EP1891238A2

EP1891238A2 - Method for breast cancer diagnosis/prognosis

Info

Publication number: EP1891238A2
Application number: EP06764851A
Authority: EP
Inventors: Thibaut Verjat
Original assignee: Biomerieux SA
Current assignee: Biomerieux SA
Priority date: 2005-06-09
Filing date: 2006-06-07
Publication date: 2008-02-27
Also published as: FR2886946A1; WO2006131677A3; US20080274465A1; CN101223287A; WO2006131677A2; FR2886946B1

Abstract

The invention concerns a method for breast cancer diagnosis/prognosis including the following steps: A) extracting the nucleic material of a biological sample; B) using at least one pair of amplifying primers to obtain amplicons of at least one target sequence of the nucleic material; C) using at least a detection probe to detect the presence of said amplicons. The invention is characterized in that, during step B), said pair of primers comprises at least one amplifying primer including at least 10 nucleotide motifs of a nucleotide sequence selected among SEQ ID N°9 to SEQ ID N°10 and/or during step C), said detection probe comprises at least one amplifying primer including at least 10 nucleotide motifs of a nucleotide sequence selected among SEQ ID N°9 to SEQ ID N°10. The invention also concerns amplifying primers and hybridizing probes which can be used in said method, as well as a kit for diagnosis/prognosis of breast cancer.

Description

Method for the diagnosis / prognosis of breast cancer

The present invention relates to a method for the diagnosis / prognosis of breast cancer. The invention also relates to amplification primers and hybridization probes that can be used in this method, as well as a breast cancer diagnosis / prognosis kit.

Breast cancer is a common disease: one in eleven women develops breast cancer in her lifetime. However, because there are different types of breast cancer, and different prognosis of breast cancer, women who suffer from it do not all follow the same treatment: the doctor offers each patient a treatment adapted to her situation, so to get the best chance of healing. Thus, hormone therapy, which is a general treatment in breast cancer, is used in hormone-dependent breast cancer, that is to say in the case of tumors expressing hormone receptors on the surface of their cells. Postoperatively, hormone therapy may be used alone or in combination with adjuvant chemotherapy. As part of a recurrence of the disease, hormone therapy may be prescribed either alone, or associated or relay chemotherapy.

Chemotherapy, for its part, is a general treatment for cancer because the drugs, carried by the bloodstream, can act everywhere in the body. Chemotherapy has an important place in the therapeutic arsenal, especially since a decade, with the appearance of new molecules. The drugs are most often administered by intravenous vein infusion, subcutaneously, intramuscularly.

Thus, depending on the expression of hormonal receptors on the surface of the hormonal cells, the treatment will be oriented towards a hormonal therapy or not. These include the estrogen receptors ER and the progesterone receptor (PR), which are the most well-known parameters for predicting the response to hormone therapy in breast cancer. The analysis of UPA (Urokinase-type Plasminogen Activator) and PAI-I (Plasminogen Activator Inhibitor Type I) gene expression also makes it possible to benefit from a prognostic tool for breast cancer. These Genes are involved in the destruction of the extracellular matrix, and are therefore factors involved in the metastatic development of tumors (Andreasen et al, J. Cancer, 1997).

In order to offer patients appropriate treatment, it is therefore essential to know the expression of hormone receptors, such as ER and PR. This expression is studied most often on the primary tumor by immunohistochemistry. In addition, it is important to know the expression of the HER2 receptor, whose overexpression, studied by immunohistochemistry, is a factor of poor prognosis. In doubtful cases, the study of gene amplification of the HER2 gene by in situ hybridization (FISH) is the alternative method used. Finally, the analysis of the expression of UPA and PAI-I, factors of aggressiveness of the tumor is studied by ELISA (Enzyme -Linked Immunosorbent

Assay).

In recent years, tumors of small size can be detected, allowing early diagnosis of breast cancer, but the prognosis of this cancer remains difficult because of the small amount of tumor tissue that makes it difficult to quantify hormone receptor protein. and previously mentioned factors.

The present invention provides a novel method for the diagnosis / prognosis of breast cancer. This method makes use, in particular, of analyzing the expression of the UPA and PAI-I genes by the use of new nucleotide sequences which can be used as amplification primers or hybridization probes. The method according to the invention makes it possible in particular to determine what is the prognosis of a patient suffering from breast cancer, in order to offer him a suitable treatment.

As such, the invention relates to a method for the diagnosis / prognosis of breast cancer comprising the following steps:

A - the nucleic material is extracted from a biological sample,

B - at least one pair of amplification primers is used to obtain amplicons of at least one target sequence of the nucleic material C - at least one detection probe is used to detect the presence of said amplicons characterized in that, in step B, said primer pair comprises at least one amplification primer comprising at least 10 nucleotide motifs of a nucleotide sequence selected from SEQ ID N ⁰ I to SEQ ID NO: 8 and / or in step C), said detection probe comprises at least 10 nucleotide units of a nucleotide sequence selected from SEQ ID No. 9 to SEQ ID NO ^: 10.

Surprisingly, the inventors have thus discovered that the use, in a method for the diagnosis / prognosis of breast cancer, of a nucleotide sequence comprising at least 10 nucleotide motifs of a nucleotide sequence chosen from SEQ IDs. No. ¹ to SEQ ID NO: 8 is highly relevant as an amplification primer for amplifying target sequences, such as the gene encoding UPA and PAI-I. The inventors have also discovered that the use of a nucleotide sequence comprising at least 10 nucleotide units of a nucleotide sequence chosen from SEQ ID NO: 9 to SEQ ID NO ^: 10 as a hybridization probe is very relevant for specific hybridization on target sequences, such as the genes encoding UPA and PAI-I.

For the purposes of the present invention, the term "biological sample" means any sample that may contain a nucleic material as defined below. This biological sample may be taken from a patient and may include a sample of tissues, blood, serum, saliva, circulating cells of the patient. Preferably, this biological sample is taken from a tumor. This biological sample is available by any type of sampling known to those skilled in the art. For the purposes of the present invention, the nucleic material comprises a nucleic acid sequence such as a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) sequence. According to a preferred embodiment of the invention, the nucleic material comprises a deoxyribonucleic acid sequence. According to a preferred embodiment of the invention, the nucleic material is extracted from a biological sample taken from a patient.

By nucleotide sequence (or nucleic acid sequences or nucleotide fragment or oligonucleotide or polynucleotide) is meant a sequence of nucleotide units assembled together by phosphoric ester bonds, characterized by the informational sequence of the naturally occurring nucleic acids, which may hybridize to another nucleic acid sequence, the sequence may contain monomers of different structures and be obtained from a natural nucleic acid molecule and / or or by genetic recombination and / or chemical synthesis. By nucleotide motif is meant a derivative of a monomer which may be a natural nucleotide nucleic acid whose constituent elements are a sugar, a phosphate group and a nitrogen base; in the DNA sugar is deoxy-2-ribose, in RNA the sugar is ribose; depending on whether it is DNA or RNA, the nitrogenous base is chosen from adenine, guanine, uracil, cytosine, thymine; or the monomer is a modified nucleotide in at least one of the three constituent elements; for example, the modification can take place either at the level of the bases, with modified bases such as inosine, methyl-5-deoxycytidine, deoxyuridine, dimethylamino-5-deoxyuridine, diamino-2,6-purine, bromo Deoxyuridine or any other modified base capable of hybridization, either at the sugar level, for example the replacement of at least one deoxyribose with a polyamide (PE Nielsen et al., Science, 254, 1497-1500 (1991), or still at the level of the phosphate group, for example its replacement with esters chosen in particular from diphosphates, alkyl- and arylphosphonates and phosphorothioates.This nucleic material comprises at least one target sequence. The nucleotide sequence is specific for a target gene, such as, preferably, the gene encoding UPA or PAI-I According to a preferred embodiment of the invention, the target sequence is included in a gene. selected from the genes encoding UPA or PAI-I. In the rest of the talk, we will talk about the target sequence whether it is single-stranded or double-stranded.

In step A, the nucleic material is extracted from a biological sample by any protocol known to those skilled in the art. As an indication, the nucleic acid extraction may be carried out by a step of the cells present in the biological sample, in order to release the nucleic acids contained in the protein and / or lipid envelopes of the cells (such as debris). cells that disrupt subsequent reactions). By way of example, it is possible to use lysis methods such as described in patent applications WO 00/05338 on magnetic and mechanical mixed lysis, WO 99/53304 on electrical lysis, and WO 99/15321 on mechanical lysis. Those skilled in the art may use other well-known lysis methods, such as thermal or osmotic shocks or chemical lyses with chaotropic agents such as guanidium salts (US Pat. No. 5,234,809). This lysis step may also be followed by a purification step, allowing the separation between the nucleic acids and the other cellular constituents released in the lysis step. This step generally allows the nucleic acids to be concentrated, and may be suitable for DNA or RNA purification. By way of example, it is possible to use magnetic particles optionally coated with oligonucleotides, by adsorption or covalence (see in this regard US Pat. No. 4,672,040 and US Pat. No. 5,750,338), and thus to purify the nucleic acids that have attached to these magnetic particles. , by a washing step. This nucleic acid purification step is particularly advantageous if it is desired to subsequently amplify said nucleic acids. A particularly interesting embodiment of these magnetic particles is described in patent applications WO 97/45202 and WO 99/35500. Another interesting example of a method for purifying nucleic acids is the use of silica either in the form of a column or in the form of inert particles (Boom R. et al., J. Clin Microbiol., 1990, No. 28 ( . 3), pp 495-503) or magnetic (Merck: Silica MagPrep ^®, Promega: MagneSil ™ Paramagnetic particles). Other widely used methods rely on columnar or paramagnetic particulate ion exchange resins (Whatman: DEAE-Magarose) (Levison PR et al., J. Chromatography, 1998, pp. 337-344). Another method that is very relevant but not exclusive to the invention is that of adsorption on a metal oxide support (Xtrana company: Xtra-Bind ™ matrix). When it is desired to specifically extract the DNA from a biological sample, it is possible in particular to carry out an extraction with phenol, chloroform and alcohol in order to eliminate the proteins and to precipitate the DNA with 100% alcohol. The DNA can then be pelleted by centrifugation, washed and resuspended.

In step B, at least one pair of amplification primers is used to obtain amplicons of at least one target sequence of the nucleic material. For the purposes of the present invention, amplification primer means a nucleic sequence comprising from 10 to 100 nucleotide units, preferably from 15 to 25 nucleotide units. This amplification primer comprises at least 10, preferably 15 and even more preferably 20 nucleotide units of a sequence chosen from SEQ ID NO ^: 1 to 8.

A pair of amplification primers allows the initiation of an enzymatic polymerization, such as in particular an enzymatic amplification reaction. By enzymatic amplification reaction is meant a process generating multiple copies (or amplicons) of a nucleic sequence by the action of at least one enzyme. For the purposes of the present invention, the term "amplicons" refers to the copies of the target sequence obtained during an enzymatic amplification reaction. Such amplification reactions are well known to those skilled in the art and may be mentioned in particular PCR (Polymerase Chain Reaction), as described in US-A-4,683,195, US-A-4,683,202 and US-A- 4,800,159; LCR (Ligase Chain Reaction), for example disclosed in EP-AO 201 184; the RCR (Repair Chain Reaction), described in the patent application WO-A-90/01069; the 3SR (Self Sustained Sequence Replication) with the patent application WO-A-90/06995; NASBA (Nucleic Acid Sequence-B ased Amplification) with patent application WO-A-91/02818, or alternatively TMA (Transcription Mediated Amplification) with US Pat. No. 5,399,491. In general, these enzymatic amplification reactions generally put a succession of cycles comprising the following steps: denaturation of the target sequence if it is double-stranded in order to obtain two complementary target strands, where hybridization of each of the target strands, obtained during the preceding denaturation step with at least one amplification primer, where the formation from the amplification primers of the complementary strands to the strands on which they are hybridized in the presence of a polymerase enzyme and nucleoside triphosphate (ribonucleoside triphosphate and / or deoxyribonucleoside triphosphate according to the techniques) this cycle being repeated a number of times determined to obtain the target sequence in a proportion sufficient to allow its detection. Hybridization is understood to mean the process in which, under appropriate conditions, two nucleic sequences, such as in particular an amplification primer and a target sequence or a hybridization probe and a target sequence, bind with stable hydrogen bonds and specific to form a double strand. These hydrogen bonds are formed between the complementary bases Adenine (A) and thymine (T) (or uracil (U)) (we speak of A-T bond) or between the complementary bases Guanine (G) and cytosine (C) (on talk about GC link). Hybridization of two nucleic sequences can be complete (called complementary sequences), that is to say that the double strand obtained during this hybridization comprises only AT bonds and CG bonds. This hybridization can be partial (we then speak of sufficiently complementary sequences), that is to say that the double strand obtained comprises AT bonds and CG bonds making it possible to form the double strand, but also bases unrelated to a complementary base. . Hybridization between two complementary or sufficiently complementary sequences depends on the operating conditions that are used, and in particular on stringency. The stringency is defined in particular according to the base composition of the two nucleic sequences, as well as by the degree of mismatch between these two nucleic sequences. The stringency may also be a function of the parameters of the reaction, such as the concentration and type of ionic species present in the hybridization solution, the nature and the concentration of denaturing agents and / or the hybridization temperature. All these data are well known and the appropriate conditions can be determined by those skilled in the art.

More specifically, NASBA is an isothermal amplification technology for nucleic acid based on the joint action of three enzymes (AMV reverse transcriptase, Rnase-H and T7-RNA polymerase). Combined with specific amplification primers of a target sequence, it amplifies RNA targets more than a billion times in 90 minutes. The amplification reaction occurs at 41 ^° C. and gives single-stranded RNA molecules as final product. NASBA requires a primer pair, at least one of which comprises a promoter for initiating transcription by bacteriophage T7 polymerase. Such a primer is preferably chosen from SEQ ID Nos. ¹¹ and 12. According to one particular embodiment of the invention, said pair of primer comprises at least one amplification primer comprising a promoter allowing the initiation of transcription by a bacteriophage T7 polymerase.

According to a particular embodiment of the invention, said pair of primers, used in step B, is chosen from the following primer pairs: a first amplification primer comprising at least 10, preferably 15 and more more preferably 20 nucleotide units of the nucleotide sequence SEQ ID NO ¹ and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 2; indication, when the first primer has the sequence SEQ ID N ⁰ I, and the second primer has the sequence SEQ ID NO: 2, an amplicon, specific for the gene encoding PAI-I, in a size 216 base pairs, which corresponds to the sequence 394 - 610 on the sequence of the gene encoding PAI-I reference (Genbank NM_000602.1). o a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ 3 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 units nucleotides of the nucleotide sequence SEQ ID No. 4; as an indication, when the first primer has the sequence SEQ ID No. 3, and the second primer has SEQ ID No. 4 sequence, we obtain an amplicon, specific for the gene encoding PAI-I, a size of 1058 base pairs, which corresponds to the 88-1146 sequence on the reference PAI-I coding sequence (Genbank NM_000602.1). a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 5 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 units; nucleotides of the SEQ nucleotide sequence ID No. 6; as an indication, when the first primer has the sequence SEQ ID No. 5, and the second primer has SEQ ID No. 6 sequence, we obtain a amplicon, specific for the UPA gene, a size of 194 pairs base, which corresponds to the 1661 - 1855 sequence on the reference UPA coding sequence (Genbank NM_002658.1). a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 7 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 units; nucleotides of the nucleotide sequence SEQ ID NO ^: 8; as an indication, when the first primer has the sequence of SEQ ID No. 7, and the second primer is SEQ ID No. 8, then an amplicon, specific for the gene encoding UPA, having a size of 927 is obtained. base pairs, which corresponds to the sequence 1228-2155 on the reference UPA coding sequence (Genbank NM_002658.1).

According to a particular embodiment of the invention, said pair of primers, used in step B, comprises a first primer comprising a promoter allowing the initiation of transcription by a bacteriophage T7 polymerase, is chosen from the pairs following primer: a first amplification primer of SEQ ID No. ¹¹ and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 2; a first primer for amplifying SEQ ID NO ⁰ 12 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID NO: 6.

In order to take into account the variability of enzymatic efficiency that can be observed during the various steps of the amplification reaction, the expression of a target gene can be normalized by the simultaneous determination of the expression of a said gene. cleaning whose expression is similar in different groups of patients. By realizing a relationship between the expression of the target gene and the expression of the household gene, this corrects any variability between the different experiments. Those skilled in the art may refer in particular to the following publications: Bustin SA Journal of Molecular Endocrinology, 2002, 29: 23-39; Giulietti A Methods, 2001, 25: 386-401. According to one particular embodiment of the invention, at least one pair of amplification primers is used, in addition, during step B to obtain amplicons specific for a household gene. By household gene is meant a gene whose expression is stable in a given tissue, and whatever the physiological situation. According to a preferred embodiment of the invention, the household gene is the PPIB gene which encodes cyclophyllin B. Those skilled in the art will refer in particular to the application PCT / FR04 / 050661 which is included by reference in the present application .

In step C, at least one detection probe is used to detect the presence of said amplicons. This detection step can be carried out by any protocol known to those skilled in the art concerning the detection of nucleic acids. For the purposes of the present invention, the expression "hybridization probe" is intended to mean a nucleic sequence of from 10 to 100 nucleotide motifs, in particular from 15 to 35 nucleotide units, having hybridization specificity under determined conditions to form a hybridization complex. with a target nucleic sequence. The hybridization probe may comprise a marker for its detection. We then speak of detection probes. By detection is meant either direct detection by a physical method, or indirect detection by a detection method using a marker. Many detection methods exist for the detection of nucleic acids. [See, for example, Kricka et al., Clinical Chemistry, 1999, No. 45 (4), p.453-458 or Keller GH et al., DNA Probes, 2nd Ed., Stockton Press, 1993, sections 5 and 6, p.173-249]. By marker is meant a tracer capable of generating a signal that can be detected. A non-limiting list of these tracers includes enzymes that produce a detectable signal for example by colorimetry, fluorescence or luminescence, such as horseradish peroxidase, alkaline phosphatase, beta galactosidase, glucose-6-phosphate dehydrogenase; chromophores like fluorescent, luminescent or coloring compounds; electron density groups detectable by electron microscopy or by their electrical properties such as conductivity, by amperometry or voltammetry methods, or by impedance measurements; groups detectable by optical methods such as diffraction, surface plasmon resonance, contact angle variation or by physical methods such as atomic force spectroscopy, tunneling effect, etc. ; radioactive molecules such as ³² P, ³⁵ S or ¹²⁵ I.

For the purposes of the present invention, the hybridization probe may be a so-called detection probe In this case, the so-called detection probe is labeled by means of a marker as defined above. Thanks to the presence of this marker, it is possible to detect the presence of a hybridization reaction between a given detection probe and the specific target sequence of a given species.

The detection probe may in particular be a "molecular beacon" detection probe as described by Tyagi & Kramer (Nature biotech, 1996, 14: 303-308). These "molecular beacons" become fluorescent during hybridization. They have a stem-loop structure and contain a fluorophore and a "quencher" group. Attachment of the specific loop sequence with its target nucleic acid complement sequence causes stem unwinding and fluorescent signal emission upon excitation at the appropriate wavelength. The hybridization probe may also be a so-called capture probe. In this case, the so-called capture probe is immobilized or immobilizable on a solid support by any appropriate means, that is to say directly or indirectly, for example by covalence or adsorption. The hybridization reaction between a given capture probe and a target sequence is then detected.

For the detection of the hybridization reaction, labeled target sequences can be used directly (in particular by the incorporation of a marker within the target sequence) or indirectly (especially by the use of a detection probe as defined above) the target sequence. In particular, it is possible to carry out a step of labeling and / or cleavage of the target sequence before the hybridization step, for example by using a labeled deoxyribonucleotide triphosphate during the enzymatic amplification reaction. The cleavage can be achieved in particular by the action of imidazole and manganese chloride. The target sequence may also be labeled after the amplification step, for example by hybridizing a detection probe according to the sandwich hybridization technique described in WO 91/19812. Another particular preferred mode of nucleic acid labeling is described in application FR 2 780 059.

As a solid support, it is possible to use synthetic materials or natural materials, optionally chemically modified, in particular polysaccharides such as cellulose-based materials, for example paper, cellulose derivatives such as cellulose acetate and cellulose. nitrocellulose or dextran, polymers, copolymers, especially based on styrene-type monomers, natural fibers such as cotton, and synthetic fibers such as nylon; mineral materials such as silica, quartz, glasses, ceramics; latexes; magnetic particles; metal derivatives, gels etc. The solid support may be in the form of a microtiter plate, a membrane as described in patent application WO 94/12670, of a particle.

According to a preferred embodiment of the invention, the detection probe comprises a flurophore and a quencher. According to an even more preferred embodiment of the invention, the hybridization probe comprises a FAM (6-carboxy-fluorescein) or ROX (6-carboxy-X-rhodamine) flurophore at its 5 'end and a quencher (Dabsyl). ) at its end 3 '. In the remainder of the discussion, such a hybridization probe is called a "molecular beacon".

According to a preferred embodiment of the invention, steps B and C are performed at the same time. This preferred mode can be implemented by "NASBA in real time" which combines in a single step the NASBA amplification technique and real-time detection that uses "molecular beacons". The NASBA reaction occurs in the tube, producing single-stranded RNA with which specific "molecular beacons" can hybridize simultaneously to give a fluorescent signal. The formation of the new RNA molecules is measured in real time by continuous control of the signal in a fluorescent reader. Unlike amplification by RT-PCR, amplification in NASBA can be done in the presence of DNA in the sample, ie even if the DNA was not completely removed during RNA extraction.

As shown in the example below, when it is desired to detect the target gene encoding PAI-I (reference sequence NCBI accession number: NM_000602.1), it is preferentially used in step b) o a first primer of SEQ ID N ⁰ I 11 or a second primer of SEQ ID NO: 2 and in step c) o a detection probe comprising SEQ ID N ⁰ 9.

As shown in the example below, when it is desired to detect the target gene encoding UPA (reference sequence NCBI accession number: NM_002658.1), it is preferentially used in step b) o a first primer of SEQ ID No. 5 or 12 o a second primer of SEQ ID N ⁰ 6 and in step c) o a detection probe comprising SEQ ID N ⁰ IO

When a pair of amplification primers are used in step B to obtain amplicons specific for a household gene, said amplicons specific for a household gene can be detected in a manner comparable to that described previously, in particular the use of a detection probe. According to a preferred embodiment of the invention, the household gene is the PPIB gene which encodes cyclophyllin B. Preferably, the detection probe comprises a flurophore and a quencher.

The invention also relates to an amplification primer comprising at least 10, preferably 15, and even more preferably 20 nucleotide units of a nucleotide sequence selected from SEQ ID NO ^: 1 to SEQ ID NO ^: 8. According to a preferred embodiment of the invention, the amplification primer comprises a promoter allowing the initiation of transcription by a polymerase of the bacteriophage T7. This primer can be in particular any one of SEQ ID N ⁰

11 to 12, and is preferably used in a NASBA amplification reaction.

The invention also relates to a primer pair chosen from the following pairs of primers: a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ I and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 2; indication, when the first primer has the sequence SEQ ID N ⁰ I, and the second primer has the sequence SEQ ID NO: 2, an amplicon, specific for the gene encoding PAI-I, in a size 216 base pairs, which corresponds to the sequence 394 - 610 on the sequence of the gene encoding PAI-I reference (Genbank NM_000602.1). o a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ 3 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 units nucleotides of the nucleotide sequence SEQ ID No. 4; as an indication, when the first primer has the sequence SEQ ID No. 3, and the second primer has SEQ ID No. 4 sequence, we obtain an amplicon, specific for the gene encoding PAI-I, a size of 1058 base pairs, which corresponds to the 88-1146 sequence on the reference PAI-I coding sequence (Genbank NM_000602.1). a first amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 5 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 units; nucleotides of the nucleotide sequence SEQ ID No. 6; as an indication, when the first primer has the sequence SEQ ID No. 5, and the second primer has SEQ ID No. 6 sequence, then we obtain a amplicon, UPA gene specific, 194 base pairs in length, which corresponds to the 1661-1855 sequence on the UPA reference coding sequence (Genbank NM_002658.1) o a first amplification primer comprising at least 10, preferentially and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID No. 7 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of the nucleotide sequence SEQ ID NO ^: 8; as an indication, when the first primer has the sequence of SEQ ID No. 7, and the second primer is SEQ ID No. 8, then an amplicon, specific for the gene encoding UPA, having a size of 927 is obtained. base pairs, which corresponds to the sequence 1228-2155 on the reference UPA coding sequence (Genbank NM_002658.1).

According to a preferred embodiment of the invention, said first primer comprises a promoter for initiating transcription by a bacteriophage T7 polymerase. This primer may in particular be any of SEQ ID Nos. ¹¹ to 12. When the first primer comprises a promoter allowing the initiation of transcription by a bacteriophage T7 polymerase, this first primer is preferably included in a primer pair. selected from the following primer pairs: a first amplification primer of SEQ ID No. 21 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID N 2; a first amplification primer of SEQ ID No. 22 and a second amplification primer comprising at least 10, preferably 15 and even more preferably 20 nucleotide motifs of the nucleotide sequence SEQ ID No. 4;

The invention also relates to the use of at least one amplification primer as defined above and / or at least one primer pair as defined above during a NASBA amplification reaction. The invention also relates to a detection probe comprising at least 10, preferably 15 and even more preferably 20 nucleotide units of a nucleotide sequence selected from SEQ ID NO: 9 to SEQ ID NO ^: 10. Preferably, this detection probe comprises a flurophore and a quencher. The invention also relates to the use of at least one primer as defined above and / or at least one primer pair as defined above and / or at least one detection probe as defined previously for the diagnosis / prognosis of breast cancer.

The invention finally relates to a kit for the diagnosis / prognosis of a breast cancer comprising at least one primer as defined above and / or at least one primer pair as defined above and / or at least one a detection probe as defined above.

As shown in the example below, when it is desired to detect the target gene encoding PAI-I, the kit preferably comprises o a first primer of SEQ ID No. ¹ or 11 o a second primer of SEQ ID No. 2 o a detection probe comprising SEQ ID N ⁰ 9.

As shown in the example below, when it is desired to detect the target gene encoding UPA, the kit preferably comprises o a first primer of SEQ ID No. 5 or 12 o a second primer of SEQ ID N ⁰ 6 o a detection probe comprising SEQ ID N ⁰ IO

The invention also relates to a kit for the diagnosis / prognosis of breast cancer which makes it possible to determine

• if a patient with breast cancer can benefit from hormone therapy (Tamoxifene) or immunotherapy (Herceptin)

• whether the cancer in question is of good or bad prognosis

• aggressiveness of the tumor For this, the kit comprises the necessary reagents, such as primers and / or probes, for the detection of genes ER, PR, HER-2, UPA, PAI-I. For the primers and probes necessary for the detection of genes ER, PR, HER-2, those skilled in the art will refer in particular to patent application PCT / FR04 / 050661 which is included by reference. For the primers and probes necessary for the detection of UPA and PAI-I genes, those skilled in the art will refer to the previously developed discussion.

The following figure is given for illustrative purposes and has no limiting character. It will better understand the invention.

FIG. 1 represents the standard curves obtained for the PAI-1 and PPIB genes (FIG. 1a, PAI-I in solid lines, PPIB in dashed lines), UPA and PPIB (FIG. 1b, UPA in solid lines, PPIB in dashed lines, such as described in the example below: Each standard curve, obtained for each gene from a reference sequence which is specific for the gene, transcribed in vitro in RNA from the UPA and PAI-I gene-specific PCR product respectively and of a plasmid for the PPIB gene, represents the time of appearance of the exponential phase of the amplification (we also speak of TTP: time to positivity, threshold time) as a function of the number of RNA copies present at the beginning of amplification by NASBA (the higher the starting amount of RNA copies is important at the beginning of the amplification, the shorter the time of appearance of the exponential phase).

The following examples are given for illustrative purposes and are in no way limiting. They will help to better understand the invention.

Example 1 Amplification and Real-Time Detection of mRNAs Encoding PAI-I and UPA

1 / Obtaining and preparing samples

This example was made from three tumor cell lines, whose expression of UPA and PAI-I proteins was previously determined by ELISA, were used: MDA-MD-231 (expressing the factors UPA and PAI-I ), and MCF7 (not expressing UPA, ri PAI-I). These lines come from the American Type Culture Collection (ATCC, Manassas, USA). These cell lines were cultured in DMEM (MCF-7) or Leibovitz (MDA-MD-231), supplemented with fetal beef serum (10%), non-essential amino acids (1%) and penicillin (50%). 000U) - streptomycin (50 μg) at 37 ^° C. under an atmosphere comprising 5% of CO2 for MCF7 and 0% of MD A-MD-231.

This example was also made from tumors of patients (n = 77) with breast cancer whose expression in UPA and PAI-I was previously determined by ELISA according to a conventional technique known to those skilled in the art. . The ELISA technique informed us about the expression of the protein.

2 / Extraction of total RNA

Total RNAs were extracted from cell lines by the use of Trizol® Reagent as recommended by the kit supplier (Invitrogen, Canada). The quality and quantity of RNA were determined at 260 and 280 nm and checked on agarose gel. The RNAs were then frozen at -70 ^° C. until use. Total RNAs have also been similarly extracted from tumors of patients with breast cancer.

3) Amplification by NASBA

The amplification reaction by NASBA is based on the simultaneous activity of a reverse transcriptase of avian myeloblast virus (AMV-RT), a RNAse H of E. coli and bacteriophage T7 RNA polymerase (Compton J, 1991, Nature, 350: 91-92). The real-time detection of the amplicons is achieved by the use of a Nuclisens EasyQ® reader (bioMérieux BV, The Netherland) and "molecular beacon" detection probes, as defined above. Quantification in NASBA is based on the use of a standard curve, obtained from a reference sequence, specific for the target gene, transcribed in vitro in RNA in a plasmid. This standard curve represents the time of onset of the exponential phase of amplification as a function of the number of RNA copies present at the beginning of amplification by NASBA (the greater the starting amount of RNA copies is important at the beginning of the amplification, the time of appearance of the exponential phase is short).

a) Amplification of the PAI-I and UPA genes and the PPIB household gene - Obtaining a standard curve

Standard curve of target gene encoding PAI-I (Figure la)

For the target gene encoding PAI-I (reference sequence NCBI accession number: NM_000602.1), a first primer of SEQ ID NO: 3 '' CCAGCCCTCA CCTGCCTAGT 3 '' having an additional sequence corresponding to the SP6 promoter was used. second primer of SEQ ID No. 4 'CACCGTGCCA CTCTCGTTCA 3', respectively located in positions 88-107 and 1127-1146 of the reference sequence, in order to generate in PCR (a first denaturation cycle (95 ^° C.; then 35 cycles comprising the following steps: denaturation: 94 ^° C., 1 min, hybridization: 60 ^° C., 1 min, elongation: 72 ^° C., 2 min) and a last cycle comprising a denaturation step: 72 ^° C. ; 7 min) a 1058 + 23 (of the sequence SP6) base pair amplicon, specific for the gene encoding PAI-1 (we will speak of "amplicon PAI-1").

The PAI-I amplicons obtained as described above, were then purified (Qiaquick® Qiagen column, Hilden, Germany) and then transcribed directly to RNA in vitro by the use of an RNA polymerase (SP6 (Megascript® kit, Ambion , Austin, USA), according to the orientation of the amplicon). After removal of the plasmid by DNAse treatment, the RNAs were purified by Reasy® Mini Kit (Qiagen, Hilden, Germany) and quantified (RNA6000Nano, Agilent Technologies, Walbronn, Germany). The amplicons obtained were well specific to the PAI-I gene.

The RNAs obtained above were diluted to different concentrations (stock solution: 0.2 10 ¹¹ copies / μl, dilution in cascade 0.2 10 ¹¹ copies / μl at 0.2 × 10 ² copies / μl). These cascade dilutions were amplified by NASBA using the kit Nuclisens Basic ® (bioMérieux BV, The Netherlands) in the presence of PAI-1 specific primers SEQ ID N ⁰ 1 and PAI-1 # 2 and "molecular beacons" SEQ ID NO: 9: a 0.2 μM of a first PAI-I primer of SEQ ID NO ^: 5 CTCCTTTCCC

AAGCAAGTTG 3 ', comprising, at its end 5', and indicated in lower case, a sequence comprising the promoter of the T7 polymerase, that is to say a first primer whose entire sequence is SEQ ID No. ¹¹ : 5 'aattctaatacgactcactatagggagaaggCTCCTTTCCC AAGC AAGTTG 3' to 0.2 μM of a second primer PAI-I of SEQ ID NO: 2 5 'GGGCCATGGA

ACAAGGATGA 3 '). o 0.1 μM of "molecular beacons" comprising SEQ ID No. 9 5 '3', labeled with a FAM fluorophore (6-carboxy-fluorescein) in 5 ', and a quencher (Dabsyl) in 3 (Complete sequence: 5 'TGTTCCGGAG CACGGTC AAG 3' FAM-cgαrcgTGTTCCGGAGCACGGTCAAGcgαrcg-Dabsyl

During amplification the signal intensifies in proportion to the amount of amplicons produced. The fluorescence curve as a function of time makes it possible to define the time or the exponential phase of the amplification will start (also called TTP: time to positivity, threshold time). The standard PAI-I curve links the number of transcripts initially present in the solution according to the TTP detected during NASBA amplification. Using a standard curve, the number of copies of the target gene is calculated absolutely. Finally, this value is normalized thanks to a household gene, in this case the PPIB gene. This standard curve PAI-I, shown in Figure la (curve in solid line).

Standard curve of target gene encoding UPA

The curve of the target gene coding for UPA was carried out according to the same principle as for PA-1, with the exception of the amplification primers used and the "molecular beacons", which were specific for UPA.

Thus, for the target gene coding for UPA (reference sequence NCBI accession number: NM_002658.1), a first primer of SEQ ID No. 7 5 'CCAAGGCCGC ATGACTTTGA 3' and a second one of SEQ ID No. 8 was used. GCCAAGAAAG GGACATCTATG 3 ', respectively located at positions 1228-1248 and 2135-2155 of the reference sequence.

The amplicons were then transcribed into RNA in vitro by the use of an RNA polymerase (T7 or SP6 (Megascript® kit, Ambion, Austin, USA), depending on the orientation of the amplicon). After removal of the plasmid by treatment with DNAse, the RNAs were purified by Rneasy® Mini Kit (Qiagen, Hilden, Germany) and quantified. (RNA6000Nano, Agilent Technologies, Walbronn, Germany). The amplicons obtained were well specific to the PAI-I gene.

The RNAs obtained above were diluted to different concentrations (stock solution: 0.2 10 ¹¹ copies / μl, dilution in cascade 0.2 10 ¹¹ copies / μl at 0.2 × 10 ² copies / μl). These cascade dilutions are amplified by NASBA using the Nuclisens basic® kit (bioMérieux BV, The Netherlands) in the presence of 0.2 μM of a first UPA primer of SEQ ID No. 5 'AGCCCTGCCC TGAAGTCGTT A 3' comprising in its 5 'end, and said lower case, a sequence comprising the promoter of the T7 polymerase, ie a first primer whose complete sequence is SEQ ID N ⁰ 12: 5' aattctaatacgactcactatagggagaaggAGCCCTGCCCTG AAGTCGTTA 3 ', 0.2 μM of a second primer UPA SEQ DN ° 6 5 'CAGGGCATCT

CCTGTGCATG 3 ', o 0.1 μM of "molecular beacons" used comprising SEQ ID NO ^: 10' TGTAAGCAGC TGAGGTCT 3 ', labeled with a FAM fluorophore (6-carboxy-fluorescein) at their 5' end, and a "quencher" (Dabsyl) at its 3 'end (complete sequence: 5' FAM-TGTAAGCAGC TGAGGTCT cgatcg-Oabsyl 3 '). The standard curve UPA is represented in FIG.

Standard curve of the PPIB target gene

The curve of the target gene PPIB was carried out according to the same principle as for PAI-I, with the exception of the amplification primers and the "molecular beacons", which were specific to PPIB.

Thus, for the housekeeping gene PPIB (reference sequence NCBI accession number: M60857), there was used a first primer of SEQ ID N ⁰ 13 5 'AC ATGAAGGT GCTCCTTGCC 3' and a second primer of SEQ ID N ⁰ 14 5 'GTCCCTGTGC CCTACTCCTT 3', respectively located in positions 11-30 and 631-650 of the reference sequence. The sequence of these PPIB amplicons was verified by sequencing (Biofidal, Vaulx en Velin, France) to ensure that it matched the sequence of the target gene that was to be amplified. The amplicons obtained were well specific to the PPIB gene. The amplicons were then transcribed into RNA in vitro by the use of an RNA polymerase (T7 or SP6 (Megascript® kit, Ambion, Austin, USA), depending on the orientation of the amplicon). After removal of the plasmid by DNAse treatment, the RNAs were purified by Reasy® Mini Kit (Qiagen, Hilden, Germany) and quantified (RNA6000Nano, Agilent Technologies, Walbronn, Germany).

The RNAs obtained above were diluted to different concentrations (stock solution: 0.2 10 ¹¹ copies / μl, dilution in cascade 0.2 10 ¹¹ copies / μl at 0.2 × 10 ² copies / μl). These cascade dilutions are amplified by NASBA using the Nuclisens basic® kit (bioMérieux BV, The Netherlands) in the presence of: a 0.2 μM of a first PPIB primer of SEQ ID No. 13 5 'CAGGCTGTCT TGACTGTCGT GA 3 ', comprising in its 5' end, and said lower case a sequence comprising the promoter of the T7 polymerase, ie a first primer whose complete sequence is SEQ ID N ⁰ 16: 5 'aattctaata cgactcacta tagggagaag gCAGGCTGTCTTGACTGTCG TGA 3 'at 0.2 μM of a second PPIB primer of SEQ ID N ⁰ 14 5' AGG AGAGAAA

GGATTTGGCT 3 'o 0, lμM of "molecular beacons" comprising SEQ ID No. 15 5' GATCCAGGGCGGAGACTTCA 3 ', labeled with a fluorophore ROX (6-carboxy-X-rhodamine) in 5', and a "quencher" (Dabsyl) at 3 '(complete sequence: 5' ROX-cgatcgGATCCAGGGCGGAGACTTCAcga cg-Dabsyl 3 'The standard curve PPIB is shown in FIGURE 1A and IB (dashed lines).

b) amplification reaction by NASBA: bl) Duplex amplification of PAI-I and PPIB genes

This amplification reaction was carried out using a Nuclisens basic® kit (bioMérieux BV, The Netherlands). For this, 5 ng of total RNA, extracted from the various cell lines, were added to 10 μl of NASBA buffer (final concentration in 20 μl of reaction medium: 40 mM Tris HCl pH 8.5, 12 mM MgCl 2, 70 mM KCl , 5mM dithiotreitol, 15% v / v DMSO, 1mM each dNTP, 2mM each NTP). In this medium, 0.1 μM of "molecular beacons" comprising SEQ ID NO: 9, labeled with a 5 'FAM (6-carboxy-fluorescein) fluorophore, and a 3' quencher (Dabsyl) for the detection of PAI-1 gene RNAs. SEQ ID NO ^: 15, labeled with a 5 'ROX (6-carboxy-X-rhodamine) fluorophore, and a 3''quencher (Dabsyl) for the detection of RNAs of the PPIB gene, medium was also added: o 0.2 μM of a first PAI-I primer of SEQ ID NO ^: 1, comprising, at its 5 'end, a sequence comprising the T7 polymerase promoter, o 0.2 μM of a second primer PAI-1 of SEQ ID No. 2, wherein 0.2 μM of a first PPIB primer of SEQ ID NO ^: 13 comprising at its 5 'end a sequence comprising the T7 polymerase promoter at 0.2 μM a second primer of SEQ ID NO PPIB ⁰ 14.

Preincubation was carried out for 2 minutes at 65 ^° C. before incubation for 2 minutes at 41 ^° C. A volume of 5 μl of an enzyme mixture (0.08 μl of RNAse H, 32 μl of T7 RNA polymerase, 6.4 U of AMV-RT) was added, and a 90 minute incubation was carried out at 41 ^° C.

The quantification of the transcribed RNAs was determined in real time (NucliSens EasyQ, bioMérieux), the NASBA reaction producing amplicons with which the specific "molecular beacons" can hybridize simultaneously to give a fluorescent signal. The formation of the new RNA molecules is measured in real time by continuous monitoring of the signal in a fluorescent reader, the NucliSens EasyQ analyzer. Automated data analysis and communication is provided by Nuclisens TTP software (bioMérieux BV, The Netherlands). The standard curve, as defined previously (RNA dilution transcribed: 10 ⁸ to 10 ² copies) was used for the quantification of the expression of each of the target gene ESR1 and the household gene PPIB, in order to extrapolate the number of mRNA copies per sample. Quantification of target gene expression was expressed as the number of mRNA copies / 5ng of total RNA.

Table 1 shows the expression of the PAI-I gene quantified from 5 ng of total RNA from the MDA-MD-231, MCF7 cell lines.

TABLE 1 Expression of the PAI-I Gene in MCF7, T47D Cells (NC: Non-calculable) The expression of the PAI-I gene was expressed by the ratio between the number of mRNA copies of the target gene and the number of mRNA copies of the housekeeping gene. Thus, PAI-I mRNAs were expressed in MDA-MD-231 cells whereas they were not detected in MCF7 cells, consistent with the expression of these cells.

Table 2 shows the expression of the PAI-I gene quantified from 50 ng of total RNA originating from ELISA + tumors, ie expressing the PAI-I protein, or of ELISA- tumors.

Table 2 - PAI-I gene expression in ELISA + and ELISA tumors -

The expression of the PAI-I gene was expressed by the ratio between the number of mRNA copies of the target gene and the number of mRNA copies of the housekeeping gene. Overexpression of the PAI-1 gene was observed in ELISA + tumors.

From the standard curves PAI-I and PPIB carried out previously, the limit of detection and the limit of quantification were determined for the genes PAI-1 and PPIB amplified in duplex. The limit of quantification was observed at 1000 copies of mRNA for PAI-I and PPIB. The detection limit was 100 copies of mRNA for PAI-I and

BIPPs.

No signal was observed when NASBA was made from total RNA from MCF7 cell line, PAI-1 negative.

All these results were confirmed by the use of another amplification technique (quantitative RT-PCR) (PAI-I: r = 0.7886, p <0.0001, n = 80; Spearman correlation statistic). In addition, the results obtained at the messenger RNA level by the NASBA technique for the PAI-1 gene were correlated with those obtained at the protein level by ELISA (PAI-I: r = 0.3590, p = 0.0013, n = 77 Spearman correlation statistical test). These results demonstrate that the expression of the mRNAs is correlated with the presence in the cytosol and the nucleus, confirming the interest of studying at the mRNA level the expression of this gene.

These results demonstrate that PAI-1 / PPIB duplex in NASBA allows quantification of PAI-I gene expression from a very small amount of total RNA, and, more broadly, from a very small amount of tumor cells, and is perfectly suited to study the diagnosis / prognosis of breast cancer, and the response of a patient to a given treatment.

b2) Duplex Amplification of UPA and PPIB Genes

This amplification reaction was carried out using a Nuclisens basic® kit (bioMérieux BV, The Netherlands). For this, 5 ng of total RNA, extracted from the various cell lines, were added to 10 μl of NASBA buffer (final concentration in 20 μl of reaction medium: 40 mM Tris HCl pH 8.5, 12 mM MgCl 2, 70 mM KCl , 5mM dithiotreitol, 15% v / v DMSO, 1mM each dNTP, 2mM each NTP). In this medium, 0.1 μM of "molecular beacons" comprising SEQ ID NO ^: 10, labeled with a FAM fluorophore (6-carboxy-fluorescein) at their 5 'end, and a quencher were added. (Dabsyl) at its 3 'end to the detection of RNA encoding UPA when duplex UPA / cyclophilin B, o SEQ ID N ⁰ 15, labeled with a ROX fluorophore (6-carboxy-X-rhodamine) 5' and of a "quencher" (Dabsyl) at 3 ', for the detection of the RNAs of the PPIB gene. In this medium was also added: o 0.2 μM of a first UPA primer of SEQ ID No. 5 comprising, in its 5 'end, a sequence comprising the T7 polymerase promoter, has 0.2 μM of a second UPA primer of SEQ ID No. 6, o 0.2 μM of a first PPIB primer of SEQ ID NO ^: 13, comprising, at its 5 'end, a sequence comprising the T7 polymerase promoter, at 0.2 μM of a second PPIB primer of SEQ ID N # 15

The quantification of the transcribed RNAs was determined in real time according to a principle comparable to that described for UPA. The standard curve, as defined previously (RNA dilution transcribed: 10 ⁸ to 10 ² copies) was used for the quantification of the expression of the target gene UPA and the household gene PPIB, in order to extrapolate the number of copies of MRNA per sample. Quantification of target gene expression was expressed as the number of mRNA copies / 5ng of total RNA.

Table 3 shows the expression of the UPA gene quantified from 5 ng of total RNA from MCF-7 and MDA-MD-231 cell lines.

Table 3 - UPA Gene Expression in MCF-7 and MDA-MD-231 Cells

UPA gene expression was expressed as the ratio of the target gene mRNA copy number to the mRNA copy number of the housekeeping gene. Thus, UPA mRNAs were expressed in MDA321 cells whereas they were not detected in MCF-7 cells, consistent with the expression of these cells.

Table 4 shows the expression of the UPA gene quantified from 50 ng of total RNA from ELISA + tumors or ELISA- tumors.

Table 4 - UPA gene expression in ELISA + and ELISA tumors -

UPA gene expression was expressed as the ratio of the target gene mRNA copy number to the mRNA copy number of the housekeeping gene. Overexpression of the UPA gene was observed in ELISA + tumors.

From the UPA and PPIB standard curves previously produced, the detection limit and the limit of quantification were determined for the duplex amplified UPA and PPIB genes. The limit of quantification was determined at 1000 and ⁴ copies of mRNA for UPA and PPIB, respectively. The detection limit was 100 copies of mRNA for UPA and PPIB.

Similarly, no signal was observed when NASBA was made from total RNAs from the MCF7 cell line, negative UPA.

All these results were confirmed by the use of another amplification technique (quantitative RT-PCR) (UPA: r = 0.8029, p <0.0001, n = 81, Spearman statistical correlation test). In addition, the results obtained at the messenger RNA level by the NASBA technique for the UPA gene were correlated with those obtained at the protein level by ELISA (UPA: r = 0.5784, p <0.0001, n = 77; Spearman correlation). These results demonstrate that the expression of the mRNAs is correlated with the presence of proteins in the cytosol and the nucleus, confirming the interest of studying at the mRNA level the expression of this gene.

These results demonstrate that UPA / PPIB duplex in NASBA allows quantification of UPA gene expression from a very small amount of total RNA, and, more broadly, from a very low amount of tumor cells, and is perfectly suited to study the diagnosis / prognosis of breast cancer, and the response of a patient to a given treatment.

Claims

A method for the diagnosis / prognosis of breast cancer comprising the steps of:

A - the nucleic material is extracted from a biological sample,

B - at least one pair of amplification primers is used to obtain amplicons of at least one target sequence of the nucleic material C - at least one detection probe is used to detect the presence of said amplicons, characterized in that, when of step B, said pair of primer comprises at least one amplification primer comprising at least 10 nucleotide motifs of a nucleotide sequence chosen from SEQ ID NO ^: 1 to SEQ ID NO: 8 and / or when step C), said detection probe comprises at least 10 nucleotide units of a nucleotide sequence selected from SEQ ID NO: 9 to SEQ ID NO ^: 10.

2. Method for the diagnosis / prognosis of breast cancer according to claim 1, characterized in that, during step B, said pair of primers is chosen from the following primer pairs: a first amplification primer comprising at least 10 nucleotide units of the nucleotide sequence SEQ ID NO ¹ and a second amplification primer comprising at least 10 nucleotide units of the nucleotide sequence SEQ ID No. 2; a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 3 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 4; o a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID NO: 5 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ 6; o a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID NO: 7 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ 8.

The method for diagnosis / prognosis of breast cancer according to any one of claims 1 or 2 wherein said pair of primer comprises at least one amplification primer comprising a promoter for initiation of transcription by a polymerase bacteriophage TJ.

The method for the diagnosis / prognosis of breast cancer according to any one of claims 1 to 3 wherein, in step C, the detection probe comprises a flurophore and a quencher.

5. Method according to any one of claims 1 to 4 wherein the target sequence is included in a gene selected from PAI-I, UPA-I.

The method of any one of claims 1 to 5 wherein steps B and C are performed at the same time.

7. Method according to any one of claims 1 to 6 characterized in that one uses, in addition, during step B, at least one pair of amplification primers to obtain specific amplicons of a household gene.

An amplification primer comprising at least 10 nucleotide motifs of a nucleotide sequence selected from SEQ ID NO ^: 1 to SEQ ID NO: 8.

9. Primer amplification according to claim 8 comprising a promoter for the initiation of transcription by a polymerase bacteriophage

T7.

10. Pair of amplification primer selected from the following primer pairs: a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. ¹ and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 2; a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 3 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 4; a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 5 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID No. 6; o a first amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID NO: 7 and a second amplification primer comprising at least 10 nucleotide motifs of the nucleotide sequence SEQ ID N ⁰ 8;

11. A pair of primer according to claim 10 wherein said first primer comprises a promoter for initiating transcription by a bacteriophage T7 polymerase.

12. Use of at least one amplification primer according to claim 8 or 9 and / or a pair of primer according to claim 10 or 11 during a NASBA amplification reaction.

13. Detection probe comprising at least 10 nucleotide motifs of a nucleotide sequence selected from SEQ ID NO: 9 to SEQ ID NO ^: 10.

The sensing probe of claim 13 comprising a flurophore and a quencher.

Use of at least one primer according to claim 8 or 9 and / or at least one pair of primers according to claim 10 or 11 and / or at least one detection probe according to claim 13 or 14 for the diagnosis / prognosis of breast cancer.

16. Kit for the diagnosis / prognosis of breast cancer comprising at least one primer according to claim 8 or 9 and / or at least one pair of primers according to claim 10 or 11 and / or at least a detection probe according to claim 13 or 14.