des ersten Primer-Oligonukleotides, so dass im 3'-Segment eine vorwiegend komplementäre Basenpaarung und eine Initiierung der Synthese möglich ist. Für die Initiierung der Synthese sollen beispielsweise besonders die ersten 4 - 10 Positionen im 3'-Segment vollkomplementär zur Matrize (Start- Nukleinsäurekette) sein. Die restlichen Nukleotidpositionen können von einer perfekten Komplementarität abweichen. Das Ausmaß einer perfekten Komplementarität im restlichen 5'- Segment des ersten Bereichs des ersten Primer-Oligonukleotides kann somit Bereiche umfassen zwischen 50% bis 100%, insbesondere zwischen 80% und 100% der Basenzusammensetzung. Je nach Länge des ersten Bereichs des ersten Primer-Oligonukleotides, umfassen die Sequenz- Abweichungen 1 bis maximal 15 Positionen, insbesondere 1 bis maximal 5 Positionen. Das erste Primer-Oligonukleotid kann somit eine Synthese von einer Start-Nukleinsäukette initiieren. Bei einer darauffolgenden Synthese des zweiten Primer-Verlängerungsproduktes werden kopierbare Sequenzabschnitte des ersten Primer-Oligonukleotides von der Polymerase kopiert, so dass wiederum in darauf folgenden Synthese-Zyklen eine vollkomplementäre Primer-Bindungsstelle innerhalb des zweiten Primer-Verlängerungsprodukts für die Bindung des ersten Primer- Oligonukleotides ausgebildet wird und in darauf folgenden Synthese-Zyklen zur Verfügung steht.Furthermore, the first primer oligonucleotide can serve as the initiator of the synthesis of the first primer extension product starting from the starting nucleic acid chain at the beginning of the amplification. In certain embodiments, the sequence of the first primer is completely complementary to the corresponding sequence segment of a starting nucleic acid chain. In certain embodiments, the sequence of the first primer oligonucleotide is only partially complementary to the corresponding sequence segment of a starting nucleic acid chain. However, this divergent complementarity is not intended to prevent the first primer oligonucleotide to start a predominantly sequence-specific primer extension reaction. The respective differences in the complementarity of the first primer oligonucleotide to the respective position in the starting nucleic acid chain are preferably in the 5 ' segment of the first region of the first primer oligonucleotide, so that in the 3 ' segment a predominantly complementary base pairing and an initiation of the Synthesis is possible. For the initiation of the synthesis, for example, especially the first 4-10 positions in the 3 ' segment should be fully complementary to the template (starting nucleic acid chain). The remaining nucleotide positions may differ from a perfect complementarity. The extent of perfect complementarity in the remaining 5 ' segment of the first region of the first primer oligonucleotide may thus range between 50% to 100%, in particular between 80% and 100%, of the base composition. Depending on the length of the first region of the first primer oligonucleotide, the sequence deviations comprise 1 to a maximum of 15 positions, in particular 1 to a maximum of 5 positions. The first primer oligonucleotide may thus initiate synthesis from a startup nucleic acid chain. In a subsequent synthesis of the second primer extension product, copyable sequence portions of the first primer oligonucleotide are copied from the polymerase such that, in subsequent synthesis cycles, a fully complementary primer binding site within the second primer extension product for binding of the first primer oligonucleotide is formed and available in subsequent synthesis cycles.
In bestimmten Ausführungsformen kann das erste Primer-Oligonukleotid im Rahmen der Vorbereitung einer Start-Nukleinsäurekette verwendet werden. Dabei kann ein solches erstes Primer-Oligonukleotid an eine Nukleinsäure (z.B. eine einzelsträngige genomische DNA oder RNA oder ihre Äquivalente umfassend eine Zielsequenz) vorwiegend / bevorzugt sequenzspezifisch binden und in Anwesenheit einer Polymerase eine matrizenabhängige Primer- Verlängerungsreaktion initiieren. Die Bindungsposition ist dermaßen gewählt, dass das Primer- Verlängerungsprodukt eine gewünschte Zielsequenz umfasst. Durch die Verlängerung des ersten Primer-Oligonukleotides resultiert ein Nukleinsäure-Strang, welcher eine zur Matrize komplementäre Sequenz aufweist. Ein solcher Strang kann von der Matrize abgelöst werden (z.B. durch Hitze oder Alkalie) und damit in eine einzelsträngige Form überführt werden. Eine solche einzelsträngige Nukleinsäurekette kann als Start-Nukleinsäurekette zu Beginn der Amplifikation dienen. Eine solche Start-Nukleinsäurekette umfasst in ihrem 5'-Segment die Sequenzanteile des ersten Primer-Oligonukleotides, weiterhin umfasst sie eine Zielsequenz oder ihre Äquivalente und eine Primer-Bindungsstelle für das zweite Primer-Oligonukleotid. Weitere Schritte sind im Abschnitt„Start-Nukleinsäurekette“ erläutert. In certain embodiments, the first primer oligonucleotide may be used in the preparation of a starting nucleic acid chain. In this case, such a first primer oligonucleotide can bind to a nucleic acid (for example a single-stranded genomic DNA or RNA or its equivalents comprising a target sequence) predominantly / preferably sequence-specifically and initiate a template-dependent primer extension reaction in the presence of a polymerase. The binding position is chosen such that the primer extension product comprises a desired target sequence. The extension of the first primer oligonucleotide results in a nucleic acid strand which has a sequence complementary to the template. Such a strand can be detached from the template (eg by heat or alkali) and thus converted into a single-stranded form. Such a single-stranded nucleic acid chain can serve as a starting nucleic acid chain at the beginning of the amplification. Such a start nucleic acid chain comprises in its 5 ' segment the sequence portions of the first primer oligonucleotide, furthermore it comprises a target sequence or its equivalents and a primer binding site for the second primer oligonucleotide. Further steps are explained in the section "Starting nucleic acid chain".
Die Synthese des ersten Primer-Verlängerungsproduktes ist eine Primer-Verlängerungsreaktion und bildet einen Teilschritt in der Amplifikation. Die Reaktionsbedingungen während dieses Schrittes sind entsprechend angepasst. Die Reaktions-Temperatur und die Reaktions-Zeit sind dermaßen gewählt, dass die Reaktion erfolgreich stattfinden kann. Die jeweils bevorzugte Temperatur in diesem Schritt hängt von der verwendeten Polymerase ab und der Bindungsstärke des jeweiligen ersten Primer-Oligonukleotides an seine Primer-Bindungsstelle und umfasst beispielsweise Bereiche von 15°C bis 75°C, insbesondere von 20 bis 65°C, insbesondere von 25°C bis 65°C. Die Konzentration des ersten Primer-Oligonukleotides umfasst Bereiche von 0,01 pmol/l bis 50 pmol/l, insbesondere von 0,1 pmol/l bis 20 pmol/l, insbesondere von 0,1 pmol/l bis 10 pmol/l.The synthesis of the first primer extension product is a primer extension reaction and forms a partial step in the amplification. The reaction conditions during this step are adjusted accordingly. The reaction temperature and the reaction time are chosen so that the reaction can take place successfully. The particular preferred temperature in this step depends on the polymerase used and the binding strength of the respective first primer oligonucleotide to its primer binding site and includes, for example, ranges from 15 ° C to 75 ° C, in particular from 20 to 65 ° C, in particular from 25 ° C to 65 ° C. The concentration of the first primer oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
In bestimmten Ausführungsformen verlaufen alle Schritte der Amplifikation unter stringenten Bedingungen, welche die Ausbildung von unspezifischen Produkten / Nebenprodukten verhindern bzw. verlangsamen. Zu solchen Bedingungen zählen beispielsweise höhere Temperaturen, beispielsweise über 50°C. In certain embodiments, all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / byproducts. Such conditions include, for example, higher temperatures, for example above 50 ° C.
Falls mehr als eine spezifische Nukleinsäurekette in einem Ansatz amplifiziert werden muss, werden in bestimmten Ausführungsformen bevorzugt jeweils sequenzspezifische Primer- Oligonukleotide für die Amplifikation von entsprechenden jeweiligen Zielsequenzen verwendet. If more than one specific nucleic acid chain has to be amplified in one batch, in certain embodiments, sequence-specific primer oligonucleotides are preferably used in each case for the amplification of corresponding respective target sequences.
Vorzugsweise sind Sequenzen des ersten Primer-Oligonukleotides, des zweiten Primer- Oligonukleotides und des Controller-Oligonukleotides dermaßen aneinander angepasst, dass Nebenreaktionen, z.B. Primer-Dimer-Ausbildung, minimiert sind. Zu diesem Zweck sind beispielsweise die Sequenz des ersten und des zweiten Primer-Oligonukleotides aneinander demassen angepasst, daß beide Primer-Oligonukleotide nicht in der Lage sind, eine Amplifikations-Reaktion in Abwesenheit einer passenden Matrize und/oder einer Zielsequenz und/oder einer Start-Nukleinsäurekette zu starten bzw. zu unterstützen. Das kann beispielsweise dadurch erreicht werden, dass das zweite Primer-Oligonukleotid keine Primer-Bindungsstelle für das erste Primer-Oligonukleotid umfasst und das erste Primer-Oligonukleotid keine Primer- Bindungsstelle für das zweite Primer-Oligonukleotid umfasst. Weiterhin soll vermieden werden, dass die Primer-Sequenzen ausgedehnte eigen-komplementäre Strukturen (Self-complement) umfassen. Preferably, sequences of the first primer oligonucleotide, the second primer oligonucleotide, and the controller oligonucleotide are matched to one another such that side reactions, e.g. Primer-dimer formation, minimized. For this purpose, for example, the sequence of the first and second primer oligonucleotides are adapted to each other such that both primer oligonucleotides are incapable of undergoing an amplification reaction in the absence of an appropriate template and / or target sequence and / or starting sequence. Start or support nucleic acid chain. This can be achieved, for example, in that the second primer oligonucleotide does not comprise a primer binding site for the first primer oligonucleotide and the first primer oligonucleotide does not comprise a primer binding site for the second primer oligonucleotide. Furthermore, it should be avoided that the primer sequences comprise extended self-complementary structures (self-complement).
In bestimmten Ausführungsformen verläuft die Synthese des ersten und des zweiten Primer- Verlängerungsproduktes bei gleicher Temperatur. In bestimmten Ausführungsformen verläuft die Synthese des ersten und des zweiten Primer-Verlängerungsproduktes bei unterschiedlichen Temperaturen. In bestimmten Ausführungsformen verläuft die Synthese des ersten Primer- Verlängerungsproduktes und die Strangverdrängung durch das Controller-Oligonukleotid bei gleicher Temperatur. In bestimmten Ausführungsformen verläuft die Synthese des ersten Primer- Verlängerungsproduktes und die Strangverdrängung durch das Controller-Oligonukleotid bei unterschiedlichen Temperaturen.  In certain embodiments, the synthesis of the first and second primer extension products proceeds at the same temperature. In certain embodiments, the synthesis of the first and second primer extension products proceeds at different temperatures. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide proceeds at the same temperature. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide proceeds at different temperatures.
Verwendung eines ersten Primer-Oligonukleotides in Kombination mit einem ersten Kompetitor- Primer-Oligonukleotid: Bevorzugte Ausführungsformen des ersten Kompetitor-Primer-Oligonukleotids (Primer-1)Use of a first primer oligonucleotide in combination with a first competitor primer oligonucleotide: Preferred Embodiments of the First Competitor Primer Oligonucleotide (Primer-1)
Ein erstes Kompetitor-Primer-Oligonukleotid konkurriert mit dem ersten Primer-Oligonukleotid um die Bindung an ein Sequenzsegment einer Zielsequenz umfassenden Nukleinsäurekette, welche zumindest zwei Varianten einer Zielnukleinsäurekette umfasst. A first competitor primer oligonucleotide competes with the first primer oligonucleotide for binding to a sequence segment of a nucleic acid sequence sequence segment comprising at least two variants of a target nucleic acid chain.
Das erste Primer-Oligonukleotid bindet dabei an die gewünschte bzw. zu erwartende Sequenzvariante und wird bevorzugt unter stringenten Reaktionsbedinungen durch eine Polymerase verlängert. Das erste Kompetitor-Oligonukleotid bindet an die zweite potenzielle bzw. erwartende Sequenzvariante und wird bevorzugt unter stringenten Reaktionsbedinungen durch eine Polymerase verlängert. Es entstehen somit zwei Primer-Verlängerungsprodukte: das eine vom ersten Primer-Oligonukleotid, welches weiter in der Amplifikation vermehrt werden soll und das andere vom ersten Kompetitor-Primer-Oligonukleotid, welches in einer Amplifikation nicht vermehrt werden soll.  The first primer oligonucleotide binds to the desired or expected sequence variant and is preferably extended under stringent Reaktionsbedinungen by a polymerase. The first competitor oligonucleotide binds to the second potential or expected sequence variant and is preferably extended under stringent reaction conditions by a polymerase. There are thus two primer extension products: one of the first primer oligonucleotide, which is to be further amplified in the amplification and the other of the first competitor primer oligonucleotide, which is not to be propagated in an amplification.
Durch die Konkurrenz von zwei Primern um eine Primerbindungssequenz in der Zielnukleinsäurekette kann die Spezifität der Analyse verbessert werden.  By competition of two primers for a primer binding sequence in the target nucleic acid chain, the specificity of the analysis can be improved.
Die beiden Primer (der erste Primer und der erste Kompetitor-Primer) stellen somit Allel-spezifische Primer in Bezug auf potenzielle bzw. zu erwartende Sequenzvarianten dar. Der wesentliche Unterschied besteht vor allem darin, dass der Kompetitor-Primer nicht in der Lage ist, unter Mitwirkung eines allel-spezifischen Controller-Oligonukleotdies eine Strang-Trennung zu initiieren. The two primers (the first primer and the first competitor primer) thus represent allele-specific primers with regard to potential or expected sequence variants. The essential difference is that the competitor primer is not able to involving a allele-specific controller oligonucleotide to initiate strand separation.
In bestimmten Ausführungsformen umfasst ein erstes Kompetitor-Primer-Oligonukleotid (Kompetitor-Primer-1) eine Nukleinsäurekette, welche mindestens folgende Eigenschaften einschließt: In certain embodiments, a first competitor primer oligonucleotide (competitor primer-1) comprises a nucleic acid chain which includes at least the following properties:
• Einen ersten Kompetitor-Primer-Bereich im 3'-Segment des ersten Kompetitor-Primer- Oligonukleotides, der an einen Strang einer zu amplifizierenden Nukleinsäurekette im Wesentlichen sequenzspezifisch binden kann und somit konkurrierend mit dem ersten Primer-Oligonukleotid um seine Primer-Bindungsstelle wirken kann. A first competitor primer region in the 3 ' segment of the first competitor primer oligonucleotide capable of substantially sequence-specific binding to a strand of a nucleic acid chain to be amplified, and thus capable of competing with the first primer oligonucleotide for its primer binding site ,
• ein 3'-Ende des Kompetitor-Primers, welches nach einer Bindung an die Primer- Bindungsstelle in der Zielsequenz sequenzspezifisch von der Polymerase verlängert werden kann unter Ausbildung eines Kompetitor-Primer-VerlängerungsproduktesA 3 ' end of the competitor primer which, following binding to the primer binding site in the target sequence, can be sequence-specifically extended by the polymerase to form a competitor-primer extension product
• ein 3'-Ende des Kompetitors, welches von der„zweiten Blockierungs-Einheit“ und / oder von der „vierten Blockierungs-Einbeit“ des Controller-Oligonukleotides am Verlängern durch eine Polymerase verhindert wird, wenn das erste Kompetitor-Primer Oligonukleotid an das Controller-Oligonukleotid komplementär gebunden ist A 3 ' end of the competitor, which is prevented from "prolonging" by a "polymerase" from the "second blocking moiety" and / or from the "fourth blocking moiety" of the controller oligonucleotide when the first competitor primer oligonucleotide is attached to the oligonucleotide Controller oligonucleotide is bound complementarily
Die Gesamtlänge des ersten Kompetitor-Primer-Oligonukleotides liegt zwischen 10 und 80, insbesondere zwischen 15 und 50, insbesondere zwischen 20 und 30 Nukleotiden oder ihren Äquivalenten (z.B. Nukleotid-Modifikationen). Die Länge des 3'-Segments, welches eine komplementäre Bindung an eine zu erwartende Sequenzvariante einer Zielsequenz eingehen kann, umfasst im Wesentlichen die gleichen Bereiche, wie der erste Bereich des ersten Primers. Damit wird sichergestellt, dass beide Primer konkurrierend an die Zielsequenz binden können und diese Bindung etwa im gleichen Temperatur-Bereich erfolgt. Die konkurrierende Bindung und vor allem die konkurrierende Primer-Verlängerung unter Verwendung von Allel-spezifischen Sequenzsegmenten der Zielnukleinsäure führt in der Regel zu einer weiteren Steigerung der Spezifität. The total length of the first competitor primer oligonucleotide is between 10 and 80, in particular between 15 and 50, in particular between 20 and 30 nucleotides or their equivalents (eg nucleotide modifications). The length of the 3 ' segment, which may undergo complementary binding to an expected sequence variant of a target sequence, comprises substantially the same regions as the first region of the first primer. This ensures that both primers can competitively bind to the target sequence and this binding occurs approximately in the same temperature range. The competitive binding and especially the competing primer extension using allele-specific sequence segments of the target nucleic acid usually leads to a further increase in specificity.
Die Struktur des ersten Kompetitor-Primer-Oligonukleotids ist dermaßen angepasst, dass es unter gewählten Reaktionsbedingungen eine reversible Bindung an das Controller-Oligonukleotid eingehen kann. In bestimmten Ausführungsformen umfasst der erste Kompetitor-Primer Sequenzsegmente, welche mit dem ersten Bereich des Controller-Oligonukleotides keine komplementäre Bindung eingehen sollen. Somit kann dieses erste Kompetitor-Oligonukleotid nicht als Initiator einer Strang-Verdrängung durch ein Controller-Oligonukleotid auftreten.  The structure of the first competitor primer oligonucleotide is adapted to undergo reversible binding to the controller oligonucleotide under selected reaction conditions. In certain embodiments, the first competitor primer comprises sequence segments which are said to be complementary to the first region of the controller oligonucleotide. Thus, this first competitor oligonucleotide can not occur as an initiator of strand displacement by a controller oligonucleotide.
In einer vorteilhaften Ausführungsform der Erfindung ist der erste Kompetitor-Primer- Oligonukleotid ein DNA-Oligonukleotid mit einer konventionellen 5'-3' Anordnung von Nukleotiden.In an advantageous embodiment of the invention, the first competitor primer oligonucleotide is a DNA oligonucleotide with a conventional 5 'to 3' arrangement of nucleotides.
In bestimmten Ausführungsformen umfasst ein Kompetitor-Primer-Oligonukleotid weitere Sequenzen, die nicht an das Controller-Oligonukleotid binden. Diese Sequenzen können zu anderen Zwecken verwendet werden, z.B. zur Bindung an die feste Phase. Diese Sequenzen sind vorzugsweise am 5'-Ende des 3'-Segmentes lokalisiert. In certain embodiments, a competitor primer oligonucleotide includes additional sequences that do not bind to the controller oligonucleotide. These sequences can be used for other purposes, such as binding to the solid phase. These sequences are preferably located at the 5 ' end of the 3 ' segment.
Der erste Primer-Bereich des ersten Kompetitor-Primer-Oligonukleotides  The first primer region of the first competitor primer oligonucleotide
Die Sequenz-Länge liegt zwischen ca.15-30 Nukleotiden, insbesondere zwischen 5 und 20 Nukleotiden, wobei die Sequenz vorwiegend komplementär zum 3'-Segment eines Stranges der in der Amplifikation zu unterdrückenden Allel-Variante einer Zielnukleinsäure ist. Der erste Primer- Bereich kann Nukleotid-Monomere einschließen, welche die Funktion der Polymerase nicht oder nur unwesentlich beeinflussen, dazu gehöhren beispielsweise: The sequence length is between about 15-30 nucleotides, in particular between 5 and 20 nucleotides, wherein the sequence is predominantly complementary to the 3 ' segment of a strand of the amplification to be repressed allele variant of a target nucleic acid. The first primer region may include nucleotide monomers which do not or only insignificantly affect the function of the polymerase, for example:
• natürliche Nukleotide (dA, dT, dC, dG etc.) oder deren Modifikationen ohne veränderte Basen-Paarung  • natural nucleotides (dA, dT, dC, dG etc.) or their modifications without altered base pairing
• Modifizierte Nukleotide, 2-Amino-dA, 2-thio-dT oder andere Nukleotid-Modifikationen mit abweichender Basen-Paarung.  • Modified nucleotides, 2-amino-dA, 2-thio-dT or other nucleotide modifications with deviant base pairing.
In bestimmten Ausführungsformen wird ein Allel-spezifischer erster Primer in Kombination mit einem Allel-spezifischen Controller-Oligonukleotid und einem Allel-spezifischen Kompetitor- Primer-Oligonukleotid verwendet.  In certain embodiments, an allele-specific first primer is used in combination with an allele-specific controller oligonucleotide and an allele-specific competitor primer oligonucleotide.
Bevorzugte Ausführungsformen des Controller-Oligonukleotids Preferred embodiments of the controller oligonucleotide
Ein Controller-Oligonukleotid (Fig. 2, 7 - 24, 29) umfasst:  A controller oligonucleotide (Figures 2, 7-24, 29) comprises:
• Einen ersten einzelsträngigen Bereich, welcher an den Polynukleotid-Schwanz des zweiten Bereichs des ersten Primer-Oligonukleotides binden kann, • einen zweiten einzelsträngigen Bereich, welcher an den ersten Bereich des ersten Primer-Oligonukleotides im Wesentlichen komplementär binden kann, A first single-stranded region which can bind to the polynucleotide tail of the second region of the first primer oligonucleotide, A second single-stranded region which can bind to the first region of the first primer oligonucleotide essentially complementary,
• einen dritten einzelsträngigen Bereich, welcher zumindest zu einem Segment des Verlängerungsprodukts des ersten Primer-Verlängerungsprodukts im Wesentlichen komplementär ist,  A third single-stranded region which is substantially complementary to at least one segment of the extension product of the first primer extension product,
und das Controller-Oligonukleotid dient nicht als Matrize für die Primerverlängerung des ersten oder des zweiten Primer-Oligonukleotids.  and the controller oligonucleotide does not serve as a template for primer extension of the first or second primer oligonucleotide.
Im Allgemeinen wird die Sequenz des dritten Bereichs des Controller-Oligonukleotides an die Sequenz der zu amplifizierenden Nukleinsäure angepasst, da diese als Matrize für die Reihenfolge der Nukleotide im Verlängerungsprodukt eines ersten Primers maßgeblich ist. Die Sequenz des zweiten Bereichs des Controller-Oligonukleotids wird an die Sequenz des ersten Primer-Bereiches angepasst. Die Struktur des ersten Bereichs des Controller-Oligonukleotides wird an die Sequenz des zweiten Bereichs des ersten Primer-Oligonukleotides angepasst, vor allem an die Beschaffenheit des Polynukleotid-Schwanzes.  In general, the sequence of the third region of the controller oligonucleotide is adapted to the sequence of the nucleic acid to be amplified, since this is a template for the order of the nucleotides in the extension product of a first primer. The sequence of the second region of the controller oligonucleotide is adapted to the sequence of the first primer region. The structure of the first region of the controller oligonucleotide is adapted to the sequence of the second region of the first primer oligonucleotide, especially the nature of the polynucleotide tail.
Ein Controller-Oligonukleotid kann auch weitere Sequenz-Segmente einschließen, welche nicht zum ersten, zweiten oder dritten Bereich gehören. Diese Sequenzen können beispielsweise als flankierende Sequenzen am 3'- und am 5'-Ende angebracht werden. Vorzugsweise stören diese Sequenzsegmente die Funktion des Controller-Oligonukleotids nicht. A controller oligonucleotide may also include other sequence segments that do not belong to the first, second or third region. For example, these sequences can be attached as flanking sequences at the 3 ' and 5 ' ends. Preferably, these sequence segments do not interfere with the function of the controller oligonucleotide.
Die Struktur des Controller-Oligonukleotids weist bevorzugt folgende Eigenschaften auf:  The structure of the controller oligonucleotide preferably has the following properties:
Die einzelnen Bereiche sind untereinander kovalent gebunden. Die Bindung kann beispielsweise via konventionelle 5'-3' Bindung erfolgen. Es kann beispielsweise eine Phospho-Diesterbindung oder eine Nuklease-resistente Phospho-Thioester Bindung verwendet werden. The individual areas are covalently bonded to each other. The binding can be done for example via conventional 5 ' -3 ' bond. For example, a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
Ein Controller-Oligonukleotid kann mittels seines ersten Bereichs an den Polynukleotid-Schwanz des ersten Primer-Oligonukleotides binden, wobei die Bindung vorwiegend durch Hybridisierung komplementärer Basen vermittelt wird. Die Länge dieses ersten Bereichs beträgt 3 - 80 Nukleotide, insbesondere 4 - 40 Nukleotide, insbesondere 6 - 20 Nukleotide. Das Ausmaß an Sequenzübereinstimmung zwischen der Sequenz des ersten Bereichs des Controller- Oligonukleotids und der Sequenz des zweiten Bereichs des ersten Primer-Oligonukleotide kann zwischen 20 % und 100 %, insbesondere zwischen 50 % und 100 %, insbesondere zwischen 80 % und 100 % liegen. Die Bindung des ersten Bereichs des Controller-Oligonukleotids sollte vorzugsweise spezifisch an den zweiten Bereich des ersten Primer-Oligonukleotid unter Reaktionsbedingungen erfolgen.  A controller oligonucleotide may bind by its first region to the polynucleotide tail of the first primer oligonucleotide, which binding is mediated primarily by hybridization of complementary bases. The length of this first region is 3 to 80 nucleotides, in particular 4 to 40 nucleotides, in particular 6 to 20 nucleotides. The degree of sequence match between the sequence of the first region of the controller oligonucleotide and the sequence of the second region of the first primer oligonucleotide may be between 20% and 100%, in particular between 50% and 100%, in particular between 80% and 100%. The binding of the first region of the controller oligonucleotide should preferably be made specifically to the second region of the first primer oligonucleotide under reaction conditions.
Die Sequenz des ersten Bereichs des Controller-Oligonukleotids ist vorzugsweise dermaßen gewählt, dass die Anzahl von komplementären Basen, welche mit dem zweiten Bereich des ersten Primer-Oligonukleotids komplementär binden können, zwischen 1 und 40, insbesondere zwischen 3 und 20, insbesondere zwischen 6 und 15 liegt. Da das Controller-Oligonukleotid keine Matrize für die Polymerase darstellt, kann es Nukleotid- Modifikationen einschließen, welche die Polymerase-Funktion nicht unterstützen, welche sowohl Basenmodifikationen und / oder Zucker-Phosphat-Rückgrad-Modifikationen sein können. Das Controller-Oligonukleotid kann beispielsweise in seinem ersten Bereich Nukleotide und/oder Nukleotid-Modifikationen einschließen, welche aus der folgenden Liste ausgewählt sind: DNA, RNA, LNA („locked nucleic acids“: Analoga mit 2'-4' Brückenbindung im Zuckerrest), UNA („unlocked nucleid acids“: ohne Bindung zwischen 2'-3'-Atomen des Zuckerrestes), PNA („peptide nucleic acids“ Analoga), PTO (phosphorothioate), Morpholino-Analoga, 2'-0-Alkyl-RNA Modifikationen (wie 2'-OMe, 2'-0 Propargyl, 2'-0-(2-Methoxyethyl), 2'-0-Propyl-Amin), 2 - Halogen-RNA, 2'-Amino-RNA etc. Diese Nukleotide oder Nukleotid-Modifikationen sind untereinander beispielsweise durch konventionelle 5'-3'- Bindung oder 5'-2' Bindung verknüpft. Es kann beispielsweise eine Phospho-Diesterbindung oder eine nuklease resistente Phospho- Thioester Bindung verwendet werden. The sequence of the first region of the controller oligonucleotide is preferably chosen such that the number of complementary bases that can bind to the second region of the first primer oligonucleotide complementary between 1 and 40, in particular between 3 and 20, in particular between 6 and 15 lies. Since the controller oligonucleotide is not a template for the polymerase, it may include nucleotide modifications that do not support polymerase function, which may be both base modifications and / or sugar-phosphate backbone modifications. The controller oligonucleotide may include, for example, in its first region nucleotides and / or nucleotide modifications selected from the following list: DNA, RNA, LNA ("locked nucleic acids": analogs having 2 ' -4 ' bridge linkage in the sugar moiety). , UNA ( "unlocked Nucleic acids": no bond between 2 '-3' -atoms of the sugar moiety), PNA ( "peptide nucleic acids" analogs), PTO (phosphorothioate), morpholino analogs, 2 '-0-alkyl-RNA modifications (such as 2 '-OMe, 2' -0 propargyl, 2 '-0- (2-methoxyethyl), 2' -0-propyl-amine), 2 - halogen-RNA, 2 '-amino-RNA, etc. These Nucleotides or nucleotide modifications are linked to one another, for example, by conventional 5 ' -3 ' or 5 ' -2 ' binding. For example, a phospho-diester bond or a nuclease-resistant phospho-thioester bond can be used.
Das Controller-Oligonukleotid kann in seinem ersten Bereich Nukleotide und/oder Nukleotid- Modifikationen einschließen, wobei die Nukleobasen aus der folgenden Liste ausgewählt sind: Adenine und seine Analoga, Guanine und seine Analoga, Cytosine und seine Analoga, Uracil und seine Analoga, Thymine und seine Analoga, Inosine oder andere Universalbasen (z.B. Nitroindol), 2-Amino-Adenin und seine Analoga, Iso-Cytosine und seine Analoga, Iso-Guanine und seine Analoga.  The controller oligonucleotide may include nucleotides and / or nucleotide modifications in its first region, the nucleobases being selected from the following list: adenines and their analogs, guanines and its analogs, cytosines and its analogs, uracil and its analogs, thymines and its analogues, inosine or other universal bases (eg nitroindole), 2-amino-adenine and its analogues, iso-cytosines and its analogues, iso-guanines and its analogues.
Das Controller-Oligonukleotid kann in seinem ersten Bereich Nicht-Nukleotid-Verbindungen einschließen, welche aus der folgenden Liste ausgewählt sind: Interkalierende Stoffe, welche die Bindungsstärke zwischen dem Controller-Oligonukleotid und dem ersten Primer-Oligonukleotid beeinflussen können, z.B. MGB, Naphthalene etc. Gleiche Elemente können auch im zweiten Bereich des ersten Primers verwendet werden.  The controller oligonucleotide may include in its first region non-nucleotide compounds selected from the following list: Intercalating substances which may affect the binding strength between the controller oligonucleotide and the first primer oligonucleotide, e.g. MGB, naphthalene etc. The same elements can also be used in the second region of the first primer.
Das Controller-Oligonukleotid kann in seinem ersten Bereich Nicht-Nukleotid-Verbindungen einschließen, z.B. Linker wie C3, C6, HEG Linker, welche einzelne Segmente des ersten Bereichs untereinander verknüpfen.  The controller oligonucleotide may include in its first region non-nucleotide compounds, e.g. Linkers such as C3, C6, HEG linkers which link individual segments of the first region together.
Das Controller-Oligonukleotid kann mittels seines zweiten Bereichs an den ersten Primer-Bereich des ersten Primer-Oligonukleotids binden, wobei die Bindung im Wesentlichen durch Hybridisierung komplementärer Basen vermittelt wird.  The controller oligonucleotide may bind by means of its second region to the first primer region of the first primer oligonucleotide, the binding being mediated essentially by hybridization of complementary bases.
Die Länge des zweiten Bereichs des Controller-Oligonukleotids ist an die Länge des ersten Bereichs des ersten Primer-Oligonukleotid angepasst und stimmt mit dieser vorzugsweise überein. Sie liegt zwischen ca. 3-30 Nukleotiden, insbesondere zwischen 5 und 20 Nukleotiden. Die Sequenz des zweiten Bereichs des Controller-Oligonukleotids ist vorzugsweise komplementär zum ersten Bereich des ersten Primer-Oligonukleotids. Das Maß der Komplementarität liegt zwischen 80 % und 100 %, insbesondere zwischen 95 % und 100 %, insbesondere bei 100 %. Der zweite Bereich des Controller-Oligonukleotids schließt vorzugsweise Nukleotid-Modifikationen ein, welche die Polymerase an der Verlängerung des ersten Primer-Oligonukleotides hindern, allerdings die Ausbildung von komplementären Doppelsträngen nicht blockieren oder nicht wesentlich verhindern, beispielsweise 2'-0-Alkyl RNA-Analoga (z.B. 2'-0-Me, 2'-0-(2-Methoxyethyl), 2'-0- Propyl, 2'-0-Propargyl Nukleotid-Modifikationen), LNA, PNA oder Morpholino Nukleotid- Modifikationen. Einzelne Nukleotid-Monomere sind vorzugsweise via 5'-3'-Bindung verknüpft, aber auch eine alternative 5'-2'-Bindung zwischen Nukleotid-Monomeren kann verwendet werden. The length of the second region of the controller oligonucleotide is matched to the length of the first region of the first primer oligonucleotide and is preferably consistent therewith. It is between about 3-30 nucleotides, in particular between 5 and 20 nucleotides. The sequence of the second region of the controller oligonucleotide is preferably complementary to the first region of the first primer oligonucleotide. The degree of complementarity is between 80% and 100%, in particular between 95% and 100%, in particular at 100%. The second region of the controller oligonucleotide preferably includes nucleotide modifications which prevent the polymerase on the extension of the first primer oligonucleotide, but do not block the formation of complementary double strands, or not substantially prevent, for example, 2 '-0-alkyl-RNA analogues (eg, 2' -0-Me, 2 '-0- ( 2-methoxyethyl), 2 '-0- propyl, 2' -0-propargyl nucleotide modifications), LNA, PNA or morpholino nucleotide modifications. Single nucleotide monomers are preferably linked via 5 ' -3 ' bond, but an alternative 5 ' -2 ' bond between nucleotide monomers may also be used.
Die Sequenz-Länge und ihre Beschaffenheit des ersten und des zweiten Bereichs des Controller- Oligonukleotides sind vorzugsweise dermaßen gewählt, dass die Bindung dieser Bereiche an das erste Primer-Oligonukleotid unter Reaktionsbedingungen zumindestens in einem Reaktions-Schritt des Verfahrens reversibel ist. Das bedeutet, dass das Controller-Oligonukleotid und das erste Primer-Oligonukleotid zwar spezifisch an einander binden können, diese Bindung soll allerdings nicht zur Ausbildung eines unter Reaktionsbedingungen dauerhaft stabilen Komplexes aus beiden Elementen führen.  The sequence length and nature of the first and second regions of the controller oligonucleotide are preferably selected such that binding of these regions to the first primer oligonucleotide is reversible under reaction conditions, at least in one reaction step of the process. This means that the controller oligonucleotide and the first primer oligonucleotide can bind specifically to each other, but this bond should not lead to the formation of a permanently stable under reaction conditions complex of both elements.
Vielmehr soll ein Gleichgewicht zwischen einer gebunden Komplex-Form aus Controller- Oligonukleotid und dem ersten Primer-Oligonukleotid und einer freien Form von einzelnen Komponenten unter Reaktionsbedingungen zumindest in einem Reaktions-Schritt angestrebt bzw. ermöglicht werden. Damit wird sichergestellt, dass zumindest ein Anteil der ersten Primer- Oligonukleotide unter Reaktionsbedingungen in freier Form vorliegt und mit der Matrize interagieren kann, um eine Primer-Verlängerungsreaktion zu initiieren. Andererseits, wird damit sichergestellt werden, dass entsprechende Sequenzbereiche des Controller-Oligonukleotides zur Bindung mit einem verlängerten Primer-Oligonukleotid zur Verfügung stehen.  Rather, an equilibrium between a bound complex form of controller oligonucleotide and the first primer oligonucleotide and a free form of individual components under reaction conditions should be sought or made possible at least in one reaction step. This ensures that at least a portion of the first primer oligonucleotides can be in free form under reaction conditions and can interact with the template to initiate a primer extension reaction. On the other hand, it will be ensured that corresponding sequence regions of the controller oligonucleotide are available for binding with an extended primer oligonucleotide.
Durch Temperatur-Wahl während der Reaktion kann der Anteil von freien, einzelsträngigen und somit reaktionsfähigen Komponenten beeinflusst werden: durch Absenkung der Temperatur binden erste Primer-Oligonukleotide an die Controller-Oligonukleotide, so dass beide Teilnehmer einen komplementären doppelsträngigen Komplex binden. Damit kann die Konzentration einzelsträngiger Formen einzelner Komponenten abgesenkt werden. Eine Erhöhung der Temperatur kann zur Dissoziation beider Komponenten in einzelsträngige Form führen. Im Bereich der Schmelz-Temperatur des Komplexes (Controller-Oligonukleotid / erstes Primer-Oligonukleotid) liegen ca. 50% der Komponenten in einzelsträngiger Form und ca. 50% als doppelsträngiger Komplex vor. Durch Verwendung entsprechender Temperaturen kann somit die Konzentration einzelsträngiger Formen im Reaktionsgemisch beeinflusst werden.  By choosing the temperature during the reaction, the proportion of free, single-stranded and thus reactive components can be influenced: by lowering the temperature, first primer oligonucleotides bind to the controller oligonucleotides, so that both participants bind a complementary double-stranded complex. Thus, the concentration of single-stranded forms of individual components can be lowered. An increase in temperature can lead to the dissociation of both components into single-stranded form. In the region of the melting temperature of the complex (controller oligonucleotide / first primer oligonucleotide) are about 50% of the components in single-stranded form and about 50% as a double-stranded complex. By using appropriate temperatures, the concentration of single-stranded forms in the reaction mixture can thus be influenced.
Bei Ausführungsformen des Amplifikationsverfahrens, welche einen Temperatur- Wechsel zwischen einzelnen Reaktions-Schritten umfassen, können gewünschte Reaktionsbedingungen während entsprechender Reaktions-Schritte herbeigeführt werden. Beispielsweise durch Verwendung von Temperatur-Bereichen etwa in Höhe von der Schmelztemperatur von Komplexen aus Controller-Oligonukleotid / erstes Primer-Oligonukleotid können Anteile von jeweils freien Formen einzelner Komponenten beeinflusst werden. Dabei führt die verwendete Temperatur zu einer Destabilisierung von Komplexen umfassend Controller-Oligonukleotid / erster Primer- Oligonukleotid, so dass während dieses Reaktionsschrittes einzelne Komplex-Komponenten zumindest vorübergehend einzelsträngig werden und damit in die Lage versetzt werden, mit anderen Reaktionspartnern zu interagieren. Beispielsweise kann ein erster Sequenzbereich des Controller-Oligonukleotides aus dem doppelsträngigen Komplex mit einem nicht-verlängerten ersten Primer freigesetzt werden und kann somit mit dem zweiten Sequenzbereich eines verlängerten ersten Primer-Oligonukleotides interagieren und damit eine Strangverdrängung initiieren. Andererseits, führt die Freisetzung eines ersten, nicht verlängerten Primer- Oligonukleotides aus einem Komplex umfassend Controller-Oligonukleotid / erster Primer- Oligonukleotid dazu, dass der erste Primer-Bereich einzelsträngig wird und somit mit der Matrize interagieren kann, so dass eine Primer-Verlängerung durch eine Polymerase initiiert werden kann.In embodiments of the amplification process comprising a temperature change between individual reaction steps, desired reaction conditions can be brought about during corresponding reaction steps. For example, by using temperature ranges approximately at the level of the melting temperature of complexes of controller oligonucleotide / first primer oligonucleotide portions of each free forms of individual components can be influenced. The temperature used increases destabilizing complexes comprising controller oligonucleotide / first primer oligonucleotide such that, during this reaction step, individual complex components become, at least temporarily, single-stranded, thereby being able to interact with other reactants. For example, a first sequence region of the controller oligonucleotide may be released from the double-stranded complex with a non-extended first primer, and thus may interact with the second sequence region of an extended first primer oligonucleotide, thereby initiating strand displacement. On the other hand, release of a first, non-extended primer oligonucleotide from a complex comprising controller oligonucleotide / first primer oligonucleotide results in the first primer region becoming single-stranded and thus able to interact with the template such that primer extension by a polymerase can be initiated.
Die verwendete Temperatur muss dabei nicht exakt der Schmelztemperatur des Komplexes aus Controller-Oligonukleotid / erstem Primer-Oligonukleotid entsprechen. Es genügt, wenn die Temperatur in einem Reaktionsschritt etwa im Bereich der Schmelztemperatur liegt. Beispielsweise umfasst die Temperatur in einem der Reaktionsschritte Bereiche von Tm +/- 10°C, insbesondere Tm +/- 5°C, insbesondere Tm +/- 3°C des Komplexes aus Controller-Oligonukleotid / erstes Primer-Oligonukleotid. The temperature used does not have to correspond exactly to the melting temperature of the complex of controller oligonucleotide / first primer oligonucleotide. It is sufficient if the temperature in a reaction step is approximately in the range of the melting temperature. For example, the temperature in one of the reaction steps comprises ranges of Tm +/- 10 ° C, in particular Tm +/- 5 ° C, in particular Tm +/- 3 ° C of the complex of controller oligonucleotide / first primer oligonucleotide.
Eine solche Temperatur kann beispielsweise im Rahmen des Reaktions-Schrittes eingestellt werden, welcher eine sequenzspezifische Strangverdrängung durch das Controller-Oligonukleotid umfasst.  Such a temperature can be set, for example, in the context of the reaction step, which comprises a sequence-specific strand displacement by the controller oligonucleotide.
Bei Ausführungsformen des Amplifikationsverfahrens, welche keinen Temperatur-Wechsel zwischen einzelnen Reaktions-Schritten umfassen und die Amplifikation unter isothermalen Bedinungen verläuft, werden über die Gesamtdauer der Amplifikationsreaktion Reaktionsbedingungen aufrechterhalten, bei welchen ein Gleichgewicht zwischen einer Komplex- Form aus Controller-Oligonukleotid und dem ersten Primer-Oligonukleotid und einer freien Form von einzelnen Komponenten möglich ist.  In embodiments of the amplification process which do not involve temperature cycling between individual reaction steps and the amplification proceeds under isothermal conditions, reaction conditions are maintained over the entire duration of the amplification reaction in which there is equilibrium between a complex oligonucleotide-controller design and the first primer Oligonucleotide and a free form of individual components is possible.
Das Verhältnis zwischen einer Komplex-Form aus Controller-Oligonukleotid und dem ersten Primer-Oligonukleotid und freien Formen einzelner Komponenten kann sowohl durch Reaktionsbedingungen (z.B. Temperatur und Mg2+ Konzentration) als auch durch Strukturen und Konzentrationen einzelner Komponenten beeinflusst werden. The ratio between a complex form of controller oligonucleotide and the first primer oligonucleotide and free forms of individual components can be influenced both by reaction conditions (eg temperature and Mg 2+ concentration) and by structures and concentrations of individual components.
Die Sequenz-Länge und ihre Beschaffenheit des ersten und des zweiten Bereichs des Controller- Oligonukleotides sind in bestimmten Ausführungsformen so gewählt, dass unter gegebenen Reaktionsbedingungen (z.B. im Reaktionsschritt einer Strangverdrängung durch das Controller- Oligonukleotid) das Verhältnis zwischen einem Anteil eines freien Controller-Oligonukleotids und einem Anteil eines Controller-Oligonukleotids im Komplex mit einem ersten Primer-Oligonukleotid folgende Bereiche umfasst: von 1 :100 bis 100:1 , insbesondere von 1 :30 bis 30:1 , insbesondere von 1 :10 bis 10:1 . Das Verhältnis zwischen einem Anteil eines freien ersten Primer-Oligonukleotids und einem Anteil eines ersten Primer-Oligonukleotids im Komplex mit einem Controller- Oligonukleotid umfasst Bereiche von 1 :100 bis 100:1 , insbesondere von 1 :30 bis 30:1 , insbesondere von 1 :10 bis 10:1 . The sequence length and nature of the first and second regions of the controller oligonucleotide are, in certain embodiments, chosen such that under given reaction conditions (eg, in the strand displacement displacement step by the controller oligonucleotide) the ratio between a proportion of free controller oligonucleotide and a portion of a controller oligonucleotide complexed with a first primer oligonucleotide comprises the following ranges: from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, more preferably from 1:10 to 10: 1. The ratio between a proportion of a free first primer oligonucleotide and a proportion of a first primer oligonucleotide complexed with a controller oligonucleotide comprises ranges of from 1: 100 to 100: 1, more preferably from 1:30 to 30: 1, more preferably from 1:10 to 10: 1.
In bestimmten Ausführungsformen ist die Konzentration des ersten Primer-Oligonukleotides höher als die Konzentration des Controller-Oligonukleotides. Dadurch liegt ein Überschuß des ersten Primers in der Reaktion vor und das Controller-Oligonukleotid muss für seine Wirkung aus der Bindung mit dem ersten Primer durch die Wahl entsprechender Reaktionstemperatur freigesetzt werden. Im Allgemeinen erfolgt das durch eine Temperaturerhöhung, bis hinreichende Konzentrationen von freien Formen des Controller-Oligonukleotids vorliegen.  In certain embodiments, the concentration of the first primer oligonucleotide is higher than the concentration of the controller oligonucleotide. This results in an excess of the first primer in the reaction and the controller oligonucleotide must be released for its effect of binding with the first primer by choosing the appropriate reaction temperature. In general, this is done by raising the temperature to sufficient levels of free forms of the controller oligonucleotide.
In bestimmten Ausführungsformen ist die Konzentration des ersten Primer-Oligonukleotides niedriger als die Konzentration des Controller-Oligonukleotides. Dadurch liegt ein Überschuss des Controller-Oligonukleotids vor und das erste Primer-Oligonukleotid muss für seine Wirkung aus der Bindung mit dem Controller-Oligonukleotid durch die Wahl entsprechender Reaktionstemperatur freigesetzt werden. Im Allgemeinen erfolgt das durch eine Temperaturerhöhung, bis hinreichende Konzentrationen von freien Formen des ersten Primer-Oligonukleotids vorliegen.  In certain embodiments, the concentration of the first primer oligonucleotide is lower than the concentration of the controller oligonucleotide. As a result, there is an excess of the controller oligonucleotide and the first primer oligonucleotide must be released for its effect of binding to the controller oligonucleotide by choosing the appropriate reaction temperature. In general, this is done by raising the temperature to sufficient levels of free forms of the first primer oligonucleotide.
Bei isothermalen Bedingungen liegt ein Gleichgewicht vor: gewisse Anteile des ersten Primer- Oligonukleotides und Controller-Oligonukleotides sind aneinander gebunden, andere dagegen sind als einzelsträngige Form in der Reaktion vorhanden.  In isothermal conditions, there is an equilibrium: certain portions of the first primer oligonucleotide and controller oligonucleotide are bound together, while others are present as a single-stranded form in the reaction.
Das Controller-Oligonukleotid kann mittels seines dritten Bereichs an mindestens ein Segment des spezifisch synthetisierten Verlängerungsprodukts des ersten Primer-Oligonukleotids binden. Die Bindung erfolgt bevorzugt durch Hybridisierung komplementärer Basen zwischen dem Controller- Oligonukleotid und dem von der Polymerase synthetisierten Verlängerungsprodukt.  The controller oligonucleotide may bind by means of its third region to at least one segment of the specifically synthesized extension product of the first primer oligonucleotide. Binding is preferably by hybridization of complementary bases between the controller oligonucleotide and the extension product synthesized by the polymerase.
Zur Unterstützung der Strangverdrängungsreaktion soll die Sequenz des dritten Bereichs vorzugsweise eine hohe Komplementarität zum Verlängerungsprodukt aufweisen. In bestimmten Ausführungsformen ist die Sequenz des dritten Bereichs zu 100 % zu dem Verlängerungsprodukt komplementär.  In order to support the strand displacement reaction, the sequence of the third region should preferably have a high complementarity to the extension product. In certain embodiments, the sequence of the third region is 100% complementary to the extension product.
Die Bindung des dritten Bereichs erfolgt vorzugsweise an das Segment des Verlängerungsproduktes, welches unmittelbar an den ersten Bereich des ersten Primer- Oligonukleotides anschließt. Somit liegt das Segment des Verlängerungsprodukts vorzugsweise im 5'-Segment des gesamten Verlängerungsprodukts des ersten Primer-Oligonukleotids. The binding of the third region is preferably carried out on the segment of the extension product, which connects directly to the first region of the first primer oligonucleotide. Thus, the segment of the extension product is preferably in the 5 ' segment of the entire extension product of the first primer oligonucleotide.
Die Bindung des dritten Bereichs des Controller-Oligonukleotids erfolgt vorzugsweise nicht über die gesamte Länge des Verlängerungsprodukts des ersten Primer-Oligonukleotides. Vorzugsweise bleibt ein Segment am 3'-Ende des Verlängerungsproduktes ungebunden. Dieses 3'-ständige Segment ist für die Bindung des zweiten Primer-Oligonukleotides notwendig. Die Länge des dritten Bereichs ist entsprechend dermaßen angepasst, dass der dritte Bereich zum einen an das 5'-ständige Segment des Verlängerungsproduktes bindet, andererseits das 3'- ständige Segment des Verlängerungsproduktes nicht bindet. The binding of the third region of the controller oligonucleotide preferably does not occur over the entire length of the extension product of the first primer oligonucleotide. Preferably, a segment remains unbound at the 3 ' end of the extension product. This 3 ' -terminal segment is necessary for the binding of the second primer oligonucleotide. The length of the third region is adapted accordingly so that the third region binds to the 5 ' -terminal segment of the extension product on the one hand, while on the other hand does not bind the 3 ' -step segment of the extension product.
Die Gesamtlänge des dritten Bereichs des Controller-Oligonukleotids beträgt von 2 bis 100, insbesondere von 6 bis 60, insbesondere von 10 bis 40 Nukleotide oder ihrer Äquivalente. Das Controller-Oligonukleotid kann mit dem Segment des Verlängerungsproduktes über diese Länge eine komplementäre Bindung eingehen und damit dieses 5'-ständige Segment des Verlängerungsprodukts aus der Bindung mit seinem komplementären Matrizen-Strang verdrängen. The total length of the third region of the controller oligonucleotide is from 2 to 100, in particular from 6 to 60, in particular from 10 to 40 nucleotides or their equivalents. The controller oligonucleotide may enter into a complementary bond with the segment of the extension product over that length, thereby displacing this 5 ' segment of the extension product from binding with its complementary template strand.
Die Länge des 3'-ständigen Segments des Verlängerungsproduktes, welches nicht vom Controller- Oligonukleotid gebunden wird, umfasst beispielsweise Bereiche zwischen 5 und 200, insbesondere zwischen 5 und 100, insbesondere zwischen 5 und 60 Nukleotide, insbesondere zwischen 10 und 40, insbesondere zwischen 15 und 30 Nukleotide. The length of the 3 ' -terminal segment of the extension product which is not bound by the controller oligonucleotide comprises, for example, ranges between 5 and 200, in particular between 5 and 100, in particular between 5 and 60 nucleotides, in particular between 10 and 40, in particular between 15 and 30 nucleotides.
Dieses 3'-ständige Segment des Verlängerungsprodukts wird nicht vom Controller-Oligonukletid aus der Bindung mit dem Matrizenstrang verdrängt. Auch bei einem vollständig gebundenen dritten Bereich des Controller-Oligonukleotids an sein komplementäres Segment des Verlängerungsproduktes kann das erste Primer-Verlängerungsprodukt via seinem 3'-ständigen Segment mit dem Matrizenstrang gebunden bleiben. Die Bindungsstärke dieses Komplexes ist vorzugsweise so gewählt, dass er unter Reaktionsbedinungen (Schritt e) beispielsweise spontan dissoziieren kann. Dies kann bespielsweise dadurch erreicht werden, dass die Schmelztemperatur dieses Komplexes aus dem 3'-ständigen Segment des Verlängerungsprodukts des ersten Primer- Oligonukleotids und seinem Matrizenstrang etwa im Bereich der Reaktionstemperatur liegt oder unterhalb der Reaktionstemperatur bei einem entsprechenden Reaktionsschritt (Reaktionsschritt e). Bei geringer Stabilität dieses Komplexes im 3'-Segment des Verlängerungsproduktes führt eine vollständige Bindung des dritten Bereichs des Controller-Oligonukleotids an das 5'-ständige Segment des Verlängerungsproduktes zu einer schnellen Dissoziation des ersten Primer- Verlängerungsprodukts von seinem Matrizenstrang. This 3 ' segment of the extension product is not displaced from the controller oligonucleotide from binding with the template strand. Even with a fully bound third region of the controller oligonucleotide to its complementary segment of the extension product, the first primer extension product may remain bound to the template strand via its 3 ' -terminal segment. The bond strength of this complex is preferably chosen so that it can dissociate spontaneously under reaction conditions (step e), for example. This may be recordable, be achieved by that the melting temperature of the complex is from the 3 '-ständigen segment of the extension product of the first primer oligonucleotide and its template strand approximately in the range of the reaction temperature or below the reaction temperature at a corresponding reaction step (reaction step e). With little stability of this complex in the 3 ' segment of the extension product, complete binding of the third region of the controller oligonucleotide to the 5 ' segment of the extension product results in rapid dissociation of the first primer extension product from its template strand.
Das Controller-Oligonukleotid hat insgesamt eine passende Struktur, um seine Funktion auszuführen: unter entsprechenden Reaktionsbedingungen ist es in der Lage, das verlängerte erste Primer-Oligonukleotid aus der Bindung mit dem Matrizenstrang sequenzspezifisch zu verdrängen, wodurch der Matrizenstrang in einzelsträngige Form überführt wird und somit für weitere Bindungen mit einem neuen ersten Primer-Oligonukleotid und deren zielsequenzspezifischer Verlängerung durch die Polymerase zur Verfügung steht.  The controller oligonucleotide as a whole has a suitable structure to perform its function: under appropriate reaction conditions, it is capable of sequence-specific displacement of the extended first primer oligonucleotide from binding with the template strand, thereby converting the template strand into single-stranded form, and thus for further binding with a novel first primer oligonucleotide and its target sequence-specific extension by the polymerase.
Um die Funktion der Strangverdrängung zu erfüllen, sollten Bereiche eins, zwei und drei des Controller-Oligonukleotids vorwiegend in einzelsträngiger Form unter Reaktionsbedingungen vorliegen. Daher sollten doppelsträngige selbstkomplementäre Strukturen (z.B. Hairpins) in diesen Bereichen nach Möglichkeit vermieden werden, da sie die Funktionalität des Controller- Oligonukleotides herabsetzen können. To fulfill the function of strand displacement, regions one, two and three of the controller oligonucleotide should be predominantly in single-stranded form under reaction conditions. Therefore, double-stranded self-complementary structures (eg hairpins) should be included in these As far as possible, they can be avoided since they can reduce the functionality of the controller oligonucleotide.
Das Controller-Oligonukleotid soll im erfindungsgemäßen Verfahren nicht als Matrize auftreten, daher soll das erste Primer-Oligonukleotid, wenn angelagert an das Controller-Oligonukleotid unter Reaktionsbedingungen, nicht von der Polymerase verlängert werden.  The controller oligonucleotide should not appear as a template in the method of the invention, therefore the first primer oligonucleotide, when attached to the controller oligonucleotide under reaction conditions, should not be extended by the polymerase.
Dies wird vorzugsweise durch Verwendung von Nukleotid-Modifikationen erreicht, welche die Polymerase am Kopieren des Stranges hindern. Vorzugsweise bleibt das 3'-Ende des ersten Primer-Oligonukleotids nicht verlängert, wenn das erste Primer-Oligonukleotid an das Controller- Oligonukleotid unter Reaktionsbedingungen bindet. This is preferably achieved by using nucleotide modifications which prevent the polymerase from copying the strand. Preferably, the 3 ' end of the first primer oligonucleotide does not remain elongated when the first primer oligonucleotide binds to the controller oligonucleotide under reaction conditions.
Das Ausmaß der Blockade/Hinderung/Verlangsamung/Erschwerung der Reaktion kann zwischen vollständiger Ausprägung dieser Eigenschaft (z.B. 100 % Blockade unter gegebenen Reaktionsbedingungen) und einer partiellen Ausprägung dieser Eigenschaft liegen (z.B. 30-90 % Blockade unter gegebenen Reaktionsbedingungen). Bevorzugt werden Nukleotid-Modifikationen, welche einzeln oder in einer Reihe aneinander gekoppelt (z.B. als Sequenzfragment bestehend aus modifizierten Nukleotiden) zu mehr als 70 %, insbesondere zu mehr als 90 %, insbesondere zu mehr als 95 %, und insbesondere zu 100 % die Verlängerung eines ersten Primers verhindern können.  The degree of blockage / inhibition / slowing / aggravation of the reaction may be between complete expression of this property (e.g., 100% blockage under given reaction conditions) and a partial expression of this property (e.g., 30-90% blockade under given reaction conditions). Preference is given to nucleotide modifications which are individually or in series coupled to one another (eg as a sequence fragment consisting of modified nucleotides) to more than 70%, in particular more than 90%, in particular more than 95%, and in particular 100% elongation prevent a first primer.
Die Nukleotid-Modifikationen können Basen-Modifikationen und/oder Zucker-Phosphat-Rest Modifikationen umfassen. Die Zucker-Phosphat-Modifikationen sind bevorzugt, da durch die Kombination mit konventionellen Nukleobasen eine beliebige komplementäre Sequenz eines Controller-Oligonukleotides zusammengestellt werden kann. Die Nukleotide mit Modifikationen im Zucker-Phosphat-Rest, welche zur Hinderung bzw. Blockade der Synthese der Polymerase führen können, schließen beispielsweise ein: 2'-0-Alkyl-Modifikationen (z.B. 2'-0-Methyl, 2'-0-(2- Methoxyethyl), 2'-0-Propyl, 2'-0-Propargyl Nukleotid-Modifikationen), 2'-Amino-2'-Deoxy- Nukleotid-Modifikationen, 2'-Amino-Alkyl-2'-Deoxy-Nukleotid-Modifikationen, PNA, Morpholino- Modifikationen usw. The nucleotide modifications may include base modifications and / or sugar-phosphate-residue modifications. The sugar-phosphate modifications are preferred because any complementary sequence of a controller oligonucleotide can be assembled by combining with conventional nucleobases. The nucleotides with modifications in the sugar-phosphate residue, which can lead to hindrance or blockage of the synthesis of the polymerase include, for example: 2 '-0-alkyl modifications (eg, 2' -0-methyl, 2 '-0- (2-methoxyethyl), 2 '-0-propyl, 2' -0-propargyl nucleotide modifications), 2 '-amino-2' -Deoxy- nucleotide modifications, 2 'amino-alkyl-2' -Deoxy- Nucleotide modifications, PNA, morpholino modifications, etc.
Die Blockade kann sowohl durch eine einzelne Nukleotid-Modifikation erfolgen oder erst durch Kopplung von mehreren Nukleotid-Modifikationen in Reihe erfolgen (z.B. als Sequenzfragment bestehend aus modifizierten Nukleotiden). Beispielsweise können mindestens 2, insbesondere mindestens 5, insbesondere mindestens 10 solcher Nukleotid-Modifikationen nebeneinander im Controller-Oligonukleotid gekoppelt sein.  The blockade can be accomplished by either a single nucleotide modification or only by coupling multiple nucleotide modifications in series (e.g., as a sequence fragment consisting of modified nucleotides). For example, at least 2, in particular at least 5, in particular at least 10, of such nucleotide modifications can be coupled side by side in the controller oligonucleotide.
Ein Controller-Oligonukleotid kann eine einheitliche Art von Nukleotid-Modifikationen aufweisen oder auch mindestens zwei verschiedene Arten der Nukleotid-Modifizierung umfassen.  A controller oligonucleotide may comprise a uniform type of nucleotide modifications or may comprise at least two different types of nucleotide modification.
Die Position solcher Nukleotid-Modifikationen im Controller-Oligonukleotid soll vorzugsweise die Polymerase daran hindern, das 3'-Ende eines am Controller-Oligonukleotid gebundenen ersten Primer-Oligonukleotids zu verlängern. In bestimmten Ausführungsformen sind solche Nukleotid-Modifikationen im zweiten Bereich des Controller-Oligonukleotids lokalisiert. In bestimmten Ausführungsformen sind solche Nukleotid- Modifikationen im dritten Bereich des Controller-Oligonukleotids lokalisiert. In bestimmten Ausführungsformen sind solche Nukleotid-Modifikationen im zweiten und im dritten Bereich des Controller-Oligonukleotids lokalisiert. The location of such nucleotide modifications in the controller oligonucleotide is preferably intended to prevent the polymerase from extending the 3 ' end of a first primer oligonucleotide bound to the controller oligonucleotide. In certain embodiments, such nucleotide modifications are located in the second region of the controller oligonucleotide. In certain embodiments, such nucleotide modifications are located in the third region of the controller oligonucleotide. In certain embodiments, such nucleotide modifications are located in the second and third regions of the controller oligonucleotide.
Beispielsweise besteht der zweite Bereich des Controller-Oligonukleotids zu mindestens 20 % seiner Positionen aus solchen Nukleotid-Modifikationen, insbesondere zu mindestens 50 %. For example, the second region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%.
Beispielsweise besteht der dritte Bereich des Controller-Oligonukleotids zu mindestens 20 % seiner Positionen aus solchen Nukleotid-Modifikationen, insbesondere zu mindestens 50 %, insbesondere zu mindestens 90%. In bestimmten Ausführungsformen umfasst der gesamte dritte Bereich Nukleotid-Modifikationen, welche eine Polymerase daran hindern, einen an einen solchen Bereich gebundenen Primer unter Verwendung des Controller-Oligonukleotides als Matrize zu verlängern. In bestimmten Ausführungsformen umfasst der gesamte dritte und zweite Bereich solche Nukleotid-Modifikationen. In bestimmten Ausführungsformen umfasst der gesamte erste, zweite und dritte Bereich solche Nukleotid-Modifikationen. Somit kann das Controller- Oligonukleotid vollständig aus solchen Nukleotid-Modifikationen bestehen. Solche modifizierten Controller-Oligonukleotide können beispielsweise bei Multiplex-Analysen verwendet werden, bei welchen weitere Primer verwendet werden. Dadurch soll verhindert werden, dass es zu unbeabsichtigten Primer-Verlängerungs-Reaktionen an einem oder mehreren Controller- Oligonukleotiden kommt. For example, the third region of the controller oligonucleotide consists of at least 20% of its positions from such nucleotide modifications, in particular at least 50%, in particular at least 90%. In certain embodiments, the entire third region comprises nucleotide modifications that prevent a polymerase from extending a primer bound to such a region using the controller oligonucleotide as a template. In certain embodiments, the entire third and second regions include such nucleotide modifications. In certain embodiments, the entire first, second, and third regions include such nucleotide modifications. Thus, the controller oligonucleotide may consist entirely of such nucleotide modifications. Such modified controller oligonucleotides can be used, for example, in multiplex analyzes in which further primers are used. This is to prevent inadvertent primer extension reactions on one or more controller oligonucleotides.
Die Sequenz der Nukleobasen von diesen Nukleotid-Modifikationen ist den Anforderungen an die Sequenz im jeweiligen Bereich angepasst.  The sequence of nucleobases from these nucleotide modifications is adapted to the requirements of the sequence in each area.
Den restlichen Anteil können beispielsweise natürliche Nukleotide ausmachen, oder Nukleotid- Modifikationen, welche die Polymerasen-Funktion gar nicht oder nur unwesentlich hindern z.B. DNA-Nukleotide, PTO-Nukleotide, LNA-Nukleotide, RNA-Nukleotide. Dabei können weitere Modifikationen, beispielsweise Basenmodifikationen wie 2-Amino-Adenosin, 2-Aminopurine, 5- Methyl-Cytosine, Inosine, 5-Nitroindole, 7-Deaza-Adenosin, 7-Deaza-Guanosin, 5-Propyl-Cytosin, 5-Propyl-Uridin oder Nicht-Nukleotid-Modifikationen wie Farbstoffe, oder MGB-Modifikationen etc. z.B. zur Anpassung von Bindungsstärken von einzelnen Bereichen der Controller-Oligonukleotide verwendet werden. Die einzelnen Nukleotid-Monomere können via konventionelle 5'-3'-Bindung untereinander gekoppelt werden oder auch abweichend via 5'-2'-Bindung. For example, the remaining portion may be natural nucleotides, or nucleotide modifications that do not or only marginally inhibit polymerase function, eg, DNA nucleotides, PTO nucleotides, LNA nucleotides, RNA nucleotides. In this case, further modifications, for example base modifications such as 2-amino-adenosine, 2-aminopurines, 5-methyl-cytosines, inosines, 5-nitroindoles, 7-deaza-adenosine, 7-deaza-guanosine, 5-propyl-cytosine, 5 Propyl uridine or non-nucleotide modifications such as dyes, or MGB modifications, etc. can be used, for example, to match binding strengths of individual regions of the controller oligonucleotides. The individual nucleotide monomers can be coupled to each other via conventional 5 ' -3 ' bond or else via 5 ' -2 ' bond.
Ein Segment des Controller-Oligonukleotids mit Nukleotid-Modifikationen, welche die Verlängerung vom 3'-Ende eines an das Controller-Oligonukleotid gebundenen ersten Primer- Oligonukleotids durch die Polymerase verhindern, wird als "zweite Blockierungs-Einheit" bezeichnet. Die Länge dieses Segments kann zwischen 1 bis 50 Nukletid-Modifikationen einschließen, insbesondere zwischen 4 und 30. Dieses Segment kann beispielsweise dermaßen im Controller-Oligonukleotid lokalisiert sein, dass das 3'-Ende des gebundenen ersten Primer- Oligonukleotids in diesem Segment liegt. Somit kann dieses Segment die Bereiche zwei und drei überspannen. Bei Verwendung weiterer Primer (z.B. Kompetitor-Primer), welche ebenfalls an das Controller-Oligonukleotid komplementär binden können, können weitere Blockierungs-Einheiten eingeführt werden, beispielsweise eine vierte Blockierungs-Einheit, welche an der gleichen Position im Controller-Oligonukleotid liegen kann wie die zweite Blockierungs-Einheit oder eine abweichende Position umfasst. Beispielsweise kann die vierte Blockierungs-Einheit in 5'-Richtung von der zweiten Blockierungs-Einheit liegen. Die Primer-Blockade durch eine solche vierte Blockierungs-Einheit erfolgt nach dem gleichen Prinzip wie bei der zweiten Blockierungs-Einheit: ein Primer, welcher zwar in der Lage ist, an das Controller-Oligonukleotid komplementär zu binden, wird von Polymerase nicht verlängert. Somit wird verhindert, dass das Controller-Oligonukleotid für weitere Primer, z.B. einen Kompetitor-Primer, als Matrize dient. A segment of the controller oligonucleotide having nucleotide modifications that prevent extension of the 3 ' end of a first primer oligonucleotide bound to the controller oligonucleotide by the polymerase is termed a "second blocking moiety". The length of this segment may include from 1 to 50 nuclide modifications, especially between 4 and 30. For example, this segment may be located in the controller oligonucleotide such that the 3 ' end of the bound first primer Oligonucleotide lies in this segment. Thus, this segment can span regions two and three. By using further primers (eg, competitor primers) which may also bind complementarily to the controller oligonucleotide, additional blocking moieties may be introduced, for example, a fourth blocking moiety which may be at the same position in the controller oligonucleotide as the second blocking unit or a deviating position. For example, the fourth blocking unit may lie in the 5 ' direction from the second blocking unit. The primer blockade by such a fourth blocking moiety follows the same principle as that of the second blocking moiety: a primer which is capable of complementarily binding to the controller oligonucleotide is not extended by polymerase. Thus, the controller oligonucleotide is prevented from serving as a template for other primers, eg a competitor primer.
Ein Segment des Controller-Oligonukleotids mit Nukleotid-Modifikationen, welche die Verlängerung vom 3'-Ende eines an den Controller-Oligonukleotid gebundenen weiteren Primer- Oligonukleotids (z.B. eines Kompetitor-Primer-Oligonukleotides) durch die Polymerase verhindern, wird als "vierte Blockierungs-Einheit" bezeichnet. Die Zusammensetzung einer solchen„vierten Blockierungs-Einheit“ kann analog zu der„zweiten Blockierungseinheit“ ausgeführt werden. A segment of the controller oligonucleotide with nucleotide modifications which prevent the extension of the 3 ' end of a further primer oligonucleotide bound to the controller oligonucleotide (eg a competitor primer oligonucleotide) by the polymerase is termed a "fourth blocking" Unit ". The composition of such a "fourth blocking unit" can be carried out analogously to the "second blocking unit".
In bestimmten Ausführungsformen werden vorzugsweise keine Linker-Strukturen oder Spacer- Strukturen, wie C3, C6, HEG-Linker zur Verhinderung der Verlängerung des 3'-Ende eines an das Controller-Oligonukleotid gebundenen ersten Primer-Oligonukleotids verwendet. In certain embodiments, preferably no linker structures or spacer structures, such as C3, C6, HEG linkers, are used to prevent the 3 ' end extension of a first primer oligonucleotide bound to the controller oligonucleotide.
Das Controller-Oligonukleotid kann außer Bereichen eins, zwei und drei noch weitere Sequenzsegmente umfassen, welche beispielsweise im 5'-Segment oder 3'-Segment des Controller-Oligonukleotid die oben genannten Bereiche flankieren. Solche Sequenzelemente können beispielsweise für weitere Funktionen verwendet werden, wie beispielsweise Interaktion mit Sonden, Bindung an eine feste Phase etc. Solche Bereiche stören vorzugsweise die Funktion der Bereiche eins bis drei nicht. Die Länge dieser flankierenden Sequenzen kann beispielsweise zwischen 1 bis 50 Nukleotide betragen. Weiterhin kann ein Controller-Oligonukleotid mindestes ein Element zu Immobilisierung an einer festen Phase umfassen, z.B. einen Biotin-Rest. Weiterhin kann ein Controller-Oligonukleotid mindestes ein Element zur Detektion umfassen, z.B. einen Fluoreszenz-Farbstoff. The controller oligonucleotide may comprise, in addition to regions one, two and three, further sequence segments which, for example, flank the abovementioned regions in the 5 ' segment or 3 ' segment of the controller oligonucleotide. Such sequence elements may be used, for example, for other functions, such as interaction with probes, binding to a solid phase, etc. Such regions preferably do not interfere with the function of regions one to three. The length of these flanking sequences may be, for example, between 1 to 50 nucleotides. Furthermore, a controller oligonucleotide may comprise at least one element for immobilization on a solid phase, eg a biotin residue. Furthermore, a controller oligonucleotide may include at least one element for detection, eg, a fluorescent dye.
In Anwesenheit von einem Controller-Oligonukleotid werden neusynthetisierte Sequenzen auf ihre Sequenz-Inhalte durch die Interaktion mit dem Controller-Oligonukleotid überprüft.  In the presence of a controller oligonucleotide, newly synthesized sequences are checked for sequence content through interaction with the controller oligonucleotide.
• Bei korrekter Übereinstimmung mit vorgegebenen Sequenzinhalten des Controller- Oligonukleotides erfolgt eine Strangverdrängung, wobei die Matrizen-Stränge von neusynthetisierten Strängen abgelöst werden. Dabei werden Primer-Bindungsstellen in den einzelsträngigen Zustand überführt und stehen für eine neue Interaktion mit den Primern und somit für eine weitere Synthese zur Verfügung. Somit wird das System aus beiden Primer-Verlängerungsprodukten in einen aktiven Zustand versetzt. Das Controller- Oligonukleotid hat somit eine aktivierende Wirkung auf das System. • If the sequence oligonucleotide is correctly matched to the sequence oligonucleotide, strand displacement occurs, with the template strands being replaced by newly synthesized strands. Here, primer binding sites are converted to the single-stranded state and are available for a new interaction with the primers and thus for further synthesis. Thus, the system is off put both primer extension products in an active state. The controller oligonucleotide thus has an activating effect on the system.
• Bei fehlender Übereinstimmung mit vorgegebenen Sequenzinhalten des Controller- Oligonukleotides wird die Strangverdrängung der Matrizen-Stränge von neusynthetisierten Strängen beeinflusst. Die Strangverdrängung und /oder Ablösung wird entweder quantitativ verlangsamt oder komplett aufgehoben. Es kommt somit gar nicht oder seltener zur Überführung von Primer-Bindungsstellen in den einzelsträngigen Zustand. Somit stehen für eine neue Interaktion mit Primern gar keine oder quantitativ gesehen weniger Primer- Bindungsstellen zur Verfügung. Somit wird das System aus beiden Primer- Verlängerungsprodukten seltener in einen aktiven Zustand versetzt bzw. ein aktiver Zustand wird gar nicht erreicht.  • If there is no match with given sequence contents of the controller oligonucleotide, the strand displacement of the template strands is influenced by newly synthesized strands. The strand displacement and / or separation is either slowed down quantitatively or completely eliminated. It is thus not at all or less often the transfer of primer binding sites in the single-stranded state. Thus, there are no or fewer primer binding sites available for a new interaction with primers. Thus, the system of both primer extension products is rarely put into an active state or an active state is not reached.
Die Effizienz der Doppelstrang-Öffnung der neusynthetisierten Primer-Verlängerungsprodukte nach jedem einzelnen Synthese-Schritt wirkt sich auf die potenziell erreichbaren Ausbeuten in darauf folgenden Zyklen aus: je weniger freie/einzelsträngige Primer-Bindungsstellen einer zu amplifizierenden Nukleinsäurekette zu Beginn eines Synthese-Schrittes zur Verfügung gestellt werden, um so geringer ist die Anzahl an neusynthetisierten Strängen der zu amplifizierenden Nukleinsäurekette in diesem Schritt. Anders ausgedrückt: Die Ausbeute eines Synthese-Zyklus ist proportional zu der Menge an Primer-Bindungsstellen, welche für die Interaktion mit entsprechenden komplementären Primern zur Verfügung stehen. Insgesamt kann dadurch ein Regelungs-Kreis realisiert werden.  The efficiency of the double-stranded opening of the newly synthesized primer extension products after each individual synthesis step affects the potentially achievable yields in subsequent cycles: the fewer free / single-stranded primer binding sites of a nucleic acid chain to be amplified at the beginning of a synthesis step The lower the number of newly synthesized strands of the nucleic acid chain to be amplified in this step. In other words, the yield of a synthesis cycle is proportional to the amount of primer binding sites available for interaction with corresponding complementary primers. Overall, this can be realized a control circuit.
Dieser Regelungs-Kreis entspricht einer Echtzeit-Kontrolle (real-time / on-line control) von synthetisierten Fragmenten: die Sequenz-Kontrolle erfolgt im Reaktionsansatz während die Amplifikation stattfindet. Diese Sequenzkontrolle erfolgt nach einem vorgegebenen Muster und das Oligonukleotid-System (durch Strang-Öffnende Wirkung von Controller-Oligonukleotid) kann ohne äußere Einmischung zwischen "korrekten" und "nicht-korrekten" Zuständen entscheiden. Im korrekten Zustand wird die Synthese von Sequenzen fortgesetzt, im nicht-korrekten Zustand wird die Synthese entweder verlangsamt oder vollständig verhindert. Die resultierenden Unterschiede in den Ausbeuten an„korrekten“ und„nicht-korrekten“ Sequenzen nach jedem Schritt wirken sich auf die gesamte Amplifikation aus, welche eine Vielzahl solcher Schritte umfasst.  This control circuit corresponds to a real-time / on-line control of synthesized fragments: the sequence control takes place in the reaction mixture while the amplification takes place. This sequence control follows a predetermined pattern and the oligonucleotide system (by strand-opening action of controller oligonucleotide) can decide between "correct" and "non-correct" states without external interference. In the correct state, the synthesis of sequences is continued; in the incorrect state, the synthesis is either slowed down or completely prevented. The resulting differences in the yields of "correct" and "incorrect" sequences after each step affect the entire amplification comprising a variety of such steps.
Bei einer exponentiellen Amplifikation ist diese Abhängigkeit exponentiell, so dass sogar geringfügige Unterschiede in der Effizienz im Rahmen eines einzelnen Synthese-Zyklus aufgrund von Sequenzunterschieden eine signifikante zeitliche Verzögerung der Gesamtamplifikation bedeuten können, bzw. das vollständige Ausbleiben einer detektierbaren Amplifikation in einem vorgegebenen Zeitrahmen bewirken.  In exponential amplification, this dependency is exponential, so even slight differences in efficiency in a single synthesis cycle due to sequence differences may signify a significant time delay in total amplification, or cause complete absence of detectable amplification in a given time frame.
Dieser Effekt der Echtzeit-Kontrolle der neusynthetisierten Nukleinsäureketten ist verbunden mit dem Einsatz des Controller-Oligonukleotides. Sequenz-Varianten-spezifische Controller-Oligonukleotide: This effect of real-time control of the newly synthesized nucleic acid chains is associated with the use of the controller oligonucleotide. Sequence variant-specific controller oligonucleotides:
Ein Zielsequenz-spezifisches Controller-Oligonukleotid wird vorzugsweise dermaßen in seinen Bereichen konstruiert, dass es in der Lage ist, bei der Amplifikation von zumindest einer vordefinierten Sequenz-Variante einer Zielsequenz mitzuwirken.  A target sequence specific controller oligonucleotide is preferably constructed in such a way that it is able to participate in the amplification of at least one predefined sequence variant of a target sequence.
In einer bevorzugten Form wird ein Amplifikations-System umfassend mindestens ein Controller- Oligonukleotid dermaßen gestaltet, dass die zu erwartende Position einer Allel-Variante einer Zielsequenz einem korrespondierenden Segment bzw. einer korrespondierenden Position im Controller-Oligonukleotid entspricht.  In a preferred form, an amplification system comprising at least one controller oligonucleotide is designed such that the expected position of an allelic variant of a target sequence corresponds to a corresponding segment or a corresponding position in the controller oligonucleotide.
Ein Allel-spezifisches Controller-Oligonukleotid wird vorzugsweise dermaßen konstruiert, dass es in der Lage ist, die Amplifikation einer Sequenz-Variante einer Zielsequenz (z.B. Allel 1 ) bevorzugt zu bewirken, wobei bei einer anderen Sequenz-Variante der gleichen Zielsequenz (z.B. Allel 2) die Amplifikation gar nicht bzw. nur mit verminderter Effizienz verläuft bzw. in der vorgegebenen Zeit gar nicht stattfindet, bzw. in einer nicht für eine Detektion hinreichenden Ausbeute an Amplifikationsprodukten resultiert.  An allele-specific controller oligonucleotide is preferably constructed such that it is capable of preferentially effecting the amplification of a sequence variant of a target sequence (eg, allele 1), wherein in another sequence variant of the same target sequence (eg, allele 2 ) the amplification does not proceed at all or only with reduced efficiency or does not take place in the given time, or results in a yield of amplification products which is insufficient for a detection.
Ein Allel-spezifisches Controller-Oligonukleotid wird somit nicht nur Zielsequenz-spezifisch, sondern auch Allel-spezifisch bereitgestellt. Ein solches Controller-Oligonukleotid umfasst somit Zielsequenz-spezifische Sequenz-Segmente als auch Allel-spezifische Sequenzsegmente. Je nach Komplexität eines polymorphen Lokus einer Zielsequenz können somit mehrere, für die jeweilige Allel-Variante einer Zielsequenz spezifische Controller-Oligonukleotide konstruiert werden.  An allele-specific controller oligonucleotide is thus not only target-specific, but also allele-specific. Such a controller oligonucleotide thus comprises target sequence-specific sequence segments as well as allele-specific sequence segments. Depending on the complexity of a polymorphic locus of a target sequence, it is thus possible to construct a plurality of controller oligonucleotides specific for the particular allelic variant of a target sequence.
Vorzugsweise umfasst ein Controller-Oligonukleotid mindestens ein Sequenzsegment, welches eine zu einer spezifischen Allel-Variante einer Zielsequenz komplementäre Sequenzzusammensetzung aufweist. Weiterhin umfasst ein Controller-Oligonukleotid vorzugsweise mindestens ein Sequenzsegment, welches eine für alle Sequenzvarianten einer Zielsequenz einheitliche komplementäre Sequenz umfasst. In bestimmten Ausführungsformen umfasst ein Controller-Oligonukleotid mindestens ein Sequenzsegment, welches komplementär an eine Variante eines polymorphen Lokus einer Zielsequenz komplementär binden kann.  Preferably, a controller oligonucleotide comprises at least one sequence segment having a sequence composition complementary to a specific allelic variant of a target sequence. Furthermore, a controller oligonucleotide preferably comprises at least one sequence segment which comprises a complementary sequence which is identical for all sequence variants of a target sequence. In certain embodiments, a controller oligonucleotide comprises at least one sequence segment capable of complementarily binding to a variant of a polymorphic locus of a target sequence.
In bestimmten Ausführungsformen werden mehrere Controller-Oligonukleotide bereitgestellt, welche jeweils Allel-spezifische Sequenzsegmente umfassen.  In certain embodiments, multiple controller oligonucleotides are provided, each comprising allele-specific sequence segments.
Die Länge eines zum polymorphen Lokus einer Start-Nukleinsäurekette vollständig komplementären Sequenzsegmentes eines Controller-Oligonukleotides kann Bereiche von einem Nukleotid bis zu 100 Nukleotiden, insbesondere von einem Nukleotid bis zu 50 Nukleotiden, insbesondere von einem Nukleotid bis zu 20 Nukleotiden umfassen. Die Länge von mindestens einem Sequenzsegment eines Controller-Oligonukleotides, welches zu einheitlichen Sequenzsegmenten einer Zielsequenz (erstes und zweite einheitliches Sequenzsegment einer Start-Nukleinsäure) komplementär ist, kann folgende Bereiche umfassen: von 4 bis 100 Nukleotide, insbesondere von 6 bis 100 Nukleotide, insbesondere von 8 bis 50 Nukleotide. In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, im dritten Bereich des Controller-Oligonukleotides lokalisiert. The length of a sequence segment of a controller oligonucleotide which is completely complementary to the polymorphic locus of a starting nucleic acid chain can comprise regions of one nucleotide of up to 100 nucleotides, in particular of one nucleotide of up to 50 nucleotides, in particular of one nucleotide of up to 20 nucleotides. The length of at least one sequence segment of a controller oligonucleotide which is complementary to uniform sequence segments of a target sequence (first and second unit sequence segment of a starting nucleic acid) may comprise the following ranges: from 4 to 100 nucleotides, in particular from 6 to 100 nucleotides, in particular from 8 to 50 nucleotides. In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the third region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, im zweiten Bereich des Controller-Oligonukleotides lokalisiert.  In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is located in the second region of the controller oligonucleotide.
In bestimmten Ausführungsformen wird ein Sequenzsegment eines Controller-Oligonukleotids, welches zu mindestens einer Variante eines polymophen Lokus einer Zielsequenz komplementär ist, teilweise und / oder vollständig im zweiten und im dritten Bereich des Controller- Oligonukleotides lokalisiert.  In certain embodiments, a sequence segment of a controller oligonucleotide that is complementary to at least one variant of a polymorphic locus of a target sequence is partially and / or completely located in the second and third regions of the controller oligonucleotide.
Die Position von Allel-spezifischen Sequenzsegmenten eines Controller-Oligonukleotides kann somit in drei Gruppen aufgeteilt werden. Die erste Gruppe umfasst Allel-spezifische Sequenzsegmente, welche sowohl im ersten Primer-Oligonukleotid als auch im Controller- Oligonukleotid erfasst werden. Diese Position umfasst somit zumindest partiell den zweiten Bereich des Controller-Oligonukleotides und den ersten Bereich des ersten Primer-Oligonukleotides. The position of allele-specific sequence segments of a controller oligonucleotide can thus be divided into three groups. The first group comprises allele-specific sequence segments which are detected in both the first primer oligonucleotide and the controller oligonucleotide. This position thus at least partially encompasses the second region of the controller oligonucleotide and the first region of the first primer oligonucleotide.
Die zweite Gruppe umfasst Allel-spezifische korrespondierende Sequenzsegmente, welche nur vom Controller-Oligonukleotid abgedecket sind, beide Primer (der erste Primer und der zweite Primer) sind lediglich zielsequenzspezifisch, aber nicht Allel-spezifisch. Die Position umfasst somit zumindest zum Teil den dritten Bereich des Controller-Oligonukleotides, welches mit dem 5'- Segment des von der Polymerase synthetisierten Anteils des ersten Primer- Verlängerungsproduktes komplementär binden soll. The second group comprises allele-specific corresponding sequence segments which are only covered by the controller oligonucleotide, both primers (the first primer and the second primer) are only target sequence specific but not allele specific. The position thus comprises, at least in part, the third region of the controller oligonucleotide which is intended to bind complementarily to the 5 ' segment of the portion of the first primer extension product synthesized by the polymerase.
Die dritte Gruppe umfasst Allel-spezifische Sequenzsegmente, welche sowohl im zweiten Primer- Oligonukleotid als auch im Controller-Oligonukleotid erfasst werden. Diese Position umfasst somit zumindest partiell den dritten Bereich des Controller-Oligonukleotides vorwiegend im 5'-Segment des Controller-Oligonukleotides. The third group comprises allele-specific sequence segments which are detected in both the second primer oligonucleotide and the controller oligonucleotide. This position thus at least partially encompasses the third region of the controller oligonucleotide predominantly in the 5 ' segment of the controller oligonucleotide.
Diskriminierung zwischen Allel-Varianten einer Zielsequenz umfasst in diesen Gruppen unterschiedliche Mechanismen, welche beispielsweise bei der Wahl von Reaktionsbedinungen zu berücksichtigen sind.  Discrimination between allelic variants of a target sequence encompasses different mechanisms in these groups, which, for example, must be taken into account when choosing reaction conditions.
Bei der ersten und der dritten Gruppe spielen Primer eine wesentliche Rolle bei der Diskriminierung. Die komplementäre Primer-Bindung an eine entsprechende Primer- Bindungsstelle einer Allel-Variante der Zielsequenz und Initiierung einer Synthese eines Primer- Verlängerungsprodutes durch die Polymerase bestimmen das Ausmass der unterschiedlichen Amplifikationen. Das Controller-Oligonukleotid interagiert lediglich mit dem ersten Primer (erste Gruppe) und mit dem komplementären Sequenzsegment zum 3'-Segment des zweiten Primers (dritte Gruppe). Die erfolgreiche Strangverdrängung durch das Controller-Oligonukleotid hängt somit in erster Linie vom entsprechenden komplementären Design dieser Anteile von Primern und des Controller-Oligonukleotids ab. Der synthetisierte Segment-Anteil des jeweiligen Primer- Verlängerungsproduktes, welches zwischen beiden Primern liegt, repräsentiert eine einheitliche Sequenzzusammensetzung für eine Allel-Variante einer gemeinsamen Zielsequenz. Aus diesem Grund ist es vorteilhaft, die Amplifikation bei stringenten Hybridisierungs-Bedingungen auszuführen, welche eine Allel-spezifische Initiierung einer Synthese unterstützen. Eine Verwendung eines weiteren allel-spezifischen Kompetitor-Primers kann eine spezifische Initiierung der Synthese weiter verbessern. For the first and third groups, primers play an essential role in discrimination. The complementary primer binding to a corresponding primer binding site of an allelic variant of the target sequence and initiation of a synthesis of a primer extension product by the polymerase determine the extent of the different amplifications. The controller oligonucleotide interacts only with the first primer (first group) and with the complementary sequence segment to the 3 ' segment of the second primer (third group). The successful strand displacement by the controller oligonucleotide thus depends primarily on the corresponding complementary design of these moieties of primers and the controller oligonucleotide. The synthesized segment content of the respective primer Extension product which lies between both primers represents a uniform sequence composition for an allelic variant of a common target sequence. For this reason, it is advantageous to carry out the amplification under stringent hybridization conditions which promote allele-specific initiation of a synthesis. Use of another allele-specific competitor primer can further enhance specific initiation of the synthesis.
Bei der zweiten Gruppe spielt die Initiierung der Synthese von Primer-Verlängerungsprodukten eine eher sekundäre Rolle, da die verwendeten Primer an Primer-Bindungsstellen binden, welche eine einheitliche Zusammensetzung für alle potenziellen Allel-Varianten einer Zielsequenz darstellen. Die Diskriminierung erfolgt lediglich unter Mitwirkung des Controller-Oligonukleotides, welches durch sequenzspezifische bzw. vorwiegend spezifische Strangverdrängung bei der Trennung des ersten und des zweiten Primer-Verlängerungsproduktes mitwirkt.  In the second group, the initiation of primer extension product synthesis plays a secondary role, as the primers used bind to primer binding sites that are a consistent composition for all potential allelic variants of a target sequence. The discrimination takes place only with the participation of the controller oligonucleotide, which participates by sequence-specific or predominantly specific strand displacement in the separation of the first and the second primer extension product.
In bestimmten Ausführungsformen wird bevorzugt eine voll-komplementäre Sequenz des dritten Bereichs des Controller-Oligonukleotides verwendet, welche einen perfekt-match mit mindestens einer Allel-Variante der Zielsequenz bilden kann. Die Amplifikation von verschiedenen Allel- Varianten erfordert somit bei dieser Ausführungsform eine Kombination aus je einem Allel- spezifischen Controller-Oligonukleotid.  In certain embodiments, a fully complementary sequence of the third region of the controller oligonucleotide is preferably used which can form a perfect match with at least one allelic variant of the target sequence. The amplification of different allelic variants thus requires in this embodiment a combination of one allele-specific controller oligonucleotide.
In der Regel führt eine Abweichung von voll-komplementären Sequenzzusammensetzungen zu abweichenden Amplifikatons-Effizienzen. Am korrespondierenden Sequenz-Segmenten eines Controller-Oligonukleotides erfolgt eine Konkurrenz um die Bindung an das erste Primer- Verlängerungsprodukt (bestehend vorwiegend aus DNA) mit dem zweiten Primer- Verlängerungsprodukt (umfasst ebenfalls DNA). Allel-spezifische Sequenz-Gestaltung dieses zu einer Allel-Variante korrespondierenden Sequenzsegmentes des Controller-Oligonukleotides ermöglicht für beide konkurrierenden Stränge eine perfekt-match / perfekt-mach Bindung an das erste Primer-Verlängerungsprodukt. Damit ist ein Controller-Oligonukleotid in der Lage, mit seinem korrespondierenden Sequenz-Segment das zweite Primer-Verlängerungsprodukt aus der Bindung mit dem ersten Primer- Verlängerungsprodukt erfolgreich zu verdrängen. Die Trennung von beiden Primer-Verlängerungsprodukten ermöglicht eine exponentielle Amplifikation.  As a rule, a deviation from fully-complementary sequence compositions leads to deviating amplification efficiencies. At the corresponding sequence segments of a controller oligonucleotide, there is competition for binding to the first primer extension product (consisting predominantly of DNA) with the second primer extension product (also comprising DNA). Allele-specific sequence design of this sequence segment of the controller oligonucleotide corresponding to an allelic variant allows a perfect match / perfect binding to the first primer extension product for both competing strands. Thus, a controller oligonucleotide is capable of successfully displacing the second primer extension product from its binding with the first primer extension product with its corresponding sequence segment. The separation of both primer extension products allows for exponential amplification.
Bei einer Abweichung in der Zusammensetzung des korrepondierenden Segmentes des Controller-Oligonukleotides (z.B. bei einer Bindung an eine nicht-komplementäre Allel-Variante eines Primer-Verlängerungsprodukts) ändert sich die Situation in der Regel. Die Interaktion zwischen perfekt-match des zweiten Primer-Verlängerungsproduktes (bestehend aus DNA) und des ersten Primer-Verlängerungsproduktes (bestehend aus DNA) kann nur schlecht oder auch gar nicht durch ein mismatch umfassendes Segment eines Controller-Oligonukleotides überwunden werden. Durch präferrierte Bindung eines perfekt-match Doppelstranges zwischen beiden Primer- Verlängerungsprodukten erfolgt somit keine hinreichende Strangtrennung unter Mitwirkung eines mismatch-Controller-Oligonukleotides, was in der Regel zu einer unzureichenden bzw. eine verlangsamten Amplifikation führt. In einer bevorzugten Ausführungsform liegt das zu einer Allel-Variante korrespondierende Sequenz-Segment im dritten Bereich des Controller-Oligonukleotides, welches vorwiegend oder ausschließlich DNA-Monomere umfasst. In the case of a deviation in the composition of the corresponding segment of the controller oligonucleotide (eg when bound to a non-complementary allelic variant of a primer extension product), the situation generally changes. The interaction between perfect-match of the second primer extension product (consisting of DNA) and the first primer extension product (consisting of DNA) can be overcome only poorly or not even by a mismatch comprehensive segment of a controller oligonucleotide. By preferenced binding of a perfect-match double strand between both primer extension products, there is thus no sufficient strand separation with the assistance of a mismatch controller oligonucleotide, which as a rule leads to an insufficient or a slowed-down amplification. In a preferred embodiment, the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises predominantly or exclusively DNA monomers.
In bestimmten Ausführungsformen liegt das zu einer Allel-Variante korrespondierende Sequenz- Segment im dritten Bereich des Controller-Oligonukleotides, welches sowohl DNA als auch DNA- Modifikationen umfasst.  In certain embodiments, the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises both DNA and DNA modifications.
In bestimmten Ausführungsformen liegt das zu einer Allel-Variante korrespondierende Sequenz- Segment im dritten Bereich des Controller-Oligonukleotides, welches vorwiegend oder ausschließlich DNA-Modifikationen umfasst. Beispielsweise bei Lokalisation eines zu einer Allel- Variante korresspondierenden Sequenzsegmentes innerhalb einer zweiten Blockierungs-Einheit, welche mehrere 2'-0-Alkyl-Modifikation von Nukleotiden umfasst, können solche Modifikationen einen Einfluss auf Bindung des Controller-Oligonukleotids an Allel-spezifische Variaten von Primer- Verlängerungsprodukten ausüben. In certain embodiments, the sequence segment corresponding to an allelic variant lies in the third region of the controller oligonucleotide, which comprises predominantly or exclusively DNA modifications. For example, in localization of a korresspondierenden an allelic variant sequence segment within a second blocking unit, which comprises a plurality of 2 '-0-alkyl-modification of nucleotides, such modifications can have an effect on binding of the controller oligonucleotide to allele-specific variates of primer - exercise extension products.
In einer bevorzugten Ausführungsform liegt das zu einer Allel-Variante korresspondierende Segment eines Controller-Oligonukleotides im dritten Bereich des Controller-Oligonukleotides, wobei dieses Segment des Stranges des Controller-Oligonukleotides vorwiegend aus DNA- Nukleotiden zusammengesetzt ist. Vorzugsweise liegt dieses Segment in 5'-Richtung von der zweiten Blockierungs-Einheit. Die Länge dieses zum polymorphen Lokus korrespondierenden Segmentes umfasst insbesondere 1 bis 20 Nukleotide. Die Zusammensetzung der Nukleotide in diesem vollkomplementären korrespondierenden Segment des Controller-Oligonukleotides umfasst dabei mindestens 70% DNA Nukleotide, insbesondere 80%, insbesondere mehr als 95% DNA-Nukleotide. In a preferred embodiment, the segment of a controller oligonucleotide that corresponds to an allele variant lies in the third region of the controller oligonucleotide, wherein this segment of the strand of the controller oligonucleotide is predominantly composed of DNA nucleotides. Preferably, this segment lies in the 5 ' direction of the second blocking unit. The length of this segment corresponding to the polymorphic locus comprises in particular 1 to 20 nucleotides. The composition of the nucleotides in this fully complementary corresponding segment of the controller oligonucleotide comprises at least 70% of DNA nucleotides, in particular 80%, in particular more than 95% of DNA nucleotides.
Bevorzugt liegt auch bei einer Allel-Variante, welche nur eine Nukleobase umfasst (z.B. SNP oder eine Punkt-Mutation), die korrespondierende Position im mittleren Bereich des Controller- Oligonukleotid-Stranges, welche auf beiden Seiten zu dieser korrespondierenden Position von zur Zielsequenz komplementären DNA-Monomeren umgeben ist, wobei der Strang des Controller- Oligonukleotides mindestens 4 DNA-Monomere, insbesondere mindestens 6 DNA-Nukleotide, insbesondere mindestens 10 DNA-Nukleotide in beide Richtungen von der zu erwartenden SNP bzw. Punkt-Mutation umfasst. Solche Anordnungen von DNA-Monomeren um eine zu erwartende SNP-Stelle bzw. Punkt-Mutation bzw. Einzelnukleotid-Allel-Variante ermöglicht die Aufrechterhaltung einer Einzelstrang-Konformation, welche für die B-Form charakteristisch ist (sogenannte single strand persistence length). Damit erfolgt eine Strangverdrängung durch das Controller-Oligonukleotid unter Verwendung eines korrespondierenden Segmentes, welches DNA- Monomere umfasst.  Preferably, in an allelic variant which comprises only one nucleobase (eg SNP or a point mutation), the corresponding position in the central region of the controller oligonucleotide strand which on both sides to this corresponding position of DNA complementary to the target sequence Surrounded by the strand of the controller oligonucleotide at least 4 DNA monomers, in particular at least 6 DNA nucleotides, in particular at least 10 DNA nucleotides in both directions of the expected SNP or point mutation. Such arrangements of DNA monomers around an expected SNP site or point mutation or single nucleotide allelic variant makes it possible to maintain a single-stranded conformation which is characteristic for the B-shape (so-called single strand persistence length). Thus, strand displacement occurs through the controller oligonucleotide using a corresponding segment comprising DNA monomers.
In bestimmten Ausführungsformen wird ein Controller-Oligonukleotid verwendet, welches mit seinem 5'-Ende eine komplementäre Bindung mit dem ersten Primer-Verlängerungsprodukt eingehen kann. Bei Allel-Varianten, welche nur eine Nukleobase umfassen, z.B. SNP oder Punktmutationen, wird das korrespondierende Sequenzsegment bevorzugt in einem Abstand vom 5'-Ende des Controller-Oligonukleotides angeordnet, welcher Längen von 10 bis 60 Nukleotide, insbesondere 20 bis 50 Nukleotide, insbesondere 30 bis 40 Nukleotide umfasst. In certain embodiments, a controller oligonucleotide is used which can form a complementary bond with the first primer extension product with its 5 ' end. In allelic variants which comprise only one nucleobase, eg SNP or Point mutations, the corresponding sequence segment is preferably arranged at a distance from the 5 ' end of the controller oligonucleotide, which comprises lengths of 10 to 60 nucleotides, in particular 20 to 50 nucleotides, in particular 30 to 40 nucleotides.
Die Verwendung von DNA-Nukleotiden als Monomere von Controller-Oligonukleotiden darf allerdings nicht dazu führen, dass das Controller-Oligonukleotid als Matrize für eine Primer- Verlängerung unter Verwendung eines der eingesetzten Primer durch eine verwendete Polymerase genutzt wird.  However, the use of DNA nucleotides as monomers of controller oligonucleotides must not result in the controller oligonucleotide being used as a template for primer extension using one of the primers employed by a polymerase used.
Verwendung von DNA-Nukleotiden (beispielsweie A, C, T oder G) innerhalb des zu einer Allel- Variante korrespondierenden Segments im Controller-Oligonukleotid-Strang bringt dadurch einige Vorteile, so dass das Diskriminierungsverhalten eines Amplifikations-Systems leichter abzuschätzen ist.  Use of DNA nucleotides (for example A, C, T or G) within the segment corresponding to an allelic variant in the controller oligonucleotide strand brings thereby some advantages, so that the discrimination behavior of an amplification system is easier to estimate.
Beispielsweise kann das Verhalten von perfekt-match Varianten eines Controller-Oligonukleotides zu bestimmten Allel-Varianten bei Punkt-Mutationen leicher abzuschätzen sein. Dabei folgt die Diskriminierung zwischen Allel-Varianten den Regeln der Watson-Crick-Basenpaarung: Controller- Oligonukleotide, welche komplementäre Basenpaare (A:T, G:C) mit den ersten Primer- Verlängerungsprodukten ausbilden können, führen in der Regel zu Amplifikationsreaktionen in guten Ausbeuten.  For example, the behavior of perfectly match variants of a controller oligonucleotide to specific allele variants in point mutations can be more easily estimated. The discrimination between allelic variants follows the rules of Watson-Crick base pairing: Controller oligonucleotides, which can form complementary base pairs (A: T, G: C) with the first primer extension products, generally lead to amplification reactions in good Exploit.
Potenzielle Mismatches zwischen einem Allel-spezifischen Controller-Oligonukleotid und einem ersten Primer-Verlängerungsprodukt (z.B. A:C oder G:G) führen hingegen zu einer unzureichenden oder verzögerten Amplifikation. Beim Vorliegen von Allel-Varianten, welche in einerm potenziellen ersten Primer-Verlängerungsprodukt mehr als einen Nukleotid-Unterschied zum Controller-Oligonukleotid ausmachen können (z.B. kurze InDels), wird in der Regel keine hinreichende Amplifikation erreicht.  However, potential mismatches between an allele-specific controller oligonucleotide and a first primer extension product (e.g., A: C or G: G) result in insufficient or delayed amplification. In the presence of allelic variants, which may account for more than one nucleotide difference from the controller oligonucleotide in a potential first primer extension product (e.g., short InDels), sufficient amplification is typically not achieved.
Die Auswirkung eines Mismatches auf eine Amplifikation kann abgeschätzt werden, indem Stabilitäten von potenziellen Duplexen bestimmt werden umfassend ein Allel-spezifisches Controller-Oligonukleotid mit einer definierten Sequenz und ein potenzielles Primer- Verlängerungsprodukt oder seine Anteile, z.B. nur der synthetisierte Anteil eines Primer- Verlängerungsproduktes. Die Duplexe werden in Abwesenheit von zweiten Primer- Verlängerungsprodukten gebildet. Bei Hybridisierung eines Allel-spezifischen Controller- Oligonukleotides an ein potenzielles Primer-Verlängerungsprodukt mit vollständiger Komplementarität (perfekt-match) ist die Bindung solcher Duplexe stabiler als die Bindung von Duplexen, welche mindstens eine Mismatch-Position umfassen. Diese Stabilität kann mittels Schmelztemperatur-Messung erfasst werden. Unterschiede zwischen Amplifikationsreaktionen von Allel-Varianten sind in der Regel um so größer, je größer die Differenz in der Stabiliät zwischen einer perfekt-match Duplex und einer mismatch Duplex umfassend ein Allel-spezifisches Controller-Oligonukleotid und ein potenzielles erstes Primer-Verlängerungsprodukt ist. Solche Unterschiede zwischen Reaktionen können beispielsweise durch die für eine Reaktion erforderliche Zeit bis zum Erreichen einer gewissen Menge an Produkten gemessen werden. Solche Unterschiede in der Zeit zwischen Amplifikations-Reaktionen von perfekt-match und mismatch Allel-Varianten können auch als Fähigkeit zur Diskriminierung aufgefasst werden: je größer die Zeitdifferenz, um so höher die Diskriminierung zwischen einzelnen Allel-Varianten.The effect of a mismatch on amplification can be estimated by determining stabilities of potential duplexes comprising an allele-specific controller oligonucleotide having a defined sequence and a potential primer extension product or its moieties, eg, only the synthesized moiety of a primer extension product. The duplexes are formed in the absence of second primer extension products. Upon hybridization of an allele-specific controller oligonucleotide to a potential perfect-match primer extension product, the binding of such duplexes is more stable than the binding of duplexes comprising at least one mismatch position. This stability can be detected by melting temperature measurement. Differences between amplification reactions of allelic variants are generally greater the greater the difference in stability between a perfect-match duplex and a mismatch duplex comprising an allele-specific controller oligonucleotide and a potential first primer extension product. Such differences between reactions, for example, by those for a reaction required time to reach a certain amount of products. Such differences in the time between amplification reactions of perfect-match and mismatch allele variants can also be seen as a capacity for discrimination: the greater the time difference, the higher the discrimination between each allele variants.
Aufgrund der Verwendung von Modifikationen im Controller-Oligonukleotid, z.B. im Bereich der zweiten Blockierungseinheit zur Verhinderung der Verlängerung des ersten Primers oder eines Kompetitor-Primers, kann eine abweichende Diskriminierung bzw. sogar Toleranz zu bestimmten Mismatches erfolgen. Dabei können beispielsweise 2'-0-Alkyl-Modifikationen innerhalb der zweiten Blockierungs-Einheit verwendet werden. Solche Nukleotid-Modifikationen können Konformation eines Doppelstranges verändern (von B-Form einer DNA:DNA-Duplex auf A-like- Form eines DNA:RNA oder DNA:mod. DNA-Duplex). Dabei kann vor allem in der Basenpaarung zwischen G:C und G:U bzw. G:T eine Änderung der Diskriminierung erfolgen. Due to the use of modifications in the controller oligonucleotide, eg in the region of the second blocking unit for preventing the extension of the first primer or a competitor primer, a different discrimination or even tolerance to certain mismatches can take place. In this case, for example, 2 '-0-alkyl modifications may be employed within the second blocking unit. Such nucleotide modifications can alter the conformation of a duplex (from B-form of a DNA: DNA duplex to A-like form of a DNA: RNA or DNA: mod. DNA duplex). In this case, especially in the base pairing between G: C and G: U or G: T, a change in the discrimination can take place.
Beispielsweise die Verwendung von Modfikationen im Controller-Oligonukleotid führt zur Änderung im Diskriminierungs-Verhalten bei einzelnen Basen-Paaren. Ein ähnliches Verhalten ist aus der Erforschung von RNA bekannt: so ändert sich das Verhalten der G:U je nach Strang-Form: bei RNA bildet ein G:U Basenpaar in der Regel eine hinreichend stabile Basenpaarung, bei DNA führt ein G:T-Mismatch in der Regel zu einer Abschwächung der Bindung von beiden Strängen.  For example, the use of modifications in the controller oligonucleotide leads to a change in the discrimination behavior of individual base pairs. A similar behavior is known from the research of RNA: the behavior of the G: U changes depending on the strand-form: in the case of RNA, a G: U base pair usually forms a sufficiently stable base pairing, in the case of DNA a G: U Mismatch usually leads to a weakening of the binding of both strands.
In dieser Anmeldung werden beispielsweise 2'-Alkyl-Nukleotid-umfassende Modifikationen im Controller-Oligonukleotid verwendet (z.B. innerhalb der zweiten Blockierungs-Einheit). Dabei wird ein 2'-0-Me Cytosine (C*) oder 2'-0-Me Adenosine (A*) verwendet. Solche modifizierten Nukleotide ermöglichen eine gute Diskriminierung zwischen einzelnen Sequenzvarianten (wobei perfekt match Bindung C*:dG und A*:U oder A*:T umfasst und Mismatch z.B. C*:dA oder A*:dC umfasst). For example, in this application, 2 ' alkyl nucleotide-comprising modifications are used in the controller oligonucleotide (eg, within the second blocking moiety). Here, a 2 '-0-Me Cytosine (C *) or 2' -0-Me Adenosine (A *) is used. Such modified nucleotides allow good discrimination between individual sequence variants (where perfectly match binding comprises C * : dG and A * : U or A * : T and mismatch includes, for example, C * : dA or A * : dC).
Hingegen führt die Verwendung von 2'-0-Me-G (G*) oder 2'-0-Me-U (U*) zu abweichenden Ergebnissen. Beispielsweise eine Amplifikation unter Verwendung von Controller-Oligonukleotid mit einem G* an der korrespondierenden Stelle im Strang führt zur gleichzeitigen Amplifikation von Allel-Varianten mit dC und dU an korrespondierenden Stellen im ersten Primer- Verlängerungsprodukt. However, the use of leads 2 '-0-Me-G (G *) or 2' -0-Me-U (U *) to different results. For example, amplification using controller oligonucleotide with a G * at the corresponding site in the strand results in the simultaneous amplification of allelic variants with dC and dU at corresponding sites in the first primer extension product.
Somit läßt sich nicht nur eine Allel-diskriminierende, sondern auch eine Allel-tolerante Funktion eines Controller-Oligonukleotides darstellen.  Thus, not only an allele-discriminating, but also an allele-tolerant function of a controller oligonucleotide can be represented.
Bei Verwendung von Nukleotid-Modifikationen, welche eine unzureichende Diskriminierung von Allel-Varianten zulassen, können somit mehrere Allel-Varianten gleichzeitig amplifiziert werden. Neben einem 2'-0-Me Guanosine oder 2'-0-Me Uridine gehören auch Universal-Basen, wie Inosine oder 5-Nitro-lndol Monomere zu Kandidaten mit Toleranz zur Allel-Zusammensetzung. Solche Modifikationen eines Controller-Oligonukleotid-Stranges können an zu erwartenden korrespondierenden Positionen zu bestimmten Allel-Varianten angeordnet werden. Somit kann diese fehlende Diskriminierung bei einigen Modifikationen wie folgt berücksichtigt werden: When using nucleotide modifications that allow inadequate discrimination of allelic variants, multiple allelic variants can thus be amplified simultaneously. In addition to a 2 '-0-Me guanosine or 2' -0-Me Uridine also universal bases such as inosine, or 5-nitro-indole monomers to be candidates for the tolerance allele composition belong. Such modifications of a controller oligonucleotide strand can be arranged at expected corresponding positions to particular allelic variants. Thus, this lack of discrimination in some modifications can be considered as follows:
In bestimmten Ausführungsformen liegt das zu einer Allel-Variante korrespondierende Sequenz- Segment im dritten Bereich des Controller-Oligonukleotides, welches vorwiegend oder ausschließlich 2'-0-Alkyl-Modifikationen umfasst. In certain embodiments, the variant is an allelic sequence corresponding segment in the third area of the controller oligonucleotide which 'comprises predominantly or exclusively 2 -0-alkyl modifications.
In bestimmten Ausführungsformen liegt das zu einer Allel-Variante korresspondierende Segment eines Controller-Oligonukleotides im dritten Bereich des Controller-Oligonukleotides, wobei dieses Segment des Stranges des Controller-Oligonukleotides vorwiegend aus 2'-0-Alkyl-Modifikationen zusammengesetzt ist. Vorzugsweise liegt dieses Segment innerhalb der zweiten Blockierungs- Einheit oder in 5'-Richtung von der zweiten Blockierungs-Einheit. Die Länge dieses zum polymorphen Lokus korrespondierenden Segmentes umfasst insbesondere 1 bis 20 Nukleotide. Die Zusammensetzung der Nukleotide in diesem vollkomplementären korrespondierenden Segment des Controller-Oligonukleotides umfasst dabei mindestens 50% 2'-0-Alkyl- Modifikationen, insbesondere 80%, insbesondere mehr als 95% 2'-0-Alkyl-Modifikationen. In certain embodiments, the segment of a controller oligonucleotide corresponding to an allelic variant lies in the third region of the controller oligonucleotide, this segment of the strand of the controller oligonucleotide being composed predominantly of 2 'to 0 alkyl modifications. Preferably, this segment is within the second blocking unit or in the 5 ' direction of the second blocking unit. The length of this segment corresponding to the polymorphic locus comprises in particular 1 to 20 nucleotides. The composition of the nucleotides in this fully complementary corresponding segment of the controller oligonucleotide comprises at least 50% while 2 '-0-alkyl modifications, more preferably 80%, in particular more than 95% 2' -0-alkyl modifications.
Insbesondere liegt auch bei einer Allel-Variante, welche nur eine Nukleobase umfasst (z.B. SNP oder eine Punkt-Mutation), die korrespondierende Position im mittleren Bereich des Controller- Oligonukleotid-Stranges. Dieser Controller-Oligonukleotid-Strang ist auf beiden Seiten zu dieser korrespondierenden Position von zur Zielsequenz komplementären 2'-0-Alkyl-Modifikationen umgeben, wobei der Strang des Controller-Oligonukleotides mindestens vier 2'-0-Alkyl- Modifikationen, insbesondere mindestens sechs 2'-0-Alkyl-Modifikationen, insbesondere mindestens 10 2'-0-Alkyl-Modifikationen in beide Richtungen von der zu erwartenden SNP bzw. Punkt-Mutation umfasst eine solche Anordnung von DNA-Monomeren um eine zu erwartende SNP-Stelle bzw. Punkt-Mutation bzw. Einzelnukleotid-Allel-Variante ermöglicht die Aufrechterhaltung einer Einzelstrang-Konformation, welche als A-like-Form bezeichnet werden kann. Damit erfolgt eine Strangverdrängung durch das Controller-Oligonukleotid unter Verwendung eines korrespondierenden Segmentes, welches Nukleotide mit 2'-0-Alkyl- Modifikationen umfasst. In particular, even in an allelic variant which comprises only one nucleobase (for example SNP or a point mutation), the corresponding position is in the middle region of the controller oligonucleotide strand. This controller oligonucleotide strand is 'surrounded -0-alkyl modifications, the strand of the controller oligonucleotide at least four 2' on both sides to this position corresponding of complementary to the target sequence 2 -0-alkyl modifications, in particular at least six 2 ' -O-Alkyl modifications, in particular at least 10 2 ' -O-alkyl modifications in both directions of the expected SNP or point mutation comprises such an arrangement of DNA monomers to an expected SNP site or point Mutation or single nucleotide allele variant allows the maintenance of a single-stranded conformation, which can be referred to as A-like form. Thus, strand displacement occurs through the controller oligonucleotide using a corresponding segment comprising nucleotides with 2 'to O alkyl modifications.
In bestimmten Ausführungsformen wird ein Controller-Oligonukleotid verwendet, welches mit seinem 5'-Ende eine komplementäre Bindung mit dem ersten Primer-Verlängerungsprodukt eingehen kann. Bei Allel-Varianten, welche nur eine Nukleobase umfassen, z.B. SNP oder Punktmutationen, wird das korrespondierende Sequenzsegment bevorzugt in einem Abstand vom 5'-Ende des Controller-Oligonukleotides angeordnet, welcher Längen von 10 bis 60 Nukleotide, insbesondere 20 bis 50 Nukleotide, insbesondere 30 bis 40 Nukleotide umfasst. In certain embodiments, a controller oligonucleotide is used which can form a complementary bond with the first primer extension product with its 5 ' end. In allelic variants which comprise only one nucleobase, eg SNP or point mutations, the corresponding sequence segment is preferably arranged at a distance from the 5 ' end of the controller oligonucleotide, which lengths of 10 to 60 nucleotides, in particular 20 to 50 nucleotides, in particular 30 to 40 nucleotides.
Bei Lokalisation eines zu einer Allel-Variante erwarteten Sequenzsegmentes innerhalb eines solchen, mehrere 2'-0-Alkyl-Modifikationen umfassenden, Segmentes wird eine ggf. abweichende Basenpaarung berücksichtigt (betrifft v.a. alternative Basenpaarung zwischen DNA-Strukturen (B- Like-Struktur) und A-Like-Strukturen der RNA (oder 20me-Varianten). In einer Ausführungsform können folgende Regel angewandt werden: Upon localization of a sequence segment expected within an allelic variant within such a segment comprising several 2 'to 0-alkyl modifications, a possibly different base pairing is taken into account (relates, in particular, to alternative base pairing between DNA structures (B). Like structure) and A-like structures of RNA (or 20me variants). In one embodiment, the following rule can be used:
Controller-Oligonukleotide umfassend 2'-0-Alkyl-Modifikationen von Cytosin können in der Regel eine hinreichende Basenpaarung mit dG-Nukleotid an korrespondierenden Stellen im ersten Primer-Verlängerungsprodukt ausbilden und somit die Amplifikation solcher Allel-Varianten unterstützen. Controller oligonucleotides comprising 2 '-0-alkyl modifications of cytosine can form a sufficient base pairing with dG-nucleotide at corresponding locations in the first primer extension product and thus support the amplification of such allelic variants generally.
Controller-Oligonukleotide umfassend 2'-0-Alkyl-Modifikationen von Adenosin können in der Regel eine hinreichende Basenpaarung mit dT- oder dU-Nukleotid an korrespondierenden Stellen im ersten Primer-Verlängerungsprodukt ausbilden und somit die Amplifikation solcher Allel- Varianten unterstützen. Controller oligonucleotides comprising 2 '-0-alkyl modifications of adenosine able to form a sufficient base pairing with dT or dU nucleotide at corresponding locations in the first primer extension product and thus support the amplification of such allelic variants generally.
Controller-Oligonukleotide umfassend 2'-0-Alkyl-Modifikationen von Guanosin können in der Regel eine hinreichende Basenpaarung mit dC- und dU-Nukleotid an korrespondierenden Stellen im ersten Primer-Verlängerungsprodukt ausbilden und somit die Amplifikation beider Allel- Varianten unterstützen. Controller oligonucleotides comprising 2 '-0-alkyl modifications of guanosine can form a sufficient base pairing with dC and dU nucleotide at corresponding locations in the first primer extension product and thus support the amplification of both allelic variants generally.
Controller-Oligonukleotide umfassend 2'-0-Alkyl-Modifikationen von Uridin können in der Regel eine hinreichende Basenpaarung mit dA- und dG-Nukleotid an korrespondierenden Stellen im ersten Primer-Verlängerungsprodukt ausbilden und somit die Amplifikation beider Allel-Varianten unterstützen. Controller oligonucleotides comprising 2 '-0-alkyl modifications of uridine can form a sufficient base pairing with dA and dG-nucleotide at corresponding locations in the first primer extension product and thus support the amplification of both allelic variants generally.
Aufgrund einer Strang-Komplementarität einer doppelsträngigen Zielnukleinsäure, können Strang spezifische Amplifikations-Systeme erstellt werden, wobei an korrespondierenden Stellen jeweils entweder 2'-0-Alkyl-Modifikationen von Cytosin oder 2'-0-Alkyl-Modifikationen von Adenosin verwendet wird. Somit kann die fehlende Diskriminierung von G- und U-Nukleotid-Analoga umgangen werden. Due to a strand of a double-complementary target nucleic acid strand, specific amplification systems are created, each either 2 '-0-alkyl modifications of cytosine or 2' -0-alkyl modifications of adenosine is used in corresponding locations. Thus, the lack of discrimination of G and U nucleotide analogs can be circumvented.
Reaktionsbedingungen bei der Strangverdrängungsreaktion  Reaction conditions in the strand displacement reaction
Die Verdrängung des zweiten Primer-Verlängerungsproduktes aus der Bindung mit dem ersten Primer-Verlängerungsprodukt mittels einer sequenzabhängigen Strangverdängung durch das Controller-Oligonukleotid bildet einen Teilschritt in der Amplifikation. Die Reaktionsbedingungen während dieses Schrittes sind entsprechend angepasst. Die Reaktions-Temperatur und die Reaktions-Zeit sind dermaßen gewählt, dass die Reaktion erfolgreich stattfinden kann.  The displacement of the second primer extension product from binding with the first primer extension product by means of a sequence-dependent strand displacement by the controller oligonucleotide forms a partial step in the amplification. The reaction conditions during this step are adjusted accordingly. The reaction temperature and the reaction time are chosen so that the reaction can take place successfully.
In einer bevorzugten Ausführungsform verläuft die Strangverdrängung durch das Controller- Oligonukleotid bis zur Ablösung / Dissoziation des zweiten Primer-Verlängerungsproduktes aus der Bindung mit dem ersten Primer-Verlängerungsprodukt. Eine solche Dissoziation des 3'- Segments des ersten Primer-Verlängrungsproduktes von komplementären Anteilen des zweiten Primerverlängerungsproduktes kann spontan erfolgen im Rahmen einer Temperatur-abhängigen / Temperatur-bedingten Trennung von beiden Primer-Verlängerungprodukten. Eine solche Dissoziation wirkt sich günstig auf Kinetik der Amplifikationsreaktion aus und kann durch die Wahl der Reaktionsbedingungen beeinflusst werden, z.B. mittels Temperatur-Bedingungen. Die Temperatur-Bedingungen werden deshalb dermaßen gewählt, dass eine erfolgreiche Strangverdrängung durch komplementäre Bindung des Controller-Oligonukleotides eine Dissoziation des zweiten Primer-Verlängerungsproduktes vom 3'-Segment des ersten Primer- Verlängerungsproduktes begünstigt. In a preferred embodiment, the strand displacement by the controller oligonucleotide until detachment / dissociation of the second primer extension product from binding with the first primer extension product. Such dissociation of the 3 ' segment of the first primer extension product from complementary portions of the second primer extension product may be spontaneous in the context of temperature dependent / temperature related separation of both primer extension products. Such a dissociation has a favorable effect on the kinetics of the amplification reaction and can be influenced by the choice the reaction conditions are influenced, for example by means of temperature conditions. The temperature conditions are therefore chosen such that successful strand displacement by complementary binding of the controller oligonucleotide favors dissociation of the second primer extension product from the 3 ' segment of the first primer extension product.
In einer weiteren bestimmten Ausführungsform verläuft die Strangverdrängung durch das Controller-Oligonukleotid bis zur Ablösung / Dissoziation eines 3'-Segmentes des zweiten Primer- Verlängerungsproduktes (P2.1-Ext) oder des Matrizenstrangs (M1 ) aus der komplementären Bindung mit dem ersten Primer-Verlängerungsprodukt (P1 .1 -Ext). Dabei umfasst dieses 3'- Segment des zweiten Primer-Verlängerungsproduktes (P2.1-Ext) bzw. des Matrizenstrangs (M1 ) zumindest einen komplementären Bereich zum ersten Primer und ein komplementäres Segment zum ersten Primerverlängerungsprodukt (P1 1-Ext), welches erst bei der enzymatischen Synthese entstanden ist. Dabei kommt es zur Ausbildung eines Komplexes (C1 .1/ P1 1 -Ext / P2.1 .-Ext) bzw. (C1 .1/ P1 .1 -Ext / M1 ) , welches sowohl das erste Primer-Verlängerungsprodukt (P1 .1 -Ext), das zweite Primer-Verlängerungsprodukt (P2.1 -Ext) / bzw. den Matrizenstrang (M1 ) sowie das Controller-Oligonukleotid (C1 .1 ) umfasst. In einem solchen Komplex liegt das 3'-Segment des zweiten Primer-Verlängerungsproduktes zumindest vorübergehend in einer einzelsträngigen Form vor, da es vom Controller-Oligonukleotid aus seiner Bindung mit dem ersten Primer- Verlängerungsprodukt verdrängt werden kann. Schematisch dargestellt, besteht ein Gleichgewicht zwischen Bindung und Ablösung des P2.1 -Ext / bzw. M1 an das P1 .1 -Ext. Das 3'-Segment des ersten Primer-Verlängerungsproduktes (P1 .1-Ext) liegt in einem solchen Komplex komplementär hybridisiert an das zweite Primer-Verlängerungsprodukt (P2.1 -Ext) bzw. an einen Matrizenstrang (M1 ) vor. In another specific embodiment, the strand displacement by the controller oligonucleotide proceeds until the dissociation / dissociation of a 3 ' segment of the second primer extension product (P2.1-Ext) or the template strand (M1) from the complementary binding with the first primer. Extension product (P1 .1-text). In this case, this 3 ' segment of the second primer extension product (P2.1-Ext) or the template strand (M1) comprises at least one complementary region to the first primer and a complementary segment to the first primer extension product (P1 1-Ext) the enzymatic synthesis has arisen. This results in the formation of a complex (C1 .1 / P1 1 -Ext / P2.1.-Ext) or (C1 .1 / P1 .1 -Ext / M1), which contains both the first primer extension product (P1. 1 -xt), the second primer extension product (P2.1-Ext) / or the template strand (M1) and the controller oligonucleotide (C1 .1). In such a complex, the 3 ' segment of the second primer extension product is at least transiently single-stranded since it can be displaced from the controller oligonucleotide from its binding with the first primer extension product. Schematically, there is a balance between binding and detachment of the P2.1 -Ext / or M1 to the P1 .1 text. The 3 ' segment of the first primer extension product (P1 .1-Ext) is in such a complex complementary hybridized to the second primer extension product (P2.1 -Ext) or to a template strand (M1).
Aufgrund einer teilweise offenen Primer-Bindungsstelle für das erste Primer-Oligonukleotid (3'- Segment des zweiten Primer-Verlängerungsprodukts) kann ein neues Primer- Verlängerungsprodukt (P1 .2) an eine dieses einzelsträngige Sequenzsegment des noch im Komplex liegenden (P2.1 -Ext) unter Reaktionsbedinungen binden und somit eine Synthese eines neuen ersten Primer-Verlängerungsproduktes (P1 .2-Ext) durch eine Polymerase initiieren. In der Regel verläuft die Initiierung dieser Reaktion mit verminderter Effizienz, da das 3'-Segment des P2.1 -Ext nicht dauerhaft einzelsträngig vorliegt, sondern im kompetetiven Verhalten mit dem Controller-Oligonukleotid steht und damit abwechselnd einzelsträngige und doppelsträngige Zustände durch Bindung an das P1 1 -Ext aufweist. Due to a partially open primer binding site for the first primer oligonucleotide (3 ' segment of the second primer extension product), a new primer extension product (P1 .2) can be attached to this single-stranded sequence segment of the complex (P2.1 Ext) under reaction conditions and thus initiate a synthesis of a new first primer extension product (P1 .2-Ext) by a polymerase. In general, the initiation of this reaction with reduced efficiency, since the 3 ' segment of P2.1 -Ext is not permanently single-stranded, but is in the competitive behavior with the controller oligonucleotide and thus alternately single-stranded and double-stranded states by binding to the P1 1 -Ext has.
Fortführung dieser neugestarteten Synthese von P1 2-Ext unter Verwendung des zweiten Primer- Verlängerungsproduktes als Matrize (P2.1-Ext) kann eine Polymerase-bedingte Strangverdrängung ebenfalls zur Dissoziierung des Komplexes (C1 .1/ P1 1 -Ext / P2.1 .-Ext) führen. Dabei wirken das Controller-Oligonukleotid, die Temperatur-abhängige Doppelstrang- Destabilisierung und die Strang-Verdrängung durch die Polymerase synergistisch und komplementär. Es resultiert eine Dissoziation des 3'-Segments des ersten Primer- Verlängrungsproduktes (P1 .1 -Ext) von komplementären Anteilen des zweiten Primerverlängerungsproduktes (P2.1-Ext). Continuing this newly started synthesis of P1 2-Ext using the second primer extension product as template (P2.1-Ext), polymerase-induced strand displacement can also dissociate the complex (C1.1 / P1 1 -Ext / P2.1. -Ext) lead. The controller oligonucleotide, the temperature-dependent double strand destabilization and the strand displacement by the polymerase act synergistically and complementarily. This results in a dissociation of the 3 ' segment of the first primer Extension product (P1 .1 -EX) of complementary portions of the second primer extension product (P2.1-Ext).
Eine solche Dissoziation wirkt sich günstig auf Kinetik der Amplifikationsreaktion aus und kann durch die Wahl der Reaktionsbedingungen beeinflusst werden, z.B. mittels Temperatur- Bedingungen. Das Mitwirken der Polymerase-vermittelten syntheseabhängigen Strangverdrängung an der Dissoziierung von P1 .1-Ext und P2.1 -Ext hat einen begünstigenden Effekt bei der Strangtrennung.  Such dissociation has a favorable effect on the kinetics of the amplification reaction and may be influenced by the choice of reaction conditions, e.g. by means of temperature conditions. The involvement of the polymerase-mediated synthesis-dependent strand displacement in the dissociation of P1 .1-Ext and P2.1 -xt has a favorable effect on strand separation.
Die Temperatur in diesem Schritt umfasst beispielsweise Bereiche von 15°C bis 75°C, insbesondere von 30°C bis 70°C, insbesondere von 50°C bis 70°C.  The temperature in this step includes, for example, ranges from 15 ° C to 75 ° C, especially from 30 ° C to 70 ° C, especially from 50 ° C to 70 ° C.
Bei gegebener Länge des ersten Bereichs des Controller-Oligonukleotides und des zweiten Bereichs des ersten Primer-Oligonukleotides (umfassend beispielsweise Bereiche von 3 bis 25 Nukleotid-Monomeren, insbesondere von 5 bis 15 Nukleotid-Monomeren) kann eine Strangverdrängungsreaktion im Allgemeinen erfolgreich initiiert werden. Bei vollständiger Komplementarität des Controller-Oligonukleotids zu entsprechenden Anteilen des ersten Primer- Verlängerungsproduktes kann das Controller-Oligonukleotid an das erste Primer- Verlängerungsprodukt bis auf das 3'-Segment des ersten Primer-Verlängerungsproduktes binden und das zweite Primer-Verlängerungsprodukt verdrängen. Das zweite Primer- Verlängerungsprodukt verbleibt somit in Verbindung mit dem 3'-Segment des ersten Primer- Verlängerungsproduktes. Die Stärke dieser Verbindung kann Temperatur-abhängig beeinflusst werden. Beim Erreichen einer kritischen Temperatur kann diese Verbindung zerfallen und beide Primer-Verlängerungsprodukte dissoziieren. Je kürzer die Sequenz des 3'-Segmentes ist, umso instabiler ist diese Verbindung und umso niedriger kann die Temperatur sein, welche eine spontane Dissoziation herbeiführt. Given the length of the first region of the controller oligonucleotide and the second region of the first primer oligonucleotide (including, for example, ranges of from 3 to 25 nucleotide monomers, more preferably from 5 to 15 nucleotide monomers), a strand displacement reaction can generally be successfully initiated. With complete complementarity of the controller oligonucleotide to corresponding portions of the first primer extension product, the controller oligonucleotide can bind to the first primer extension product except for the 3 ' segment of the first primer extension product and displace the second primer extension product. The second primer extension product thus remains in association with the 3 ' segment of the first primer extension product. The strength of this compound can be influenced by temperature. Upon reaching a critical temperature, this compound can decay and dissociate both primer extension products. The shorter the sequence of the 3 ' segment, the more unstable this compound and the lower the temperature which causes spontaneous dissociation.
Eine spontane Dissoziation kann beispielsweise im Temperatur-Bereich erreicht werden, welcher etwa bei der Schmelztemperatur liegt. In bestimmten Ausführungsformen liegt die Temperatur der Schritte der Strangverdrängung durch das Controller-Oligonukleotid etwa bei der Schmelztemperatur (Tm +/- 3°C) des Komplexes umfassend das 3'-Segment des ersten Primer- Verlängerungsproduktes, welches nicht vom Controller-Oligonukleotid gebunden wird, und dem zweiten Primer-Oligonukleotid bzw. dem zweiten Primer-Verlängerungsprodukt. A spontaneous dissociation can be achieved for example in the temperature range, which is approximately at the melting temperature. In certain embodiments, the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 3 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by the controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
In bestimmten Ausführungsformen liegt die Temperatur der Schritte der Strangverdrängung durch das Controller-Oligonukleotid etwa bei der Schmelztemperatur (Tm +/- 5°C) des Komplexes umfassend das 3'-Segment des ersten Primer-Verlängerungsproduktes, welches nicht von Controller-Oligonukleotid gebunden wird, und dem zweiten Primer-Oligonukleotid bzw. dem zweiten Primer- Verlängerungsprodukt. In certain embodiments, the temperature of the strand displacement steps through the controller oligonucleotide is at about the melting temperature (Tm +/- 5 ° C) of the complex comprising the 3 ' segment of the first primer extension product that is not bound by controller oligonucleotide , and the second primer oligonucleotide and the second primer extension product, respectively.
In bestimmten Ausführungsformen liegt die Temperatur der Schritte der Strangverdrängung durch das Controller-Oligonukleotid über der Schmelztemperatur des Komplexes umfassend das 3'- Segment des ersten Primer-Verlängerungsproduktes, welches nicht von Controller-Oligonukleotid gebunden wird, und dem zweiten Primer-Oligonukleotid bzw. dem zweiten Primer- Verlängerungsprodukt. Eine solche Temperatur umfasst Temperatur-Bereiche von etwa Tm + 5°C bis Tm+20°C, insbesondere von Tm+5°C bis Tm +10°C. Durch Verwendung einer höheren Temperatur kann das Gleichgewicht in diesem Reaktionsschritt in Richtung Dissoziation verschoben werden. Dadurch kann die Kinetik der Reaktion günstig beeinflusst werden. Verwendung von zu niedrigen Temperaturen im Schritt der Strangverdrängung mittels Controller- Oligonukleotid kann zu einer signifikanten Verlangsamung der Amplifikation führen. In certain embodiments, the temperature of the strand displacement steps through the controller oligonucleotide is above the melting temperature of the complex comprising the 3 ' segment of the first primer extension product other than controller oligonucleotide and the second primer oligonucleotide and the second primer extension product, respectively. Such a temperature includes temperature ranges from about Tm + 5 ° C to Tm + 20 ° C, especially from Tm + 5 ° C to Tm + 10 ° C. By using a higher temperature, the equilibrium in this reaction step can be shifted towards dissociation. As a result, the kinetics of the reaction can be favorably influenced. Use of too low temperatures in the strand displacement step by controller oligonucleotide can result in a significant slowing of the amplification.
In bestimmten Ausführungsformen umfasst ein erstes Primer-Verlängerungsprodukt ein 3'- Segment, welches nicht vom Controller-Oligonukleotid gebunden wird, und welchesIn certain embodiments, a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
Sequenzlängen von 9 bis etwa 18 Nukleotiden umfasst. Bei dieser Ausführungsform kann eine spontane Dissoziation in der Regel bereits bei Temperatur-Bereichen zwischen 40°C und 65°C erreicht werden. Auch höhere Temperaturen führen zu einer Dissoziation. Sequence lengths from 9 to about 18 nucleotides. In this embodiment, spontaneous dissociation can usually be achieved already at temperature ranges between 40 ° C and 65 ° C. Higher temperatures also lead to dissociation.
In bestimmten Ausführungsformen umfasst ein erstes Primer-Verlängerungsprodukt ein 3'- Segment, welches nicht vom Controller-Oligonukleotid gebunden wird, und welchesIn certain embodiments, a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
Sequenzlängen von 15 bis etwa 25 Nukleotiden umfasst. Bei dieser Ausführungsform kann eine spontane Dissoziation in der Regel bereits bei Temperatur-Bereichen zwischen 50°C und 70°C erreicht werden. Auch höhere Temperaturen führen zu einer Dissoziation. Sequence lengths from 15 to about 25 nucleotides. In this embodiment, spontaneous dissociation can usually be achieved already at temperature ranges between 50 ° C and 70 ° C. Higher temperatures also lead to dissociation.
In bestimmten Ausführungsformen umfasst ein erstes Primer-Verlängerungsprodukt ein 3'- Segment, welches nicht vom Controller-Oligonukleotid gebunden wird, und welchesIn certain embodiments, a first primer extension product comprises a 3 ' segment which is not bound by the controller oligonucleotide, and which
Sequenzlängen von 20 bis etwa 40 Nukleotiden umfasst. Bei dieser Ausführungsform kann eine spontane Dissoziation in der Regel bereits bei Temperatur-Bereichen zwischen 50°C und 75°C erreicht werden. Auch höhere Temperaturen führen zu einer Dissoziation. Sequence lengths from 20 to about 40 nucleotides. In this embodiment, a spontaneous dissociation usually already at temperature ranges between 50 ° C and 75 ° C can be achieved. Higher temperatures also lead to dissociation.
Die Zusammensetzung des 3'-Segmentes des ersten Primer-Verlängerungsproduktes und ggf. eine Einführung von Schmelztemperatur-beeinflussenden Oligonukleotid-Modifikationen (z.B. MGB) bzw. Reaktionsbedingungen (z.B. TPAC, Betaine) kann die Wahl der Temperatur beeinflussen. Eine entsprechende Anpassung kann daher vorgenommen werden. The composition of the 3 ' segment of the first primer extension product and optionally an introduction of melting temperature-influencing oligonucleotide modifications (eg MGB) or reaction conditions (eg TPAC, betaine) can influence the choice of temperature. An appropriate adaptation can therefore be made.
In bestimmten Ausführungsformen verlaufen alle Schritte der Amplifikation unter stringenten Bedingungen, welche die Ausbildung von unspezifischen Produkten / Nebenprodukten verhindern bzw. verlangsamen. Zu solchen Bedingungen zählen beispielsweise höhere Temperaturen, beispielsweise über 50°C.  In certain embodiments, all steps of the amplification proceed under stringent conditions that prevent or slow down the formation of nonspecific products / byproducts. Such conditions include, for example, higher temperatures, for example above 50 ° C.
In bestimmten Ausführungsformen Verläufen die Einzelschritte der Strangverdrängung durch Controller-Oligonukleotide bei gleicher Temperatur wie die Synthese des ersten und des zweiten Primer-Verlängerungsproduktes. In bestimmten Ausführungsformen Verläufen die Einzelschritte der Strangverdrängung durch Controller-Oligonukleotide bei einer Temperatur, welche von der Temperatur der jeweiligen Synthese des ersten und des zweiten Primer- Verlängerungsproduktes abweicht. In bestimmten Ausführungsformen verläuft die Synthese des ersten Primer- Verlängerungsproduktes und die Strangverdrängung durch das Controller-Oligonukleotid bei gleicher Temperatur. In bestimmten Ausführungsformen verläuft die Synthese des zweiten Primer- Verlängerungsproduktes und die Strangverdrängung durch das Controller-Oligonukleotid bei gleicher Temperatur. In certain embodiments, the single steps of strand displacement by controller oligonucleotides proceed at the same temperature as the synthesis of the first and second primer extension products. In certain embodiments, the single steps of strand displacement by controller oligonucleotides occur at a temperature that is different from the temperature of the particular synthesis of the first and second primer extension products. In certain embodiments, synthesis of the first primer extension product and strand displacement by the controller oligonucleotide is included same temperature. In certain embodiments, synthesis of the second primer extension product and strand displacement by the controller oligonucleotide proceeds at the same temperature.
Die Konzentration des Controller-Oligonukleotides umfasst Bereiche von 0,01 pmol/l bis 50 pmol/l, insbesondere von 0,1 pmol/l bis 20 pmol/l, insbesondere von 0,1 pmol/l bis 10 pmol/l.  The concentration of the controller oligonucleotide comprises ranges from 0.01 pmol / l to 50 pmol / l, in particular from 0.1 pmol / l to 20 pmol / l, in particular from 0.1 pmol / l to 10 pmol / l.
Primer-Oligonukleotide umfassend zusätzliche Sequenz-Segmente:  Primer oligonucleotides comprising additional sequence segments:
Die oben angeführten Strukturen des ersten Primers und des zweiten Primers können als sogenannte„Basis-Struktur des Primers“ bzw.„Minimale Struktur des Primers“ aufgefasst werden.  The above-mentioned structures of the first primer and the second primer can be considered as so-called "base structure of the primer" or "minimal structure of the primer".
Solche Basis-Strukturen von Oligonukleotiden mit Primer-Funktion (z.B. erstes Primer- Oligonukleotid, zweites Primer-Oligonukleotid, ggf. drittes Primer-Oligonukleotid, ggf. viertes Primer-Oligonukleotid usw.) umfassen Sequenz-Segmente, welche für die Ausführung des Amplifikations-Verfahrens vorteilhaft sind, beispielsweise den ersten und zweiten Bereich des ersten Primers.  Such basic structures of oligonucleotides with primer function (eg, first primer oligonucleotide, second primer oligonucleotide, optionally third primer oligonucleotide, optionally fourth primer oligonucleotide, etc.) comprise sequence segments which are essential for the execution of the amplification reaction. Method are advantageous, for example, the first and second region of the first primer.
Eine solche Basis-Struktur der Primer kann durch weitere, zusätzliche Sequenz-Segmente erweitert werden. Solche zusätzlichen Sequenz-Segmente umfassen Strukturen, welche ihrerseits zwar nicht für die Ausführung des Amplifikations-Verfahrens notwendig sind, dennoch für andere Aufgaben nützlich sein können.  Such a basic structure of the primer can be extended by additional, additional sequence segments. Such additional sequence segments include structures which, while not necessary for the performance of the amplification process, may nevertheless be useful for other tasks.
Solche zusätzliche Sequenz-Segmente können optional in einen Primer eingeführt werden und für weitere Funktionen bzw. Reaktionen eingesetzt werden. Dadurch können die von der  Such additional sequence segments may optionally be introduced into a primer and used for further functions or reactions. This can be done by the
Polymerase synthetisierten Primer-Verlängerungsprodukte (ausgehend z.B. vom ersten und /oder vom zweiten Primer) mit solchen Sequenzen-Segmenten verbunden werden. Dadurch wird eine Integration solcher zusätzlichen Sequenz-Segmente und Primer-Verlängerungsprodukte zu einer molekularen Struktur erreicht. Eine solche Integration kann in gewissen Ausführungsformen vorteilhaft sein. Eine Vielzahl von Anwendungen für Primer-Sequenzen mit zusätzlichen Polymerase synthesized primer extension products (starting, for example, from the first and / or the second primer) can be linked to such sequences segments. This achieves integration of such additional sequence segments and primer extension products into a molecular structure. Such integration may be advantageous in certain embodiments. A multitude of applications for primer sequences with additional
Sequenz-Segmenten sind einem Fachmann bekannt. Sequence segments are known to a person skilled in the art.
Mehrere Funktionen sind einem Fachmann bekannt, welche durch zusätzliche Sequenz- Segmente des Primers unterstützt werden.  Several functions are known to a person skilled in the art, which are supported by additional sequence segments of the primer.
Die Einführung von zusätzlichen Strukturen kann beispielsweise als Mittel zur Vermittlung einer intermolekularen oder intramolekularen Bindung verwendet werden. Einem Fachmann sind mehrere Beispiele solcher Strukturen bekannt. Beispielsweise können Sonden nach einem solchen Prinzip einer intra-molekularen Bindung gestaltet werden, z.B. im Rahmen von Scorpion- Primern. Beispielsweise können weiterhin Sequenzsegmente zur Bindung von weiteren  The introduction of additional structures can be used, for example, as a means of imparting intermolecular or intramolecular bonding. A person skilled in the art is aware of several examples of such structures. For example, probes may be designed according to such a principle of intra-molecular binding, e.g. as part of Scorpion primers. For example, sequence segments can be used to bind further
Oligonukleotiden dienen. Dabei kann eine sequenz-spezifische inter-molekulare Bindung unter Verwendung von stringenten Bedingungen zustande kommen. Solche Interaktionen können beispielsweise für die Bindung von Amplifikations-Produkten an eine feste Phase durch komplementäre Bindung an immobilisierte Oligonukleotide verwendet werden. Serve oligonucleotides. In this case, a sequence-specific intermolecular binding can be achieved using stringent conditions. Such interactions can for example, for the binding of amplification products to a solid phase by complementary binding to immobilized oligonucleotides.
Ein weiteres Beispiel stellt Einführung von sogenannten Adaptor-Sequenzen und / oder  Another example introduces so-called adapter sequences and / or
Verwendung von weiteren Sequenz-Segmenten zur eindeutigen Kodierung bzw. sequenz spezifischen Markierung von Primern und davon ausgehenden Primer-Verlängerungsprodukten (sogenanntes Primer Barcoding). Das wird beispielsweise für NGS-Library Preparation verwendet (Stählberg et al Nucleic Acids Res. 2016 Jun 20; 44(1 1 ): e105). Bei der Sequenz- Analyse von Primer-Verlängerungs-Produkten kann durch eine solche Markierung eine spätere Zuordnung von Sequenzen erfolgen. Use of further sequence segments for the unique coding or sequence-specific labeling of primers and primer extension products emanating therefrom (so-called primer barcoding). This is used, for example, for NGS library preparation (Stählberg et al Nucleic Acids Res. 2016 Jun 20; 44 (11): e105). In the sequence analysis of primer extension products, such a label can be used to assign sequences later.
Noch ein weiteres Beispiel stellt die Verwendung von weiteren Sequenz-Segmenten zur  Yet another example is the use of further sequence segments
Einführung von spezifischen Sequenzen mit Bindung von gewissen Proteinen, z.B. Restrictions- Endonukleasen etc. Introduction of specific sequences with binding of certain proteins, e.g. Restriction endonucleases etc.
Noch ein weiteres Beispiel stellt die Verwendung von weiteren Sequenz-Segmenten zur  Yet another example is the use of further sequence segments
Einführung von Abstand-Halter-Sequenzen (Spacer-Sequences), welche keinen spezifischen interaktions-Partner binden sollen, sondern vorwiegend zur Erhöhung des Abstandes zwischen benachbarten Sequenzen dienen. Introduction of spacer-sequence sequences, which are not intended to bind a specific interaction partner, but serve primarily to increase the distance between adjacent sequences.
Solche zusätzlichen Sequenzen können entweder am kopierbaren Anteil des Primers positioniert werden oder an den unkopierbaren Anteil des Primers angefügt werden. Mehrere Faktoren spielen eine Rolle bei der Beurteilung, ob ein Sequenzsegment kopiert wird oder nicht.  Such additional sequences may either be positioned on the copiable portion of the primer or added to the non-clippable portion of the primer. Several factors play a role in judging whether a sequence segment is copied or not.
Beispielsweise kann Positionierung des Sequenzsegmentes im jeweiligen Oligonukleotid, verwendete Nukleotid-Modifikationen (z.B. C3, HEG, 2'-Ome etc.) darüber entscheiden, ob ein Sequenz-Segment als Template während eines Verfahrensschrittes verwendet wird oder nicht.For example, positioning of the sequence segment in the respective oligonucleotide, nucleotide modifications used (eg C3, HEG, 2 ' -Ome etc.) can decide whether or not a sequence segment is used as a template during a process step.
In einer Ausführungsform wird ein zusätzliches Sequenz-Segment in kopierbaren Bereich des Primers, z.B. am 5'-Segment des kopierbaren Anteils des zweiten Primers, eingeführt, so dass beispielsweise bei der Ablesung der Primer-Sequenz während eines Synthese-Vorgangs einer Zielsequenz auch zusätzliche Sequenz-Segmente von der Polymerase ebenfalls abgelesen werden. Die Länge eines solchen zusätzlichen Sequenz-Segments umfasst Bereiche von 3 bis 50 Nukleotiden. Die Zusammensetzung dieser Sequenz-Segmente läßt bei dieser In one embodiment, an additional sequence segment is introduced into the copyable region of the primer, eg, at the 5 ' segment of the copiable portion of the second primer, so that, for example, in reading the primer sequence during a synthesis of a target sequence, additional sequence Segments are also read from the polymerase. The length of such additional sequence segment includes ranges of 3 to 50 nucleotides. The composition of these sequence segments leaves at this
Ausführungsform die Synthese durch eine Polymerase zu, dieses Sequenz-Segment dient also als Matrize für Polymerase-abhängige Synthese. In einem solchen Segment werden Embodiment, the synthesis by a polymerase, this sequence segment thus serves as a template for polymerase-dependent synthesis. In such a segment will be
beispielsweise natürliche Nukleotide verwendet, z.B. dA, dG, dC, dT. For example, using natural nucleotides, e.g. dA, dG, dC, dT.
In einer weiteren Ausführungsform können zusätzliche Sequenz-Segmente beispielsweise am 5'- Terminus des Primers positioniert sein, welches nicht bei der Synthese von spezifischen In a further embodiment, additional sequence segments may be positioned, for example, at the 5 ' terminus of the primer, which is not useful in the synthesis of specific
Amplifikations-Fragmenten umfassend eine Zielsequenz kopiert werden soll. Dies kann beispielsweise durch Positionierung einer oder mehrerer Modifikationen bzw. chemischen Gruppen erreicht werden, welche Polymerase an der Synthese eines komplementären Stranges hindert (z.B. HEG, C3, ein Segment umfassend 4 - 10 Nukleotide mit 2'-Ome Modifikationen etc.). Eine solche Modifikation kann beispielsweise am 5'-Terminus des kopierbaren Anteils des zweiten Primers positioniert sein und die Fortführung der Synthese behindern. Beispielsweise kann am 5'-Ende des kopierbaren Segments des zweiten Primers eine HEG-Gruppe eingeführt werden, und danach ein zusätzliches Sequenz-Segment. Amplification fragments comprising a target sequence to be copied. This can be achieved, for example, by positioning one or more modifications or chemical groups which prevents polymerase from the synthesis of a complementary strand (eg HEG, C3, a segment comprising 4 to 10 nucleotides with 2 'to- Ome modifications Etc.). Such modification may for example be positioned at the 5 'terminus of the copyable portion of the second primer and obstruct the continuation of the synthesis. For example, an HEG group may be introduced at the 5 ' end of the copiable segment of the second primer, followed by an additional sequence segment.
Weiterhin kann ein zusätzliches Sequenz-Segment am 5'-Terminus des zweiten Bereichs des ersten Primers positioniert werden. Durch eine solche Lokalisation von zusätzlichen Sequenz- Segmenten wird die Synthese eines komplementären Stranges während einer regulären Synthese von spezifischen Amplifikations-Produkten umfassend eine Zielsequenz verhindert.Furthermore, an additional sequence segment may be positioned at the 5 ' terminus of the second region of the first primer. Such localization of additional sequence segments prevents synthesis of a complementary strand during regular synthesis of specific amplification products comprising a target sequence.
Die Länge eines solchen zusätzlichen Sequenz-Segments umfasst Bereiche von 3 bis 50 Nukleotide. Die Basen-Zusammensetzung kann beispielsweise natürliche Nukleobasen (A,G, C, T, U, Inosine) oder Modifikationen an unterschiedlichen Positionen von Nukleotiden umfassen (z.B. an den Basen, wie 2-Amino-Adenin, Iso-Guanin, Iso-Cytosine, 5-Propargyl-Uridine, 5- Propargyl-Cytosine oder am Zucker-Phosphat-Rückgrat, wie beispielsweise LNA, 2'-Ome, 2 - Halogen etc.). In einer gewissen Ausführungsform werden ein erster Primer und zusätzliche Sequenz-Segmente zu einem Oligonukleotid zusammengefasst. In einer gewissen weiteren Ausführungsform werden ein zweiter Primer und zusätzliche Sequenz-Segmente zu einem Oligonukleotid zusammengefasst. The length of such additional sequence segment includes ranges of 3 to 50 nucleotides. The base composition may comprise, for example, natural nucleobases (A, G, C, T, U, inosine) or modifications at different positions of nucleotides (eg at the bases such as 2-amino-adenine, iso-guanine, iso-cytosines, 5-propargyl-Uridine, 5- propargyl cytosines or the sugar-phosphate backbone, such as LNA, 2 '-OMe, 2 - halogen, etc.). In a certain embodiment, a first primer and additional sequence segments are combined to form an oligonucleotide. In a certain further embodiment, a second primer and additional sequence segments are combined to form an oligonucleotide.
Solche zusätzlichen Sequenz-Segmente werden in einem Oligonukleotid dermaßen gestaltet, dass sie das Amplifikations-Verfahren von Zielsequenzen nicht verhindern. Dies wird  Such additional sequence segments are designed in an oligonucleotide such that they do not prevent amplification of target sequences. this will
beispielsweise dadurch erreicht, dass hemmende Interaktionen mit den für das Verfahren wesentlichen Strukturen der Primer bzw. Controller vermieden bzw. vermindert werden. In bestimmten Ausführungsformen können zusätzliche Strukturen unter den gewählten This is achieved, for example, by avoiding or reducing inhibiting interactions with the structures of the primers or controllers which are essential for the method. In certain embodiments, additional structures may be chosen from among
Reaktionsbedingungen mit anderen Primer-Bereichen komplementäre Doppelsträng-Segmente ausbilden. Insbesondere verhindern solche doppelsträngige Segmente allerdings eine spezifische Amplifikation einer Zielsequenz nicht. In bestimmten Ausführungsformen interagieren bzw. binden solche zusätzliche Sequenz-Segmente nicht an den ersten oder zweiten Primer- Bereich des ersten Primers. In bestimmten Ausführungsformen interagieren solche zusätzliche Sequenz-Segmente nicht mit dem Controller-Oligonukleotid. In bestimmten Ausführungsformen interagieren solche zusätzliche Sequenz-Segmente nicht mit anderen Primern in der Reaktion. In bestimmten Ausführungsformen interagieren solche zusätzliche Sequenz-Segmente nicht mit P1 .1 -Ext oder P2.1 -Ext oder anderen Amplifikations-Fragmenten umfassend eine Zielsequenz. In bestimmten Ausführungsformen bilden solche zusätzliche Sequenz-Segmente keine unter Reaktionsbedingungen stabile doppelsträngige Abschnitte mit dem ersten oder zweiten Bereich des ersten Primers, welche die Funktion des ersten oder des zweiten Bereichs vollständig verhindern. Form reaction conditions with other primer regions complementary double-stranded segments. In particular, however, such double-stranded segments do not prevent specific amplification of a target sequence. In certain embodiments, such additional sequence segments do not interact with the first or second primer region of the first primer. In certain embodiments, such additional sequence segments do not interact with the controller oligonucleotide. In certain embodiments, such additional sequence segments do not interact with other primers in the reaction. In certain embodiments, such additional sequence segments do not interact with P1.1 ext or P2.1 ext or other amplification fragments comprising a target sequence. In certain embodiments, such additional sequence segments do not form reaction-stable double-stranded portions with the first or second region of the first primer that completely inhibit the function of the first or second region.
In bestimmten Ausführungsformen interagieren bzw. binden solche zusätzliche Sequenz- Segmente nicht an den zweiten Primer. In bestimmten Ausführungsformen interagieren solche zusätzliche Sequenz-Segmente insbesondere nicht mit dem 3'-Segment des zweiten Primers. In bestimmten Ausführungsformen umfasst der erste Primer an seinem 5'-Terminus des zweiten Bereichs ein zusätzliches Sequenz-Segment des ersten Primers (Zusatzsequenz Variante P1 ). Dieses Segment umfasst optional eine Sequenz von 10 - 50 Nukleotiden, welche nicht mit dem Amplifikations-Verfahren von Zielsequenzen interferiert (z.B. keine sekundären Strukturen mit Primern bildet). Weiterhin umfasst dieses Segment optional eine Sequenz von etwa 5 bis 15 Nukleotiden des kopierbaren ersten Bereichs des ersten Primers. Die Zusatzsequenz Variante P1 umfasst natürliche Nukleotide als Monomere (A, C, G,T) und kann potenziell als Matrize für eine Polymerase dienen. In certain embodiments, such additional sequence segments do not interact with the second primer. In particular, in certain embodiments, such additional sequence segments do not interact with the 3 ' segment of the second primer. In certain embodiments, the first primer comprises at its 5 ' terminus of the second region an additional sequence segment of the first primer (variant sequence variant P1). This segment optionally includes a sequence of 10-50 nucleotides which does not interfere with the amplification process of target sequences (eg, does not form secondary structures with primers). Furthermore, this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copiable first region of the first primer. The additional sequence variant P1 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
In bestimmten Ausführungsformen umfasst der zweite Primer an seinem 5'-Terminus ein zusätzliches Sequenz-Segment des zweiten Primers (Zusatzsequenz Variante P2). Dieses Segment umfasst optional eine Sequenz von 10 - 50 Nukleotiden, welche nicht mit dem In certain embodiments, the second primer comprises at its 5 ' terminus an additional sequence segment of the second primer (variant sequence variant P2). This segment optionally includes a sequence of 10-50 nucleotides which does not match the
Amplifikations-Verfahren von Zielsequenzen interferiert (z.B. keine sekundären Strukturen mit Primern bildet). Weiterhin umfasst dieses Segment optional eine Sequenz von etwa 5 bis 15 Nukleotiden des kopierbaren Bereichs des zweiten Primers. Die Zusatzsequenz Variante P2 umfasst natürliche Nukleotide als Monomere (A, C, G,T) und kann potenziell als Matrize für eine Polymerase dienen. Amplification process of target sequences interferes (e.g., does not form secondary structures with primers). Furthermore, this segment optionally comprises a sequence of about 5 to 15 nucleotides of the copyable region of the second primer. The additional sequence variant P2 comprises natural nucleotides as monomers (A, C, G, T) and can potentially serve as a template for a polymerase.
Es wurde beobachtet, dass solche Oligonukleotide umfassend einen ersten Primer und  It has been observed that such oligonucleotides comprise a first primer and
Zusatzsequenz Variante P1 oder Oligonukleotide umfassend einen zweiten Primer und Additional sequence variant P1 or oligonucleotides comprising a second primer and
Zusatzsequenz Variante P2 im geringeren Maß anfällig für Neben-Reaktionen sind, als Additional sequence variant P2 are less susceptible to side reactions than
Oligonukleotide umfassend nur einen ersten Primer, oder Oligonukleotide umfassend nur einen zweiten Primer. In bestimmten Ausführungsformen kann beispielsweise die Generierung und / oder Amplifikation von unspezifischen Primer-Dimer-Strukturen verzögert werden. In einer solchen Nebenreaktion kann somit optional die Bildung von Nebenprodukten umfassend keine Zielsequenz verringert oder verzögert werden. Dadurch kann beispielsweise der vorzeitige Verbrauch von Primern reduziert oder verzögert werden. Vorteilhaft ist beispielsweise der Einsatz von solchen Oligonukleotiden, wenn durch Nebenreaktionen Primer-Dimere umfassend ersten Primer (PD P1 ) oder Primer-Dimere umfassend zweiten Primer (PD P2) erzeugt werden und zum vorzeitigen Verbrauch von Primern in der Reaktion führen. Verwendung von Primern mit solchen zusätzlichen Strukturen (erster Primer mit Zusatzsequenz Variante P1 und / oder zweiter Primer mit Zusatzsequenz Variante P2) ist in gewissen Ausführungsformen vom Vorteil, wenn in einer Amplifikations-Reaktion unspezifische Reaktionen beobachtet werden. Solche Nebenreaktionen können durch mehrere Faktoren begünstigt werden, dazu zählen unter anderem: Oligonucleotides comprising only a first primer, or oligonucleotides comprising only a second primer. For example, in certain embodiments, the generation and / or amplification of nonspecific primer-dimer structures may be delayed. Thus, in such a side reaction, optionally, the formation of by-products comprising no target sequence can be reduced or retarded. As a result, for example, the premature consumption of primers can be reduced or delayed. For example, the use of such oligonucleotides is advantageous if primer dimers comprising first primers (PD P1) or primer dimers comprising second primers (PD P2) are produced by secondary reactions and lead to premature consumption of primers in the reaction. Use of primers having such additional structures (first primer with additional sequence variant P1 and / or second primer with additional sequence variant P2) is advantageous in certain embodiments if nonspecific reactions are observed in an amplification reaction. Such side reactions may be favored by several factors, including but not limited to:
• längere Reaktionszeiten (z.B. in Bereichen zwischen 1 hr und 100 hr)  • longer reaction times (for example in ranges between 1 hr and 100 hr)
• höhere Konzentrationen von Primern werden verwendet (z.B. in Bereichen zwischen 1 pmol/l und 1 mmol/l)  Higher concentrations of primers are used (e.g., in the range between 1 pmol / l and 1 mmol / l)
• höhere Konzentrationen von Polymerase werden verwendet (z.B. in Bereichen über 10 Unit / 10 pl) • Multiplex-Reaktionen (z.B. Amplifikation von mehr als 10 unterschiedlichen Zielsequenzen in einem Reaktions-Ansatz). • higher concentrations of polymerase are used (eg in areas above 10 unit / 10 pl) • Multiplex reactions (eg amplification of more than 10 different target sequences in a reaction mixture).
• hohe Konzentrationen von komplexen Nukleinsäureketten im Reaktions-Ansatz (z.B.  High concentrations of complex nucleic acid chains in the reaction mixture (e.g.
Konzentrationen über 1 pg hgDNA in 50 pl)  Concentrations above 1 μg hgDNA in 50 μl)
Einzelne Faktoren können dabei alleine oder in Kombination mit anderen Faktoren  Individual factors can be alone or in combination with other factors
Nebenreaktionen begünstigen. Favor side reactions.
Im Allgemeinen kann man gegen Nebenreaktionen (z.B. unspezifische Primer-Dimer Bildung) Vorgehen, indem man Reaktions-Komponenten und / oder Reaktions-Bedingungen optimiert, beispielsweise durch Reduzierung von Konzentrationen von einzelnen Komponenten, kürzere Reaktions-Zeiten, Sequenz-Gestaltung von Primer-Sequenzen, Wahl von stringenteren Reaktions- Bedingungen. Die in einer vorteilhaften Ausführungsform angeführten zusätzliche Sequenz- Segmente (Oligonukleotide umfassend einen ersten Primer und Zusatzsequenz Variante P1 oder Oligonukleotide umfassend einen zweiten Primer und Zusatzsequenz Variante P2) stellen eine weitere Möglichkeit dar, gewisse Nebenreaktionen zu verzögern.  In general, it is possible to counteract side reactions (eg nonspecific primer-dimer formation) by optimizing reaction components and / or reaction conditions, for example by reducing concentrations of individual components, shorter reaction times, sequence design of primer sequences , Choice of more stringent reaction conditions. The additional sequence segments cited in an advantageous embodiment (oligonucleotides comprising a first primer and additional sequence variant P1 or oligonucleotides comprising a second primer and additional sequence variant P2) represent a further possibility for delaying certain side reactions.
In Ausführungsbeispielen werden Primer-Oligonukleotide mit zusätzlichen Sequenz-Segmenten gezeigt. In diesen Ausführungsbeispielen werden zusätzliche Sequenz-Segmente verwendet, welche nicht an der spezifischen Amplifikation einer Zielsequenz teilnehmen und zur Verzögerung von Neben-Reaktionen beitragen. Somit werden Oligonukleotide umfassend einen ersten Primer und Zusatzsequenz Variante P1 und Oligonukleotide umfassend einen zweiten Primer und Zusatzsequenz Variante P2 verwendet.  In embodiments, primer oligonucleotides with additional sequence segments are shown. In these embodiments, additional sequence segments are used which do not participate in the specific amplification of a target sequence and contribute to the delay of side reactions. Thus, oligonucleotides comprising a first primer and additional sequence variant P1 and oligonucleotides comprising a second primer and additional sequence variant P2 are used.
Ein Fachmann wird erkennen, dass ein Oligonukleotid neben einer Primer-Struktur, welche für die spezifische Amplifikation einer Zielsequenz vorteilhaft ist (diese Struktur kann auch als„Basis- Struktur“ oder „Minimal-Struktur“ bezeichnet werden), auch weitere, zusätzliche Sequenz- Segmente umfassen kann (z.B. Zusatzsequenz Variante P1 oder Zusatzsequenz Variante P2). Solche zusätzliche Sequenz-Segmente können eine Vielzahl von unterschiedlichen weiteren vorteilhaften bzw. nützlichen Eigenschaften bzw. Funktionen vermitteln.  One skilled in the art will recognize that an oligonucleotide, in addition to a primer structure that is advantageous for the specific amplification of a target sequence (this structure may also be referred to as a "base structure" or "minimal structure"), also includes additional, additional sequence sequences. Segments may include (eg additional sequence variant P1 or additional sequence variant P2). Such additional sequence segments may provide a variety of different other beneficial properties.
Beispiele für Ausführungsformen der vorliegenden Erfindung Examples of embodiments of the present invention
Figurenbeschreibung  figure description
Fig. 1 zeigt die Sequenzkomponenten einer bevorzugten Ausführungsform der Erfindung. Primer 1 .1 kann mit seinem ersten Bereich (in 3'-Segmenten) an die jeweilige Primerbindungsstelle am Matrizenstrang (M1 .1 ) vorwiegend komplementär binden. Der Polynukleotid-Schwanz (Primer- Überhang) des zweiten Bereichs bindet nicht an den Matrizenstrang (M1 .1 ). Der Controller (1 .1 .) umfasst einen ersten, zweiten und dritten Bereich. Fig. 1 shows the sequence components of a preferred embodiment of the invention. Primer 1 .1 can bind with its first region (in 3 ' segments) to the respective primer binding site on the template strand (M1 .1) predominantly complementary. The polynucleotide tail (primer overhang) of the second region does not bind to the template strand (M1 .1). The controller (1 .1.) Comprises a first, second and third area.
In Fig. 2 ist schematisch die Topographie des vollständigen Primer-Verlängerungsproduktes (P1- Ext.) dargestellt, wobei das Verlängerungsprodukt einen vom Primer 1 .1 gebildeten Bereich und ein von der Polymerase synthetisiertes Segment umfasst. Die Synthese eines P1 -Ext Primer-Verlängerungsproduktes ist in Fig. 3 schematisch dargestellt. Der Synthesefortschritt wird hierbei durch ein Block-Oligonukleotid sequenzspezifisch gestoppt. Der Primer / Controller-Komplex ist unter verwendeten Reaktionsbedingungen während der Synthese-Phase stabil. Die Synthese des P1-Ext durch die Polymerase geht bis zum Block- Oligonukleotid (B 1.1 ), so dass die Länge des synthetisierten Segments des P1 -Ext begrenzt wird.FIG. 2 schematically illustrates the topography of the complete primer extension product (P1-Ext.), Wherein the extension product comprises a region formed by primer 1 .1 and a segment synthesized by the polymerase. The synthesis of a P1-ext primer extension product is shown schematically in FIG. The synthesis progress is in this case stopped by a block oligonucleotide sequence-specific. The primer / controller complex is stable under the reaction conditions used during the synthesis phase. The synthesis of the P1-Ext by the polymerase goes to the block oligonucleotide (B 1.1), so that the length of the synthesized segment of the P1-Ext is limited.
Die sequenzspezifische Kontrolle der Primerverlängerung wird insbesondere durch die Bindung des Controller-Oligonukleotids vermittelt. Die Controller-Bindung an das Primer- Verlängerungsprodukt während der Controllling-Phase ist schematisch in Fig. 4 dargestellt, wobei A) die Freisetzung des Controllers aus dem Komplex: Primer-/ Controller; B-C) die Bindung des Controllers an den zweiten Bereich des Primers am Primer-Verlängerungsprodukt, und D-E) die Sequenz-spezifische Strangverdrängung durch den Controller unter Freisetzung des Matrizenstranges illustriert. The sequence-specific control of primer extension is mediated in particular by the binding of the controller oligonucleotide. The controller binding to the primer extension product during the control phase is shown schematically in Figure 4, where A) the release of the controller from the complex: primer / controller; B-C), the binding of the controller to the second region of the primer on the primer extension product, and D-E) illustrates the sequence-specific strand displacement by the controller to release the template strand.
In Fig. 5 wird schematisch eine Sonden-Bindung an das Primer-Verlängerungsprodukt nach seiner Freisetzung vom Matrizenstrang dargestellt. Durch die Freisetzung vom Matrizenstrang kann das 3'-Segment des P1-Ext mit einem anderen Oligonukleotid interagieren, z.B. einer Fluoreszenz- Sonde (S1 .1 ), oder anderen Primern oder einer Affinitäts-Sonde. Durch eine Bindung kann es beispielsweise zum Zuwachs eines Fluoreszenzsignals kommen. FIG. 5 schematically shows a probe binding to the primer extension product after its release from the template strand. Release from the template strand allows the 3 ' segment of the P1-Ext to interact with another oligonucleotide, such as a fluorescent probe (S1 .1), or other primers or an affinity probe. For example, a binding can lead to the increase of a fluorescence signal.
Als Sonde kann beispielsweise ein zum 3'-Segment des gebildeten Primer- Verlängerungsproduktes komplementäres Oligonukleotid mit einem Quencher (z.B. BHQ1 ) und einem Reporter (z.B. FAM) verwendet werden. Als Reporter kann beispielsweise ein molecular beacon mit Self-Quenching Eigenschaften verwendet werden. Das Signal wird erst bei einer komplementären Bindung generiert. Dadurch können beispielsweise vollständige P1 -Ext von nicht vollständigen unterschieden werden. As a probe, for example, a complementary to the 3 ' segment of the primer extension product formed oligonucleotide with a quencher (eg BHQ1) and a reporter (eg FAM) can be used. As a reporter, for example, a molecular beacon with self-quenching properties can be used. The signal is generated only when a complementary bond. This allows, for example, complete P1-text to be distinguished from incomplete ones.
Die Synthese-Phase und die Controlling-Phase kann gleichzeitig stattfinden, wie durch den in Fig. 6 dargestellten Reaktionsansatz illustriert. Controller und Primer sowie deren Komplex liegen im Gleichgewicht während der Reaktion vor (Fig. 6 A)). Die Synthese des Primer- Verlängerungsproduktes wird durch Zugabe einer Polymerase initiiert. Bei Primer-Bindung an die Primer-Bindungsstelle kann die Polymerase die Synthese eines komplementären Primer- Verlängerungsproduktes starten (Fig. 6 B)). Die von der Polymerase katalysierte Synthese von vollkomplementären Produkten erfolgt schneller als die Synthese von Produkten, welche einen Mismatch infolge eines während der Synthese entstandenen Fehlers umfassen. Die Mismatch- Stränge werden langsamer synthetisiert.  The synthesis phase and the controlling phase may take place simultaneously, as illustrated by the reaction approach illustrated in FIG. Controller and primer as well as their complex are in equilibrium during the reaction (Figure 6 A)). The synthesis of the primer extension product is initiated by the addition of a polymerase. Upon primer binding to the primer binding site, the polymerase can start the synthesis of a complementary primer extension product (Figure 6B)). The polymerase-catalyzed synthesis of fully complementary products occurs faster than the synthesis of products that involve a mismatch due to an error arising during the synthesis. The mismatch strands are synthesized more slowly.
In Fig. 7 und 8 sind weitere schematische Darstellungen eines Reaktionsansatzes mit gleichzeitiger Synthese-Phase und Controlling-Phase gezeigt. Controller und Primer sowie deren Komplex liegen im Gleichgewicht während der Reaktion vor (Fig. 7 A), Fig. 8 B)). Die frei im Ansatz vorliegenden Controller können während der Synthese-Phase mit den Primer- Verlängerungsprodukten interagieren. Die Interaktion beginnt am zweiten Primer-Bereich eines jeweiligen Primer-Verlängerungsproduktes (Fig. 7 B), Fig. 8 B)). Das Ergebnis der Interaktion der Controller mit den Primer-Verlängerungsprodukten ist je nach Synthese-Fortschritt am Primer- Verlängerungsprodukt unterschiedlich: bei vollständig synthetisierten P1-Ext kann es zu einer Ablösung dieses Produktes kommen. Dabei kann ein vollständig synthetisiertes P1 -Ext durch sein 3'-Segment mit anderen Oligonukleotiden interagieren, z.B. Sonden, Primern etc. (Fig. 8 C)). Bei unvollständig synthetisierten P1-Ext kommt es ebenfalls zu einer Ablösung dieses Produktes vom Matrizenstrang. Der gebildete Komplex ist unter Reaktionsbedingungen hinreichend stabil, so dass dieses unvollständige Primer-Verlängerungsprodukt von einer Fortsetzung seiner Synthese am Matrizenstrang ausgeschlossen werden kann bzw. durch die Komplex-Form mit dem Controller stark an der Fortsetzung der matrizenabhängigen Synthese Reaktion gehindert wird. Damit kann die Synthese von fehlerhaften Primer-Verlängerungsprodukten bis zur vollen Synthese-Länge verhindert werden. Wegen einer unzureichenden Länge umfassen solche unvollständigen P1-Ext beispielsweise nicht die erforderlichen Sequenzsegmente um an anderen Reaktionen teilzunehmen. Z.B. fehlt hier ein 3'-Segment im Primer-Verlängerungsprodukt (Fig. 8 D)). In Fig. 7 and 8 further schematic representations of a reaction mixture with simultaneous synthesis phase and controlling phase are shown. Controller and primer as well as their complex are in equilibrium during the reaction before (Fig. 7 A), Fig. 8 B)). The free-of-charge controllers can interact with the primer extension products during the synthesis phase. The interaction starts at the second primer area of a respective primer extension product (Figure 7B), Figure 8B)). The result of the controller's interaction with the primer extension products will be different depending on the progress of the synthesis of the primer extension product: with fully synthesized P1-Ext, this product may be released. In this case, a fully synthesized P1 -ex can interact through its 3 ' segment with other oligonucleotides, eg probes, primers etc. (FIG. 8C)). Incompletely synthesized P1-Ext also leads to a detachment of this product from the template strand. The complex formed is sufficiently stable under reaction conditions, so that this incomplete primer extension product can be excluded from a continuation of its synthesis at the template strand or is prevented by the complex form with the controller strongly to the continuation of the template-dependent synthesis reaction. Thus, the synthesis of defective primer extension products can be prevented to full synthesis length. For example, due to insufficient length, such incomplete P1 ext does not include the required sequence segments to participate in other reactions. For example, here a 3 ' segment is missing in the primer extension product (Figure 8D)).
Fig. 9 A bis C zeigen schematisch die Topographie eines Matrizenstranges (umfassend eine Zielsequenz) mit einem polymorphen Lokus (N2) und zwei einheitlichen Zielsequenzsegmenten (N1 und N3). Der Matrizenstrang mit der ersten Variante (M 1.1 ) und der Matrizenstrang mit der zweiten Variante (M 1 .2) zeigen schematisch die Topographie einer Zielsequenz innerhalb von Matrizensträngen. Beide Matrizenstränge umfassen Zielsequenzsegmente N1 und N3, welche bei beiden Matrizensträngen identisch und einheitlich sind. Das jeweilige Sequenzsegment N2 ist bei jedem Matrizenstrang charakteristisch und spezifisch, so dass beide Matrizenstrange dadurch unterschieden werden können. N2 umfasst mindestens zwei Sequenzvarianten eines polymorphen Lokus einer Zielsequenz. M 1 .1 = Matrize mit der ersten Variante der Zielsequenz. M 1.2 = Matrize mit der zweiten Variante der Zielsequenz. N1 = erstes einheitliches Zielsequenzsegment, in welchem S1.1 identisch zu S1 .2 ist. N2 = polymorpher Lokus, in welchem S1.1 nicht identisch zu S1.2 ist. N3 = zweites einheitliches Zielsequenzsegment , in welchem S1 .1 identisch zu S1 .2 ist. B1.1 Block-Oligonukleotid zur Begrenzung einer Primer-Verlängerung.  Figures 9A-C schematically show the topography of a template strand (comprising a target sequence) with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3). The template strand with the first variant (M 1.1) and the template strand with the second variant (M 1 .2) schematically show the topography of a target sequence within template strands. Both template strands comprise target sequence segments N1 and N3, which are identical and uniform in both template strands. The respective sequence segment N2 is characteristic and specific in each template strand, so that both template streaks can be distinguished by it. N2 comprises at least two sequence variants of a polymorphic locus of a target sequence. M 1 .1 = template with the first variant of the target sequence. M 1.2 = template with the second variant of the target sequence. N1 = first unified target sequence segment in which S1.1 is identical to S1 .2. N2 = polymorphic locus, in which S1.1 is not identical to S1.2. N3 = second uniform target sequence segment, in which S1 .1 is identical to S1 .2. B1.1 block oligonucleotide for limiting a primer extension.
In dieser Ausführungsform umfasst eine Zielsequenz, welche mehrere Sequenzvarianten in einem polymorphen Lokus (N2) umfassen kann, weiterhin mindestens ein erstes Zielsequenzsegment (N1 ), welches für alle Zielsequenzvarianten einer Zielsequenz (Zielsequenz-Gruppe umfassend hier M 1 .1 und M 1 .2) charakteristisch und einheitlich ist. Weiterhin umfasst eine Zielsequenz mindestens ein zweites Zielsequenzsegment (N3), welches für alle Zielsequenzvarianten einer Zielsequenz (Zielsequenz-Gruppe umfassend hier M 1 .1 und M 1 .2) charakteristisch und einheitlich ist. Solche einheitlichen Zielsequenzsegmente sind vorzugsweise auf beiden Seiten eines polymorphen Lokus lokalisiert und flankieren somit einen polymorphen Lokus (mit Sequenzvarianten) einer Zielsequenz von beiden Seiten. Vorzugsweise unterscheidet sich das erste einheitliche Zielsequenzsegment (N1 ) in seiner Sequenzzusammensetzung von der Sequenzzusammensetzung des zweiten einheitlichen Zielsequenzsegments (N3) in mindestens einer Nukleotid-Position. In this embodiment, a target sequence, which may comprise a plurality of sequence variants in a polymorphic locus (N2), furthermore comprises at least a first target sequence segment (N1) which is suitable for all target sequence variants of a target sequence (target sequence group comprising M 1 .1 and M 1 .2 ) is characteristic and uniform. Furthermore, a target sequence comprises at least one second target sequence segment (N3) which is characteristic and uniform for all target sequence variants of a target sequence (target sequence group comprising M 1 .1 and M 1 .2 here). Such uniform target sequence segments are preferably located on either side of a polymorphic locus and thus flank a polymorphic locus (with sequence variants) of a target sequence from both sides. Preferably, the first uniform target sequence segment (N1) differs in its sequence composition from the Sequence composition of the second unitary target sequence segment (N3) in at least one nucleotide position.
Fig. 10 (A - C) zeigen schematisch die Topographie eines Matrizenstranges mit einem polymorphen Lokus (N2) und zwei einheitlichen Zielsequenzsegmenten (N1 und N3) wie in Fig. 9 dargestellt.  Figures 10 (A - C) show schematically the topography of a template strand with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3) as shown in Figure 9.
Fig. 10 D zeigt das Ergebnis einer Strangtrennung nach einer Primer-Verlängerung durch zwei jeweils für eine Sequenz-Variante charakteristischen und spezifischen Controller-Oligonukleotide (C1.1 und C1 .2), wobei jedes dieser Controller-Oligonukleotide einen zum polymorphen Lokus der Zielsequenz (N2) korrespondierendes Sequenzsegment umfasst, wobei C1 .1 und C1 .2 sich in diesem Sequenzsegment unterscheiden. Daraus folgt eine spezifische und charakteristische Paarbildung einer spezifischen und charakteristischen Sequenz-Variante (einer Allel-Variante) einer spezifischen Zielsequenz und eines für diese Sequenz-Variante charakteristischen und spezifischen Controller-Oligonukleotides.  Figure 10D shows the result of strand separation after primer extension by two specific and unique controller oligonucleotides (C1.1 and C1 .2), each of which controller oligonucleotides provides a polymorphic locus of the target sequence (N2) corresponding sequence segment, wherein C1 .1 and C1 .2 differ in this sequence segment. This results in a specific and characteristic pairing of a specific and characteristic sequence variant (an allelic variant) of a specific target sequence and a specific for this sequence variant and specific controller oligonucleotide.
Die Abbildung fasst schematisch zusammen, welche Wirkung die Anwesenheit des voll komplementären Stranges (Matrizenstrang) auf die mögliche Mismatch-Duplex hat: Wegen der voll-komplementären Natur des von einer Polymerase synthetisierten Primer- Verlängerungsprodutkes, umfassen beide während der Synthese entstandenen Primer- Verlängerungsprodukte jeweils voll-komplementäre Sequenzen. Bindung von solchen voll komplementären Sequenzen aneinander erfolgt effektiver, als bei Sequenzen, welche ein Mismatch umfassen. Die Strang-Trennung verläuft somit nur über eine kürzere Distanz und ist weniger effektiv als bei vollkomplementären Strängen.  The figure summarizes schematically the effect of the presence of the fully complementary strand (template strand) on the potential mismatch duplex: Because of the fully-complementary nature of the polymerase-synthesized primer extension product, both primer extension products formed during synthesis both comprise fully-complementary sequences. Binding of such fully complementary sequences to each other is more effective than in sequences involving a mismatch. The strand separation thus runs only over a shorter distance and is less effective than with fully complementary strands.
Fig. 1 1 zeigt schematisch eine andere Topographie eines N2 einer Zielnukleinsäurekette in Bezug auf das Controller-Oligonukleotid und den ersten Primer.  Fig. 11 schematically shows another topography of an N2 of a target nucleic acid chain with respect to the controller oligonucleotide and the first primer.
Bei diesem Ausführungsbeispiel umfasst das zum N2 korrespondierende Sequenzsegment des Controller-Oligonukleotides teilweise den dritten Bereich als auch teilweise den zweiten Bereich. Auch das 3'-Segment des ersten Primers wird sequenzspezifisch und charakteristisch für eine spezifische und charakteristische Sequenz-Variante der Zielnukleinsäure gestaltet. An der Allel- Diskriminierung nehmen also sowohl das Controller-Oligonukleotid als auch das erste Primer- Oligonukleotid teil. Für jede spezifische Sequenzvariante des polymorphen Lokus kann somit sowohl ein spezifisches Controller-Oligonukleotid als auch ein spezifisches erstes Primer- Oligonukleotid konstruiert werden. In this embodiment, the N2-corresponding sequence segment of the controller oligonucleotide partially comprises the third region as well as partially the second region. Also, the 3 ' segment of the first primer is designed to be sequence specific and characteristic of a specific and characteristic sequence variant of the target nucleic acid. Thus, both the controller oligonucleotide and the first primer oligonucleotide participate in allele discrimination. Thus, for each specific sequence variant of the polymorphic locus, both a specific controller oligonucleotide and a specific first primer oligonucleotide can be constructed.
Fig. 12 zeigt schematisch potenzielle Positionen eines polymorphen Lokus innerhalb einer Zielsequenz (Position 1 bis 6) und ihre korrespondierenden Sequenzsegment-Positionen in den einzelnen Komponenten eines Primer-Verlängerungs-Systems. Die hier schematisch dargestellten polymorphen Loki einer Zielsequenz umfassen 2 bis 50 Nukleotide, insbesondere 4 bis 30 Nukleotide, welche für eine Allel-Variante einer Zielsequenz charakteristisch und spezifisch sind. Insgesamt kann die Anordnung von einzelnen Amplifikations-Komponenten dermaßen gestaltet werden, dass mehrere Varianten / Kombinationen möglich sind: Figure 12 shows schematically potential positions of a polymorphic locus within a target sequence (positions 1 to 6) and their corresponding sequence segment positions in the individual components of a primer extension system. The polymorphic loci of a target sequence shown schematically comprise 2 to 50 nucleotides, in particular 4 to 30 nucleotides, which are characteristic and specific for an allelic variant of a target sequence. Overall, the arrangement of individual amplification components can be designed so that several variants / combinations are possible:
Anordnung 1 (P1 ): Ein polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (im ersten Bereich) und das Controller-Oligonukleotid (im zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Arrangement 1 (P1): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). These components of the amplification system can thus be specific and characteristic of the respective
Sequenzvariate der Zielsequenz konstruiert werden. Sequence variate of the target sequence can be constructed.
Anordnung 2 (P2): Ein polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (im ersten Bereich) und das Controller-Oligonukleotid (im zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Array 2 (P2): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). These components of the amplification system can thus be specific and characteristic of the respective
Sequenzvariate der Zielsequenz konstruiert werden. Anordnung P2 unterscheidet sich von P1 vor allem dadurch, dass N2 vorwiegend im 3'-terminalen Sequenz-Segment des ersten Primers liegt. Dadurch kann ggf. eine bessere Spezifität der Amplifikation erreicht werden. Sequence variate of the target sequence can be constructed. Arrangement P2 differs from P1 mainly in that N2 lies predominantly in the 3 ' terminal sequence segment of the first primer. As a result, if necessary, a better specificity of the amplification can be achieved.
Anordnung 3 (P3): Ein polymorpher Lokus (N2) der Zielsequenz überlagert nur das Controller- Oligonukleotid (im dritten Bereich), wobei das korrespondierende Sequenzsegment des Controller- Oligonukleotides im 5'-Segment des synthetisierten Anteils des ersten Primer- Verlängerungsproduktes liegt. Das Controller-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein zielsequenzspezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist. Aufgrund der möglichen Nähe der zweiten Blockierungs-Einheit kann die Bindung des Controller-Oligonukleotide an das erste Primer- Verlängerungsprodukt durch Nukleotid-Modifikationen der zweiten Blockierungs-Einheit beeinflusst werden. Arrangement 3 (P3): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region) with the corresponding sequence segment of the controller oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product. The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first primer is used, which is not sequence variant specific. Because of the possible proximity of the second blocking moiety, the binding of the controller oligonucleotides to the first primer extension product can be affected by nucleotide modifications of the second blocking moiety.
Anordnung 4 (P4 - P6): Ein polymorpher Lokus (N2) der Zielsequenz überlagert nur das Controller-Oligonukleotid (im dritten Bereich). Das Controller-Oligonukleotid des Amplifikations- Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein zielsequenzspezifischer erster Primer verwendet, welche aber nicht Sequenz-Varianten-spezifisch sind. Dieses Sequenzsegment des Controller-Oligonukleotides liegt in 5'-Richtung von der zweiten Blockierungs-Einheit und kann mehrere DNA-Nukleotid-Monomere umfassen, z.B. von 5 bis 30. Arrangement 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region). The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first primer is used, but which are not sequence variant specific. This sequence segment of the controller oligonucleotide lies in the 5 ' direction from the second blocking unit and may comprise several DNA nucleotide monomers, eg from 5 to 30.
Fig. 13 - 14 zeigen schematisch die Topographie einer Zielnukleinsäurekette mit einem polymorphen Lokus (N2) und zwei einheitlichen Zielsequenzsegmenten (N1 und N3), wobei der polymorphe Lokus nur eine Nukleotid-Position umfasst (z.B. ein SNV oder ein SNP oder eine Punkt-Mutation etc.). Die Unterschiede zwischen einzelnen Sequenzvarianten betragen somit lediglich nur ein Nukleotid (hier als 4.1 und 4.2 bezeichnet). Ein solcher Lokus (N2) kann zu ähnlichen Anordnungen einzelner Komponenten führen wie ein Lokus mit mindestens 2 Nukeotiden. Bei einer Bindung des Controller-Oligonukleotides an ein komplementäres erstes Primer-Verlängerungsprodukt (perfekt-Match) kann somit eine Strangtrennung nach einer Primer- Verlängerung erfolgen. Bei der Ausbildung eines Mismatches wird die Strang-Trennung gehemmt oder verlangsamt bzw. sogar unterbrochen. Figures 13-14 show schematically the topography of a target nucleic acid chain with a polymorphic locus (N2) and two unitary target sequence segments (N1 and N3), where the polymorphic locus comprises only one nucleotide position (eg an SNV or an SNP or a point mutation Etc.). The differences between individual sequence variants thus amount to only one nucleotide (here referred to as 4.1 and 4.2). Such a locus (N2) can lead to similar arrangements of individual components as a locus with at least 2 nukeotids. When the controller oligonucleotide is bound to a complementary first primer extension product (perfect match), strand separation following a primer can thus be achieved. Extension done. In the formation of a mismatch strand separation is inhibited or slowed down or even interrupted.
Fig. 15 zeigt schematisch potenzielle Positionen eines polymorphen Lokus mit Sequenz-Varianz von nur einem Nukleotid innerhalb einer Zielsequenz (Position 1 bis 6) eines Matrizenstrangs und ihre korrespondierenden Sequenzsegment-Positionen in einzelnen Komponenten eines Primer- Verlängerungs-Systems.  Fig. 15 shows schematically potential positions of a polymorphic locus with sequence variance of only one nucleotide within a target sequence (positions 1 to 6) of a template strand and their corresponding sequence segment positions in individual components of a primer extension system.
Insgesamt kann die Anordnung von einzelnen Amplifikations-Komponenten dermaßen gestaltet werden, dass mehrere Varianten / Kombinationen möglich sind:  Overall, the arrangement of individual amplification components can be designed so that several variants / combinations are possible:
Anordnung 1 (P1 ): Ein polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (im ersten Bereich) und das Controller-Oligonukleotid (im zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Arrangement 1 (P1): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). These components of the amplification system can thus be specific and characteristic of the respective
Sequenzvariate der Zielsequenz konstruiert werden. Sequence variate of the target sequence can be constructed.
Anordnung 2 (P2): Ein polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (im ersten Bereich) und das Controller-Oligonukleotid (im zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Array 2 (P2): A polymorphic locus (N2) of the target sequence overlays the first primer (in the first region) and the controller oligonucleotide (in the second region). These components of the amplification system can thus be specific and characteristic of the respective
Sequenzvariate der Zielsequenz konstruiert werden. Anordnung P2 unterscheidet sich von P1 vor allem dadurch, dass N2 vorwiegend im 3'-terminalen Sequenz-Segment des ersten Primers liegen kann oder sogar das 3'-terminale Nukleotid umfasst. Dadurch kann ggf. eine weitere Erhöhnung der Spezifität der Amplifikation erzeicht werden. Sequence variate of the target sequence can be constructed. Arrangement P2 differs from P1 primarily in that N2 may be predominantly in the 3 ' terminal sequence segment of the first primer or even comprises the 3 ' terminal nucleotide. This may possibly result in a further increase in the specificity of the amplification.
Anordnung 3 (P3): Ein polymorpher Lokus (N2) der Zielsequenz überlagert nur das Controller- Oligonukleotid (im dritten Bereich), wobei das korrespondierende Sequenzsegment des Controller- Oligonukleotides im 5'-Segment des synthetisierten Anteils des ersten Primer- Verlängerungsproduktes liegt. Das Controller-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein zielsequenzspezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch sind. Aufgrund der möglichen Nähe der zweiten Blockierungs-Einheit kann die Bindung des Controller-Oligonukleotide an das erste Primer- Verlängerungsprodukt durch Nukleotid-Modifikationen der zweiten Blockierungs-Einheit beeinflusst werden. Arrangement 3 (P3): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region) with the corresponding sequence segment of the controller oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product. The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first primer is used, but which are not sequence variant specific. Because of the possible proximity of the second blocking moiety, the binding of the controller oligonucleotides to the first primer extension product can be affected by nucleotide modifications of the second blocking moiety.
Anordnung 4 (P4 - P6): Ein polymorpher Lokus (N2) der Zielsequenz überlagert nur das Controller-Oligonukleotid (im dritten Bereich). Das Controller-Oligonukleotid des Amplifikations- Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein zielsequenzspezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist. Dieses Sequenzsegment des Controller-Oligonukleotides liegt in 5'-Richtung von der zweiten Blockierungs-Einheit. Dieses Segment des Controller-Oligonukleotides kann mehrere DNA-Nukleotid-Monomere umfassen, z.B. von 5 bis 30, wobei das N2-korrespondierende Sequenzsegment von mindestens 3 bis 15 DNA- Nukleotid-Bausteinen auf beiden Seiten flankiert sein kann. Arrangement 4 (P4-P6): A polymorphic locus (N2) of the target sequence overlays only the controller oligonucleotide (in the third region). The controller oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first primer is used, which is not sequence variant specific. This sequence segment of the controller oligonucleotide lies in the 5 ' direction of the second blocking unit. This segment of the controller oligonucleotide may comprise multiple DNA nucleotide monomers, eg from 5 to 30, wherein the N2-corresponding sequence segment may be flanked by at least 3 to 15 DNA nucleotide building blocks on both sides.
Fig. 16 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante des Matrizenstranges (S1.1 ) binden und die Synthese des P1.1 -Ext initiieren. Es wird kein Kompetitor-Primer verwendet. P1 .1 -Ext kann komplementär an C1 .1 binden und unter dessen Mitwirkung vom Matrizenstrang abgelöst werden.  16 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region. A specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the template strand (S1.1) under reaction conditions and initiate the synthesis of the P1.1 -ext. No competitor primer is used. P1 .1 -Ext can bind complementarily to C1 .1 and be released from the template strand with its participation.
Fig. 17 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante des Matrizenstranges (M 1 .1 ) binden und die Synthese des P1.1 -Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1.1-Ext. Es wird kein Kompetitor-Primer verwendet. Die Bindung an eine andere Sequenz-Variante (M 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der M 1 .2. Die Primer-Verlängerung wird somit unter stringenten Reaktionsbedinungen weniger effizient gestartet.  17 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region. A specific P1 .1 can preferentially bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1.1 -ext. During primer extension, P1.1-Ext. No competitor primer is used. The binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1 .2. The primer extension is thus started less efficiently under stringent reaction conditions.
Fig. 18 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im zweiten Bereich liegt (2). Der N2-Lokus umfasst auch das 3'- terminale Nukleotid des ersten Primers. Ein spezifischer P1.1 mit einem komplementären 3'- terminalen Nukleotid kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante des Matrizenstranges (M 1 .1 ) binden und die Synthese des P1 .1-Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1.1 -Ext. Es wird kein Kompetitor-Primer verwendet. Die Bindung an eine andere Sequenz-Variante (SN 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der M 1.2. Die Primer-Verlängerung wird somit unter stringenten Reaktionsbedingungen weniger effizient gestartet. Fig. 18 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the segment of the controller oligonucleotide corresponding to N2 lies in the second region (2). The N2 locus includes the 3 '- terminal nucleotide of the first primer. A specific P1.1 with a complementary 3 '- terminal nucleotide under the reaction conditions can preferably specifically bind to the complementary position of a specific sequence variant of the template strand (M 1 .1) bind and initiate synthesis of P1 .1-Ext. In the course of the primer extension it comes to the formation of P1.1 -Ext. No competitor primer is used. The binding to another sequence variant (SN 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1.2. The primer extension is thus started less efficiently under stringent reaction conditions.
Fig. 19 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im dritten Bereich liegt (3). Es werden zielsequenzspezifische aber nicht Sequenz-Varianten-spezifische erster Primer verwendet. Ein für alle Sequenz-Varianten einer Zielnukleinsäure einheitlicher P1 .1 , kann an den Matrizenstrang binden und die Synthese des P1 1 -Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1 .1 - Ext. Es wird kein Kompetitor-Primer verwendet. Die Trennung von Primer-Verlängerungsprodukten P1.1 -Ext vom Matrizenstrang erfolgt vorzugsweise spezifisch durch komplementäre Bindung des P1.1 -Ext an das Controller-Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz- Variante, welche unter Verwendung von (M 1.2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Controller-Oligonukleotides. Die Position des Sequenz-Segmentes (3), welches zu N2 der Zielsequenz korrespondiert, liegt in der Nähe der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Controller-Oligonukleotid und dem jeweiligen ersten Primer- Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit beeinflusst werden kann. Fig. 19 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the segment of the controller oligonucleotide corresponding to N2 lies in the third region (Fig. 3). Target sequence specific but not sequence variant specific first primers are used. One for all sequence variants of one Target nucleic acid unitary P1 .1, can bind to the template strand and initiate the synthesis of the P1 1 -ext. During primer extension, P1 .1-Ext is formed. No competitor primer is used. The separation of primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1.1 -Ext to the controller oligonucleotide. The separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide. The position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking unit, so that the interaction between the controller oligonucleotide and the respective first primer extension product are affected by modifications used in the second blocking unit can.
Fig. 20 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im dritten Bereich liegt (4). Es werden zielsequenzspezifische aber nicht Sequenz-Varianten spezifische erste Primer verwendet. Ein für alle Sequenz-Varianten einer Zielnukleinsäure einheitlicher P1.1 , kann an die Matrizenstränge binden und die Synthese des P1 1 -Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1 1- Ext. Es wird kein Kompetitor-Primer verwendet. Die Trennung von Primer-Verlängerungsprodukten P1.1 -Ext vom Matrizenstrang erfolgt vorzugsweise spezifisch durch komplementäre Bindung des P1.1 -Ext an das Controller-Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz- Variante, welche unter Verwendung von (M 1.2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Controller-Oligonukleotides. Die Position des Sequenz-Segmentes (4), welches zu N2 der Zielsequenz korrespondiert, liegt in einer Entfernung von der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Controller-Oligonukleotid und dem jeweiligen ersten Primer- Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit im Wesentlichen unbeeinflusst bleibt. Das Segment des Controller-Oligonukleotides, welches zu N2 korrespondiert besteht vorzugsweise aus DNA-Monomeren, wobei zwischen 4 bis 20 DNA Monomeren verwendet werden und mindestens 4 bis 10 DNA-Monomere um die Position-4 auf beiden Seiten lokalisiert sind.  Fig. 20 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments, in which the N2-corresponding segment of the controller oligonucleotide lies in the third region (4). Target sequence specific but not sequence variant specific first primers are used. A P1.1 unitary for all sequence variants of a target nucleic acid can bind to the template strands and initiate the synthesis of the P1 1 -text. In the course of primer extension, this results in the formation of P1 1- Ext. No competitor primer is used. The separation of primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1.1 -Ext to the controller oligonucleotide. The separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide. The position of the sequence segment (4) corresponding to N2 of the target sequence is at a distance from the second blocking moiety, so that the interaction between the controller oligonucleotide and the respective first primer extension product of modifications used in the second blocking moiety in FIG Essentially unaffected. The segment of the controller oligonucleotide corresponding to N2 is preferably made up of DNA monomers using between 4 to 20 DNA monomers and at least 4 to 10 DNA monomers located around position-4 on both sides.
Fig. 21 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplemenäre Position einer spezifischen Sequenz-Variante des Matrizenstranges (M 1 .1 ) binden und die Synthese des P1.1 -Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1 1-Ext. Die Bindung an eine andere Sequenz-Variante (M 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der M 1.2. Die Primer-Verlängerung wird somit unter stringenten Bedingungen weniger effizient gestartet. Das P5.1 bildet einen perfekt match mit M 1 .2 und kann von der Polymerase verlängert werden, unter Ausbildung eines Kompetitor-Primer- Verlängerungsproduktes P5.1-Ext. Fig. 21 zeigt Varianten von Kompetitor-Primer P5.1 für P1 .1 ohne Überhang zur Bindung an das Controller-Oligonukleotid, wobei das 3'- Ende von P5.1 innerhalb der zweiten Blockierungseinheit bindet. Fig. 21 shows schematically an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region. A specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1.1 -ext. In the course of primer extension, this leads to the formation of P1 1-Ext. The binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of M 1.2. The primer extension is thus started less efficiently under stringent conditions. The P5.1 forms a perfect match with M 1 .2 and can be extended by the polymerase to form a competitor primer extension product P5.1-Ext. Figure 21 shows variants of competitor primer P5.1 for P1 .1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.1 binding within the second blocking unit.
Zur weiteren Erhöhung der Spezifität wird ein Kompetitor-Primer-Oligonukleotid (P 5.1 ) in die Reaktion zugegeben, welches in der Lage ist, vorwiegend komplementär an die Sequenz- Varianten der Zielsequenz zu binden, und wessen Kopie-Erstellung mit anschließender Trennung vom Matrizenstrang unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor-Primer bevorzugt binden und von der Polymerase verlängert werden. Das dabei resultierende Produkt (hier P5.1 -Ext) blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion des ersten Primers.  To further increase the specificity, a competitor primer oligonucleotide (P 5.1) is added to the reaction which is capable of binding predominantly complementarily to the sequence variants of the target sequence and whose copy formation with subsequent separation from the template strand is suppressed must become. Due to a complementary binding with such primer binding sites, a competitor primer may preferentially bind and be extended by the polymerase. The resulting product (here P5.1 -Ext) blocks the single-stranded primer binding sites for an interaction of the first primer.
In bestimmten Ausführungsformen bindes das 3'-Ende eines Kompetitor-Primers innerhalb der zweiten Blockierungs-Einheit des Controller-Oligonukleotides, so dass keine Verlängerung dieses Primers am Controller-Oligonukleotid erfolgen kann. Der Kompetitor-Primer umfasst kein Sequenzsegment, welches mit dem ersten Bereich des Controller-Oligonukleotids interagieren kann. Dadurch wird verhindert, dass das Verlängerungsprodukt des Kompetitor-Oligonukleotides von der Matrize abgelöst wird. In certain embodiments, the 3 ' end of a competitor primer binds within the second blocking unit of the controller oligonucleotide so that extension of this primer on the controller oligonucleotide can not occur. The competitor primer does not include a sequence segment that can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
Fig.22 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im zweiten Bereich liegt (2). Der N2-Lokus umfasst auch das 3'- terminale Nukleotid des ersten Primers. Ein spezifischer P1 .1 , mit einem komplementären 3'- terminalen Nukleotid kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplemenäre Position einer spezifischen Sequenz-Variante des Matrizenstrangs (M 1 .1 ) binden und die Synthese des P1 1 -Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1 .1-Ext. Die Bindung an eine andere Sequenz-Variante (M 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1.2. Die Primer-Verlängerung wird somit unter stringenten Bedingungen weniger effizient gestartet.FIG. 22 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the second region (FIG. 2). The N2 locus includes the 3 '- terminal nucleotide of the first primer. A specific P1 .1 having a complementary 3 ' -terminal nucleotide can preferably bind specifically to the complementary position of a specific sequence variant of the template strand (M 1 .1) under reaction conditions and initiate the synthesis of the P1 1 -text. During primer extension, P1 .1-Ext. The binding to another sequence variant (M 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1.2. The primer extension is thus started less efficiently under stringent conditions.
Zur Erhöhung der Spezifität wird ein Kompetitor-Primer (P5.2) in die Reaktion zugegeben, welches in der Lage ist, vorwiegend komplementär an die Sequenz-Varianten der Zielsequenz zu binden, und wessen Primer-Verlängerung und anschließende Trennung vom Matrizenstrang unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor-Primer bevorzugt an bestimmte Sequenz-Varianten binden (hier mit N bezeichnet) und von der Polymerase verlängert werden. Das dabei resultierende Produkt (P5.2-Ext) blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion mit dem ersten Primer. To increase the specificity, a competitor primer (P5.2) is added to the reaction which is capable of binding predominantly complementarily to the sequence variants of the target sequence and whose primer extension and subsequent separation from the template strand must be suppressed , Due to a complementary binding with such primer binding sites, a competitor primer can preferably bind to particular sequence variants (designated here by N) and extended by the polymerase. The resulting product (P5.2-Ext) blocks the single-stranded primer binding sites for interaction with the first primer.
In bestimmten Ausführungsformen bindes das 3'-Ende eines Kompetitor-Primers innerhalb der zweiten Blockierungs-Einheit des Controller-Oligonukleotides, so dass keine Verlängerung dieses Primers am Controller-Oligonukleotid erfolgen kann. Der Kompetitor-Primer umfasst kein Sequenzsegment, mit welchem es mit dem ersten Bereich des Controller-Oligonukleotids interagieren kann. Damit wird verhindert, dass das Verlängerungsprodukt des Kompetitor- Oligonukleotides von der Matrize abgelöst wird. In certain embodiments, the 3 ' end of a competitor primer binds within the second blocking unit of the controller oligonucleotide so that extension of this primer on the controller oligonucleotide can not occur. The competitor primer does not include a sequence segment with which it can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
Fig. 22 zeigt Varianten von Kompetitor-Primer 5.2 für P1.1 ohne Überhang zur Bindung an das Controller-Oligonukleotid, wobei das 3'- Ende von P5.2 innerhalb der zweiten Blockierungseinheit bindet. Das 3'-terminale Segment von P5.2 bildet einen perfekt match mit M 1.2 und kann von der Polymerase verlängert werden. Figure 22 shows variants of competitor primer 5.2 for P1.1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.2 binding within the second blocking unit. The 3 ' -terminal segment of P5.2 forms a perfect match with M 1.2 and can be extended by the polymerase.
Fig.23 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Controller-Oligonukleotids im dritten Bereich liegt (3). Es werden zielsequenzspezifische aber nicht Sequenz-Varianten-spezifische erste Primer verwendet. Ein für alle Sequenz-Varianten einer Zielnukleinsäure einheitlicher P1 .1 kann an die Matrizenstränge binden und die Synthese des P1.1 - Ext initiieren. Im Verlauf der Primer-Verlängerung kommt es dabei zur Ausbildung von P1 .1-Ext. Die Trennung von synthetisierten Primer-Verlängerungsprodukten P1.1 -Ext vom Matrizenstrang erfolgt vorzugsweise spezifisch durch komplementäre Bindung des P1 .1-Ext an das Controller- Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz-Variante, welche unter Verwendung von (M 1.2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Controller-Oligonukleotides. Die Position des Sequenz-Segmentes (3), welches zu N2 der Zielsequenz korrespondiert, liegt in der Nähe der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Controller- Oligonukleotid und dem jeweiligen ersten Primer-Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit beeinflusst werden kann.  FIG. 23 schematically shows an embodiment with topography of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments in which the N2-corresponding segment of the controller oligonucleotide lies in the third region (FIG. 3). Target sequence specific but not sequence variant specific first primers are used. A P1 .1 unitary to all sequence variants of a target nucleic acid can bind to the template strands and initiate the synthesis of P1.1-Ext. During primer extension, P1 .1-Ext. The separation of synthesized primer extension products P1.1 -Ext from the template strand is preferably carried out specifically by complementary binding of P1 .1-Ext to the controller oligonucleotide. The separation of strands of another sequence variant synthesized using (M 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the controller oligonucleotide. The position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking unit, so that the interaction between the controller oligonucleotide and the respective first primer extension product are affected by modifications used in the second blocking unit can.
Zur Erhöhung der Spezifität wird ein Kompetitor-Primer (P5.3) in die Reaktion zugegeben, welcher in der Lage ist, vorwiegend komplementär an die Sequenz-Varianten der Zielsequenz zu binden (N), und wessen Kopie-Erstellung und anschließende Strang-Trennung unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor- Primer bevorzugt an bestimmte Sequenz-Varianten binden (hier mit N bezeichnet) und von der Polymerase verlängert werden. Das dabei resultierende Produkt blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion mit dem ersten Primer.  To increase the specificity, a competitor primer (P5.3) is added to the reaction which is able to bind predominantly complementarily to the sequence variants of the target sequence (N) and whose copy generation and subsequent strand separation must be suppressed. Due to a complementary binding with such primer binding sites, a competitor primer may preferentially bind to certain sequence variants (designated here by N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction with the first primer.
In bestimmten Ausführungsformen ist das Kompetitor-Primer-Oligonukleotid (P5.3) länger als das erste Primer-Oligonukleotid, so dass sein 3'-Ende innerhalb der vierten Blockierungs-Einheit des Controller-Oligonukleotides binden kann (die vierte Blockierungseinheit ist analog zur zweiten Blockierungseinheit zusammengesetzt und blockiert eine Primer-Verlängerung am Controller- Oligonukleotid), so dass keine Verlängerung dieses Primers am Controller-Oligonukleotid erfolgen kann. Der Kompetitor-Primer umfasst kein Sequenz-Segment welches mit dem ersten Bereich des Controller-Oligonukleotids interagieren kann. Dadurch wird verhindert, dass das Verlängerungsprodukt des Kompetitor-Oligonukleotides von der Matrize abgelöst wird. In certain embodiments, the competitor primer oligonucleotide (P5.3) is longer than the first primer oligonucleotide such that its 3 ' end is within the fourth blocking moiety of the Controller oligonucleotide can bind (the fourth blocking unit is assembled analogously to the second blocking unit and blocks a primer extension on the controller oligonucleotide), so that no extension of this primer can be done on the controller oligonucleotide. The competitor primer does not include a sequence segment which can interact with the first region of the controller oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
Fig. 23 zeigt Varianten von Kompetitor-Primer 5.3 für P1.1 ohne Überhang zur Bindung an das Controller-Oligonukleotid, wobei das 3'- Ende von P5.3 innerhalb der vierten Blockierungseinheit bindet. Das 3'-terminale Segment von P5.3 bildet einen perfekt match mit M 1.2 und kann von der Polymerase verlängert werden. Figure 23 shows variants of competitor primer 5.3 for P1.1 with no overhang for binding to the controller oligonucleotide, with the 3 ' end of P5.3 binding within the fourth blocking unit. The 3 ' -terminal segment of P5.3 forms a perfect match with M 1.2 and can be extended by the polymerase.
Fig. 24 zeigt schematisch eine selektive Primer-Verlängerungsreaktion von mehreren Sequenz- Varianten bei Verwendung von mehreren selektiven Controller-Oligonukleotiden (C1.1 und C1.2). Figure 24 shows schematically a selective primer extension reaction of several sequence variants using multiple selective controller oligonucleotides (C1.1 and C1.2).
Figur 25 - 29 zeigen schematisch die Struktur des ersten Primer-Oligonukleotids und des Controller-Oligonukleotides, sowie die Interaktion zwischen dem ersten Primer-Oligonukleotid und der Matrize, sowie die Synthese des ersten Primer-Verlängerungsprodukts. Figures 25-29 show schematically the structure of the first primer oligonucleotide and the controller oligonucleotide, as well as the interaction between the first primer oligonucleotide and the template, as well as the synthesis of the first primer extension product.
Figur 30 zeigt schematisch die Interaktion zwischen Strukturen während der Primer-Verlängung des ersten Primer-Oligonukleotids.  Figure 30 shows schematically the interaction between structures during primer extension of the first primer oligonucleotide.
Fig. 31 zeigt Ergebnisse aus Beispiel 1  Fig. 31 shows results of Example 1
Fig. 32 zeigt Ergebnisse aus Beispiel 2  Fig. 32 shows results of Example 2
Fig. 33 zeigt schematisch einige Ausführungsformen von Strukturen einer Start-Nukleinsäurekette und ihre Verwendung als Matrize zu Beginn der Reaktion. Unter Verwendung von P1.1 , ohne Block-Oligonukleotid.  Fig. 33 shows schematically some embodiments of structures of a starting nucleic acid chain and their use as template at the beginning of the reaction. Using P1.1, without block oligonucleotide.
Fig. 34 zeigt schematisch einige Ausführungsformen von Strukturen einer Start-Nukleinsäurekette und ihre Verwendung als Matrize zu Beginn der Reaktion. Unter Verwendung von P1.1 , mit Block- Oligonukleotid.  Fig. 34 shows schematically some embodiments of structures of a starting nucleic acid chain and their use as a template at the beginning of the reaction. Using P1.1, with block oligonucleotide.
Figur 35 zeigt schematisch das Zusammenwirken der Strukturen während der Nukleinsäureamplifikation durch einerseits die Amplifikation vom ersten Primer-Oligonukleotid und vom zweiten Primer-Oligonukleotid und weiterhin die Einwirkung des Controller-Oligonukleotids und die dabei resultierende Strangverdrängung.  FIG. 35 shows schematically the interaction of the structures during the nucleic acid amplification by, on the one hand, the amplification of the first primer oligonucleotide and of the second primer oligonucleotide and furthermore the action of the controller oligonucleotide and the resulting strand displacement.
Fig. 36 - 38 zeigen Ergebnisse aus Beispiel 4  FIGS. 36-38 show results from Example 4
Fig. 39 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Primer- Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, ergänzend zu anderen Abbildungen wird hier folgende Nomenklatur von Reaktions-Komponenten und von Sequenzsegmenten verwendet: a) eine Probe, die ein Nukleinsäurepolymer umfassend die Zielsequenz M umfasst, wobei die Zielsequenz in 5‘-3‘-Orientierung die Sequenzabschnitte MS und MP umfasst und MP unmittelbar in 3‘ von MS angeordnet ist, mit folgenden Fig. 39 shows schematically an embodiment with topography of a specific primer extension system and a template strand with a polymorphic locus (N2) in certain embodiments, in addition to other illustrations the following nomenclature of reaction components and sequence segments is used: a) a sample comprising a nucleic acid polymer comprising the target sequence M, wherein the target sequence in 5'-3 'orientation comprises the sequence sections MS and MP and MP is located directly in 3' of MS, with the following
Komponenten in Kontakt gebracht wird:  Components is brought into contact:
b) ein Oligonukleotidprimer P, welcher in 5‘-3‘-Orientierung die Sequenzabschnitte PC und PM umfasst und PM unmittelbar in 3‘ von PC angeordnet ist, wobei PM die zum Sequenzabschnitt MP komplementäre [die hybridisierende] Sequenz aufweist [im Wesentlichen sequenzspezifisch binden kann] und PC nicht an M [oder eine in 3‘ unmittelbar an MP anschließende Sequenz] binden kann;  b) an oligonucleotide primer P which comprises the sequence sections PC and PM in the 5'-3 'orientation and PM is arranged directly in 3' of PC, wherein PM has the sequence [MPa] complementary to the sequence section MP [that binds] in a substantially sequence-specific manner can] and PC can not bind to M [or a sequence immediately adjacent to MP in 3 '];
c) ein Controller-Oligonukleotid C, welches in 5‘-3‘-Orientierung die  c) a controller oligonucleotide C which in 5'-3 'orientation the
Sequenzabschnitte CS, CP und CC umfasst, wobei CP unmittelbar in 3‘-Richtung von CS und unmittelbar in 5‘-Richtung von CC angeordnet ist, und wobei CS zumindest zum 3'-Segment von MS (unmittelbar in 5‘-Richtung von MP liegenden) identisch ist und CP und CC die zum Sequenzabschnitt PM und PC Sequence sections CS, CP and CC, where CP is located immediately in the 3 'direction of CS and immediately in the 5' direction of CC, and where CS is at least to the 3 ' segment of MS (immediately in the 5' direction of MP lying) and CP and CC to the sequence section PM and PC
komplementäre [die hybridisierende] Sequenz aufweist und wobei CS modifizierte Nukleotidbausteine umfasst, so dass CS nicht als Matrize für die Aktivität der matrizenabhängigen Nukleinsäurepolymerase dienen kann;  complementary [hybridizing] sequence and wherein CS comprises modified nucleotide building blocks such that CS can not serve as a template for the activity of the template-dependent nucleic acid polymerase;
d) eine matrizenabhängige Nukleinsäurepolymerase, insbesondere eine DNA- Polymerase sowie Substrate der DNA-Polymerase (insbesondere Ribonukleosid- triphosphate oder Desoxyribonukleosid-triphosphate) und geeignete Kofaktoren, wobei ein Primer-Verlängerungsprodukt P‘ erhalten wird, welches neben den  d) a template-dependent nucleic acid polymerase, in particular a DNA polymerase, as well as substrates of the DNA polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors, a primer extension product P 'being obtained which, besides the
Sequenzbereichen PC und PM einen synthetisierten Bereich PS umfasst, der im Wesentlichen komplementär zur Zielsequenz MS ist,  Sequence areas PC and PM comprises a synthesized area PS, which is substantially complementary to the target sequence MS,
und wobei  and where
entweder die Reaktionsbedingungen so gewählt sind, und/oder  either the reaction conditions are chosen, and / or
die Längen und die Schmelztemperatur von PC und ggf. MS so gewählt sind, dass P‘ mit M einen Doppelstrang bilden kann und P‘ mit C einen Doppelstrang bilden kann und die Bildung des Doppelstranges aus P‘ und C gegenüber der Bildung des Doppelstrangs aus P‘ mit M bevorzugt ist.  the lengths and the melting temperature of PC and possibly MS are selected so that P 'can form a double strand with M and P' can form a double strand with C and the formation of the double strand from P 'and C opposite the formation of the double strand from P 'is preferred with M.
Das Verfahren gemäß bestimmten Ausführungsformen, wobei der Sequenzabschnitt CS an seinem 3‘ Ende unmittelbar in 5‘-Richtung des Sequenzabschnitts CP einen  The method according to certain embodiments, wherein the sequence section CS at its 3 'end immediately in the 5' direction of the sequence section CP a
Sequenzabschnitt CS‘ von 5 bis 15 Nukleotidpositionen Länge enthält, welcher aus Nukleinsäureanaloga, insbesondere aus 2’0-Alkyl-Ribonucleotiden, besteht. Sequence section CS 'of 5 to 15 nucleotide positions contains length, which consists of nucleic acid analogs, in particular of 2'0-alkyl ribonucleotides.
Das Verfahren gemäß einem der vorstehenden Ausführungsformen, wobei M einen Sequenzabschnitt MB unmittelbar in 5‘ von MS umfasst, und wobei weiterhin ein Block- Oligonukleotid B, das an MB hybridisieren kann, mit der Probe in Kontakt gebracht wird, und wobei a. B Nukleosidanaloga umfasst, die so ausgewählt sind, dass ein Hybrid von B mit MB die Reaktion der matrizenabhängigen Nukleinsäurepolymerase auf MB nicht erlaubt oder The method according to any one of the preceding embodiments, wherein M comprises a sequence portion MB immediately in 5 'of MS, and further wherein a block oligonucleotide B capable of hybridizing to MB is contacted with the sample, and wherein a. B comprises nucleoside analogs selected such that a B hybrid to MB does not permit the MB-dependent nucleic acid polymerase reaction on MB or
b. die matrizenabhängige Nukleinsäurepolymerase so ausgewählt ist, dass ein  b. the template-dependent nucleic acid polymerase is selected such that a
Hybrid von B mit MB [auch wenn B aus natürlichen Nukleosiden oder  Hybrid of B with MB [even if B from natural nucleosides or
Deoxynukleosiden besteht] die Reaktion der matrizenabhängigen Nukleinsäurepolymerase auf MB nicht erlaubt.  Deoxynucleosides], the reaction of the template-dependent nucleic acid polymerase on MB is not allowed.
Die in dieser Ausführungsform verwendeten Begriffe illustrieren bestimmte Varianten der in der Anmeldung beschriebenen Strukturen.  The terms used in this embodiment illustrate certain variants of the structures described in the application.
Ein Nukleinsäurepolymer (eine Ausführungsform der Matrize) umfasst die Zielsequenz M, welche in 5‘-3‘-Orientierung die Sequenzabschnitte MS und MP und MP umfasst und unmittelbar in 3‘ von MS angeordnet ist. In einer Ausführungsform umfasst die Zielsequenz ein polymorphen Lokus (N2).  A nucleic acid polymer (one embodiment of the template) comprises the target sequence M, which comprises the sequence segments MS and MP and MP in the 5'-3 'orientation and is located directly in 3' of MS. In one embodiment, the target sequence comprises a polymorphic locus (N2).
Ein Oligonukleotidprimer P (entspricht einem ersten Primer-Oligonukleotid) umfasst in 5‘-3‘- Orientierung die Sequenzabschnitte PC (entspricht einem zweiten Bereich des ersten Primer- Oligonukleotides) und PM (entspricht einem ersten Bereich des ersten Primer-Oligonukleotides). An oligonucleotide primer P (corresponding to a first primer oligonucleotide) comprises, in 5'-3 'orientation, the sequence segments PC (corresponding to a second region of the first primer oligonucleotide) and PM (corresponding to a first region of the first primer oligonucleotide).
Ein Controller-Oligonukleotid C umfasst in 5‘-3‘-Orientierung die Sequenzabschnitte CS (entspricht einem dritten Bereich des Controller-Oligonukleotides), CP (entspricht einem zweiten Bereich des Controller-Oligonukleotides) und CC (entspricht einem ersten Bereich des Controller- Oligonukleotides) A controller oligonucleotide C comprises, in 5'-3 'orientation, the sequence sections CS (corresponding to a third region of the controller oligonucleotide), CP (corresponding to a second region of the controller oligonucleotide) and CC (corresponding to a first region of the controller oligonucleotide )
Ein Primer-Verlängerungsprodukt P‘ (entspricht einem ersten Primer-Verlängerungsprodukt) wird durch matrizenabhängige Verlängerung des ersten Primer-Oligonukleotides erhalten. Das Primer- Verlängerungsprodukt umfasst neben den Sequenzbereichen PC und PM einen synthetisierten Bereich PS, der im Wesentlichen komplementär zur Zielsequenz MS ist  A primer extension product P '(corresponding to a first primer extension product) is obtained by template-dependent extension of the first primer oligonucleotide. In addition to the sequence regions PC and PM, the primer extension product comprises a synthesized region PS which is essentially complementary to the target sequence MS
Eine Variante VM der Zielsequenz M ist in mindestens einer Position VMM von der Sequenz M verschieden. Diese Position weist insbesondere eine oder mehrere Substitution(en), Insertion(en) und/oder Deletion(en) auf. Diese Position VMM ist in dieser Ausführungsform eine Sequenzvariante des polymorphen Lokus (N2) der Zielsequenz. In einer Ausführungsform liegt VMM am 5’-Ende von VMP. mit anderen Worten, dass das 3’-Ende von VPM mit VMM hybridisiert. A variant VM of the target sequence M is different from the sequence M in at least one position VMM. In particular, this position has one or more substitution (s), insertion (s) and / or deletion (s). This position VMM in this embodiment is a sequence variant of the polymorphic locus (N2) of the target sequence. In one embodiment, VMM is at the 5 'end of VMP. in other words, the 3 'end of VPM hybridizes with VMM.
Ein zweites Controller-Oligonukleotid VC umfasst in 5‘-3‘-Orientierung die Sequenzabschnitte VCS (entspricht einem dritten Bereich des Controller-Oligonukleotides), VCP (entspricht einem zweiten Bereich des Controller-Oligonukleotides) und VCC (entspricht einem ersten Bereich des Controller- Oligonukleotides). A second controller oligonucleotide VC comprises in the 5'-3 'orientation the sequence sections VCS (corresponding to a third area of the controller oligonucleotide), VCP (corresponding to a second area of the controller oligonucleotide) and VCC (corresponding to a first area of the controller). oligonucleotide).
Ein zweiter Oligonukleotidprimer VP (entspricht einer Variante eines ersten Primer- Oligonukleotides) umfasst in 5‘-3‘-Orientierung die Sequenzabschnitte VPC (entspricht einem zweiten Bereich des ersten Primer-Oligonukleotides) und VPM (entspricht einem ersten Bereich des ersten Primer-Oligonukleotides) und VPM unmittelbar in 3‘ von VPC angeordnet ist, wobei VPM die zum Sequenzabschnitt VMP der Zielsequenz VM komplementäre [die hybridisierende] Sequenz aufweist [im Wesentlichen sequenzspezifisch binden kann] und VPC nicht an VM [oder eine in 3‘ unmittelbar an VMP anschließende Sequenz] binden kann. In einer Ausführungsform liegt VMM (polymorpher Lokus N2) der Zielsequenz am 5’-Ende von VMP und das 3’-Ende von VPM (des ersten Primer-Oligonukleotides) kann mit VMM spezifisch hybridisiert. A second oligonucleotide primer VP (corresponding to a variant of a first primer oligonucleotide) comprises, in the 5'-3 'orientation, the sequence segments VPC (corresponding to a second region of the first primer oligonucleotide) and VPM (corresponds to a first region the first primer oligonucleotide) and VPM is located immediately in 3 'of VPC, where VPM has [the hybridizing] sequence complementary to the sequence portion VMP of the target sequence VM and can not bind VPC to VM [or one in 3 'immediately following VMP sequence] can bind. In one embodiment, VMM (polymorphic locus N2) of the target sequence resides at the 5 'end of VMP and the 3' end of VPM (of the first primer oligonucleotide) can be specifically hybridized with VMM.
Ein Kompetitor-Oligonukleotid KP kann mit der Zielsequenz hybridisieren. In einer Ausführungsform kann KP mit VMP der Zielsequenz hybridisiert.  A competitor oligonucleotide KP can hybridize to the target sequence. In one embodiment, KP can hybridize with VMP of the target sequence.
Ein Block-Oligonukleotid B kann in einer Ausführungsform an einen unmittelbar in 5‘-Richtung von MS gelegenen Sequenzabschnitt der Zielsequenz MB hybridisieren, wobei B Nukleosidanaloga umfasst, die so ausgewählt sind, dass ein Hybrid (Komplex) von B mit MB die Reaktion einer matrizenabhängigen Nukleinsäurepolymerase auf MB nicht erlaubt.  In one embodiment, a block oligonucleotide B can hybridize to a sequence portion of the target sequence MB immediately adjacent to the 5 'direction of MS, where B comprises nucleoside analogs selected such that a hybrid (complex) of B with MB is the response of a template-dependent one Nucleic acid polymerase not allowed on MB.
Fig. 40 - 58 zeigt schematisch bestimme Ausführungformen für Verwendung eines Primer- Verlängerungsproduktes als eine Start-Nukleinsäurekette für ein Amplifikationsverfahren.  Figures 40-58 schematically show certain embodiments for using a primer extension product as a starting nucleic acid chain for an amplification method.
Fig. 52 zeigt Varianten von Kompetitor-Primer P 5.1 für P1 .1 :  52 shows variants of competitor primer P 5.1 for P1 .1:
• P5.1 umfasst keinen Überhang zur Bindung an das Aktivator-Oligonukleotid.  • P5.1 does not contain an overhang for binding to the activator oligonucleotide.
• 3'- Ende von P5.1 bindet innerhalb der zweiten Blockierungseinheit • 3 ' - end of P5.1 binds within the second blocking unit
• P5.1 bildet einen perfekt match mit SN 1.2 und kann von der Polymerase verlängert werden • P5.1 forms a perfect match with SN 1.2 and can be extended by the polymerase
• P5.1 hat die gleiche Länge, wie der erste Bereich von P1 .1 • P5.1 has the same length as the first range of P1 .1
Fig. 53 zeigt Varianten von Kompetitor-Primer P 5.2 für P1 .1 :  FIG. 53 shows variants of competitor primer P 5.2 for P1 .1:
• P5.2 umfasst keinen Überhang zur Bindung an das Aktivator-Oligonukleotid.  • P5.2 does not contain an overhang for binding to the activator oligonucleotide.
• 3'- Ende von P5.2 bindet innerhalb der zweiten Blockierungseinheit • 3 ' - End of P5.2 binds within the second blocking unit
• 3'-Terminales Segment von P5.2 umfasst mindestens einen Mismatch zu SN 1 .1• 3 ' terminal segment of P5.2 includes at least one mismatch to SN 1 .1
• 3'-Terminales Segment von P1.1 umfasst mindestens einen Mismatch zu SN 1 .2• 3 ' terminal segment of P1.1 includes at least one mismatch to SN 1 .2
• P5.2 bildet einen perfekt match mit SN 1.2 und kann von der Polymerase verlängert werden• P5.2 forms a perfect match with SN 1.2 and can be extended by the polymerase
• P5.2 hat ein längeres Bindungs-Segment an SN 1 .2 als der erste Bereich von P1.1• P5.2 has a longer binding segment at SN 1 .2 than the first region of P1.1
Fig. 54 zeigt Varianten von Kompetitor-Primer P 5.3 oder P5.4 für P1 .1 : FIG. 54 shows variants of competitor primer P 5.3 or P5.4 for P1 .1:
• P5.3 umfasst keinen Überhang zur Bindung an das Aktivator-Oligonukleotid.  • P5.3 does not contain an overhang for binding to the activator oligonucleotide.
• 3'- Ende von P5.3 oder P5.4 bindet innerhalb der vierten Blockierungseinheit • 3 ' - End of P5.3 or P5.4 binds within the fourth blocking unit
• P5.3 bildet einen perfekt match mit SN 1.2 und kann von der Polymerase verlängert werden • P5.3 forms a perfect match with SN 1.2 and can be extended by the polymerase
• P5.3 hat ein längeres Segment zur Bindung an SN 1.2, als der erste Bereich von P1 .1• P5.3 has a longer segment to bind to SN 1.2 than the first range of P1 .1
• P5.3 blockiert das zu P1 .1 komplementäre Segment in SN 1 .2 • P5.3 blocks the segment complementary to P1 .1 in SN 1 .2
Fig. 59 - 60 zeigt schematisch bestimmte Ausführungsformen mit Topographie eines spezifischen Primer-Verlängerungs-Systems und eines Matrizenstrangs mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, ergänzend zu anderen Abbildungen wird hier folgende Nomenklatur von Reaktions-Komponenten und von Sequenzsegmenten verwendet (siehe Nomenklatur Fig. 39). Figures 59-60 schematically show certain topographical embodiments of a specific primer extension system and a polymorphic locus (N2) template strand in certain embodiments, in addition to other illustrations, the following are Nomenclature of reaction components and sequence segments used (see nomenclature Fig. 39).
Für Fig. 58: P3.1-Ext-Teil 1 = Verlängerungsprodukt des P3.1 synthetisiert am P2.1 -Ext als Matrize. P4.1 -Ext-Teil 1 = Verlängerungsprodukt des P4.1 synthetisiert am P1.1 -Ext als Matrize. P3.1-Ext = Verlängerungsprodukt des P3.1 synthetisiert unter Verwendung von P4.1 -Ext-Teil 1 oder am P4.1 -Ext als Matrize. P4.1 -Ext = Verlängerungsprodukt des P4.1 synthetisiert unter Verwendung von P3.1-Ext-Teil 1 oder am P3.1 -Ext als Matrize.  For Figure 58: P3.1-Ext part 1 = extension product of P3.1 synthesized on P2.1 -EX as template. P4.1 Ext Part 1 = Extension product of P4.1 synthesized on P1.1 -xt as template. P3.1-Ext = extension product of P3.1 synthesized using P4.1 -Ext part 1 or at the P4.1 -Ext as template. P4.1 -Ext = extension product of P4.1 synthesized using P3.1 Ext part 1 or at the P3.1 text as template.
Beispiele:  Examples:
Material und Methoden:  Material and methods:
Reagenzien wurden von folgenden kommerziellen Anbietern bezogen:  Reagents were purchased from the following commercial suppliers:
nicht modifizierte und modifizierte Oligonukleotide (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences) ; Polymerasen NEB (New England Biolabs) ; dNTP's: Jena Bioscience; interkallierender EvaGreen Farbstoff: Jena Bioscience; Puffer- Substanzen und andere Chemikalien: Sigma-Aldrich; Plastikware: Sarstedt unmodified and modified oligonucleotides (Eurofins MWG, Eurogentec, Biomers, Trilink Technologies, IBA Solutions for Life Sciences); Polymerases NEB (New England Biolabs); dNTP 's : Jena Bioscience; intercalating EvaGreen dye: Jena Bioscience; Buffer substances and other chemicals: Sigma-Aldrich; Plastic goods: Sarstedt
Lösung 1 (Amplifikationsreaktion Lösung 1 ):  Solution 1 (amplification reaction solution 1):
Kaliumglutamat, 50 mmol/l, pH 8,0; Magnesiumacetat, 10 mmol/l ; dNTP (dATP, dCTP, dTTP, dGTP), je 200 pmol/l; Polymerase (Bst 2.0 Warmstart, 120.000 U/ml NEB), 12 Units / 10 pl; Potassium glutamate, 50 mmol / l, pH 8.0; Magnesium acetate, 10 mmol / l; dNTP (dATP, dCTP, dTTP, dGTP), 200 pmol / l each; Polymerase (Bst 2.0 warm start, 120,000 U / ml NEB), 12 units / 10 pl;
Triton X-100, 0,1 % (v/v) ; EDTA, 0,1 mmol/l; TPAC (Tetrapropylammonium Chloride), 50 mmol/l, pH 8,0; EvaGreen Farbstoff (Farbstoff wurde entsprechend Anleitung des Herstellers in Triton X-100, 0.1% (v / v); EDTA, 0.1 mmol / l; TPAC (tetrapropylammonium chloride), 50 mmol / l, pH 8.0; EvaGreen dye (dye was according to manufacturer's instructions in
Verdünnung 1 :50 eingesetzt). Dilution 1: 50 used).
Lösung 2 (Amplifikationsreaktion Lösung 2):  Solution 2 (amplification reaction solution 2):
1x Isothermal Puffer (New England Biolabs); in einfacher Konzentration enthält der Puffer: 20 mM Tris-HCI; 10 mM (NH4)2S04 ; 50 mM KCl; 2 mM MgS04; 0.1 % Tween® 20;pH 8.8@25°C) ; dNTP (dATP, dCTP, dUTP, dGTP), je 200 pmol/l; 1x isothermal buffer (New England Biolabs); in simple concentration, the buffer contains: 20 mM Tris-HCl; 10mM (NH 4 ) 2 S0 4 ; 50 mM KCl; 2mM MgSO 4 ; 0.1% Tween® 20; pH 8.8@25 ° C); dNTP (dATP, dCTP, dUTP, dGTP), 200 pmol / l each;
EvaGreen Farbstoff (Farbstoff wurde entsprechend Anleitung des Herstellers in Verdünnung 1 :50 eingesetzt)  EvaGreen dye (dye was used according to manufacturer's instructions in 1:50 dilution)
Alle Konzentrationen sind Angaben der Endkonzentrationen in der Reaktion. Abweichungen von der Standard-Reaktion werden entsprechend angegeben.  All concentrations are indications of the final concentrations in the reaction. Deviations from the standard reaction are indicated accordingly.
Die Schmelztemperatur (Tm) von beteiligten Komponenten wurde bei Konzentration von 1 pmol/l von jeweiligen Komponenten in Lösung 1 oder 2 bestimmt. Abweichende Parameter sind jeweils angegeben.  The melting temperature (Tm) of the components involved was determined at concentration of 1 pmol / l of respective components in solution 1 or 2. Different parameters are indicated in each case.
Allgemeine Informationen zu Reaktionen  General information about reactions
Primer-Verlängerungsreaktionen und Amplifikation wurden standardmäßig bei zwei Reaktionstemperaturen von 55°C und / oder 65°C durchgeführt. Abweichungen sind angegeben. Der Reaktionsstart erfolgte durch Erhitzen der Reaktionslösungen auf Reaktionstemperatur, da Bst 2.0 Polymerase Warmstart bei niedrigeren Temperauren größtenteils in ihrer Funktion durch ein Temperatur-sensitives Oligonukleotid gehemmt ist (ein„Aptamer“ laut Hersteller-Angaben). Die Polymerase wird zunehmend aktiver ab einer Temperatur von ca. 45°C, bei einer Temperatur von 65°C konnten keine Unterschiede zwischen Polymerase Bst 2.0 und Bst 2.0 Warmstart festgestellt werden. Um der extensiven Bildung von Nebenprodukten (z.B. Primer-Dimeren) während der Vorbereitungsphase einer Reaktion vorzubeugen, wurde Polymerase Bst 2.0 Warmstart verwendet. Abweichungen davon werden speziell angegeben. Primer extension reactions and amplification were performed by default at two reaction temperatures of 55 ° C and / or 65 ° C. Deviations are indicated. The start of the reaction was carried out by heating the reaction solutions to reaction temperature, since Bst 2.0 polymerase warm start at lower temperatures is largely inhibited in their function by a temperature-sensitive oligonucleotide (an "aptamer" according to the manufacturer). The polymerase becomes increasingly more active from a temperature of about 45 ° C, at a temperature of 65 ° C, no differences between Polymerase Bst 2.0 and Bst 2.0 warm start were found. To prevent the extensive formation of byproducts (eg, primer dimers) during the preparation phase of a reaction, Polymerase Bst 2.0 Warmstart was used. Deviations are specified.
Der Reaktionsstopp erfolgte durch Erhitzen der Reaktionslösung auf über 80°C, z.B. 10 min bei 95°C. Bei dieser Temperatur wird die Polymerase Bst 2.0 irreversibel denaturiert und das Ergebnis der Synthese-Reaktion kann nachträglich nicht geändert werden.  The reaction was stopped by heating the reaction solution to above 80 ° C, e.g. 10 min at 95 ° C. At this temperature, the polymerase Bst 2.0 is irreversibly denatured and the result of the synthesis reaction can not be subsequently changed.
Reaktionen wurden in einem Thermostat mit einer Fluoreszenz-Messvorrichtung ausgeführt. Zu diesem Zweck wurde ein kommerzielles Real-Time PCR Gerät verwendet, StepOne Plus (Applied Biosystems, Thermofischer). Das Reaktionsvolumen betrug standardmäßig 10 pl. Abweichungen davon werden angegeben.  Reactions were carried out in a thermostat with a fluorescence measuring device. For this purpose, a commercial real-time PCR device was used, StepOne Plus (Applied Biosystems, Thermofischer). The reaction volume was 10 pl by default. Deviations are indicated.
Sowohl Endpunkt-Bestimmung als auch kinetische Beobachtungen wurden vorgenommen. Bei Endpunktbestimmungen wurde das Signal beispielsweise von an Nukleinsäuren gebundenen Farbstoffen registriert, z.B. von TMR (Tetramethyl-Rhodamine, auch TAMRA genannt) oder von FAM (Fluorescein). Die Wellenlängen zur Anregung und Messung der Fluoreszenzsignale von FAM und TMR sind als Werkeinstellungen bei StepOne Plus Real-Time PCR Gerät gespeichert. Ebenfalls wurde ein interkallierender Farbstoff (EvaGreen) bei Endpunktmessungen vorgenommen, z.B. bei Messung einer Schmelzkurve). EvaGreen ist ein interkallierender Farbstoff und ist ein Analogon des häufig eingesetzten Farbstoff Sybrgreen, allerdings mit etwas geringerer Inhibierung von Polymerasen. Die Wellenlängen zur Anregung und Messung der Fluoreszenzsignale von SybrGreen und EvaGreen sind identisch und sind als Werkeinstellungen bei StepOne Plus Real-Time PCR Gerät gespeichert. Die Fluoreszenz kann mittels eingebauter Detektoren fortlaufend, d.h. "online" oder "Real-Time" detektiert werden. Da die Polymerase während ihrer Synthese einen Doppelstrang synthetisiert, konnte diese Technik zu kinetischen Messungen (Real-Time Monitoring) der Reaktion verwendet werden. Aufgrund von einem gewissen Cross-Talk zwischen Farb-Kanälen bei StepOne Plus Gerät wurde teilweise erhöhte basale Signal-Intensität bei Messungen beobachtet, bei welchen z.B. TMR-markierte Primer in Konzentration von über 1 pmol/l (z.B. 10 pmol/l) eingesetzt waren. Es wurde beobachtet, dass das TMR-Signal im SybrGreen-Kanal zu erhöhten Grundwerten führt. Diese erhöhten Grundwerte wurden bei Berechnungen berücksichtigt.  Both endpoint determination and kinetic observations were made. For example, in endpoint determinations, the signal was registered by nucleic acids bound to nucleic acids, e.g. TMR (tetramethyl-rhodamine, also called TAMRA) or FAM (fluorescein). The wavelengths for excitation and measurement of the fluorescence signals of FAM and TMR are stored as factory settings in the StepOne Plus Real-Time PCR device. Also, an intercalating dye (EvaGreen) was used in end point measurements, e.g. when measuring a melting curve). EvaGreen is an intercalating dye and is an analog of the commonly used dye Sybrgreen, but with slightly less inhibition of polymerases. The wavelengths for excitation and measurement of the fluorescence signals of SybrGreen and EvaGreen are identical and are stored as factory settings in the StepOne Plus Real-Time PCR device. Fluorescence can be monitored continuously by means of built-in detectors, i. "online" or "real-time" are detected. Since the polymerase synthesizes a double strand during its synthesis, this technique could be used for kinetic measurements (real-time monitoring) of the reaction. Due to some cross-talk between color channels in the StepOne Plus device, partially increased basal signal intensity was observed in measurements where e.g. TMR-labeled primers in concentrations greater than 1 pmol / L (e.g., 10 pmol / L) were used. It has been observed that the TMR signal in the SybrGreen channel leads to increased baselines. These increased baseline values were taken into account in calculations.
Die kinetischen Beobachtungen von Reaktionsverläufen wurden routinemäßig mittels Fluoreszenzsignalen von Fluoreszein (FAM-TAMRA Fret-Paar) bzw. interkallierenden Farbstoffen (EvaGreen) aufgenommen. Zeitabhängigkeit des Signal-Verlaufs wurde registriert (Real-Time Signal Erfassung bei StepOne plus PCR Gerät). Ein Anstieg des Signals während einer Reaktion verglichen mit einer Kontroll-Reaktion wurde je nach Aufbau des Ansatzes interpretiert. Beispielsweise, eine Zunahme des Signals bei Verwendung von Evagreen-Farbstoff wurde als Hinweis auf Zunahme der Menge an doppelsträngigen Nukleinsäureketten während der Reaktion interpretiert, und somit als Ergebnis einer stattfindenden Synthese durch die DNA-Polymerase gewertet. The kinetic observations of response curves were routinely recorded by fluorescence signals from fluorescein (FAM-TAMRA Fret pair) and intercalating dyes (EvaGreen), respectively. Time-dependence of the signal course was registered (real-time signal acquisition with StepOne plus PCR device). An increase in the signal during a reaction compared with a control reaction was interpreted according to the structure of the approach. For example, an increase in the signal using Evagreen dye was interpreted as an indication of an increase in the amount of double-stranded nucleic acid chains during the reaction, and thus as a result of ongoing DNA polymerase synthesis.
Bei einigen Reaktionen wurde in der Regel im Anschluss an die Reaktion eine Schmelzkurvenbestimmung durchgeführt. Solche Messungen erlauben Rückschlüsse auf das Vorliegen von Doppelsträngen, welche beispielsweise interkallierende Farbstoffe aufnehmen können und dadurch die Signalintensität von Farbstoffen deutlich verstärken. Mit der steigenden Temperatur sinkt der Anteil von Doppelsträngen und die Signal-Intensität sinkt ebenfalls. Das Signal ist von der Länge von Nukleinsäureketten und von der Sequenzzusammensetzung abhängig. Diese Technik ist einem Fachmann hinreichend bekannt.  In some reactions, a melting curve determination was usually performed following the reaction. Such measurements allow conclusions about the presence of double strands, which can absorb, for example, intercalating dyes and thereby significantly enhance the signal intensity of dyes. As the temperature increases, the proportion of double strands decreases and the signal intensity also decreases. The signal is dependent on the length of nucleic acid chains and on the sequence composition. This technique is well known to a person skilled in the art.
Bei Verwendung der Schmelzkurven-Analyse im Zusammenhang mit Reaktionen, welche signifikante Anteile von modifizierten Nukleinsäureketten (z.B. Controller-Oligonukleotide oder Primer) enthielten, wurde festgestellt, dass sich das Signal von Farbstoff EvaGreen beispielsweise unterschiedlich zwischen B-Form der DNA und A-Form von modifizierten Nukleinsäureketten verhalten kann. Beispielsweise wurde bei der B-Form der doppelsträngigen Nukleinsäureketten (gewöhnlich angenommen für klassische DNA-Abschnitte) eine höhere Signal-Intensität beobachtet, als bei doppelsträngigen Nukleinsäureketten mit der gleichen Sequenz von Nukleobasen, welche eine A-Form ähnliche Konformation annehmen können (z.B. durch mehrere 2'-0-Me Modifikationen von Nukleotiden). Diese Beobachtung wurde beim Einsatz von interkallierenden Farbstoffen berücksichtigt. For example, when using melting curve analysis in conjunction with reactions containing significant levels of modified nucleic acid chains (eg, controller oligonucleotides or primers), the EvaGreen dye signal was found to differ between B-form of DNA and A-form of DNA can behave modified nucleic acid chains. For example, in the B-form of the double-stranded nucleic acid chains (commonly believed for classical DNA segments), higher signal intensity has been observed than with double-stranded nucleic acid chains having the same sequence of nucleobases which may adopt an A-form-like conformation (eg, multiple 2 '-0-Me modifications of nucleotides). This observation has been taken into account when using intercalating dyes.
Bei Bedarf wurde die Reaktion mittels Kapillarelektrophorese analysiert und die Länge von gebildeten Fragmenten mit einem Standard verglichen. Als Vorbereitung auf die Kapillarelektrophorese wurde die Reaktionsmischung in einem Puffer (Tris-HCI, 20 mmol/l, pH 8,0, und EDTA, 20 mmol/l, pH 8,0) dermaßen verdünnt, dass die Konzentration von markierten Nukleinsäuren ca. 20 nmol/l betrug. Die Kapillar-Elektrophorese wurde bei der Firma GATC- Biotech (Konstanz, Deutschland) als Auftragsleistung durchgeführt. Nach Angaben des Anbieters wurde die Kapillarelektrophorese auf einem ABI 3730 Cappilary Sequencer unter Standard- Bedingungen für eine Sanger-Sequenzierung unter Verwendung von POP7 Gelmatrix, bei ca. 50°C und bei konstanter Spannung (ca. 10 kV) durchgeführt. Die verwendeten Bedingungen führten zur Denaturierung von Doppelsträngen, so dass in der Kapillarelektrophorese die einzelsträngige Form von Nukleinsäureketten separiert wurde. Die Elektrophorese ist eine Standardtechnik in der genetischen Analyse. Die automatisierte Kapillar-Elektrophorese wird heute routinemäßig bei Sanger-Sequenzierung eingesetzt. Das Fluoreszenz-Signal wird während der Kapillar-Elektrophorese kontinuierlich aufgezeichnet (gewöhnlich unter Verwendung von virtuellen Filtern), so dass ein Elektrophorogramm entsteht, bei welchem die Signal-Intensität mit der Dauer der Elektrophorese korreliert. Bei kürzeren Fragmenten, z.B. nicht verbrauchte Primer, beobachtet man einen früheren Signal-Peak, bei verlängerten Fragmenten kommt es zu einer zeitlichen Verschiebung der Signale proportional zu der Länge des extendierten Bereichs. Dank mitgeführten Kontrollen mit bekannten Längen lässt sich die Länge von extendierten Fragmenten ausmessen. Diese Technik ist einem Fachmann bekannt und wird ebenfalls standardmäßig bei Fragment- Längen-Polymorphismus eingesetzt. If necessary, the reaction was analyzed by capillary electrophoresis and the length of fragments formed was compared to a standard. In preparation for capillary electrophoresis, the reaction mixture was diluted in a buffer (Tris-HCl, 20 mmol / l, pH 8.0, and EDTA, 20 mmol / l, pH 8.0) to such an extent that the concentration of labeled nucleic acids was ca. 20 nmol / l. Capillary electrophoresis was performed by GATC-Biotech (Konstanz, Germany) as a contract performance. According to the supplier, capillary electrophoresis was performed on an ABI 3730 Cappilary Sequencer under standard conditions for Sanger sequencing using POP7 gel matrix, at about 50 ° C and at constant voltage (about 10 kV). The conditions used led to the denaturation of double strands, so that in capillary electrophoresis the single-stranded form of nucleic acid chains was separated. Electrophoresis is a standard technique in genetic analysis. Automated capillary electrophoresis is now routinely used in Sanger sequencing. The fluorescence signal is continuously recorded during capillary electrophoresis (usually using virtual filters) to produce an electrophorogram in which the signal intensity correlates with the duration of the electrophoresis. For shorter fragments, eg unused primers observed an earlier signal peak, with extended fragments there is a time shift of the signals proportional to the length of the extended area. Thanks to guided controls of known lengths, the length of extended fragments can be measured. This technique is known to a person skilled in the art and is also used by default in fragment length polymorphism.
Soweit nichts anderes in Bezug auf eine bestimmte Sequenz definiert ist, bezeichnen sowohl Groß- wie Kleinbuchstaben agct und AGCT die Desoxyribonucleotidbausteine der DNA, oder die entsprechenden Ribonucleotide oder Basenanaloga. In einigen Ausführungsbeispielen werden Uracil-Nukleobasen in modifizierten Sequenzsegmenten eingesetzt, als Zucker waren daher 2 - OMe Modifikationen eingesetzt (Ribose mit 2'-0-Methyl-Modifikation). Auch andere 2'-0-Alkyl Modifikationen kommen in Frage. Bei Amplifikations-Ansätzen mit dUTP (insbesondere erste Amplifikationsreaktion) werden Amplifikations-Fragmente generiert, welche dUMP umfassen (als Schutz vor Kontamination). Generell können aber Uracil-Basen sowohl mit 2'-Deoxy-Ribose als auch mit Ribose eingesetzt werden; der Fachmann entnimmt der Offenbarung als Ganzes die auf die jeweiligen Sequenzabschnitte der hier verwendeten Sequenzen bezogene Lehre zur Bestimmung, an welchen Stellen klassische DNA-Rückgrate, RNA oder Basenanaloga sinnvoll einsetzbar sind. Unless otherwise defined with respect to a particular sequence, both upper case and lower case letters agct and AGCT refer to the deoxyribonucleotide building blocks of the DNA, or the corresponding ribonucleotides or base analogs. In some embodiments, uracil nucleobases are used in modified sequence segments, so as the sugar 2 were - OMe modifications used (ribose 2 '-0-methyl modification). Other 2 '-0-alkyl modifications are possible. In amplification approaches with dUTP (especially first amplification reaction), amplification fragments are generated which comprise dUMP (as protection against contamination). In general, however uracil bases can be used with both 2 '-deoxy-ribose and ribose; The person skilled in the disclosure as a whole extracts from the disclosure the teaching relating to the respective sequence segments of the sequences used here for determining at which sites classical DNA backbones, RNA or base analogues can be usefully used.
Beispiel 1 :  Example 1 :
Primer-Verlängerungs-Reaktion zur Herstellung eines Primerverlängerungsproduktes unter Verwendung von Sequenz-Varianten einer Zielsequenz und anschließende Verwendung des synthetisierten Primer-Verlängerungsproduktes in einer Amplifikations-Reaktion. A primer extension reaction for the preparation of a primer extension product using sequence variants of a target sequence and subsequent use of the synthesized primer extension product in an amplification reaction.
In diesem Beispiel wurde der Einfluss von Sequenzdifferenzen in zwei Matrizen auf die Interaktion mit dem Controller nach einer Synthese-Phase untersucht. Es wurden zwei Matrizen bereitgestellt, welche an einer Nukleotid-Position eine Sequenzdifferenz umfassten. Bei Verlängerung des ersten Primer-Oligonukleotides wurde jeweils ein komplementärer Strang gebildet, welcher eine komplementäre Sequenz zur jeweiligen Matrize aufwies und somit ebenfalls diese Sequenzdifferenz in der Sequenz umfasste. Beide Matrizen umfassten eine einheitliche Primer- Bindungsstelle, so dass ein einheitlicher Primer verwendet werden konnte. Diskriminierung zwischen einzelnen Sequenz-Varianten der Zielsequenz erfolgte somit mittels eines spezifischen Controller-Oligonukleotides.  In this example the influence of sequence differences in two matrices on the interaction with the controller after a synthesis phase was investigated. Two templates were provided which included a sequence difference at a nucleotide position. Upon extension of the first primer oligonucleotide, a complementary strand was formed in each case which had a complementary sequence to the respective template and thus likewise comprised this sequence difference in the sequence. Both templates included a uniform primer binding site so that a single primer could be used. Discrimination between individual sequence variants of the target sequence thus took place by means of a specific controller oligonucleotide.
Die während der Synthese-Phase generierten Primer-Verlängerungsprodukte können durch Controller vorwiegend spezifisch von Matrizensträngen abgelöst werden. Die Primer- Verlängerungsprodukte umfassen ein 3'-Segment, welches nicht von einem Controller- Oligonukleotid gebunden wird. Dieses 3'-Segment des ersten Primer-Verlängerungsproduktes kann von einem anderen Oligonukleotid, z.B. einem Primer, komplementär gebunden werden. Auf diese Weise generierte erste Primer-Verlängerungsprodukte können in einer anschließenden Amplifikations-Reaktion unter Verwendung eines weiteren, zweiten Primers amplifiziert werden. Die Amplifikations-Reaktion dient somit zur Veranschaulichung einer Auswirkung einer Controlling- Phase (Strang-Trennung durch einen Controller) nach einer Synthese-Phase. The generated during the synthesis phase primer extension products can be replaced by controllers mainly specifically of template strands. The primer extension products comprise a 3 ' segment that is not bound by a controller oligonucleotide. This 3 ' segment of the first primer extension product may be complementarily bound by another oligonucleotide, eg a primer. First primer extension products generated in this manner can be amplified in a subsequent amplification reaction using a further second primer. The amplification reaction thus serves to illustrate an effect of a controlling phase (strand separation by a controller) after a synthesis phase.
Folgende Matrizen wurden verwendet:  The following matrices were used:
Matrize mit Sequenzzusammensetzung, welche zu einem ersten Primer-Verlängerungsprodukt mit einer Perfekt-Match Übereinstimmung mit dem Controller-Oligonukleotid führt:  Template with sequence composition leading to a first primer extension product with a perfect match with the controller oligonucleotide:
M2SF5-M001 -200  M2SF5-M001 -200
5' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3' (SEQ ID NO:001 ) 5 ' GCT CATA CTACAATGTCA CTTA CTGTAA GAGCAGATCC CTGGACAGGC AA GGAATACAGGTA AAAAA 3 ' (SEQ ID NO: 001)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Die Bindungssequenz für das erste Primer-Oligonukleotid ist unterstrichen.  The binding sequence for the first primer oligonucleotide is underlined.
Matrize mit Sequenzzusammensetzung, welche zu einem ersten Primer-Verlängerungsprodukt führt, das an einer einzelnen Basenposition (fett gedruckt) ein Mismatch mit dem Controller- Oligonukleotid bildet:  Template-sequence template resulting in a first primer extension product that mismatches with the controller oligonucleotide at a single base position (in bold):
M2SF5-WT01-200  M2SF5-WT01-200
5' GCT CATA CTACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC GA GGAATACAGGTA AAAAA 3' (SEQ ID NO:002) 5 ' GCT CATA CTACAATGTCA CTTA CTGTAA GAGCAGATCC CTGGACAGGC GA GGAATACAGGTA AAAAA 3 ' (SEQ ID NO: 002)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Die Bindungssequenz für das erste Primer-Oligonukleotid ist unterstrichen.  The binding sequence for the first primer oligonucleotide is underlined.
Folgende Primer wurden verwendet:  The following primers were used:
Das erste Primer-Oligonukleotid: P1 F5-200-AE2053  The first primer oligonucleotide: P1 F5-200-AE2053
5 ' AACTCAGACAAGATGTGA I I I I I I I ACCTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ' (SEQ ID NO:003) 5 ' AACTCAGACAAGATGTGA IIIIIII ACCTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ' (SEQ ID NO: 003)
Der als Primer in der Reaktion verwendetes Segment ist unterstrichen.  The segment used as the primer in the reaction is underlined.
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Dieses Oligonukleotid umfasste folgende Modifikationen:  This oligonucleotide included the following modifications:
1 = C3-Linker  1 = C3 linker
Das in eckingen Klammern gesetzte Segment des Primers [CUCU GAUGCUUC] umfasste 2'-0- Me-Modifikationen und diente als zweiter Primer-Bereich zur Bindung des ersten Bereichs des Controller-Oligonukleotides: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl-Cytosine); U = (2'-0-Methyl-Uridine) The compound in parentheses eckingen segment of the primer [CUCU GAUGCUUC] comprised Me modifications 2 '-0- and served as the second primer region capable of binding the first portion of the controller oligonucleotide: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl-cytosine); U = (2 '-0-methyl-uridine)
Dieses Primer-Oligonukleotid umfasst den ersten Bereich (Positionen 1 - 12 vom 3 '-Ende), den zweiten Bereich (C3-Linker, sowie Positionen 13 - 24 vom 3'-Ende), sowie ein Segment mit einer Zusatzsequenz Variante P1 (Positionen 25 - 57 vom 3'-Ende). Der erste Bereich und der zweite Bereich sind für die Ausführung einer spezifischen Amplifikation notwendig und können als„Basis- Struktur des ersten Primers“ oder „Minimal-Struktur des ersten Primers“ zusammengefasst werden. Die Zusatzsequenz Variante P1 stellt ein Beispiel dar für zusätzliche Sequenz-Segmente, welche am ersten Primer-Oligonukleotid integriert werden können. Positionen 1 - 12 dienen als Matrize bei Synthese des zweiten Primer-Verlängerungsproduktes. C3-Modifikation und der zweite Bereich verhindern eine Fortsetzung der Synthese an Positionen 25 - 57 während einer Synthese des zweiten Primer-Verlängerungsproduktes. This primer oligonucleotide comprises the first region (positions 1 - 12 from the 3 ' end), the second region (C3 linker, as well as positions 13 - 24 from the 3 ' end), and a segment with an additional sequence variant P1 (positions 25 - 57 from the 3 ' end). The first region and the second region are necessary for performing a specific amplification and may be summarized as "base structure of the first primer" or "minimal structure of the first primer". The additional sequence variant P1 represents an example of additional sequence segments which can be integrated on the first primer oligonucleotide. Positions 1-12 serve as template in synthesis of the second primer extension product. C3 modification and the second region prevent synthesis from continuing at positions 25-57 during synthesis of the second primer extension product.
Folgendes Controller-Oligonukleotid wurde verwendet: AD-F5-1001 -503  The following controller oligonucleotide was used: AD-F5-1001 -503
5 ' [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC]AGGTAGAAGCATC AGAG X 3 ' (SEQ ID NO:004) 5 ' [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] AGGTAGAAGCATC AGAG X 3 ' (SEQ ID NO: 004)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Das in eckigen Klammern gesetzte 5'-Segment des Oligonukleotids [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] umfasste 2'-0-Me-Nukleotid-Modifikationen:The set in square brackets 5 'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] included 2' -0-Me-nucleotide modifications:
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
X = 3'-Phosphat-Gruppe zur Blockade einer möglichen Verlängerung durch Polymerase. X = 3 'phosphate group for blocking a possible extension by polymerase.
Die Nukleotide und Nukleotid-Modifikationen sind untereinander mit Phosphodiesterbindungen verknüpft. Das 3'-Ende des Controller-Oligonukleotdies ist mit einer Phosphat-Gruppe blockiert, um eine mögliche Verlängerung durch die Polymerase zu verhindern. The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ' end of the controller oligonucleotide is blocked with a phosphate group to prevent possible extension by the polymerase.
Die Primer-Verlängerungs-Reaktion wurde direkt als Amplifikations-Reaktion fortgeführt (homogenes Assay).  The primer extension reaction was continued directly as an amplification reaction (homogeneous assay).
Zu diesem Zweck wurde vor Beginn der Primer-Verlängerungs-Reaktion ein weiterer Primer (Primer 2) in das Reaktions-Gemisch gegeben. Dieser zweite Primer kann an das 3'-Segment des in der Primer-Verlängerungsreaktion synthetisierten Primer-Verlängerungsproduktes komplementär binden. Weiterhin kann dieser zweite Primer eine Amplifikations-Reaktion unterstützen, ausgehend vom während der Synthese-Phase matrizenspezifisch synthetisierten ersten Primer-Verlängerungsprodukt, welches anschließend in der Controlling-Phase von seinem Matrizen-Strang durch den Controller abgelöst wird. Primer 2: P2G3-5270-7063 For this purpose, another primer (primer 2) was added to the reaction mixture before starting the primer extension reaction. This second primer can bind to the 3 ' segment of the primer extension product synthesized in the primer extension reaction. Furthermore, this second primer can support an amplification reaction, starting from the first primer extension product, which is synthesized during the synthesis phase, which is subsequently removed in the controlling phase from its template strand by the controller. Primer 2: P2G3-5270-7063
5' CT AC AG AACT C AG AC AAG AT GT G AACT AC AATGTT 6 5 ' CT AC AG AACT AG AC AAG AT GT AACT AC AATGTT 6
G CT CAT ACT AC AATGTC ACTT ACTGTAAG AG C AG A 3' (SEQ ID N0:005) G CT CAT ACT AC AATGTC ACTT ACTGTAAG AG C AG A 3 ' (SEQ ID NO: 005)
Dieses Oligonukleotid umfasst folgende Modifikationen:  This oligonucleotide comprises the following modifications:
6 = HEG-Linker  6 = HEG linker
Das als Primer in der Reaktion verwendete Segment ist unterstrichen. Dieses Segment ist in der Lage, an das 3'-Segment des ersten Primer-Verlängerungsproduktes komplementär zu binden und unter Verwendung des ersten Primer-Verlängerungsproduktes als Matrize eine zweite Primer- Verlängerungsreaktion zu initiieren. The segment used as primer in the reaction is underlined. This segment is capable of complementarily binding to the 3 ' segment of the first primer extension product and initiating a second primer extension reaction using the first primer extension product as a template.
Dieses Primer-Oligonukleotid umfasst einen kopierbaren Bereich und einen nicht kopierbaren Bereich. Der kopierbare Bereich umfasst (Positionen 1 - 13 vom 3'-Ende, welche an Sequenz des FVL-Gens innerhalb von hgDNA komplementär binden kann und Positionen 14 - 35, welche zwar nicht an Sequenz des FVL-Gens komplementär binden aber während der Amplifikation an das erste Primer-Verlängerungsprodukt binden können). Der kopierbare Bereich kann als „Basis- Struktur des zweiten Primers“ oder„Minimal-Struktur des zweiten Primers“ zusammengefasst werden. This primer oligonucleotide comprises a copyable region and a non-copyable region. The copyable region comprises (positions 1-13 of the 3 ' end which can bind to sequence of the FVL gene within hgDNA and positions 14-35 which, while not complementary to the sequence of the FVL gene, bind during amplification can bind the first primer extension product). The copyable area can be summarized as "basic structure of the second primer" or "minimal structure of the second primer".
Der nicht-kopierbare Bereich (Positionen 36 - 70 vom 3'-Ende, welche nicht an Sequenz von FVL- Gen komplementär binden) ist durch HEG-Modifikation vom kopierbaren Bereich getrennt, was die Fortsetzung der Synthese an Positionen 36 - 70 während einer Synthese des ersten Primer- Verlängerungsproduktes verhindert. Der nicht-kopierbare Bereich stellt ein Beispiel für eine Zusatzsequenz Variante P2, welche am zweiten Primer-Oligonukleotid integriert werden können.The non-copyable region (positions 36 to 70 from the 3 'end which is not complementary to bind to the sequence of FVL- gene) is separated by HEG modification of copiable area, which the continuation of the synthesis at positions 36-70 during synthesis prevents the first primer extension product. The non-copyable region provides an example of an additional sequence variant P2, which can be integrated on the second primer oligonucleotide.
Aus der ersten Primer-Verlängerungs-Reaktion und der zweiten Primer-Verlängerungsreaktion resultiert dabei ein Doppelstrang, umfassend das erste und das zweite Primer- Verlängerungsprodukt. Bei weiterer Verwendung von beiden Primern und des Controller- Oligonukleotides (und wiederholten Temperaturen von 55°C und 65°C) resultierte eine exponentielle Amplifikation, welche sowohl Primer-Verlängerungs-Schritte als auch Strang- Trennung mittels Controller-Oligonukleotides umfasst. Während der Amplifikations-Phase diente das erste Primer-Oligonukleotid weiterhin als Amplifikations-Primer. The first primer extension reaction and the second primer extension reaction result in a duplex comprising the first and second primer extension products. Further use of both primers and the controller oligonucleotide (and repeated temperatures of 55 ° C and 65 ° C) resulted in exponential amplification involving both primer extension steps and strand separation by controller oligonucleotide. During the amplification phase, the first primer oligonucleotide continued to serve as an amplification primer.
Es wurden vier Ansätze vorbereitet:  Four approaches have been prepared:
Ansatz 1 enthält die Matrize M2SF5-M001-200 (Perfect Match Situation) in Konzentration von 300 fmol/l (entspricht ca. 2e6 Kopien/ Ansatz).  Approach 1 contains the template M2SF5-M001-200 (Perfect Match Situation) in a concentration of 300 fmol / l (corresponds to approx. 2e6 copies / batch).
Ansatz 2 enthält die Matrize M2SF5-M001-200 (Perfect Match Situation) in Konzentration von 300 amol/l (entspricht ca. 2x10L3 Kopien/ Ansatz). Approach 2 contains the template M2SF5-M001-200 (Perfect Match Situation) in a concentration of 300 amol / l (corresponds to approx. 2x10 L 3 copies / batch).
Ansatz 3 enthält keine Matrize und bildet somit eine Kontrolle. Ansatz 4 enthält als die Matrize M2SF5-WT01-200 (single Mismatch Situation) in 300 pmol/l Konzentration (ca. 2x 10L9 Kopien pro Ansatz). Approach 3 does not contain a template and thus forms a control. Approach 4 contains as the template M2SF5-WT01-200 (single mismatch situation) in 300 pmol / l concentration (about 2x 10 L 9 copies per batch).
Primer 1 wurde mit 5 pmol/l, das Controller-Oligonukleotid mit 2 pmol/l und Primer 2 mit 1 pmol/l eingesetzt. Die weiteren Reaktionsbedingungen waren: Amplifikations-Lösung 2.  Primer 1 was used at 5 pmol / L, the controller oligonucleotide at 2 pmol / L and primer 2 at 1 pmol / L. The other reaction conditions were: Amplification solution 2.
Um die Anwesenheit von genomischer DNA im Assay nachzustellen wurden pro Reaktion 100 ng frisch denaturierte Fisch-DNA (Lachs-DNA) zugegeben.  To readjust the presence of genomic DNA in the assay, 100 ng of freshly denatured fish DNA (salmon DNA) was added per reaction.
Eine Primer-Verlänqerunqs-Reaktion (Synthese-Phase und Controlling-Phase).  A primer extension reaction (synthesis phase and controlling phase).
Die thermischen Reaktionsbedingungen waren 2 min bei 55 °C (Synthese-Phase) und anschließend 5 min bei 65 °C (Controlling-Phase).  The thermal reaction conditions were 2 min at 55 ° C (synthesis phase) and then 5 min at 65 ° C (controlling phase).
Die Synthese-Phase der Primer-Verlängerungs-Reaktion des ersten Primers fand in erster Linie bei 55°C statt. Bei dieser Temperatur lag der Controller in Komplex mit dem ersten Primer vor und war damit in einem nicht-aktiven Zustand. Die Controlling-Phase fand bei 65°C statt. Bei dieser Temperatur dissoziierte der Controller zumindest teilweise vom ersten Primer- Oligonukleotid und konnte somit mit gebildeten Primer-Verlängerungsprodukten interagieren. Die Schmelztemperatur des ersten Bereichs des ersten Primers mit seiner Primer-Bindungsstelle an der Matrize betrug ca. 45°C in Amplifikations-Lösung 2. Somit wurde die Synthese-Phase bei einer Reaktions-Temperatur von etwa Tm +10°C durchgeführt, bezogen auf Tm von Matrize / erster Primer-Komplex. Aufgrund einer höheren Konzentration des ersten Primers (5 pmol) lag in der Synthese-Phase eine genügende Menge des ersten Primers frei, um an die Matrize zu binden und die Reaktion zu starten. Bei Erhöhung der Temperatur auf 65°C sank die Ausbeute der Synthese-Phase signifikant. Bei dieser T emperatur wurde der Controller aus seiner Bindung mit dem Primer teilweise freigesetzt (Tm des Komplexes umfassend den ersten Primer und Controller in Amplifikations-Lösung 1 betrug 63°C). Daher verlief die Controlling Phase bei ca. The synthesis phase of the primer extension reaction of the first primer took place primarily at 55 ° C. At this temperature, the controller was in complex with the first primer and was thus in a non-active state. The controlling phase took place at 65 ° C. At this temperature, the controller at least partially dissociated from the first primer oligonucleotide and thus could interact with formed primer extension products. The melting temperature of the first region of the first primer with its primer binding site on the template was about 45 ° C in amplification solution 2. Thus, the synthesis phase was carried out at a reaction temperature of about Tm + 10 ° C, based on Tm of template / first primer complex. Due to a higher concentration of the first primer (5 pmol), a sufficient amount of the first primer was free in the synthesis phase to bind to the template and initiate the reaction. As the temperature was raised to 65 ° C, the yield of the synthesis phase decreased significantly. At this temperature, the controller was partially released from its binding with the primer (Tm of the complex comprising the first primer and controller in Amplification Solution 1 was 63 ° C). Therefore, the controlling phase was at approx.
Tm +2°C. bezogen auf Tm von Controller / erster Primer - Komplex. Tm + 2 ° C. relative to Tm of controller / first primer complex.
Amplifikations-Reaktion (Wiederholung von Primer-Verlängerungs-Reaktionen)  Amplification reaction (repeat of primer extension reactions)
Die thermischen Reaktionsbedingungen waren zyklisch alternierende Temperaturänderungen, wobei jeweils auf ein 2 min Zeitintervall bei 55 °C ein 5 min Zeitintervall bei 65 °C folgte. Die Amplifikation wurde über 100 Zyklen verfolgt. Detektion erfolgte bei 65°C für EvaGreen- Fluoreszenzsignal.  The thermal reaction conditions were cyclic alternating temperature changes, each followed by a 5 minute time interval at 65 ° C for a 2 minute time interval at 55 ° C. The amplification was followed for 100 cycles. Detection was carried out at 65 ° C for Eva Green fluorescence signal.
Die erfolgreiche Synthese von Primer-Verlängerungs-Produkten (hier als Amplifikation bezeichnet) konnte durch einen Anstieg des EvaGreen-Fluoreszenzsignals im Laufe der Zeit festgestellt werden. Die Temperatur-Änderungen und Real-Time Monitoring wurde mit StepPne Plus Real- Time PCR Gerät von Thermofisher durchgeführt.  The successful synthesis of primer extension products (referred to herein as amplification) could be detected by an increase in the EvaGreen fluorescence signal over time. The temperature changes and real-time monitoring were performed with the StepPne Plus Real-Time PCR device from Thermofisher.
Fig. 31 zeigt einen typischen Verlauf des EvaGreen-Signals. Auf der Y-Achse ist die Zunahme des Fluoreszenzsignals (Delta Rn) und auf der X-Achse ist die Reaktionszeit (als Zyklusnummer) aufgetragen. Pfeile markieren einzelne Reaktionsansätze. Dabei gehören die markierten Positionen zu folgenden Ansätzen: Fig. 31 shows a typical course of the EvaGreen signal. On the Y-axis is the increase of the fluorescence signal (Delta Rn) and on the X-axis is the reaction time (as cycle number) applied. Arrows mark individual reaction approaches. The selected positions belong to the following approaches:
Pfeil 1 : 300 fmol/l perfekt-Match Matrize ( ca. 2x10L6 Kopien/Ansatz) Arrow 1: 300 fmol / l perfect match matrix (about 2x10 L 6 copies / batch)
Pfeil 2: 300 amol/l perfekt-Match Matrize ( ca. 2x10L3 Kopien/Ansatz) Arrow 2: 300 amol / l perfect match die (about 2x10 L 3 copies / batch)
Pfeil 3: keine Matrize  Arrow 3: no die
Pfeil 4: 300 pmol/l Mismatch Matrize (ca. 2x 10L9 Kopien pro Ansatz). Arrow 4: 300 pmol / l mismatch template (about 2x 10 L 9 copies per batch).
Es ist der Anstieg des Fluoreszenz-Signals sowohl bei perfekt-Match als auch bei Mismatch- Variante der Matrize zu sehen, wobei das Signal der Mismatch-Variante (4) trotz 1000fachen Überschußes später erscheint. Beim Single Mismatch wird eine Verzögerung von ca. 15 Zyklen beobachtet. Die zeitliche Verzögerung (=Zyklusanzahl) ist ein unmittelbares Maß für die Diskriminierung durch die Wirkung des Controllers. Bei Verwendung einer Perfect-Match Matrize kommt es zur Synthese eines komplementären Stranges eines Primer-Verlängerungsproduktes. Dieses Verlängerungsprodukt ist sowohl zur Perfect-Match-Matrize komplementär als auch zum verwendeten Controller-Oligonukleotid. Im Gegensatz dazu, unter Verwendung einer Mismatch- Sequenz kommt es bei der Synthese des ersten Primer-Verlängerungsproduktes zur Generierung eines komplementären Stranges des Verlängerungsproduktes, welches zwar eine vollständige Komplementarität zur Mismatch-Matrize aufweist, aber dadurch von der Komplementarität mit dem dritten Bereich des Controller-Oligonukleotid abweicht. Diese Abweichung findet im 5'-ständigen Segment des Verlängerungsproduktes statt, welches mit dem Controller-Oligonukleotid reagieren sollte, damit der Strangverdrängungsvorgang voranschreiten kann. Wie im vorliegenden Beispiel gezeigt wird, stört das Mismatch eine Strangtrennung durch das Controller-Oligonukleotid. The increase of the fluorescence signal can be seen both in the perfect match and in the mismatch variant of the template, the signal of the mismatch variant (4) appearing later despite a 1000-fold excess. With the single mismatch, a delay of about 15 cycles is observed. The time delay (= number of cycles) is a direct measure of discrimination by the controller. Using a Perfect-Match template results in the synthesis of a complementary strand of a primer extension product. This extension product is complementary to both the Perfect Match template and the controller oligonucleotide used. In contrast, using a mismatch sequence, the synthesis of the first primer extension product results in the generation of a complementary strand of the extension product which, while having complete complementarity to the mismatch template, but thereby complements with the third region of the controller -Oligonucleotide differs. This deviation occurs in the 5 ' -store segment of the extension product, which should react with the controller oligonucleotide to allow the strand displacement process to proceed. As shown in the present example, the mismatch interferes with strand separation by the controller oligonucleotide.
Dieses Ergebnis veranschaulicht die Bedeutung der Basenzusammensetzung im Controller- Oligonukleotid: Abweichungen von der Komplementarität zwischen Controller-Oligonukleotid und dem Primer-Verlängerungsprodukt können zur Verlangsamung oder sogar Unterbrechung der Amplifikation führen.  This result illustrates the importance of the base composition in the controller oligonucleotide: deviations from the complementarity between the controller oligonucleotide and the primer extension product can lead to slowing or even interrupting the amplification.
In diesem Beispiel wurde gezeigt, dass obwohl Sequenz-Enden von Perfect-Match-Matrize und Mismatch-Matrize komplett übereinstimmten und somit das Potenzial zu Bindung von beiden Primer-Oligonukleotide gleich war, sind beide Reaktionen vollkommen unterschiedlich gelaufen: bei einer vollständigen Komplementarität zwischen dem Controller-Oligonukleotid und dem 5'- Segment des Verlängerungsproduktes des ersten Primer-Oligonukleotides verlief die Amplifikation planmäßig. Eine Unterbrechung der Strangtrennung während der Controlling-Phase durch eine nicht-komplementäre Sequenzvariante (in diesem Fall durch ein Mismatch) führte zur Minderung der Strang-Trennung, was sich in der Unterdrückung der Amplifikations-Kinetik äußerte. In this example, it was shown that although the sequence ends of the perfect match template and the mismatch template were completely identical and thus the potential for binding of both primer oligonucleotides was the same, both reactions proceeded completely differently: with a complete complementarity between the Controller oligonucleotide and the 5 ' segment of the extension product of the first primer oligonucleotide proceeded according to the amplification. An interruption of the strand separation during the controlling phase by a non-complementary sequence variant (in this case by a mismatch) led to the reduction of the strand separation, which was expressed in the suppression of the amplification kinetics.
Somit kann ein in einer Primer-Verlängerungs-Reaktion hergestelles Primer-Verlängerungsprodukt in einem Amplifikations-Verfahren als Start-Nukleinsäure verwendet werden.  Thus, a primer extension product made in a primer extension reaction can be used as the starting nucleic acid in an amplification procedure.
Beispiel 2: Einfluss eines Mismatches zwischen einem ersten Primer und einem Controller auf die Strang- Trennung (Controlling-Phase). Example 2: Influence of a mismatch between a first primer and a controller on the strand separation (controlling phase).
Ähnlich wie im ersten Beispiel wurde eine Amplifikations-Reaktion zur Veranschaulichung einer Auswirkung einer Controlling-Phase (Strang-Trennung durch einen Controller) nach einer Synthese-Phase verwendet.  Similar to the first example, an amplification reaction was used to illustrate an effect of a controlling phase (strand separation by a controller) after a synthesis phase.
Die Synthese-Phase findet unter Reaktionsbedingungen statt, welche eine Primer- Verlängerungsreaktion an einer Matrize ermöglichen. Zur jeweiligen Strang-Trennung (Controller- Phase) wurden allerdings verschiedene Controller verwendet: Perfekt-Match- und Mismatch- Controller-Oligonukleotid zum verwendeten Primer während der Synthese-Phase. Um den Effekt eines solchen einzelnen Mismatches zwischen einem ersten Primer und einem Controller zu demonstrieren, wurden wiederholt Primer-Verlängerungsreaktionen (Synthese-Phasen) und Controlling-Phasen unter zyklischen Temperaturbedingungen durchgeführt. Es resultierte somit eine Amplifikation von einem ersten Primer-Verlängerungsprodukt.  The synthesis phase takes place under reaction conditions which allow a primer extension reaction on a template. However, different controllers were used for the respective strand separation (controller phase): perfect match and mismatch controller oligonucleotide to the primer used during the synthesis phase. To demonstrate the effect of such a single mismatch between a first primer and a controller, repeated primer extension reactions (synthesis phases) and controlling phases were performed under cyclic temperature conditions. Thus, an amplification of a first primer extension product resulted.
Die Amplifikation diente dabei als Detektions-Methode für die Controlling-Phase: nur wenn die Strang-Trennung erfolgreich verlaufen kann und das zweite Primer-Oligonukleotid an das 3'- Segment des ersten Primer-Verlängerungsproduktes binden kann, findet eine Amplifikation statt. Aufgrund einer hohen Sensitivität dieser Methode (wegen exponentiellen Charakters) und einer Quantifizierungs-Möglichkeit (Zeit-Abhänigkeit von Signal-Detektion je nach Konzentration) wurde die Amplifikation als Detektions-Methode für eine erfolgreiche bzw. nicht erfolgreiche Strang-Trennung während einer Controlling Phase verwendet. Das Real-Time-Monitoring der Synthese von entstehenden Amplifikationsprodukten erfolgte in diesem Beispiel mit dem interkalierenden Farbstoff Eva Green. The amplification served as a detection method for the controlling phase: only if the strand separation can proceed successfully and the second primer oligonucleotide can bind to the 3 ' segment of the first primer extension product, an amplification takes place. Due to the high sensitivity of this method (because of its exponential character) and its ability to quantify (time-dependent signal detection depending on concentration), amplification was used as a detection method for successful or unsuccessful strand separation during a controlling phase , The real-time monitoring of the synthesis of resulting amplification products was carried out in this example with the intercalating dye Eva Green.
Folgende Matrize wurde verwendet:  The following template was used:
• Matrize mit Sequenzzusammensetzung, welche zu einem ersten Primer-Verlängerungsprodukt mit einer Perfekt-Match-Übereinstimmung mit dem Controller-Oligonukleotid führt:  Template-sequence template leading to a first primer extension product with a perfect match match to the controller oligonucleotide:
M2SF5-M001 -200  M2SF5-M001 -200
5' GCT CATA CT ACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA 5 ' GCT CATA CT ACAATGTCA CT TA CTGTAA GAGCAGATCC CTGGACAGGC AA
GGAATACAGGTA AAAAA 3' (SEQ ID NO:001 ) GGAATACAGGTA AAAAA 3 ' (SEQ ID NO: 001)
Die Bindungssequenz für das erste Primer-Oligonukleotid ist unterstrichen.  The binding sequence for the first primer oligonucleotide is underlined.
Das zweite Primer-Oligonukleotid bindet an das Reverse-Complement der doppelt unterstrichen Sequenz.  The second primer oligonucleotide binds to the reverse complement of the double underlined sequence.
Folgende Primer wurden verwendet:  The following primers were used:
Das erste Primer-Oligonukleotid (SEQ ID NO:2), diente als Primer-Verlängerungsprimer und als Amplifikations-Primer.  The first primer oligonucleotide (SEQ ID NO: 2) served as a primer extension primer and as an amplification primer.
P1 F5-200-AE2053 5' AACT CAG ACAAG ATGTG ATTTTTTT ACCTGT AT [CUCU GAUGCUUC] 1 TACCTGTATTCC 3'(SEQ ID N0:003) P1 F5-200-AE2053 5 ' AACT CAG ACAAG ATGTG ATTTTTT ACCTGT AT [CUCU GAUGCUUC] 1 TACCTGTATTCC 3 ' (SEQ ID NO: 003)
Der als Primer in der Reaktion verwendetes Segment ist unterstrichen.  The segment used as the primer in the reaction is underlined.
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Dieses Oligonukleotid umfasst folgende Modifikationen:  This oligonucleotide comprises the following modifications:
1 = C3-Linker diente zur Terminierung der Synthese des zweiten Primer-Verlängerungsproduktes. 1 = C3 linker served to terminate the synthesis of the second primer extension product.
Segment des Primers [CUCU GAUGCUUC] umfasste 2'-0-Me-Modifikationen und diente als zweiter Primer-Bereich zur Bindung des ersten Bereichs des Controller-Oligonukleotides: Segment of the primer [CUCU GAUGCUUC] included 2 '-0-Me modifications and served as the second primer region capable of binding the first portion of the controller oligonucleotide:
A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl-Cytosine); U = (2'-0-Methyl-Uridine) A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl-cytosine); U = (2 '-0-methyl-uridine)
• Das zweite Primer-Oligonukleotid diente als zweiter Amplifikations-Primer:  The second primer oligonucleotide served as a second amplification primer:
P2G3-5270-7063  P2G3-5270-7063
5' CT AC AG AACT CAG ACAAG AT GT G AACT AC AATGTT 6 5 ' CT AC AG AACT CAG ACAAG AT GT AACT AC AATGTT 6
G CT CAT ACT AC AATGTC ACTT ACTGTAAG AG C AG A 3' (SEQ ID NO:005) G CT CAT ACT AC AATGTC ACTT ACTGTAAG AG C AG A 3 ' (SEQ ID NO: 005)
Modifikationen:  modifications:
6 = HEG-Linker  6 = HEG linker
Sowohl der erste Primer als auch der zweite Primer sind in der Lage, eine Amplifikation mit einem perfekt-match Controller-Oligonukleotid zu unterstützen.  Both the first primer and the second primer are capable of supporting amplification with a perfect-match controller oligonucleotide.
Folgendes Perfekt-Match-Controller-Oligonukleotid wurde verwendet:  The following perfect match controller oligonucleotide was used:
AD-F5-1001-503  AD F5-1001-503
5'[UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA G G AA U AC] AG GT AG AAG CAT C AGAG X 3' (SEQ ID NO:004) 5 ' [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GG AA U AC] AG GT AG AAG CAT C AGAG X 3 ' (SEQ ID NO: 004)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Das in eckigen Klammern gesetzte 5'-Segment des Oligonukleotids [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] umfasste 2'-0-Me-Nukleotid-Modifikationen:The set in square brackets 5 'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] included 2' -0-Me-nucleotide modifications:
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
X = 3'-Phosphat-Gruppe zur Blockade einer möglichen Verlängerung durch die Polymerase. Folgendes Mismatch-Controller-Oligonukleotid wurde verwendet: X = 3 ' phosphate group to block a possible extension by the polymerase. The following mismatch controller oligonucleotide was used:
MD2AD-F5-01 1-5 5 ' - GCTC TAATCTGTAA GAGCAGATCC CTG [GAC AGGC AA AGAAUACAGG] TA GAAGCATC AGAG X 3 ' (SEQ ID N0:007) MD2AD-F5-01 1-5 5 ' - GCTC TAATCTGTAA GAGCAGATCC CTG [GAC AGGC AA AGAAUACAGG] TA GAAGCATC AGAG X 3 ' (SEQ ID NO: 007)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Das in eckigen Klammern gesetzte mittlere Segment des Oligonukleotids [GAC AGGC AA AGAAUACAGG] umfasste 2'-0-Me-Nukleotid- Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl-Cytosine); U = (2'-0-Methyl-Uridine) The set in square brackets middle segment of the oligonucleotide [AGGC GAC AA AGAAUACAGG] included 2 '-0-Me-nucleotide modifications: A = (2' -0-methyl-adenosine), G = (2 '-0-methyl Guanosine); C = (2 '-0-methyl-cytosine); U = (2 '-0-methyl-uridine)
X = 3'-Phosphat-Gruppe zur Blockade einer möglichen Verlängerung durch die Polymerase.X = 3 ' phosphate group to block a possible extension by the polymerase.
Die Nukleotide und Nukleotid-Modifikationen sind untereinander mit Phosphodiesterbindungen verknüpft. Das 3'-Ende ist mit einer Phosphat-Gruppe blockiert, um eine mögliche Verlängerung durch die Polymerase zu verhindern. The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ' end is blocked with a phosphate group to prevent possible extension by the polymerase.
Im Mismatch Controller-Oligonukleotid wurde in der Position -24 (vom 3'-Ende) ein A-Nukleotid (Mismatch-Variante) anstatt eines G-Nukleotides (perfekt Match Variante) eingesetzt. Das Nukleotid ist durch Fettschrift hervorgehoben. Diese Position bildet ein Mismatch mit dem 3'- terminalen Nukleotid des eingesetzten ersten Primers. In the mismatch controller oligonucleotide, an A nucleotide (mismatch variant) was used in position -24 (from the 3 ' end) instead of a G nucleotide (perfectly match variant). The nucleotide is highlighted in bold. This position forms a mismatch with the 3 '- terminal nucleotide of the first primer set.
Die Matrize wurde in Konzentrationen von 1-3 pmol/l eingesetzt. In der Kontroll-Reaktion wurde keine Matrize eingesetzt (= Negativkontrolle). Primer 1 wurde mit 5 pmol/l, das jeweilige  The template was used in concentrations of 1-3 pmol / l. No template was used in the control reaction (= negative control). Primer 1 was 5 pmol / L, the respective
Controller-Oligonukleotid mit 2 pmol/l und Primer 2 mit 1 pmol/l eingesetzt. Controller oligonucleotide used at 2 pmol / l and primer 2 at 1 pmol / l.
Die weiteren Reaktionsbedingungen waren:  The further reaction conditions were:
• Amplifikations-Lösung 2  • Amplification Solution 2
• Um die Anwesenheit von genomischer DNA im Assay nachzustellen wurden pro Reaktion 100 ng frisch denaturierte Fisch-DNA (Lachs-DNA) zugegeben.  • To replicate the presence of genomic DNA in the assay, 100 ng of freshly denatured fish DNA (salmon DNA) was added per reaction.
Die Synthese-Phase der Primer-Verlängerungs-Reaktion des ersten Primers fand in erster Linie bei 55°C statt. Bei dieser Temperatur lag der Controller im Komplex mit dem ersten Primer vor und war damit in einem nicht-aktiven Zustand. Die Controlling-Phase fand bei 65°C statt. Bei dieser Temperatur dissoziierte der Controller zumindest teilweise vom ersten Primer- Oligonukleotid und konnte somit mit gebildeten Primer-Verlängerungsprodukten interagieren. Die Schmelztemperatur des ersten Bereichs des ersten Primers mit seiner Primer-Bindungsstelle an der Matrize betrug ca. 45°C in Amplifikations-Lösung 2. Somit wurde die Synthese-Phase bei einer Reaktions-Temperatur von etwa Tm +10°C durchgeführt, bezogen auf Tm von Matrize / erster Primer-Komplex. Aufgrund einer höheren Konzentration des ersten Primers (5 pmol) lag in der Synthese-Phase eine genügende Menge des ersten Primers frei, um an die Matrize zu binden und die Reaktion zu starten. Bei Erhöhung der Temperatur auf 65°C sank die Ausbeute der Synthese-Phase signifikant. Bei dieser T emperatur wurde der Controller aus seiner Bindung mit dem Primer teilweise freigesetzt (Tm des Komplexes umfassend erstes Primer und Controller in Amplifikations-Lösung 1 betrug 63°C). Daher verlief die Controlling Phase bei ca. Tm +2°C. bezogen auf T m von Controller / erster Primer - Komplex. The synthesis phase of the primer extension reaction of the first primer took place primarily at 55 ° C. At this temperature, the controller was in complex with the first primer and thus in a non-active state. The controlling phase took place at 65 ° C. At this temperature, the controller at least partially dissociated from the first primer oligonucleotide and thus could interact with formed primer extension products. The melting temperature of the first region of the first primer with its primer binding site on the template was about 45 ° C in amplification solution 2. Thus, the synthesis phase was carried out at a reaction temperature of about Tm + 10 ° C, based on Tm of template / first primer complex. Due to a higher concentration of the first primer (5 pmol), a sufficient amount of the first primer was free in the synthesis phase to bind to the template and initiate the reaction. As the temperature was raised to 65 ° C, the yield of the synthesis phase decreased significantly. At this temperature, the controller was partially released from its binding with the primer (Tm of the complex comprising first primer and controller in amplification solution 1 was 63 ° C). Therefore, the controlling phase was around Tm + 2 ° C. relative to T m of controller / first primer complex.
In der Amplifikation waren die thermischen Reaktionsbedingungen zyklisch alternierende  In the amplification, the thermal reaction conditions were cyclically alternating
Temperaturänderungen, wobei jeweils auf ein 1 min Zeitintervall bei 55 °C ein 5 min Zeitintervall bei 65 °C folgte. Die Amplifikation wurde typischerweise über 120 Zyklen, d.h. 120 x (1 min 55°C + 5 min 65°C) = 120 x 6 min = 12 h verfolgt. Die erfolgreiche Amplifikation konnte durch einen Anstieg des EvaGreen-Fluoreszenzsignals im Laufe der Zeit festgestellt werden. Temperature changes, each followed by a 5 minute time interval at 65 ° C for a 1 minute time interval at 55 ° C. The amplification was typically over 120 cycles, i. Followed 120 x (1 min 55 ° C + 5 min 65 ° C) = 120 x 6 min = 12 h. The successful amplification could be detected by an increase in the EvaGreen fluorescence signal over time.
Analyse der Primer-Verlängerungs-Reaktion (und Amplifikationsreaktion) Analysis of primer extension reaction (and amplification reaction)
Zur Analyse der Amplifikationsreaktion und zur Bewertung der entstandenen  To analyze the amplification reaction and to evaluate the resulting
Amplifikationsprodukte wurden folgende Techniken genutzt: Amplification products were used the following techniques:
• Fluoreszenzsignal eines interkalierenden Farbstoffes (EvaGreen)  Fluorescence signal of an intercalating dye (EvaGreen)
• Schmelzkurvenanalyse von den entstandenen Amplifikationsprodukten  Melting curve analysis of the resulting amplification products
Fig. 32 A zeigt einen typischen Verlauf des EvaGreen-Fluoreszenzsignals im Laufe einer Allel- spezifischen Amplifikationsreaktion unter Verwendung eines Perfekt-Match-Controller- Oligonukleotids. Auf der Y-Achse ist das Fluoreszenzsignal des EvaGreen-Farbstoffes und auf der X-Achse ist die Reaktionszeit (als Zyklusnummer) aufgetragen. Pfeil 1 markiert in Fig. 32 A einen Perfekt-Match-Amplifikationsansatz. Aufgrund des Perfekt-Match-Controller-Oligonukleotids kann die Matrize amplifiziert werden und es kommt ab Zyklus 27 zu einem Anstieg des Fluoreszenzsignals. Pfeil 2 markiert einen Negativkontroll-Ansatz, der keine Matrize enthält und daher im Laufe des Experiments auch kein Amplifikationssignal generiert.  Figure 32A shows a typical course of the EvaGreen fluorescence signal in the course of an allele-specific amplification reaction using a perfect match controller oligonucleotide. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Arrow 1 marks in Fig. 32A a perfect match amplification approach. Due to the perfect match controller oligonucleotide, the template can be amplified and an increase in the fluorescence signal occurs from cycle 27 onwards. Arrow 2 marks a negative control approach that does not contain a template and thus does not generate an amplification signal during the course of the experiment.
Fig. 32 B zeigt einen typischen Verlauf des EvaGreen-Fluoreszenzsignals im Laufe einer Allel- spezifischen Amplifikationsreaktion unter Verwendung eines Mismatch-Controller- Oligonukleotids. Auf der Y-Achse ist das Fluoreszenzsignal des EvaGreen-Farbstoffes und auf der X-Achse ist die Reaktionszeit (als Zyklusnummer) aufgetragen. Pfeil 1 markiert einen Mismatch-Amplifikationsansatz. Aufgrund des Mismatch-Controller-Oligonukleotids kann die Matrize nicht amplifiziert werden. Pfeil 2 markiert einen Negativkontroll-Ansatz, der keine Matrize enthält und daher im Laufe des Experiments auch kein Amplifikationssignal generiert. Das Fluoreszenzsignal von Mismatch-Controller-Oligonukleotid-Ansatz und Negativkontrolle sind nahezu deckungsgleich, was zeigt, wie stark die Amplifikation in der Mismatch-Situation unterdrückt wird.  Figure 32B shows a typical course of the EvaGreen fluorescence signal in the course of an allele-specific amplification reaction using a mismatch controller oligonucleotide. On the Y-axis is the fluorescence signal of the EvaGreen dye and on the X-axis the reaction time (as cycle number) is plotted. Arrow 1 marks a mismatch amplification approach. Due to the mismatch controller oligonucleotide, the template can not be amplified. Arrow 2 marks a negative control approach that does not contain a template and thus does not generate an amplification signal during the course of the experiment. The fluorescence signal from the mismatch controller oligonucleotide approach and negative control are nearly congruent, indicating how much the amplification in the mismatch situation is suppressed.
Fig. 32 C zeigt die Schmelzkurven der Allel-spezifischen Amplifikationsprodukte aus Fig. 32A und 32 B. Auf der Y-Achse ist die Ableitung des Fluoreszenzsignals gegen die Temperatur und auf der X-Achse ist die Temperatur aufgetragen. Es wurden zwei charakteristische Peaks gefunden, markiert mit Pfeil 1 und 2. Der Peak bei Position 1 mit einem Schmelzpunkt in der Nähe von 65 °C gehört zum Mismatch-Controller-Oligonukleotid-Ansatz. Der Signalverlauf ist nicht von Negativkontroll-Ansätzen (= Amplifikationsreaktion ohne Matrize) zu unterscheiden. Dem gegenüber zu stellen ist der Peak bei Position 2 mit einem Schmelzpunkt in der Nähe von etwa 85 °C. Dieser Peak gehört zum Perfekt-Match-Controller-Oligonukleotid-Ansatz und ist spezifisch für das gebildete Amplifikationsprodukt. Die Ergebnisse legen nahe, dass in der Perfekt-Match- Situation spezifische Amplifikationsprodukte mit einem definierten Schmelzpunkt in der Nähe von etwa 85 °C entstehen. Dagegen wird bei Mismatch-Controller-Oligonukleotiden die Figure 32C shows the melting curves of the allele-specific amplification products of Figures 32A and 32B. The Y-axis plots the derivative of the fluorescence signal versus temperature, and the temperature is plotted on the X-axis. Two characteristic peaks were found, marked with arrows 1 and 2. The peak at position 1 with a melting point near 65 ° C belongs to the mismatch controller oligonucleotide approach. The signal curve can not be distinguished from negative control approaches (= amplification reaction without template). the opposite is the peak at position 2 with a melting point near about 85 ° C. This peak belongs to the perfect match controller oligonucleotide approach and is specific for the amplification product formed. The results suggest that in the perfect-match situation, specific amplification products with a defined melting point close to about 85 ° C are formed. In contrast, in mismatch controller oligonucleotides, the
Amplifiktionsreaktion unterdrückt. Die Fluoreszenzsignale der Mismatch-Controller- Oligonukleotid-Ansätze waren in diesem Beispiel nicht von der Negativ-Kontrolle zu Amplification reaction suppressed. The fluorescence signals of the mismatch controller oligonucleotide batches were not in this example from the negative control
unterscheiden. Dies zeigt wie stark die Amplifikationsunterdrückung in der Mismatch-Situation ist.differ. This shows how strong the amplification suppression is in the mismatch situation.
Zusammenfassend wird festgehalten: ein Nukleotid-Mismatch im Controller-Oligonukleotid positioniert im zweiten Bereich des Controller-Oligonukleotides zum korrespondierenden ersten Bereich des Primers kann eine Amplifikation verhindern. In summary, it is stated: a nucleotide mismatch positioned in the controller oligonucleotide in the second region of the controller oligonucleotide to the corresponding first region of the primer can prevent amplification.
Ausgehend von diesem Beispiel ist zu erkennen, dass Sequenz-Varianten-spezifische  Starting from this example, it can be seen that sequence variant-specific
Amplifikations-Systeme umfassend einen Sequenz-Varianten-spezifischen Primer und ein entsprechendes komplementäres Sequenz-Varianten-spezifisches Controller-Oligonukleotid zusammengestellt werden können. Amplification systems comprising a sequence variant-specific primer and a corresponding complementary sequence variant-specific controller oligonucleotide can be assembled.
Beispiel 3  Example 3
Primer Verlängerungs-Reaktion unter Verwendung einer Matrize und Block-Oligonukleotiden mit LNA-Modifikationen zu einer Begrenzung einer Primer-Verlängerungsreaktion. Primer extension reaction using a template and block oligonucleotides with LNA modifications to limit a primer extension reaction.
In diesem Beispiel wird die Verwendung humaner genomischer DNA (hgDNA) als Quelle einer Zielsequenz gezeigt, wobei die Primer-Verlängerungsreaktion unter Verwendung von einem ersten Primer-Oligonukleotid und einem Controller-Oligonukleotid durchgeführt wird. Zur Begrenzung des Synthese-Fortschrittes wurden Block-Oligonukleotide verwendet, welche komplementär an den Matrizen-Strang in 3'-Richtung vom Primer vor dem Start einer Primer-Verlängerungsreaktion durch Hybridisierung gebunden wurden. Die Synthese wurde für 15 min bei 55°C durchgeführt. Während dieser Synthese-Phase bindet der erste Primer-Bereich an die Primer-Bindungsstelle in der Matrize und wird von der Polymerase verlängert, so dass dabei ein Primer- Verlängerungsprodukt resultiert. Der Controller wurde vor Beginn der Primer- Verlängerungsreaktion zugegeben und lag im doppelsträngigen Komplex mit dem Primer während dieser Synthese-Phase in einer nicht-aktiven Form im Ansatz vor. In this example, the use of human genomic DNA (hgDNA) as the source of a target sequence is shown wherein the primer extension reaction is performed using a first primer oligonucleotide and a controller oligonucleotide. To limit the progress of the synthesis, block oligonucleotides were used which bound complementarily to the template strand in the 3 ' direction from the primer prior to the initiation of a primer extension reaction by hybridization. The synthesis was carried out at 55 ° C for 15 min. During this synthesis phase, the first primer region binds to the primer binding site in the template and is extended by the polymerase, thereby resulting in a primer extension product. The controller was added prior to the start of the primer extension reaction and was present in the double-stranded complex with the primer during this synthesis phase in a non-active form.
Nach Abschluss der Synthese-Phase wurde die Reaktionstemperatur auf 65°C für 5 min erhöht, so dass der Komplex umfassend den Controller und den Primer bei dieser Temperatur dissoziieren konnte und der Controller nun mit dem während der Synthese-Phase gebildeten Primer- Verlängerungsprodukt interagieren konnte und es vom Matrizen-Strang trennen konnte.  Upon completion of the synthesis phase, the reaction temperature was increased to 65 ° C for 5 minutes so that the complex comprising the controller and primer could dissociate at that temperature and the controller could now interact with the primer extension product formed during the synthesis phase and separate it from the matrix strand.
Als Zielsequenz wurde ein Sequenzsegment des Faktor-V-Leiden Genes (Homo sapiens coagulation factor V (F5), mRNA, hier als FVL-Gen bezeichnet) gewählt. Zielsequenz: The target sequence was a sequence segment of the Factor V Leiden gene (Homo sapiens coagulation factor V (F5), mRNA, referred to herein as the FVL gene). Target sequence:
5 ' TGACGTGGAC ATCATGAGAG ACATCGCCTC TGGGCTAATA GGACTACTTC 5 ' TGACGTGGAC ATCATGAGAG ACATCGCCTC TGGGCTAATA GGACTACTTC
TAATCTGTAATAATCTGTAA
GAGCAGATCC CTGGACAGGC AAGGAATACA GGTATTTTGT CCTTGAAGTA ACCTTTCAGA GAGCAGATCC CTGGACAGGC AAGGAATACA GGTATTTTGT CCTTGAAGTA ACCTTTCAGA
3' (SEQ ID NO: 008) 3 ' (SEQ ID NO: 008)
Die Bindungssequenz für das erste Primer-Oligonukleotid ist unterstrichen (Primer- Bindungsstelle). Die Bindungsstelle für das Block-Oligonukleotid ist doppel-unterstrichen.  The binding sequence for the first primer oligonucleotide is underlined (primer binding site). The binding site for the block oligonucleotide is double-underlined.
Das Block-Oligonukleotid:  The block oligonucleotide:
Pl-EXB- 1000- 101  Pl-EXB-1000-101
5' {CCA GAGGCGATG}T ATCTCATGAT GTCCACAACA CTGTAGTATG GTCTTGTTAA GCAAAAA 3' X (SEQ ID NO:009) 5 ' {CCA GAGGCGATG} T ATCTCATGAT GTCCACAACA CTGTAGTATG GTCTTGTTAA GCAAAAA 3 ' X (SEQ ID NO: 009)
Das in geschweifte Klammern gesetzte Sequenzsegment {CCA GAGGCGATG} umfasst LNA- Modifikationen.  The curly-braced sequence segment {CCA GAGGCGATG} contains LNA modifications.
Der erste Primer sowie Controller-Oligonukletid wurden für FVL-Mutation Variante des Genes designet und synthetisiert.  The first primer and controller oligonucleotide were designed and synthesized for FVL mutation variant of the gene.
Das erste Primer-Oligonukleotid:  The first primer oligonucleotide:
P1 F5-200-AE2053  P1 F5-200-AE2053
5 ' AACTCAGACAAGATGTGA I I I I I I I ACCTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ' (SEQ ID NO:003) 5 ' AACTCAGACAAGATGTGA IIIIIII ACCTGTAT [CUCU GAUGCUUC] 1TACCTGTATTCC 3 ' (SEQ ID NO: 003)
Der als Primer in der Reaktion verwendetes Segment ist unterstrichen.  The segment used as the primer in the reaction is underlined.
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Dieses Oligonukleotid umfasst folgende Modifikationen:  This oligonucleotide comprises the following modifications:
1 = C3-Linker diente zur Terminierung der Synthese des zweiten Primer-Verlängerungsproduktes. 1 = C3 linker served to terminate the synthesis of the second primer extension product.
Das Segment des Primers [CUCU GAUGCUUC] umfasste 2'-0-Me-Modifikationen und diente als zweiter Primer-Bereich zur Bindung des ersten Bereichs des Controller-Oligonukleotides: Diese Sequenz kann nicht an die Matrize im Bereich neben der Primer-Bindungs-Stelle komplementär binden und steht somit für die Interaktion mit dem Controller-Oligonukleotid zur Verfügung. The segment of the primer [CUCU GAUGCUUC] included 2 '-0-Me modifications and served as the second primer region capable of binding the first portion of the controller oligonucleotide: This sequence can not take the die in the region next to the primer binding site bind complementary and is thus available for interaction with the controller oligonucleotide.
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
Der erste Primer umfasst in seinem ersten Bereich eine Sequenz, welche spezifisch an die Sequenz des Faktor-V-Leiden Genes innerhalb der genomischen DNA binden kann, so dass eine Synthese durch eine Polymerase gestartet werden kann. Der zweite Bereich des ersten Primers umfasst eine Sequenz, welche nicht an die Sequenz des FVL-Genes spezifisch hybridisiert. Weiterhin umfasst der erste Primer ein weiteres Sequenzsegment, welches an das 5'-Ende des zweiten Bereichs anknüpft. Dieses Segment nimmt an der spezifischen Primer-Verlängerung des Faktor-5-Leiden Segments nicht teil. Die Funktion dieses Segments wird vor allem in der Verzögerung von Nebenreaktionen gesehen. The first primer comprises in its first region a sequence which can specifically bind to the sequence of the Factor V Leiden gene within the genomic DNA such that synthesis by a polymerase can be started. The second region of the first primer comprises a sequence which does not specifically hybridize to the sequence of the FVL gene. Furthermore, the first primer comprises a further sequence segment which connects to the 5 ' end of the second region. This segment does not participate in the specific primer extension of the factor 5 Leiden segment. The function of this segment is mainly seen in the delay of side reactions.
Folgendes Controller-Oligonukleotid wurde verwendet:  The following controller oligonucleotide was used:
AD-F5-1001-503  AD F5-1001-503
5 ' rUAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC1AGGTAGAAGCATC 5 ' rUAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC1AGGTAGAAGCATC
AGAG X 3 ' (SEQ ID NO: 004) AGAG X 3 ' (SEQ ID NO: 004)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Das in eckigen Klammern gesetzte 5'-Segment des Oligonukleotids [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] umfasste 2'-0-Me-Nukleotid-Modifikationen:The set in square brackets 5 'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] included 2' -0-Me-nucleotide modifications:
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
X = 3'-Phosphat-Gruppe zur Blockade einer möglichen Verlängerung durch die Polymerase.X = 3 ' phosphate group to block a possible extension by the polymerase.
Die Nukleotide und Nukleotid-Modifikationen sind untereinander mit Phosphodiesterbindungen verknüpft. Das 3'-Ende des Controller-Oligonukleotides ist mit einer Phosphat-Gruppe blockiert, um eine mögliche Verlängerung durch die Polymerase zu verhindern. Dieser Controller kann mit seinem Segment (oben unterstrichen gesetzte Positionen) an das erste zu erwartende Primer- Verlängerungsprodukt komplementär binden: The nucleotides and nucleotide modifications are linked together with phosphodiester bonds. The 3 ' end of the controller oligonucleotide is blocked with a phosphate group to prevent possible extension by the polymerase. This controller can bind with its segment (positions underlined above) to the first expected primer extension product complementarily:
fUAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC1 AGGTA fSEO ID NO: 0101fUAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC1 AGGTA fSEO ID NO: 0101
Das Controller-Oligonukleotid wurde dermaßen konstruiert, dass eine Perfekt-Match-Situation zur Sequenz der Faktor-V-Leiden Mutation des FVL-Gens resultiert. Das Controller-Oligonukleotid umfasst einen ersten, zweiten und dritten Bereich. The controller oligonucleotide was designed so that a perfect match situation results in the sequence of the Factor V Leiden mutation of the FVL gene. The controller oligonucleotide comprises first, second and third regions.
Alle Reaktionen wurden in Amplifikations-Lösung 2 durchgeführt.  All reactions were performed in Amplification Solution 2.
Die verwendeten dNTPs umfassten: dATP, dGTP, dCTP, dUTP (anstatt von dTTP).  The dNTPs used included: dATP, dGTP, dCTP, dUTP (instead of dTTP).
Als Polymerase wurde Bst 2.0 Warm-Start Polymerase von NEB verwendet.  The polymerase used was Bst 2.0 Warm-Start Polymerase from NEB.
Die Primer-Verlängerungsreaktion wurde wie folgt angesetzt:  The primer extension reaction was set up as follows:
Etwa 50.000 haploider genomischer Äquivalente (HGE), 150 ng hgDNA in 40 pl, FVL-WHO- Standard, doppelsträngig, wurden im Reaktions-Lösung 2 in Kontakt mit einem Block- Oligonukleotid (0,3 pmol/l) gebracht und durch Erhitzung zunächst denaturiert (5 min bei 95°C) und anschließend auf Raumtemperatur abgekühlt. Anschließend wurden in die Reaktion der erste Primer (2 mitioI/I) zusammen mit dem Controller- Oligonukleotid (1 pmol/L) zugegeben und anschließend wurde Bst-2.0 Warm Start Polymerase (etwa 1 unit), sowie dNTPs (ca. 250 mitioI/I) zugegeben und das Reaktionsvolumen auf 50 mI gebracht. Das resultierende Reaktions-Gemisch wurde unter stringenten Primer- Verlängerungsbedingungen (Amplifikationslösung 2, Temperatur von etwa 55°C) für ca. 15 min inkubiert. Während dieser Phase erfolgt eine Verlängerung des ersten Primers, wobei die genomische DNA als Matrize diente. Es resultierte ein Primer-Verlängerungsprodukt. Da während dieser Phase das Controller-Oligonukleotid vom ersten Primer komplexiertwird (und somit in einem inaktiven Zustand vorliegt), lag das gebildete Primer-Verlängerungsprodukt im doppelsträngigen Komplex mit der Matrize. Um dieses Produkt von der Matrize sequenzspezifisch abzulösen, wurde das Reaktionsgemisch auf 65°C erhitzt und ca. 5 min inkubiert. Während dieser Phase wurde das Primer-Verlängerungsprodukt aus der Bindung mit der Matrize durch den Controller zumindest teilweise verdrängt. Das 3'-Segment des Primer-Verlängerungsproduktes dissoziierte spontan unter gewählten Reaktionsbedingungen. Ein solches Primer-Verlängerungsprodukt kann beispielsweise in einer nachfolgenden Amplifikations-Reaktion in Analogie zum Beispiel 1 verwendet werden. Approximately 50,000 haploid genomic equivalents (HGE), 150 ng of hgDNA in 40 pl, FVL-WHO standard, double-stranded, were placed in reaction solution 2 in contact with a block oligonucleotide (0.3 pmol / l) and heated by heating denatured (5 min at 95 ° C) and then cooled to room temperature. Subsequently, in the reaction, the first primer (2 mitioI / I) was added together with the controller oligonucleotide (1 pmol / L), followed by Bst-2.0 Warm Start Polymerase (about 1 unit), and dNTPs (about 250 ml / l). I) was added and the reaction volume brought to 50 ml. The resulting reaction mixture was incubated under stringent primer extension conditions (Amplification Solution 2, temperature of about 55 ° C) for about 15 min. During this phase, the first primer is extended, with the genomic DNA as template. This resulted in a primer extension product. Since during this phase the controller oligonucleotide is complexed by the first primer (and thus in an inactive state), the primer extension product formed was in the double-stranded complex with the template. In order to remove this product from the template sequence-specific, the reaction mixture was heated to 65 ° C and incubated for about 5 min. During this phase, the primer extension product from binding to the template was at least partially displaced by the controller. The 3 ' segment of the primer extension product spontaneously dissociated under selected reaction conditions. Such a primer extension product can be used, for example, in a subsequent amplification reaction in analogy to Example 1.
Eine solche Anordnung von Block-Oligonukleotiden an einer Matrize und somit eine Begrenzung der Länge eines Primer-Verlängerungsproduktes kann beispielsweise bei Bereitstellung eines Nukleinsäure-Fragmentes verwendet werden, welches als Start-Nukleinsäure in einer spezifischen exponentiellen Amplifikation verwendet werden soll. Zwar kann eine solche Start-Nukleinsäure als Primer-Verlängerungs-Reaktion auch ohne ein Block-Oligonukleotid erfolgen (Fig. 33 A und B). Die Undefinierte Länge eines Primer-Verlängerungsfragments, welches beim Kopieren des Matrizenstranges dabei entstehen kann, kann allerdings eine Sequenz-unspezifische, z.B. eine Temperatur-bedingte Strang-Trennung erforderlich machen (Fig. 33 C). Die Bindung eines zweiten Amplifikations-Primers erfolgt dabei im mittleren Bereich eines solchen Primer- Verlängerungsproduktes (Fig. 33 C und D).  Such an arrangement of block oligonucleotides on a template and thus limiting the length of a primer extension product can be used, for example, in providing a nucleic acid fragment to be used as a starting nucleic acid in a specific exponential amplification. Although such a start nucleic acid as a primer extension reaction also without a block oligonucleotide take place (Fig. 33 A and B). However, the undefined length of a primer extension fragment that may result from copying the template strand may be a sequence unspecific, e.g. require a temperature-related strand separation (Fig. 33 C). The binding of a second amplification primer takes place in the middle region of such a primer extension product (FIGS. 33 C and D).
Die Verwendung eines Block-Oligonukleotides erlaubt dagegen eine beinahe willkürliche spezifische Begrenzung der Länge eines Primer-Verlängerungsproduktes, ungeachtet der Länge eines Matrizenstranges (Fig. 34 A und B). Weiterhin begünstigt das Block-Oligonukleotid eine sequenzabhängige Trennung von gebildeten Primer-Verlängerungsprodukten bereits vor Beginn einer Amplifikation. Dabei erfolgt beispielsweise zunächst eine Synthese-Phase einer Primer- Verlängerung und anschließend eine Controlling-Phase (Sequenzielle Anordnung von Schritten). In einer anderen Ausführungsform kann die Synthese-Phase und die Controlling-Phase mit der Trennung des Primer-Verlängerungsproduktes in einem Schritt ablaufen und parallel zu einander stattfinden).  In contrast, the use of a block oligonucleotide allows an almost arbitrary specific limitation on the length of a primer extension product, regardless of the length of a template strand (Figures 34A and B). Furthermore, the block oligonucleotide favors sequence-dependent separation of formed primer extension products even prior to initiation of amplification. In this case, for example, first a synthesis phase of a primer extension and then a controlling phase (sequential arrangement of steps). In another embodiment, the synthesis phase and the controlling phase may proceed with the separation of the primer extension product in one step and take place in parallel with each other).
Im Ergebnis wird ein spezifisches Primer-Verlängerungsprodukt erzeugt und sequenzspezifisch von der Matrize unter Mitwirkung eines Controllers getrennt, ohne dabei einen unspezifischen Denaturierungs-Schritt einsetzten zu müssen (Fig. 34 B und C). Ein solches Primer- Verlängerungsprodukt kann als Start-Nukleinsäure für eine weitere Amplifikation verwendet werden (Fig. 34 D und E). Dadurch kann die Spezifität der Erstellung einer Start-Nukleinsäure erhöht werden. As a result, a specific primer extension product is generated and separated sequence-specifically from the template with the assistance of a controller, without having to resort to a nonspecific denaturation step (Figures 34 B and C). Such a primer Extension product can be used as starting nucleic acid for further amplification (Figures 34D and E). This can increase the specificity of creating a starting nucleic acid.
Das Block-Oligonukleotid dient vorzugsweise selbst nicht als Primer. Das kann beispielsweise durch Blockade seiner 3'-OH Gruppe erfolgen. Das Block-Oligonukleotid umfasst somit mindestens ein Sequenzsegment, welches zum Matrizen-Strang komplementär ist, an welchem auch die Primer-Verlängerungs-Reaktion erfolgt. Dieses Segment (Blockierendes Segment) ist vorzugsweise hinreichend lang bzw. umfasst ggf. Modifikationen, um bei Reaktionsbedingungen einer Primer-Verlängerungsreaktion mit dem Matrizenstrang einen stabilen Doppelstrang zu bilden. Weiterhin kann ein solches Block-Oligonukleotid auch Sequenz-Segmente umfassen, welche nicht zum Matrizen-Strang komplementär sind. Solche Sequenzsegmente können beispielsweise das Segment, welches an die Matrize binden soll und die Primer-Verlängerungs- Reaktion blockieren soll, auf beiden Seiten flankieren. Das Block-Oligonukleotid kann beispielsweise in einem Sequenzsegment einer Zielnukleinsäure lokalisiert sein oder an einem ihrer Enden platziert werden. Das Block-Oligonukleotid ist somit dermaßen angeordnet, dass es in 3'-Richtung vom zu erwartenden Primer-Verlängerungsprodukt an der Matrize lokalisiert ist und die Polymerase am weiteren Kopieren des Matrizenstranges hindert. The block oligonucleotide preferably does not itself serve as a primer. This can be done for example by blocking its 3 'OH group. The block oligonucleotide thus comprises at least one sequence segment which is complementary to the template strand on which the primer extension reaction also takes place. This segment (blocking segment) is preferably sufficiently long, or may include modifications, to form a stable duplex upon reaction conditions of a primer extension reaction with the template strand. Furthermore, such a block oligonucleotide may also comprise sequence segments that are not complementary to the template strand. For example, such sequence segments may flank the segment which is to bind to the template and block the primer extension reaction on both sides. For example, the block oligonucleotide may be located in a sequence segment of a target nucleic acid or placed at one of its ends. The block oligonucleotide is thus located such that it is located in the 3 ' direction of the expected primer extension product on the template and prevents the polymerase from further copying the template strand.
Das Ziel einer Primer-Verlängerungsreaktion kann die Herstellung einer Start-Nukleinsäurekette für eine anschließende Amplifikations-Reaktion darstellen. Eine solche Start-Nukleinsäurekette wird zu Beginn einer Amplifikations-Reaktion eingesetzt. Ihre Funktion kann dahingehend gesehen werden, dass sie die anfängliche Matrize darstellt, welche eine korrekte Positionierung von Primern, der Synthese-Abschnitte zwischen beiden Primern, sowie die Initiierung von Bindungs und Verlängerungsvorgängen ermöglicht. In bestimmten Ausführungsformen umfasst eine Start- Nukleinsäurekette eine Zielsequenz.  The goal of a primer extension reaction may be the production of a starting nucleic acid chain for a subsequent amplification reaction. Such a starting nucleic acid chain is used at the beginning of an amplification reaction. Their function can be seen as representing the initial template which allows for correct positioning of primers, the synthesis portions between both primers, and the initiation of binding and extension events. In certain embodiments, a start-up nucleic acid chain comprises a target sequence.
Durch die Bindung von Primern an ihre entsprechenden Primer-Bindungsstellen (PBS 1 und PBS 2) und die Initiierung von entsprechenden Primer-Verlängerungsreaktionen erfolgt durch Generierung von ersten Primer-Verlängerungsprodukten. Diese werden als spezifische Kopien der zu Beginn der Reaktion vorliegenden Nukleinsäurekette synthetisiert.  By binding primers to their corresponding primer binding sites (PBS 1 and PBS 2) and initiating appropriate primer extension reactions, generation of first primer extension products occurs. These are synthesized as specific copies of the nucleic acid chain present at the beginning of the reaction.
In bestimmten Ausführungsformen kann die in das Reaktionsgemisch vor Beginn der Amplifikations-Reaktion einzusetzende Nukleinsäurekette (Start-Nukleinsäurekette) mit der zu amplifizierenden Nukleinsäurekette identisch sein. Durch die Amplifikations-Reaktion wird lediglich die Menge einer solchen Nukleinsäurekette vermehrt.  In certain embodiments, the nucleic acid sequence (starting nucleic acid chain) to be inserted into the reaction mixture prior to the start of the amplification reaction may be identical to the nucleic acid sequence to be amplified. The amplification reaction only increases the amount of such a nucleic acid chain.
In bestimmten Ausführungsformen unterscheiden sich die zu amplifizierende Nukleinsäure und die Start-Nukleinsäurekette dahingehend, dass die Start-Nukleinsäurekette zwar die Anordnung einzelner Sequenzelemente der zu amplifizierenden Nukleinsäurekette vorgibt, doch die Sequenzzusammensetzung der Start-Nukleinsäurekette von der Sequenz der zu amplifizierenden Nukleinsäurekette abweichen kann. Beispielsweise können im Rahmen der Primer-Bindung und Verlängerung während einer Amplifikation neue Sequenzinhalte (bezogen auf die Start- Nukleinsäurekette) in die zu amplifizierende Nukleinsäurekette integriert werden. Weiterhin können sich Sequenzelemente einer zu amplifizierenden Nukleinsäurekette von solchen Sequenzelementen einer Start-Nukleinsäurekette in ihrer Sequenzzusammensetzung unterscheiden (z.B. Primer-Bindungsstellen oder Primer-Sequenzen). Die Start-Nukleinsäure dient nur als initiale Matrize für die spezifische Synthese der zu amplifizierenen Nukleinsäurekette. Diese initiale Matrize kann im Reaktionsgemisch bis zum Ende der Amplifikation verbleiben. Durch den exponentiellen Charakter der Amplifikation überwiegt allerdings die Menge der zu amplifizierenden Nukleinsäurekette am Ende einer Amplifikationsreaktion gegenüber der Menge einer in die Reaktion zugegebenen Start-Nukleinsäurekette. In certain embodiments, the nucleic acid to be amplified and the starting nucleic acid chain differ in that the starting nucleic acid chain prescribes the arrangement of individual sequence elements of the nucleic acid chain to be amplified, but the sequence composition of the starting nucleic acid chain can deviate from the sequence of the nucleic acid chain to be amplified. For example, in the context of primer binding and Extension during amplification new sequence contents (based on the starting nucleic acid chain) are integrated into the nucleic acid chain to be amplified. Furthermore, sequence elements of a nucleic acid chain to be amplified may differ from such sequence elements of a starting nucleic acid chain in their sequence composition (eg primer binding sites or primer sequences). The starting nucleic acid serves only as an initial template for the specific synthesis of the nucleic acid chain to be amplified. This initial template may remain in the reaction mixture until the end of the amplification. Due to the exponential nature of the amplification, however, the amount of nucleic acid chain to be amplified at the end of an amplification reaction is greater than the amount of starting nucleic acid chain added to the reaction.
Die Start-Nukleinsäurekette umfasst in bestimmten Ausführungsformen eine Zielsequenz oder ihre Teil-Segmente, welche zumindest eine zu erwartende Sequenz-Variante eines polymorphen Lokus der Zielsequenz umfassen.  The starting nucleic acid sequence, in certain embodiments, comprises a target sequence or its partial segments which comprise at least one expected sequence variant of a polymorphic locus of the target sequence.
Eine Start-Nukleinsäure umfasst weiterhin zumindest ein vorwiegend einzelsträngiges Sequenzsegment, zu welchem mindestens einer der Primer des Amplifikations-Systems mit seinem 3'-Segment vorwiegend komplementär binden kann, so dass die verwendete Polymerase einen solchen Primer, wenn hybridisiert an die Start-Nukleinsäurekette, matrizenspezifisch unter Einbau von dNTPs verlängern kann. A start nucleic acid further comprises at least one predominantly single-stranded sequence segment, to which at least one of the primers of the amplification system can bind predominantly complementary to its 3 ' segment, so that the polymerase used such a primer, when hybridized to the starting nucleic acid chain, may extend template-specific incorporation of dNTPs.
Eine Start-Nukleinsäure, welche mehrere Sequenzvarianten in einem polymorphen Lokus einer Zielsequenz umfassen kann, umfasst vorzugsweise weiterhin mindestens ein erstes Zielsequenzsegment, welches für alle Zielsequenzvarianten charakteristisch und einheitlich ist. In bestimmten Ausführungsformen umfasst eine Start-Nukleinsäure mindestens zwei Zielsequenzsegmente (ein erstes Zielsequenzsegment und ein zweites Zielsequenzsegment), welche auf beiden Seiten eines polymorphen Lokus einer Zielsequenz lokalisiert sind und somit die Sequenzvarianten einer Zielsequenz von beiden Seiten flankieren.  A start-up nucleic acid, which may comprise multiple sequence variants in a polymorphic locus of a target sequence, preferably further comprises at least a first target sequence segment that is characteristic and unitary for all target sequence variants. In certain embodiments, a starting nucleic acid comprises at least two target sequence segments (a first target sequence segment and a second target sequence segment) located on either side of a polymorphic locus of a target sequence, thus flanking the sequence variants of a target sequence from both sides.
Die Länge eines polymorphen Lokus einer Start-Nukleinsäureke kann Bereiche von einem Nukleotid bis zu 200 Nukleotiden, insbesondere von einem Nukleotid bis zu 50 Nukleotiden, insbesondere von einem Nukleotid bis zu 20 Nukleotiden umfassen. Die Längen von einheitlichen Sequenzsegmenten (erstes und zweites einheitliches Sequenzsegment einer Start-Nukleinsäure) kann zumindest für eines der beiden einheitlichen Sequenz-Segmente folgende Bereiche umfassen: von 4 bis 200 Nukleotide, insbesondere von 6 bis 100 Nukleotide, insbesondere von 8 bis 50 Nukleotide.  The length of a polymorphic locus of a starting nucleic acid nucleus may comprise regions of one nucleotide up to 200 nucleotides, in particular from one nucleotide up to 50 nucleotides, in particular from one nucleotide up to 20 nucleotides. The lengths of uniform sequence segments (first and second unitary sequence segment of a starting nucleic acid) can comprise the following regions for at least one of the two unitary sequence segments: from 4 to 200 nucleotides, in particular from 6 to 100 nucleotides, in particular from 8 to 50 nucleotides.
In bestimmten Ausführungsformen kann die Start-Nukleinsäurekette mindestens einen Sequenzabschnitt umfassen, welcher nicht amplifiziert wird. Eine solche Start-Nukleinsäurekette ist somit nicht mit der zu amplifizierenden Sequenz identisch. Solche nicht zu amplifizierenden Abschnitte können beispielsweise als Folge von Sequenz-Vorbereitungsschritten bzw. als Folge von vorangegangenen Sequenz-Manipulations-Schritten einen Sequenzabschnitt einer Start- Nukleinsäurekette repräsentieren. In certain embodiments, the startup nucleic acid chain may comprise at least one sequence segment which is not amplified. Such a start nucleic acid chain is thus not identical to the sequence to be amplified. Such portions not to be amplified may be, for example, as a consequence of sequence preparation steps or as a consequence of preceding sequence manipulation steps represent a sequence segment of a starting nucleic acid chain.
In einer bevorzugten Ausführungsform schließt die in das Reaktionsgemisch vor Beginn der Reaktion einzusetzende Start-Nukleinsäurekette mindestens eine Zielsequenz ein.  In a preferred embodiment, the starting nucleic acid sequence to be inserted into the reaction mixture prior to initiation of the reaction includes at least one target sequence.
In bestimmten Ausführungsformen schließt eine solche Start-Nukleinsäurekette mindestens eine Zielsequenz (engl. Target-Sequence) und noch weitere Sequenzen ein, welche nicht Zielsequenz (engl. Non-target Sequences) sind. Während der Amplifikation werden Sequenzsegmente umfassend die Zielsequenz exponentiell vermehrt und andere Sequenzsegmente werden dabei entweder gar nicht oder nur teilweise exponentiell vermehrt.  In certain embodiments, such a starting nucleic acid chain includes at least one target sequence and still other non-target sequence sequences. During amplification, sequence segments comprising the target sequence are multiplied exponentially and other sequence segments are either not or only partially exponentially propagated.
Aufbau einer Start-Nukleinsäurekete Construction of a starting nucleic acid ketone
Beispiel für eine solche Start-Nukleinsäurekette stellt eine Nukleinsäurekette dar, welche eine Zielsequenz oder ihre Äquivalente (beispielsweise eine zur Zielsequenz komplementäre Sequenz) einschließt und welche ein Sequenzfragment-A umfasst und ein Sequenzfragment-B umfasst. An example of such a start nucleic acid chain is a nucleic acid sequence which includes a target sequence or its equivalents (for example, a sequence complementary to the target sequence) and which comprises a sequence fragment A and comprises a sequence fragment-B.
Das Sequenzfragment-A der Start-Nukleinsäurekette umfasst eine Sequenz, die mit der Sequenz eines der beiden in der Amplifikation verwendeten Primer eine signifikante Homologie aufweist oder im Wesentlichen mit dem kopierbaren Anteil des 3'-Segments des einen Primers identisch ist. Bei Synthese eines komplementären Stranges zu diesem Segment wird eine komplementäre Sequenz generiert, welche eine entsprechende Primer-Bindungs-Stelle darstellt. Sequence fragment-A of the starting nucleic acid chain comprises a sequence which has significant homology with the sequence of one of the two primers used in the amplification or is substantially identical to the copiable portion of the 3 ' segment of the one primer. Upon synthesis of a complementary strand to this segment, a complementary sequence is generated which represents a corresponding primer binding site.
Das Sequenzfragment-B der Start-Nukleinsäurekette umfasst eine Sequenz, welche zur komplementären Bindung eines entsprechenden weiteren Primers oder seines 3'-Segmentes unter Ausbildung eines extensionsfähigen Primer-Matrizen-Komplexes geeignet ist, wobei Sequenzfragment-A und Sequenzfragment-B im Verhältnis zu einander vorwiegend / bevorzugt nicht komplementär sind. The sequence fragment B of the starting nucleic acid chain comprises a sequence which is suitable for complementarily binding a corresponding further primer or its 3 ' segment to form an extension-capable primer-template complex, wherein sequence fragment A and sequence fragment B are relative to each other predominantly / preferably are not complementary.
In einer bevorzugten Ausführungsform wird zum Reaktionsgemisch eines Amplifikationsverfahrens eine Start-Nukleinsäurekette umfassend eine Zielsequenz gegeben, welche folgende Eigenschaften aufweist:  In a preferred embodiment, the reaction mixture of an amplification process is given a starting nucleic acid chain comprising a target sequence which has the following properties:
• Sequenzsegment-5 (genannt Segment 5, S5 in Fig. 34), welches eine Sequenz umfasst, die mit der Sequenz des ersten Bereichs des ersten Primers eine signifikante Homologie aufweist oder im Wesentlichen mit dem kopierbaren Anteil des ersten Bereichs des ersten Primers identisch ist. Dieses Segment-5 liegt im 5'-Segment der Start-Nukleinsäurekette und ist von einem nicht kopierbaren Oligonukleotid-Schwanz flankiert (analog zum ersten Primer- Oligonukleotid), vorzugsweise bildet dieses Segment - 5 eine Begrenzung des kopierbaren Nukleinsäurekette-Stranges in 5'-Richtung. Sequence segment-5 (called segment 5, S5 in Figure 34) which comprises a sequence having significant homology with the sequence of the first region of the first primer or substantially identical to the copiable portion of the first region of the first primer , This segment-5 is located in the 5 ' segment of the starting nucleic acid chain and is flanked by a non-duplicable oligonucleotide tail (analogous to the first primer oligonucleotide), preferably this segment forms a boundary of the copiable nucleic acid chain strand in 5 ' . Direction.
• Das Sequenzfragment-7 (genannt Segment 7, S7), welches eine Sequenz umfasst, welche zur komplementären Bindung eines zweiten Primers oder seines 3'-Segmentes unter Ausbildung eines extensionsfähigen Primer-Matrizen-Komplexes geeignet ist. Vorzugsweise liegt das Segment 7 in 3‘-Richtung von Segment 5 der Start-Nukleinsäurekette (Fig. 34).Sequence fragment-7 (called segment 7, S7) which comprises a sequence which is capable of complementary binding of a second primer or its 3 ' segment to Training an extension-capable primer-template complex is suitable. Preferably, the segment 7 lies in the 3 'direction of segment 5 of the starting nucleic acid chain (FIG. 34).
• Die Zielsequenz, welche teilweise oder ganz zwischen Segment 5 und Segment 7 liegt (in Fig. The target sequence, which lies partially or completely between segment 5 and segment 7 (in FIG.
34 dieser Anteil der Zielsequenz wird als Segment 6, S6, bezeichnet). In einer bevorzugten Ausführungsform umfasst die Zielsequenz Segment 6 und mindestens eines von Segment 5 und / oder Segment 7.  34 this portion of the target sequence is referred to as segment 6, S6). In a preferred embodiment, the target sequence comprises segment 6 and at least one of segment 5 and / or segment 7.
• Die Start-Nukleinsäurekette kann im 3'-Segment flankierende Sequenzabschnitte umfassen (in Fig. 33 als Segment 8 bezeichnet), welche nicht amplifiziert werden. The start nucleic acid chain may comprise flanking sequence segments in the 3 ' segment (designated as segment 8 in Fig. 33) which are not amplified.
In einer weiteren Ausführungsform wird zum Reaktionsgemisch eines Amplifikationsverfahrens eine Start-Nukleinsäurekette umfassend eine zur Zielsequenz komplementäre Sequenz (Äquivalent einer Zielsequenz) gegeben, welche folgende Eigenschaften aufweist:  In a further embodiment, the reaction mixture of an amplification method is given a starting nucleic acid chain comprising a sequence complementary to the target sequence (equivalent of a target sequence), which has the following properties:
• Sequenzsegment-5 (genannt Segment 5, S5 in Fig. 34), welches eine Sequenz umfasst, die mit der Sequenz des ersten Bereichs des ersten Primers eine signifikante Homologie aufweist oder im Wesentlichen mit dem kopierbaren Anteil des ersten Bereichs des ersten Primers identisch ist. Dieses Segment-5 liegt im 5'-Segment der Start-Nukleinsäurekette und ist von einem nicht kopierbaren Oligonukleotid-Schwanz flankiert (analog zum ersten Primer-Oligonukleotid), vorzugsweise bildet dieses Segment - 5 eine Begrenzung des kopierbaren Nukleinsäurekette- Stranges in 5'-Richtung. Sequence segment-5 (called segment 5, S5 in Figure 34) which comprises a sequence having significant homology with the sequence of the first region of the first primer or substantially identical to the copiable portion of the first region of the first primer , This segment-5 is located in the 5 ' segment of the starting nucleic acid chain and is flanked by a non-copyable oligonucleotide tail (analogous to the first primer oligonucleotide), preferably this segment forms a boundary of the copiable nucleic acid chain strand in 5 ' . Direction.
• Das Sequenzfragment-7 (genannt Segment 7, S7), welches eine Sequenz umfasst, welche zur komplementären Bindung eines zweiten Primers oder seines 3'-Segmentes unter Ausbildung eines extensionsfähigen Primer-Matrizen-Komplexes geeignet ist. Vorzugsweise liegt das Segment 7 in 3‘-Richtung von Segment 5 der Start-Nukleinsäurekette (Fig. 34). The sequence fragment-7 (called segment 7, S7), which comprises a sequence which is suitable for the complementary binding of a second primer or its 3 ' segment to form an extension-capable primer-template complex. Preferably, the segment 7 lies in the 3 'direction of segment 5 of the starting nucleic acid chain (FIG. 34).
• Die zur Zielsequenz komplementäre Sequenz, welche teilweise oder ganz zwischen Segment 5 und Segment 7 liegt (in Fig. 34 dieser Anteil der Sequenz wird als Segment 6, S6, bezeichnet). In einer bevorzugten Ausführungsform umfasst die Sequenz Segment 6 und mindestens eines von Segment 5 und / oder Segment 7.  The sequence complementary to the target sequence, which lies partially or completely between segment 5 and segment 7 (in FIG. 34 this portion of the sequence is referred to as segment 6, S6). In a preferred embodiment, the sequence comprises segment 6 and at least one of segment 5 and / or segment 7.
• Die Start-Nukleinsäurekette kann im 3'-Segment flankierende Sequenzabschnitte umfassen (in Fig. 33 als Segment 8 bezeichnet), welche nicht amplifiziert werden. The start nucleic acid chain may comprise flanking sequence segments in the 3 ' segment (designated as segment 8 in Fig. 33) which are not amplified.
Funktionsweise der Start-Nukleinsäurekette Functioning of the starting nucleic acid chain
Zu Beginn der Amplifikations-Reaktion dient die Start-Nukleinsäurekette als Matrize für die initiale Entstehung von jeweiligen Primer-Verlängerungsprodukten. Sie stellt somit die Ausgangs-Matrize für die zu amplifizierende Nukleinsäurekette dar. Die Start-Nukleinsäurekette braucht nicht zwingend mit der zu amplifizierenden Nukleinsäurekette identisch zu sein. Durch Bindung und Verlängerung von beiden Primern während der Amplifikations-Reaktion bestimmen im Wesentlichen die beiden Primer, welche Sequenzen an beiden endständigen Segmenten der zu amplifizierenden Nukleinsäurekette im Rahmen der Amplifikation generiert werden. In einer bevorzugten Ausführungsform des Verfahrens werden für einen Doppelstrang nicht- denaturierende Reaktionsbedinungen während des exponentiellen Amplifikationsvorgangs aufrechterhalten. Daher ist es vorteilhaft, wenn die Start-Nukleinsäurekette eine Begrenzung in ihrem durch eine Polymerase verlängerbaren 5'-Sequenzsegment aufweist, was zu einem Stopp in der enzymatischen Verlängerung eines entsprechenden Primers führt. Damit wird die Länge der unter Reaktionsbedinungen generierten Primer-Verlängerungsfragmente begrenzt. Das kann sich vorteilhaft auf die Strangverdrängung durch das Controller-Oligonukleotid auswirken und zu einer Dissoziation des jeweiligen Stranges führen, so dass Primer-Bindungsstellen in einen einzelsträngigen Zustand überführt werden und somit für eine erneute Bindung von Primern zugängig werden. At the beginning of the amplification reaction, the starting nucleic acid chain serves as a template for the initial generation of respective primer extension products. It thus represents the starting template for the nucleic acid chain to be amplified. The starting nucleic acid chain does not necessarily have to be identical to the nucleic acid chain to be amplified. By binding and extending both primers during the amplification reaction, essentially the two primers determine which sequences are generated at both terminal segments of the nucleic acid chain to be amplified as part of the amplification. In a preferred embodiment of the process, non-denaturing reaction conditions are maintained for a double strand during the exponential amplification process. Therefore, it is advantageous if the starting nucleic acid chain has a restriction in its polymerase-extendable 5 ' sequence segment, resulting in a stop in the enzymatic extension of a corresponding primer. This limits the length of the primer extension fragments generated under reaction conditions. This can have an advantageous effect on the strand displacement by the controller oligonucleotide and lead to a dissociation of the respective strand, so that primer binding sites are converted into a single-stranded state and thus become available for a recapture of primers.
Beispiel 4: Einfluss eines Controller-Oligonukleotids auf die Primer-Verlängerungs-Reaktion bei einer parallel stattfindenden Synthese-Phase und Controlling-Phase: Example 4 Influence of a Controller Oligonucleotide on the Primer Extension Reaction in a Parallel Synthesis Phase and Controlling Phase:
Die Reaktionen wurden in der Amplifikations-Lösung 2 durchgeführt.  The reactions were carried out in Amplification Solution 2.
Folgende Matrizen wurden verwendet (DNA-Matrizen):  The following matrices were used (DNA matrices):
P1 Ex-400-4001  P1 Ex-400-4001
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATACAGGTA  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATACAGGTA
A 3'(SEQ ID NO:01 1 ) A 3 ' (SEQ ID NO: 01 1)
P1 EX-400-4002  P1 EX-400-4002
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GAATACAGGTA A  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GAATACAGGTA A
(SEQ ID NO:012) (SEQ ID NO: 012)
P1 EX-400-4003  P1 EX-400-4003
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA AATACAGGTA A  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA AATACAGGTA A
(SEQ ID NO:013) (SEQ ID NO: 013)
P1 EX-400-4004  P1 EX-400-4004
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATAAAGGTA  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATAAAGGTA
A (SEQ ID NO:014) A (SEQ ID NO: 014)
P1 EX-400-4005  P1 EX-400-4005
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA AGAATACAGGTA  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA AGAATACAGGTA
A (SEQ ID NO:015) A (SEQ ID NO: 015)
DNA-Matrizen mit Iso-dC  DNA templates with iso-dC
P1 EX-400-4201 (ist identisch mit SEQ ID NO 1 1 ; weist aber in der unten gezeigten Sequenz ein Iso-dC anstelle des fett gesetzten G an Position 47 auf:) C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATACAGGTA A 3'(SEQ ID NO:01 1 ) P1 EX-400-4201 (is identical to SEQ ID NO 1 1 but has an iso-dC instead of the bold G at position 47 in the sequence shown below :) C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAGGC AA GGAATACAGGTA A 3 ' (SEQ ID NO: 01 1)
CTTACAGTAA GTGACATTGT AGTATGAGCG ATCCCTGGAC AGGCAA 1 GAATACAGGTA A(SEQ ID NO:016)  CTTACAGTAA GTGACATTGT AGTATGAGCG ATCCCTGGAC AGGCAA 1 GAATACAGGTA A (SEQ ID NO: 016)
P1 EX-400-4202 (ist identisch mit SEQ ID NO 1 1 ; weist aber i ein Iso-dC anstelle des G an Position 43 auf:)  P1 EX-400-4202 (is identical to SEQ ID NO 1 but has i an iso-dC instead of G at position 43 :)
C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAG1 C AA GGAATACAGGTA A (SEQ ID NO:017)  C TTACAG TAAGTGACATTGTAG TATG AGC GATCC CTGGACAG1 C AA GGAATACAGGTA A (SEQ ID NO: 017)
1 = 5-Me-lso-dC (Nukleotid kann nur mit Iso-dG eine komplementäre Nukleobase bilden. Es bildet keine„typische Watson-Crick“ Basenpaarung mit einem der verwendeten dNTP's, so dass die Überwindung dieser Position nur durch Mismatch-Bildung erfolgen kann). 1 = 5-Me-iso-dC (nucleotide can form only with iso-dG a complementary nucleobase. There is no "typical Watson-Crick" base pairing with one of the dNTP used 's, so that overcoming this position only by mismatch Education can take place).
Die Matrizen wurden dermaßen in ihrer Sequenzzusammensetzung variiert, so dass daraus resultierende Primer-Verlängerungsprodukte unterschiedlich mit dem Controller-Oligonukleotid interagieren können. Je nach Sequenzzusammensetzung der Matrize konnte somit entweder eine perfekt-match Übereinstimmung oder auch ein Mismatch im Komplex aus Primer- Verlängerungsprodukt / Controller generiert werden.  The templates were varied in their sequence composition so that resulting primer extension products can interact differently with the controller oligonucleotide. Depending on the sequence composition of the template, either a perfect-match agreement or a mismatch in the complex of primer extension product / controller could be generated.
Zur Testung eines Polymerase-Fehlers wurden Matrizen verwendet, welche an bestimmten Positionen ein Iso-dC einschließen. Da dieses Nukleotid kein natürliches Korrelat umfasst, muss eine Polymerase einen Mismatch generieren und erst bei Überwindung dieses Mismatches kann die Verdrängung der Sonde (s.u.) stattfinden. Somit repräsentieren Matrizen mit Iso-dC ein Beispiel für die Primer-Verlängerungs-Reaktionen, welche unter einer Mismatch-Bildung (z.B. infolge eines Polymrease-Fehlers) entstehen. Matrizen mit Iso-dC sollen lediglich die Änderungen im Verhalten der Primer-Verlängerungs-Reaktionen und den Einfluss von dem Controller auf das Verhalten der Polymerasen / Synthese von komplementären Strängen veranschaulichen.  To test for a polymerase error, templates were used which include an iso-dC at certain positions. Since this nucleotide does not comprise a natural correlate, a polymerase must generate a mismatch and only when this mismatch is overcome can the displacement of the probe (see above) take place. Thus, matrices with Iso-dC represent an example of the primer extension reactions that result from mismatch formation (e.g., due to a polymrease defect). Iso-dC matrices are intended to illustrate only the changes in the behavior of the primer extension reactions and the influence of the controller on the behavior of the polymerases / synthesis of complementary strands.
Folgende Primer wurden verwendet:  The following primers were used:
SEQP1 F5 300-35X  SEQP1 F5 300-35X
5‘ AC GAAG CTCGCAAGAAC TCAG AG TGTG CTCGAC AC TACCTGTATTCC 3' (SEQ ID NO: 018) 5 'AC GAAG CTCGCAAGAAC TCAG AG TGTG CTCGAC AC TACCTGTATTCC 3 ' (SEQ ID NO: 018)
Der erste Primer-Bereich ist unterstrichen. Mit diesem Segment kann der Primer an perfekt-match Templates binden.  The first primer area is underlined. With this segment, the primer can bind to perfect-match templates.
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Dieser Primer umfasst kein Segment, welches mit dem ersten Bereich des Controller- Oligonukleotides interagieren kann. Somit kann ein Controller-Oligonukleotid bei Verlängerung dieses Primers das gebildete Primer-Verlängerungsprodukt nicht vom Matrizenstrang trennen. P1 F5-001 -1003 This primer does not include a segment that can interact with the first region of the controller oligonucleotide. Thus, upon extension of this primer, a controller oligonucleotide can not separate the formed primer extension product from the template strand. P1 F5-001 -1003
5' TMR - [CU GAUGCUUC] 1 TACCTGTATTCC 3’ (SEQ ID NO: 019) 5 ' TMR - [CU GAUGCUUC] 1 TACCTGTATTCC 3' (SEQ ID NO: 019)
1 = C3-LINKER  1 = C3-LINKER
Der erste Primer-Bereich ist unterstrichen. Mit diesem Segment kann der Primer an perfekt- match Templates binden.  The first primer area is underlined. With this segment, the primer can bind to perfect match templates.
Das in eckige Klammern gesetzte Segment [CU GAUGCUUC] umfasst 2'-0-Me-Modifikationen und stellt den zweiten Bereich des Primers dar. The square segment [CU GAUGCUUC] contains 2 ' -0-Me modifications and represents the second region of the primer.
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
TMR = Tetramethyl-Rhodamin am 5'-Ende TMR = tetramethyl-rhodamine at the 5 ' end
Folgendes Controller-Oligonukleotid wurde verwendet:  The following controller oligonucleotide was used:
AD-F5-1001-503  AD F5-1001-503
5'[UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA G G AA U AC] AG GT AG AAG CAT C AGAG X 3'(SEQ ID NO: 020) 5 ' [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GG AA U AC] AG GT AG AAG CAT C AGAG X 3 ' (SEQ ID NO: 020)
A = 2'-deoxy-Adenosin; C = 2'-deoxy-Cytosin; G = 2'-deoxy-Guanosin; T = 2'-deoxy-Thymidin (Thymidin) A = 2 'deoxy-adenosine; C = 2 'deoxy-cytosine; G = 2 'deoxy-guanosine; T = 2 'deoxy-thymidine (thymidine)
Das 5'-Segment des Oligonukleotids [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] umfasste 2'-0-Me-Nukleotid-Modifikationen: The 5 'segment of the oligonucleotide [UAAUCUGUAA GAGCAGAUCC CUGGACAGGC AA GGAAUAC] included 2' -0-Me-nucleotide modifications:
Modifikationen: A = (2'-0-Methyl-Adenosine), G = (2'-0-Methyl-Guanosine); C = (2'-0-Methyl- Cytosine); U = (2'-0-Methyl-Uridine) Modifications: A = (2 '-0-methyl-adenosine), G = (2' -0-methyl-guanosine); C = (2 '-0-methyl cytosines); U = (2 '-0-methyl-uridine)
X = 3'-Phosphat-Gruppe zur Blockade einer möglichen Verlängerung durch die Polymerase.X = 3 ' phosphate group to block a possible extension by the polymerase.
Das Controller-Oligonukleotid kann in diesem Beispiel mit bestimmten Primer- Verlängerungsprodukten einen perfekt-match bilden. Mit anderen Primer-Verlängerungsprodukten kann es einen Mismatch bilden. The controller oligonucleotide can be a perfect match in this example with certain primer extension products. It can mismatch with other primer extension products.
Zur Überwachung des Fortschrittes der Primer-Verlängerungs-Reaktion wurde eine Fluoreszenz- Sonde verwendet, welche an das 5'-Segment der verwendeten Matrizen binden kann. Bei Verdrängung dieser Sonde aus der Bindung mit diesem 5'-Segment der jeweiligen Matrize kommt es zur Minderung des Signals der Sonde (Intramolekulares Quenchinng zwischen dT-BHQ1 und FAM-Reporter) To monitor the progress of the primer extension reaction, a fluorescent probe was used which can bind to the 5 ' segment of the templates used. Displacement of this probe from binding with this 5 ' segment of the respective template reduces the signal from the probe (intramolecular quenching between dT-BHQ1 and FAM reporter)
Fluoreszenz-Sonde:  Fluorescent probe:
P2D-LUX-1000-101  P2D-LUX-1000-101
FAM- 5' TAGTATGAGC TTTT 1 G CT CAT AC2 AC AATGTCACTT A CTGTAA GAGCAGA (SEQ ID NO:021 ) 1 = HEG FAM-5 ' TAGTATGAGC TTTT 1G CT CAT AC2 AC AATGTCACTT A CTGTAA GAGCAGA (SEQ ID NO: 021) 1 = HEG
2 = dT-BHQ1  2 = dT-BHQ1
Die Sonde wurde in 0,2 pmol/L Konzentration verwendet. Die Matrizen wurden in einer Konzentration von 0,5 mitioI/I verwendet, die Primer wurden in 1 mitioI/I Konzentration eingesetzt und Controller (wenn verwendet, wie indiziert) wurden bei 2 mitioI/I verwendet. Bst-2.0 Warm-Start (NEB) wurde in einer Konzentration eingesetzt von 4 Units / 10 mI.  The probe was used in 0.2 pmol / L concentration. Matrices were used at a concentration of 0.5 μg / L, primers were used at 1 μg / L concentration, and controllers (when used as indicated) were used at 2 μg / L. Bst-2.0 warm-start (NEB) was used in a concentration of 4 units / 10 mI.
Die Reaktionen wurden in einem StepOne Plus Gerät durchgeführt bei einer Temperatur von 55°C. Die Signal-Detektion erfolgte via FAM-Kanal. Die Reaktion wurde kontinuierlich überwacht (Sampling-Interval = 10 sec). Als Kontrolle der Signal-Intensität dienten zum einen Reaktions- Ansätze ohne Polymerase (aber mit allen anderen Komponenten) oder alternativ mit Polymerase aber ohne Matrize.  The reactions were carried out in a StepOne Plus instrument at a temperature of 55 ° C. The signal detection took place via FAM channel. The reaction was monitored continuously (sampling interval = 10 sec). As a control of the signal intensity served on the one hand reaction approaches without polymerase (but with all other components) or alternatively with polymerase but without template.
Die Tm von PBS (perfekt match) der Matrize mit dem ersten Bereich des Primers betrug ca. The Tm of PBS (perfect match) of the template with the first region of the primer was approximately
45°C. Die Tm von Controller-Oligonukleotid / Primer (P1 F5-001 -1003) betrug ca. 57°C. Die Reaktionstemperatur der Primer-Verlängerungs-Reaktion war 55°C. Die Reaktion verlief über 100 min. 45 ° C. The Tm of controller oligonucleotide / primer (P1 F5-001-1003) was about 57 ° C. The reaction temperature of the primer extension reaction was 55 ° C. The reaction proceeded for 100 min.
Die Ergebnisse von einzelnen Reaktionen sind in Fig. 36 zusammengefasst.  The results of individual reactions are summarized in FIG.
Die Kinetik einzelner Reaktionen wurde anhand der Veränderung des Fluoreszenzsignals ausgewertet.  The kinetics of individual reactions were evaluated on the basis of the change in the fluorescence signal.
Nachfolgend wird die Auswertung von representativen Datensätzen dargestellt:  The following shows the evaluation of representative data records:
Reaktion 1 (Fig. 36 A): Bei perfekt-match Bindung eines Primers in Abwesenheit eines Controllers erfolgte eine rasche Primer-Verlängerung und Sonden-Verdrängung, so dass bereits bei der ersten Signal-Erfassung mehr als 70% der Sonden vom 5'-Segment der Matrizen abgelöst waren und das Signal stark gemindert war bereits zu Beginn der Messung. Reaction 1 (Figure 36A): With perfect-match binding of a primer in the absence of a controller, rapid primer extension and probe displacement occurred, so that more than 70% of the probes were already separated from the 5 ' at the first signal acquisition. Segment of the matrices were detached and the signal was greatly reduced already at the beginning of the measurement.
Reaktion 2 (Fig. 36 A): Bei perfekt-match Bindung eines Primers in Anwesenheit eines Controllers erfolgte ebenfalls eine schnelle Primer-Verlängerung und Sonden-Verdrängung, welche allerdings langsamer verläuft verglichen mit Reaktion 1 ohne Controller.  Reaction 2 (Figure 36A): With perfect match binding of a primer in the presence of a controller, there was also fast primer extension and probe displacement, which, however, is slower compared to reaction 1 without controller.
Reaktion 3 (Fig. 36 A): diente als Referenz-Signal für Sonde in Abwesenheit einer Polymerase. Reaction 3 (Figure 36A): served as a probe reference signal in the absence of a polymerase.
Reaktionen 4 - 6 (Fig. 36 B) zeigen Reaktionen mit einem Primer, welches nicht mit dem  Reactions 4-6 (Figure 36B) show reactions with a primer which does not interfere with the
Controller im ersten Bereich interagieren kann (dieser Primer hat keinen zweiten Bereich, welcher komplementär an den ersten Bereich des Controllers binden kann). Die Anwesenheit des Controllers scheint keinen detektierbaren Einfluss auf den Verlauf dieser Reaktion zu haben. Bei gewählten Reaktionsbedingungen stört der Controller den Verlauf dieser Reaktion kaum. Controller in the first area can interact (this primer has no second area, which can bind complementary to the first area of the controller). The presence of the controller seems to have no detectable influence on the course of this reaction. At selected reaction conditions, the controller hardly disturbs the course of this reaction.
Einführung eines Mismatches in Primer-Bindungs-Stelle in der Matrize  Introduction of a mismatch in primer binding site in the template
Reaktionen 7 und 8 zeigen, dass das Fehlen eines komplementären Nukleotides in der Matrize (3'-terminales Mismatch) zu einer vollständigen Verhinderung der Primer-Verlängerungs- Reaktion führt (Fig. 37A). Analoges Reaktionsverhalten wurde bei Matrizen P1 EX-400-4003, P1 EX-400-4004, P1 EX-400-4005, P1 EX-400-4201 beobachet (Fehlen von 2 terminalen Reactions 7 and 8 show that the absence of a complementary nucleotide in the template (3 ' -terminal mismatch) results in complete prevention of the primer extension reaction (Figure 37A). Analogous reaction behavior was observed for matrices P1 EX-400-4003, P1 EX-400-4004, P1 EX-400-4005, P1 EX-400-4201 (absence of 2 terminal
Nukleotiden, ein Mismatch in der Mitte von PBS, eine Substitution von G auf A (Mismatch), eine Substitution von G auf Iso-dC). In keiner der Reaktionen wurde die Sonde verdrängt. Das zeigt, dass sich die Anwesenheit von einem Controller-Oligonukleotid nicht negativ auf die  Nucleotides, a mismatch in the middle of PBS, a substitution of G for A (mismatch), a substitution of G for iso-dC). In none of the reactions was the probe displaced. This shows that the presence of a controller oligonucleotide does not adversely affect the
Diskriminierung auswirkt. Discrimination.
Reaktion 10 (Fig. 37 B): Zeigt die Überwindung einer Iso-dC-Position in der Matrize in Abwesenheit eines Controllers und Fortsetzung der Synthese bis zur Verdrängung der Sonde unter Verwendung eines ersten Primer-Oligonukleotides (P1 F5-001-1003). Es ist zwar eine verzögerte Reaktionskinetik zu sehen (Verdrängung der Sonde erfolgt wesentlich langsamer, als bei der perfekt-Match Matrize), dennoch kann ein komplementäres Primer-Verlängerungsprodukt in guten Ausbeuten synthetisiert werden (Sonde wurde verdrängt). Reaction 10 (Figure 37B): Demonstrates the overcoming of an iso-dC position in the template in the absence of a controller and the continuation of synthesis until displacement of the probe using a first primer oligonucleotide (P1 F5-001-1003). Although delayed reaction kinetics can be seen (displacement of the probe is much slower than with the perfect match template), a complementary primer extension product can still be synthesized in good yields (probe displaced).
Reaktion 1 1 (Fig. 37 B): Zeigt den Einfluss des in der Reaktion anwesenden Controllers: Die Überwindung der Mismatch-Position gelingt wesentlich langsamer. Dies wird damit in Verbindung gebracht, dass das während der Reaktion entstehende Primer-Verlängerungsprodukt während der Reaktion abgelöst werden kann und mit dem Controller einen Komplex bildet, weicher eine höhere Tm hat, als der Primer / Controller-Komplex. Das vorzeitig abgelöste, nicht vollständige Primer- Verlängerungsprodukt verbleibt bevorzugt im Komplex mit dem Controller und wird damit aus der Reaktion entzogen („Trapping“ von unvollständigen Primer-Verlängerungsprodukten). Damit wird verhindert, dass die Polymerase das Iso-dC Nukleotid überwinden kann. Die Anwesenheit des Controllers übt somit eine „korrigierende Wirkung“ auf die Polymerase aus: zwar ist eine Polymerase grundsätzlich in der Lage, ein solches Mismatch zu überwinden, doch in Kombination mit dem Controller wird diese Eigeschaft des Primer-Verlängerungs-Systems dermaßen verändert, dass eine vollständige Synthese von fehlerhaften Primer-Verlängerungsprodukten unterdrückt wird. Die zwischenzeitlich entstehenden Primer-Verlängerungsprodukte werden aus der weiteren Verlängerung entzogen, die während einer Primer-Verlängerungs-Reaktion läuft (On-Iine Kontrolle).  Reaction 1 1 (Figure 37 B): Shows the influence of the controller present in the reaction: The overcoming of the mismatch position succeeds much more slowly. This is related to the fact that the primer extension product formed during the reaction can be released during the reaction and forms a complex with the controller that has a higher Tm than the primer / controller complex. The prematurely detached, incomplete primer extension product preferably remains in complex with the controller and is thus removed from the reaction ("trapping" of incomplete primer extension products). This prevents the polymerase from being able to overcome the iso-dC nucleotide. The presence of the controller thus exerts a "corrective effect" on the polymerase: while a polymerase is basically capable of overcoming such a mismatch, in combination with the controller, this property of the primer extension system is altered to such an extent a complete synthesis of defective primer extension products is suppressed. The intermediate primer extension products are removed from further extension which proceeds during a primer extension reaction (on-line control).
Reaktion 12: diente als Referenz-Signal für die Sonde in Abwesenheit einer Polymerase.  Reaction 12: served as the reference signal for the probe in the absence of a polymerase.
Reaktion 13 (Fig. 38 A): Zeigt die Überwindung einer Iso-dC-Position in der Matrize in Abwesenheit eines Controllers und die Fortsetzung der Synthese bis zur Verdrängung der Sonde unter Verwendung eines Primer-Oligonukleotides, welches keinen zweiten Bereich umfasst (SEQP1 F 300-35X). Man sieht zwar eine verzögerte Reaktionskinetik (Verdrängung der Sonde erfolgt wesentlich langsamer, als bei der perfekt-Match Matrize), dennoch kann ein komplementäres Primer-Verlängerungsprodukt in guten Ausbeuten synthetisiert werden (Sonde wurde verdrängt). Reaction 13 (Figure 38A): Shows the overcoming of an iso-dC position in the template in the absence of a controller and the continuation of synthesis until displacement of the probe using a primer oligonucleotide which does not comprise a second region (SEQP1F 300-35X). Although delayed reaction kinetics are observed (displacement of the probe is much slower than with the perfect-match template), a complementary primer extension product can still be synthesized in good yields (probe displaced).
Reaktion 14: Die Anwesenheit eines Controller-Oligonukleotides scheint bei einem solchen Primer- Design allerdings keine Auswirkung auf das Verhalten des Primer-Verlängerungs-Systems zu haben: der verwendete Primer hat keinen zweiten Bereich, im Gegensatz zum in der Reaktion 1 1 verwendeten Primer. Reaction 14: However, the presence of a controller oligonucleotide does not appear to affect the behavior of the primer extension system in such a primer design: the primer used has no second region, unlike the primer used in reaction 11.
Insgesamt wurde in diesem Beispiel die Fähigkeit eines Primer-Verlängerungs-Systems demonstriert, die Überwindung eines Mismatchs durch die Polymerase in Anwesenheit eines Controller-Oligonukleotides und eines ersten Primers zu modifizieren / zu verhindern.  Overall, this example demonstrates the ability of a primer extension system to modify / prevent the overcoming of a mismatch by the polymerase in the presence of a controller oligonucleotide and a first primer.
Beispiel 5  Example 5
Anwendung einer synthetisierten Nukleinsäurekette als Start-Nukleinsäurekette in einem Application of a synthesized nucleic acid chain as a starting nucleic acid chain in one
Amplifikationsverfahren. Amplification.
Die durch eine Primer-Verlängerungsreaktion erhaltene Nukleinsäurekette kann vom  The nucleic acid chain obtained by a primer extension reaction can be derived from
Matrizenstrang abgelöst werden und in einem weiteren Verfahren verwendet werden. Matrizenstrang be replaced and used in another method.
Die Ausführung dieses Amplifikationsverfahrens wurde in der PCT Anmeldung  The execution of this amplification method was described in the PCT application
PCT/EP2017/07101 1 und der europäischen Anmeldung 16185624.0 bereits beschrieben. Zu Details der Ausführung der Amplifikation wird der Fachmann an diese Anmeldung verwiesen.PCT / EP2017 / 07101 1 and the European application 16185624.0 already described. For details of the execution of the amplification, the skilled person is referred to this application.
Beispielsweise in einerm Verfahren zur Vermehrung von Nukleinsäureketten mit einem Controller- Oligonukleotid (siehe Beispiele 1 und 2). Ein solches Amplifikationsverfahren umfasst dabei mehrere Schritte dargestellt in Fig. 40 - 42. Diese Figuren zeigen schematisch das Zusammenwirken von Komponenten bei einer exponentiellen Amplifikation einer zu amplifizierenden Nukleinsäurekette in einzelnen Schritten. For example, in a method of amplifying nucleic acid chains with a controller oligonucleotide (see Examples 1 and 2). Such an amplification method comprises several steps shown in FIGS. 40-42. These figures show schematically the interaction of components in an exponential amplification of a nucleic acid chain to be amplified in individual steps.
Damit kann die durch eine Primer-Verlängerung bereitgestellte Nukleinsäurekette beispielsweise als Start-Nukleinsäurekette in einer Amplifikation mit Allel-Diskriminierung als Matrize verwendet werden.  Thus, the nucleic acid chain provided by a primer extension can be used, for example, as a starting nucleic acid chain in an allele discrimination amplification as a template.
Fig. 43A zeigt schematisch eine Start-Nukleinsäurekette und Komponenten des Amplifikationssystems im Ansatz vor Amplifikationsstart:  FIG. 43A schematically shows a start nucleic acid chain and components of the amplification system in the preparation prior to the amplification start:
Start-Nukleinsäure (Start-NS), welche eine Zielsequenz umfasst.  Starting nucleic acid (start NS) comprising a target sequence.
Primer 1 (P1.1 ), Primer 2 (P2.1 ), ein Aktivator-Oligonukleotid (C1.1 ).  Primer 1 (P1.1), primer 2 (P2.1), an activator oligonucleotide (C1.1).
Komponenten für Primer-Verlängerungsreaktion: Polymerase (Pol) und dNTPs Fig. 43B zeigt schematisch das Ergebnis der Amplifikation: Components for primer extension reaction: polymerase (Pol) and dNTPs Fig. 43B shows schematically the result of the amplification:
Das Primer-Verlängerungsprodukt P1.1 -Ext ausgehend von P1 .1 und das Primer- Verlängerungsprodukt 2.1-Ext. Diese Produkte (P1 .1 -Ext, P2.1 -Ext) können untereinader und mit Aktivator-Oligonukleotid unterschiedliche Komplexformen ausbilden (je nach Konzentrations- Verhältnis und Reaktionsbedingungen). Im Einzelnen, können diese Formen Komplexe aus P1.1 - Ext / C1.1 und / oder P1 1-Ext und / oder P1 1-Ext / C1 .1/ P2.1-Ext umfassen.  The primer extension product P1.1 -Ext from P1 .1 and the primer extension product 2.1-Ext. These products (P1 .1 -Ext, P2.1 -Ext) can form different complex forms with each other and with activator oligonucleotide (depending on the concentration ratio and reaction conditions). Specifically, these forms may comprise complexes of P1.1-Ext / C1.1 and / or P1-Ext and / or P1-Ext / C1.1 / P2.1-Ext.
Das P1-Ext umfasst ein 3'-Segment, welches nicht vom Aktivator-Oligonukleotid komplementär gebunden wird. Dieses Segment dient als Bindungspartner für die Oligonukleotid-Sonde. The P1-Ext comprises a 3 ' segment which is not complementarily bound by the activator oligonucleotide. This segment serves as a binding partner for the oligonucleotide probe.
Fig. 44 zeigt schematisch potenzielle Positionen eines polymorphen Lokus innerhalb einer Zielsequenz (Position 1 bis 6) und ihre korrespondierenden Sequenzsegment-Positionen in einzelnen Komponenten eines Amplifikations-Systems. Die hier schematisch dargestellten polymorphen Loki einer Zielsequenz umfassen 2 bis 50 Nukleotide, insbesondere 4 bis 30 Nukleotide welche für eine Allel-Variante einer Zielsequenz charakteristisch und spezifisch sind. Fig. 44 shows schematically potential positions of a polymorphic locus within a target sequence (positions 1 to 6) and their corresponding sequence segment positions in individual components of an amplification system. The polymorphic loci of a target sequence shown schematically comprise 2 to 50 nucleotides, in particular 4 to 30 nucleotides, which are characteristic and specific for an allelic variant of a target sequence.
Insgesamt kann die Anordnung von einzelnen Amplifikations-Komponenten dermaßen gestaltet werden, dass mehrere Varianten/Kombinationen möglich sind: Overall, the arrangement of individual amplification components can be designed so that several variants / combinations are possible:
Anordnung 1 (P1): polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (ersten Bereich) und Aktivator-Oligonukleotid (zweiten Bereich). Diese Komponenten des Amplifikations- Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein zielsequenzspezifischer zweiter Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist.  Arrangement 1 (P1): polymorphic locus (N2) of the target sequence superimposed on the first primer (first region) and activator oligonucleotide (second region). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific second primer is used, which is not sequence variant specific.
Anordnung 2 (P2): polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (ersten Bereich) und Aktivator-Oligonukleotid (zweiten Bereich). Diese Komponenten des Amplifikations- Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer zweiter Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist. Anordnung P2 unterscheidet sich von P1 vor allem dadurch, dass N2 vorwiegend im 3'-terminalen Sequenz- Segment des ersten Primers liegt. Dadurch kann ggf. eine bessere Spezifität der Amplifikation erzeicht werden. Array 2 (P2): polymorphic locus (N2) of the target sequence superimposed on the first primer (first region) and activator oligonucleotide (second region). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific second primer is used, which is not sequence variant specific. Arrangement P2 differs from P1 mainly in that N2 lies predominantly in the 3 ' terminal sequence segment of the first primer. This may possibly result in a better specificity of the amplification.
Anordnung 3 (P3): polymorpher Lokus (N2) der Zielsequenz überlagert nur das Aktivator- Oligonukleotid (dritter Bereich), wobei das korrespondierende Sequenzsegment des Aktivator- Oligonukleotides im 5'-Segment des synthetisierten Anteils des ersten Primer- Verlängerungsproduktes liegt. Das Aktivator-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster und zweiter Primer verwendet, welche aber nicht Sequenz-Varianten spezifisch sind. Aufgrund der möglichen Nähe der zweiten Blockierungs-Einheit kann die Bindung des Aktivator-Oligonukleotids an das erste Primer-Verlängerungsprodukt durch Nukleotid-Modifikationen der zweiten Blockierungs-Einheit beeinflusst werden. Arrangement 3 (P3): Polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region), with the corresponding sequence segment of the activator oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product. The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence-specific first and second primer is used, which are not specific for sequence variants. Due to the possible proximity of the second blocking moiety, the binding of the activator oligonucleotide to the first Primer extension product can be influenced by nucleotide modifications of the second blocking unit.
Anordnung 4 (P4): polymorpher Lokus (N2) der Zielsequenz überlagert nur das Aktivator- Oligonukleotid (dritter Bereich). Das Aktivator-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster und zweiter Primer verwendet, welche aber nicht Sequenz-Varianten-spezifisch sind. Dieses Sequenzsegment des Aktivator-Oligonukleotides liegt in 5'-Richtung von der zweiten Blockierungs-Einheit und kann mehrere DNA-Nukleotid-Monomere umfassen, z.B. von 5 bis 30. Arrangement 4 (P4): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region). The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first and second primer is used, which are not sequence variant specific. This sequence segment of the activator oligonucleotide lies in the 5 ' direction of the second blocking unit and may comprise several DNA nucleotide monomers, eg from 5 to 30.
Anordnung 5 (P5): polymorpher Lokus (N2) der Zielsequenz überlagert den zweiten Primer und das Aktivator-Oligonukleotid (dritter Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist.  Arrangement 5 (P5): polymorphic locus (N2) of the target sequence superimposed on the second primer and the activator oligonucleotide (third region). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first primer is used, which is not sequence variant specific.
Anordnung 6 (P6): polymorpher Lokus (N2) der Zielsequenz überlagert den zweiten Primer und das Aktivator-Oligonukleotid (dritten Bereich, nahe dem 5'-Ende). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariate der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz spezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist. Array 6 (P6): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region, near the 5 ' end). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence of specific first primer is used, which is not sequence variant specific.
Aus den Design-Unterschieden einzelner Elemente ergeben sich auch Unterschiede für die während einer Amplifikation synthetisierten Primer-Verlängerungsprodukte..  The design differences of individual elements also result in differences for the primer extension products synthesized during amplification.
Fig. 45 zeigt schematisch potenzielle Positionen eines polymorphen Lokus mit Sequenz-Varianz von nur einem Nukleotid innerhalb einer Zielsequenz (Position 1 bis 6) und ihre korrespondierenden Sequenzsegment-Positionen in einzelnen Komponenten eines Amplifikations- Systems.  Fig. 45 shows schematically potential positions of a polymorphic locus with sequence variance of only one nucleotide within a target sequence (positions 1 to 6) and their corresponding sequence segment positions in individual components of an amplification system.
Insgesamt kann die Anordnung von einzelnen Amplifikations-Komponenten dermaßen gestaltet werden, dass mehrere Varianten/Kombinationen möglich sind:  Overall, the arrangement of individual amplification components can be designed so that several variants / combinations are possible:
Anordnung 1 (P1): polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (ersten Bereich) und das Aktivator-Oligonukleotid (zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweiligen Sequenzvarianten der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer zweiter Primer verwendet, welcher aber nicht Sequenz-Varianten- spezifisch ist.  Arrangement 1 (P1): polymorphic locus (N2) of the target sequence superimposed on the first primer (first region) and the activator oligonucleotide (second region). These components of the amplification system can thus be constructed specifically and characteristically for the respective sequence variants of the target sequence. In this arrangement, a target sequence specific second primer is used, which is not sequence variant specific.
Anordnung 2 (P2): polymorpher Lokus (N2) der Zielsequenz überlagert den ersten Primer (ersten Bereich) und das Aktivator-Oligonukleotid (zweiten Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweiligen Sequenzvarianten der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer zweiter Primer verwendet, welcher aber nicht Sequenz-Varianten- spezifisch ist. Anordnung P2 unterscheidet sich von P1 vor allem dadurch, dass N2 vorwiegend im 3'-terminalen Sequenz-Segment des ersten Primers liegen kann oder sogar das 3'-terminale Nukleotid umfasst. Dadurch kann ggf. eine weitere Erhöhnung der Spezifität der Amplifikation erreicht werden. Arrangement 2 (P2): polymorphic locus (N2) of the target sequence superimposed on the first primer (first region) and the activator oligonucleotide (second region). These components of the amplification system can thus be specific and characteristic of the respective Sequence variants of the target sequence can be constructed. In this arrangement, a target sequence specific second primer is used, which is not sequence variant specific. Arrangement P2 differs from P1 primarily in that N2 may be predominantly in the 3 ' terminal sequence segment of the first primer or even comprises the 3 ' terminal nucleotide. As a result, a further increase in the specificity of the amplification can optionally be achieved.
Anordnung 3 (P3): polymorpher Lokus (N2) der Zielsequenz überlagert nur das Aktivator- Oligonukleotid (dritten Bereich), wobei das korrespondierende Sequenzsegment des Aktivator- Oligonukleotides im 5'-Segment des synthetisierten Anteils des ersten Primer- Verlängerungsproduktes liegt. Das Aktivator-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariante der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster und zweiter Primer verwendet, welche aber nicht Sequenz-Varianten-spezifisch sind. Aufgrund der möglichen Nähe der zweiten Blockierungs-Einheit kann die Bindung des Aktivator-Oligonukleotids an das erste Primer-Verlängerungsprodukt durch Nukleotid-Modifikationen der zweiten Blockierungs-Einheit beeinflusst werden. Arrangement 3 (P3): polymorphic locus (N2) of the target sequence superimposes only the activator oligonucleotide (third region) with the corresponding sequence segment of the activator oligonucleotide in the 5 ' segment of the synthesized portion of the first primer extension product. The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first and second primer is used, which are not sequence variant specific. Because of the possible proximity of the second blocking moiety, binding of the activator oligonucleotide to the first primer extension product can be affected by nucleotide modifications of the second blocking moiety.
Anordnung 4 (P4): polymorpher Lokus (N2) der Zielsequenz überlagert nur das Aktivator- Oligonukleotid (dritten Bereich). Das Aktivator-Oligonukleotid des Amplifikations-Systems kann somit spezifisch und charakteristisch für die jeweilige Sequenzvariante der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster und zweiter Primer verwendet, welche aber nicht Sequenz-Varianten-spezifisch sind. Dieses Sequenzsegment des Aktivator-Oligonukleotides liegt in 5'-Richtung von der zweiten Blockierungs-Einheit. Dieses Segment des Aktivator-Oligonukleotides kann mehrere DNA-Nukleotid-Monomere umfassen, z.B. von 5 bis 30, wobei das N2-korrespondierende Sequenzsegment von mindestens 3 bis 15 DNA- Nukleotid-Bausteinen auf beiden Seiten flankiert sein kann. Arrangement 4 (P4): polymorphic locus (N2) of the target sequence overlays only the activator oligonucleotide (third region). The activator oligonucleotide of the amplification system can thus be constructed specifically and characteristically for the respective sequence variant of the target sequence. In this arrangement, a target sequence specific first and second primer is used, which are not sequence variant specific. This sequence segment of the activator oligonucleotide lies in the 5 ' direction of the second blocking unit. This segment of the activator oligonucleotide may comprise multiple DNA nucleotide monomers, eg, from 5 to 30, wherein the N2-corresponding sequence segment may be flanked by at least 3 to 15 DNA nucleotide building blocks on both sides.
Anordnung 5 (P5): polymorpher Lokus (N2) der Zielsequenz überlagert den zweiten Primer und das Aktivator-Oligonukleotid (dritter Bereich). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariante der Zielsequenz konstruiert werden. Die Anordnung kann dermaßen gestaltet werden, dass das 3'-terminale Nukleotid des zweiten Primers mit dem N2-Lokus korrespondiert. Bei dieser Anordnung wird ein Zielsequenz-spezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten- spezifisch ist. Arrangement 5 (P5): polymorphic locus (N2) of the target sequence superimposed on the second primer and the activator oligonucleotide (third region). These components of the amplification system can thus be constructed specifically and characteristically for the particular sequence variant of the target sequence. The arrangement can be made such that the 3 ' -terminal nucleotide of the second primer corresponds to the N2 locus. In this arrangement, a target sequence specific first primer is used, which is not sequence variant specific.
Anordnung 6 (P6): polymorpher Lokus (N2) der Zielsequenz überlagert den zweiten Primer und das Aktivator-Oligonukleotid (dritter Bereich, nahe dem 5'-Ende). Diese Komponenten des Amplifikations-Systems können somit spezifisch und charakteristisch für die jeweilige Sequenzvariante der Zielsequenz konstruiert werden. Bei dieser Anordnung wird ein Zielsequenz spezifischer erster Primer verwendet, welcher aber nicht Sequenz-Varianten-spezifisch ist. Aus den Design-Unterschieden einzelner Elemente ergeben sich auch Unterschiede für die während einer Amplifikation synthetisierten Primer-Verlängerungsprodukte. Array 6 (P6): polymorphic locus (N2) of the target sequence overlays the second primer and the activator oligonucleotide (third region, near the 5 ' end). These components of the amplification system can thus be constructed specifically and characteristically for the particular sequence variant of the target sequence. In this arrangement, a target sequence of specific first primer is used, which is not sequence variant specific. Differences in the design of individual elements also result in differences for the primer extension products synthesized during amplification.
Fig. 46 - 54  FIGS. 46-54
Fig. 46 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotids im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante der Start-Nukleinsäure (SN 1.1 ) binden und die Synthese des P1 .1-Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1 -Ext und P2.1 -Ext. Es wird kein Kompetitor- Primer verwendet.  Fig. 46 shows schematically an embodiment with topography of a specific amplification system and a start-up nucleic acid chain with a polymorphic locus (N2) in certain embodiments in which the N2-corresponding segment of the activator oligonucleotide lies in the second region. A specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the starting nucleic acid (SN 1.1) under reaction conditions and initiate the synthesis of the P1 .1-Ext. In the course of the amplification, this results in the formation of P1.1 text and P2.1 text. No competitor primer is used.
Fig. 47 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Fig. 47 schematically shows an embodiment with topography of a specific one
Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotides im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante der Start-Nukleinsäure (SN 1.1 ) binden und die Synthese des P1 .1-Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1 -Ext und P2.1 -Ext. Es wird kein Kompetitor- Primer verwendet. Die Bindung an eine andere Sequenz-Variante (SN 1.2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1 .2. Die Amplifikation wird somit weniger effizient gestartet. Amplification system and a start-up nucleic acid chain with a polymorphic locus (N2) in certain embodiments, in which the N2 corresponding segment of the activator oligonucleotide lies in the second region. A specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the starting nucleic acid (SN 1.1) under reaction conditions and initiate the synthesis of the P1 .1-Ext. In the course of the amplification, this results in the formation of P1.1 text and P2.1 text. No competitor primer is used. The binding to another sequence variant (SN 1.2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1 .2. The amplification is thus started less efficiently.
Fig. 48 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Fig. 48 schematically shows an embodiment with topography of a specific one
Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotids im zweiten Bereich liegt (2). Der N2-Lokus umfasst auch das 3'-terminale Nukleotid und / oder das 3'-terminale Segment des ersten Primers. Ein spezifischer P1 .1 , mit einem komplementären 3'-terminalen Nukleotid kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante der Start- Nukleinsäure (SN 1.1 ) binden und die Synthese des P1 1 -Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1 -Ext und P2.1 -Ext. Es wird kein Kompetitor-Primer verwendet. Die Bindung und Initiierung der Primer-Verlängerung an einer anderen Sequenz- Variante (SN 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1 .2. Die Amplifikation wird somit weniger effizient gestartet. Amplification system and a starting nucleic acid chain with a polymorphic locus (N2) in certain embodiments, in which the N2 corresponding segment of the activator oligonucleotide lies in the second region (2). The N2 locus includes the 3 '-terminal nucleotide and / or the 3' -terminal segment of the first primer. A specific P1 .1, with a complementary 3 ' -terminal nucleotide can bind under reaction conditions preferably specifically to the complementary position of a specific sequence variant of the starting nucleic acid (SN 1.1) and initiate the synthesis of the P1 1 -ext. In the course of the amplification, this results in the formation of P1.1 text and P2.1 text. No competitor primer is used. The binding and initiation of primer extension at another sequence variant (SN 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1 .2. The amplification is thus started less efficiently.
Fig. 49 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotids im dritten Bereich liegt (3). Es wird ein Zielsequenz-spezifischer aber nicht Sequenz-Varianten-spezifischer erster und zweiter Primer verwendet. Ein für alle Sequenz- Varianten einer Zielnukleinsäure einheitlicher P1.1 und P2.1 , kann an die Start-Nukleinsäurekette binden und die Synthese des P1 1-Ext bzw. P2.1 -Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1 .1-Ext und P2.1-Ext. Es wird kein Kompetitor-Primer verwendet. Die Trennung von beiden synthetisierten komplementären Primer-Verlängerungsprodukten P1 .1- Ext und P2.1 -Ext erfolgt vorzugsweise spezifisch durch eine komplementäre Bindung des P1 1-Ext an das Aktivator-Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz-Variante, welche unter Verwendung von (SN 1 .2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Aktivator- Oligonukleotides. Die Amplifikation von der SN 1 .2 Sequenz-Variante erfolgt somit weniger effizient bzw. nur unwesentlich bzw. gar nicht. Die Position des Sequenz-Segmentes (3), welches zu N2 der Zielsequenz korrespondiert, liegt in der Nähe der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Aktivator-Oligonukleotid und dem jeweiligen ersten Primer- Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit beeinflusst werden kann. Fig. 49 shows schematically an embodiment with topography of a specific amplification system and a starting nucleic acid chain with a polymorphic locus (N2) in certain embodiments in which the N2-corresponding segment of the activator oligonucleotide lies in the third region (3). It becomes a target sequence-specific but not Sequence variant-specific first and second primer used. One for all sequence variants of a target nucleic acid unitary P1.1 and P2.1, can bind to the starting nucleic acid chain and initiate the synthesis of the P1 1-Ext or P2.1 -ext. In the course of the amplification, this leads to the formation of P1 .1-Ext and P2.1-Ext. No competitor primer is used. The separation of both synthesized complementary primer extension products P1 .1 Ext and P2.1 -Ext is preferably carried out specifically by a complementary binding of P1 1-Ext to the activator oligonucleotide. The separation of strands of another sequence variant synthesized using (SN 1 .2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the activator oligonucleotide. The amplification of the SN 1 .2 sequence variant is thus less efficient or only insignificant or not at all. The position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking moiety so that the interaction between the activator oligonucleotide and the respective first primer extension product is affected by modifications used in the second blocking moiety can.
Fig. 50 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotides im dritten Bereich liegt (4). Es wird ein Zielsequenz-spezifischer aber nicht Sequenz-Varianten-spezifischer erster und zweiter Primer verwendet. Ein für alle Sequenz- Varianten einer Zielnukleinsäure einheitlicher P1.1 und P2.1 , kann an die Start-Nukleinsäurekette binden und die Synthese des P1 1-Ext bzw. P2.1 -Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1 .1-Ext und P2.1-Ext. Es wird kein Kompetitor-Primer verwendet. Die Trennung von beiden synthetisierten komplementären Primer-Verlängerungsprodukten P1 .1- Ext und P2.1 -Ext erfolgt vorzugsweise spezifisch durch eine komplementäre Bindung des P1 1-Ext an das Aktivator-Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz-Variante, welche unter Verwendung von (SN 1 .2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Aktivator- Oligonukleotides. Die Amplifikation von der SN 1 .2 Sequenz-Variante erfolgt somit weniger effizient bzw. nur unwesentlich bzw. gar nicht. Die Position des Sequenz-Segmentes (4), welches zu N2 der Zielsequenz korrespondiert, liegt in einer Entfernung von der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Aktivator-Oligonukleotid und dem jeweiligen ersten Primer- Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit im Wesentlichen unbeeinflusst bleibt. Das Segment des Aktivator-Oligonukleotides, welches zu N2 korrespondiert, besteht vorzugsweise aus DNA-Monomeren, wobei zwischen 4 bis 20 DNA Monomeren verwendet werden und mindestens 4 bis 10 DNA-Monomere um die Position-4 auf beiden Seiten lokalisiert sind. Fig. 51 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotides im dritten Bereich liegt (5). Der N2-Lokus umfasst auch das 3'-terminale Nukleotid des zweiten Primers. Ein spezifischer P2.1 mit einem komplementären 3'-terminalen Nukleotid kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante ausgehend von zur Start-Nukleinsäure (SN 1.1 ) komplementären Strängen binden und die Synthese des P2.1-Ext vorzugsweise spezifisch initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1-Ext und P2.1 -Ext. Es wird kein Kompetitor- Primer verwendet. Die Bindung an eine andere Sequenz-Variante (SN 1.2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1 .2. Die Amplifikation wird somit weniger effizient gestartet. Fig. 50 shows schematically an embodiment with topography of a specific amplification system and a starting nucleic acid chain with a polymorphic locus (N2) in certain embodiments in which the N2-corresponding segment of the activator oligonucleotide lies in the third region (4). A target sequence specific but not sequence variant specific first and second primer is used. One for all sequence variants of a target nucleic acid unitary P1.1 and P2.1, can bind to the starting nucleic acid chain and initiate the synthesis of the P1 1-Ext or P2.1 -ext. In the course of the amplification, this leads to the formation of P1 .1-Ext and P2.1-Ext. No competitor primer is used. The separation of both synthesized complementary primer extension products P1 .1 Ext and P2.1 -Ext is preferably carried out specifically by a complementary binding of P1 1-Ext to the activator oligonucleotide. The separation of strands of another sequence variant synthesized using (SN 1 .2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the activator oligonucleotide. The amplification of the SN 1 .2 sequence variant is thus less efficient or only insignificant or not at all. The position of the sequence segment (4) corresponding to N2 of the target sequence is at a distance from the second blocking moiety, such that the interaction between the activator oligonucleotide and the respective first primer extension product of modifications used in the second blocking moiety in FIG Essentially unaffected. The segment of activator oligonucleotide corresponding to N2 is preferably made of DNA monomers using between 4 to 20 DNA monomers and at least 4 to 10 DNA monomers located around position-4 on both sides. 51 schematically shows an embodiment with topography of a specific amplification system and a starting nucleic acid chain with a polymorphic locus (N2) in certain embodiments, in which the N2-corresponding segment of the activator oligonucleotide lies in the third region (5). The N2 locus also includes the 3 ' terminal nucleotide of the second primer. A specific P2.1 having a complementary 3 ' -terminal nucleotide may preferentially bind under reaction conditions specifically to the complementary position of a specific sequence variant starting from strands complementary to the starting nucleic acid (SN 1.1) and preferably the synthesis of P2.1-Ext specifically initiate. During the amplification process, P1.1-Ext and P2.1-Ext are formed. No competitor primer is used. The binding to another sequence variant (SN 1.2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1 .2. The amplification is thus started less efficiently.
Fig. 52 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotids im zweiten Bereich liegt. Ein spezifischer P1 .1 kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplementäre Position einer spezifischen Sequenz-Variante der Start-Nukleinsäure (SN 1.1 ) binden und die Synthese des P1 .1-Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1-Ext und P2.1 -Ext. Die Bindung an eine andere Sequenz-Variante (SN 1 .2) erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1.2. Die Amplifikation wird somit weniger effizient gestartet.  52 schematically shows an embodiment with topography of a specific amplification system and a start-up nucleic acid chain with a polymorphic locus (N2) in certain embodiments, in which the N2-corresponding segment of the activator oligonucleotide lies in the second region. A specific P1 .1 may preferably bind specifically to the complementary position of a specific sequence variant of the starting nucleic acid (SN 1.1) under reaction conditions and initiate the synthesis of the P1 .1-Ext. During the amplification process, P1.1-Ext and P2.1-Ext are formed. The binding to another sequence variant (SN 1 .2) is less efficient due to the mismatch with position (N) within the primer binding site of SN 1.2. The amplification is thus started less efficiently.
Zur Erhöhung der Spezifität wird ein Kompetitor-Primer (P 5.1 ) in die Reaktion zugegeben, welcher in der Lage ist, vorwiegend komplementär an die Sequenz-Varianten der Zielsequenz zu binden, dessen Amplifikation unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor-Primer bevorzugt binden und von der Polymerase verlängert werden. Das dabei resultierende Produkt blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion des ersten Amplifikations-Primers. In bestimmten Ausführungsformen bindet das 3'-Ende eines Kompetitor-Primers innerhalb der zweiten Blockierungs-Einheit des Aktivator-Oligonukleotides, so dass keine Verlängerung dieses Primers am Aktivator-Oligonukleotid erfolgen kann. Der Kompetitor-Primer umfasst keinen zweiten Bereich und kann somit nicht mit dem ersten Bereich des Aktivator-Oligonukleotids interagieren. Dadurch wird verhindert, dass das Verlängerungsprodukt des Kompetitor-Oligonukleotides von der Matrize unter Mitwirkung eines Aktivator-Oligonukleotides abgelöst wird. To increase the specificity of a competitor primer (P 5.1) is added to the reaction, which is able to bind predominantly complementary to the sequence variants of the target sequence, the amplification of which must be suppressed. Due to a complementary binding with such primer binding sites, a competitor primer may preferentially bind and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction of the first amplification primer. In certain embodiments, the 3 ' end of a competitor primer binds within the second blocking moiety of the activator oligonucleotide so that no extension of this primer on the activator oligonucleotide can occur. The competitor primer does not include a second region and thus can not interact with the first region of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template with the assistance of an activator oligonucleotide.
Fig. 53 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment der Aktivator- Oligonukleotide im zweiten Bereich liegt (2). Der N2-Lokus umfasst auch das 3 '-terminale Nukleotid des ersten Primers. Ein spezifischer P1 .1 , mit einem komplementären 3'-terminalen Nukleotid kann unter Reaktionsbedingungen bevorzugt spezifisch an die komplemenäre Position einer spezifischen Sequenz-Variante der Start-Nukleinsäure (SN 1.1 ) binden und die Synthese des P1 1 -Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1.1 -Ext und P2.1 -Ext. Die Bindung an eine andere Sequenz-Variante (SN 1 .2) und die Verlängerung durch eine Polymerase erfolgt weniger effizient aufgrund des Mismatches mit Position (N) innerhalb der Primer-Bindungsstelle der SN 1 .2. Die Amplifikation wird somit weniger effizient gestartet. Fig. 53 shows schematically an embodiment with topography of a specific amplification system and a starting nucleic acid chain with a polymorphic locus (N2) in certain embodiments in which the N2-corresponding segment of the activator oligonucleotides lies in the second region (2). The N2 locus also includes the 3 ' terminal Nucleotide of the first primer. A specific P1 .1, with a complementary 3 ' -terminal nucleotide, can under reaction conditions preferably specifically bind to the complementary position of a specific sequence variant of the starting nucleic acid (SN 1.1) and initiate the synthesis of the P1 1 -text. In the course of the amplification, this results in the formation of P1.1 text and P2.1 text. Binding to another sequence variant (SN 1 .2) and extension by a polymerase is less efficient due to the mismatch with position (N) within the primer binding site of SN 1 .2. The amplification is thus started less efficiently.
Zur Erhöhung der Spezifität wird ein Kompetitor-Primer (P 5.2) in die Reaktion zugegeben, welcher in der Lage ist, vorwiegend komplementär an die Sequenz-Varianten der Zielsequenz zu binden, dessen Amplifikation unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor-Primer bevorzugt an bestimmte Sequenz- Varianten binden (hier mit N bezeichnet) und von der Polymerase verlängert werden. Das dabei resultierende Produkt blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion des ersten Amplifikations-Primers.  To increase the specificity, a competitor primer (P 5.2) is added to the reaction, which is able to bind predominantly complementary to the sequence variants of the target sequence whose amplification must be suppressed. Due to a complementary binding with such primer binding sites, a competitor primer can preferentially bind to certain sequence variants (designated here by N) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction of the first amplification primer.
In bestimmten Ausführungsformen bindet das 3'-Ende eines Kompetitor-Primers innerhalb der zweiten Blockierungs-Einheit des Aktivator-Oligonukleotides, so dass keine Verlängerung dieses Primers am Aktivator-Oligonukleotid erfolgen kann. Der Kompetitor-Primer umfasst keinen zweiten Bereich und kann somit nicht mit dem ersten Bereich des Aktivator-Oligonukleotids interagieren. Dadurch wird verhindert, dass das Verlängerungsprodukt des Kompetitor-Oligonukleotides von der Matrize abgelöst wird. In certain embodiments, the 3 ' end of a competitor primer binds within the second blocking moiety of the activator oligonucleotide so that no extension of this primer on the activator oligonucleotide can occur. The competitor primer does not include a second region and thus can not interact with the first region of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template.
Fig. 54 zeigt schematisch eine Ausführungsform mit Topographie eines spezifischen Amplifikations-Systems und einer Start-Nukleinsäurekette mit einem polymorphen Lokus (N2) in bestimmten Ausführungsformen, bei welcher das zu N2 korrespondierende Segment des Aktivator- Oligonukleotids im dritten Bereich liegt (3). Es wird ein Zielsequenz-spezifischer aber nicht Sequenz-Varianten-spezifischer erster und zweiter Primer verwendet. Ein für alle Sequenz- Varianten einer Zielnukleinsäure einheitlicher P1.1 und P2.1 , kann an die Start-Nukleinsäurekette binden und die Synthese des P1 1-Ext bzw. P2.1 -Ext initiieren. Im Verlauf der Amplifikation kommt es dabei zur Ausbildung von P1 .1-Ext und P2.1 -Ext. Die Trennung von beiden synthetisierten komplementären Primer-Verlängerungsprodukten P1.1 -Ext und P2.1 -Ext erfolgt vorzugsweise spezifisch durch komplementäre Bindung des P1.1 -Ext an das Aktivator-Oligonukleotid. Die Trennung von Strängen einer anderen Sequenz-Variante, welche unter Verwendung von (SN 1.2) synthetisiert wurden, erfolgt weniger effizient aufgrund des Mismatches mit Position (N) zum korrespondierenden Sequenz-Segment des Aktivator-Oligonukleotides. Die Amplifikation von der SN 1 .2 Sequenz-Variante erfolgt somit weniger effizient bzw. nur unwesentlich bzw. gar nicht. Die Position des Sequenz-Segmentes (3), welches zu N2 der Zielsequenz korrespondiert, liegt in der Nähe der zweiten Blockierungseinheit, so dass die Interaktion zwischen dem Aktivator- Oligonukleotid und dem jeweiligen ersten Primer-Verlängerungsprodukt von verwendeten Modifikationen in der zweiten Blockierungseinheit beeinflusst werden kann. Zur Erhöhung der Spezifität wird ein Kompetitor-Primer (P 5.3 oder P5.4) in die Reaktion zugegeben, welches in der Lage ist, vorwiegend komplementär an die Sequenz-Varianten der Zielsequenz zu binden (N), dessen Amplifikation unterdrückt werden muss. Aufgrund einer komplementären Bindung mit solchen Primer-Bindungsstellen kann ein Kompetitor-Primer bevorzugt an bestimmte Sequenz-Varianten binden (hier mit N bezeichnet) und von der Polymerase verlängert werden. Das dabei resultierende Produkt blockiert die einzelsträngigen Primer-Bindungsstellen für eine Interaktion des ersten Amplifikations-Primers. Fig. 54 shows schematically an embodiment with topography of a specific amplification system and a start-up nucleic acid chain with a polymorphic locus (N2) in certain embodiments in which the N2-corresponding segment of the activator oligonucleotide lies in the third region (3). A target sequence specific but not sequence variant specific first and second primer is used. One for all sequence variants of a target nucleic acid unitary P1.1 and P2.1, can bind to the starting nucleic acid chain and initiate the synthesis of the P1 1-Ext or P2.1 -ext. During the amplification, P1 .1-Ext and P2.1 -xt are formed. The separation of both synthesized complementary primer extension products P1.1 -Ext and P2.1 -Ext is preferably carried out specifically by complementary binding of P1.1 -Ext to the activator oligonucleotide. The separation of strands of another sequence variant synthesized using (SN 1.2) is less efficient due to the mismatch with position (N) to the corresponding sequence segment of the activator oligonucleotide. The amplification of the SN 1 .2 sequence variant is thus less efficient or only insignificant or not at all. The position of the sequence segment (3) corresponding to N2 of the target sequence is in the vicinity of the second blocking moiety so that the interaction between the activator oligonucleotide and the respective first primer extension product is affected by modifications used in the second blocking moiety can. To increase the specificity of a competitor primer (P 5.3 or P5.4) is added to the reaction, which is able to bind mainly complementary to the sequence variants of the target sequence (N), whose amplification must be suppressed. Due to complementary binding with such primer binding sites, a competitor primer may preferentially bind to certain sequence variants (designated N herein) and be extended by the polymerase. The resulting product blocks the single-stranded primer binding sites for interaction of the first amplification primer.
In bestimmten Ausführungsformen ist das Kompetitor-Primer-Oligonukleotid (P 5.3) länger als der erste Bereich des ersten Primer-Oligonukleotids, so dass sein 3'-Ende innerhalb der vierten Blockierungs-Einheit des Aktivator-Oligonukleotides bindet (vierte Blockierungseinheit ist analog zur zweiten Blockierungseinheit zusammengesetzt und blockiert eine Primer-Verlängerung am Aktivator-Oligonukleotid), so dass keine Verlängerung dieses Primers am Aktivator-Oligonukleotid erfolgen kann. Der Kompetitor-Primer kann das Segment der Matrize, welches P1 .1 vorwiegend komplementär binden kann, vollständig (P 5.3) oder teilweise (P 5.4) abdecken. Der Kompetitor- Primer umfasst keinen zweiten Bereich und kann somit nicht mit dem ersten Bereich des Aktivator- Oligonukleotid interagieren. Dadurch wird verhindert, dass das Verlängerungsprodukt des Kompetitor-Oligonukleotides von der Matrize unter Mitwirkung eines Aktivator-Oligonukleotides abgelöst wird. In certain embodiments, the competitor primer oligonucleotide (P 5.3) is longer than the first region of the first primer oligonucleotide such that its 3 ' end binds within the fourth blocking moiety of the activator oligonucleotide (fourth blocking moiety is analogous to the second Blocking unit composed and blocks a primer extension on the activator oligonucleotide), so that no extension of this primer on the activator oligonucleotide can take place. The competitor primer can cover the segment of the template which can predominantly complement P1 .1 completely (P 5.3) or partially (P 5.4). The competitor primer does not include a second region and thus can not interact with the first region of the activator oligonucleotide. This prevents the extension product of the competitor oligonucleotide from being detached from the template with the assistance of an activator oligonucleotide.
Eine solche Amplifikation kann alleine oder in Kombination beispielsweise mit einer nachgeschalteten PCR durchgeführt werden.  Such amplification can be carried out alone or in combination, for example with a downstream PCR.
Fig. 55 - 57 zeigt schematisch die Topographie von Komponenten des ersten Amplifikations- Systems.  Figures 55-57 schematically show the topography of components of the first amplification system.
Die Start-Nukleinsäure 1.1 umfasst (in 5'-3'-Richtung) folgende Segmente: M1 Ύ, M1 .5, M1.4, M1.3, M1 .2, M1.1 , M1 .X. The starting nucleic acid 1.1 comprises (in the 5 ' -3 ' direction) the following segments: M1 Ύ, M1.5, M1.4, M1.3, M1.2, M1.1, M1.X.
Das erste Primer-Oligonukleotid umfasst (in 5'-3'-Richtung) folgende Segmente: den ersten Bereich (P1.1 .1 ) und den zweiten Bereich (P1.1 .2). The first primer oligonucleotide comprises (in the 5 ' -3 ' direction) the following segments: the first region (P1.1 .1) and the second region (P1.1 .2).
Das Controller-Oligonukleotid (C1 .1 ) umfasst (in 5'-3'-Richtung) folgende Segmente: den dritten Bereich (01 .1.3), den zweiten Bereich ( C1 .1.2) und den ersten Bereich ( C.1.1.1 ). The controller oligonucleotide (C1 .1) comprises (in the 5 ' -3 ' direction) the following segments: the third region (01 .1.3), the second region (C1 .1.2) and the first region (C.1.1.1 ).
Das Controller-Oligonukleotid (C1 .2) umfasst (in 5'-3'-Richtung) folgende Segmente: den dritten Bereich (C1 .2.3), den zweiten Bereich ( C1 .2.2) und den ersten Bereich ( C.1.2.1 ). The controller oligonucleotide (C1 .2) comprises (in the 5 ' -3 ' direction) the following segments: the third region (C1 .2.3), the second region (C1 .2.2) and the first region (C.1.2.1 ).
Das zweite Primer P2.1 umfasst (in 5'-3'-Richtung) folgende Segmente: P2.1.1. The second primer P2.1 comprises (in the 5 ' -3 ' direction) the following segments: P2.1.1.
Das zweite Primer P2.2 umfasst (in 5'-3'-Richtung) folgende Segmente: P2.2.1. The second primer P2.2 comprises (in the 5 ' -3 ' direction) the following segments: P2.2.1.
Das zweite Primer P2.3 umfasst (in 5'-3'-Richtung) folgende Segmente: P2.3.1. The second primer P2.3 comprises (in the 5 ' -3 ' direction) the following segments: P2.3.1.
Das erste Primer-Verlängerungsprodukt (P1.1 -Ext) umfasst (in 5'-3'-Richtung) folgende The first primer extension product (P1.1 Ext) comprises (in the 5 ' -3 ' direction) the following
Segmente: P1.1 E6, P1 .1 E5, P1 .1 E4, P1 .1 E3, P1 .1 E2, P1.1 E1. Das zweite Primer-Verlängerungsprodukt (P2.1 -Ext) umfasst (in 5'-3'-Richtung) folgende Segmente: P2.1 E5, P2.1 E4, P2.1 E3, P2.1 E2, P2.1 E1. Segments: P1.1 E6, P1.1 E5, P1.1 E4, P1.1 E3, P1.1 E2, P1.1 E1. The second primer extension product (P2.1 -Ext) comprises (in the 5 ' -3 ' direction) the following segments: P2.1 E5, P2.1 E4, P2.1 E3, P2.1 E2, P2.1 E1 ,
Die während der ersten Amplifikation vorzugsweise erhaltenen Primer-Verlängerungsprodukte P1.1 -Ext und P2.1 -Ext können einen komplementären Doppelstrang bilden und stellen zusammen das zweite Amplifikations-Fragment 1 .1 dar, welches als Start-Nukleinsäure 2.1 für die zweite Amplifikation dienen kann.  The primer extension products P1.1 -Ext and P2.1 -Ext which are preferably obtained during the first amplification can form a complementary double strand and together constitute the second amplification fragment 1 .1, which serve as start nucleic acid 2.1 for the second amplification can.
Wobei P1.1 .1 an M1.1 vorwiegend komplementär binden kann und von der Polymerase verlängert werden kann und P2.1.1 an P1.1 E1 komplementär binden kann und verlängert werden kann. P1 1 -Ext und P2.1-Ext stellen die zu amplifizierende Nukleinsäure dar, welche als Start- Nukleinsäure 2.1 für die zweite Amplifikation dient. P2.1 , P2.2. und P2.3 stellen Varianten von zweiten Primern dar und führen zu gleichen Amplifikations-Fragmenten.  Where P1.1 .1 can bind predominantly complementary to M1.1 and can be extended by the polymerase and P2.1.1 can bind to P1.1 E1 complementarily and can be extended. P1 1 -Ext and P2.1-Ext represent the nucleic acid to be amplified which serves as starting nucleic acid 2.1 for the second amplification. P2.1, P2.2. and P2.3 represent variants of second primers and result in equal amplification fragments.
Fig. 56 zeigt schematisch die Topographie des zweiten Amplifikations-Systems:  Fig. 56 shows schematically the topography of the second amplification system:
Das dritte Primer-Oligonukleotid umfasst (in 5'-3'-Richtung) folgende Segmente: P3.1.2, P3.1.1 , wobei P3.1.2 nicht komplementär zur Start-Nukleinsäure 1.1 oder zu P2.1 -Ext ist. P3.1 .1 ist im Wesentlichen komplementär zu P2.1 E1 des P2.1 -Ext. The third primer oligonucleotide comprises (in the 5 ' -3 ' direction) the following segments: P3.1.2, P3.1.1, where P3.1.2 is not complementary to the starting nucleic acid 1.1 or to P2.1 -Ext. P3.1 .1 is essentially complementary to P2.1 E1 of the P2.1 text.
Das vierte Primer-Oligonukleotid umfasst (in 5'-3'-Richtung) folgende Segmente: P4.1.2, P4.1.1 , wobei P4.1.2 nicht komplementär zum komplementären Strang der Start-Nukleinsäure 1 .1 oder zu P1 1 -Ext ist. P4.1.1 ist im Wesentlichen komplementär zu P1 .1 E1 des P1 1-Ext. The fourth primer oligonucleotide comprises (in the 5 ' -3 ' direction) the following segments: P4.1.2, P4.1.1, where P4.1.2 is not complementary to the complementary strand of the starting nucleic acid 1 .1 or to P1 1 -Ext , P4.1.1 is essentially complementary to P1 .1 E1 of P1 1-Ext.
Die während der zweiten Amplifikation vorzugsweise erhaltenen Primer-Verlängerungsprodukte P3.1 -Ext und P4.1 -Ext können einen komplementären Doppelstrang bilden und stellen zusammen das zweite Amplifikations-Fragment 2.1 dar.  The preferably obtained during the second amplification primer extension products P3.1 -Ext and P4.1 -Ext can form a complementary double strand and together represent the second amplification fragment 2.1.
P3.1 -Ext umfasst (in 5'-3'-Richtung) folgende Segmente: P3.1 E7, P3.1 E6, P3.1 E5, P3.1 E4,P3.1 -Ext comprises (in the 5 ' -3 ' direction) the following segments: P3.1 E7, P3.1 E6, P3.1 E5, P3.1 E4,
P3.1 E3, P3.1 E2, P3.1 E1 . Die Segmente P3.1 .E5 bis P3.1 E3 sind in ihrer Sequenz identisch zu P1.1 E4 bis P1.1 E2. P3.1 E3, P3.1 E2, P3.1 E1. The segments P3.1 .E5 to P3.1 E3 are identical in their sequence to P1.1 E4 to P1.1 E2.
P4.1 -Ext umfasst (in 5'-3'-Richtung) folgende Segmente: P4.1 E7, P4.1 E6, P43.1 E5, P4.1 E4,P4.1 -Ext comprises (in the 5 ' -3 ' direction) the following segments: P4.1 E7, P4.1 E6, P43.1 E5, P4.1 E4,
P4.1 E3, P43.1 E2, P4.1 E1. Die Segmente P4.1 E5 bis P4.1 E3 sind in ihrer Sequenz identisch zu P2.1 E4 bis P2.1 E2. P4.1 E3, P43.1 E2, P4.1 E1. The segments P4.1 E5 to P4.1 E3 are identical in their sequence to P2.1 E4 to P2.1 E2.
Fig. 57 - 58 zeigt Varianten des dritten Primers (P3.1 , P3.2, P3.3) und des vierten Primers (P4.1 , P4.2, P4.3), wobei das 3'-Segment des jeweiligen Primers verschoben sein kann in Bezug auf einander. FIGS. 57-58 show variants of the third primer (P3.1, P3.2, P3.3) and of the fourth primer (P4.1, P4.2, P4.3), the 3 ' segment of the respective primer may be shifted in relation to each other.
Die Kopplung von beiden Amplifikationen unter Verwendung von Start-Nukleinsäurekette synthetisiert nach dem erfindungsgemäßen Verfahren kann man wie folgt zusammenfassen: The coupling of both amplifications using starting nucleic acid chain synthesized by the method according to the invention can be summarized as follows:
Das Verfahren umfasst die Schritte: The method comprises the steps:
A) Bereitstellung eines Nukleinsäurefragmentes umfassend eine erste Zielsequenz (eine Start- Nukleinsäurekette) B) Bereitstellung eines ersten Amplifikations-Systems, umfassend: A) Provision of a nucleic acid fragment comprising a first target sequence (a start nucleic acid chain) B) providing a first amplification system comprising:
• Ein erstes Primer-Oligonukleotid  A first primer oligonucleotide
• Ein zweites Primer-Oligonukleotid  A second primer oligonucleotide
• Ein Controller-Oligonukleotid  • A controller oligonucleotide
• Eine erste Polymerase  • A first polymerase
• Substrate für die erste Polymerase (dNTPs) und geeignete Puffer-Lösung  • Substrates for the first polymerase (dNTPs) and appropriate buffer solution
C) Bereitstellung eines zweiten Amplifikations-Systems, umfassend:  C) providing a second amplification system comprising:
• Ein drittes Primer-Oligonukleotid  A third primer oligonucleotide
• Ein viertes Primer-Oligonukleotid  A fourth primer oligonucleotide
• Eine zweite Polymerase, welche eine thermostabile Polymerase umfasst  A second polymerase comprising a thermostable polymerase
• Substrate für die zweite Polymerase (dNTPs) und geeignete Puffer-Lösung  Substrates for the second polymerase (dNTPs) and appropriate buffer solution
• Ein Detektions-System  • A detection system
D) Durchführung einer ersten Amplifikation unter Verwendung der Start-Nukleinsäurekette als initialen Matrizenstrang und des ersten Amplifikationssystems, unter Erhalt eines ersten Amplifikations-Fragmetnes 1 .1 , umfassend die erste Zielsequenz, und umfassend ein erstes Primer-Verlängerungsprodukt und ein zweites Primer-Verlängerungsprodukt, welche einen komplementären Doppelstrang bilden können, wobei das erste Primer-Verlängerungsprodukt resultiert aus matrizenabhängiger Verlängerung eines ersten Primers mittels einer Polymerase unter Verwendung der Start-Nukleinsäurekette und / oder des zweiten Primer- Verlängerungsproduktes als Matrize und das zweite Primer-Verlängerungsprodukt resultiert aus matrizenabhängiger Verlängerung eines zweiten Primers mittels einer Polymerase unter Verwendung des ersten Primer-Verlängeungsproduktes als Matrize, wobei das erste und das zweite Primer-Verlängerungsprodukt gegenseitig als Matrizen für die jeweilige Primer- Verlängerung dienen können und  D) performing a first amplification using the starting nucleic acid chain as the initial template strand and the first amplification system to obtain a first amplification fragment 1 .1 comprising the first target sequence, and comprising a first primer extension product and a second primer extension product, which can form a complementary duplex, wherein the first primer extension product results from template-dependent extension of a first primer by means of a polymerase using the start nucleic acid chain and / or the second primer extension product as template and the second primer extension product results from template-dependent extension of one second primer by means of a polymerase using the first primer extension product as a template, wherein the first and the second primer extension product mutually serve as templates for the respective primer extension can and
wobei beide komplementären Stränge des ersten Amplifikations-Produktes 1 .1 unter Mitwirkung des Controller-Oligonukleotides zumindest teilweise in einzelsträngige Form überführt werden können, so dass eine erneute Primer-Bindung an jeweils komplementäre Seqmente der synthetisierten Primer-Verlängerungsprodutke möglich ist und wherein both complementary strands of the first amplification product 1 .1 can be at least partially converted into single-stranded form with the assistance of the controller oligonucleotide, so that a renewed primer binding to each complementary Seqmente of the synthesized primer extension Produtke is possible and
die verwendeten Reaktionsbedingen der ersten Amplifikation mindestens einen Temperatur-Schritt umfassen, welcher Hybridisierung und matrizenabhängige Primer-Verlängerung von beiden Primern des ersten Amplifikations-Systems zuläßt und mindestens einen Temperatur-Schritt umfassen, bei welchem das erste Primer-Verlängerungsprodukt vom zweiten Primer- Verlängerungsprodukt unter Mitwirkung des Controller-Oligonukleotides getrennt wird, wobei die verwendeten Reaktionsbedingungen keine spontante Trennung des ersten Primer- Verlängerungsproduktes vom zweiten Primer-Verlängerungsprodukt in Abwesenheit des Controller-Oligonukleotides zulassen. Wobei die erste Amplifikation so lange durchgeführt wird bis die gewünschte Menge des ersten Amplifikationsproduktes 1.1 synthetisiert wird. the reaction conditions of the first amplification used comprise at least one temperature step permitting hybridization and template-dependent primer extension of both primers of the first amplification system and comprising at least one temperature step in which the first primer extension product is displaced from the second primer extension product With the use of the controller oligonucleotide is separated, wherein the reaction conditions used no spontaneous separation of the first primer Allow extension product from the second primer extension product in the absence of the controller oligonucleotide. Wherein the first amplification is carried out until the desired amount of the first amplification product 1.1 is synthesized.
E) Durchführung einer zweiten Amplifikation unter Verwendung von mindestens einem der beiden Stränge des ersten Amplifikations-Fragmentes 1.1 als initialer Matrizenstrang und unter Verwendung des zweiten Amplifikations-Systems unter Erhalt eines zweiten Amplifikations- Fragments 2.1 , umfassend ein drittes Primer-Verlängerungsprodukt und ein viertes Primer- Verlängerungsprodukt, welche einen komplementären Doppelstrang bilden können, wobei beide Stränge des Amplifikations-Fragments 2.1 beide als Matrizen bei einer Primer-Verlängerung dienen können, wobei die verwendeten Reaktionsbedingungen der zweiten Amplifikation mindestens in einem Temperatur-Schritt eine Hybridisierung der beiden Primer des zweiten Amplifikations-Systems und eine matrizenabhängige Primer-Verlängerung des jeweils an komplementäre Bereiche gebundenen Primers des zweiten Amplifikations-Systems zulassen und mindestens in einem weiteren Temperatur-Schritt eine Trennung eines Doppelstranges zulassen, umfassend ein drittes Primer-Verlängerungsprodukt und ein viertes Primer-Verlängerungsprodukt, wobei das dritte und das vierte Primer-Verlängerungsprodukt in einzelstränige Form überführt werden, so dass eine erneute Primer-Bindung und Verlängerung stattfinden kann. Wobei die zweite Amplifikation so lange durchgeführt wird bis die gewünschte Menge des zweiten Amplifikationsproduktes 2.1 synthetisiert wird.  E) performing a second amplification using at least one of the two strands of the first amplification fragment 1.1 as an initial template strand and using the second amplification system to obtain a second amplification fragment 2.1 comprising a third primer extension product and a fourth primer - Extension product, which can form a complementary double strand, both strands of the amplification fragment 2.1 can both serve as templates in a primer extension, wherein the reaction conditions used the second amplification at least in a temperature step, a hybridization of the two primers of the second amplification Allow system and a template-dependent primer extension of each bound to complementary regions primer of the second amplification system and allow at least in a further temperature step, a separation of a double strand include and a third primer extension product and a fourth primer extension product, wherein the third and fourth primer extension products are converted into single stranded form such that re-primer binding and extension may occur. Wherein the second amplification is carried out until the desired amount of the second amplification product 2.1 is synthesized.
Im Einzelnen bestimmen die Eigenschaften von Komponenten des jeweiligen Amplifikations- Systems, des Nukeinsäurefragmentes umfassend eine erste Zielsequenz, sowie die verwendeten Reaktionsbedingungen den Verlauf der beiden Amplifikations-Reaktionen.  In detail, the properties of components of the respective amplification system, of the nucleic acid fragment comprising a first target sequence, as well as the reaction conditions used, determine the course of the two amplification reactions.
Im Allgemeinen erfolgt die erste Amplifikation unter Mitwirkung des Controller-Oligonukleotides. Dabei erfolgt die Trennung der beiden synthetisierten Primer-Verlängerungsprodukte zumindest teilweise in Abhängigkeit von der Sequenzusammensetzung des ersten Primer- Verlängerungsproduktes und ihrer Komplementarität zur Zusammensetzung des Controller- Oligonukleotides.  In general, the first amplification takes place with the assistance of the controller oligonucleotide. The separation of the two synthesized primer extension products takes place at least in part depending on the sequence composition of the first primer extension product and its complementarity with the composition of the controller oligonucleotide.
Während der zweiten Amplifikation wird ein zweites Amplifikations-Fragment 2.1 im Wesentlichen ohne Mitwirkung des Controller-Oligonukleotide amplifiziert.  During the second amplification, a second amplification fragment 2.1 is amplified essentially without the involvement of the controller oligonucleotides.
Im Verlauf von beiden Amplifikations-Reaktionen können sowohl gewünschte Amplifikations- Produkte (Amplifikation-Fragment 1 .1 und Amplifikations-Fragment 2.1 ) gebildet werden, als auch ihre Zwischen-Stufen (Zwischenprodukte) (Fig. 58). Die Zusammensetzung der Zwischenprodukte hängt im Wesentlichen von den bereitgestellten Komponenten des ersten und des zweiten Amplifikations-Systems ab.  In the course of both amplification reactions both desired amplification products (amplification fragment 1 .1 and amplification fragment 2.1) can be formed, as well as their intermediate stages (intermediates) (FIG. 58). The composition of the intermediates depends essentially on the provided components of the first and second amplification systems.
Nachfolgend werden einige molekulare Vorgänge und dabei resultierende Produkte und die potenziellen Zwischenstufen exemplarisch und schematisch erläutert. Gemäß einem ersten Aspekt der Erfindung wird ein Verfahren zur Amplifikation zur Verfügung gestellt. Das Verfahren umfasst die Schritte: In the following, some molecular processes and the resulting products and the potential intermediates will be exemplarily and schematically explained. According to a first aspect of the invention, a method for amplification is provided. The method comprises the steps:
1 ) eine erste Amplifikation mit den Schritten  1) a first amplification with the steps
1.A) Hybridisieren eines ersten Primer-Oligonukleotids an das 3'-Segment eines als Matrize dienenden Nukleinsäurefragments (Matrizenstrang, Start-Nukleinsäurekette) einer ersten zu amplifizierenden Nukleinsäure, welche eine erste Zielsequenz umfasst, wobei das erste Primer-Oligonukleotid folgende Bereiche umfasst:  1.A) hybridizing a first primer oligonucleotide to the 3 'segment of a template nucleic acid fragment (template strand, starting nucleic acid chain) of a first nucleic acid to be amplified which comprises a first target sequence, wherein the first primer oligonucleotide comprises the following regions:
• einen ersten Bereich, der sequenzspezifisch an das 3' -Segment eines Matrizenstranges der ersten zu amplifizierenden Nukleinsäure binden kann und komplementär zumindest zu einem Teil der Zielsequenz ist;  A first region which can sequence-specifically bind to the 3 'segment of a template strand of the first nucleic acid to be amplified and is complementary to at least a portion of the target sequence;
• einen zweiten Bereich, der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid gebunden werden kann und von einer für die erste Amplifikation verwendeten Polymerase unter den gewählten  A second region which connects to the 5 'end of the first region or is linked via a linker, the second region being capable of being bound by a controller oligonucleotide and of a polymerase used for the first amplification among the selected ones
Reaktionsbedingungen im Wesentlichen unkopiert bleibt;  Reaction conditions remain essentially unkopiert;
1.B) Verlängerung des ersten Primer-Oligonukleotids wenn hybridisiert an komplementäre Segmente einer ersten zu amplifizierenden Nukleionsäure durch die erste matrizenabhängige Polymerase unter Erhalt eines ersten Primer-Verlängerungsprodukts, welches neben dem ersten Primer-Oligonukleotid einen von der Polymerase synthetisierten Bereich umfasst, der im Wesentlichen komplementär zum Matrizenstrang der ersten zu amplifizierenden  1.B) extension of the first primer oligonucleotide when hybridized to complementary segments of a first nucleic acid to be amplified by the first template-dependent polymerase to obtain a first primer extension product which comprises, in addition to the first primer oligonucleotide, a polymerase-synthesized region Substantially complementary to the template strand of the first to be amplified
Nukleinsäure ist, welcher eine erste Zielsequenz umfasst, wobei das erste Primer- Verlängerungsprodukt und der Matrizenstrang der ersten zu amplifizierenden Nukleinsäure im Wesentlichen als Doppelstrang unter verwendeten Reaktionsbedingungen der ersten Amplifikation vorliegen;  Nucleic acid comprising a first target sequence, wherein the first primer extension product and the template strand of the first nucleic acid to be amplified are present substantially as a duplex under reaction conditions of the first amplification used;
1 .C) Bindung eines Controller-Oligonukleotids an das erste Primer-Verlängerungsprodukt, wobei das Controller-Oligonukleotid folgende Bereiche umfasst:  1 .C) binding of a controller oligonucleotide to the first primer extension product, wherein the controller oligonucleotide comprises the following ranges:
• einen ersten Bereich, der an den zweiten Bereich des ersten Primers und / oder des ersten Primer-Verlängerungsprodukts binden kann;  A first region capable of binding to the second region of the first primer and / or the first primer extension product;
• einen zweiten Bereich, der zum ersten Bereich des ersten Primer-Oligonukleotids und / oder des ersten Primer-Verlängerungsproduktes im Wesentlichen komplementär oder vollständig komplementär ist, und  A second region that is substantially complementary or fully complementary to the first region of the first primer oligonucleotide and / or the first primer extension product, and
• einen dritten Bereich, der zumindest zu einem Teil des von der Polymerase  • a third area that is at least part of the polymerase
synthetisierten Bereiches des ersten Primer-Verlängerungsprodukts im  in the synthesized region of the first primer extension product in the
Wesentlichen komplementär oder vollständig komplementär ist; wobei das Controller-Oligonukleotid nicht als Matrize für eine Primerverlängerung des ersten Primer-Oligonukleotids dient, und das Controller-Oligonukleotid ein Sequenzsegment umfasst, welches zu einem Strang der ersten zu amplifizierenden Nukleinsäure komplementär oder im Wesentlichen komplementär ist, und Is substantially complementary or fully complementary; wherein the controller oligonucleotide does not serve as a template for primer extension of the first primer oligonucleotide, and the controller oligonucleotide comprises a sequence segment which is complementary or substantially complementary to a strand of the first nucleic acid to be amplified, and
das Controller-Oligonukleotid an den ersten Bereich des ersten Primer- Verlängerungsprodukts bindet und  the controller oligonucleotide binds to the first region of the first primer extension product and
und das Controller-Oligonukleotid an den zweiten Bereich des ersten Primer- Verlängerungsproduktes, sowie zumindest teilweise an den synthetisierten Bereich des ersten Primer-Verlängerungsproduktes unter Verdrängung von komplementären Anteilen des Matrizenstrangs der ersten zu amplifizierenden Nukleinsäure bindet; wobei der von der Polymerase synthetisierte Bereich des ersten Primer-Verlängerungsproduktes umfassend das zum zweiten Primer-Oligonukleotid komplementäre Segment des ersten Primer-Verlängerungsproduktes unter Reaktionsbedingungen einzelsträngig wird  and binding the controller oligonucleotide to the second region of the first primer extension product, as well as at least partially to the synthesized region of the first primer extension product, displacing complementary portions of the template strand of the first nucleic acid to be amplified; wherein the polymerase synthesized portion of the first primer extension product comprising the second primer oligonucleotide complementary segment of the first primer extension product becomes single-stranded under reaction conditions
1 .D) Hybridisieren eines zweiten Primer-Oligonukleotids an das einzelsträngige  1 .D) hybridizing a second primer oligonucleotide to the single-stranded one
komplementäre Segment des ersten Primer-Verlängerungsprodukts, wobei das zweite Primer-Oligonukleotid einen Bereich umfasst, der sequenzspezifisch an den synthetisierten Bereich des ersten Primer-Verlängerungsprodukts hybridisieren kann und mindestens einen Anteil einer Zielsequenz umfasst  A complementary segment of the first primer extension product, wherein the second primer oligonucleotide comprises a region capable of hybridizing sequence-specifically to the synthesized region of the first primer extension product and comprising at least a portion of a target sequence
1 .E) Verlängerung des zweiten Primer-Oligonukleotids durch die erste Polymerase unter Verwendung des ersten Primer-Verlängerungsproduktes als Matrize unter Erhalt eines zweiten Primer-Verlängerungsproduktes, welches neben dem zweiten Primer-Oligonukleotid einen von der Polymerase synthetisierten Bereich umfasst, der zumindest einen Anteil der ersten Zielsequenz umfasst, wobei das erste Primer-Verlängerungsprodukt und das zweite Primerverlängerungsprodukt unter Reaktionsbedingungen der ersten Amplifikation ein erstes doppelsträngiges Amplifikationsprodukt bilden; und;  1 .E) extension of the second primer oligonucleotide by the first polymerase using the first primer extension product as a template to yield a second primer extension product comprising, in addition to the second primer oligonucleotide, a polymerase synthesized region comprising at least a portion the first target sequence, wherein the first primer extension product and the second primer extension product form a first double-stranded amplification product under reaction conditions of the first amplification; and;
1 .F) Ggf. Wiederholung der Schritte der ersten Amplifikation 1 .F) If necessary Repetition of the steps of the first amplification
) eine zweite Amplifikation mit den Schritten (Fig. 58): ) a second amplification with the steps (Figure 58):
2.A) Hybridisieren eines dritten Primer-Oligonukleotids an das zweite Primer- Verlängerungsprodukt des ersten Amplifikationsprodukts, wobei das dritte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an ein Segment des zweiten Primer-Verlängerungsprodukt binden kann;  2.A) hybridizing a third primer oligonucleotide to the second primer extension product of the first amplification product, the third primer oligonucleotide comprising a first region capable of substantially sequence-specific binding to a segment of the second primer extension product;
2.B) Verlängerung des dritten Primer-Oligonukleotids durch eine zweite Polymerase unter Verwendung des zweiten Primer-Verlängerungsproduktes als Matrize unter Erhalt eines dritten Primer-Verlängerungsprodukts (P3.1-Ext Teil 1 ), welches neben dem dritten Primer- Oligonukleotid einen von der Polymerase synthetisierten Bereich umfasst, der ein  2.B) extension of the third primer oligonucleotide by a second polymerase using the second primer extension product as a template to give a third primer extension product (P3.1-Ext part 1) containing, in addition to the third primer oligonucleotide, one of the Polymerase comprises a synthesized area that includes a
Sequenzsegment umfasst, welches im Wesentlichen komplementär zum zweiten Primer- Verlängerungsprodukt bzw. zur ersten zu amplifizierenden Nukleinsäure oder zu einem Anteil der ersten Zielsequenz ist, wobei das zweite Primer-Verlängerungsprodukt und das dritte Primer-Verlängerungsprodukt (P3.1 -Ext Teil 1 ) als Doppelstrang vorliegen; Sequence segment comprises, which is substantially complementary to the second primer extension product or to the first nucleic acid to be amplified or to a proportion the first target sequence, wherein the second primer extension product and the third primer extension product (P3.1-Ext part 1) are present as a double strand;
2C) Hybridisieren eines vierten Primer-Oligonukleotids an das erste Primer- Verlängerungsprodukt des ersten Amplifikationsprodukts, wobei das vierte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an den von der Polymerase synthetisierten Bereich des ersten Primer-Verlängerungsprodukts binden kann;  2C) hybridizing a fourth primer oligonucleotide to the first primer extension product of the first amplification product, the fourth primer oligonucleotide comprising a first region capable of substantially sequence-specific binding to the polymerase-synthesized region of the first primer extension product;
2D) Verlängerung des vierten Primer-Oligonukleotids durch die zweite Polymerase unter Verwendung des ersten Primer-Verlängerungsproduktes als Matrize unter Erhalt eines vierten Primer-Verlängerungsproduktes (P4.1 -Ext Teil 1 ), welches neben dem vierten Primer- Oligonukleotid einen von der Polymerase synthetisierten Bereich umfasst, der im  2D) extension of the fourth primer oligonucleotide by the second polymerase using the first primer extension product as template to yield a fourth primer extension product (P4.1-Ext Part 1) which synthesized one from the polymerase in addition to the fourth primer oligonucleotide Area includes, in the
Wesentlichen komplementär zum ersten Primer-Verlängerungsprodukt ist und Anteile der Zielsequenz umfasst, wobei das erste Primer-Verlängerungsprodukt und das vierte Primer- Verlängerungsprodukt (P4.1-Ext Teil 1 ) als Doppelstrang vorliegen; Is substantially complementary to the first primer extension product and comprises portions of the target sequence, wherein the first primer extension product and the fourth primer extension product (P4.1-Ext Part 1) are present as a duplex;
2E) Trennung des Doppelstrangs aus dem ersten Primer-Verlängerungsprodukt und dem vierten Primer-Verlängerungsprodukt (P4.1 -Ext Teil 1 ) und des Doppelstrangs aus dem zweiten Primer-Verlängerungsprodukt und dem dritten Primer-Verlängerungsprodukt (P3.1 - Ext Teil 1 );  2E) Separation of the double strand from the first primer extension product and the fourth primer extension product (P4.1 -Ext part 1) and the double strand from the second primer extension product and the third primer extension product (P3.1 - Ext Part 1) ;
2.F) Hybridisieren eines dritten Primer-Oligonukleotids an das vierte Primer- Verlängerungsprodukt (erhalten im Schritt 2D, P4.1 -Ext Teil 1 ), wobei das dritte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an ein Segment des vierten Primer-Verlängerungsprodukts (P4.1-Ext Teil 1 ) binden kann;  2.F) hybridizing a third primer oligonucleotide to the fourth primer extension product (obtained in step 2D, P4.1-Ext part 1), the third primer oligonucleotide comprising a first region substantially sequence-specific to a segment of the nucleotide fourth primer extension product (P4.1-Ext Part 1);
2.G) Verlängerung des dritten Primer-Oligonukleotids durch eine zweite Polymerase unter Verwendung des vierten Primer-Verlängerungsprodutkes (P4.1 -Ext Teil 1 ) als Matrize unter Erhalt eines vollständigen dritten Primer-Verlängerungsprodukts (P3.1-Ext), wobei das dritte Primer-Verlängerungsprodukt (P3.1 -Ext) und das vierte Primer-Verlängerungsprodukt (P4.1- Ext Teil 1 ) als Doppelstrang vorliegen;  2.G) extension of the third primer oligonucleotide by a second polymerase using the fourth primer extension product (P4.1-Ext Part 1) as a template to give a complete third primer extension product (P3.1-Ext), the the third primer extension product (P3.1-Ext) and the fourth primer extension product (P4.1-Ext Part 1) are present as a double strand;
2H) Hybridisieren eines vierten Primer-Oligonukleotids an das dritte Primer- Verlängerungsprodukt (erhalten im Schritt 2B, P3.1 -Ext Teil 1 ), wobei das vierte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an den von der Polymerase synthetisierten Bereich des dritten Primer-Verlängerungsprodukts binden kann;  2H) hybridizing a fourth primer oligonucleotide to the third primer extension product (obtained in step 2B, P3.1 -ext part 1), wherein the fourth primer oligonucleotide comprises a first region which is substantially sequence-specific to that synthesized by the polymerase Area of the third primer extension product can bind;
2I) Verlängerung des vierten Primer-Oligonukleotids durch die zweite Polymerase unter Verwendung des dritten Primer-Verlängerungsproduktes (P3.1-Ext Teil 1 ) als Matrize unter Erhalt eines vollständigen vierten Primer-Verlängerungsproduktes (P4.1 -Ext), wobei das dritte Primer-Verlängerungsprodukt (P3.1 -Ext Teil 1 ) und das vierte Primer- Verlängerungsprodukt (P4.1-Ext) als Doppelstrang vorliegen; 2J) Trennung des Doppelstrangs aus dem dritten Primer-Verlängerungsprodukt (P3.1 -Ext Teil 1 ) und dem vollständigen vierten Primer-Verlängerungsprodukt (P4.1-Ext) und des Doppelstrangs aus dem vierten Primer-Verlängerungsprodukt (P4.1 -Ext Teil 1 ) und dem vollständigen dritten Primer-Verlängerungsprodukt (P3.1 -Ext); 2I) extension of the fourth primer oligonucleotide by the second polymerase using the third primer extension product (P3.1-Ext Part 1) as template to give a complete fourth primer extension product (P4.1 -Ext), the third primer Extension product (P3.1-Ext Part 1) and the fourth primer extension product (P4.1-Ext) are present as a double strand; 2J) Separation of the double strand from the third primer extension product (P3.1 Ext Part 1) and the complete fourth primer extension product (P4.1 Ext) and the double strand from the fourth primer extension product (P4.1-Ext part 1) and the complete third primer extension product (P3.1-ext);
2.K) Hybridisieren eines dritten Primer-Oligonukleotids an das vollständige vierte Primer- Verlängerungsprodukt (erhalten im Schritt 2I, P4.1 -Ext), wobei das dritte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an ein Segment des vierten Primer-Verlängerungsprodukts (P4.1-Ext) binden kann;  2.K) hybridizing a third primer oligonucleotide to the complete fourth primer extension product (obtained in step 2I, P4.1 -Ext), wherein the third primer oligonucleotide comprises a first region substantially sequence-specific to a segment of the fourth Primer extension product (P4.1-Ext);
2.L) Verlängerung des dritten Primer-Oligonukleotids durch eine zweite Polymerase unter Verwendung des vollständigen vierten Primer-Verlängerungsproduktes (P4.1 -Ext) als Matrize unter Erhalt eines vollständigen dritten Primer-Verlängerungsprodukts (P3.1-Ext), wobei das vollständige dritte Primer-Verlängerungsprodukt (P3.1-Ext) und das vollständige vierte Primer-Verlängerungsprodukt (P4.1 -Ext) als Doppelstrang vorliegen;  2.L) extension of the third primer oligonucleotide by a second polymerase using the complete fourth primer extension product (P4.1 -Ext) as template to give a complete third primer extension product (P3.1-Ext), the complete the third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext) are present as a double strand;
2M) Hybridisieren eines vierten Primer-Oligonukleotids an das vollständige dritte Primer- Verlängerungsprodukts (erhalten im Schritt 2G, P3.1 -Ext ), wobei das vierte Primer- Oligonukleotid einen ersten Bereichs umfasst, der im Wesentlichen sequenzspezifisch an den von Polymerase synthetisierten Bereich des vollständigen dritten Primer- Verlängerungsprodukts binden kann;  2M) hybridizing a fourth primer oligonucleotide to the complete third primer extension product (obtained in step 2G, P3.1 -Ext), the fourth primer oligonucleotide comprising a first region substantially sequence specific to the polymerase synthesized region of the full third primer extension product can bind;
2N) Verlängerung des vierten Primer-Oligonukleotids durch die zweite Polymerase unter Verwendung des vollständigen dritten Primer-Verlängerungsproduktes (P3.1-Ext ) als Matrize unter Erhalt eines vollständigen vierten Primer-Verlängerungsproduktes (P4.1-Ext), wobei das vollständige dritte Primer-Verlängerungsprodukt (P3.1-Ext ) und das vollständige vierte Primer-Verlängerungsprodukt (P4.1 -Ext) als Doppelstrang vorliegen;  2N) extension of the fourth primer oligonucleotide by the second polymerase using the complete third primer extension product (P3.1-Ext) as template to yield a complete fourth primer extension product (P4.1-Ext), the complete third primer Extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext) are present as a double strand;
20) Trennung der in Schritt 2L und 2N gebildeten Doppelstränge aus dem vollständigen dritten Primer-Verlängerungsprodukt (P3.1-Ext) und dem vollständigen vierten Primer- Verlängerungsprodukt (P4.1-Ext)  20) Separation of the double strands formed in steps 2L and 2N from the complete third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1-Ext)
2.P) Ggf. Wiederholung der Schritte der zweiten Amplifikation unter Vermehrung des vollständigen dritten Primer-Verlängerungsproduktes (P3.1-Ext) und des vollständigen vierten Primer-Verlängerungsproduktes (P4.1 -Ext).  2.P) If necessary Repetition of the steps of the second amplification with propagation of the complete third primer extension product (P3.1-Ext) and the complete fourth primer extension product (P4.1 -Ext).
wobei der Reaktionsmischung ein Detektionssystem zugegeben wird. wherein a detection system is added to the reaction mixture.
Der Umfang von Ausbeuten an einzelnen Produkten und Zwischenprodukten hängt von mehreren Faktoren ab. Beispielsweise begünstigen höhere Konzentrationen von einzelnen Primern im Allgemeinen die Ausbeuten an Produkten / Zwischenprodukten. Weiterhin kann die Bildung von Produkten / Zwischenprodukten durch die Reaktions-Temperatur sowie durch die Bindung / Affinität einzelner Reaktionsteilnehmer zu einander beeinflusst werden (Affinität der Bindung einzelner Primer an ihre komplementäre Primerbindungsstellen innerhalb von Matrizensträngen): im Allgemeinen binden beispielsweise längere Oligonukleotide bei höheren Temperaturen besser als kürzere Oligonukleotide, weiterhin kann der CG-Gehalt bei komplementären Sequenzsegmenten eine Rolle spielen: CG-reichere Sequenzen binden ebenfalls bei höheren Temperaturen stärker als AT-Reiche Sequenzen. Weiterhin können Modifikationen, wie MGB oder 2-Amino-dA oder LNA, die Bindungsstärke von Primern an ihre respektive komplementäre Segmente erhöhen, was ebenfalls in bevorzugter Bindung von Primern bei höheren Temperaturen resultiert. The amount of yields of individual products and intermediates depends on several factors. For example, higher concentrations of individual primers generally favor the yields of products / intermediates. Furthermore, the formation of products / intermediates can be influenced by the reaction temperature as well as the binding / affinity of individual reactants to each other (affinity of the binding of individual primers to their complementary primer binding sites within Template strands): in general, for example, longer oligonucleotides bind better than shorter oligonucleotides at higher temperatures, and CG content may also play a role in complementary sequence segments: CG-richer sequences also bind more strongly at higher temperatures than AT-rich sequences. Furthermore, modifications such as MGB or 2-amino-dA or LNA can increase the binding strength of primers to their respective complementary segments, which also results in preferential binding of primers at higher temperatures.
Daraus lässt sich ableiten, dass durch die Gestaltung von Sequenzsegmenten einzelner Primer- Sequenzen Einfluss auf die Ausbeuten bestimmter Produkte / Zwischenprodukte genommen werden kann und somit ihre Anreicherung während der Amplifikation beeinflusst werden kann. It can be deduced from this that the design of sequence segments of individual primer sequences can influence the yields of certain products / intermediates and thus their enrichment during amplification can be influenced.
Verfahren zur Amplifikation einer Nukleinsäure (Fig. 56 - 58) , umfassend die Schritte: A method of amplifying a nucleic acid (Figs. 56-58), comprising the steps of:
a) eine erste Amplifikation mit den Schritten:  a) a first amplification with the steps:
Bereitstellung einer Start-Nukleinsäure 1.1 , welche eine Zielsequenz umfasst Provision of a starting nucleic acid 1.1, which comprises a target sequence
Hybridisieren eines ersten Primer-Oligonukleotids (P1.1 ) an eine zu amplifizierende Nukleinsäure mit einer Zielsequenz (entweder Start-Nukleinsäure 1.1 oder P2.1 -Ext), wobei das erste Primer-Oligonukleotid (P1 .1 ) folgende Bereiche umfasst: Hybridizing a first primer oligonucleotide (P1.1) to a nucleic acid to be amplified with a target sequence (either starting nucleic acid 1.1 or P2.1 -Ext), wherein the first primer oligonucleotide (P1.1) comprises the following ranges:
• einen ersten Bereich (P1.1.1 ), der sequenzspezifischen an einen Bereich der zu amplifizierenden Nukleinsäure (P2.1 E1 ) binden kann,  A first region (P1.1.1) which can bind sequence-specific to a region of the nucleic acid to be amplified (P2.1 E1),
• einen zweiten Bereich (P1.1.2) , der sich an das 5'-Ende des ersten Bereichs anschließt oder über einen Linker verbunden ist, wobei der zweite Bereich von einem Controller-Oligonukleotid gebunden werden kann und für die verwendete Polymerase unter den gewählten  A second region (P1.1.2) which connects to the 5 'end of the first region or is linked via a linker, the second region being capable of being bound by a controller oligonucleotide and of the polymerase used
Reaktionsbedingungen im Wesentlichen unkopiert bleibt;  Reaction conditions remain essentially unkopiert;
Verlängerung des ersten Primer-Oligonukleotids (P1.1 ) durch eine erste  Extension of the first primer oligonucleotide (P1.1) by a first
Polymerase unter Erhalt eines ersten Primer-Verlängerungsprodukts (P1 1-Ext), welches neben dem ersten Primer-Oligonukleotid (P1 .1 ) einen synthetisierten Bereich umfasst (P1 .1 E1 bis P1.1 E4), der im Wesentlichen komplementär zu der zu amplifizierenden Nukleinsäure oder zur Zielsequenz ist, wobei das erste Primer-Verlängerungsprodukt und die zu amplifizierende Nukleinsäure als Doppelstrang vorliegen;  Polymerase to obtain a first primer extension product (P1 1-Ext), which in addition to the first primer oligonucleotide (P1 .1) comprises a synthesized region (P1 .1 E1 to P1.1 E4), which is substantially complementary to that amplifying nucleic acid or to the target sequence, wherein the first primer extension product and the nucleic acid to be amplified are present as a double strand;
Bindung eines Controller-Oligonukleotids (C1.2) an das erste Primer- Verlängerungsprodukt (P1.1 -Ext), wobei das Controller-Oligonukleotid (C1.2) folgende Bereiche umfasst:  Binding of a controller oligonucleotide (C1.2) to the first primer extension product (P1.1 -Ext), wherein the controller oligonucleotide (C1.2) comprises the following ranges:
• einen ersten Bereich (01 .2.1 ), der an den zweiten Bereich (Überhang) des ersten Primer-Verlängerungsprodukts (P1.1 E6) binden kann, • einen zweiten Bereich (C1.2.2), der zum ersten Bereich des ersten Primer-Oligonukleotids (P1.1 .1 ) komplementär ist, und A first region (01 .2.1) which can bind to the second region (overhang) of the first primer extension product (P1.1 E6), A second region (C1.2.2) which is complementary to the first region of the first primer oligonucleotide (P1.1 .1), and
• einen dritten Bereich (C1 .2.3), der zumindest zu einem Teil des  • a third area (C1 .2.3) that is at least part of the
synthetisierten Bereiches des ersten Primer-Verlängerungsprodukts (P1.1 E4) im Wesentlichen komplementär ist; und  synthesized region of the first primer extension product (P1.1 E4) is substantially complementary; and
wobei das Controller-Oligonukleotid (C1 .1 ) nicht als Matrize für eine  wherein the controller oligonucleotide (C1 .1) is not used as a template for a
Primerverlängerung des ersten Primer-Oligonukleotids (P1 .1 ) dient, und das erste Controller-Oligonukleotid (C 1 .1 ) an das erste Primer-Verlängerungsprodukt (P1 .1 E6, P1 .1 E5, P1 .1 E4) unter Verdrängung des zu diesem Bereich  Primer extension of the first primer oligonucleotide (P1 .1), and the first controller oligonucleotide (C 1 .1) to the first primer extension product (P1 .1 E6, P1 .1 E5, P1 .1 E4) with displacement of the to this area
komplementären Bereichs (P2.1 E1 , P2.1 E2) der zu amplifizierenden  complementary region (P2.1 E1, P2.1 E2) of the to be amplified
Nukleinsäure bindet;  Nucleic acid binds;
Hybridisieren eines zweiten Primer-Oligonukleotids (P1.1 ) an das erste Primer- Verlängerungsprodukt, wobei das zweite Primer-Oligonukleotid (P2.1 ) einen Bereich umfasst (P2.1.1 ), der sequenzspezifisch an den synthetisierten Bereich des ersten Primer-Verlängerungsprodukts (P1.1 E1 ) binden kann,  Hybridizing a second primer oligonucleotide (P1.1) to the first primer extension product, wherein the second primer oligonucleotide (P2.1) comprises a region (P2.1.1) that is sequence-specifically attached to the synthesized region of the first primer extension product (P1.1). P1.1 E1) can bind,
Verlängerung des zweiten Primer-Oligonukleotids (P.2.1 ) durch die erste  Extension of the second primer oligonucleotide (P.2.1) by the first
Polymerase unter Erhalt eines zweiten Primer-Verlängerungsproduktes (P2.1 - Ext), welches neben dem zweiten Primer-Oligonukleotid (P2.1 ) einen  Polymerase to give a second primer extension product (P2.1 - Ext), which in addition to the second primer oligonucleotide (P2.1) a
synthetisierten Bereich (P2.1 E4 bis P2.1 E1 ) umfasst, der im Wesentlichen identisch zu der zu amplifizierenden Nukleinsäure oder zur Zielsequenz ist, wobei das erste Primer-Verlängerungsprodukt (P1 1-Ext) und das zweite  synthesized region (P2.1 E4 to P2.1 E1) which is substantially identical to the nucleic acid or the target sequence to be amplified, wherein the first primer extension product (P1 1-Ext) and the second
Primerverlängerungsprodukt (P2.1 ) ein erstes doppelsträngiges  Primer extension product (P2.1) a first double-stranded
Amplifikationsprodukt bilden; und  Form amplification product; and
Schritte der ersten Amplifikation wiederholt werden, bis die gewünschte Menge an ersten Amplifikationsprodukten synthetisiert wurde.  Steps of the first amplification are repeated until the desired amount of first amplification products has been synthesized.
b) eine zweite Amplifikation mit den Schritten: b) a second amplification with the steps:
Hybridisieren eines dritten Primer-Oligonukleotids (P3.2) an das zweite und / oder das vierte Primer-Verlängerungsprodukt (P1 .1-Ext. oder P4.1 -Ext ), wobei der dritte Primer-Oligonukleotid (P3.2) einen ersten Bereich (P3.1 .1 ) umfasst, der sequenzspezifisch an einen Bereich des zweiten Primer-Verlängerungsprodukts (P2.1 E1 ) und des vierten Primer-Verlängerungsprodukts (P4.1 E2) binden kann, Hybridizing a third primer oligonucleotide (P3.2) to the second and / or the fourth primer extension product (P1 .1-Ext. Or P4.1-Ext), wherein the third primer oligonucleotide (P3.2) has a first Comprises a region (P3.1 .1) which can sequence-specifically bind to a region of the second primer extension product (P2.1 E1) and the fourth primer extension product (P4.1 E2),
Verlängerung des dritten Primer-Oligonukleotids (P3.2) durch eine zweite Polymerase unter Erhalt eines dritten Primer-Verlängerungsprodukts (P3.2-Ext), welches neben dem dritten Primer-Oligonukleotid (P3.2) einen synthetisierten Bereich (P3.1 E5 bis P3.1 E2 bzw. P3.1 E5 bis P3.1 E1 ) umfasst, der im Extension of the third primer oligonucleotide (P3.2) by a second polymerase to obtain a third primer extension product (P3.2-Ext) which, in addition to the third primer oligonucleotide (P3.2), has a synthesized region (P3.1 E5 to P3.1 E2 or P3.1 E5 to P3.1 E1), which in
Wesentlichen komplementär zum zweiten Primer-Verlängerungsprodukt (P2.1- Ext) oder zur Zielsequenz ist, wobei das zweite Primer-Verlängerungsprodukt (P2.1 ) und das dritte Primer-Verlängerungsprodukt (P3.1 ) als Doppelstrang vorliegen; Substantially complementary to the second primer extension product (P2.1- Ext) or to the target sequence, wherein the second primer extension product (P2.1) and the third primer extension product (P3.1) are present as a double strand;
Hybridisieren eines vierten Primer-Oligonukleotids (P4.2) an das erste Primer- Verlängerungsprodukts (P1 1 -Ext) und / oder an das dritte Primer- Hybridizing a fourth primer oligonucleotide (P4.2) to the first primer extension product (P1 1 -Ext) and / or to the third primer
Verlängerungsprodukt (P3.1 -Ext) wobei das vierte Primer-Oligonukleotid (P4.2) einen ersten Bereichs umfasst (P4.1.1 ), der sequenzspezifisch an den synthetisierten Bereich des ersten Primer-Verlängerungsprodukts (P1.1 E1 ) und des dritten Primerverlängerungsproduktes (P3.1 E2) binden kann, Extension product (P3.1 -Ext) wherein the fourth primer oligonucleotide (P4.2) comprises a first region (P4.1.1) that is sequence-specifically to the synthesized region of the first primer extension product (P1.1 E1) and the third primer extension product (P3.1 E2),
- Verlängerung des vierten Primer-Oligonukleotids (P4.2) durch die zweite Extension of the fourth primer oligonucleotide (P4.2) by the second
Polymerase unter Erhalt eines vierten Primer-Verlängerungsproduktes (P4.2-Ext), welches neben dem vierten Primer-Oligonukleotid einen synthetisierten Bereich (P4.1 E5 bis P4.1 E2 oder P4.1 E5 bis P4.1 E1 ) umfasst, der im Wesentlichen komplementär zum ersten Primer-Verlängerungsprodukt (P1.1 -Ext) oder identisch zur Zielsequenz ist, wobei das erste Primer-Verlängerungsprodukt (P1 1-Ext) und das vierte Primer-Verlängerungsprodukt (P4.1-Ext) als Doppelstrang vorliegen; Polymerase to obtain a fourth primer extension product (P4.2-Ext), which in addition to the fourth primer oligonucleotide comprises a synthesized region (P4.1 E5 to P4.1 E2 or P4.1 E5 to P4.1 E1), the is substantially complementary to the first primer extension product (P1.1 -Ext) or identical to the target sequence, wherein the first primer extension product (P1 1-Ext) and the fourth primer extension product (P4.1-Ext) are present as a double strand;
Trennung des Doppelstrangs aus dem ersten Primer-Verlängerungsprodukt (P1 1-Ext) und dem vierten Primer-Verlängerungsprodukt (P4.2-Ext) und des Doppelstrangs aus dem zweiten Primer-Verlängerungsprodukt (P2.1 -Ext) und dem dritten Primer-Verlängerungsprodukt (P3.1 -Ext) und des Doppelstrangs aus dem vierten Primer-Verlängerungsprodukt (P4.1-Ext) und dem dritten Primer- Verlängerungsprodukt (P3.1 -Ext); Separation of the double strand from the first primer extension product (P1 1-Ext) and the fourth primer extension product (P4.2-Ext) and the double strand from the second primer extension product (P2.1 -Ext) and the third primer extension product (P3.1-Ext) and the double strand from the fourth primer extension product (P4.1-Ext) and the third primer extension product (P3.1-Ext);
Hybridisieren des dritten Primer-Oligonukleotids (P3.2) an das vierte Primer- Verlängerungsprodukt (P4.2-Ext) und Verlängerung des dritten Primer- Oligonukleotids (P3.2) durch die zweite Polymerase; und  Hybridizing the third primer oligonucleotide (P3.2) to the fourth primer extension product (P4.2-Ext) and extension of the third primer oligonucleotide (P3.2) by the second polymerase; and
Hybridisieren des vierten Primer-Oligonukleotids an das dritte Primer- Verlängerungsprodukt (P3.2-Ext) und Verlängerung des vierten Primer- Oligonukleotids (P4.2) durch die zweite Polymerase.  Hybridizing the fourth primer oligonucleotide to the third primer extension product (P3.2-Ext) and extending the fourth primer oligonucleotide (P4.2) by the second polymerase.

Claims

Ansprüche claims
1 . Ein Verfahren zur Synthese einer zu einer Zielsequenz komplementären  1 . A method of synthesizing a gene complementary to a target sequence
Nukleinsäuresequenz, wobei  Nucleic acid sequence, wherein
a) eine Probe, die ein Nukleinsäurepolymer umfassend die Zielsequenz M umfasst, wobei die Zielsequenz in 5‘-3‘-Orientierung die Sequenzabschnitte MS und MP umfasst und MP unmittelbar in 3‘-Richtung von MS angeordnet ist, mit folgenden Komponenten in Kontakt gebracht wird:  a) a sample comprising a nucleic acid polymer comprising the target sequence M, wherein the target sequence in 5'-3 'orientation comprises the sequence sections MS and MP and MP is arranged directly in the 3' direction of MS, contacted with the following components becomes:
b) ein Oligonukleotidprimer P, welcher in 5‘-3‘-Orientierung die Sequenzabschnitte PC und PM umfasst und PM unmittelbar in 3‘-Richtung von PC angeordnet ist, wobei PM die zum Sequenzabschnitt MP komplementäre [die hybridisierende] Sequenz aufweist [im Wesentlichen sequenzspezifisch binden kann] und PC nicht an M [oder eine in 3‘-Richtung unmittelbar an MP anschließende Sequenz] binden kann;  b) an oligonucleotide primer P, which in the 5'-3 'orientation comprises the sequence sections PC and PM and PM is arranged directly in the 3' direction of PC, wherein PM has the [the hybridizing] sequence complementary to the sequence section MP [ can bind sequence-specifically] and PC can not bind to M [or a sequence directly adjacent to MP in the 3 'direction];
c) ein Controller-Oligonukleotid C, welches in 5‘-3‘-Orientierung die  c) a controller oligonucleotide C which in 5'-3 'orientation the
Sequenzabschnitte CS, CP und CC umfasst, wobei CP unmittelbar in 3‘-Richtung von CS und unmittelbar in 5‘-Richtung von CC angeordnet ist, und wobei CS zumindest zum 3'-Segment von MS (unmittelbar in 5‘-Richtung von MP liegenden) identisch ist und CP und CC die zum Sequenzabschnitt PM und PC komplementäre [die hybridisierende] Sequenz aufweist und wobei CS modifizierte Nukleotidbausteine umfasst, so dass CS nicht als Matrize für die Aktivität der matrizenabhängigen Nukleinsäurepolymerase dienen kann; Sequence sections CS, CP and CC, where CP is located immediately in the 3 'direction of CS and immediately in the 5' direction of CC, and where CS is at least to the 3 ' segment of MS (immediately in the 5' direction of MP lying) and CP and CC has the [the hybridizing] sequence complementary to the sequence section PM and PC, and wherein CS comprises modified nucleotide building blocks such that CS can not serve as template for the activity of the template-dependent nucleic acid polymerase;
d) eine matrizenabhängige Nukleinsäurepolymerase, insbesondere eine DNA- Polymerase, sowie Substrate der matrizenabhängigen Nukleinsäurepolymerase (insbesondere Ribonukleosid-triphosphate oder Desoxyribonukleosid-triphosphate) und geeignete Kofaktoren,  d) a template-dependent nucleic acid polymerase, in particular a DNA polymerase, and substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors,
wobei ein Primer-Verlängerungsprodukt P‘ erhalten wird, welches neben den wherein a primer extension product P 'is obtained, which in addition to the
Sequenzbereichen PC und PM einen synthetisierten Bereich PS umfasst, der imSequence areas PC and PM comprises a synthesized area PS, which in the
Wesentlichen komplementär zur Zielsequenz MS ist, Is substantially complementary to the target sequence MS,
und wobei  and where
entweder die Reaktionsbedingungen so gewählt sind, und/oder die Länge und Schmelztemperatur von PC und/oder MS so gewählt sind, dass P‘ mit M einen Doppelstrang bilden kann und P‘ mit C einen Doppelstrang bilden kann.  either the reaction conditions are selected, and / or the length and melting temperature of PC and / or MS are selected such that P 'can form a double strand with M and P' can form a double strand with C.
2. Das Verfahren gemäß Anspruch 1 , wobei der Sequenzabschnitt CS an seinem 3‘-Ende unmittelbar in 5‘-Richtung des Sequenzabschnitts CP einen Sequenzabschnitt CS‘ von 5 bis 15 Nukleotid Positionen Länge enthält, welcher aus Nukleinsäureanaloga, 2. The method according to claim 1, wherein the sequence section CS at its 3 'end immediately in the 5' direction of the sequence section CP has a sequence section CS 'of FIG contains up to 15 nucleotide positions of nucleic acid analogues,
insbesondere aus 2’0-Alkylribonukleotiden, besteht.  especially from 2'0-Alkylribonukleotiden exists.
3. Das Verfahren gemäß einem der vorstehenden Ansprüche, wobei M einen  3. The method according to any one of the preceding claims, wherein M is a
Sequenzabschnitt MB unmittelbar in 5‘-Richtung von MS umfasst, und wobei weiterhin ein Block-Oligonukleotid B, das an MB hybridisieren kann, mit der Probe in Kontakt gebracht wird, und wobei  Sequence portion MB directly in the 5 'direction of MS, and further wherein a block oligonucleotide B, which can hybridize to MB, is brought into contact with the sample, and wherein
a. B Nukleosidanaloga umfasst, die so ausgewählt sind, dass ein Hybrid von B mit MB die Reaktion der matrizenabhängigen Nukleinsäurepolymerase auf MB nicht erlaubt oder  a. B comprises nucleoside analogs selected such that a B hybrid to MB does not permit the MB-dependent nucleic acid polymerase reaction on MB or
b. die matrizenabhängige Nukleinsäurepolymerase so ausgewählt ist, dass ein Hybrid von B mit MB [auch wenn B aus natürlichen Nukleosiden oder Deoxynukleosiden besteht] die Reaktion der matrizenabhängigen  b. the template-dependent nucleic acid polymerase is selected such that a hybrid of B to MB [even though B consists of natural nucleosides or deoxynucleosides] is the response of the template-dependent ones
Nukleinsäurepolymerase auf MB nicht erlaubt.  Nucleic acid polymerase not allowed on MB.
4. Das Verfahren nach Anspruch 3, wobei B mit der Probe in Kontakt gebracht wird, bevor die matrizenabhängige Nukleinsäurepolymerase mit der Probe in Kontakt gebracht wird. The method of claim 3, wherein B is contacted with the sample before the template-dependent nucleic acid polymerase is contacted with the sample.
5. Das Verfahren nach einem der vorstehenden Ansprüche, wobei CS mit MS identisch ist und CP identisch mit MP ist. The method of any one of the preceding claims, wherein CS is identical to MS and CP is identical to MP.
6. Das Verfahren nach einem der vorstehenden Ansprüche, wobei die Bildung des  6. The method according to any one of the preceding claims, wherein the formation of the
Doppelstranges aus P‘ und C gegenüber der Bildung des Doppelstrangs aus P‘ mit M bevorzugt ist  Double strand of P 'and C is preferred over the formation of the double strand of P' with M.
7. Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass das Verfahren im Wesentlichen isothermal durchgeführt wird.  7. The method according to any one of the preceding claims, characterized in that the method is carried out substantially isothermal.
8. Das Verfahren gemäß einem der vorstehenden Ansprüche, wobei die Probe nicht mit einem Primer-Oligonukleotid in Kontakt gebracht wird (oder dieses umfasst), welches an einen in PS gelegenen Sequenzabschnitt binden und von dem aus durch die  The method according to any one of the preceding claims, wherein the sample is not contacted (or comprises) with a primer oligonucleotide which bind to and from a sequence located in the PS region
matrizenabhängige Nukleinsäurepolymerase eine Synthese eines Gegenstrangs zu PS erfolgen kann (mit anderen Worten: das Verfahren führt nicht zur exponentiellen  matrix-dependent nucleic acid polymerase can be a synthesis of a counterstrand to PS (in other words: the method does not lead to exponential
Amplifikation von M).  Amplification of M).
9. Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass MS eine Länge von 20 Nukleotiden bis 200 Nukleotiden hat.  9. The method according to any one of the preceding claims, characterized in that MS has a length of 20 nucleotides to 200 nucleotides.
10. Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass P eine Länge im Bereich von 15 Nukleotiden bis 100 Nukleotiden hat.  10. The method according to any one of the preceding claims, characterized in that P has a length in the range of 15 nucleotides to 100 nucleotides.
1 1 . Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass PC eine Länge im Bereich von 5 Nukleotiden bis 85 Nukleotiden hat, insbesondere dass PC zwischen 50% und 300% der Länge des Sequenzabschnitts PM hat. 1 1. The method according to one of the preceding claims, characterized in that PC has a length in the range of 5 nucleotides to 85 nucleotides, in particular that PC has between 50% and 300% of the length of the sequence section PM.
12. Das Verfahren nach einem der vorherigen Ansprüche, durch gekennzeichnet, dass C eine Länge im Bereich von 20 Nukleotiden bis 100 Nukleotiden hat. 12. The method according to any one of the preceding claims, characterized in that C has a length in the range of 20 nucleotides to 100 nucleotides.
13. Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass die Probe eine Variante VM der Zielsequenz M umfasst, welche >85%, insbesondere >95%, >92%, >94%, >96% oder sogar >98% identisch zu M ist, wobei ein Abschnitt VMS der Variante dem Abschnitt MS hoch identitisch ist, und ein Abschnitt VMP dem Abschnitt MP hochidentisch ist, und VM in mindestens einer Positition VMM von der Sequenz M verschieden ist, insbesondere eine oder mehrere Substitution(en), Insertion(en) und/oder Deletion(en) aufweist.  13. The method according to any one of the preceding claims, characterized in that the sample comprises a variant VM of the target sequence M, which> 85%, in particular> 95%,> 92%,> 94%,> 96% or even> 98% is identical to M, wherein a section VMS of the variant is highly identical to the section MS, and a section VMP is highly identical to the section MP, and VM in at least one position VMM is different from the sequence M, in particular one or more substitution (s) , Insertion (s) and / or deletion (s).
14. Das Verfahren nach Anspruch 13, dadurch gekennzeichnet, dass VMM eine Länge von 1 bis 20 Nukleotiden, insbesondere von 1 bis 3 Nukleotiden, aufweist.  14. The method according to claim 13, characterized in that VMM has a length of 1 to 20 nucleotides, in particular of 1 to 3 nucleotides.
15. Das Verfahren nach Anspruch 13 oder 14, wobei VMM in dem von VMS umfassten  The method of claim 13 or 14, wherein VMM is included in that of VMS
Sequenzabschnitt liegt.  Sequence section lies.
16. Das Verfahren nach einem der vorherigen Ansprüche 13 bis 15, dadurch gekennzeichnet, dass die Abschnitte MP und VMP >99%, insbesondere 100%, identisch sind.  16. The method according to any one of the preceding claims 13 to 15, characterized in that the sections MP and VMP> 99%, in particular 100%, are identical.
17. Das Verfahren nach einem der vorherigen Ansprüche 13 bis 16, dadurch gekennzeichnet, dass die Abschnitte MS und VMS ausserhalb des Abschnitts VMM >99%, insbesondere 100%, identisch sind.  17. The method according to any one of the preceding claims 13 to 16, characterized in that the sections MS and VMS outside of the section VMM> 99%, in particular 100%, are identical.
18. Das Verfahren nach einem der vorherigen Ansprüche 13 bis 17, dadurch gekennzeichnet, dass VMM < 30 Nukleotidpositionen, insbesondere <25, <15 oder <10 Nukleotidpositionen in 5’-Richtung von VMP auf VM angeordnet ist.  18. The method according to any one of the preceding claims 13 to 17, characterized in that VMM <30 nucleotide positions, in particular <25, <15 or <10 nucleotide positions in the 5 'direction from VMP to VM is arranged.
19. Das Verfahren nach einem der vorherigen Ansprüche 13 bis 18 (Fig. 59), dadurch  19. The method according to one of the preceding claims 13 to 18 (Fig. 59), characterized
gekennzeichnet, dass weiterhin ein zweites Controller-Oligonukleotid VC mit der Probe in Kontakt gebracht wird, welches in 5‘-3‘-Orientierung die Sequenzabschnitte VCS, VCP und VCC umfasst, wobei VCP unmittelbar in 3‘-Richtung von VCS und unmittelbar in 5‘- Richtung von VCC angeordnet ist, und wobei VCS zumindest zum 3'-Segment von VMS (unmittelbar in 5‘-Richtung von VMP liegenden) identisch ist und VCP und VCC die zum Sequenzabschnitt PM und PC komplementäre [die hybridisierende] Sequenz aufweist und wobei VCS modifizierte Nukleotidbausteine umfasst, so dass VCS nicht als Matrize für die Aktivität der matrizenabhängigen Nukleinsäurepolymerase dienen kann. characterized in that further a second controller oligonucleotide VC is brought into contact with the sample comprising in the 5'-3 'orientation the sequence sections VCS, VCP and VCC, where VCP is immediately in the 3' direction of VCS and immediately in FIG - Vcc direction is arranged, and wherein VCS at least to the 3 ' segment of VMS (immediately in the 5' direction of VMP lying) is identical and VCP and VCC to the sequence section PM and PC complementary having [the hybridizing] sequence and wherein VCS comprises modified nucleotide building blocks such that VCS can not serve as a template for the activity of the template-dependent nucleic acid polymerase.
20. Das Verfahren nach Anspruch 13 oder 14, wobei VMM mindestens teilweise von dem von VMP umfassten Sequenzabschnitt umfasst wird.  The method of claim 13 or 14, wherein VMM is at least partially encompassed by the sequence portion encompassed by VMP.
21 . Das Verfahren nach Anspruch 20, dadurch gekennzeichnet, dass die Abschnitte MS und VMS >95%, insbesondere >98%, >99% oder sogar 100% identisch sind.  21. The method according to claim 20, characterized in that the sections MS and VMS are> 95%, in particular> 98%,> 99% or even 100% identical.
22. Das Verfahren nach einem der vorherigen Ansprüche 13, 14, oder 19 bis 21 (Fig. 60), dadurch gekennzeichnet, dass weiterhin ein zweiter Oligonukleotidprimer VP mit der Probe in Kontakt gebracht wird, welcher in 5‘-3‘-Orientierung die Sequenzabschnitte VPC und VPM umfasst und VPM unmittelbar in 3‘ von VPC angeordnet ist, wobei VPM die zum Sequenzabschnitt VMP der Zielsequenz VM komplementäre [die hybridisierende] Sequenz aufweist [im Wesentlichen sequenzspezifisch binden kann] und VPC nicht an VM [oder eine in 3‘ unmittelbar an VMP anschließende Sequenz] binden kann. 22. The method according to any one of the preceding claims 13, 14, or 19 to 21 (Fig. 60), characterized in that further a second oligonucleotide primer VP is brought into contact with the sample, which in 5'-3 'orientation the Sequence sections VPC and VPM and VPM is located immediately in 3 'of VPC, where VPM complementary to the sequence section VMP of the target sequence VM [the hybridizing] Has sequence [essentially sequence-specific binding] and VPC can not bind to VM [or a sequence immediately adjacent to VMP in 3 '].
23. Das Verfahren nach einem der vorherigen Ansprüche 13, 14, oder 19 bis 20, dadurch gekennzeichnet, dass VMM am 5’-Ende von VMP liegt, mit anderen Worten, dass das 3’- Ende von VPM mit VMM hybridisiert.  23. The method according to any one of the preceding claims 13, 14, or 19 to 20, characterized in that VMM is at the 5 'end of VMP, in other words that the 3' end of VPM hybridizes with VMM.
24. Das Verfahren nach einem der vorherigen Ansprüche 13, 14, oder 19 bis 23, dadurch gekennzeichnet, dass weiterhin ein Kompetitor-Oligonukleotid KP mit der Probe in Kontakt gebracht wird, welches mit VMP hybridisiert.  24. The method according to any one of the preceding claims 13, 14, or 19 to 23, characterized in that further a competitor oligonucleotide KP is brought into contact with the sample which hybridizes with VMP.
25. Das Verfahren nach einem der vorherigen Ansprüche, dadurch gekennzeichnet, dass die gewählten Reaktionsbedingungen eine Reaktionstemperatur im Bereich von 25 °C bis 80 °C umfassen.  25. The method according to any one of the preceding claims, characterized in that the reaction conditions selected include a reaction temperature in the range of 25 ° C to 80 ° C.
26. Ein Kit zur Durchführung eines Verfahrens nach einem der Ansprüche 1 bis 25,  26. A kit for carrying out a method according to one of claims 1 to 25,
umfassend:  full:
ein Oligonukleotidprimer P, welcher in 5‘-3‘-Orientierung die Sequenzabschnitte PC und PM umfasst und PM unmittelbar in 3‘ von PC angeordnet ist, wobei PM an eine genomische Sequenz M eines eukaryoten Organismus oder eines pathogenen Bakteriums, insbesondere eines Säugetiers, ganz insbesondere an eine menschliche Zielsequenz, umfassend eine Primerbindungsstelle MP binden kann und PC nicht an eine direkt in 3‘-Richtung von MP liegende Sequenz binden kann;  an oligonucleotide primer P which comprises the sequence segments PC and PM in the 5'-3 'orientation and PM is arranged directly in 3' of PC, wherein PM refers to a genomic sequence M of a eukaryotic organism or of a pathogenic bacterium, in particular of a mammal in particular, to a human target sequence comprising a primer binding site capable of binding MP and failing to bind PC to a sequence located directly in the 3 'direction of MP;
ein Controller-Oligonukleotid C, welches in 5‘-3‘-Orientierung die Sequenzabschnitte CS, CP und CC umfasst, wobei CP unmittelbar in 3‘ von CS und unmittelbar in 5‘ von CC angeordnet ist, und wobei CS identisch mit einer unmittelbar in 5‘-Richtung von MP liegenden Sequenz MS ist und CP identisch mit MP ist und CC die zum  a controller oligonucleotide C comprising, in the 5'-3 'orientation, the sequence sections CS, CP and CC, where CP is located immediately in 3' of CS and immediately in 5 'of CC, and where CS is identical to one immediately in 5 'direction of MP lying sequence is MS and CP is identical to MP and CC to the
Sequenzabschnitt PC komplementäre [die hybridisierende] Sequenz aufweist, und wobei CS modifizierte Nukleotidbausteine umfasst, so dass CS nicht als Matrize für die Aktivität einer matrizenabhängigen Nukleinsäurepolymerase dienen kann.  PC sequence comprising complementary nucleotide building blocks, so that CS can not serve as template for the activity of a template-dependent nucleic acid polymerase.
27. Der Kit gemäß Anspruch 26, weiterhin umfassend ein Block-Oligonukleotid B, das an einen unmittelbar in 5‘-Richtung von MS gelegenen Sequenzabschnitt der Zielsequenz MB hybridisieren kann, wobei B Nukleosidanaloga umfasst, die so ausgewählt sind, dass ein Hybrid von B mit MB die Reaktion einer matrizenabhängigen Nukleinsäurepolymerase auf MB nicht erlaubt.  The kit of claim 26, further comprising a block oligonucleotide B capable of hybridizing to a sequence portion of the target sequence MB immediately adjacent to the 5 'direction of MS, wherein B comprises nucleoside analogs selected such that a hybrid of B MB does not allow the reaction of a template-dependent nucleic acid polymerase on MB.
28. Der Kit gemäß Anspruch 26 oder 27, weiterhin umfassend  28. The kit according to claim 26 or 27, further comprising
einen zweiten Oligonukleotidprimer VP, welcher in 5‘-3‘-Orientierung die  a second oligonucleotide primer VP, which in 5'-3 'orientation the
Sequenzabschnitte VPC und VPM umfasst und VPM unmittelbar in 3‘ von VPC angeordnet ist, wobei VPM an eine genomische Sequenz VM umfassend eine Primerbindungsstelle VMP binden kann, wobei VM zu >85%, insbesondere zu >95%, >92%, >94%, >96% oder sogar zu >98% identisch zu M ist, aber in mindestens einer Position verschieden von M ist, und VPC nicht an eine direkt in 3‘-Richtung von VMP liegende Sequenz binden kann; Sequence sections VPC and VPM and VPM is located immediately in 3 'of VPC, where VPM can bind to a genomic sequence VM comprising a primer binding site VMP, where VM is> 85%, in particular>95%,>92%,> 94% ,> 96% or even> 98% is identical to M, but in at least one Position is different from M, and VPC can not bind to a sequence located directly in the 3 'direction of VMP;
und/oder  and or
ein zweites Controller-Oligonukleotid VC, welches in 5‘-3‘-Orientierung die  a second controller oligonucleotide VC, which in 5'-3 'orientation the
Sequenzabschnitte VCS, VCP und VCC umfasst, wobei VCP unmittelbar in 3‘- Richtung von VCS und unmittelbar in 5‘-Richtung von VCC angeordnet ist, und wobei VCS identisch mit einer (unmittelbar in 5‘-Richtung von VMP liegenden) genomischen Sequenz VMS ist, die Teil einer Variante VM ist, die >85%, insbesondere >95%, Sequence sections VCS, VCP and VCC, wherein VCP is located immediately in the 3 'direction of VCS and immediately in the 5' direction of VCC, and wherein VCS identical to a (immediately in the 5 'direction of VMP lying) genomic sequence VMS which is part of a variant VM which is> 85%, in particular> 95%,
>92%, >94%, >96% oder sogar >98% identisch zu M, aber in mindestens einer Position verschieden von M ist, und VCP identisch mit VMP ist und VCC die zum Sequenzabschnitt VPC komplementäre [die hybridisierende] Sequenz aufweist, und wobei VCS modifizierte Nukleotidbausteine umfasst, so dass VCS nicht als Matrize für die Aktivität einer matrizenabhängigen Nukleinsäurepolymerase dienen kann, und/oder > 92%,> 94%,> 96% or even> 98% identical to M, but different in at least one position from M, and VCP is identical to VMP and VCC has the sequence complementary to the sequence section VPC [hybridizing] sequence, and wherein VCS comprises modified nucleotide building blocks such that VCS can not serve as a template for the activity of a template-dependent nucleic acid polymerase, and / or
ein Kompetitor-Oligonukleotid KP, welches mit VMP hybridisiert.  a competitor oligonucleotide KP which hybridizes with VMP.
29. Der Kit nach einem der Ansprüche 26 bis 28, weiterhin umfassend eine  29. The kit according to any one of claims 26 to 28, further comprising a
matrizenabhängige Nukleinsäurepolymerase, insbesondere eine DNA-Polymerase, sowie optional Substrate der matrizenabhängigen Nukleinsäurepolymerase (insbesondere Ribonukleosid-triphosphate oder Desoxyribonukleosid-triphosphate) und geeignete Kofaktoren.  matrix-dependent nucleic acid polymerase, in particular a DNA polymerase, and optionally substrates of the template-dependent nucleic acid polymerase (in particular ribonucleoside triphosphates or deoxyribonucleoside triphosphates) and suitable cofactors.
30. Der Kit nach einem der Ansprüche 26 bis 29, wobei dieser Kit kein Primer-Oligonukleotid umfasst, welches an einen auf dem Gegenstrang von M gelegenen Sequenzabschnitt binden und von dem aus durch die matrizenabhängige Nukleinsäurepolymerase eine Synthese einer im Wesentlichen zu dem 5’-Ende von MP auf M gelegenen Sequenz identischen Sequenz erfolgen kann (mit anderen Worten: der Kit ermöglicht nicht, die in 5’- Richtung von MP auf M gelegene Sequenz exponentiell zu amplifizieren).  30. The kit of any of claims 26 to 29, wherein said kit does not comprise a primer oligonucleotide which bind to a sequence portion located on the counterstrand of M and from which, by the template-dependent nucleic acid polymerase, a synthesis of a substantially to the 5 ' End of MP sequence located on M identical sequence (in other words: the kit does not allow to amplify the sequence located in the 5 'direction of MP to M exponentially).
EP19711506.6A 2018-02-26 2019-02-26 Method for primer extension reaction with improved specificity Withdrawn EP3759247A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP18158720 2018-02-26
DE102018001639.1A DE102018001639A1 (en) 2018-02-28 2018-02-28 Method for primer extension reaction with improved specificity
EP18195189.8A EP3530753A1 (en) 2018-02-26 2018-09-18 Method for primer extension reaction with improved specificity
PCT/EP2019/054755 WO2019162529A1 (en) 2018-02-26 2019-02-26 Method for primer extension reaction with improved specificity

Publications (1)

Publication Number Publication Date
EP3759247A1 true EP3759247A1 (en) 2021-01-06

Family

ID=67687059

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19711506.6A Withdrawn EP3759247A1 (en) 2018-02-26 2019-02-26 Method for primer extension reaction with improved specificity

Country Status (3)

Country Link
US (1) US20210071243A1 (en)
EP (1) EP3759247A1 (en)
WO (1) WO2019162529A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107429292B (en) 2014-12-15 2021-12-17 塞弗德公司 Exponential nucleic acid amplification with base number greater than 2
WO2020092134A1 (en) * 2018-10-29 2020-05-07 Cepheid Exponential base-3 nucleic acid amplification with reduced amplification time using nested overlapping primers

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040091923A1 (en) * 1993-07-23 2004-05-13 Bio-Rad Laboratories, Inc. Linked linear amplification of nucleic acids
US5882857A (en) * 1995-06-07 1999-03-16 Behringwerke Ag Internal positive controls for nucleic acid amplification
WO2002018616A1 (en) * 2000-09-01 2002-03-07 Hitachi Chemical Co., Ltd. Adjusting the efficiency of nucleic acid template amplification by attenuated pcr with template-mimic oligonucleotides
CN101889096B (en) * 2007-10-04 2015-10-21 联邦科学及工业研究组织 Nucleic acid amplification
AU2011319755B2 (en) * 2010-10-27 2017-02-23 President And Fellows Of Harvard College Compositions of toehold primer duplexes and methods of use
CN107429292B (en) * 2014-12-15 2021-12-17 塞弗德公司 Exponential nucleic acid amplification with base number greater than 2

Also Published As

Publication number Publication date
WO2019162529A1 (en) 2019-08-29
US20210071243A1 (en) 2021-03-11

Similar Documents

Publication Publication Date Title
EP3504338B1 (en) Method for amplification of nucleic acids and use of a kit for same
DE60116651T2 (en) METHOD FOR THE AMPLIFICATION AND POSSIBLE CHARACTERIZATION OF NUCLEIC ACIDS
DE69432919T2 (en) Methods for the detection of specific polynucleotides
DE60121750T2 (en) HYBRIDIZATION TEST AND METHOD FOR FAST IDENTIFICATION AND FAST DISTINCTION OF SEQUENCES
DE602006000944T2 (en) Method for genotyping by melting temperature dependence
DE69829328T2 (en) Strand Displacement Amplification of RNA
DE60219199T2 (en) ANALYSIS AND DETECTION OF MULTIPLE TARGET SEQUENCES USING CIRCULAR SAMPLES
DE60025840T2 (en) METHOD FOR DETECTING VARIATIONS OR POLYMORPHISMS
DD284053A5 (en) A PROCESS FOR THE REINFORCEMENT OF NUCLEOTIDE SEQUENCES
EP2207896A1 (en) Nucleic acid amplification
WO2019162529A1 (en) Method for primer extension reaction with improved specificity
DE10253966B4 (en) Microarray-based method for the amplification and detection of nucleic acids in a continuous process
WO1996027680A1 (en) Sequence-specific detection of nucleic acids
EP3759252A1 (en) Method for the selective amplification of nucleic acids and kit for carrying out same
WO2019166586A1 (en) Method for the amplification of a nucleic acid with improved specificity
EP3530755B1 (en) Method for displaying the progress in the amplification of nucleic acids and kit for same
DE102018001639A1 (en) Method for primer extension reaction with improved specificity
EP3759248A1 (en) Agmethod for amplification of a nucleic acid having improved specificity
DE102018001586A1 (en) Method for detecting the amplification of a nucleic acid with improved specificity
EP0745687A1 (en) Method for the specific amplification and detection of DNA and RNA
DE102005048503B4 (en) Method for controlling the section-wise enzymatic nucleic acid amplification via incomplete complementary strands
EP0736608A1 (en) Method for the specific amplification and the detection of DNA or RNA
EP3530753A1 (en) Method for primer extension reaction with improved specificity
EP0736609A2 (en) Method for specific amplification and detection od DNA or RNA

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20200916

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20230901