EP1855523A2 - Insulin and leptin resistance with hyperleptinemia in mice lacking androgen receptor - Google Patents
Insulin and leptin resistance with hyperleptinemia in mice lacking androgen receptorInfo
- Publication number
- EP1855523A2 EP1855523A2 EP06717647A EP06717647A EP1855523A2 EP 1855523 A2 EP1855523 A2 EP 1855523A2 EP 06717647 A EP06717647 A EP 06717647A EP 06717647 A EP06717647 A EP 06717647A EP 1855523 A2 EP1855523 A2 EP 1855523A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- diabetes
- subject
- activity
- type
- mice
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0276—Knock-out vertebrates
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
- C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
- G01N33/5082—Supracellular entities, e.g. tissue, organisms
- G01N33/5088—Supracellular entities, e.g. tissue, organisms of vertebrates
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0362—Animal model for lipid/glucose metabolism, e.g. obesity, type-2 diabetes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/30—Vector systems comprising sequences for excision in presence of a recombinase, e.g. loxP or FRT
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
- G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
- G01N2333/723—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/04—Endocrine or metabolic disorders
- G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/32—Cardiovascular disorders
Definitions
- Androgen receptor is a member of the steroid hormone superfamily of nuclear receptors. Androgen receptor has been implicated in many cancers in an androgen dependent way. Disclosed herein androgen receptor is also involved in the development of Type ⁇ Diabetes and coronary heart disease (CHD). Furthermore, while antiandrogens, such as hydroxyflutamide have been used to treat AR dependent cancers for many years, these same treatments can increase the factors that contribute to Type ⁇ Diabetes and CHD.
- this invention in one aspect, relates to Type II Diabetes and Coronary Heart Disease (CHD) and related diseases and conditions.
- CHD Type II Diabetes and Coronary Heart Disease
- Figure 1 shows that AR "/y mice developed excess adiposity.
- Figure IA shows that the growth curves of mice were determined at indicated time points between the ages of 5 and 40 weeks. Values are mean ⁇ SE from 9-10 mice per group. *P ⁇ 0.05, **P ⁇ 0.01, AR "/y versus male WT.
- Figure IB shows the epididymal and perirenal fat pads isolated from 35-week-old mice (upper panel). Sections of WAT (white adipose tissue) are shown at 4Ox magnification (lower panel) of 35-week-old mice, scale bar, 200 ⁇ m.
- C Distribution of cell size of epididymal WATs from 35-week-old mice.
- Figure 2 shows that AR " y mice are insulin resistant, and glucose intolerant.
- Figure 2A shows the GTT (glucose tolerance test) (oral bolus 2 mg/g body weight) of 35- week-old mice after 14-h fast.
- Figure 2B shows the AUC analysis of GTT.
- Figure 2C shows the ITT (insulin tolerance test ) (intraperitoneal 1 U/kg body weight) of 25-week-old mice.
- Figure 2D shows the ITT (intraperitoneal 1 U/kg body weight) of 35-week-old mice. Values are mean ⁇ SE from 5-6 mice per group. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, AR " /y versus male WT.
- Figure 2E shows that in vivo PI3K activity was measured in phosphotyrosine immunoprecipitates prepared from skeletal muscles, adipose tissues, and livers from 14-h fast of 35-week-old mice. Tissues were collected 3 min after intraperitoneal injection of insulin or isotonic saline. The results were quantified by
- PhosphoLnaging Values are representative of 3 mice of each group. **P ⁇ 0.01, AR "/y with insulin versus WT with insulin.
- Figure 2F shows the skeletal muscles and livers that were removed from 35-week-old, ad libitum-fed mice. Values of each group were converted into milligrams of TG (triglyceride) per gram of tissue (wet weight) after comparison with a glycerol standard. Values are mean ⁇ SE from 5 mice per group. ***P ⁇ 0.001, AR "/y versus WT.
- Figure 3 shows the Effects of AR deficiency on adipocyte-derived adipokine.
- Figure 3A shows the fed leptin concentrations in 8-, 25-, or 35-week-old mice.
- Figure 3B shows the relationship between fed leptin concentrations and body weight of 35-week-old mice.
- Figure 3 C shows the adiponectin concentrations in 35-week-old mice.
- Figure 4 shows that Aging AR " y mice developed leptin resistance but not younger mice.
- Figure 4A shows the food intake per 24-h of 35-week-old mice.
- Figure 4B shows the weight changes per 24-h of 35 -week-old mice.
- Figure 4C shows the food intake per 24-h of 20-week-old mice.
- Figure 4D shows the weight changes per 24-h of 20-week-old mice.
- Values are mean -t SE from 3-4 mice per group.
- Figure 5 shows the recombination of AR-loxP allele in the liver of AR (L"/y) mice, growth curve, cumulative weight gain, and serum glucose in WT and AR (L"/y) mice on high fat diet (HFD). Mice were given HFD from 8 weeks as described in Methods.
- Figure 5(a) shows the detection of intact (wt) versus recombined (ko) allele and SIp by RT- PCR from liver.
- Figure 5(b) shows the body weight and (c) cumulative weight gain on
- HFD of the animals measured weekly. Also shown are fasting serum glucose levels (d) at 24 weeks, (e) at 36 weeks, and (f) at 52 weeks on HFD of the animals.
- Figure 6 shws the fat accumulation in the liver of treated WT and AR (Wy) mice on HFD.
- Figures 6(a-b) show images of gross appearance and H&E staining of liver sections of WT mice treated with the normal chow (a), HFD (b), AR (Wy -* mice with normal chow (c), and HFD (d) at 16 weeks for 8 weeks. The clear vacuoles in the liver section are identified by arrows in b and d.
- Figure 7 shows that fed HFD in AR (L"/y) mice results in defects in glucose homeostasis.
- Figure 7(a) shows that glucose tolerance tests were performed. Blood samples were collected and glucose measured at the times indicated. Results represent blood glucose concentrations are expressed as mean ⁇ SEM.
- Figure 7(b) shows the serum insulin concentration at the times indicated.
- Figure 7(c) shows PI3K activity in PY- immunoprecipitates, and a representative ⁇ hosphatidylinositol-(3,4,5) trisphosphate (PIP3) level. Bars represent mean ⁇ SEM.
- Figure 7(d) show the serum insulin concentration at 24 weeks.
- Figure 8 shows decreased adiponectin, increased FFA, and leptin levels in AR (L" /y) mice.
- Figure 8(a) shows serum free fatty acid levels in random-fed mice.
- Figure 8(b) shows serum cholesterol levels in random-fed mice.
- Figure 8(c) shows serum adiponectin levels of random-fed mice.
- Figure 8(d) shows serum leptin levels of random-fed mice. Bars represent mean ⁇ SEM.
- compositions and methods are not limited to specific synthetic methods, specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. 17. It is estimated that by the year 2030 there will be approximately 366 million people affected by type 2 diabetes in worldwide (WiId 5 S, et al. (2004) Diabetes Care 27:1047-1053) with many of those affected in the elderly age group ⁇ Diabetes Care 21 :296- 309, 1998). Although the primary factors causing this disease are elusive, insulin resistance and leptin insensitivity may play a major role in its development (Saad, MF 5 et al. (1989) Lancet 1:1356-1359).
- Testosterone and its metabolite, dihydrotestosterone (DHT) 5 can activate androgen receptor (AR) to exert their androgenic actions.
- AR androgen receptor
- the proper or maximal androgen (A) action typically requires interaction with selective coregulators in selective tissues (Chang,CS, et al. (1988) Science 240:324-326; Heinlein,CA, and Chang,C. (2002) Endocr.Rev. 23:175-200).
- Leptin the adipocyte-derived adipokine product of the ob gene, has been shown to induce a negative energy balance by reducing appetite and increasing energy expenditure (Friedman, JM 5 and HalaasJL. (1998) Nature 395:763-770). Leptin circulates in serum at levels that parallel the mass of body fat. However, obese individuals have been found to be resistant to the negative regulatory function of circulating leptin (Hamilton, BS 5 et al. (1995) Nat Med 1 :953-956).
- mice that lack leptin or are leptin resistant, respectively, are profoundly hyperphagic and hypometabolic, leading to an obese phenotype, and manifest numerous abnormalities, such as type 2 daibetes with severe insulin resistance, hypothermia and cold intolerance, infertility, and decrease in lean mass (Burks, DJ, et al. (2000) Nature 407:377-382; Chen, H, et al. (1996) Cell 84:491-495; Chua, SCJ, et al. (1996) Science 271 :994-996; Hausberg,M, et al. (2002) Diabetes 51:2434-2440; Lee,GH, et al. (1996) Nature 379:632-635).
- Ranges can be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value “10” is disclosed, then “about 10" is also disclosed.
- Primers are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur.
- a primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
- Probes are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
- Decrease refers to lower or less than and typically in reference to a control or other embodiment.
- a level of a subject activity can be decreased either in reference to a control level of activity, the activity of a control performed in parallel with the subject activity, or the activity of a second subject activity.
- a level of a subject activity can be increased either in reference to a control level of activity, the activity of a control performed in parallel with the subject activity, or the activity of a second subject activity.
- AR activity is shown herein to have a profound effect on leptin sensitivity (resistance), insulin resistance, glucose resistance, triglyceride levels, high-density lipoprotein levels (HDL), and low-density lipoprotein (LDL) levels. Specifically, it is disclosed herein, that a decrease in AR activity results in increased insulin, glucose, and leptin resistance, increased HDL levels, increased uric acid, and decreased LDL levels. Thus, decreased AR activity can play a prime role in the development of Type II diabetes as well as coronary heart disease. 31.
- animals which lack functional AR such as an AR knockout animal have leptin sensitivity (resistance), insulin resistance, glucose resistance, triglyceride levels, increased HDL, and decreased LDL levels. These animals are shown herein as a model or part of a model for Type II diabetes.
- models for type II diabetes that comprise an animal which is an AR knock out as well as models comprising an AR knock out animal and a particular assay, condition, or state, which is related to diabetes or heart disease, such as Type II diabetes, as well as animals that have a particular level of blood glucose as controlled, by for example, having been fed or fasted for a particular period of time.
- compositions as models for type II diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes. a) Androgen receptor knockouts
- an AR knock out animal is any animal with a disrupted AR loci or gene.
- the AR loci can be disrupted by, for example, disrupting one of the exons, such that a stop codon terminates translation of the AR peptide early or where the exon is completely taken out.
- the AR loci would include any exon or intron associated with the AR gene on the X chromosome.
- the AR gene is considered any sequence associated with the AR locus. Thus, it would at least include the chromosomal nucleic acid contained within any organism that expresses an AR, such as, the introns, exons, 5' upstream sequence involved with the AR coding and non-coding sequence, and 3' downstream sequence involved with the AR coding and non coding sequence.
- a disrupted AR loci can be any AR loci that does not produce a native AR protein.
- a disrupted AR loci would also include any AR loci wherein the nucleic acid of the natural AR gene, including exons and introns has been altered.
- the altering of the AR gene will cause a disruption in AR function, by for example, preventing DNA binding in the AR gene product or ligand binding in the AR gene product or transactivating activity in the AR gene product.
- the disrupted AR loci can be made using any known technique, including homologous recombination techniques.
- the disrupted loci can be an alteration of any exon to produce a non-functional AR protein.
- constructs and methods to mutate any exon in the AR through homologous recombination via the surrounding introns are constructs and methods to mutate any exon in the AR through homologous recombination via the surrounding introns.
- the AR knock outs can be produced so that they are conditional, by for example, being dependent on recombinase activity, such as Cre.
- Cre recombinase activity
- the Cre-lox system has been successfully used herein to generate AR knockout mice (ARKO).
- This principle has been successfully applied for tissue-specific transgene expression (Orban PC, 1992), for site specific gene targeting (Gu, 1994) and for exchange of gene sequence by the "knock-in" method (Hank M, 1995).
- the ARKO animal can have a liver-specific knock out by using the albumin promoter. It is understood and herein contemplated that other ARKO animals can be used utilizing other tissue specific promoters known in the art.
- exon 1 can be floxed through addition of a lox site in sequence that will homologously recombine with Ihtron 1 and inron 2.
- lox sites could be inserted into sequence which would homologously recombine with intron 2 and intron 3 for exon 2, intron 3 and intron 4 for exon 3, intron 4 and intron 5 for exon 4, intron 5 and intron 6 for exon 5, and so forth for each exon which are considered disclosed herein.
- the disrupted AR loci can be in any cell that contains an AR loci, such as an embryonic stem cell, an embryonic germ cell, a breast cell, a breast cancer cell, an ovary cell, an ovary cancer cell, and any cell line of cells that contain AR genes which are expressed, such as prostate cells, testis, bone, brain, neural, and muscle.
- an AR loci such as an embryonic stem cell, an embryonic germ cell, a breast cell, a breast cancer cell, an ovary cell, an ovary cancer cell, and any cell line of cells that contain AR genes which are expressed, such as prostate cells, testis, bone, brain, neural, and muscle.
- the ARKOs can be in any cell or in any animal, such as a rat, mouse, non- human primate (including but not limited to monkey and chimpanzee), rabbit, porcine, ovine, or bovine.
- a rat, mouse, non- human primate including but not limited to monkey and chimpanzee
- rabbit, porcine, ovine, or bovine can be in any mammal. They can be used via any technique and the animals produced as well as their progeny are disclosed.
- Disclosed are methods of making a model for type II diabetes comprising a) generating a mouse with an AR gene or necessary portion thereof for AR actvity, between two loxP sites, b) generating a mouse with Cre recombinase under the control of a ⁇ -actin promoter (ACTB Cre+) and heterozygous for the AR gene, and c) mating a female ACTB Cre+ mouse with and ARloxP mouse creating an AR Cre-lox mouse.
- ACTB Cre+ ⁇ -actin promoter
- Cre-loxP system is described herein to create the model, it is understood and herein contemplated that any inducible promoter system such as the FIp recombinase and the tetracycline inducible promoter system, may be used in place of the Cre-loxP inducible promoter system. Also disclosed are methods of generating a model for type II diabetes comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of type II diabetes.
- a model for Coronary Heart Disease comprising a) generating a mouse with an AR gene or necessary portion thereof for activity, between two loxP sites, b) generating a mouse with Cre recombinase under the control of a ⁇ -actin promoter (ACTB Cre+) and heterozygous for the AR gene, and c) mating a female ACTB Cre+ mouse with and ARloxP mouse creating an AR Cre-lox mouse.
- methods of generating a model for Coronary Heart Disease (CHD) comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of coronary heart disease. b) Assays, conditions, or states related to diabetes
- the models include an assay or a condition or a state that is related to diabetes which is either monitored or tested, for example.
- a model could include the ARKO animal disclosed herein, along with a state the animal is put into, such as a fed state or a fasting state for a period of time. It is understood and herein contemplated that periods of fasting can occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours prior to assay. It is also understood that feeding can occur within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours of the assay period. This can, for example, produce conditions which mimic a Type II diabetic situation.
- models for Type ⁇ diabetes comprising an androgen receptor knockout animal and an assay for type ⁇ diabetes, wherein the assay is performed on an animal that fasted for at least 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 hours or any number of hours in between. It is also understood that feeding can occur after a period of fasting.
- the animal can be put into a fed state 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours prior to the assay period following 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours of fasting.
- the ARKO animal can have its blood glucose level tested or an insulin tolerance test (ITT) or glucose tolerance test (GTT) can be performed.
- ITT insulin tolerance test
- GTT glucose tolerance test
- models for Type ⁇ diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes, wherein the assay for Type II diabetes comprises an insulin tolerance test (ITT).
- models for Type II diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes, wherein the assay for Type II diabetes comprises a glucose tolerance test (GTT).
- the ARKO animal can have its leptin levels monitored or tested, or its triglyceride or HDL or LDL levels monitored or tested. Fatty acids, triglycerides, and cholesterol can also be measured.
- C- reactive peptide CBP
- Adiponectin and Resistin markers for Diabetes, also can be assayed by Elisa method. It is understood that these and other types of tests can also be performed on a subject to determine if they have a particular disases condition, even if they are not an ARKO mouse, such as a human.
- the disclosed models can be used in a variety of ways.
- the models can be used to test the effect a particular composition, such as a potential drug for Type II diabetes, has on the knockout animal.
- the effect a composition has on the model can be determined using one or more of the assays disclosed herein alone or in combination.
- the models can also be used to screen libraries of compounds to identify molecules having a particular effect on the model animal. Molecules having the desired effect can be identified and further synthesized or tested for example.
- the models can also be used to test existing pharmaceuticals to see what their effect is the disclosed models.
- the information gained from perfoming tests on existing pharmaceuticals can be used to make treatment decisions regarding that particular composition or one could make the decision to start other therapies in conjunction with that composition, if for example, the composition had a negative effect in the Type II diabetes model, one might look for a combination therapy for Type II diabetes or one might further choose to monitor diabetic indicators, such as glucose levels or insulin resistance, when taking that particular pharmaceutical.
- methods for screening drugs for an effect on Type II Diabetes comprising administering the drug to an androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can treat Type II Diabetes.
- Diabetes comprising administering the drug to an androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can treat Type II Diabetes, further comprising performing an assay for a characteristic of type II diabetes.
- a control may be used as a basis for assessing the effect of a composition being screened.
- methods of testing a composition for its effect on Type II diabetes comprising administering the composition to an androgen receptor knockout animal, and performing an assay related to Type II diabetes, wherein a change in the assay relative to a control indicates the compound has an effect on Type II diabetes.
- methods for screening drags for an effect on CHD comprising administering the drug to an Androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can be used to treat CHD.
- Methods of diagnosis and prognosis 43 The information that lack of androgen receptor leads to characteristics and conditions related to diabetes, such as Type II diabetes, and CHD indicate that a variety of screening and testing methods are disclosed related to subjects and the presence of or likelihood to have or get diabetes, such as Type II diabetes, or CHD. 44.
- subjects who have diabetes or Type II diabetes or CHD can have their AR activity tested.
- To test a human subject's AR activity one could indirectly assay the serum levels of Testosterone or 5-alpha-dihydrotestosterone. Besides, one could assay the number of CAG repeats of AR in subject, which is inversely correlated with AR activity.
- AR activity can also be performed using methods as described herein, for example, for assaying AR activity in tissue or cell samples from mice disclosed herein. An AR activity lower than that of a control would indicate that the diabetes or CHD of the subject could be due to the loss of AR activity. Steps could then be taken, as discussed herein, to elevate the activity of the AR activity to help alleviate or reduce the diabetes or CHD. In another sitruation, a subject could have their AR activity tested.
- the techniques and methods disclosed herein can be used to assess the likelihood a subject will develop a condition due to decreased AR activity.
- methods for diagnosing the likelihood of a subject to develop Type II Diabetes comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates Type II Diabetes. It is understood that subjects with decreased AR activity can have increased leptin resistance and increased insulin resistance. Therefore, it is understood and herein contemplated that a subject with decreased AR activity will likely develop Type II diabetes.
- One measure of AR activity would be to assay the expression of AR dependent genes in the sample.
- Another measure of AR acivity comprises assaying the amount of AR present in the sample.
- the disclosed methods can be used to diagnose the likelihood a subject will develop coronary heart disease CHD.
- methods for diagnosing the likelihood of a subject to develop CHD comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates CHD. It is understood and herein contemplated that subjects with decreased AR activity can have increased uric acid levels, increased HDL, and decreased LDL, all of which contribute to CHD. It is also understood that a subject can be a cell, mammal, mouse, or human. 46.
- the disclosed methods can also be used to diagnose a condition.
- a method of diagnosing a subject with Type II diabetes comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates Type ⁇ diabetes.
- a method of diagnosing a subject with CHD comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates CHD.
- various tissue samples can be used with the disclosed methods. Specifically disclosed are methods, wherein the tissue sample is blood, white adipose tissue (WAT), liver tissue, or skeletal muscle.
- Androgen ablation thereapy is a commonly used method of treating cancer and in particular prostate cancer.
- the diminishment of AR activity can have dramatic consequences in the patient.
- the patient can develop leptin resistance and insulin resistance which are two of the main components of Type ⁇ Diabetes.
- decreased AR activity can lead to increased high density lipoproteins, increased uric acid output, and decreased low-density lipoproteins associated with CHD.
- a patient being treated for cancer with an androgen ablatement mitin can develope secondary problems associated with the treatment that left unchecked can put the patients life at risk.
- a patient that developes Type II diabetes or CHD while under treatment with androgen ablatement therapy can be assessed to determine if AR is the reason for the developing Type II diabetes or CHD. IfAR activity is decreased in the patient and tests indicate that diabetes or CHD is a problem, a new treatment can be prescribed to avoid complications associated with Type II diabetes and CHD.
- Also disclosed are methods for evaluating whether a treatment with a compound should be performed due to the effect the treatment has on CHD, wherein the compound modulates the androgen activity the method comprising a) exposing a subject Q to the compound, and b) evaluating androgen activity in the presence of the compound, wherein a change in the androgen activity of the subject, relative to the androgen activity of a subject that has not been exposed to the compound, indicates that the compound modulates androgen activity, and wherein a decrease in androgen activity indicates a negative effect on CHD, providing an indication that treatment with the compound may not 5 be indicated.
- AR activators Due to the effects of AR activity on prinicipal activities (e.g., leptin resistance, insulin resistance, increased HDL) associated with Type II dabetes and CHD, agents that can increase AR activity can be used to treat these conditions, herein called AR activators.
- Q AR activators can be any molecule discussed herein as increasing AR activity including coactivators and androgen receptor ligands and anlogs as discussed herein and understood.
- a reduced level can be determined by either comparing the amount of the testosterone or one of its precursors or metabolites or molecules in the testosterone synthesis pathway in a subject and comparing it to the amount that had been present in the subject at a prior determination of the same.
- a reduced level can also include a comparison of the level of testosterone or one of its precursors or metabolites or molecules in the testosterone synthesis pathway in a subject to a known standard or average amount for the same.
- average levels of testosterone for males can be 300-l,000ng/dl or 300-1, 100ng/dl.
- Average testosterone levels in women can be about 10 times lower, such as between 15-70 ng/DL for women aged 20-39 and between 4-70 ng/dL for women aged 40-59.
- Disclosed are methods of treating a subject with Type ⁇ Diabetes comprising administering to the subject an agent that modulates AR activity, wherein an increase in
- AR activity reduces Type II Diabetes.
- methods of treating a subject with CHD comprising administering to the subject an agent that modulates AR activity, wherein an increase in AR activity reduces CHD.
- agent for treating CHD or Type II diabetes can include hormones such as testosterone and DHT.
- methods of treating a subject with Type II diabetes or CHD wherein the agent comprises testosterone or CHD.
- compositions which act as AR coactivators/coregulators including ARA24, ARA54, ARA55, ARA70, ARA267, gelsolin, and supervillian. A discussion of these co-regulators can be found in United States Patent Application Nos.
- the N-terminus is quite polymorphic in terms of sequence and length between NRs.
- the N-terminus is more likely to provide unique surfaces to recruit distinct factors that contribute to the specific action of a certain NR.
- the AR has a large N-termius (ARN) and there are two distinct regions important for its transactivation function residing within the ARN: residues 141-338, which are required for full ligand-inducible transactivation, and residues 360-494, where the ligand-independent activation function-1 (AF-I) region is located (Heinlein, C.A., et al. 2002. Endocr. Rev. 23 : 175-200).
- Coactivators and corepressors have been identified to interact with ARN (Hsiao, P., et al. 1999. J Biol. Chem. 274:22373-22379, Hsiao, P., et al. 1999. J. Biol. Chem. 274:20229-20234, Knudsen, K.E., et al. 1999. Cancer Res. 59:2297- 2301, Lee, D.K., et al. 2000. J. Biol. Chem. 275:9308-9313, Markus, S.M., et al. 2002. MoI. Biol. Cell 13:670-682, Petre, C.E., et al. 2002. J. Biol.
- ARN extends to more than one half of the full length protein, its associated proteins are relatively fewer compared to those associated with AR DBD and AR LBD, presumably due to the existence of the AF-I region which limits the application of conventional yeast-two hybrid system by using ARN as bait. It's likely there are still more ARN associated proteins remaining to be identified.
- AR is classified with glucocorticoid receptor (GR), mineralocorticoid receptor and progesterone receptor (PR) as one group within the nuclear receptor (NR) superfamily, since they share high homology in the DBD and recognize very similar hormone response elements (Forman, B.M. et al. 1990. MoI. Endocrinol. 4:1293-1301, Laudet, V., et al. 1992. EMBO J. 11 : 1003-1013).
- GR glucocorticoid receptor
- PR progesterone receptor
- Androgen receptor signalling 54 Androgen exerts its effects via the intracellular AR, a member of the superfamily of nuclear receptors (Chang, C. S., et al. (1988) Science 240 (4850), 324-6, Mangelsdorf, D. J., et al. (1995) Cell 83 (6), 835-9).
- AR Upon androgen binding, AR dissociates from the heat-shock proteins and binds to androgen response elements, resulting in upregulation or downregulation of the transcription of AR target genes.
- the AR In addition to responding to ligands, the AR is affected by kinase signaling pathways which directly or indirectly alter the biological response to androgens. This phenomenon is mediated by the AR, as antiandrogens have been shown to block kinase-induced transcriptional activation (Sadar, M. D. (1999) JBiol Chem 21 A (12), 7777-83). Growth factors, cytokines, and neuropeptides have been implicated in various in vitro and in vivo models of human malignancies, including prostate cancers (Burfeind, P., et al. (1996) Proc Nat! Acad Sd US A 93 (14), 7263-8).
- IGF-I insulin-like growth factor- 1
- KGF keratinocyte growth factor
- EGF epidermal growth factor
- MAPK and Akt kinase cascades have been shown to be involved in growth factor-mediated AR activation (Yeh, S., et al. (1999) Proc Natl Acad Sci USA 96 (10), 5458-63, Wen, Y., et al. (2000) Cancer Res 60 (24), 6841-5, Lin, H. K., et al. (2001) Proc Natl A cad Sci USA 98 (13), 7200-5).
- AR can be activated and have increased activity, such as transcription activity, as described herein, when AR is bound to its ligand or an activating derivative of said ligand, a precursor to said ligand, a metabolite of said ligand, or a composition that increases a protein or small molecule in the pathway that produces testosterone or an androgen receptor ligand.
- AR is activated by androgens such as testosterone and 5- ⁇ - dihydrotestosterone.
- Principal mammalian androgens are testosterone and 5- ⁇ -dihydrotestosterone.
- androgens There are variety of classes of androgens including Delta-3,4-3-keto androgens, which included Delta-4-androstenedione (Adione), Testosterone, and 11-Beta-hydroxy- androstenedione (11-Adione); Delta-5,6-3-keto androgens, which include, Dehydroepiandrosterone, also known as dehydroisoandrosterone (DHEA), DHEA sulfate (DHEAS); and Delta-5-androstenedion; 5 -Alpha-reduced androgens, which include, 5- Alpha-dihydrotestosterone (dihydrotestosterone, DHT) and 5-Alpha-androstanediol; 17- Keto-steroids, which include DHEA, DHEAS, Delta-4-androstenedione (Adione), Delta
- testosterone contains a 17- ⁇ -OH (hydroxyl) and a 3-keto group which are necessary for activity. Oxidation of the 17-/3-OH to a 17-keto group, or conversion to a 17 ⁇ -OH, results in steroids with decreased androgen activity. Likewise, the 3 -OH instead of 3-keto group is much less active partly due to increased metabolism. (http://www.iieuiOSci.pharm.utoledo.edu/MBC3320/andiOgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.)
- testosterone analogs increase oral activity, prolonged action, and/or selectivity for either anabolic or androgenic activity, but not both.
- Various testosterone analogs and testosterone and other androgen activators can be administered as a topical cream.
- Testosterone analogs show increased activity if Reducing the double bond between carbons 4 and 5 ( ⁇ 4) increases testosterone analog activity. This reduction can be catalyzed by the action of 5- ⁇ reductase.
- Introduction of a fluorine at C9, as for glucocorticoids, increases activity.
- addition of an alkyl group to position 17 increases stability by preventing oxidation to an inactive 17-keto form. Oxidation to the 17- keto form typically occurs in the liver and can be an obstacle to oral administration.
- the 17- ⁇ methyl testosterone has twice the activity of native testosterone and can enter through the buccal mucosa (mouth membranes). Loss of the 19-CH 3 enhances selectivity for anabolic activity by decreasing seletively the androgenic effect.
- Danazol (Danocrine®) is a testosterone derivative having lower androgen agonist without estrogenic activity. Danazol has an acetylene group at Cl 7 and couples a heterocyclic (oxazole) ring to the steroid A ring. Danazol suppresses FSH and LH release from the anterior pituitary and to increase levels of C4 component of complement. (http://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
- Fluoxymesterone (Halotestin®) possesses a combination of features including a 17- ⁇ methyl group, a 9- ⁇ fluorine, and a 11-OH group. Andronergic activity is increased 10 times and anabolic activity increased 20 times as compared to that of 17- ⁇ methyl testosterone.
- Testosterone (Andro®, Andryl®, Delatest®, Depotest®, Duratest®, Everone®, Histerone®, Tesanone®, Testex®, Testrin®P.A.) and 17- ⁇ methyl testosterone (Android®, Metandren®, Oreton® Methyl, Virilon®) can be used, as well as the other AR activators, as described herein.
- Nandrolone derivatives (Androlone®, Duraboline®, HybolinTM Improved, Neo-Durabolic) are examples of this type of analog.
- the prodrug form contains a des-C19 methyl group.
- Oxandrolone having an oxygen instead of C2 and a 17- ⁇ methyl group exhibits approximately three times more anabolic activity with only slight andronergic activity compared to testosterone. flittp://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm. Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
- antibodies that are disclosed herein in particular antibodies that bind AR in any of its various forms, sujch as logand bound, as well as binding of coactivators-or co-regulators of AR. Also disclosed are antibodies that bind proteins whose production is regulated by AR. The disclosed antibodies can be used in assays for determining the presence of AR either directly or indirectly and thus, can be used to assay for AR activity either directly or indirectly. Also disclosed are antibodies which are capable of increasing the AR activity, or binding other ligands, such that the diabetic related effects disclosed herein, are reduced. a) Antibodies Generally, antibodies that bind AR in any of its various forms, sujch as logand bound, as well as binding of coactivators-or co-regulators of AR. Also disclosed are antibodies that bind proteins whose production is regulated by AR. The disclosed antibodies can be used in assays for determining the presence of AR either directly or indirectly and thus, can be used to assay for AR activity either directly or indirectly. Also disclosed are antibodies which are capable of increasing the AR activity, or binding other
- antibodies is used herein in a broad sense and includes both polyclonal and monoclonal antibodies, hi addition to intact immunoglobulin molecules, also included in the term “antibodies” are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as described herein.
- the antibodies are tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo therapeutic and/or prophylactic activities are tested according to known clinical testing methods.
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules.
- the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL USA, 81:6851-6855 (1984)). 70.
- Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
- a hybridoma method a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro, e.g., using the HTV Env-CD4-co-receptor complexes described herein.
- the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.).
- DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al. 72. In vitro methods are also suitable for preparing monovalent antibodies.
- Digestion of antibodies to produce fragments thereof, particularly, Fab fragments can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
- the fragments can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc.
- the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen.
- Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide.
- antibody can also refer to a human antibody and/or a humanized antibody.
- Many non-human antibodies e.g., those derived from mice, rats, or rabbits
- are naturally antigenic in humans and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods of the invention serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response.
- Human antibodies e.g., those derived from mice, rats, or rabbits
- the human antibodies of the invention can be prepared using any technique. Examples of techniques for human monoclonal antibody production include those described by Cole et al. (Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77, 1985) and byBoerner et al. (J. Immunol, 147 (l):86-95, 1991). Human antibodies of the invention (and fragments thereof) can also be produced using phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381, 1991; Marks et al., J. MoI Biol, 222:581, 1991). 76. The human antibodies of the invention can also be obtained from transgenic animals.
- transgenic, mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits et al., Proc. Natl. Acad. ScL USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993)).
- the antibodies are generated in other species and "humanized” for administration in humans.
- Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as scFv, sFv, FV, Fab, Fab', F (ab')2, or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
- Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, ret or rabbit having the desired specificity, affinity and capacity, hi some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- CDR complementary determining region
- donor antibody such as mouse, ret or rabbit having the desired specificity, affinity and capacity, hi some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
- Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences, hi general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
- the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); and Presta, Curr. Op. Struct.
- Fc immunoglobulin constant region
- Humanization can be essentially performed following the method of Winter and co- workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Pat. No.
- humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
- variable domains both light and heavy
- the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences.
- the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993) and Chothia et al., J. MoI. Biol., 196:901 (1987)).
- Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci.
- humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences.
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules.
- the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL U.S.A., 81:6851-6855 (1984)).
- Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975).
- a hybridoma method a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
- the lymphocytes may be immunized in vitro, e.g., using the complexes described herein.
- Transgenic animals e.g., mice
- J (H) antibody heavy chain joining region
- transfer of the human germ-line immunoglobulin gene array in such germ- line mutant mice will result in the production of human antibodies upon antigen challenge (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci.
- Human antibodies can also be produced in phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381 (1991); Marks et al., J. MoL Biol, 222:581 (1991)).
- the techniques of Cote et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J. Immunol., 147 (l):86-95 (1991)).
- peripheral blood lymphocytes are used in methods of producing monoclonal antibodies if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired.
- the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, "Monoclonal Antibodies: Principles and Practice” Academic Press, (1986) pp. 59-103).
- Immortalized cell lines are usually transformed mammalian cells, including myeloma cells of rodent, bovine, equine, and human origin.
- rat or mouse myeloma cell lines are employed.
- the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine (“HAT medium”), which substances prevent the growth of HGPRT-deficient cells.
- HAT medium hypoxanthine, aminopterin, and thymidine
- Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium.
- More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the SaIk Institute Cell Distribution Center, San Diego, Calif, and the American Type Culture Collection, Rockville, Md. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., "Monoclonal Antibody Production Techniques and Applications” Marcel Dekker, Inc., New York, (1987) pp. 51-63).
- the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against ARA67, AR, GSK2B, or hRad9, for example.
- the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
- RIA radioimmunoassay
- ELISA enzyme-linked immunoabsorbent assay
- the clones maybe subcloned by limiting dilution or FACS sorting procedures and grown by standard methods. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
- the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, protein G, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
- the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.).
- DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al.
- In vitro methods are also suitable for preparing monovalent antibodies.
- Digestion of antibodies to produce fragments thereof, particularly, Fab fragments can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566.
- Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
- Antibody fragments 89. Also disclosed are fragments of antibodies which have bioactivity.
- the polypeptide fragments of the present invention can be recombinant proteins obtained by cloning nucleic acids encoding the polypeptide in an expression system capable of producing the polypeptide fragments thereof, such as an adenovirus or baculovirus expression system.
- an expression system capable of producing the polypeptide fragments thereof, such as an adenovirus or baculovirus expression system.
- amino acids found to not contribute to either the activity or the binding specificity or affinity of the antibody can be deleted without a loss in the respective activity.
- amino or carboxy-terminal amino acids are sequentially removed from either the native or the modified non-immunoglobulin molecule or the immunoglobulin molecule and the respective activity assayed in one of many available assays.
- a fragment of an antibody comprises a modified antibody wherein at least one amino acid has been substituted for the naturally occurring amino acid at a specific position, and a portion of either amino terminal or carboxy terminal amino acids, or even an internal region of the antibody, has been replaced with a polypeptide fragment or other moiety, such as biotin, which can facilitate in the purification of the modified antibody.
- a modified antibody can be fused to a maltose binding protein, through either peptide chemistry or cloning the respective nucleic acids encoding the two polypeptide fragments into an expression vector such that the expression of the coding region results in a hybrid polypeptide.
- the hybrid polypeptide can be affinity purified by passing it over an amylose affinity column, and the modified antibody receptor can then be separated from the maltose binding region by cleaving the hybrid polypeptide with the specific protease factor Xa. (See, for example, New England Biolabs Product Catalog, 1996, pg. 164.). Similar purification procedures are available for isolating hybrid proteins from eukaryotic cells as well.
- the fragments include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the fragment must possess a bioactive property, such as binding activity, regulation of binding at the binding domain, etc. Functional or active regions of the antibody may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide.
- a variety of immunoassay formats may be used to select antibodies that selectively bind with a particular protein, variant, or fragment.
- solid-phase ELISA immunoassays are routinely used to select antibodies selectively immunoreactive with a protein, protein variant, or fragment thereof. See Harlow and Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988), for a description of immunoassay formats and conditions that could be used to determine selective binding.
- the binding affinity of a monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson et al., Anal. Biochem., 107:220 (1980). f) Administration of antibodies
- Antibodies of the invention are preferably administered to a subject in a pharmaceutically acceptable carrier.
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of antibody being administered.
- the antibodies can be administered to the subject, patient, or cell by injection (e.g., intravenous, intraperitoneal, subcutaneous, intramuscular), or by other methods such as infusion that ensure its delivery to the bloodstream in an effective form. Local or intravenous injection is preferred.
- Effective dosages and schedules for administering the antibodies may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of antibodies that must be administered will vary depending on, for example, the subject that will receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered.
- the AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I antibodies and antibody fragments can also be administered' to patients or subjects as a nucleic acid preparation (e.g., DNA or RNA) that encodes the antibody or antibody fragment, such that the patient's or subject's own cells take up the nucleic acid and produce and secrete the encoded antibody or antibody fragment.
- a nucleic acid preparation e.g., DNA or RNA
- compositions identified by screening with disclosed compositions / combinatorial chemistry a) Combinatorial chemistry
- compositions can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way.
- Particular disclosed are assays for identifying molecules that modulate AR or another ligand, such that the diabetic related effects of a loss of AR as disclosed herein are reduced or decreased.
- compositions such as macromolecular molecules
- molecules such as macromolecular molecules
- the molecules identified and isolated when using the disclosed compositions such as, AR, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also disclosed.
- the products produced using the combinatorial or screening approaches that involve the disclosed compositions such as, AR, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also considered herein disclosed.
- Combinatorial chemistry includes but is not limited to all methods for isolating small molecules or macromolecules that are capable of binding either a small molecule or another macromolecule, typically in an iterative process.
- Proteins, oligonucleotides, and sugars are examples of macromolecules.
- oligonucleotide molecules with a given function, catalytic or ligand-binding can be isolated from a complex mixture of random oligonucleotides in what has been referred to as "in vitro genetics" (Szostak, TIBS 19:89, 1992).
- Combinatorial techniques are particularly suited for defining binding interactions between molecules and for isolating molecules that have a specific binding activity, often called aptamers when the macromolecules are nucleic acids.
- RNA molecule is generated in which a puromycin molecule is covalently attached to the 3 '-end of the RNA molecule.
- An in vitro translation of this modified RNA molecule causes the correct protein, encoded by the RNA to be translated.
- the puromycin a peptdyl acceptor which cannot be extended, the growing peptide chain is attached to the puromycin which is attached to the RNA.
- the protein molecule is attached to the genetic material that encodes it. Normal in vitro selection procedures can now be done to isolate functional peptides.
- nucleic acid manipulation procedures are performed to amplify the nucleic acid that codes for the selected functional peptides.
- new RNA is transcribed with puromycin at the 3 '-end, new peptide is translated and another functional round of selection is performed.
- protein selection can be performed in an iterative manner just like nucleic acid selection techniques.
- the peptide which is translated is controlled by the sequence of the RNA attached to the puromycin. This sequence can be anything from a random sequence engineered for optimum translation (i.e. no stop codons etc.) or it can be a degenerate sequence of a known RNA molecule to look for improved or altered function of a known peptide.
- Cohen et al. modified this technology so that novel interactions between synthetic or engineered peptide sequences could be identified which bind a molecule of choice.
- the benefit of this type of technology is that the selection is done in an intracellular environment.
- the method utilizes a library of peptide molecules that attached to an acidic activation domain.
- a peptide of choice for example an extracellular portion of AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I is attached to a DNA binding domain of a transcriptional activation protein, such as Gal 4.
- Combinatorial libraries can be made from a wide array of molecules using a number of different synthetic techniques. For example, libraries containing fused 2,4- pyrimidinediones (United States patent 6,025,371) dihydrobenzopyrans (United States Patent 6,017,768and 5,821,130), amide alcohols (United States Patent 5,976,894), hydroxy-amino acid amides (United States Patent 5,972,719) carbohydrates (United States patent 5,965,719), l,4-benzodiazepin-2,5-diones (United States patent 5,962,337), cyclics (United States patent 5,958,792), biaryl amino acid amides (United States patent 5,948,696), thiophenes (United States patent 5,942,387), tricyclic Tetrahydroquinolines (United States patent 5,925,527), benzofurans (United States patent 5,919,955), isoquino
- the disclosed compositions can be used as targets for any molecular modeling technique to identify either the structure of the disclosed compositions or to identify potential or actual molecules, such as small molecules, which interact in a desired way with the disclosed compositions.
- the nucleic acids, peptides, and related molecules disclosed herein can be used as targets in any molecular modeling program or approach.
- CHARMm performs the energy minimization and molecular dynamics functions.
- QUANTA performs the construction, graphic modeling, and analysis of molecular structure.
- QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
- a number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57 (June 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol. Toxiciol.
- SEQ ID NO: 2 sets forth a particular sequence of an AR
- SEQ E) NO: 1 sets forth a particular sequence of the protein encoded by SEQ ID NO: 2, an AR protein.
- variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent homology to the stated sequence.
- the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
- hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
- Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
- the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
- selective hybridization conditions can be defined as stringent hybridization conditions.
- stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
- the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-25 0 C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm.
- the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989; Kunkel et al. Methods Enzymol. 1987:154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids).
- a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68 0 C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C.
- Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
- stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
- selective hybridization conditions are by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid.
- the non-limiting primer is in for example, 10 or 100 or 1000 fold excess.
- This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their kd, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their k d .
- Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation.
- selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 91, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended.
- Preferred conditions also include those suggested
- compositions and methods are used herein, as an example, to exemplify the disclosed compositions and methods. It is understood that the description related to this sequence is applicable to any sequence disclosed herein unless specifically indicated otherwise. Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences (i.e. sequences of AR). Primers and/or probes can be designed for any AR sequence given the information disclosed herein and known in the art. 3. Delivery of the compositions to cells
- compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non- viral based delivery systems.
- the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes.
- Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)).
- plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as Ab, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered.
- Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, ADDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus (MMLV) and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells.
- MMLV Murine Maloney Leukemia virus
- Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector
- Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells.
- Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature.
- a preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens.
- Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
- Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells.
- viral vectors contain nonstructural early genes, structural late genes, an RNA polymerase HI transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome.
- viruses When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material.
- the necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
- a retrovirus is an animal virus belonging to the virus family of Retro viridae, including any types, subfamilies, genus, or tropisms.
- Retroviral vectors in general, are described by Verma, I.M., Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference.
- a retrovirus is essentially a package which has packed into it nucleic acid cargo.
- the nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat.
- a packaging signal In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus.
- a retroviral genome contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell.
- Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serves as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome.
- a packaging signal for incorporation into the package coat a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serves as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the
- gag, pol, and env genes allow for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert. 130. Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line.
- a packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal.
- the vector carrying the DNA of choice When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
- viruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest.
- Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., MoL Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)).
- a viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line. In another preferred embodiment both the El and E3 genes are removed from the adenovirus genome.
- AAV adeno-associated virus
- This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans.
- AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred.
- An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
- the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell- specific expression operably linked to a heterologous gene.
- ITRs inverted terminal repeats
- Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus.
- the vectors of the present invention thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
- the inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements. (4) Large payload viral vectors
- herpes simplex virus (HSV) and Epstein-Barr virus (EBV) have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA.
- compositions can be delivered to the target cells in a variety of ways.
- the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro.
- the compositions can comprise, in addition to the disclosed AR, Rb,
- lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
- Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired.
- Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract.
- liposomes see, e.g., Brigham et al. Am. J. Resp. Cell. MoI.
- the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage. 142.
- delivery of the compositions to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LBPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD),
- nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (hnaRx Pharmaceutical Corp., Arlington, AZ).
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconiugate
- Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)).
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced.
- receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10(6) 399-409 (1991)).
- Nucleic acids that are delivered to cells which are to be integrated into the host cell genome typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral integration systems can also be incorporated into nucleic acids which are to be delivered using a non- nucleic acid based system of delivery, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
- Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on a sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art. c) In vivo/ex vivo
- compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject' s cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
- cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art.
- the compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes.
- the transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject. 4.
- the nucleic acids that are delivered to cells typically contain expression controlling systems.
- the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product.
- a promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site.
- a promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
- promoters controlling transcription from vectors in mammalian host cells may be obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter.
- the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)).
- the immediate early promoter of the human cytomegalovirus is conveniently obtained as a Hindi ⁇ E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360 (1982)).
- promoters from the host cell or related species also are useful herein.
- Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al., MoI. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)).
- Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression.
- Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- the promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function.
- Systems can be regulated by reagents such as tetracycline and dexamethasone.
- the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed, m certain constructs the promoter and/or enhancer region may be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time.
- a preferred promoter of this type is the CMV promoter (650 bases).
- Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTF.
- GFAP glial fibrillary acetic protein
- Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA.
- the identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs.
- the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct. b) Markers
- the viral vectors can include nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed.
- Preferred marker genes are the E. CoIi lacZ gene, which encodes ⁇ -galactosidase, and green fluorescent protein.
- the marker may be a selectable marker.
- suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin.
- DHFR dihydrofolate reductase
- thymidine kinase thymidine kinase
- neomycin neomycin analog G418, hydromycin
- puromycin puromycin.
- selectable markers When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure.
- These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media.
- An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements, individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
- the second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., JL Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al, MoI. Cell. Biol. 5: 410-413 (1985)).
- AR protein and gelsolin protein there are numerous variants of the AR protein and gelsolin protein that are known and herein contemplated.
- derivatives of the AR proteins which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.
- Immunogenic fusion protein derivatives are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross- linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion.
- Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule.
- These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
- substitution mutations at predetermined sites in DNA having a known sequence are well known, for example Ml 3 primer mutagenesis and PCR mutagenesis.
- Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues.
- Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions.
- Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
- an electropositive side chain e.g., lysyl, arginyl, or histidyl
- an electronegative residue e.g., glutamyl or aspartyl
- substitutions include combinations such as, for example, GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr.
- conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
- Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr).
- Deletions of cysteine or other labile residues also maybe desirable.
- Deletions or substitutions of potential proteolysis sites, e.g. Arg is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
- Certain post-translational derealizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o- amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C- terminal carboxyl.
- variants and derivatives of the disclosed proteins herein are through defining the variants and derivatives in terms of homology/identity to specific known sequences.
- SEQ JD NO: 2 sets forth a particular sequence of AR
- SEQ ID NO: 1 sets forth a particular sequence of an AR protein.
- variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence.
- the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
- each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence.
- one of the many nucleic acid sequences that can encode the protein sequence set forth in SEQ ID NO: 1 is set forth in SEQ ID NO:2. It is understood that for this mutation all of the nucleic acid sequences that encode this particular derivative of the AR are also disclosed. It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein within an organism, where particular variants of a disclosed protein are disclosed herein, the known nucleic acid sequences that encodes that protein are herein disclosed and described.
- compositions can also be administered in vivo in a pharmaceutically acceptable carrier.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art. 170.
- compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although topical intranasal administration or administration by inhalant is typically preferred.
- topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. The latter may be effective when a large number of animals is to be treated simultaneously.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism.
- compositions can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- the exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. 171.
- Parenteral administration of the composition, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al.,
- Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research. 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophvsica Acta. 1104:179-187, (1992)).
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced.
- receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene. DNA and Cell Biology 10:6, 399-409 (1991)). a) Pharmaceutically Acceptable Carriers
- compositions including antibodies, can be used therapeutically in combination with a pharmaceutically acceptable carrier.
- compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
- compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
- Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
- the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
- the disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally.
- Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable
- organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
- Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable. 180.
- compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid, glyco
- the dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected.
- the dosage should not be so large as to cause adverse side effects, such as unwanted cross- reactions, anaphylactic reactions, and the like.
- the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art.
- the dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
- compositions 182 Methods of making the compositions 182.
- the compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
- animals produced by the process of transfecting a cell within the animal with any of the nucleic acid molecules disclosed herein Disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the animal is a mammal. Also disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the mammal is mouse, rat, rabbit, cow, sheep, pig, or primate.
- ⁇ -Actin is a housekeeping gene and is universally expressed in every tissue; therefore, the ⁇ -Actin promoter driven Cre (ACTB-Cre; Jackson Laboratories, Bar Harbor, ME) will express and delete floxed AR fragments in all the tissues.
- the AR-/y mice were genotyped by PCR, as described previously (Yeh,S, et al. (2002) Proc Natl Acad Sd USA 99:13498-13503). Animals were housed in pathogen free facilities, maintained on a 12-hour light/dark schedule (light on at 0600) and had free access to standard laboratory chow (no. 5010; PMI Lab Diet, St. Louis, MO) and water.
- Serum tumor necrosis factor-alpha (TNF- ⁇ ) levels were determined in duplicate in 20 ⁇ l serum samples using a mouse TNF- ⁇ ELISA kit (eBioscience, San Diego, CA) according to the manufacturer's protocol.
- GTT glucose tolerance test
- mice were given an oral bolus of D-glucose (2 g/kg body weight) and the blood glucose concentration was measured in samples taken at 0, 30, 60, 90, and 120 min after the glucose bolus.
- An Insulin tolerance test (ITT) was performed on 6-h fasting mice by intraperitoneal injection of 1 U/kg body weight human insulin (Sigma-Aldrich, St. Louis, MO). Blood glucose concentration was determined at 0, 30, 60, 90, and 120 min after insulin administration.
- Triglyceride (TG) levels in serum from fasting animals were determined using the GPO-Trinder Assay (Sigma-Aldrich).
- Serum free fatty acid (FFA) levels in fasting animals were measured using NEFA-Kit-U (Wako Pure Chemical USA Inc., Richmond, VA).
- FFA serum free fatty acid
- tissue TG content 50-100 mg tissue pieces were homogenized on ice in pH 7.3 extraction buffer (20 mM Tris, 1 niM ⁇ -mercaptoethanol, 1 mM EDTA). Following centrifugation, the glycerol content of the supernatants was determined using the GPO-Trinder assay (Sigma- Aldrich) according to the manufacturer's instructions.
- Phosphoinositide-3-OH kinase (PI3K) activity (4) Phosphoinositide-3-OH kinase (PI3K) activity.
- mice were subjected to 14-h fast, injected intraperitonelly with saline or insulin (10 U per kg (body weight)) and sacrificed 3 min after injection. Tissues were collected and frozen. PI3K activity was measured in phosphotyrosine immunoprecipitates (p-Tyr, Ab-4; EMD Biosciences, Inc., San Diego, CA) from white adipose tissue (WAT), skeletal muscle, and liver lysates as previously described (Goodyear,LJ, et al. (1995) J Clin Invest 95:2195-2204).
- the medium was changed again 24 h after transfection, and the cells were treated with 1 nM of DHT or 1 ⁇ M of HF for 24 h. The cells were then harvested and whole cell extracts were used for CAT or Luc assay. The CAT activity was quantitated with a Phosphorlmager (Molecular Dynamics). The Luc assay was determined using a Dual-Luciferase Reporter Assay System (Promega) and luminometer. (6) Glutathione S-transferase (GST) pull-down assay
- the purified GST proteins were then resuspended in 100 ⁇ l of interaction buffer (20 mM HEPES/pH 7.9, 150 mM KCl, 5 mM MgCl 2 , 0.5 mM EDTA, 0.5 mM Dithiothreitol, 0.1% (v/v) NP-40, 0.1% (w/v) BSA and 1 mM PMSF) and mixed with 5 ⁇ l of [ 35 S]-labeled TNT AR protein in the presence or absence of 1 ⁇ M ligand at 4oC for 3 hours. After several washes with NETN buffer, the bound proteins were separated by SDS/8% PAGE and visualized using autoradiography. (7) Western Blot
- DUl 45 cells were transiently cotransfected with a GAL4-hybrid expression plasmid, a VP16-hybrid expression plasmid, the reporter plasmid pG5-CAT, and the pCMV- ⁇ -gal internal control plasmid. Transfections and CAT assays were performed as described above.
- mice were divided into 2 groups and were treated once daily with equal volumes of intraperitoneal injections of saline or mouse leptin (R&D Systems Inc., Minneapolis, MN) dissolved in saline at 5 /xg/g (body weight) doses for 6 days. Food intake and changes in body weight were measured to estimate the effects of exogenous leptin administration.
- MEF cell lines were self-immortalized following the 3T9 protocol. Briefly, primary WT and ARVy MEFs were isolated from E 12.5 littermate embryos and cultured in
- DMEM plus 10% (v/v) FBS DMEM plus 10% (v/v) FBS.
- MEFs were then plated at a density of 2.5 x 106 cells per 25 ml flask. Every 3 days, cells were gently trypsinized and re-plated at the same density. Cells were immortalized after 5 months of continuous culture.
- Mouse 3T3-L1 preadipocytes (CLl 73; ATCC, Manassas, VA), WT, and AR-/y MEF cell lines were maintained in DMEM containing 10% (v/v) FBS.
- the medium was changed to DMEM supplemented with 10% (v/v) FBS, 10 ⁇ g/ml insulin, 0.5 mM 3-isobutyl-l-methylxanthine, and 1 ⁇ M dexamethasone at 2 days after reaching confluence and then incubated with 10 nM DHT or 100 nM DHT and with or without hydroxyflutamide (HF).
- the media containing either of the drugs were renewed every other day.
- Each PCR reaction contained 1 ⁇ cDNA, 50 ⁇ M primers and 12.5 ⁇ iQTM SYBR green supermix reagent (Bio-Rad Laboratories) and was triplicated. 18s was used as an internal control.
- a list of the primer sequences for real-time PCR is available in Table 3.
- ACTB-Cre mice mice lacking AR in mixed C57BL/6/129Sv/FVB background were generated (Yeh,S, et al. (2002) Proc Natl Acad Sd U.S.A. 99:13498-13503).
- Male WT and knockout AR-/y mice were used for the present studies. Since the AR-/y mice were phenotypically female in appearance, female WT mice were also used as an additional comparison group for phenotypic analysis.
- the growth curves of male WT, female WT, and AR-/y mice showed that AR-/y mice exhibited a significant decrease in the body weight gain throughout the 20th week as compared to male WT mice (Fig. IA).
- Serum NEFA 0.25 ⁇ 0.02 0.25 ⁇ 0.02 0.71 ⁇ 0.04 $
- Serum cholesterol (mmol/1) 2.28 ⁇ 0.05 2.28 ⁇ 0.06 2.44 ⁇ 0.05
- mRNA from these tissues were further analyzed.
- the mRNA levels of four lipid metabolism genes, peroxisome proliferators-activated receptor gamma (PP AR ⁇ ), CCAAT/enhancer-binding protein alpha (C/EBP ⁇ ), adipocyte fatty acid binding protein/adipocyte P2 (aP2), and sterol regulatory element-binding protein Ic (SREBPIc) were higher in WAT of AR '/y as compared to WT mice (Table 5), indicating loss of AR can contribute to the increase of adipogenesis and lipogenesis via stimulation of several genes, such as lipid metabolism genes.
- estradiol is converted not only from estrone but also T, therefore it was also impossible to exclude another possibility that the abnormalities in AR "/y mice simply reflected less estrogen converted from T, but it was found that serum estradiol levels, as well as levels of the prohormone androstenedione remained unchanged in AR "/y mice compared to WT mice s O I
- TG total TG
- NEFA nonesteri ⁇ ed fatty acids for mice.
- the IR index is the product versus sham male WT.
- the marked hyperinsulinemia and hyperglycemia in AR "/y mice clearly demonstrate that loss of AR can reduce insulin sensitivity.
- a relatively small increase in body weight (-15%) is associated with a remarkable reduction in insulin sensitivity ( ⁇ 65%) in AR "/y mice, and insulin resistance that occurs as early as 20 weeks of age in non-obese AR "/y mice, indicating that loss of AR can directly reduce insulin sensitivity in target tissues without first increasing body weight significantly.
- the excess fat mass in AR '/y mice can be due to an impaired ability of skeletal muscle to use lipid as fuel substrate and of liver to catabolize lipid, leading to a shunting of lipid to adipose tissue.
- the unchanged food intake in AR "/y mice indicates that the excess weight gain and adiposity can be due to normal energy input coupled with reduced lipid oxidation and increased lipid storage.
- impairment in hepatic lipid oxidation resulted in elevated circulating FFA, and hepatic steotosis in PPAR ⁇ -null mice (Kersten,S, et al. (1999) J.Clin.Invest 103:1489-1498).
- PP ARa Activation of PP ARa by fibrates reduces adiposity in fa/fa Zucker diabetic fatty (ZDF) rats by the activation of several peroxisomal and mitochondrial fatty acid oxidation genes (Guerre- MiIIo 5 M, et al. (2003) J.Biol.Chem. 275:16638-16642). Given that skeletal muscle and liver are the major sites of lipid oxidation and deposition, respectively, it is possible that loss of PP ARo; could produce such an effect.
- skeletal muscle and hepatic insulin resistance in AR "/y mice can be secondary to altered release of adipokine.
- Leptin increased insulin sensitivity and concomitantly reduced TG content by promoting lipid oxidation in animal models of insulin resistance and in humans with lipodystrophic diabetes (Petersen,KF, et al. (2002) J.Clin.Invest 109:1345-1350).
- the AR-Iy mice with elevated leptin however, have significant leptin resistance when exogenous leptin is administered.
- PP ARa is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissues, hi PPAR ⁇ -null mice infused with adenovirus-leptin, up- regulation of carnitine palmitoyl transferase- 1 rnENA in fat, down-regulation of acetyl CoA carboxylase in liver, and up-regulation of PPAR ⁇ coactivator-1 alpha rnRNA in both tissues are abolished, as is the reduction in their TG content, indicating that leptin action may be mediated through PP ARa (Lee, Y, et al.
- AR-/y mice progressively develop leptin resistance and insulin resistance, resulting in obesity. This differs from the ob/ob and db/db mice that display early onset genetic obesity and have leptin inactivity from a very early stage (Tschop,M, and Heiman,ML. (200I) E*/?. Clin. Endocrinol. Diabetes. 109:307-319). ARrIy mice have milder obesity due to the late onset of leptin and insulin resistance. However, leptin resistance in AR-/y mice that is similar with db/db mice, whereas dysfunctional leptin receptor is likely to be a major factor.
- AR "/y mice not only have an AR deficiency but also have decreased serum levels of androgens.
- treatment with nonaromatizable DHT restored the physiological serum DHT levels, whereas estrogen levels remained unchanged as compared to WT mice.
- ERa estrogen receptor alpha
- AR mice provide an in vivo model showing that loss of AR increases serum leptin concentration and skeletal muscle/hepatic TG content, which can result in the development of obesity, leptin resistance, and insulin resistance.
- obesity and progressive insulin resistance can lead to type 2 diabetes and an increased risk of cardiovascular diseases (Fernandez-Real,JM, and Gört,W (2003) Endocr Rev 24:278- 301), a better understanding of the molecular mechanisms involved, and dissection of the roles of A-AR in insulin and leptin resistance can help in the development of better therapeutic approaches to type 2 diabetes, obesity, and other cardiovascular diseases.
- hepatic androgen receptor (AR) hepatic androgen receptor
- AlC y ' mice hepatic AR knockout mice were generated by crossbreeding floxAR mice with albumin-Cre mice.
- the AR ⁇ " y ' mice showed similar growth curve to wild-type mice ( Figure IA-B.
- HFD high-fat diet
- AR (L"/y) mice exhibit greater cumulative weight gain and increased serum glucose levels while being fed on a HFD for 24, 36, and 52 weeks (Figure 5C-F). AR (L"/y) mice were also marked by increase fat vacuoles in the liver ( Figure 6). Additionally, compared with WT mice, AR ⁇ mice on a HFD displayed more hepatic steatosis, and a type 2 diabetes phenotype, characterized by hypertriglyceridemia, hyperinsulinemia, hyperglycemia, and insulin resistance possibly due to a decreased insulin-mediated PI3K activation (Figure 7, Figure 8, and Table 8).
- GTT Glucose tolerance test
- IR insulin resistance
- the mRNA levels of the gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and hepatic nuclear factor-4 alpha were upregulated in livers of ABS Uy ⁇ mice as compared with wt mice fed with high-fat diet.
- Loss of hepatic AR increased sterol regulatory element-binding protein- Ic, a key regulator of lipogenic gene transcription, and its downstream target mRNAs, as well as increased hepatic lipid accumulation. Loss of hepatic AR was also associated with a decrease in peroxisomal proliferator-activated receptor alpha mRNA expression, and a trend toward decreased fatty acid /3-oxidation.
- Haluzik,M, Gavrilova,O, LeRoith,D Peroxisome proliferator-activated receptor-alpha deficiency does not alter insulin sensitivity in mice maintained on regular or high-fat diet: hyperinsulinemic-euglycemic clamp studies. Endocrinology 145:1662-1667, 2004
- Heine,PA, Taylor, JA, Iwamoto,GA, Lubahn,DB, Cooke,PS Increased adipose tissue in male and female estrogen receptor-alpha knockout mice.
- Heinlein,CA, Chang,C Induction and repression of peroxisome proliferator-activated receptor alpha transcription by coregulator ARA70. Endocrine. 21 : 139-146, 2003
- Hotamisligil,GS, Johnson,RS, Distel,RJ, Ellis,R, Papaioannou,VE, Spiegelman,BM Uncoupling of obesity from insulin resistance through a targeted mutation in aP2, the adipocyte fatty acid binding protein. Science 274:1377-1379, 1996
- Hotamisligil The role of TNFalpha and TNF receptors in obesity and insulin resistance. J Intern Med 245:621-625, 1999
- Aromatase-deficient mice have a phenotype of increased adiposity. Proc. Natl. Acad. Sd. U.S.A 97:12735-12740, 2000
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Environmental Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Toxicology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biodiversity & Conservation Biology (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Endocrinology (AREA)
- Animal Husbandry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Animal Behavior & Ethology (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Food Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Disclosed are compositions and methods for related to diabetes and coronary heart disease.
Description
INSULIN AND LEPTIN RESISTANCE WITH HYPERLEPTINEMIA IN MICE LACKING ANDROGEN RECEPTOR
1. This application claims the benefit of U.S. Provisional Application No. 60/642,129 filed January 7, 2005, which is incorporated herein by reference in its entirety. 2. This application was made with government support under federal grants NlH
DK60905 and DK60948 awarded by the NIH. The Government has certain rights to this invention.
I. BACKGROUND OF THE INVENTION
3. Androgen receptor (AR) is a member of the steroid hormone superfamily of nuclear receptors. Androgen receptor has been implicated in many cancers in an androgen dependent way. Disclosed herein androgen receptor is also involved in the development of Type π Diabetes and coronary heart disease (CHD). Furthermore, while antiandrogens, such as hydroxyflutamide have been used to treat AR dependent cancers for many years, these same treatments can increase the factors that contribute to Type π Diabetes and CHD. The disclosed molecules and their interactions between androgen receptor, as well as the information that androgen receptor can have effects on Type II Diabetes and CHD provide for methods of identifying compositions which modulate or mimic this activity, as well as methods of modulating AR activity itself, as well as treatments and modulation of these diseases and the effects of these diseases. II. SUMMARY OF THE INVENTION
4. In accordance with the purposes of this invention, as embodied and broadly described herein, this invention, in one aspect, relates to Type II Diabetes and Coronary Heart Disease (CHD) and related diseases and conditions.
5. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.
III. BRIEF DESCRIPTION OF THE DRAWINGS
6. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the invention and together with the description, serve to explain the principles of the invention.
7. Figure 1 shows that AR"/y mice developed excess adiposity. Figure IA shows that the growth curves of mice were determined at indicated time points between the ages
of 5 and 40 weeks. Values are mean ± SE from 9-10 mice per group. *P < 0.05, **P < 0.01, AR"/y versus male WT. Figure IB shows the epididymal and perirenal fat pads isolated from 35-week-old mice (upper panel). Sections of WAT (white adipose tissue) are shown at 4Ox magnification (lower panel) of 35-week-old mice, scale bar, 200 μm. C: Distribution of cell size of epididymal WATs from 35-week-old mice.
8. Figure 2 shows that AR" y mice are insulin resistant, and glucose intolerant. Figure 2A shows the GTT (glucose tolerance test) (oral bolus 2 mg/g body weight) of 35- week-old mice after 14-h fast. Figure 2B shows the AUC analysis of GTT. Figure 2C shows the ITT (insulin tolerance test ) (intraperitoneal 1 U/kg body weight) of 25-week-old mice. Figure 2D shows the ITT (intraperitoneal 1 U/kg body weight) of 35-week-old mice. Values are mean ± SE from 5-6 mice per group. *P < 0.05, **P < 0.01, ***P < 0.001, AR" /y versus male WT. Figure 2E shows that in vivo PI3K activity was measured in phosphotyrosine immunoprecipitates prepared from skeletal muscles, adipose tissues, and livers from 14-h fast of 35-week-old mice. Tissues were collected 3 min after intraperitoneal injection of insulin or isotonic saline. The results were quantified by
PhosphoLnaging. Values are representative of 3 mice of each group. **P < 0.01, AR"/y with insulin versus WT with insulin. Figure 2F shows the skeletal muscles and livers that were removed from 35-week-old, ad libitum-fed mice. Values of each group were converted into milligrams of TG (triglyceride) per gram of tissue (wet weight) after comparison with a glycerol standard. Values are mean ± SE from 5 mice per group. ***P < 0.001, AR"/y versus WT.
9. Figure 3 shows the Effects of AR deficiency on adipocyte-derived adipokine. Figure 3A shows the fed leptin concentrations in 8-, 25-, or 35-week-old mice. Figure 3B shows the relationship between fed leptin concentrations and body weight of 35-week-old mice. Figure 3 C shows the adiponectin concentrations in 35-week-old mice. Figure 3D shows the TNF-α concentrations in 35-week-old mice. Values are mean ± SE from 5 mice per group. *P < 0.05, **P < 0.01, AR"/y versus WT; N.S., no significance. Li D, n = 8 for WT mice and n = 7 for AR"/y mice. Regression lines for both groups are shown.
10. Figure 4 shows that Aging AR" y mice developed leptin resistance but not younger mice. Two groups of 35-week-old mice or 20-week-old mice received an intraperitoneal injection of either leptin (5 μg/g body weight) or isotonic saline. Figure 4A shows the food intake per 24-h of 35-week-old mice. Figure 4B shows the weight changes
per 24-h of 35 -week-old mice. Figure 4C shows the food intake per 24-h of 20-week-old mice. Figure 4D shows the weight changes per 24-h of 20-week-old mice. Values are mean -t SE from 3-4 mice per group. *P < 0.05, WT with leptin versus control; f P < 0.05, leptin treatment versus control; y-fP < 0.001, leptin treatment versus control; N.S., no significance.
11. Figure 5 shows the recombination of AR-loxP allele in the liver of AR(L"/y) mice, growth curve, cumulative weight gain, and serum glucose in WT and AR(L"/y) mice on high fat diet (HFD). Mice were given HFD from 8 weeks as described in Methods. Figure 5(a) shows the detection of intact (wt) versus recombined (ko) allele and SIp by RT- PCR from liver. Figure 5(b) shows the body weight and (c) cumulative weight gain on
HFD of the animals measured weekly. Also shown are fasting serum glucose levels (d) at 24 weeks, (e) at 36 weeks, and (f) at 52 weeks on HFD of the animals.
12. Figure 6 shws the fat accumulation in the liver of treated WT and AR(Wy) mice on HFD. Figures 6(a-b) show images of gross appearance and H&E staining of liver sections of WT mice treated with the normal chow (a), HFD (b), AR(Wy-* mice with normal chow (c), and HFD (d) at 16 weeks for 8 weeks. The clear vacuoles in the liver section are identified by arrows in b and d.
13. Figure 7 shows that fed HFD in AR(L"/y) mice results in defects in glucose homeostasis. Figure 7(a) shows that glucose tolerance tests were performed. Blood samples were collected and glucose measured at the times indicated. Results represent blood glucose concentrations are expressed as mean ± SEM. Figure 7(b) shows the serum insulin concentration at the times indicated. Figure 7(c) shows PI3K activity in PY- immunoprecipitates, and a representative ρhosphatidylinositol-(3,4,5) trisphosphate (PIP3) level. Bars represent mean ± SEM. Figure 7(d) show the serum insulin concentration at 24 weeks.
14. Figure 8 shows decreased adiponectin, increased FFA, and leptin levels in AR(L" /y) mice. Figure 8(a) shows serum free fatty acid levels in random-fed mice. Figure 8(b) shows serum cholesterol levels in random-fed mice. Figure 8(c) shows serum adiponectin levels of random-fed mice. Figure 8(d) shows serum leptin levels of random-fed mice. Bars represent mean ± SEM.
IV. DETAILED DESCRIPTION
15. The present compositions and methods maybe understood more readily by reference to the following detailed description of preferred embodiments and the Examples included therein and to the Figures and their previous and following description.
16. Before the present compounds, compositions, articles, devices, and/or methods are disclosed and described, it is to be understood that the compositions and methods are not limited to specific synthetic methods, specific recombinant biotechnology methods unless otherwise specified, or to particular reagents unless otherwise specified, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. 17. It is estimated that by the year 2030 there will be approximately 366 million people affected by type 2 diabetes in worldwide (WiId5S, et al. (2004) Diabetes Care 27:1047-1053) with many of those affected in the elderly age group {Diabetes Care 21 :296- 309, 1998). Although the primary factors causing this disease are elusive, insulin resistance and leptin insensitivity may play a major role in its development (Saad, MF5 et al. (1989) Lancet 1:1356-1359).
18. Epidemiological evidence suggests that gender differences exist in the type 2 diabetes. The prevalence of type 2 diabetes is higher in men than women (Wild, S5 et al. (2004) Diabetes Care 27:1047-1053), possibly due to the differences in insulin sensitivity and regional body fat deposition (GaIe5EA, and Gillespie,KM. (2001) Diabetologia 44:3- 15; Livingstone5C, and Collison,M. (2002) Clin.Sci.(Lond) 102:151-166). The detailed mechanisms of how sex hormones influence the insulin sensitivity or fat deposition, however, remain unclear. Testosterone and its metabolite, dihydrotestosterone (DHT)5 can activate androgen receptor (AR) to exert their androgenic actions. The proper or maximal androgen (A) action typically requires interaction with selective coregulators in selective tissues (Chang,CS, et al. (1988) Science 240:324-326; Heinlein,CA, and Chang,C. (2002) Endocr.Rev. 23:175-200).
19. Leptin, the adipocyte-derived adipokine product of the ob gene, has been shown to induce a negative energy balance by reducing appetite and increasing energy expenditure (Friedman, JM5 and HalaasJL. (1998) Nature 395:763-770). Leptin circulates in serum at levels that parallel the mass of body fat. However, obese individuals have been found to be resistant to the negative regulatory function of circulating leptin (Hamilton, BS5 et al. (1995) Nat Med 1 :953-956). The ob/ob and db/db mice that lack leptin or are leptin
resistant, respectively, are profoundly hyperphagic and hypometabolic, leading to an obese phenotype, and manifest numerous abnormalities, such as type 2 daibetes with severe insulin resistance, hypothermia and cold intolerance, infertility, and decrease in lean mass (Burks, DJ, et al. (2000) Nature 407:377-382; Chen, H, et al. (1996) Cell 84:491-495; Chua, SCJ, et al. (1996) Science 271 :994-996; Hausberg,M, et al. (2002) Diabetes 51:2434-2440; Lee,GH, et al. (1996) Nature 379:632-635).
20. Herein is described a conditional knockout strategy that was used to generate AR knockout mice (AR"/y) (Yeh,S, et al. (2002) Proc Natl Acad Sci U S A 99:13498- 13503). Disclosed herein are the influences of loss of AR on insulin and leptin resistance, and methods and compositons which arise from this connection of AR to the insulin and leptin resistance pathways. A. Definitions
21. As used in the specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.
22. Ranges can be expressed herein as from "about" one particular value, and/or to "about" another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed that "less than or equal to" the value, "greater than or equal to the value" and possible ranges between values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value "10" is disclosed the "less than or equal to 10"as well as "greater than or equal to 10" is also disclosed. It is also understood that the throughout the application, data is provided in a number of different formats, and that this data, represents endpoints and starting points, and ranges for any combination of the data
points. For example, if a particular data point "10" and a particular data point 15 are disclosed, it is understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15 are considered disclosed as well as between 10 and 15.
23. In this specification and in the claims which follow, reference will be made to a number of terms which shall be defined to have the following meanings:
24. "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.
25. "Primers" are a subset of probes which are capable of supporting some type of enzymatic manipulation and which can hybridize with a target nucleic acid such that the enzymatic manipulation can occur. A primer can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art which do not interfere with the enzymatic manipulation.
26. "Probes" are molecules capable of interacting with a target nucleic acid, typically in a sequence specific manner, for example through hybridization. The hybridization of nucleic acids is well understood in the art and discussed herein. Typically a probe can be made from any combination of nucleotides or nucleotide derivatives or analogs available in the art.
27. "Decrease" refers to lower or less than and typically in reference to a control or other embodiment. For example, a level of a subject activity can be decreased either in reference to a control level of activity, the activity of a control performed in parallel with the subject activity, or the activity of a second subject activity.
28. "Increase" refers to higher or more than and typically in reference to a control or other embodiment. For example, a level of a subject activity can be increased either in reference to a control level of activity, the activity of a control performed in parallel with the subject activity, or the activity of a second subject activity.
29. Throughout this application, various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this pertains. The references disclosed are also individually and specifically incorporated by reference herein for the material contained in them that is discussed in the sentence in which the reference is relied upon.
B. Compositions and Methods
1. Models for diabetes and heart disease
30. Androgen Receptor (AR) activity is shown herein to have a profound effect on leptin sensitivity (resistance), insulin resistance, glucose resistance, triglyceride levels, high-density lipoprotein levels (HDL), and low-density lipoprotein (LDL) levels. Specifically, it is disclosed herein, that a decrease in AR activity results in increased insulin, glucose, and leptin resistance, increased HDL levels, increased uric acid, and decreased LDL levels. Thus, decreased AR activity can play a prime role in the development of Type II diabetes as well as coronary heart disease. 31. It is shown herein that animals which lack functional AR, such as an AR knockout animal have leptin sensitivity (resistance), insulin resistance, glucose resistance, triglyceride levels, increased HDL, and decreased LDL levels. These animals are shown herein as a model or part of a model for Type II diabetes.
32. Disclosed are models for type II diabetes that comprise an animal which is an AR knock out as well as models comprising an AR knock out animal and a particular assay, condition, or state, which is related to diabetes or heart disease, such as Type II diabetes, as well as animals that have a particular level of blood glucose as controlled, by for example, having been fed or fasted for a particular period of time. Thus, for example, disclosed are compositions as models for type II diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes. a) Androgen receptor knockouts
33. For example, an AR knock out animal is any animal with a disrupted AR loci or gene. Disclosed are methods of generating a cell line wherein the AR loci has been disrupted. For example, the AR loci can be disrupted by, for example, disrupting one of the exons, such that a stop codon terminates translation of the AR peptide early or where the exon is completely taken out. The AR loci would include any exon or intron associated with the AR gene on the X chromosome.
34. The AR gene is considered any sequence associated with the AR locus. Thus, it would at least include the chromosomal nucleic acid contained within any organism that expresses an AR, such as, the introns, exons, 5' upstream sequence involved with the AR
coding and non-coding sequence, and 3' downstream sequence involved with the AR coding and non coding sequence.
35. A disrupted AR loci can be any AR loci that does not produce a native AR protein. A disrupted AR loci would also include any AR loci wherein the nucleic acid of the natural AR gene, including exons and introns has been altered. Typically the altering of the AR gene will cause a disruption in AR function, by for example, preventing DNA binding in the AR gene product or ligand binding in the AR gene product or transactivating activity in the AR gene product. The disrupted AR loci can be made using any known technique, including homologous recombination techniques. The disrupted loci can be an alteration of any exon to produce a non-functional AR protein. Furthermore, disclosed are constructs and methods to mutate any exon in the AR through homologous recombination via the surrounding introns.
36. The AR knock outs can be produced so that they are conditional, by for example, being dependent on recombinase activity, such as Cre. For example, as disclosed herein, the Cre-lox system has been successfully used herein to generate AR knockout mice (ARKO). This principle has been successfully applied for tissue-specific transgene expression (Orban PC, 1992), for site specific gene targeting (Gu, 1994) and for exchange of gene sequence by the "knock-in" method (Hank M, 1995). Thus, for example, the ARKO animal can have a liver-specific knock out by using the albumin promoter. It is understood and herein contemplated that other ARKO animals can be used utilizing other tissue specific promoters known in the art. Disclosed herein, the system has been applied to avoid the infertility problem of male carriers of an ARKO. This strategy has been used to generate a knock-out model for those genes that are located in X or Y chromosomes and are critical in fertility. For example, exon 1 can be floxed through addition of a lox site in sequence that will homologously recombine with Ihtron 1 and inron 2. Likewise lox sites could be inserted into sequence which would homologously recombine with intron 2 and intron 3 for exon 2, intron 3 and intron 4 for exon 3, intron 4 and intron 5 for exon 4, intron 5 and intron 6 for exon 5, and so forth for each exon which are considered disclosed herein.
37. The disrupted AR loci can be in any cell that contains an AR loci, such as an embryonic stem cell, an embryonic germ cell, a breast cell, a breast cancer cell, an ovary
cell, an ovary cancer cell, and any cell line of cells that contain AR genes which are expressed, such as prostate cells, testis, bone, brain, neural, and muscle.
38. The ARKOs can be in any cell or in any animal, such as a rat, mouse, non- human primate (including but not limited to monkey and chimpanzee), rabbit, porcine, ovine, or bovine. Thus, it is understood that the ARKO can be in any mammal. They can be used via any technique and the animals produced as well as their progeny are disclosed.
39. Disclosed are methods of making a model for type II diabetes comprising a) generating a mouse with an AR gene or necessary portion thereof for AR actvity, between two loxP sites, b) generating a mouse with Cre recombinase under the control of a β-actin promoter (ACTB Cre+) and heterozygous for the AR gene, and c) mating a female ACTB Cre+ mouse with and ARloxP mouse creating an AR Cre-lox mouse. Although a Cre-loxP system is described herein to create the model, it is understood and herein contemplated that any inducible promoter system such as the FIp recombinase and the tetracycline inducible promoter system, may be used in place of the Cre-loxP inducible promoter system. Also disclosed are methods of generating a model for type II diabetes comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of type II diabetes.
40. Also disclosed are methods of making a model for Coronary Heart Disease (CHD) comprising a) generating a mouse with an AR gene or necessary portion thereof for activity, between two loxP sites, b) generating a mouse with Cre recombinase under the control of a β-actin promoter (ACTB Cre+) and heterozygous for the AR gene, and c) mating a female ACTB Cre+ mouse with and ARloxP mouse creating an AR Cre-lox mouse. Also disclosed are methods of generating a model for Coronary Heart Disease (CHD) comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of coronary heart disease. b) Assays, conditions, or states related to diabetes
41. Often the models include an assay or a condition or a state that is related to diabetes which is either monitored or tested, for example. For example, a model could include the ARKO animal disclosed herein, along with a state the animal is put into, such as a fed state or a fasting state for a period of time. It is understood and herein contemplated that periods of fasting can occur for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours prior to assay. It is also understood that
feeding can occur within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours of the assay period. This can, for example, produce conditions which mimic a Type II diabetic situation. Thus, disclosed herein are models for Type π diabetes comprising an androgen receptor knockout animal and an assay for type π diabetes, wherein the assay is performed on an animal that fasted for at least 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 hours or any number of hours in between. It is also understood that feeding can occur after a period of fasting. Thus, for example, the animal can be put into a fed state 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours prior to the assay period following 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours of fasting. In another model, the ARKO animal can have its blood glucose level tested or an insulin tolerance test (ITT) or glucose tolerance test (GTT) can be performed. Thus, for example, specifically disclosed are models for Type π diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes, wherein the assay for Type II diabetes comprises an insulin tolerance test (ITT). Also disclosed are models for Type II diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes, wherein the assay for Type II diabetes comprises a glucose tolerance test (GTT). In yet another model, the ARKO animal can have its leptin levels monitored or tested, or its triglyceride or HDL or LDL levels monitored or tested. Fatty acids, triglycerides, and cholesterol can also be measured. These and other tests can be performed using, for example, and ELISA procedure. These tests can be performed as disclosed in the Examples or using any known method for testing same. For example, C- reactive peptide (CRP), a marker for CHD, can be assayed by Elisa method. Adiponectin and Resistin, markers for Diabetes, also can be assayed by Elisa method. It is understood that these and other types of tests can also be performed on a subject to determine if they have a particular disases condition, even if they are not an ARKO mouse, such as a human.
2. Use of the diabetes and CHD models
42. It is understood that the disclosed models can used in a variety of ways. For example, the models can be used to test the effect a particular composition, such as a potential drug for Type II diabetes, has on the knockout animal. The effect a composition has on the model can be determined using one or more of the assays disclosed herein alone or in combination. The models can also be used to screen libraries of compounds to identify molecules having a particular effect on the model animal. Molecules having the
desired effect can be identified and further synthesized or tested for example. The models can also be used to test existing pharmaceuticals to see what their effect is the disclosed models. The information gained from perfoming tests on existing pharmaceuticals, for example, can be used to make treatment decisions regarding that particular composition or one could make the decision to start other therapies in conjunction with that composition, if for example, the composition had a negative effect in the Type II diabetes model, one might look for a combination therapy for Type II diabetes or one might further choose to monitor diabetic indicators, such as glucose levels or insulin resistance, when taking that particular pharmaceutical. Thus herein disclosed are methods for screening drugs for an effect on Type II Diabetes comprising administering the drug to an androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can treat Type II Diabetes. It is understood that other characteristics of type II diabetes can also be measured, for example, the amount of leptin produced (Note: any other characteristic test of type II diabetes can be used and is herein contemplated). Thus, for example, disclosed herein are are methods for screening drugs for an effect on Type II
Diabetes comprising administering the drug to an androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can treat Type II Diabetes, further comprising performing an assay for a characteristic of type II diabetes. It is also understood herein that a control may be used as a basis for assessing the effect of a composition being screened. Thus, specifically contemplated herein are methods of testing a composition for its effect on Type II diabetes comprising administering the composition to an androgen receptor knockout animal, and performing an assay related to Type II diabetes, wherein a change in the assay relative to a control indicates the compound has an effect on Type II diabetes. Also disclosed are methods for screening drags for an effect on CHD comprising administering the drug to an Androgen deficient mouse and assaying for AR activity, wherein a increase in AR activity indicates a drug that can be used to treat CHD.
3. Methods of diagnosis and prognosis 43. The information that lack of androgen receptor leads to characteristics and conditions related to diabetes, such as Type II diabetes, and CHD indicate that a variety of screening and testing methods are disclosed related to subjects and the presence of or likelihood to have or get diabetes, such as Type II diabetes, or CHD.
44. For example, subjects who have diabetes or Type II diabetes or CHD can have their AR activity tested. To test a human subject's AR activity, one could indirectly assay the serum levels of Testosterone or 5-alpha-dihydrotestosterone. Besides, one could assay the number of CAG repeats of AR in subject, which is inversely correlated with AR activity. AR activity can also be performed using methods as described herein, for example, for assaying AR activity in tissue or cell samples from mice disclosed herein. An AR activity lower than that of a control would indicate that the diabetes or CHD of the subject could be due to the loss of AR activity. Steps could then be taken, as discussed herein, to elevate the activity of the AR activity to help alleviate or reduce the diabetes or CHD. In another sitruation, a subject could have their AR activity tested. If their AR activity is low relative to a control, for example, then this could be a risk factor for acquiring diabetes or CHD in the future, such as a family history, is a risk factor, hi this type of situation, the subject could, for example, begin life style changes or perform other types of preventative activities, if they were found to be at risk for diabetets or CHD based on low AR activity.
45. Furthermore, the techniques and methods disclosed herein can be used to assess the likelihood a subject will develop a condition due to decreased AR activity. Thus, disclosed are methods for diagnosing the likelihood of a subject to develop Type II Diabetes comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates Type II Diabetes. It is understood that subjects with decreased AR activity can have increased leptin resistance and increased insulin resistance. Therefore, it is understood and herein contemplated that a subject with decreased AR activity will likely develop Type II diabetes. One measure of AR activity would be to assay the expression of AR dependent genes in the sample. Another measure of AR acivity comprises assaying the amount of AR present in the sample. Similarly, the disclosed methods can be used to diagnose the likelihood a subject will develop coronary heart disease CHD. Thus also disclosed are methods for diagnosing the likelihood of a subject to develop CHD comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates CHD. It is understood and herein contemplated that subjects with decreased AR activity can have increased uric acid levels, increased HDL, and decreased LDL, all of which contribute to CHD. It is also understood that a subject can be a cell, mammal, mouse, or human.
46. The disclosed methods can also be used to diagnose a condition. Thus disclosed are methods of diagnosing a subject with Type II diabetes comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates Type π diabetes. Also discosed a method of diagnosing a subject with CHD comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates CHD. It is understood that various tissue samples can be used with the disclosed methods. Specifically disclosed are methods, wherein the tissue sample is blood, white adipose tissue (WAT), liver tissue, or skeletal muscle.
47. It is also understood that the information disclosed herein indicates that individuals receiving androgen ablation therapy should be monitored for diabetic or CHD types of conditions, and preventative efforts for each of these are indicated for those undergoing androgen ablation therapy or have androgen receptor deficiencies. Thus, a subset of subjects upon whom the types of assays and tests disclosed herein should be performed on, are those receiving androgen ablation therapy or have androgen receptor deficiencies. Thus, also disclosed herein are methods of testing a subject for Type II diabetes comprising performing an assay for Type II diabetes wherein the subject has an androgen receptor deficiency or has had androgen ablation therapy.
48. Androgen ablation thereapy is a commonly used method of treating cancer and in particular prostate cancer. However, as disclosed herein, the diminishment of AR activity can have dramatic consequences in the patient. For example, the patient can develop leptin resistance and insulin resistance which are two of the main components of Type π Diabetes. Also, decreased AR activity can lead to increased high density lipoproteins, increased uric acid output, and decreased low-density lipoproteins associated with CHD. A patient being treated for cancer with an androgen ablatement regimin can develope secondary problems associated with the treatment that left unchecked can put the patients life at risk. Therefore, a patient that developes Type II diabetes or CHD while under treatment with androgen ablatement therapy can be assessed to determine if AR is the reason for the developing Type II diabetes or CHD. IfAR activity is decreased in the patient and tests indicate that diabetes or CHD is a problem, a new treatment can be prescribed to avoid complications associated with Type II diabetes and CHD. Disclosed are methods for evaluating whether a treatment with a compound should be performed due to the effect the treatment has on Type II diabetes, wherein the compound modulates the
androgen activity, the method comprising a) exposing cells to the compound, and b) evaluating androgen activity in the presence of the compound, wherein a change in the androgen activity of the subject, relative to the androgen activity of a subject that has not been exposed to the compound, indicates that the compound modulates androgen activity, 5 and wherein a decrease in androgen activity indicates a negative effect on Type II Diabetes, providing an indication that treatment with the compound may not be indicated.
49. Also disclosed are methods for evaluating whether a treatment with a compound should be performed due to the effect the treatment has on CHD, wherein the compound modulates the androgen activity, the method comprising a) exposing a subject Q to the compound, and b) evaluating androgen activity in the presence of the compound, wherein a change in the androgen activity of the subject, relative to the androgen activity of a subject that has not been exposed to the compound, indicates that the compound modulates androgen activity, and wherein a decrease in androgen activity indicates a negative effect on CHD, providing an indication that treatment with the compound may not 5 be indicated.
4. Treatments for diabetes and CHD
50. Due to the effects of AR activity on prinicipal activities (e.g., leptin resistance, insulin resistance, increased HDL) associated with Type II dabetes and CHD, agents that can increase AR activity can be used to treat these conditions, herein called AR activators. Q AR activators can be any molecule discussed herein as increasing AR activity including coactivators and androgen receptor ligands and anlogs as discussed herein and understood. Thus disclosed are methods of administering an AR activator to a subject having diabetes, such as Type I or Type π, or CHD, or one or more of the symptoms or characteristics of these, such as those disclosed herein. Also disclosed are methods wherein the subject has j been diagnosed as having diabetes, such as Type I or Type π, or CHD, or one or more of the symptoms or characteristics of these, such as those disclosed herein. Furthermore disclosed are methods of treating diabetes, such as Type I or Type π, or CHD, or one or more of the symptoms or characteristics of these, such as those disclosed herein or decreasing or inhibiting diabetes, such as Type I or Type II, or CHD, or one or more of the Q symptoms or characteristics of these, such as those disclosed herein. Also disclosed are
methods wherein the subject has been shown to have a reduced amount of AR activity. Also disclosed are methods wherein the subject has been shown to have reduced levels of testosterone or one of its precursors or metabolites or molecules in the testosterone synthesis pathway as disclosed herein. A reduced level can be determined by either comparing the amount of the testosterone or one of its precursors or metabolites or molecules in the testosterone synthesis pathway in a subject and comparing it to the amount that had been present in the subject at a prior determination of the same. A reduced level can also include a comparison of the level of testosterone or one of its precursors or metabolites or molecules in the testosterone synthesis pathway in a subject to a known standard or average amount for the same. For example, average levels of testosterone for males can be 300-l,000ng/dl or 300-1, 100ng/dl. Average testosterone levels in women can be about 10 times lower, such as between 15-70 ng/DL for women aged 20-39 and between 4-70 ng/dL for women aged 40-59.
51. Disclosed are methods of treating a subject with Type π Diabetes comprising administering to the subject an agent that modulates AR activity, wherein an increase in
AR activity reduces Type II Diabetes. Also disclosed are methods of treating a subject with CHD comprising administering to the subject an agent that modulates AR activity, wherein an increase in AR activity reduces CHD. It is understood that agent for treating CHD or Type II diabetes can include hormones such as testosterone and DHT. Thus, dpecifically disclosed are methods of treating a subject with Type II diabetes or CHD, wherein the agent comprises testosterone or CHD. There are number of compositions which act as AR coactivators/coregulators including ARA24, ARA54, ARA55, ARA70, ARA267, gelsolin, and supervillian. A discussion of these co-regulators can be found in United States Patent Application Nos. 60/387,087 filed on June 6, 2003, 60/093,239 filed on July 17, 1998, 60/100,243 filed on September 14, 1998, and 09/354,221, filed on July 15, 1999, as well as PCT application no. PCT/US03/17937, all of which are herein incorporated by reference at least for material related to co-activators or modulators of AR. a) AR domains
52. Compared to the quite conserved DBD and LBD, the N-terminus is quite polymorphic in terms of sequence and length between NRs. The N-terminus is more likely to provide unique surfaces to recruit distinct factors that contribute to the specific action of
a certain NR. The AR has a large N-termius (ARN) and there are two distinct regions important for its transactivation function residing within the ARN: residues 141-338, which are required for full ligand-inducible transactivation, and residues 360-494, where the ligand-independent activation function-1 (AF-I) region is located (Heinlein, C.A., et al. 2002. Endocr. Rev. 23 : 175-200). Coactivators and corepressors have been identified to interact with ARN (Hsiao, P., et al. 1999. J Biol. Chem. 274:22373-22379, Hsiao, P., et al. 1999. J. Biol. Chem. 274:20229-20234, Knudsen, K.E., et al. 1999. Cancer Res. 59:2297- 2301, Lee, D.K., et al. 2000. J. Biol. Chem. 275:9308-9313, Markus, S.M., et al. 2002. MoI. Biol. Cell 13:670-682, Petre, C.E., et al. 2002. J. Biol. Chem. 277:2207-2215). Furthermore, although ARN extends to more than one half of the full length protein, its associated proteins are relatively fewer compared to those associated with AR DBD and AR LBD, presumably due to the existence of the AF-I region which limits the application of conventional yeast-two hybrid system by using ARN as bait. It's likely there are still more ARN associated proteins remaining to be identified. 53. AR is classified with glucocorticoid receptor (GR), mineralocorticoid receptor and progesterone receptor (PR) as one group within the nuclear receptor (NR) superfamily, since they share high homology in the DBD and recognize very similar hormone response elements (Forman, B.M. et al. 1990. MoI. Endocrinol. 4:1293-1301, Laudet, V., et al. 1992. EMBO J. 11 : 1003-1013). However, the physiological responses mediated by these receptors upon cognate ligand activation are quite distinct and hormone specific.
Apparently, these cannot be explained by a specific DNA-binding through the DBD. Factors located outside the DBD may play a key role in determining the specific hormone responses. b) Androgen receptor signalling 54. Androgen exerts its effects via the intracellular AR, a member of the superfamily of nuclear receptors (Chang, C. S., et al. (1988) Science 240 (4850), 324-6, Mangelsdorf, D. J., et al. (1995) Cell 83 (6), 835-9). Upon androgen binding, AR dissociates from the heat-shock proteins and binds to androgen response elements, resulting in upregulation or downregulation of the transcription of AR target genes. In addition to responding to ligands, the AR is affected by kinase signaling pathways which directly or indirectly alter the biological response to androgens. This phenomenon is mediated by the AR, as antiandrogens have been shown to block kinase-induced
transcriptional activation (Sadar, M. D. (1999) JBiol Chem 21 A (12), 7777-83). Growth factors, cytokines, and neuropeptides have been implicated in various in vitro and in vivo models of human malignancies, including prostate cancers (Burfeind, P., et al. (1996) Proc Nat! Acad Sd US A 93 (14), 7263-8). In the absence of androgens, insulin-like growth factor- 1 (IGF-I), keratinocyte growth factor (KGF), and epidermal growth factor (EGF) are able to activate transcription of androgen receptor-regulated genes in prostate cancer cells (Culig, Z., et al. (1995) Eur Urol 27 (Suppl 2), 45-7). MAPK and Akt kinase cascades have been shown to be involved in growth factor-mediated AR activation (Yeh, S., et al. (1999) Proc Natl Acad Sci USA 96 (10), 5458-63, Wen, Y., et al. (2000) Cancer Res 60 (24), 6841-5, Lin, H. K., et al. (2001) Proc Natl A cad Sci USA 98 (13), 7200-5). c) Androgen Receptor ligands and derivatives
55. AR can be activated and have increased activity, such as transcription activity, as described herein, when AR is bound to its ligand or an activating derivative of said ligand, a precursor to said ligand, a metabolite of said ligand, or a composition that increases a protein or small molecule in the pathway that produces testosterone or an androgen receptor ligand. AR is activated by androgens such as testosterone and 5-α- dihydrotestosterone.
56. Principal mammalian androgens are testosterone and 5-α-dihydrotestosterone. There are variety of classes of androgens including Delta-3,4-3-keto androgens, which included Delta-4-androstenedione (Adione), Testosterone, and 11-Beta-hydroxy- androstenedione (11-Adione); Delta-5,6-3-keto androgens, which include, Dehydroepiandrosterone, also known as dehydroisoandrosterone (DHEA), DHEA sulfate (DHEAS); and Delta-5-androstenedion; 5 -Alpha-reduced androgens, which include, 5- Alpha-dihydrotestosterone (dihydrotestosterone, DHT) and 5-Alpha-androstanediol; 17- Keto-steroids, which include DHEA, DHEAS, Delta-4-androstenedione (Adione), Delta-5- androstenedione, and 11-Beta-hydroxy-androstenedione (11-Adione).
57. Other analogs of testosterone can be found in Solo et al., "Ring-D-bridged steroid analogs. 8. Testosterone analogs," J Med Chem. 1970 Jul;13(4):751-4. which is herein incorporated by reference in its entirety and at least material related to testosterone analogs.
58. The structure of testosterone contains a 17-β-OH (hydroxyl) and a 3-keto group which are necessary for activity. Oxidation of the 17-/3-OH to a 17-keto group, or
conversion to a 17 α-OH, results in steroids with decreased androgen activity. Likewise, the 3 -OH instead of 3-keto group is much less active partly due to increased metabolism. (http://www.iieuiOSci.pharm.utoledo.edu/MBC3320/andiOgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.)
59. Typically testosterone analogs increase oral activity, prolonged action, and/or selectivity for either anabolic or androgenic activity, but not both. Various testosterone analogs and testosterone and other androgen activators can be administered as a topical cream. (http://www.neurosci.pharm.utoledo.edu/MBC3320/andiOgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.)
60. Testosterone analogs show increased activity if Reducing the double bond between carbons 4 and 5 (Δ4) increases testosterone analog activity. This reduction can be catalyzed by the action of 5-α reductase. Introduction of a fluorine at C9, as for glucocorticoids, increases activity. Furthermore, addition of an alkyl group to position 17 increases stability by preventing oxidation to an inactive 17-keto form. Oxidation to the 17- keto form typically occurs in the liver and can be an obstacle to oral administration. The 17-α methyl testosterone has twice the activity of native testosterone and can enter through the buccal mucosa (mouth membranes). Loss of the 19-CH3 enhances selectivity for anabolic activity by decreasing seletively the androgenic effect. (http://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
61. Creation of an ester at the 17-β position leads to longer acting analogs, presumably by creation of prodrugs.
Effcctw 2-3 days Effective 2-4 weefe? (Testosterone is effective forinwBS (My)
(http ://www.neurosci .phami.utoledo . edu/MBC3320/aiidro gens .him, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
62. Danazol (Danocrine®) is a testosterone derivative having lower androgen agonist without estrogenic activity. Danazol has an acetylene group at Cl 7 and couples a heterocyclic (oxazole) ring to the steroid A ring. Danazol suppresses FSH and LH release from the anterior pituitary and to increase levels of C4 component of complement. (http://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
63. Fluoxymesterone (Halotestin®) possesses a combination of features including a 17-α methyl group, a 9-α fluorine, and a 11-OH group. Andronergic activity is increased 10 times and anabolic activity increased 20 times as compared to that of 17-α methyl testosterone. (http://www.neiirosci.phann.utoledo.edu/MBC3320/androgens.htiii, Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
64. Testosterone (Andro®, Andryl®, Delatest®, Depotest®, Duratest®, Everone®, Histerone®, Tesanone®, Testex®, Testrin®P.A.) and 17-α methyl testosterone (Android®, Metandren®, Oreton® Methyl, Virilon®) can be used, as well as the other AR activators, as described herein.
65. Anabolic activity can be increased over androgenic activity. Nandrolone derivatives (Androlone®, Duraboline®, Hybolin™ Improved, Neo-Durabolic) are examples of this type of analog. The prodrug form contains a des-C19 methyl group.
Oxandrolone having an oxygen instead of C2 and a 17-α methyl group exhibits approximately three times more anabolic activity with only slight andronergic activity compared to testosterone. flittp://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm. Dr. William S. Messer, Jr, This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m.).
66. Other testosterone analogs which can b used herein as AR activators can be found in United States Patent No. 6,828,313 for "Use of oxandrolone in the treatment of burns and other wounds" issued December 7, 2004 to d. Fishbein, which is herein incorporated by reference in its entirety and at least for material related to testosterone analogs as discussed herein. 5. Antibodies
67. There are avariety of antibodies that are disclosed herein, in particular antibodies that bind AR in any of its various forms, sujch as logand bound, as well as binding of coactivators-or co-regulators of AR. Also disclosed are antibodies that bind proteins whose production is regulated by AR. The disclosed antibodies can be used in assays for determining the presence of AR either directly or indirectly and thus, can be used to assay for AR activity either directly or indirectly. Also disclosed are antibodies which are capable of increasing the AR activity, or binding other ligands, such that the diabetic related effects disclosed herein, are reduced. a) Antibodies Generally
68. The term "antibodies" is used herein in a broad sense and includes both polyclonal and monoclonal antibodies, hi addition to intact immunoglobulin molecules, also included in the term "antibodies" are fragments or polymers of those immunoglobulin molecules, and human or humanized versions of immunoglobulin molecules or fragments thereof, as described herein. The antibodies are tested for their desired activity using the in vitro assays described herein, or by analogous methods, after which their in vivo
therapeutic and/or prophylactic activities are tested according to known clinical testing methods.
69. The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL USA, 81:6851-6855 (1984)). 70. Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro, e.g., using the HTV Env-CD4-co-receptor complexes described herein.
71. The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.). DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al. 72. In vitro methods are also suitable for preparing monovalent antibodies.
Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be
performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen.
73. The fragments, whether attached to other sequences or not, can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc. In any case, the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen. Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the antibody or antibody fragment. (Zoller, MJ. Curr. Opin. Biotechnol. 3:348-354, 1992).
74. As used herein, the term "antibody" or "antibodies" can also refer to a human antibody and/or a humanized antibody. Many non-human antibodies (e.g., those derived from mice, rats, or rabbits) are naturally antigenic in humans, and thus can give rise to undesirable immune responses when administered to humans. Therefore, the use of human or humanized antibodies in the methods of the invention serves to lessen the chance that an antibody administered to a human will evoke an undesirable immune response. b) Human antibodies
75. The human antibodies of the invention can be prepared using any technique. Examples of techniques for human monoclonal antibody production include those described by Cole et al. (Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77, 1985) and byBoerner et al. (J. Immunol, 147 (l):86-95, 1991). Human antibodies of the invention (and fragments thereof) can also be produced using phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381, 1991; Marks et al., J. MoI Biol, 222:581, 1991).
76. The human antibodies of the invention can also be obtained from transgenic animals. For example, transgenic, mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits et al., Proc. Natl. Acad. ScL USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993)).
Specifically, the homozygous deletion of the antibody heavy chain joining region (J (H)) gene in these chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production, and the successful transfer of the human germ-line antibody gene array into such germ-line mutant mice results in the production of human antibodies upon antigen challenge. Antibodies having the desired activity are selected using Env-CD4-co-receptor complexes as described herein. c) Humanized antibodies
77. Optionally, the antibodies are generated in other species and "humanized" for administration in humans. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as scFv, sFv, FV, Fab, Fab', F (ab')2, or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, ret or rabbit having the desired specificity, affinity and capacity, hi some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences, hi general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., Nature, 321 :522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); and Presta, Curr. Op. Struct. Biol, 2:593-596 (1992)).
78. Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source that is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co- workers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species, hi practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
79. The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important in order to reduce antigenicity.
According to the "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993) and Chothia et al., J. MoI. Biol., 196:901 (1987)). Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993)). 80. It is further important that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of
these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antigen (s), is achieved. In general, the CDR residues are directly and most substantially involved in influencing antigen binding (see, WO 94/04679, published 3 March 1994). d) Monoclonal Antibodies
81. The term "monoclonal antibody" as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies within the population are identical except for possible naturally occurring mutations that may be present in a small subset of the antibody molecules. The monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain (s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, as long as they exhibit the desired antagonistic activity (See, U.S. Pat. No. 4,816,567 and Morrison et al., Proc. Natl. Acad. ScL U.S.A., 81:6851-6855 (1984)).
82. Monoclonal antibodies of the invention can be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro, e.g., using the complexes described herein.
83. Transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production can be employed. For example, it has been described that the homozygous deletion of the antibody heavy chain joining region (J (H)) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array in such germ-
line mutant mice will result in the production of human antibodies upon antigen challenge (see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-255 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggemann et al., Year in Irnrnuno., 7:33 (1993)). Human antibodies can also be produced in phage display libraries (Hoogenboom et al., J. MoI. Biol, 227:381 (1991); Marks et al., J. MoL Biol, 222:581 (1991)). The techniques of Cote et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner et al., J. Immunol., 147 (l):86-95 (1991)).
84. Generally, either peripheral blood lymphocytes ("PBLs") are used in methods of producing monoclonal antibodies if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, "Monoclonal Antibodies: Principles and Practice" Academic Press, (1986) pp. 59-103). Immortalized cell lines are usually transformed mammalian cells, including myeloma cells of rodent, bovine, equine, and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the SaIk Institute Cell Distribution Center, San Diego, Calif, and the American Type Culture Collection, Rockville, Md. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J. Immunol., 133:3001 (1984); Brodeur et al., "Monoclonal Antibody Production Techniques and Applications" Marcel Dekker, Inc., New York, (1987) pp. 51-63). The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against
ARA67, AR, GSK2B, or hRad9, for example. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques and assays are known in the art, and are described further in the Examples below or in Harlow and Lane
"Antibodies, A Laboratory Manual" Cold Spring Harbor Publications, New York, (1988).
85. After the desired hybridoma cells are identified, the clones maybe subcloned by limiting dilution or FACS sorting procedures and grown by standard methods. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
86. The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, protein G, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
87. The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Pat. No. 4,816,567 (Cabilly et al.). DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Libraries of antibodies or active antibody fragments can also be generated and screened using phage display techniques, e.g., as described in U.S. Patent No. 5,804,440 to Burton et al. and U.S. Patent No. 6,096,441 to Barbas et al.
88. In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994 and U.S. Pat. No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields a fragment that has two antigen combining sites and is still capable of cross-linking antigen. e) Antibody fragments
89. Also disclosed are fragments of antibodies which have bioactivity. The polypeptide fragments of the present invention can be recombinant proteins obtained by cloning nucleic acids encoding the polypeptide in an expression system capable of producing the polypeptide fragments thereof, such as an adenovirus or baculovirus expression system. For example, one can determine the active domain of an antibody from a specific hybridoma that can cause a biological effect associated with the interaction of the antibody with ARA67, AR, GSK2B, hRad9, TR2, or TR4, for example. For example, amino acids found to not contribute to either the activity or the binding specificity or affinity of the antibody can be deleted without a loss in the respective activity. For example, in various embodiments, amino or carboxy-terminal amino acids are sequentially removed from either the native or the modified non-immunoglobulin molecule or the immunoglobulin molecule and the respective activity assayed in one of many available assays. Ih another example, a fragment of an antibody comprises a modified antibody wherein at least one amino acid has been substituted for the naturally occurring amino acid at a specific position, and a portion of either amino terminal or carboxy terminal amino acids, or even an internal region of the antibody, has been replaced with a polypeptide fragment or other moiety, such as biotin, which can facilitate in the purification of the modified antibody. For example, a modified antibody can be fused to a maltose binding protein, through either peptide chemistry or cloning the respective nucleic acids encoding the two polypeptide fragments into an expression vector such that the expression of the coding region results in a hybrid polypeptide. The hybrid polypeptide can be affinity purified by passing it over an amylose affinity column, and the modified antibody receptor can then be separated from the maltose binding region by cleaving the hybrid polypeptide with the specific protease factor Xa. (See, for example, New England Biolabs Product Catalog, 1996, pg. 164.). Similar purification procedures are available for isolating hybrid proteins from eukaryotic cells as well.
90. The fragments, whether attached to other sequences or not, include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the fragment is not significantly altered or impaired compared to the nonmodified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove or add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory
characteristics, etc. In any case, the fragment must possess a bioactive property, such as binding activity, regulation of binding at the binding domain, etc. Functional or active regions of the antibody may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide. Such methods are readily apparent to a skilled practitioner in the art and can include site-specific mutagenesis of the nucleic acid encoding the antigen. (Zoller MJ et al. Nucl. Acids Res. 10:6487-500 (1982).
91. A variety of immunoassay formats may be used to select antibodies that selectively bind with a particular protein, variant, or fragment. For example, solid-phase ELISA immunoassays are routinely used to select antibodies selectively immunoreactive with a protein, protein variant, or fragment thereof. See Harlow and Lane. Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988), for a description of immunoassay formats and conditions that could be used to determine selective binding. The binding affinity of a monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson et al., Anal. Biochem., 107:220 (1980). f) Administration of antibodies
92. Antibodies of the invention are preferably administered to a subject in a pharmaceutically acceptable carrier. Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Examples of the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution. The pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5. Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of antibody being administered.
93. The antibodies can be administered to the subject, patient, or cell by injection (e.g., intravenous, intraperitoneal, subcutaneous, intramuscular), or by other methods such as infusion that ensure its delivery to the bloodstream in an effective form. Local or intravenous injection is preferred.
94. Effective dosages and schedules for administering the antibodies may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of antibodies that must be administered will vary depending on, for example, the subject that will receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered. Guidance in selecting appropriate doses for antibodies is found in the literature on therapeutic uses of antibodies, e.g., Handbook of Monoclonal Antibodies, Ferrone et al., eds., Noges Publications, Park Ridge, NJ., (1985) ch. 22 and pp. 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., eds., Raven Press, New York (1977) pp. 365-389. A typical daily dosage of the antibody used alone might range from about 1 μg/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above. g) Nucleic acid approaches for antibody delivery
95. The AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I antibodies and antibody fragments, for example, can also be administered' to patients or subjects as a nucleic acid preparation (e.g., DNA or RNA) that encodes the antibody or antibody fragment, such that the patient's or subject's own cells take up the nucleic acid and produce and secrete the encoded antibody or antibody fragment.
6. Compositions identified by screening with disclosed compositions / combinatorial chemistry a) Combinatorial chemistry
96. The disclosed compositions can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way. Particular disclosed are assays for identifying molecules that modulate AR or another ligand, such that the diabetic related effects of a loss of AR as disclosed herein are reduced or decreased.
97. It is understood that when using the disclosed compositions in combinatorial techniques or screening methods, molecules, such as macromolecular molecules, will be identified that have particular desired properties such as inhibition or stimulation of the target molecule's function. The molecules identified and isolated when using the disclosed compositions, such as, AR, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also disclosed. Thus, the products produced using the
combinatorial or screening approaches that involve the disclosed compositions, such as, AR, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also considered herein disclosed.
98. Combinatorial chemistry includes but is not limited to all methods for isolating small molecules or macromolecules that are capable of binding either a small molecule or another macromolecule, typically in an iterative process. Proteins, oligonucleotides, and sugars are examples of macromolecules. For example, oligonucleotide molecules with a given function, catalytic or ligand-binding, can be isolated from a complex mixture of random oligonucleotides in what has been referred to as "in vitro genetics" (Szostak, TIBS 19:89, 1992). One synthesizes a large pool of molecules bearing random and defined sequences and subjects that complex mixture, for example, approximately 1015 individual sequences in 100 μg of a 100 nucleotide RNA, to some selection and enrichment process. Through repeated cycles of affinity chromatography and PCR amplification of the molecules bound to the ligand on the column, Ellington and Szostak (1990) estimated that 1 in 10 RNA molecules folded in such a way as to bind a small molecule dyes. DNA molecules with such ligand-binding behavior have been isolated as well (Ellington and Szostak, 1992; Bock et al, 1992). Techniques aimed at similar goals exist for small organic molecules, proteins, antibodies and other macromolecules known to those of skill in the art. Screening sets of molecules for a desired activity whether based on small organic libraries, oligonucleotides, or antibodies is broadly referred to as combinatorial chemistry. Combinatorial techniques are particularly suited for defining binding interactions between molecules and for isolating molecules that have a specific binding activity, often called aptamers when the macromolecules are nucleic acids.
99. There are a number of methods for isolating proteins which either have de novo activity or a modified activity. For example, phage display libraries have been used to isolate numerous peptides that interact with a specific target. (See for example, United States Patent No. 6,031,071; 5,824,520; 5,596,079; and 5,565,332 which are herein incorporated by reference at least for their material related to phage display and methods relate to combinatorial chemistry) 100. A preferred method for isolating proteins that have a given function is described by Roberts and Szostak (Roberts R. W. and Szostak J.W. Proc. Natl. Acad. Sci. USA, 94(23)12997-302 (1997). This combinatorial chemistry method couples the
functional power of proteins and the genetic power of nucleic acids. An RNA molecule is generated in which a puromycin molecule is covalently attached to the 3 '-end of the RNA molecule. An in vitro translation of this modified RNA molecule causes the correct protein, encoded by the RNA to be translated. In addition, because of the attachment of the puromycin, a peptdyl acceptor which cannot be extended, the growing peptide chain is attached to the puromycin which is attached to the RNA. Thus, the protein molecule is attached to the genetic material that encodes it. Normal in vitro selection procedures can now be done to isolate functional peptides. Once the selection procedure for peptide function is complete traditional nucleic acid manipulation procedures are performed to amplify the nucleic acid that codes for the selected functional peptides. After amplification of the genetic material, new RNA is transcribed with puromycin at the 3 '-end, new peptide is translated and another functional round of selection is performed. Thus, protein selection can be performed in an iterative manner just like nucleic acid selection techniques. The peptide which is translated is controlled by the sequence of the RNA attached to the puromycin. This sequence can be anything from a random sequence engineered for optimum translation (i.e. no stop codons etc.) or it can be a degenerate sequence of a known RNA molecule to look for improved or altered function of a known peptide. The conditions for nucleic acid amplification and in vitro translation are well known to those of ordinary skill in the art and are preferably performed as in Roberts and Szostak (Roberts R.W. and Szostak J.W. Proc. Natl. Acad. Sci. USA, 94(23)12997-302 (1997)).
101. Another preferred method for combinatorial methods designed to isolate peptides is described in Cohen et al. (Cohen B.A.,et al., Proc. Natl. Acad. Sci. USA 95(24): 14272-7 (1998)). This method utilizes and modifies two-hybrid technology. Yeast two-hybrid systems are useful for the detection and analysis of protein:protein interactions. The two-hybrid system, initially described in the yeast Saccharomyces cerevisiae, is a powerful molecular genetic technique for identifying new regulatory molecules, specific to the protein of interest (Fields and Song, Nature 340:245-6 (1989)). Cohen et al., modified this technology so that novel interactions between synthetic or engineered peptide sequences could be identified which bind a molecule of choice. The benefit of this type of technology is that the selection is done in an intracellular environment. The method utilizes a library of peptide molecules that attached to an acidic activation domain. A
peptide of choice, for example an extracellular portion of AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I is attached to a DNA binding domain of a transcriptional activation protein, such as Gal 4. By performing the Two- hybrid technique on this type of system, molecules that bind the extracellular portion of AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I can be identified.
102. Using methodology well known to those of skill in the art, in combination with various combinatorial libraries, one can isolate and characterize those small molecules or macromolecules, which bind to or interact with the desired target. The relative binding affinity of these compounds can be compared and optimum compounds identified using competitive binding studies, which are well known to those of skill in the art.
103. Techniques for making combinatorial libraries and screening combinatorial libraries to isolate molecules which bind a desired target are well known to those of skill in the art. Representative techniques and methods can be found in but are not limited to United States patents 5,084,824, 5,288,514, 5,449,754, 5,506,337, 5,539,083, 5,545,568, 5,556,762, 5,565,324, 5,565,332, 5,573,905, 5,618,825, 5,619,680, 5,627,210, 5,646,285, 5,663,046, 5,670,326, 5,677,195, 5,683,899, 5,688,696, 5,688,997, 5,698,685, 5,712,146, 5,721,099, 5,723,598, 5,741,713, 5,792,431, 5,807,683, 5,807,754, 5,821,130, 5,831,014, 5,834,195, 5,834,318, 5,834,588, 5,840,500, 5,847,150, 5,856,107, 5,856,496, 5,859,190, 5,864,010, 5,874,443, 5,877,214, 5,880,972, 5,886,126, 5,886,127, 5,891,737, 5,916,899, 5,919,955, 5,925,527, 5,939,268, 5,942,387, 5,945,070, 5,948,696, 5,958,702, 5,958,792, 5,962,337, 5,965,719, 5,972,719, 5,976,894, 5,980,704, 5,985,356, 5,999,086, 6,001,579, 6,004,617, 6,008,321, 6,017,768, 6,025,371, 6,030,917, 6,040,193, 6,045,671, 6,045,755, 6,060,596, and 6,061,636. 104. Combinatorial libraries can be made from a wide array of molecules using a number of different synthetic techniques. For example, libraries containing fused 2,4- pyrimidinediones (United States patent 6,025,371) dihydrobenzopyrans (United States Patent 6,017,768and 5,821,130), amide alcohols (United States Patent 5,976,894), hydroxy-amino acid amides (United States Patent 5,972,719) carbohydrates (United States patent 5,965,719), l,4-benzodiazepin-2,5-diones (United States patent 5,962,337), cyclics (United States patent 5,958,792), biaryl amino acid amides (United States patent 5,948,696), thiophenes (United States patent 5,942,387), tricyclic Tetrahydroquinolines
(United States patent 5,925,527), benzofurans (United States patent 5,919,955), isoquinolines (United States patent 5,916,899), hydantoin and thiohydantoin (United States patent 5,859,190), indoles (United States patent 5,856,496), imidazol-pyrido-indole and imidazol-pyrido-benzothiophenes (United States patent 5,856,107) substituted 2- methylene-2, 3-dihydrothiazoles (United States patent 5,847,150), quinolines (United States patent 5,840,500), PNA (United States patent 5,831,014), containing tags (United States patent 5,721,099), polyketides (United States patent 5,712,146), morpholino- subunits (United States patent 5,698,685 and 5,506,337), sulfamides (United States patent 5,618,825), and benzodiazepines (United States patent 5,288,514). 105. As used herein combinatorial methods and libraries included traditional screening methods and libraries as well as methods and libraries used in interative processes. b) Computer assisted drug design
106. The disclosed compositions can be used as targets for any molecular modeling technique to identify either the structure of the disclosed compositions or to identify potential or actual molecules, such as small molecules, which interact in a desired way with the disclosed compositions. The nucleic acids, peptides, and related molecules disclosed herein can be used as targets in any molecular modeling program or approach.
107. It is understood that when using the disclosed compositions in modeling techniques, molecules, such as macromolecular molecules, will be identified that have particular desired properties such as inhibition or stimulation or the target molecule's function. The molecules identified and isolated when using the disclosed compositions, such as, AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also disclosed. Thus, the products produced using the molecular modeling approaches that involve the disclosed compositions, such as, AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, are also considered herein disclosed.
108. Thus, one way to isolate molecules that bind a molecule of choice is through rational design. This is achieved through structural information and computer modeling. Computer modeling technology allows visualization of the three-dimensional atomic structure of a selected molecule and the rational design of new compounds that will interact with the molecule. The three-dimensional construct typically depends on data from x-ray
crystallographic analyses or NMR imaging of the selected molecule. The molecular dynamics require force field data. The computer graphics systems enable prediction of how a new compound will link to the target molecule and allow experimental manipulation of the structures of the compound and target molecule to perfect binding specificity. Prediction of what the molecule-compound interaction will be when small changes are made in one or both requires molecular mechanics software and computationally intensive computers, usually coupled with user-friendly, menu-driven interfaces between the molecular design program and the user.
109. Examples of molecular modeling systems are the CHARMm and QUANTA programs, Polygen Corporation, Waltham, MA. CHARMm performs the energy minimization and molecular dynamics functions. QUANTA performs the construction, graphic modeling, and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other. 110. A number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen, et al., 1988 Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57 (June 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol. Toxiciol. 29, 111-122; Perry and Davies, QSAR: Quantitative Structure- Activity Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236, 125-140 and 141-162; and, with respect to a model enzyme for nucleic acid components, Askew, et al., 1989 J. Am. Chem. Soc. I ll, 1082- 1090. Other computer programs that screen and graphically depict chemicals are available from companies such as BioDesign, Inc., Pasadena, CA., Allelix, Inc, Mississauga, Ontario, Canada, and Hypercube, Inc., Cambridge, Ontario. Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of molecules specifically interacting with specific regions of DNA or RNA, once that region is identified.
111. Although described above with reference to design and generation of compounds which could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds which alter substrate binding or enzymatic activity.
C. Compositions
112. Disclosed are the components to be used to prepare the disclosed compositions as well as the compositions themselves to be used within the methods disclosed herein. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular AR is disclosed and discussed and a number of modifications that can be made to a number of molecules including the AR are discussed, specifically contemplated is each and every combination and permutation of AR and the modifications that are possible unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited each is individually and collectively contemplated meaning combinations, A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E would be considered disclosed. This concept applies to all aspects of this application including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods.
1. Homology/identity
113. It is understood that one way to define any known variants and derivatives or those that might arise, of the disclosed genes and proteins herein is through defining the variants and derivatives in terms of homology to specific known sequences. For example SEQ ID NO: 2 sets forth a particular sequence of an AR and SEQ E) NO: 1 sets forth a particular sequence of the protein encoded by SEQ ID NO: 2, an AR protein. Specifically disclosed are variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins or nucleic acids, such as
genes. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
114. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
115. The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
2. Hybridization/selective hybridization
116. The term hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene. Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide. The hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
117. Parameters for selective hybridization between two nucleic acid molecules are well known to those of skill in the art. For example, in some embodiments selective hybridization conditions can be defined as stringent hybridization conditions. For example, stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps. For example, the conditions of hybridization to achieve selective hybridization may involve hybridization in
high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 12-250C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm. The temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA-RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989; Kunkel et al. Methods Enzymol. 1987:154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids). A preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 680C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C. Stringency of hybridization and washing, if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for. Likewise, stringency of hybridization and washing, if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
118. Another way to define selective hybridization is by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid. Typically, the non-limiting primer is in for example, 10 or 100 or 1000 fold excess. This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their kd, or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their kd.
119. Another way to define selective hybridization is by looking at the percentage of primer that gets enzymatically manipulated under conditions where hybridization is required to promote the desired enzymatic manipulation. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 91, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer molecules are extended. Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation.
120. Just as with homology, it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein. 121. It is understood that those of skill in the art understand that if a composition or method meets any one of these criteria for determining hybridization either collectively or singly it is a composition or method that is disclosed herein. a) Sequences 122. There are a variety of sequences related to the AR, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I, for example, and other disclosed genes having the following Genbank Accession Numbers: (SEQ ID NOs: 1 and 2) human AR protein and DNA, NM_000044; (SEQ ID NOs:3 and 4) Mouse AR protein and DNA, X59592; (SEQ ID NOs:5 and 6) Mouse AR protein and DNA, M37890; (SEQ ID NOs:7 and 8) Human ARA70 protein and DNA, L49399; (SEQ ID NOs:9 and 10) Human ARA 54 protein and DNA, AF060544; (SEQ ID NOs: 11 and 12) Human ARA55 protein and DNA, AFl 16343; (SEQ ID NOs:13 and 14) Human ARA24 protein and DNA, AF052578; (SEQ ID NOs:15 and 16) Human ARA267-a protein and DNA, AF380302;
(SEQ ID NOs:17 and 18) Human ARA267-b protein and DNA, AY049721; (SEQ ID NOs:19 and 20) Human supervillin protein and DNA, AF051850; (SEQ ID NOs:21 and 22) Mouse gelsolin protein and DNA, J04953; (SEQ ID NOs:23 and 24) Human retinoblastoma protein and DNA, M28419; (SEQ ID NOs:25 and 26) Human gelsolin protein and DNA, MGC:39262; (SEQ ID NOs:27 and 28) Human steroid receptor coactivator-1 SRC-I) mRNA, protein and DNA, U90661, these sequences and others are herein incorporated by reference in their entireties as well as for individual subsequences contained therein.
123. One particular sequence set forth in SEQ ID NO: 1 and having Genbank accession number NM_000044 is used herein, as an example, to exemplify the disclosed compositions and methods. It is understood that the description related to this sequence is applicable to any sequence disclosed herein unless specifically indicated otherwise. Those of skill in the art understand how to resolve sequence discrepancies and differences and to adjust the compositions and methods relating to a particular sequence to other related sequences (i.e. sequences of AR). Primers and/or probes can be designed for any AR sequence given the information disclosed herein and known in the art. 3. Delivery of the compositions to cells
124. There are a number of compositions and methods which can be used to deliver nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non- viral based delivery systems. For example, the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described by, for example, Wolff, J. A., et al., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991) Such methods are well known in the art and readily adaptable for use with the compositions and methods described herein, hi certain cases, the methods will be modifed to specifically function with large DNA molecules. Further, these methods can be used to target certain diseases and cell populations by using the targeting characteristics of the carrier.
a) Nucleic acid based delivery systems
125. Transfer vectors can be any nucleotide construction used to deliver genes into cells (e.g., a plasmid), or as part of a general strategy to deliver genes, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). 126. As used herein, plasmid or viral vectors are agents that transport the disclosed nucleic acids, such as Ab, RB, ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Vaccinia virus, Polio virus, ADDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with the HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus (MMLV) and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect non-dividing cells. Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens. Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
127. Viral vectors can have higher transaction (ability to introduce genes) abilities than chemical or physical methods to introduce genes into cells. Typically, viral vectors contain nonstructural early genes, structural late genes, an RNA polymerase HI transcript, inverted terminal repeats necessary for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene/promotor cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are typically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
(1) Retroviral Vectors
128. A retrovirus is an animal virus belonging to the virus family of Retro viridae, including any types, subfamilies, genus, or tropisms. Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer. In Microbiology-1985, American Society for Microbiology, pp. 229-232, Washington, (1985), which is incorporated by reference herein. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90/02806 and WO 89/07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference. 129. A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, which ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules which are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome, contains the gag, pol, and env genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors typically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serves as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. The removal of the gag, pol, and env genes allows for about 8 kb of foreign sequence to be inserted into the viral genome, become reverse transcribed, and upon replication be packaged into a new retroviral particle. This amount of nucleic acid is sufficient for the delivery of one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert. 130. Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been
transfected or transformed with a retrovirus that contains the replication and packaging machinery, but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
(2) Adenoviral Vectors
131. The construction of replication-defective adenoviruses has been described (Berkner et al., J. Virology 61:1213-1220 (1987); Massie et al., MoI. Cell. Biol. 6:2872- 2883 (1986); Haj-Ahmad et al., J. Virology 57:267-29 '4 (1986); Davidson et al., J. Virology 61 :1226-1239 (1987); Zhang "Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis" BioTechniques 15:868- 872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell, but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery to airway epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest. 92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest. 92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation Research 73:1201-1207 (1993); Bout, Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501- 507 (1993)). Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, et al., J. Virol. 51:650-655 (1984); Seth, et al., MoL Cell. Biol. 4:1528-1533 (1984); Varga et al., J. Virology 65:6061-6070 (1991); Wickham et al., Cell 73:309-319 (1993)).
132. A viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line. In
another preferred embodiment both the El and E3 genes are removed from the adenovirus genome.
(3) Adeno-associated viral vectors
133. Another type of viral vector is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this type of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene, HSV-tk, and/or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
134. In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell- specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus.
135. Typically the AAV and B19 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity, and the promoter directs cell-specific expression. United states Patent No. 6,261,834 is herein incorproated by reference for material related to the AAV vector.
136. The vectors of the present invention thus provide DNA molecules which are capable of integration into a mammalian chromosome without substantial toxicity.
137. The inserted genes in viral and retroviral usually contain promoters, and/or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements. (4) Large payload viral vectors
138. Molecular genetic experiments with large human herpesviruses have provided a means whereby large heterologous DNA fragments can be cloned, propagated
and established in cells permissive for infection with herpesviruses (Sun et al., Nature genetics 8: 33-41, 1994; Cotter and Robertson,. Curr Opin MoI Ther 5: 633-644, 1999). These large DNA viruses (herpes simplex virus (HSV) and Epstein-Barr virus (EBV), have the potential to deliver fragments of human heterologous DNA > 150 kb to specific cells. EBV recombinants can maintain large pieces of DNA in the infected B-cells as episomal DNA. Individual clones carried human genomic inserts up to 330 kb appeared genetically stable The maintenance of these episomes requires a specific EBV nuclear protein, EBNAl, constitutively expressed during infection with EBV. Additionally, these vectors can be used for transfection, where large amounts of protein can be generated transiently in vitro. Herpesvirus amplicon systems are also being used to package pieces of DNA > 220 kb and to infect cells that can stably maintain DNA as episomes.
139. Other useful systems include, for example, replicating and host-restricted non-replicating vaccinia virus vectors. b) Non-nucleic acid based systems 140. The disclosed compositions can be delivered to the target cells in a variety of ways. For example, the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro. 141. Thus, the compositions can comprise, in addition to the disclosed AR, Rb,
ARA54, ARA55, ARA24, ARA70, ARA267, gelsolin, supervillin, and SRC-I or vectors for example, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract. Regarding liposomes, see, e.g., Brigham et al. Am. J. Resp. Cell. MoI. Biol. 1:95-100 (1989); Feigner et al. Proc. Natl. Acad. Sd U.S.A. 84:7413-7417 (1987); U.S. Pat. No.4,897,355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage.
142. In the methods described above which include the administration and uptake of exogenous DNA into the cells of a subject (i.e., gene transduction or transfection), delivery of the compositions to cells can be via a variety of mechanisms. As one example, delivery can be via a liposome, using commercially available liposome preparations such as LIPOFECTIN, LBPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD),
SUPERPECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), as well as other liposomes developed according to procedures standard in the art. In addition, the nucleic acid or vector of this invention can be delivered in vivo by electroporation, the technology for which is available from Genetronics, Inc. (San Diego, CA) as well as by means of a SONOPORATION machine (hnaRx Pharmaceutical Corp., Tucson, AZ).
143. The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al., Bioconiugate
Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer. 58:700-703, (1988); Senter, et al., Bioconiugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews. 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol. 42:2062-2065, (1991)). These techniques can be used for a variety of other specifc cell types. Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104:179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins,
clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10(6) 399-409 (1991)).
144. Nucleic acids that are delivered to cells which are to be integrated into the host cell genome, typically contain integration sequences. These sequences are often viral related sequences, particularly when viral based systems are used. These viral integration systems can also be incorporated into nucleic acids which are to be delivered using a non- nucleic acid based system of delivery, such as a liposome, so that the nucleic acid contained in the delivery system can be come integrated into the host genome.
145. Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems typically rely on a sequence flanking the nucleic acid to be expressed that has enough homology with a target sequence within the host cell genome that recombination between the vector nucleic acid and the target nucleic acid takes place, causing the delivered nucleic acid to be integrated into the host genome. These systems and the methods necessary to promote homologous recombination are known to those of skill in the art. c) In vivo/ex vivo
146. As described above, the compositions can be administered in a pharmaceutically acceptable carrier and can be delivered to the subject' s cells in vivo and/or ex vivo by a variety of mechanisms well known in the art (e.g., uptake of naked DNA, liposome fusion, intramuscular injection of DNA via a gene gun, endocytosis and the like).
147. If ex vivo methods are employed, cells or tissues can be removed and maintained outside the body according to standard protocols well known in the art. The compositions can be introduced into the cells via any gene transfer mechanism, such as, for example, calcium phosphate mediated gene delivery, electroporation, microinjection or proteoliposomes. The transduced cells can then be infused (e.g., in a pharmaceutically acceptable carrier) or homotopically transplanted back into the subject per standard
methods for the cell or tissue type. Standard methods are known for transplantation or infusion of various cells into a subject. 4. Expression systems
148. The nucleic acids that are delivered to cells typically contain expression controlling systems. For example, the inserted genes in viral and retroviral systems usually contain promoters, and/or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to the transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements. a) Viral Promoters and Enhancers
149. Preferred promoters controlling transcription from vectors in mammalian host cells maybe obtained from various sources, for example, the genomes of viruses such as: polyoma, Simian Virus 40 (SV40), adenovirus, retroviruses, hepatitis-B virus and most preferably cytomegalovirus, or from heterologous mammalian promoters, e.g. beta actin promoter. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication (Fiers et al., Nature, 273: 113 (1978)). The immediate early promoter of the human cytomegalovirus is conveniently obtained as a Hindiπ E restriction fragment (Greenway, PJ. et al., Gene 18: 355-360 (1982)). Of course, promoters from the host cell or related species also are useful herein.
150. Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5' (Laimins, L. et al., Proc. Natl. Acad. Sci. 78: 993 (1981)) or 3' (Lusky, M.L., et al., MoI. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al., MoI. Cell Bio. 4: 1293 (1984)). They are usually between 10 and 300 bp in length, and they function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase,
albumin, fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. 151. The promotor and/or enhancer may be specifically activated either by light or specific chemical events which trigger their function. Systems can be regulated by reagents such as tetracycline and dexamethasone. There are also ways to enhance viral vector gene expression by exposure to irradiation, such as gamma irradiation, or alkylating chemotherapy drugs. 152. In certain embodiments the promoter and/or enhancer region can act as a constitutive promoter and/or enhancer to maximize expression of the region of the transcription unit to be transcribed, m certain constructs the promoter and/or enhancer region may be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time. A preferred promoter of this type is the CMV promoter (650 bases). Other preferred promoters are SV40 promoters, cytomegalovirus (full length promoter), and retroviral vector LTF.
153. It has been shown that all specific regulatory elements can be cloned and used to construct expression vectors that are selectively expressed in specific cell types such as melanoma cells. The glial fibrillary acetic protein (GFAP) promoter has been used to selectively express genes in cells of glial origin.
154. Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells) may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed as polyadenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3' untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contain a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of polyadenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs. In certain transcription units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases. It is also preferred that the transcribed units contain other
standard sequences alone or in combination with the above sequences improve expression from, or stability of, the construct. b) Markers
155. The viral vectors can include nucleic acid sequence encoding a marker product. This marker product is used to determine if the gene has been delivered to the cell and once delivered is being expressed. Preferred marker genes are the E. CoIi lacZ gene, which encodes β-galactosidase, and green fluorescent protein.
156. In some embodiments the marker may be a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR), thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell's metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are: CHO DHFR- cells and mouse LTK- cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements, individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
157. The second category is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and would survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg, P., JL Molec. Appl. Genet. 1: 327 (1982)), mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al, MoI. Cell. Biol. 5: 410-413 (1985)). The three examples employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puramycin.
5. Peptides a) Protein variants
158. As discussed herein there are numerous variants of the AR protein and gelsolin protein that are known and herein contemplated. In addition, to the known functional AR strain variants there are derivatives of the AR proteins which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional, or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues. Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues. Immunogenic fusion protein derivatives, such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross- linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule. These variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example Ml 3 primer mutagenesis and PCR mutagenesis. Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues.
Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct. The mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure. Substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally
are made in accordance with the following Tables 1 and 2 and are referred to as conservative substitutions.
159. TABLE 1 : Amino Acid Abbreviations
160. Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 2, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g. leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an electronegative residue, e.g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g., phenylalanine, is substituted for (or by) one not having a side chain, e.g., glycine, in this case, (e) by increasing the number of sites for sulfation and/or glycosylation. 161. For example, the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution. For example, a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another. The substitutions include combinations such as, for example, GIy, Ala; VaI, He, Leu; Asp, GIu; Asn, GIn; Ser, Thr; Lys, Arg; and Phe, Tyr. Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein.
162. Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr). Deletions of cysteine or other labile residues also maybe desirable. Deletions or substitutions of potential proteolysis sites, e.g. Arg, is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
163. Certain post-translational derealizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions.
Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o- amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H. Freeman & Co., San Francisco pp 79-86 [1983]), acetylation of the N-terminal amine and, in some instances, amidation of the C- terminal carboxyl.
164. It is understood that one way to define the variants and derivatives of the disclosed proteins herein is through defining the variants and derivatives in terms of homology/identity to specific known sequences. For example, SEQ JD NO: 2 sets forth a particular sequence of AR and SEQ ID NO: 1 sets forth a particular sequence of an AR protein. Specifically disclosed are variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% homology to the stated sequence. Those of skill in the art readily understand how to determine the homology of two proteins. For example, the homology can be calculated after aligning the two sequences so that the homology is at its highest level.
165. Another way of calculating homology can be performed by published algorithms. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. Sci. U.S.A. 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by inspection.
166. The same types of homology can be obtained for nucleic acids by for example the algorithms disclosed in Zuker, M. Science 244:48-52, 1989, Jaeger et al. Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al. Methods Enzymol. 183:281-306, 1989 which are herein incorporated by reference for at least material related to nucleic acid alignment.
167. It is understood that the description of conservative mutations and homology can be combined together in any combination, such as embodiments that have at least 70% homology to a particular sequence wherein the variants are conservative mutations.
168. As this specification discusses various proteins and protein sequences it is understood that the nucleic acids that can encode those protein sequences are also disclosed. This would include all degenerate sequences related to a specific protein sequence, i.e. all nucleic acids having a sequence that encodes one particular protein sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences. Thus, while each particular nucleic acid sequence may not be written out herein, it is understood that each and every sequence is in fact disclosed and described herein through the disclosed protein sequence. For example, one of the many nucleic acid sequences that can encode the protein sequence set forth in SEQ ID NO: 1 is set forth in SEQ ID NO:2. It is understood that for this mutation all of the nucleic acid sequences that encode this particular derivative of the AR are also disclosed. It is also understood that while no amino acid sequence indicates what particular DNA sequence encodes that protein within an organism, where particular variants of a disclosed protein are disclosed herein, the known nucleic acid sequences that encodes that protein are herein disclosed and described.
6. Pharmaceutical carriers/Delivery of pharamceutical products
169. As described above, the compositions can also be administered in vivo in a pharmaceutically acceptable carrier. By "pharmaceutically acceptable" is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained. The carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art. 170. The compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although topical intranasal administration or administration by inhalant is typically preferred. As used herein, "topical intranasal administration" means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. The latter may be effective when a large number of animals is to be treated simultaneously.
Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism. Delivery can also be directly to any area of the respiratory system (e.g., lungs) via intubation. The exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein. 171. Parenteral administration of the composition, if used, is generally characterized by injection. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions. A more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
172. The materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These may be targeted to a particular cell type via antibodies, receptors, or receptor ligands. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, et al.,
Bioconiugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br. J. Cancer, 60:275-281, (1989); Bagshawe, et al., Br. J. Cancer, 58:700-703, (1988); Senter, et al., Bioconiugate Chem., 4:3-9, (1993); Battelli, et al., Cancer Immunol. Immunother.. 35:421-425, (1992); Pietersz and McKenzie. Immunolog. Reviews, 129:57-80, (1992); and Roffler, et al., Biochem. Pharmacol, 42:2062-2065, (1991)). Vehicles such as "stealth" and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo. The following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research. 49:6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophvsica Acta. 1104:179-187, (1992)). In general, receptors are involved in pathways of endocytosis, either constitutive or ligand
induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin-coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes. The internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene. DNA and Cell Biology 10:6, 399-409 (1991)). a) Pharmaceutically Acceptable Carriers
173. The compositions, including antibodies, can be used therapeutically in combination with a pharmaceutically acceptable carrier.
174. Pharmaceutical carriers are known to those skilled in the art. These most typically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH. The compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
175. Pharmaceutical compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice. Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, antiinflammatory agents, anesthetics, and the like.
176. The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including ophthalmically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection. The disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally. 177. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable
^j
organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
178. Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
179. Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders may be desirable. 180. Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines. b) Therapeutic Uses 181. The dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are effected. The dosage should not be so large as to cause adverse side effects, such as unwanted cross- reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any counterindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days.
D. Methods of making the compositions
182. The compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
183. Disclosed are animals produced by the process of transfecting a cell within the animal with any of the nucleic acid molecules disclosed herein. Disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the animal is a mammal. Also disclosed are animals produced by the process of transfecting a cell within the animal any of the nucleic acid molecules disclosed herein, wherein the mammal is mouse, rat, rabbit, cow, sheep, pig, or primate.
184. Also disclosed are animals produced by the process of adding to the animal any of the cells disclosed herein.
E. Examples
185. The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and/or methods claimed herein are made and evaluated, and are intended to be purely exemplary of the invention and are not intended to limit the scope of what the inventors regard as their invention. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C or is at ambient temperature, and pressure is at or near atmospheric. 1. Example 1 a) Methods
(1) Mice 186. All animal procedures were approved by the Animal Care and Use
Committee of University of Rochester School of Medicine, in accordance with the NIH guidelines. Construction of targeting vectors and generation of the chimera founder mice have been described previously (Yeh,S, et al. (2002) Proc Natl Acad Sd USA 99:13498- 13503 and United States Patent Application 10/484,950 and PCT application PCT/US02/24234, all of which are incorporated herein at least for information related to making AR Knock Out (ARKO) mice). The strains of the mosaic founder mice were C57BL/6 and 129Sv background. β-Actin is a housekeeping gene and is universally
expressed in every tissue; therefore, the β-Actin promoter driven Cre (ACTB-Cre; Jackson Laboratories, Bar Harbor, ME) will express and delete floxed AR fragments in all the tissues. The AR-/y mice were genotyped by PCR, as described previously (Yeh,S, et al. (2002) Proc Natl Acad Sd USA 99:13498-13503). Animals were housed in pathogen free facilities, maintained on a 12-hour light/dark schedule (light on at 0600) and had free access to standard laboratory chow (no. 5010; PMI Lab Diet, St. Louis, MO) and water.
(2) Histology
187. Tissues were fixed in 10% neutral buffered formalin and imbedded in paraffin. Non-adjacent sections, separated by 70-80 μm, were obtained from perigonadal fat pads and analyzed systematically with respect to adipocyte size and number. Staining of the sections was performed with hematoxylin/eosin. Images were acquired using an E800 microscope (Nikon, Melville, NY) and a SPOT camera (Diagnostic Instruments, Sterling Heights, MI) and were analyzed using SigmaScan Pro (version 5.0; SPSS Inc., Chicago, IL) software. (3) Analytical Procedures
188. Fasting blood samples were taken from mice 14-h after withdrawal of food. Blood samples designated as random-fed state were drawn 6-h after introducing food into the cages of mice that had been subjected to a preceding 14-h fast. Blood glucose concentrations were measured using a glucometer (One Touch Ultra; Lifescan Inc., Milpitas, CA). Insulin levels and leptin levels were determined in duplicate 5 μl serum samples using a mouse insulin and leptin ELISA kit (Crystal Chem Inc., Downers Grove, IL) according to the manufacturer's protocol. Serum tumor necrosis factor-alpha (TNF-α) levels were determined in duplicate in 20 μl serum samples using a mouse TNF-α ELISA kit (eBioscience, San Diego, CA) according to the manufacturer's protocol. For the glucose tolerance test (GTT), after a 14-h fast, mice were given an oral bolus of D-glucose (2 g/kg body weight) and the blood glucose concentration was measured in samples taken at 0, 30, 60, 90, and 120 min after the glucose bolus. An Insulin tolerance test (ITT) was performed on 6-h fasting mice by intraperitoneal injection of 1 U/kg body weight human insulin (Sigma-Aldrich, St. Louis, MO). Blood glucose concentration was determined at 0, 30, 60, 90, and 120 min after insulin administration. Triglyceride (TG) levels in serum from fasting animals were determined using the GPO-Trinder Assay (Sigma-Aldrich). Serum free fatty acid (FFA) levels in fasting animals were measured using NEFA-Kit-U (Wako
Pure Chemical USA Inc., Richmond, VA). For determination of tissue TG content, 50-100 mg tissue pieces were homogenized on ice in pH 7.3 extraction buffer (20 mM Tris, 1 niM β-mercaptoethanol, 1 mM EDTA). Following centrifugation, the glycerol content of the supernatants was determined using the GPO-Trinder assay (Sigma- Aldrich) according to the manufacturer's instructions.
(4) Phosphoinositide-3-OH kinase (PI3K) activity.
189. Mice were subjected to 14-h fast, injected intraperitonelly with saline or insulin (10 U per kg (body weight)) and sacrificed 3 min after injection. Tissues were collected and frozen. PI3K activity was measured in phosphotyrosine immunoprecipitates (p-Tyr, Ab-4; EMD Biosciences, Inc., San Diego, CA) from white adipose tissue (WAT), skeletal muscle, and liver lysates as previously described (Goodyear,LJ, et al. (1995) J Clin Invest 95:2195-2204).
(5) Cell Culture, Transient Transfections, and Reporter Gene Assays 190. The human prostate cancer cell lines, LNCaP, PC-3, and DU145, were maintained in Dulbecco's minimum essential medium (DMEM) containing 5% fetal calf serum (FCS). Transfections using the calcium phosphate precipitation method and chloramphenicol acetyltransferase (CAT) and luciferase (Luc) assays were performed as previously described (Miyamoto et al. (1998) Proc. Natl. Acad. Sci. U.S.A. 95, 7379-7384; Yeh et al. (1999) Endocrine 11, 195-202; Miyamoto et al. (1998) Proc. Natl. Acad. Sci.
U.S.A. 95, 11083-11088). Briefly, 1-4 x 105 cells were plated on 35-mm or 60-mm dishes 24 h before adding the precipitation mix containing a CAT or Luc reporter gene and a β- galactosidase expression plasmid (pCMV- β -gal) as an internal control for normalization of transfection efficiency. The medium was changed to phenol-red-free DMEM with 5% charcoal-stripped FCS 1 h before transfection. In each experiment, the total amount of transfected DNA per dish was maintained as a constant by addition of empty expression vector (pSG5 or pVPlό, as appropriate). The medium was changed again 24 h after transfection, and the cells were treated with 1 nM of DHT or 1 μM of HF for 24 h. The cells were then harvested and whole cell extracts were used for CAT or Luc assay. The CAT activity was quantitated with a Phosphorlmager (Molecular Dynamics). The Luc assay was determined using a Dual-Luciferase Reporter Assay System (Promega) and luminometer.
(6) Glutathione S-transferase (GST) pull-down assay
191. GST-AR, Rb, ARA54, ARA55, ARA24, ARA70, ARA267, Gelsolin, Supervillin, and SRC-I fusion proteins and GST control protein were purified as described by the manufacturer (Amersham Pharmacia). The purified GST proteins were then resuspended in 100 μl of interaction buffer (20 mM HEPES/pH 7.9, 150 mM KCl, 5 mM MgCl2, 0.5 mM EDTA, 0.5 mM Dithiothreitol, 0.1% (v/v) NP-40, 0.1% (w/v) BSA and 1 mM PMSF) and mixed with 5 μl of [35S]-labeled TNT AR protein in the presence or absence of 1 μM ligand at 4oC for 3 hours. After several washes with NETN buffer, the bound proteins were separated by SDS/8% PAGE and visualized using autoradiography. (7) Western Blot
192. Western blotting analysis was performed in the stable LNCaP cells, using NH27 polyclonal antibody for the AR and monoclonal prostate-specific antigen (PSA) antibody (DAKO), as described previously (Miyamoto et al. (1998) Proc. Natl. Acad. Sd. U.S.A. 95, 7379-7384). An antibody for β-actin (Santa Cruz Biotechnology) was used as the internal control.
(8) Mammalian Two-Hybrid Assay
193. DUl 45 cells were transiently cotransfected with a GAL4-hybrid expression plasmid, a VP16-hybrid expression plasmid, the reporter plasmid pG5-CAT, and the pCMV-β-gal internal control plasmid. Transfections and CAT assays were performed as described above.
(9) Intraperitoneal leptin administration
194. Mice were divided into 2 groups and were treated once daily with equal volumes of intraperitoneal injections of saline or mouse leptin (R&D Systems Inc., Minneapolis, MN) dissolved in saline at 5 /xg/g (body weight) doses for 6 days. Food intake and changes in body weight were measured to estimate the effects of exogenous leptin administration.
(10) Establishment of wild type (WT) and AR-/y mouse embryonic fibroblast (MEF) cell lines
195. MEF cell lines were self-immortalized following the 3T9 protocol. Briefly, primary WT and ARVy MEFs were isolated from E 12.5 littermate embryos and cultured in
DMEM plus 10% (v/v) FBS. Early passage (less than 5) MEFs were then plated at a density of 2.5 x 106 cells per 25 ml flask. Every 3 days, cells were gently trypsinized and
re-plated at the same density. Cells were immortalized after 5 months of continuous culture.
196. Cell culture and Oil-Red O staining. Mouse 3T3-L1 preadipocytes (CLl 73; ATCC, Manassas, VA), WT, and AR-/y MEF cell lines were maintained in DMEM containing 10% (v/v) FBS. For differentiation, the medium was changed to DMEM supplemented with 10% (v/v) FBS, 10 μg/ml insulin, 0.5 mM 3-isobutyl-l-methylxanthine, and 1 μM dexamethasone at 2 days after reaching confluence and then incubated with 10 nM DHT or 100 nM DHT and with or without hydroxyflutamide (HF). The media containing either of the drugs were renewed every other day. Nine days after stimulation and incubation with these drugs, cells were fixed with 10% formaldehyde for 1-h and then with 0.1 mg/ml Oil-Red O solution for 2-h at room temperature. All liquid in each well was removed and 100 μ\ of isopropyl alcohol was added to dissolve the precipitation. The OD at 510 nm was determined by ELISA spectrometry.
(11) Real-time quantitative RT-PCR 197. Mouse WATs, skeletal muscles, and livers from WT and AR"/y were dissected and total RNA isolated by using a TRIzol reagent (Invitrogen Corp., Carlsbad, CA). cDNA synthesis and PCR were performed using Superscript™ RNase H" Reverse Transcriptase and cDNA cycle kit (Invitrogen Corp.) according to the manufacturer's instructions. Real-time PCR was performed using icycler real-time PCR amplifier (Bio- Rad Laboratories, Hercules, CA). Each PCR reaction contained 1 μ\ cDNA, 50 μM primers and 12.5 μ\ iQ™ SYBR green supermix reagent (Bio-Rad Laboratories) and was triplicated. 18s was used as an internal control. A list of the primer sequences for real-time PCR is available in Table 3.
TABLE 3
Primers used for real-time PCR for assaying mRNA expression related lipid metabolism in WAT, liver, and skeletal muscle
Gene Access Forward Primer Reverse Primer Amplicon (bp) number aP2 M13385 AAGGAAAGTGGCAGGCATGG CACGCCCAGTTTGAAGGAAATC 118
C/EBPα BC028890 CAAGAACAGCAACGAGTACC AGGCGGTCATTGTCACTG 135
PPARα X57638 CGGGAAAGACCAGCAACAAC TGGCAGCAGTGGAAGAATCG 142 PPARγ NMOl 1146 CGAGGACATCCAAGACAAC TGTGACGATCTGCCTGAG 124
SREBPIc NMOl 1480 CTGGCTGAGGCGGGATGA TACGGGCCACAAGAAGTAGA 290
(12) Statistical analyses
198. All values are presented as mean ± SE. Differences between two groups were assessed using unpaired two-tailed Student's t-test or among more than two groups by ANOVA. In all Statistical comparisons, P < 0.05 was defined as a significant difference. SigmaStat statistics software (version 2.0; SPSS Inc.) was used for all calculations.
(13) DHT replacement study
199. A 60-day time-release 5α-DHT (5 mg) and placebo pellet (Innovative Research of American, Sarasota, FL), inserted into a subcutaneous pocket (posterior neck region) of male WT and AR"/y mice, respectively. Eight weeks after implantation of the pellet, the mice were sacrificed to study serum hormones and metabolic parameters. b) Results
(1) Loss of AR is associated with fat accumulation and altered metabolic profiles. 200. Using Cre/loxP-mediated recombination by crossing AR-loxP mice with
ACTB-Cre mice, mice lacking AR in mixed C57BL/6/129Sv/FVB background were generated (Yeh,S, et al. (2002) Proc Natl Acad Sd U.S.A. 99:13498-13503). Male WT and knockout AR-/y mice were used for the present studies. Since the AR-/y mice were phenotypically female in appearance, female WT mice were also used as an additional comparison group for phenotypic analysis. The growth curves of male WT, female WT, and AR-/y mice showed that AR-/y mice exhibited a significant decrease in the body weight gain throughout the 20th week as compared to male WT mice (Fig. IA). The body weight of male WT and AR-/y mice was significantly greater at all timepoints after 8 weeks as compared to female WT littermates. However, body weight gain was significantly greater in AR-/y mice after 22 weeks as compared to their male WT and female WT littermates throughout the 40- week study period (male WT: 36.0 ± 1.3 g; female WT: 26.35 ± 0.59 g; AR-/y: 40.87 ± 1.0 g; P = 0.009 for male WT versus AR-/y; n = 9). This was accompanied by significantly enlarged gonadal and perirenal fat pads compared with male WT and female WT counterparts (Fig. 1 B, C, and Table 4).
TABLE 4
Physiological and metabolic parameters of 35-week-old study groups
Genotype
Male WT Female WT AK/y n 9 10 9
Body weight (g) 33.15 ± 1.2 25.81 ± 0.44 39.06 ± 2.7 *
Gonadal fat/body (%) 2.21 ± 0.14 0.34 ± 0.08 3.29 ± 0.23 *
Serum TG (mmol/1) 0.30 ± 0.04 0.32 ± 0.08 0.67 ± 0.1 f
Serum NEFA (mEq/1) 0.25 ± 0.02 0.25 ± 0.02 0.71 ± 0.04 $
Serum cholesterol (mmol/1) 2.28 ± 0.05 2.28 ± 0.06 2.44 ± 0.05
Fasting blood glucose (mmol/1) 6.46 ± 0.31 6.41 ± 0.27 7.94 ± 0.38 *
Fed blood glucose (mmol/1) 14.03 ± 0.54 14.93 ± 0.29 19.75 ± 0.78 %
Fasting serum insulin (ng/ml) 0.55 ± 0.13 0.53 ± 0.33 0.88 ± 0.33 *
Fed serum insulin (ng/ml) 0.92 ± 0.17 1.12 ± 0.14 1.54 ± 0.16 *
Values are mean ± SE. After a 14-h fast, animals were sacrificed. TG, total TG;
NEFA, nonesterified fatty acids. *P < 0.05, fP < 0.01, JP < 0.001 AK/y versus male WT.
201. Aging obesity profiles are consistent with previous findings (Matsumoto,T, et al. (2003) J.Steroid Biochem.Mol.BioL 85:95-99; Sato,T, et al. (2003) Biochem. Biophys. Res. Commun. 300:167-171). Circulating TG levels of AR-/y mice was increased by 2 fold as compared to male WT and female WT mice (Table 3). Notably, histological analysis of WATs after fixation (Fig. IB) and quantification of adipocyte size (Fig. 1C) revealed that adipocytes from 35-week-old AR-/y mice were significantly larger than those in WT counterparts. The comparison data for muscle mass and bone mass showed no significant difference in those tissue masses between WT and AR-/y mice. Although obvious enlargement of adipose tissues can be seen from intra-abdominal appearance in AR7y mice, this only accounts for -15% increased body weight in AR-Vy mice as compared to WT mice. These results indicate that AR-/y mice had marked increased adiposity at an older age.
(2) Development of insulin resistance in AR"/y mice.
202. Given the excess lipid deposition in WAT, blood glucose and insulin levels were examined in male WT, female WT, and AR"/y mice. AR~/y mice start to show elevated blood glucose at 20 weeks, which persisted to at least 35 weeks under both the fasting and fed conditions (Table 4). The hyperglycemia occurred despite a marked increase in serum insulin levels in the fasting (-60%) and fed (-67%) states. (Table 4), indicating that AR"/y mice were more resistant to insulin than their WT counterparts under ambient conditions.
203. To assess whole-body glucose homeostasis, oral bolus GTT and intraperitoneal ITT were performed on these mice. Oral bolus GTT demonstrated marked glucose intolerance and distinguishable AUC in AR~/ymice (Fig. 2 A and B). Blood glucose levels of AR"/y mice were greater at all times during the test and hyperglycemia was still apparent 2-h after the glucose bolus. ITT showed that AR'/y mice were slightly resistant and highly resistant to the hypoglycemic effect of exogenous insulin at both 25- and 35-week- old, respectively (Fig. 2C and D). The defect in whole-body insulin sensitivity was not due to female-like phenotype in AR"/y mice, because no differences were detected in the response patterns of male WT and female WT mice.
204. As insulin resistance can be correlated to the activity of PI3K, a signaling mediator that is needed for many metabolic effects of insulin, insulin-stimulated PI3K activity was examined using WT mice as controls. The PI3K activity upon insulin stimulation in AR" y mice was reduced by 60-63% in insulin target organs, such as skeletal muscle and liver (Fig. 2E), suggesting that AR"/y mice did have skeletal muscle and hepatic insulin resistance and hyperinsulinemia with obesity.
(3) Increased lipid deposition and leptin levels in AR"/y mice. 205. Serum FFA levels in the fasting state are elevated in AR"/y mice (Table 4).
Moreover, the skeletal muscle and hepatic TG contents markedly increased by 2.6 fold and 1.9 fold, respectively, indicating that insulin resistance was associated with increasing TG deposition in the skeletal muscle and liver (Fig. 2F).
206. Also observed was that from the increased WAT mass, fed serum leptin concentrations were higher in AR"/y mice at both 25- and 35-week-old (Fig. 3A). Moreover, serum leptin levels show elevated linear relationships with body weight in AR"/y mice as compared with WT littermates (Fig. 3B). Surprisingly, fed serum leptin levels were also
higher despite the tact that AR"/y mice gained significantly less weight before 20-week-old (Fig. 3A), indicating loss of AR can cause increased leptin earlier than increased body weight. Adiponectin, an insulin-sensitizing adipokine, was reduced in AR"/y mice (Fig. 3C), whereas TNF-α was no difference (Fig. 3D). (4) Development of leptin resistance in AR/y mice.
207. It was also found that food intake and body weight was significantly reduced following an exogenously administrated leptin in WT mice, but not in AR'/y mice (Fig. 4, A and B). Furthermore, food intake was not significantly different in AR"/y mice as compared with that in WT mice before exogenous leptin administration despite elevated leptin levels, indicating AR"/y mice were leptin resistant at 35-week-old. However, the food intake and body weight were reduced following an exogenous load of leptin in both 20-week-old AR" y mice and WT mice, whereas two study groups have similar body weight and adiposity (Fig. 4, C and D). These results indicate that AR"/y mice develop leptin resistance that can be due to development of adiposity and long-term absence of AR. (5) Loss of AR altered the lipid metabolic profiles.
208. To determine the mechanism of the increased lipid deposition in WAT, as well as skeletal muscle and hepatic TG accumulation, mRNA from these tissues were further analyzed. The mRNA levels of four lipid metabolism genes, peroxisome proliferators-activated receptor gamma (PP ARγ), CCAAT/enhancer-binding protein alpha (C/EBPα), adipocyte fatty acid binding protein/adipocyte P2 (aP2), and sterol regulatory element-binding protein Ic (SREBPIc), were higher in WAT of AR'/y as compared to WT mice (Table 5), indicating loss of AR can contribute to the increase of adipogenesis and lipogenesis via stimulation of several genes, such as lipid metabolism genes.
TABLE 5
Expression of lipid metabolism genes in WAT, liver, and skeletal muscle in AR'^ mice as quantified by real-time RT-PCR
Gene ΔΔCx (Avg. Normalized amount relative
ΔCτ - Avg. to WT 2-ΔΔCτ
ΔCT.WT
WAT
PPARγ -1.40 ± 0.81 2.6 (1.5-4.6)
C/EBPce -3.98 ± 0.22 15.8 (13.5-18.4)
SREBPIc -2.28 ± 0.58 4.9 (3.2-7.3) aP2 -0.43 ± 0.17 1.35 (1.20-1.52)
Liver
PPARα 3.13 ± 0.45 0.11 (0.08-0.16)
Skeletal Muscle
PPARα 2.36 ± 0.13 0.19 (0.18-0.21)
Moreover, consistent with TG accumulation, loss of AR reduced mRNA levels of peroxisome proliferators-activated receptor alpha (PP ARa) in skeletal muscle and liver (Table 5). These results indicate that AR is directly or indirectly involved in lipid metabolism.
(6) DHT replacement failed to reverse the metabolic abnormalities and insulin resistance in AR"/y mice
209. As serum T levels were markedly decreased due to atrophic testes in AR"/y mice, it was impossible to exclude the possibility that the insulin resistance and metabolic abnormalities in AR" y mice simply reflected the low levels of androgens. To address this issue, nonaromatizable androgen DHT was given to AR" y and WT littermates to both 26- week-old mice and 12-week-old mice. Several serum hormones and metabolic parameters were assessed after 8 weeks of pellet implantation. DHT replacement restored serum DHT levels to within the physiological range (0.6-0.9 ng/ml) in AR"/y mice. It is known that estradiol is converted not only from estrone but also T, therefore it was also impossible to exclude another possibility that the abnormalities in AR"/y mice simply reflected less estrogen converted from T, but it was found that serum estradiol levels, as well as levels of the prohormone androstenedione remained unchanged in AR"/y mice compared to WT mice
s O I
total TG; NEFA, nonesteriϊϊed fatty acids for mice. The IR index is the product versus sham male WT.
>r>
W
O
nonesterified fatty I The IR index is versus sham male
idld ditaaogvees ;c emoa i na ce an L< ii bidlttuewees insn i: ;
JHhH it tma esu ;e i anncιi..
2 diabetes mellitus in men (Defay,R, et al. (1998) Int.J.Obes.Relat Metab Disord. 22:927- 934; Haffher,SM, et al. (1996) J.Clin.Endocrinol.Metab 81:3697-3701). The results disclosed herein demonstrate that mice lacking AR develop insulin and leptin resistance at an advanced age. Late onset of obesity, as observed in AR-/y mice, was reported to be associated with insulin resistance (Kubota,N, et al. (1999) MoI Cell 4:597-609). The marked hyperinsulinemia and hyperglycemia in AR"/y mice clearly demonstrate that loss of AR can reduce insulin sensitivity. A relatively small increase in body weight (-15%) is associated with a remarkable reduction in insulin sensitivity (~65%) in AR"/y mice, and insulin resistance that occurs as early as 20 weeks of age in non-obese AR"/y mice, indicating that loss of AR can directly reduce insulin sensitivity in target tissues without first increasing body weight significantly.
211. The phenotypically female appearance of AR" y mice is similar to that of testicular feminized (Tfm) mice in which AR is functionally deficient by introduction of the Tfm mutation in the AR gene (He5WW, et al. (1991) Nucleic Acids Res. 19:2373- 2378). To this regard, female WT mice were added for comparison, and these mice remain smaller and have less adiposity than both male WT and AR-/y mice. In addition, no significantly distinguishable metabolic pattern was found between female WT and male WT mice, whereas AR-/y mice exhibited severe insulin resistance and obesity. A previous study has showed that db/db Tfm/Y males develop severe diabetes. In contrast, female db/db littermates only exhibit mild hyperglycemia (Prochazka,M, and Leiter,EH. (1991) HormMetab Res. 23:149-154).
212. The excess fat mass in AR'/y mice can be due to an impaired ability of skeletal muscle to use lipid as fuel substrate and of liver to catabolize lipid, leading to a shunting of lipid to adipose tissue. In fact, the unchanged food intake in AR"/y mice indicates that the excess weight gain and adiposity can be due to normal energy input coupled with reduced lipid oxidation and increased lipid storage. Indeed, impairment in hepatic lipid oxidation resulted in elevated circulating FFA, and hepatic steotosis in PPARα-null mice (Kersten,S, et al. (1999) J.Clin.Invest 103:1489-1498). Activation of PP ARa by fibrates reduces adiposity in fa/fa Zucker diabetic fatty (ZDF) rats by the activation of several peroxisomal and mitochondrial fatty acid oxidation genes (Guerre- MiIIo5M, et al. (2003) J.Biol.Chem. 275:16638-16642). Given that skeletal muscle and liver are the major sites of lipid oxidation and deposition, respectively, it is possible that
loss of PP ARo; could produce such an effect. Consistent with this possibility, the decreased PPARo; expression in skeletal muscle, decreased hepatic lipid metabolism, and the subsequent alterations in expression of genes that stimulate adipocyte differentiation (PPARγ(Kubota,N, et al. (1999) MoI Cell 4:597-609), C/EBPα (Loftus,TM, et al. (1997) Curr.Opin.Genet.Dev. 7:603-608), and SREBPIc (Kim,JB, et al. (1998) J.Clin.Invest 101:1-9)) and lipid accumulation (aP2 (Hotarnisligil,GS, et al. (1996) Science 274:1377- 1379)) in WAT were found in AR-/y mice. Furthermore, liver-specific AR knockout mice, which are more susceptible to high-fat diet (HFD) -induced insulin resistance, showed lower hepatic PPARo; expression. Recent studies using hyperinsulinemic-euglycemic clamp have shown that PPAROHIUU mice are not protected against HFD-induced insulin resistance (Haluzik,M, et al. (2004) Endocrinology 145:1662-1667). Thus, loss of PPARo: expression in AR" y mice can be a mechanism contributing to the decreased insulin sensitivity observed.
213. Also skeletal muscle and hepatic insulin resistance in AR"/y mice can be secondary to altered release of adipokine. Leptin increased insulin sensitivity and concomitantly reduced TG content by promoting lipid oxidation in animal models of insulin resistance and in humans with lipodystrophic diabetes (Petersen,KF, et al. (2002) J.Clin.Invest 109:1345-1350). The AR-Iy mice with elevated leptin, however, have significant leptin resistance when exogenous leptin is administered. Related results have been observed in ZDF rats, ob/ob mice that lack leptin, and db/db mice that have an inactive leptin receptor, and the livers of such mice are all steatotic (Lee, Y, et al. (2001) J.Biol.Chem. 276:5629-5635; ShimomuraJ, et al. (1999) J.Biol.Chem. 274:30028-30032). In ZDF rats, the skeletal muscle, pancreas, and heart are also steatotic (FlierJS. (1997) Proc.Natl.Acad.Sci. U.S.A 94:4242-4245). A strong correlation between intracellular TG content and insulin resistance has been established in both human and animal studies of obesity-related insulin resistance and type 2 diabetes (Unger,RH, and Orci,L. (2001) FASEB J. 15:312-321). Consistent with this possibility, a substantial ectopic deposition of TG in nonadipocytes such as skeletal muscle and liver in AR-/y mice is a central element. TG overload of nonadipocytes cause, respectively, insulin resistance, lipotoxic heart disease and adipogenic type 2 diabetes (Unger,RH, and Orci,L. (2000) Int.J.Obes.Relat
Metab Disord. 24 Suppl 4:S28-S32). It was also demonstrated, through PI3K activity assay following injection of insulin, that skeletal muscle and liver in AR-/y mice are insulin
resistant. Interestingly, PP ARa is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissues, hi PPARα-null mice infused with adenovirus-leptin, up- regulation of carnitine palmitoyl transferase- 1 rnENA in fat, down-regulation of acetyl CoA carboxylase in liver, and up-regulation of PPARγ coactivator-1 alpha rnRNA in both tissues are abolished, as is the reduction in their TG content, indicating that leptin action may be mediated through PP ARa (Lee, Y, et al. (2002) Proc.Natl.Acad.Sd. U.S.A 99: 11848-11853). Thus, loss of PP ARa in AR-/y mice can reduce leptin action despite elevated leptin levels. In contrast, decreased adiponectin and no elevation of serum TNF-α (another adipokine that contributes to insulin resistance) (Hotamisligil,GS. (1999) J Intern Med 245:621-625) was found in AR-/y mice at 35-week-old, whereas mice lacking adiponectin exhibited severe insulin resistance (Yamauchi,T, et al. (2001) Nat.Med. 7:941- 946). However, it is known that other adipokines also mediate the metabolism of lipids and contribute to the pathogenesis of insulin resistance.
214. Indirect interactions of AR and PP ARa through nuclear receptor coregulators are possible. ARA70, a coactivator of the AR, was able to physically interact with PP ARa as determined by coimmunoprecipitation. In the adrenal cell line Yl, ARA70 behaved as a repressor of PP ARa (Heinlein,C A, and Chang,C. (2003) Endocrine. 21:139-146). An early study indicated that in primary rat adipocytes expressing AR, testosterone and DHT were able to suppress leptin mRNA and leptin secretion (Machinal,F, et al. (1999) Endocrinology 140:1567-1574), suggesting a direct effect of testosterone on the regulation of leptin secretion in adipocytes. Additionally, using 3T3-L1 cells, it was demonstrated that DHT inhibited the adipogenesis of preadipocytes in vitro. This indicates that a direct effect of AR also exists at the level of adipogenesis in adipocytes.
215. Taken together, these data indicate that loss of AR can contribute to an increase of leptin levels and leptin resistance, which can play important roles for the development of obesity and insulin resistance. A previous study using transgenic mice overexpressing leptin demonstrated that loss of the leptin effectiveness in older transgenic mice might contribute to the accumulation of adipose mass (Qiu,J, et al. (2001) Endocrinology 142:348-358). Consistent with this possibility, the AR-/y mice were progressively desensitized to leptin due to long-term elevated circulating leptin throughout the 40-week study period. In rats, testosterone was reported to be associated negatively with serum leptin, independent of body mass index (Li5H, et al. (1997) Diabetes 46:2035-
2039). Leptin levels axe higher in aging men with lower testosterone (Luukkaa,V, et al. (1998) J.Clin.Endocrinol.Metab 83:3243-3246). Furthermore, low testosterone may lead to the accumulation of visceral fat (Cohen,PG. (2001) Med Hypotheses 56:702-708). As total body fat mass increases, resistance develops to both leptin and insulin. Elevated leptin fails to stimulate weight loss and the hypogonadal-obesity cycle ensures further visceral obesity and insulin resistance. In the present study, AR-/y mice progressively develop leptin resistance and insulin resistance, resulting in obesity. This differs from the ob/ob and db/db mice that display early onset genetic obesity and have leptin inactivity from a very early stage (Tschop,M, and Heiman,ML. (200I) E*/?. Clin. Endocrinol. Diabetes. 109:307-319). ARrIy mice have milder obesity due to the late onset of leptin and insulin resistance. However, leptin resistance in AR-/y mice that is similar with db/db mice, whereas dysfunctional leptin receptor is likely to be a major factor. Progressive insulin resistance can then lead to type 2 diabetes and other diseases, such as high TG-low high density lipoprotein pattern dyslipidemia, and the metabolic syndrome X, as well as increased risk of cardiovascular diseases (Cohen,PG. (2001) Med Hypotheses 56:702-708). It has been reported that hypotestosteronemia may be a risk factor for coronary artery diseases in men (Phillips,GB, et al. (1994) Arterioscler Thromb 14:701-706).
216. Interestingly, not only lacking AR results in a metabolic syndrome, but both estrogen receptor alpha absence (Heine,PA, et al. (2000) Proc.Natl.Acad.Sci. U.S. A 97: 12729-12734) and aromatase deficiency which loss of the ability to synthesis estrogen (Jones,MΕ, et al. (2000) Proc.Natl.Acad.Sci. U.S.A 97:12735-12740) result in a metabolic syndrome. These observations indicate a possibility that loss of both androgen and estrogen responsiveness disrupt energy homeostasis.
217. AR"/y mice not only have an AR deficiency but also have decreased serum levels of androgens. In this regard, in AR'/y mice, treatment with nonaromatizable DHT restored the physiological serum DHT levels, whereas estrogen levels remained unchanged as compared to WT mice. Thus, the possibility of lacking estrogen receptor alpha (ERa) activation resulting in increased WATs, as seen in male mice deficient in either ERa or aromatase, can be excluded. Importantly, no reversed effect was found after DHT treatment, indicating that insulin resistance in AR" y mice, disclosed herein, is mediated directly via AR.
218. In summary, AR"/y mice provide an in vivo model showing that loss of AR increases serum leptin concentration and skeletal muscle/hepatic TG content, which can result in the development of obesity, leptin resistance, and insulin resistance. As obesity and progressive insulin resistance can lead to type 2 diabetes and an increased risk of cardiovascular diseases (Fernandez-Real,JM, and Ricart,W (2003) Endocr Rev 24:278- 301), a better understanding of the molecular mechanisms involved, and dissection of the roles of A-AR in insulin and leptin resistance can help in the development of better therapeutic approaches to type 2 diabetes, obesity, and other cardiovascular diseases.
2. Example 2: Dysregulation of Lipid Metabolism and Insulin Signaling Accelerates Diet-Induced Hepatic Steatosis and Insulin
Resistance in Mice Lacking Hepatic Androgen Receptor
219. In order to investigate the role of hepatic androgen receptor (AR) in the pathogenesis of hepatic steatosis and insulin resistance, hepatic AR knockout (AlC y') mice were generated by crossbreeding floxAR mice with albumin-Cre mice. The AR^" y' mice showed similar growth curve to wild-type mice (Figure IA-B. Whole-body insulin action in awake AR(Wy) and wild-type (wt) mice fed a high-fat diet (HFD) for 8 weeks was examined. In contrast to high-fat-fed wt mice, AR(L"/y) mice exhibit greater cumulative weight gain and increased serum glucose levels while being fed on a HFD for 24, 36, and 52 weeks (Figure 5C-F). AR(L"/y) mice were also marked by increase fat vacuoles in the liver (Figure 6). Additionally, compared with WT mice, AR^^ mice on a HFD displayed more hepatic steatosis, and a type 2 diabetes phenotype, characterized by hypertriglyceridemia, hyperinsulinemia, hyperglycemia, and insulin resistance possibly due to a decreased insulin-mediated PI3K activation (Figure 7, Figure 8, and Table 8).
Table 8. Glucose tolerance test (GTT) and insulin resistance (IR) index in male WT and AR(L7y) mice treated with chow or HFD at 16 weeks old or 35 weeks old.
GTT area (cmz) IR index
Group (16 weeks) Glucose Insulin Glucose x Insulin
WT chow 48.95 1.026 50.22
WT HFD 63.44 1.605 101.82
AR(Wy) chow 59.13 1.140 67.41
A11(L-Zy) jjpD 74.28 2.958 219.72
Group (35 weeks)
WT chow 31.96 2.071 66.19
WT HFD 64.51 4.593 296.29
AR(L-/y) chow 30.36 2.062 62.60
AR(L-Zy) Hpr, 57.08 9.369 534.78
Area of glucose and insulin curves was calculated by multiplying the cumulative mean height of the glucose values (lmg/ml = lcm) and insulin values (lng/ml = lcm), respectively, by time (60min = lcm). IR index was calculated the product of the area of glucose and insulin x IQ2
220. The mRNA levels of the gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and hepatic nuclear factor-4 alpha were upregulated in livers of ABSUy^ mice as compared with wt mice fed with high-fat diet. Loss of hepatic AR increased sterol regulatory element-binding protein- Ic, a key regulator of lipogenic gene transcription, and its downstream target mRNAs, as well as increased hepatic lipid accumulation. Loss of hepatic AR was also associated with a decrease in peroxisomal proliferator-activated receptor alpha mRNA expression, and a trend toward decreased fatty acid /3-oxidation.
221. Together, these data indicate that AR in liver plays an important role in pathogenesis of the metabolic syndrome by concordantly modulating lipid metabolism and insulin signaling. AJR. serves as a novel target for treatment of hepatic steatosis and hepatic insulin resistance.
F. References
United States Patent No. 6,828,313
Burks,DJ, de Mora,JF, Schubert,M, Withers,DJ, Myers,MG, Towery,HH, Altamuro,SL, Flint, CL, White,MF: IRS-2 pathways integrate female reproduction and energy homeostasis. Nature 407:377-382, 2000
Chang,CS, KokontisJ, Liao,ST: Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240:324-326, 1988
Chen,H, Charlat,O, Tartaglia,LA, WooUζEA, Weng,X, ElHs5SJ, Lakey,ND, Culpepper,J, Moore,KJ, Breitbart,RE, Duyk,GM, Tepper,RI, Morgenstern,JP: Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491-495, 1996
Chua,SCJ, Chung, WK, Wu-Peng,XS, Zhang, Y, Liu,SM, Tartaglia,L, Leibel,RL: Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271:994-996, 1996 Cohen,PG: Aromatase, adiposity, aging and disease. The hypogonadal-metabolic- atherogenic-disease and aging connection. Med Hypotheses 56:702-708, 2001
Defay,R, Papoz,L, Barny,S, Bonnot-Lours,S, Caces,E, Simon,D: Hormonal status and NIDDM in the European and Melanesian populations of New Caledonia: a case-control study. The CALedonia DIAbetes Mellitus (CALDIA) Study Group. Int. J. Obes. Relat Metab Disord. 22:927-934, 1998
Economic consequences of diabetes mellitus in the U.S. in 1997. American Diabetes Association. Diabetes Care 21:296-309, 1998
Endre,T, Mattiasson,L Berglund,G, Hulthen,UL: Low testosterone and insulin resistance in hypertension-prone men. J Hum. Hypertens. 10:755-761, 1996 Fernandez-Real,JM, Ricart,W: Insulin resistance and chronic cardiovascular inflammatory syndrome. EndocrRev 24:278-301, 2003
Flier, JS: Leptin expression and action: new experimental paradigms. Proc. Natl. Acad. ScL U.S.A 94:4242-4245, 1997
Friedman, JM, HalaasJL: Leptin and the regulation of body weight in mammals. Nature 395:763-770, 1998
Gale,EA, Gillespie,KM: Diabetes and gender. Diabetologia 44:3-15, 2001
Goodyear,LJ, Giorgino,F, Sherman,LA, Carey,J, Smith,RJ, Dohm,GL: Insulin receptor phosphorylation, insulin receptor substrate-1 phosphorylation, and phosphatidylinositol 3- kinase activity are decreased in intact skeletal muscle strips from obese subjects. J Clin Invest 95:2195-2204, 1995
Guerre-Millo,M, Gervois,P, Rasρe,E, Madsen,L, Poulain,P, Derudas,B, Herbert,JM, Winegar,DA, Willson,TM, FruchartJC, Berge,RK, Staels,B: Peroxisome proliferator-
activated receptor alpha activators improve insulin sensitivity and reduce adiposity. J. Biol. Chem. 275:16638-16642, 2000
Haffher,SM, Laakso,M, Miettinen,H, Mykkanen,L, Karhapaa,P, Rainwater,DL: Low levels of sex hormone-binding globulin and testosterone are associated with smaller, denser low density lipoprotein in normoglycemic men. J Clin. Endocrinol. Metab 81:3697-3701, 1996
Haluzik,M, Gavrilova,O, LeRoith,D: Peroxisome proliferator-activated receptor-alpha deficiency does not alter insulin sensitivity in mice maintained on regular or high-fat diet: hyperinsulinemic-euglycemic clamp studies. Endocrinology 145:1662-1667, 2004
Hamilton,BS, Paglia,D, Kwan,AY, Deitel,M: Increased obese mRNA expression in omental fat cells from massively obese humans. Nat Med 1 :953-956, 1995
Hausberg,M, Morgan,DA, MitchellJL, Sivitz,WI, Mark,AL, Haynes,WG: Leptin potentiates thermogenic sympathetic responses to hypothermia: a receptor-mediated effect. Diabetes 51:2434-2440, 2002
He3WW, Kumar,MV, Tindall,DJ: A frame-shift mutation in the androgen receptor gene causes complete androgen insensitivity in the testicular-feminized mouse. Nucleic Acids Res. 19:2373-2378, 1991
Heine,PA, Taylor, JA, Iwamoto,GA, Lubahn,DB, Cooke,PS: Increased adipose tissue in male and female estrogen receptor-alpha knockout mice. Proc. Natl. Acad. Sd. U.S. A 97:12729-12734, 2000 Heinlein,CA, Chang,C: Androgen receptor (AR) coregulators: an overview. Endocr. Rev. 23:175-200, 2002
Heinlein,CA, Chang,C: Induction and repression of peroxisome proliferator-activated receptor alpha transcription by coregulator ARA70. Endocrine. 21 : 139-146, 2003
Hotamisligil,GS, Johnson,RS, Distel,RJ, Ellis,R, Papaioannou,VE, Spiegelman,BM: Uncoupling of obesity from insulin resistance through a targeted mutation in aP2, the adipocyte fatty acid binding protein. Science 274:1377-1379, 1996
Hotamisligil,GS: The role of TNFalpha and TNF receptors in obesity and insulin resistance. J Intern Med 245:621-625, 1999
Jones,ME, Thorburn,AW, Britt,KL, Hewitt,KN, Wreford,NG, ProiettoJ, Oz5OK, Leury,BJ, Robertson,KM, Yao,S, Simpson,ER: Aromatase-deficient (ArKO) mice have a phenotype of increased adiposity. Proc. Natl. Acad. Sd. U.S.A 97:12735-12740, 2000
Kersten,S, Seydoux,J, PetersJM, Gonzalez,FJ, Desvergne,B, Wahli,W: Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J. Clin.Invest 103:1489-1498, 1999 KimJB, Sarraf,P, Wright,M, Yao,KM, Mueller,E, Solanes,G, Lowell,BB, Spiegelman,BM: Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J. Clin. Invest 101:1-9, 1998
Kubota,N, Terauchi,Y, Miki,H, Tamemoto,H, Yamauchi,T, Komeda,K, Satoh,S, Nakano,R, IshiijC, Sugiyama,T, Eto,K, Tsubamoto,Y, Okuno,A, Murakami,K, Sekihara,H, Hasegawa,G, Naito,M, Toyoshima,Y, Tanaka,S, Shiota,K, Kitamura,T, Fujita,T, Ezaki,O, Aizawa,S, Kadowaki,T: PPAR gamma mediates high-fat diet-induced adipocyte hypertrophy and insulin resistance. MoI Cell 4:597-609, 1999
Lee,GH, Proenca,R, Montez,JM, Carroll,KM, DarvishzadehJG, Lee,JI, Friedman, JM: Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632-635, 1996
Lee, Y, Wang,MY, Kakuma,T, Wang,ZW, Babcock,E, McCorkle,K, Higa,M, Zhou, YT, Unger,RH: Liporegulation in diet-induced obesity. The antisteatotic role of hyperleptinemia. J. Biol. Chem. 276:5629-5635, 2001
Lee, Y, Yu9X, Gonzales,F, Mangelsdorf,DJ, Wang,MY, Richardson,C, Witters,LA, Unger,RH: PPAR alpha is necessary for the lipopenic action of hyperleptinemia on white adipose and liver tissue. Proc. Natl. Acad. ScL U.S.A 99: 11848-11853, 2002
Li5H, Matheny,M, Nicolson,M, Tumer,N, Scarpace,PJ: Leptin gene expression increases with age independent of increasing adiposity in rats. Diabetes 46:2035-2039, 1997
Livingstone,C, Collison,M: Sex steroids and insulin resistance. CHn. ScL (Lond) 102:151- 166, 2002
Loftus,TM, Lane,MD: Modulating the transcriptional control of adipogenesis. Curr. Opin. Genet. Dev. 7:603-608, 1997 Luukkaa,V, Pesonen,U, Huhtaniemi,I, Lehtonen,A, Tilvis,R, TuomilehtoJ, Koulu,M, Huupponen,R: mverse correlation between serum testosterone and leptin in men. J. Clin. Endocrinol. Metab 83:3243-3246, 1998
MachinaLF. Dieudonne,MN, Leneveu,MC, Pecquery,R, Giudicelli,Y: In vivo and in vitro ob gene expression and leptin secretion in rat adipocytes: evidence for a regional specific regulation by sex steroid hormones. Endocrinology 140:1567-1574, 1999
MatsumotOjT, Takeyama,K, Sato,T, Kato,S: Androgen receptor functions from reverse genetic models. J. Steroid Bioch em. MoI. Biol. 85:95-99, 2003
Messer, WS., Jr http://www.neurosci.pharm.utoledo.edu/MBC3320/androgens.htm, , This page was last updated on Wedneday, April 19, 2000 at 5:23 p.m. Petersen,KF, Oral,EA, Dufour,S, Befroy,D, Ariyan,C, Yu5C, Cline,GW, DePaoli,AM,
Taylor,SI, Gorden,P5 Shulman,GI: Leptin reverses insulin resistance and hepatic steatosis in patients with severe lipodystrophy. J. CHn. Invest 109:1345-1350, 2002
Phillips,GB, Pinkernell5BH, Jing,TY: The association of hypotestosteronemia with coronary artery disease in men. Arterioscler Thromb 14:701-706, 1994 Prochazka,M, Leiter,EH: Effect of androgen insensitivity on diabetogenesis in db/db male mice with testicular feminization (Tfm). Horm. Metab Res. 23:149-154, 1991
Qiu,J, Ogus,S, Lu5R5 Chehab5FF: Transgenic mice overexpressing leptin accumulate
adipose mass at an older, but not younger, age. Endocrinology 142:348-358, 2001
Saad,MF, Knowler,WC, Pettitt,DJ, Nelson,RG, Mott,DM5 Bennett,PH: Sequential changes in serum insulin concentration during development of non-insulin-dependent diabetes. Lancet 1:1356-1359, 1989 Sato,T, Matsumoto,T, Yamada,T, Watanabe,T, Kawano,H, Kato,S: Late onset of obesity in male androgen receptor-deficient (AR KO) mice. Biochem. Biophys. Res. Commun. 300:167-171, 2003
Shimomura,! Bashmakov,Y, HortonJD: Increased levels of nuclear SREBP-Ic associated with fatty livers in two mouse models of diabetes mellitus. J. Biol. Chem. 274:30028-30032, 1999
Solo et al., "Ring-D-bridged steroid analogs. 8. Testosterone analogs," J Med Chem. 1970 Jul;13(4):751-4
Tschop,M, Heiman,ML: Rodent obesity models: an overview. Exp. Clin. Endocrinol. Diabetes 109:307-319, 2001 Unger,RH, Orci,L: Diseases of liporegulation: new perspective on obesity and related disorders. FASEB J. 15:312-321, 2001
Unger,RH, Orci,L: Lipotoxic diseases of nonadipose tissues in obesity. Int. J. Obes. Relat Metab Disord. 24 Suppl 4:S28-S32, 2000
WiId3S, Roglic,G, Green,A, Sicree,R, King,H: Global prevalence of diabetes: estimates for the year 2000 and projections for 2030. Diabetes Care 27: 1047-1053, 2004
Yamauchi,T, Kamon,J, Waki,H, Terauchi,Y, Kubota,N, Hara,K, Mori, Y, Ide,T, MurakamijK, Tsuboyama-Kasaoka,N, Ezaki,O, Akanuma,Y, Gavrilova,O, Vinson,C, Reitman,ML, Kagechika,H, Shudo,K, Yoda,M, Nakano,Y, Tobe,K, Nagai,R, Kimura,S, Tomita,M, Froguel,P, Kadowaki,T: The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat. Med. 7:941-946, 2001
Yeh,S, Tsai,MY, Xu5Q, Mu5XM, Lardy,H, Huang,KE, Lin,H, Yeh,SD, Altuwaijri,S, Zhou,X, Xing,L, Boyce,BF, Hung,MC, Zhang,S, Gan,L, Chang,C: Generation and characterization of androgen receptor knockout (ARKO) mice: an in vivo model for the study of androgen functions in selective tissues. Proc Natl Acad Sci USA 99:13498-13503, 2002
Claims
1. A composition as a model for Type II diabetes comprising an androgen receptor knockout animal and an assay for type II diabetes.
2. The composition of claim 1 , wherein the assay for Type II diabetes comprises an insulin tolerance test (ITT).
3. The composition of claim 2, wherein the assay is performed on an animal that fasted for at least 6 hours.
4. The composition of claim 1, wherein the assay for Type II diabetes comprises a glucose tolerance test (GTT).
5. The composition of claim 4, wherein the assay is performed on an animal that fasted for at least 14 hours.
6. The composition of claim 1, wherein the assay for Type II diabetes comprises a test for determining the amount of leptin.
7. The composition of claim 1, wherein the assay for Type II diabetes comprises an ELISA test.
8. The composition of claim 1 , wherein the assay for Type II diabetes comprises a test for determining the amount of serum free fatty acid.
9. The composition of claim 1 , wherein the assay for Type II diabetes comprises a test for determining the amount of triglycerides.
10. The composition of claim 1, wherein the assay for Type II diabetes comprises a test for determining the amount of cholesterols.
11. The composition of claim 1, wherein the animal is a fasting animal. 12. The composition of claim 11, wherein the fasting animal has fasted for 1, 2, 3, 4, 5,
6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours.
13. The composition of claim 1, wherein the animal is a fed animal.
14. The composition of claim 13, wherein the fed animal has eaten within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours.
15. The composition of claim 14, wherein the animal had fasted for at least 14 hours before being fed.
16. The composition of claim 1, wherein the animal is a mammal.
17. The composition of claim 1, wherein the animal is a rodent (including mouse and rat).
18. A method of generating a model for Type II diabetes comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of Type π diabetes.
19. A method for screening a drug for an effect on Type II Diabetes comprising administering the drug to an animal and assaying for AR activity, wherein an increase in AR activity indicates a drug that can be used to treat Type II Diabetes.
20. The method of claim 19, further comprising performing an assay for a characteristic of Type π diabetes.
21. The method of claim 20, wherein the assay comprises an insulin tolerance test, a glucose tolerance test, or a test determining the amount of leptin produced. Note: other characteristic tests for type 2 diabetes.
22. A method of screening a composition for its effect on Type II diabetes comprising administering the composition to an androgen receptor knockout animal, and performing an assay related to Type II diabetes, wherein a change in the assay relative to a control indicates the compound has an effect on Type II diabetes.
23. A method of screening a subject for Type II diabetes comprising performing an assay for Type II diabetes, wherein the subject has an androgen receptor deficiency.
24. A method of screening a subject for Type II diabetes comprising performing an assay for Type II diabetes, wherein the subject has had androgen ablation therapy.
25. A method of diagnosing the likelihood of a subject to develop Type II Diabetes comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates Type II Diabetes.
26. The method of claim 25, wherein assaying for AR activity comprises looking at the expression of AR dependent genes in the sample.
27. The method of claim 25, wherein assaying for AR activity comprises looking at the amount of androgen receptor present in the sample.
28. The method of claim 25, wherein the subject is a mammal.
29. The method of claim 25, wherein the subject is a (rodent).
30. The subject of claim 25, wherein the subject is a human.
31. A method of diagnosing a subject with Type II diabetes comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates Type π diabetes.
32. The method of claim 31, wherein the subject is a mammal.
33. The method of claim 31, wherein the subject is a (rodent).
34. The subject of claim 31, wherein the subject is a human.
35. The method of claim 31, wherein the tissue sample is blood.
36. The method of claim 31, wherein the tissue sample is white adipose tissue (WAT).
37. The method of claim 31, wherein the tissue is liver.
38. The method of claim 31, wherein the tissue is skeletal muscle.
39. A method of treating a subject with Type II Diabetes comprising administering to the subject an agent that modulates AR activity, wherein an increase in AR activity reduces Type It Diabetes.
40. The method of claim 39, wherein the agent comprises testosterone or DHT.
41. A method for evaluating whether a treatment with a compound should be performed due to the effect the treatment of a subject has on Type II Diabetes, wherein the compound modulates the androgen receptor activity, the method comprising exposing cells having androgen receptor activity to the compound, and evaluating androgen receptor activity in the presence of the compound, wherein a difference in the androgen receptor activity, relative to the androgen receptor activity of the cells that have not been exposed to the compound, indicates that the compound modulates androgen receptor activity, and wherein a decrease in androgen receptor activity indicates an adverse effect on Type II Diabetes, providing an indication that treatment with the compound may not be indicated.
42. A method of generating a model for coronary heart disease comprising generating an androgen receptor knock out animal and assaying the animal for characteristics of coronary heart disease.
43. A method of diagnosing the likelihood of a subject to develop CHD comprising taking a tissue sample from the subject and assaying for AR activity, wherein a decrease in AR activity indicates CHD.
44. The method of claim 43, wherein the subject is a mammal.
45. The method of claim 43, wherein the subject is a rodent.
46. The method of claim 45, wherein the rodent is a mouse.
47. The subject of claim 43, wherein the subject is a human.
48. A method of diagnosing a subject with CHD comprising a) obtaining a tissue sample, and b) assaying for AR activity, wherein a lack of AR indicates CHD.
49. The method of claim 48, wherein the subject is a mammal.
50. The method of claim 48, wherein the subject is a rodent.
51. The method of claim 50, wherein the rodent is a mouse.
52. The subject of claim 48, wherein the subject is a human.
53. The method of claim 48, wherein the tissue sample is blood.
54. The method of claim 48, wherein the tissue sample is WAT.
55. The method of claim 48, wherein the tissue is liver.
56. The method of claim 48, wherein the tissue is skeletal muscle.
57. A method for screening drugs for an effect on CHD comprising administering the drug to an animal and assaying for AR activity, wherein a increase in AR activity indicates a drug that can be used to treat CHD.
58. A method of treating a subject with CHD comprising administering to the subject an agent that modulates AR activity, wherein an increase in AR activity reduces CHD.
59. The method of claim 58, wherein the agent comprises testosterone or DHT.
60. A method for evaluating whether a treatment with a compound should be performed due to the effect the treatment of a subject has on coronary heart disease (CHD), wherein the compound modulates the androgen receptor activity, the method comprising exposing cells having androgen receptor activity to the compound, and evaluating androgen receptor activity in the presence of the compound, wherein a difference in the androgen receptor activity, relative to the androgen receptor activity of the cells that have not been exposed to the compound, indicates that the compound modulates androgen receptor activity, and wherein a decrease in androgen receptor activity indicates an adverse effect on CHD, providing an indication that treatment with the compound may not be indicated.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US64212905P | 2005-01-07 | 2005-01-07 | |
| PCT/US2006/000474 WO2006074378A2 (en) | 2005-01-07 | 2006-01-06 | Insulin and leptin resistance with hyperleptinemia in mice lacking androgen receptor |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1855523A2 true EP1855523A2 (en) | 2007-11-21 |
| EP1855523A4 EP1855523A4 (en) | 2010-06-23 |
Family
ID=36648219
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP06717647A Withdrawn EP1855523A4 (en) | 2005-01-07 | 2006-01-06 | INSULIN AND LEPTIN RESISTANCE WITH HYPERLETPTINEMIA IN MOUSE WITH ANDROGEN RECEPTOR DEFICIENCIES |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1855523A4 (en) |
| AU (1) | AU2006203870A1 (en) |
| CA (1) | CA2596783A1 (en) |
| WO (1) | WO2006074378A2 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1423695A4 (en) * | 2001-07-27 | 2005-09-28 | Univ Rochester | TRANSGENIC ANIMALS WITH INACTIVATION OF THE ANDROGEN RECEPTOR |
| EP1456400A4 (en) * | 2001-12-19 | 2005-09-14 | Exelixis Inc | Modulating insulin receptor signaling through targeting facl |
| AU2003238794A1 (en) * | 2002-05-28 | 2003-12-12 | University Of Rochester | Tr2, tr4, tr2/tr4 double knockouts and uses thereof |
-
2006
- 2006-01-06 CA CA002596783A patent/CA2596783A1/en not_active Abandoned
- 2006-01-06 WO PCT/US2006/000474 patent/WO2006074378A2/en not_active Ceased
- 2006-01-06 EP EP06717647A patent/EP1855523A4/en not_active Withdrawn
- 2006-01-06 AU AU2006203870A patent/AU2006203870A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| WO2006074378A2 (en) | 2006-07-13 |
| CA2596783A1 (en) | 2006-07-13 |
| AU2006203870A1 (en) | 2006-07-13 |
| WO2006074378A3 (en) | 2007-03-08 |
| EP1855523A4 (en) | 2010-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Morioka et al. | Disruption of leptin receptor expression in the pancreas directly affects β cell growth and function in mice | |
| Zhang et al. | Leptin function and regulation | |
| Whirledge et al. | Glucocorticoid signaling in health and disease: insights from tissue-specific GR knockout mice | |
| Xian et al. | LRP1 integrates murine macrophage cholesterol homeostasis and inflammatory responses in atherosclerosis | |
| Kim et al. | FOXO1 in the ventromedial hypothalamus regulates energy balance | |
| Hu et al. | Steroid deficiency syndromes in mice with targeted disruption of Cyp11a1 | |
| Akiyama et al. | Conditional disruption of the peroxisome proliferator-activated receptor γ gene in mice results in lowered expression of ABCA1, ABCG1, and apoE in macrophages and reduced cholesterol efflux | |
| Antonson et al. | Generation of ERα-floxed and knockout mice using the Cre/LoxP system | |
| Skovsø et al. | Beta-cell specific Insr deletion promotes insulin hypersecretion and improves glucose tolerance prior to global insulin resistance | |
| Obermüller et al. | Defective secretion of islet hormones in chromogranin-B deficient mice | |
| Yang et al. | The Krüppel-like zinc finger protein GLIS3 transactivates neurogenin 3 for proper fetal pancreatic islet differentiation in mice | |
| EP2727465A1 (en) | Animal model for type 2 diabetes and obesity | |
| Silva et al. | Igf2 deficiency results in delayed lung development at the end of gestation | |
| US20160102126A1 (en) | Novel Peptides Involved in Energy Homeostasis | |
| George et al. | The E3 ubiquitin ligase RNF216/TRIAD3 is a key coordinator of the hypothalamic-pituitary-gonadal axis | |
| Dillon et al. | Deletion of nuclear progesterone receptors from kisspeptin cells does not impair negative feedback in female mice | |
| Volinic et al. | Overexpression of the coactivator bridge-1 results in insulin deficiency and diabetes | |
| Tenbaum et al. | Alien/CSN2 gene expression is regulated by thyroid hormone in rat brain | |
| US20100256220A1 (en) | PAS Kinase Regulates Energy Homeostasis | |
| US20080050387A1 (en) | Non-Androgen Dependent Roles for Androgen Receptor and Non-Androgen Related Inhibitors of Androgen Receptor | |
| Plieschnig et al. | Renal LRP2 expression in man and chicken is estrogen-responsive | |
| US20100048676A1 (en) | Non-androgen dependent roles for androgen receptor in liver cancer | |
| WO2006074378A2 (en) | Insulin and leptin resistance with hyperleptinemia in mice lacking androgen receptor | |
| Ullrich et al. | Identification of SPRED2 (sprouty-related protein with EVH1 domain 2) as a negative regulator of the hypothalamic-pituitary-adrenal axis | |
| Matthäus et al. | EHD2-mediated restriction of caveolar dynamics regulates cellular lipid uptake |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20070720 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20100525 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20100201 |