EP1848823A4 - Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes - Google Patents

Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes

Info

Publication number
EP1848823A4
EP1848823A4 EP06719184A EP06719184A EP1848823A4 EP 1848823 A4 EP1848823 A4 EP 1848823A4 EP 06719184 A EP06719184 A EP 06719184A EP 06719184 A EP06719184 A EP 06719184A EP 1848823 A4 EP1848823 A4 EP 1848823A4
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
target
dna
solution
negatively charged
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06719184A
Other languages
German (de)
English (en)
Other versions
EP1848823A2 (fr
Inventor
Lewis J Rothberg
Huixiang Li
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Rochester
Original Assignee
University of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Rochester filed Critical University of Rochester
Publication of EP1848823A2 publication Critical patent/EP1848823A2/fr
Publication of EP1848823A4 publication Critical patent/EP1848823A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6832—Enhancement of hybridisation reaction
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase

Definitions

  • the present invention relates to hybridization-based nucleic acid detection procedures and materials for practicing the same.
  • PCR polymerase chain reaction
  • a first aspect of the present invention relates to a method for detecting presence or absence of a target nucleic acid molecule in a test solution (e.g., sample).
  • This method includes the steps of: combining at least one single-stranded oligonucleotide probe with a test solution potentially including a target nucleic acid to form a hybridization solution, wherein the at least one single-stranded oligonucleotide probe and the test solution are combined under conditions effective to allow formation of a hybridization complex between the at least one single-stranded oligonucleotide probe and any target nucleic acid present in the test solution; exposing the hybridization solution to a plurality of metal nanoparticles under conditions effective to allow the at least one single-stranded oligonucleotide probe that remains unhybridized after said combining to associate electrostatically with the plurality of metal nanoparticles; and determining whether the at least one single-stranded oligonucleotide probe has
  • a colorimetric assay utilizes an unlabeled oligonucleotide probe and involves making the determination by detecting a color change of the hybridization solution after the step of exposing, whereby a color change indicates substantial aggregation of the plurality of metal nanoparticles in the presence of the target nucleic acid. If no color change (or an insignificant change) occurs, absence of the target nucleic acid is indicated.
  • Another embodiment utilizes a fluorescently labeled oligonucleotide probe and involves determining whether or not fluorescence can be detected following exposure to the plurality of metal nanoparticles, whereby elimination of fluorescence indicates absence of a target nucleic acid and remaining fluorescence indicates its presence. If fluorescence by the labeled oligonucleotide probes remains, the oligonucleotide probes have formed duplexes and remain dissociated from the metal nanoparticles (i.e., no fluorescence quenching has occurred).
  • a second aspect of the present invention relates to a method for detecting a single nucleotide polymorphism ("SNP") in a target nucleic acid molecule.
  • SNP single nucleotide polymorphism
  • This method is carried out by combining (i) a test solution including a target nucleic acid molecule and (ii) at least one first single-stranded oligonucleotide probe that has a nucleotide sequence that hybridizes to a region of the target nucleic acid molecule that may contain a single-nucleotide polymorphism, to form a test hybridization solution, wherein said combining is carried out under conditions effective to allow hybridization between the target nucleic acid molecule and the at least one first single-stranded oligonucleotide probe to form at least one hybridization complex; combining (i) a control solution including the target nucleic acid molecule and (ii) at least one second single-stranded oligonucleotide probe that has a nucleotide sequence that hybridizes perfectly to a region of the target nucleic acid molecule that does not contain a single-nucleotide polymorphism, to form a control hybridization solution, wherein
  • a third aspect of the present invention relates to a method for detecting a SNP in a target nucleic acid molecule. This method is carried out by: combining (i) a solution including a target nucleic acid molecule and (ii) at least one first single- stranded oligonucleotide probe having a nucleotide sequence and a fluorescent label attached thereto, wherein the nucleotide sequence hybridizes to a region of the target nucleic acid molecule that may contain a single-nucleotide polymorphism, to form a hybridization solution, wherein said combining is carried out under conditions effective to allow hybridization between the target nucleic acid molecule and the at least one first single-stranded oligonucleotide probe to form at least one hybridization complex; exposing the hybridization solution to a plurality of metal nanoparticles under conditions effective to allow unhybridized probes in the hybridization solution to electrostatically associate with the metal nanoparticles;
  • a fourth aspect of the present invention relates to a method for detecting a target nucleic acid in a test solution.
  • This method includes the steps of: subjecting a portion of a test solution potentially including a target nucleic acid to polymerase chain reaction and obtaining a product solution that includes single- stranded nucleic acid products of the polymerase chain reaction; combining at least one single-stranded oligonucleotide probe with the product solution to form a hybridization solution under conditions effective to allow formation of a hybridization complex between the at least one single-stranded oligonucleotide probe and any target nucleic acid present in the product solution; exposing the hybridization solution to a plurality of metal nanoparticles under conditions effective to allow any single- stranded nucleic acids in the hybridization solution to associate with the plurality of metal nanoparticles; and determining whether the at least one single-stranded oligonucleotide probe has hybridized to target nucleic acid or electrostatically associated with
  • a fifth aspect of the present invention relates to a method of detecting a pathogen in a sample that includes the steps of obtaining a sample that may contain nucleic acid of a pathogen, and then performing a method of the present invention using an oligonucleotide probe specific for a target nucleic acid of the pathogen, wherein the step of determining that the at least one single-stranded oligonucleotide probe has hybridized to the target nucleic acid indicates presence of the pathogen.
  • a sixth aspect of the present invention relates to a method of genetic screening.
  • a seventh aspect of the present invention relates to a method of detecting a protein in a sample.
  • This method is carried out by obtaining a sample, performing an immuno-polymerase chain reaction procedure using the sample, wherein the immuno-polymerase chain reaction procedure results in amplification of a nucleic acid that is conjugated to a protein, and then performing a method of the present invention using an oligonucleotide probe specific for the nucleic acid that is conjugated to the protein (or its complement), wherein the step of determining that the at least one single-stranded oligonucleotide probe has hybridized to the target nucleic acid indicates that the protein is present in the sample.
  • An eighth aspect of the present invention relates to a method of quantifying the amount of amplified nucleic acid prepared by polymerase chain reaction.
  • This method is carried out by providing two or more fluorescently labeled oligonucleotide primers that each have a nucleotide sequence capable of hybridizing to a nucleic acid molecule, or its complement, to be amplified; performing polymerase chain reaction using a target nucleic acid molecule and/or its complement, and the provided fluorescently labeled oligonucleotide primers; and performing the fluorimetric method of the present invention on a sample obtained after said performing polymerase chain reaction, wherein the level of fluorescence detected from the sample indicates the amount of primer that has been incorporated into an amplified nucleic acid molecule.
  • a ninth aspect of the present invention relates to a method for detecting presence or absence of a target nucleic acid in a test solution that includes the steps of: combining at least one single-stranded oligonucleotide probe with a test solution potentially including a target nucleic acid to form a hybridization solution, wherein the at least one single-stranded oligonucleotide probe and the test solution are combined under conditions effective to allow formation of a hybridization complex between the at least one single-stranded oligonucleotide probe and any target nucleic acid present in the test solution; exposing the hybridization solution to a plurality of negatively charged nanoparticles under conditions effective to allow any single- stranded oligonucleotide probe or non-target nucleic acid that remains unhybridized after said combining to associate electrostatically with the plurality of negatively charged nanoparticles; separating the plurality of negatively charged nanoparticles from the hybridization solution after said exposing; and determining whether
  • kits containing various components that will allow a user to perform one or more methods of the present invention minimally include a first container that contains a plurality of negatively charged nanoparticles; and a second container that contains a salt solution having a concentration of salt that is effective to cause aggregation of the negatively charged nanoparticles.
  • the kits can further include a third container that contains at least one single-stranded oligonucleotide probe complementary to a target nucleic acid and/or a fourth container that contains a hybridization solution and/or a filter sufficient to allow for filtration of aggregated nanoparticles.
  • the kits can include a container that contains the plurality of negatively charged nanoparticles coupled to a substrate.
  • An eleventh aspect of the present invention relates to a detection device for performing a method of the present invention.
  • Assays and kits of the present invention involve the use of negatively charged nanoparticles and nucleic acid molecules, harnessing the electrostatic interactions between the nanoparticles and nucleic acid molecules.
  • applicants have identified four unique interactions that can be harnessed by the assays and materials of the present invention.
  • the negatively charged nanoparticles in solution are typically stabilized by their repulsion, which prevents the strong Van der Waals attraction between the particles from causing them to aggregate (Hunter, Foundations of Colloid Science, Oxford University Press Inc., New York (2001); Shaw, Colloid and Surface Chemistry, Butterworth-Heinemann Ltd., Oxford (1991), each of which is hereby incorporated by reference in its entirety). Repulsion between the charged phosphate backbone of ds-nucleic acid and the negatively charged nanoparticles dominates the electrostatic interaction between the nanoparticle and ds-nucleic acid so that ds-nucleic acid will not adsorb.
  • the ss-nucleic acid is sufficiently flexible to partially uncoil its bases, they can be exposed to the negatively charged nanoparticles. Under these conditions, the negative charge on the backbone is sufficiently distant so that attractive Van der Waals forces between the bases and the nanoparticle are sufficient to cause ss-nucleic acid to adsorb to the negatively charged nanoparticle. The same mechanism is not operative with ds-nucleic acid because the duplex structure does not permit the uncoiling needed to expose the bases.
  • the selective adsorption of ss-DNA and RNA to negatively charged nanoparticles e.g., citrate-coated Au nanoparticles
  • the assay is easy to implement for visual detection at the level of 100 femtomoles, and it is shown that it is easily adapted to detect single base mismatches between probe and target. Also presented herein are initial studies of how length mismatches between target and probe sequence affect the propensity for oligonucleotides to adsorb on metal nanoparticles. [0023] By harnessing the above-identified interactions in the assays and kits of the present invention, the present invention affords methods of detecting target nucleic acids that offer a number of benefits over previously developed detection procedures.
  • Some of these benefits include: no target labeling is required; the assays occur in solution, allowing for detection of the target nucleic acid in less than about 10 minutes (which is significantly faster than chip or surface-based assays that tend to slow down the hybridization process); the detection procedure is temporally separated from the hybridization procedure so that the hybridization process can be optimized with little or no regard to the detection procedure; and the assays can be performed using commercially available materials.
  • the two basic embodiments of the present invention, a colorimetric assay and a fluorimetric assay afford significant benefits.
  • the colorimetric assay can be performed without the need for expensive detection instrumentation, such as fluorescence microscopes or photomultipliers.
  • Detection of a positive or negative result in the colorimetric assay can be assessed by naked eye of an observer.
  • the assays are extremely sensitive, capable of detecting target nucleic acids in femtomole quantities (or less in the case of the fluorescent approach), capable of discriminating between complex mixtures of nucleic acid, and capable of discriminating between wild-type targets and those bearing SNPs or other mutations such as deletions or modifications such as knockout insertions.
  • Figure 1 is a pictorial representation of the colorimetric method for differentiating between single and double stranded oligonucleotides; and consequently selective oligonucleotide detection.
  • the circles represent colloidal metal (e.g. gold) nanoparticles.
  • Figure 2 is a pictorial representation of the fluorimetric method for selective oligonucleotide detection.
  • the red stars in panels A, B, and D represent identifiable (i.e., unquenched) fluorescence from the fluorescence label on the probe strands.
  • the thin green strands and the thick green strands represent single-strand and double-strand nucleic acid molecules, respectively.
  • the circles in panels C and D represent metal (e.g., gold) nanoparticles. Hybridization between the oligonucleotide probes and target nucleic acid molecules occur before introducing metal nanoparticles.
  • Figure 3 is a schematic protocol of protein detection combining immuno-PCR with the methods of the present invention.
  • Figures 4A-B provide evidence for preferential adsorption of ss-DNA on gold nanoparticles.
  • Figure 4A is a graphical illustration of fluorescence emitted from rhodamine red attached to ss-DNA (dashed) and ds-DNA (solid). The fluorescence spectra were recorded from mixtures consisting of the trial hybridization solution (final concentration of the dye labeled ss-DNA: 50 nM), 500 ⁇ L of gold colloid, and 500 ⁇ L of 10 mM phosphate buffer solution (PBS) containing 0.1 M NaCl. The ss-DNA (dashed) curve was recorded from the mixture containing the probe and its non-complementary target (nc-target). Dot curve was recorded from the W
  • FIG. 4B is a graphical illustration of Surface Enhanced Resonant Raman Scattering ("SERRS") from Rhodamine Green tagged on ss-DNA (solid) and ds-DNA (dashed).
  • SERRS Surface Enhanced Resonant Raman Scattering
  • FIG. 5A-C show colorimetric detection of oligonucleotide hybridization.
  • Figure 5A is a graph showing absorption spectra of gold colloid (diamonds) and the mixtures containing ss-DNA 1 (circles), ss-DNA2 (triangles), and ds-DNA from the hybridization of ss-DNA 1 and ss-DNA2 (squares), respectively.
  • the gold colloid was diluted with water to the same concentration as in the mixtures.
  • the mixtures contained trial hybridization solution (5 ⁇ L (60 ⁇ M) ss-DNA in salt buffer solution) added to 500 ⁇ L of 17 nM gold colloid, followed by 200 ⁇ L of 10 mM PBS and 0.2 M NaCl).
  • Figure 5B is a graphical illustration of the ratio of the absorbance at 520 nm to the absorbance at 700 nm versus oligonucleotide concentration expressed in number of DNA per gold nanoparticle.
  • the DNA sequences and the mixture are the same as in Figure 5 A, except for variation of the amount of DNA.
  • Figure 5C is a photograph showing colorimetric detection of a DNA sequence fragment characteristic of Severe Acute Respiratory Syndrome (“SARS") virus (Drosten et al., The New England Journal of Medicine 348:1967-1976 (2003), which is hereby incorporated by reference in its entirety). All solutions contained 120 picomoles of probe, 200 ⁇ L gold colloid, and 100 ⁇ L of 10 mM PBS and 0.2 M NaCl. The ratio of the amount of target to the amount of probe in the solutions was 0, 0.2, 0.4, 0.6, and 1 (from left to right), respectively.
  • SARS Severe Acute Respiratory Syndrome
  • Figures 6A-E show colorimetric detection of targets in mixtures, low concentrations, low amounts, and with single base mismatches.
  • Figure 6A is a photograph showing detection of a target sequence in a mixture.
  • 3.5 ⁇ L of trial hybridization solution was mixed with 300 ⁇ L of gold colloid and 300 ⁇ L of 10 mM phosphate buffer solution containing 0.2 M NaCl.
  • the complementary target contained in the solutions from left to right were 50%, 40%, 30%, and 0% of the total ⁇
  • FIG. 6B is a photograph showing detection of target DNA in low concentration solution. 100 ⁇ L of gold colloid was diluted in 300 ⁇ L water, mixed with 1 ⁇ L trial hybridization solution and 300 ⁇ L of 10 mM phosphate buffer solution containing 0.3 M NaCl (final target concentration: 4.3 nM). The vial on the left contained unmatched ss-DNA strands while the vial on the right contained complementary strands.
  • Figure 6C is a photograph showing detection of small amounts of target.
  • oligonucleotide and 300 ⁇ L of gold nanoparticles were ultrasonicated for 0.5, 1, and 2 minutes, respectively, and then mixed with 300 ⁇ L of 10 mM phosphate buffer solution 0.3 M NaCl (final target concentration: 0.05 ⁇ M).
  • the solution in the left vial of each dehybridization time group contained ds-DNA with a single base pair mismatch while the right vial contained perfectly matched target and probe strands. The red color indicates that part of ds-DNA has dehybridized.
  • the oligonucleotide sequences are identified in the text.
  • Figures 7A-B show that gold nanoparticles preferentially quench the fluorescence from fluorophores labeled on ss-DNA.
  • Figure 7A is a graph showing the fluorescence spectra of the mixtures of 5 ⁇ L (10 ⁇ M) trial hybridized solution of rhodamine red labeled ss-DNA probe and its complementary target (solid squares), or non-complementary target (open squares), 500 ⁇ L of gold colloid and 500 ⁇ L of 10 mM PBS containing 0.1 M NaCl.
  • Figure 7B is a graph showing the fluorescence image intensity profile measured with a confocal fluorescence microscope.
  • 0.5 ⁇ L (0.1 ⁇ M) of the trial hybridization solution was mixed with 500 ⁇ L of the diluted gold colloid (diluted with deionized water by factor 20) and 500 ⁇ L of 10 mM PBS containing 0.1 M NaCl. Solid circles were recorded from 2 ⁇ L of the mixture containing complementary target; open circles from 2 ⁇ L of the mixture containing non-complementary target.
  • Figures 8A-B show detection of long target and long target in a mixture.
  • Figure 8A is a graph showing the method working with long target. The fluorescence spectra were recorded from the solutions containing complementary target a (solid squares), complementary target b (open squares), and non- complementary target c (solid triangles), respectively. The solution contained 4 ⁇ L (10 ⁇ M) of trial hybridized solution, 500 ⁇ L gold colloid, and 500 ⁇ L of 10 mM PBS containing 0. IM NaCl.
  • Figure 8B is a graph showing the method working with long target in a mixture.
  • the fluorescence spectra were recorded from mixtures containing 1% complementary target a (solid squares), 1% complementary target b (open squares), and non-complementary target (solid triangles), respectively.
  • the components of oligonucleotides in the trial hybridized solution contained 10 picomolar non-complementary target, 0.5 picomolar probe, and 0.1 picomolar candidates.
  • the mixtures were made up of 0.5 ⁇ L of trial hybridized solutions, 500 ⁇ L gold colloid (diluted with 250 ⁇ L water), and 500 ⁇ L of 10 mM PBS containing 0. IM NaCl.
  • Figures 9A-B show single base-pair mismatch detection.
  • Figure 9 A is a graph showing the probe binding in the middle of long target a and target a'.
  • Figure 9B is a graph showing the probe binding at one end of long target b and complementary target b'.
  • the fluorescence spectra for single base-pair mismatch detection were recorded from mixtures containing 1 ⁇ L (10 ⁇ M) trial hybridized solution (same amount of the probe and the target) warmed in 46°C water bath, 500 ⁇ L gold colloid, and 500 ⁇ L of 10 mM PBS and 0.1 M NaCl. Solid squares were recorded from the mixtures containing perfect matched ds-DNA and open squares from the mixtures containing ds-DNA with one base-pair mismatch.
  • Figures 10A-B show simultaneous multiple target detection. Figure
  • FIG. 1OA is a graph showing excitation at 570 nm, which is absorption maximum of rhodamine red tagged on probe 1.
  • Figure 1OB is a graph showing excitation at 648 nM, which is absorption maximum of cy5 tagged on probe 2.
  • the second peak of the spectrum (solid squares) in Figure 1OB is the emission of cy5 tagged on probe 2 excited by 570 nm.
  • Figures 1 IA-D show adsorption of ss-DNA to gold nanoparticles.
  • Figure 1 IA graphically illustrates absorption spectra of 300 ⁇ L gold colloid and 100 ⁇ L deionized water (red), 100 ⁇ L of 10 mM PBS (0.2 M NaCl) (blue), 300 picomoles 24 base ss-DNA first, then 100 ⁇ L of 10 mM PBS (0.2 M NaCl) (green).
  • Figure 1 IB is a graph showing photoluminescence intensity versus time following addition of 4 picomoles rhodamine red tagged ss-DNAs to 1000 ⁇ L gold colloid. 10 mer (red), 24 mer (green) and 50 mer (blue).
  • Figure 11C graphically illustrates absorption spectra of the mixture of 200 picomoles ss-DNA (50 mer) and 300 ⁇ L gold nanoparticles heated at different temperature for two minutes, followed by addition of 300 ⁇ L of 10 mM PBS (0.2 M NaCl). 22 0 C (blue), 45°C (cyan), 70 0 C (green), and 95 0 C (red).
  • Figure 1 ID graphically illustrates the fluorescence spectra of the hybridized solutions of rhodamine red labeled 15 mer ss-DNA, 50 mer ss-DNA, and gold colloid, the 15 mer binding to 50 mer at middle (red), at end (green) and nowhere (blue).
  • Figure 12 is a schematic of the interaction between negatively charged metal nanoparticules and ss-DNA.
  • the wedge-like structure (left) represents the metal nanoparticle, and the structure (right) represents a ss-nucleic acid having a phosphate backbone (solid vertical line) and nucleotide bases (horizontal lines).
  • Figures 13A-B show identification of PCR amplified DNA sequences.
  • Figure 13A is a schematic of the detection protocol.
  • the mixture of PCR product and probes is denatured and annealed below the melting temperature of the complementary probes, followed by addition of gold colloid.
  • the long blue and green lines represent the PCR amplified DNA fragments and the pink and light blue medium bars the excess PCR primers.
  • the short blue and green bars are complementary probes that bind, resulting in gold nanoparticle aggregation (purple color).
  • the short purple and orange bars are non-complementary probes that do not bind and adsorb to the gold nanoparticles, preventing nanoparticle aggregation and leaving the solution pink.
  • Figure 13B is a color photograph of the resulting solutions with complementary probes (a) and non-complementary probes (b).
  • Figures 14A-B show single base-pair mismatch detection.
  • Figure 14A illustrates the detection strategy.
  • the red spots on long green and blue lines represent positions of a potential SNP.
  • the long green and blue lines are the complementary sequences of PCR amplified DNA fragment.
  • the short green and blue bars are probes complementary to parts of the wild type sequence of PCR amplified DNA fragment as illustrated.
  • Figure 14B is a photograph showing detection of a single base-pair mismatch.
  • Vials b, d, and f contain PCR product with probes overlapping the single-base mismatch while vials a, c, and e contain PCR product with probes not overlapping the single base pair mismatch. Photographs were taken of the mixtures annealed at 50 0 C (a, b), 54°C (c, d) and 58°C (e, f). 8 ⁇ L PCR product, 3.5 picomoles probe and 70 ⁇ L gold colloid were used in each vial. [0038] Figures 15 A-B illustrate single base-pair mismatch detection using RNA probes and RNA targets.
  • Figure 16 illustrates schematically one implementation of the immobilized bead method for separating double stranded from single stranded nucleic acids. Removal of unhybridized short ss-DNA probes by processing the analyte through a filter of packed glass beads (circles filled with grid) functionalized with immobilized negatively charged nanoparticles (shaded circles). The trial hybridization solution prior to the filter is shown schematically above and after the filter below.
  • FIG. 17 is a graph showing that ss-DNA is preferentially retained by the column of immobilized beads.
  • Figure 18 is a graph illustrating the fluorescence of solutions remaining after removal of gold by salt-induced crashout and centrifugation.
  • FIGS 19A-D illustrate the colorimetric method for RNA sequence detection.
  • the same mixtures of trial hybridization solutions and gold colloid were used.
  • the left vial in each image contains complementary target
  • the middle vial contains a target with a single base mismatch with the probe
  • the right vial contains a random non-complementary target.
  • Figures 20A-B are graphs showing the absorption spectra from the mixtures of trial hybridization solutions annealed at two different temperatures after being added to gold colloid.
  • Squares, circles and triangles from the mixtures contain, respectively, complementary target (c-target), mismatch target (mc-target) and non- complementary target (nc-target).
  • c-target complementary target
  • mc-target mismatch target
  • nc-target non- complementary target
  • FIG. 21 is a graph illustrating detection of single base mutations in RNA sequences using fluorescence quenching of fluorescently labeled DNA probe. Fluorescence spectra of the mixtures of hybridization solution, gold colloid, and buffer/salt solution are illustrated two minutes after mixing.
  • Figure 22 is a graph illustrating the detection of single base mutations in RNA sequences in complex mixtures using the fluorescence assay.
  • P and T denote probe and target, respectively, while w and m indicate wild-type and mutant, respectively.
  • AU hybridization solutions contain non-complementary background RNA at 10 times the concentration of the target. Sequences of the wild-type probe, wild-type target, and mutant target are stated in the description of Figure 21.
  • the methods of the present invention can be used to detect the presence (or substantial absence) of a target nucleic acid molecule in a sample or test solution.
  • the method involves combining at least one single-stranded oligonucleotide probe and the test solution under conditions effective to allow formation of a hybridization complex between the at least one single-stranded oligonucleotide probe and any target nucleic acid present in the test solution. If no target nucleic acid or substantially no target nucleic acid is present, then no hybridization complex or substantially no hybridization complex will form.
  • the hybridization solution After allowing for hybridization to occur (i.e., if hybridization between the probe and target is possible), the hybridization solution is exposed to a plurality of negatively charged nanoparticles under conditions effective to allow any unhybridized probe to associate electrostatically with the plurality of negatively charged nanoparticles. A determination is then made whether the at least one single-stranded oligonucleotide probe has hybridized to target nucleic acid or electrostatically associated with one or more of the plurality of negatively charged nanoparticles. This determination is made according to an optical property of the hybridization solution, as discussed below.
  • the methods of the present invention can further include a step for separating ds-nucleic acid from the short single-stranded probe molecules (or other ss- nucleic acids) that remain unbound after the hybridization step, as discussed below.
  • the target nucleic acid molecule that is intended to be detected can be
  • DNA or RNA can be isolated directly from samples (i.e., concentrated to be free of cellular debris) and then tested, if present in sufficient quantities, or it can first be amplified by polymerase chain reaction ("PCR") or reverse-transcription PCR.
  • PCR polymerase chain reaction
  • reverse-transcription PCR reverse-transcription PCR
  • the cDNA can also have incorporated therein synthetic, natural, or structurally modified nucleoside bases.
  • the target nucleic acid molecule can also be from any source organism
  • the target nucleic acid can contain a nucleotide sequence coupled or otherwise conjugated to a protein or polypeptide. In such case, detection of the target nucleic acid directly confirms presence of the protein or polypeptide.
  • the target nucleic acid can contain a nucleotide sequence coupled or otherwise conjugated to a protein or polypeptide that participates in an immuno-PCR procedure; the subsequently amplified target cDNA confirms indirectly the presence of the target nucleic acid in a sample to be tested (i.e., absence of the target cDNA confirms that the target is not present in the initial sample).
  • the single-stranded oligonucleotide probes that can be used in the present invention can either be unlabeled or they can be conjugated or otherwise coupled to a label.
  • Suitable labels include, without limitation, fluorescent labels, redox (electrochemical) labels, and radioactive labels.
  • Coupling of a fluorescent label to the oligonucleotide probe can be achieved using known nucleic acid-binding chemistry or by physical means, such as through ionic, covalent or other forces well known in the art ⁇ see, e.g., Dattagupta et al., Analytical Biochemistry 177:85-89 (1989); Saiki et al., Proc. Natl. Acad. ScL USA 86:6230-6234 (1989); Gravitt et al., J Clin. Micro. 36:3020-3027 (1998), each of which is hereby incorporated by reference in its entirety).
  • Either a terminal base or another base near the terminal base can be bound to the fluorescent label.
  • a terminal nucleotide base of the oligonucleotide probe can be modified to contain a reactive group, such as (without limitation) carboxyl, amino, hydroxyl, thiol, or the like.
  • the fluorescent label can be any fluorophore that can be conjugated to a nucleic acid and preferably has a photoluminescent property that can be detected and easily identified with appropriate detection equipment.
  • Exemplary fluorescent labels include, without limitation, fluorescent dyes, semiconductor quantum dots, lanthanide atom-containing complexes, and fluorescent proteins.
  • the fluorophore used in the present invention is characterized by a fluorescent emission maxima that is detectable either visually or using optical detectors of the type known in the art. Fluorophores having fluorescent emission maxima in the visible spectrum are preferred.
  • Exemplary dyes include, without limitation, Cy2TM, YO-PROTM- 1 ,
  • YOYOTM-1 Calcein, FITC, FluorXTM, AlexaTM, Rhodamine 110, 5-FAM, Oregon GreenTM 500, Oregon GreenTM 488, RiboGreenTM, Rhodamine GreenTM, Rhodamine 123, Magnesium GreenTM, Calcium GreenTM, TO-PROTM-1, TOTO ® -1, JOE, BODIPY ® 530/550, DiI, BODIPY ® TMR, BODIPY ® 558/568, BODIPY ® 564/570, Cy3TM, AlexaTM 546, TRITC, Magnesium OrangeTM, Phycoerythrin R&B, Rhodamine Phalloidin, Calcium OrangeTM, Pyronin Y, Rhodamine B, TAMRA, Rhodamine RedTM, Cy3.5TM, ROX, Calcium CrimsonTM, AlexaTM 594, Texas Red ® , Nile Red, YO-PROTM-3, YOYOTM-3, R-phyco
  • Attachment of dyes to the oligonucleotide probe can be carried out using any of a variety of known techniques allowing, for example, either a terminal base or another base near the terminal base to be bound to the dye.
  • 3'- tetramethylrhodamine may be attached using commercially available reagents, such as 3'-TAMRA-CPG, according to manufacturer's instructions (Glen Research, Sterling, Virginia).
  • Other exemplary procedures are described in, e.g., Dubertret et al, Nature Biotech. 19:365-370 (2001); Wang et al., J. Am. Chem. Soc, 125:3214-3215 (2003); Bioconjugate Techniques, Hermanson, ed. (Academic Press) (1996), each of which is hereby incorporated by reference in its entirety.
  • Exemplary proteins include, without limitation, both naturally occurring and modified (i.e., mutant) green fluorescent proteins (Prasher et al., Gene 111 :229-233 (1992); PCT Application WO 95/07463, each of which is hereby incorporated by reference in its entirety) from various sources such as Aequorea and Renilla; both naturally occurring and modified blue fluorescent proteins (Karatani et al., Photochem. Photobiol. 55(2):293-299 (1992); Lee et al., Methods Enzymol. (Biolumin. Chemilumin.) 57:226-234 (1978); Gast et al., Biochem. Biophys. Res. Commun.
  • Attachment of fluorescent proteins to the oligonucleotide probe can be carried out using substantially the same procedures used for tethering dyes to the nucleic acids, see, e.g., Bioconjugate Techniques, Hermanson, ed. (Academic Press) (1996), which is hereby incorporated by reference in its entirety.
  • Nanocrystal particles or semiconductor nanocrystals also known as
  • Quantum DotTM particles whose radii are smaller than the bulk exciton Bohr radius, constitute a class of materials intermediate between molecular and bulk forms of matter. Quantum confinement of both the electron and hole in all three dimensions leads to an increase in the effective band gap of the material with decreasing crystallite size. Consequently, both the optical absorption and emission of semiconductor nanocrystals shift to the blue (higher energies) as the size of the nanocrystals gets smaller.
  • capped nanocrystal particles of the invention are illuminated with a primary light source, a secondary emission of light occurs at a frequency that corresponds to the band gap of the semiconductor material used in the nanocrystal particles.
  • the band gap is a function of the size of the nanocrystal particle.
  • the illuminated nanocrystal particles emit light of a narrow spectral range resulting in high purity light.
  • Particles size can be between about 1 nm and about 1000 nm in diameter, preferably between about 2 nm and about 50 nm, more preferably about 5 nm to about 20 nm.
  • Fluorescent emissions of the resulting nanocrystal particles can be controlled based on the selection of materials and controlling the size distribution of the particles.
  • ZnSe and ZnS particles exhibit fluorescent emission in the blue or ultraviolet range (-400 nm or less);
  • Au, Ag, CdSe, CdS, and CdTe exhibit fluorescent emission in the visible spectrum (between about 440 and about 700 nm);
  • InAs and GaAs exhibit fluorescent emission in the near infrared range (-1000 nm), and PbS, PbSe, and PbTe exhibit fluorescent emission in the near infrared range (i.e., between about 700-2500 nm).
  • Preparation of the nanocrystal particles can be carried out according to known procedures, e.g., Murray et al., MRS Bulletin 26(12):985-991 (2001); Murray et al., IBMJ. Res. Dev. 45(l):47-56 (2001); Sun et al., J. Appl. Phys. 85(8, Pt. 2A): 4325-4330 (1999); Peng et al., J. Am. Chem. Soc.
  • nanocrystal particles can be purchased from commercial sources, such as Evident Technologies.
  • Attachment of a nanocrystal particle to the oligonucleotide probe can be carried out using substantially the same procedures used for tethering dyes thereto. Details on these procedures are described in, e.g., Bioconjugate Techniques, Hermanson, ed. (Academic Press) (1996), which is hereby incorporated by reference in its entirety.
  • Exemplary lanthanide atoms include, without limitation, Ce, Pr, Nd,
  • Attachment of a lanthanide atom (or a complex containing the lanthanide atom) to the oligonucleotide probe can be carried out using substantially the same procedures used for tethering dyes thereto. Details on these procedures are described in, e.g., Bioconjugate Techniques, Hermanson, ed. (Academic Press) (1996), which is hereby incorporated by reference in its entirety.
  • the fluorescent labels can be distinguished from one another using appropriate detection equipment. That is, the fluorescent emissions of one fluorescent label should not overlap or interfere with the fluorescent emissions of another fluorescent label being utilized. Likewise, the absorption spectra of any one fluorescent label should not overlap with the emission spectra of another fluorescent label (which may result in fluorescent resonance energy transfer that can mask emissions by the other label).
  • any of a variety of electrochemical or redox labels can be employed. Various electrochemical approaches to DNA detection have been developed (Palecek, E.
  • Exemplary electrochemical labels include, without limitation, a reporter group that contains a transition metal complex (e.g., ruthenium, cobalt, iron, or osmium complexes), or a redox moiety useful against an aqueous saturated calomel reference electrode (e.g., transition metal complexes, 1,4-benzoquinone, ferrocene, ferrocyanide, tetracyanoquinodimethane, N, N, N 1 , N'-tetramethyl-p- phenylenediamine, or tetrathiafulvalene), and redox moieties useful against an Ag/AgCI reference electrode (e.g., 9-aminoacridine, aciidine orange, aclarubicin, daunomycin, doxorubicin, pirarubicin, ethidium bromide, ethidium monoazide, chlortetracycline, tetracycline, minocycline
  • the electrochemical labels can optionally be linked through a suitable linker molecule, typically an organic moiety, as described in PCT Application WO 01/42508 to Choong et al., which is hereby incorporated by reference in its entirety.
  • a suitable linker molecule typically an organic moiety, as described in PCT Application WO 01/42508 to Choong et al., which is hereby incorporated by reference in its entirety.
  • the single-stranded oligonucleotide probe can be formed of either
  • RNA or DNA can contain one or more modified bases, one or more modified sugars, one or more modified backbones, or combinations thereof.
  • the modified bases, sugars, or backbones can be used either to enhance the affinity of the probe to a target nucleic acid molecule or to allow for conjugation to a fluorescent label.
  • Exemplary forms of modified bases are known in the art and include, without limitation, alkylated bases, alkynylated bases, thiouridine, and G-clamp (Flanagan et al., Proc. Natl. Acad. ScL USA 30:3513-3518 (1999), which is hereby incorporated by reference in its entirety).
  • modified sugars include, without limitation, LNA 5 2'-O-methyl, 2'-O-methoxyethyl, and 2'-fluoro (see, e.g., Freier and Attmann, Nucl. Acids Res. 25:4429-4443 (1997), which is hereby incorporated by reference in its entirety).
  • modified backbones include, without limitation, phosphoramidates, thiophosphoramidates, and alkylphosphonates. Other modified bases, sugars, and/or backbones can, of course, be utilized.
  • the single-stranded oligonucleotide probes can be of any length that is suitable to allow for rapid hybridization to target nucleic acids (if present) in the test solution, and rapid electrostatic association with negatively charged nanoparticles later introduced into the test solution. By rapid, it is intended that the single-stranded oligonucleotide probe can electrostatically associate with negatively charged nanoparticles at a rate that is greater (preferably by at least an order of magnitude) than the rate of association with other nucleic acids in the test solution prior to introduction of the oligonucleotide probe.
  • the single-stranded oligonucleotide probes are preferably between about 10 and about 50 nucleotides in length, more preferably between about 10 and 30 nucleotides in length, most preferably between about 12 and 20 nucleotides in length.
  • the single-stranded oligonucleotide probes can have their entire length or any portion thereof targeted to hybridize to the target nucleic acid. It is preferable for the oligonucleotide probe to have a nucleotide sequence that is 100 percent or perfectly complementary to part of the target nucleic acid sequence.
  • the amount of oligonucleotide probe introduced into the test solution can be determined based upon the total amount of negatively charged nanoparticles to be introduced into the hybridization solution and/or the total amount of target nucleic acid that is believed to be present.
  • the amount of oligonucleotide probe is at least slightly greater than the amount of negatively charged nanoparticles present in the hybridization solution (i.e., greater than a 1 : 1 ratio), more preferably greater than about 10:1, and up to about 30:1.
  • a reasonable match in the amounts of probe and target used are desirable for optimization of the assay. If the amount of nucleic acid in a sample can be reasonable estimated, then the ratio of probe:target should be between about 0.3:1 and about 3:1. If reasonable estimates cannot be made, then concentration series can be performed.
  • the relative concentrations of target and probe in the trial solution are not critical.
  • oligonucleotide probe can be synthesized using standard synthesis procedures or ordered from commercial vendors, such as Midland Certified Reagent Co.
  • the negatively charged nanoparticles can be formed of either a conductive metal or an uncharged substrate, such as glass.
  • the metal nanoparticles can be formed of any conductive metal or metal alloy that allows the nanoparticle to be capable of electrostatically associating with a single-stranded nucleic acid molecule or aggregating with other metal nanoparticles under appropriate conditions. (Prior to use in the present invention, it should be appreciated that the colloidal suspension maintains the metal nanoparticles in a stable environment in which they are substantially free of aggregation.) Importantly, the metal nanoparticles do not significantly associate electrostatically with hybridization complexes (that is, double-stranded nucleic acid molecules).
  • Exemplary metal nanoparticles include, without limitation, gold nanoparticles, silver nanoparticles, platinum nanoparticles, mixed metal nanoparticles (e.g., gold shell surrounding a silver core), and combinations thereof.
  • the metal nanoparticles can be magnetic, formed of a magnetic inner core such as cobalt and an outer core such as gold.
  • Suspensions of colloidal metal nanoparticles can be formed using the procedures described in Grabar et al., Anal. Chem. 67:735-743 (1995), which is hereby incorporated by reference in its entirety.
  • the metal nanoparticles in certain embodiments do not contain any ligands conjugated or otherwise bound to their outer surface.
  • the colloidal suspension preferably contains metal nanoparticles of between about 5 nm and about 500 nm, most preferably between about 10 nm and 30 nm.
  • the nanoparticle formed of an uncharged substrate is preferably charged using anions or polyanions.
  • the anions or polyanions can be coupled to the substrate (e.g., glass) using standard glass binding chemistry.
  • Exemplary anions include, without limitation, citrate, acetate, carbonate, dihydrogen phosphate, oxalate, sulfate, and nitrate.
  • Exemplary polyanions include, without limitation, poly(2- acrylamido-2-methyl-l-propanesulfonic acid), poly(acrylic acid), poly(anetholesulfonic acid), poly(anilinesulfonic acid), poly(sodium 4- styrenesulfonate), poly(4-styrenesulfonic acid), and poly(vinylsulfonic acid).
  • Other anions and polyanions can also be employed.
  • the detection of hybridization between probe and target can be achieved in one of several preferred approaches: a colorimetric approach, a fluorimetric approach, and a redox or radiation approach. Each has a distinct advantage over the other and can be employed as desired.
  • a colorimetric assay in which the probe can be unlabeled
  • the optical property of the hybridization solution is the visible color thereof.
  • the negatively charged nanoparticles are preferably the metal nanoparticles.
  • a color change of the hybridization solution can be brought about by inducing aggregation of the plurality of metal nanoparticles as illustrated in Figure 1.
  • the colorimetric assay is particularly useful when quantification is not necessary and where expensive detection equipment is unavailable. Detection of the color change in the hybridization solution can be carried out by naked eye observation of a user (i.e., the person performing the assay).
  • Aggregation will only occur if an insubstantial number of oligonucleotide probes has electrostatically associated with the metal nanoparticles. If a substantial number of oligonucleotide probes has electrostatically associated with the metal nanoparticles (on average greater than about one or two per nanoparticle), aggregation will be inhibited noticeably. Aggregation (color change) indicates that the target nucleic acid was present in the test solution. Induction of aggregation can be carried out by introducing a salt solution into the hybridization solution, with the salt being of sufficient concentration to alter the electrostatic properties of the metal nanoparticles, thereby promoting their aggregation.
  • the salt solution preferably comprises a Na + concentration of between about 0.01 and about 1 M, more preferably between about 0.1 and about 0.3 M.
  • the introduction of the salt solution to the hybridization medium can either be carried out simultaneously with the introduction of the solution containing the metal nanoparticles, or in succession therewith (either with or without a delay of up to about 15 minutes).
  • the colorimetric assay can be detected by naked eye observation, a user can either examine the hybridization solution for a detectable change in color or the assay can be carried out in parallel with one or more controls (positive or negative) that replicate the color of a comparable solution containing aggregated metal nanoparticles (negative control) and/or a comparable solution containing substantially non-aggregated metal nanoparticles (positive control).
  • the optical property of the hybridization solution is the fluorescence spectrum or the magnitude of a fluorescence peak by a f ⁇ uorophore. The photoluminescent property of the fluorophore label is detected after the hybridization procedure is allowed to proceed in the presence of the negatively charged nanoparticles.
  • Non-hybridizing oligonucleotide probes based on their size, will more rapidly associate electrostatically with the negatively charged nanoparticles than longer nucleic acid molecules in the hybridization solution.
  • the aggregates may or may not need to be separated from the nanoparticles remaining in solution.
  • separation is not required because the absence of hybridization (i.e., absence of the target) is indicated by substantial quenching of fluorescence by the fluorescent label when oligonucleotide probes electrostatically associate with one or more metal nanoparticles.
  • Hybridization between the oligonucleotide and the target nucleic acid molecule is indicated by a maintained photoluminescent property even after aggregation of the metal nanoparticles (which is achieved in the same manner as described above).
  • These alternatives are illustrated in Figure 2.
  • labeled probes remaining in solution i.e., in a ds- hybridization complex
  • aggregates to which ss-nucleic acids and probes have bound. Fluorescent emissions from the eluent (solution) - ⁇ y-
  • the fluorimetric assay is particularly useful for high sensitivity, when the target of interest is only one or many nucleic acid strands in a sample, when quantification of the target nucleic acid is desired, or when the presence of multiple distinct target nucleic acid molecules are being simultaneously analyzed within the same hybridization solution (i.e., using multiple oligonucleotide probes each with a distinct fluorophore attached thereto). Detection of the fluorescence properties of the hybridization solution can be achieved using appropriate detection equipment as is known in the art (e.g., fluorescence microscope, photomultipliers, CCD cameras, photodiodes, etc.).
  • the fluorimetric assay involves measuring fluorescence caused by the fluorophore(s) in the hybridization solution, a user can either examine the hybridization solution for the presence or absence of fluorescence. No controls are necessary.
  • the fluorimetric assay is highly sensitive to even small quantities and the photoluminescent properties can be detected with precise instrumentation, the fluorimetric assay lends itself to quantifying the amount of a target nucleic acid present in a test solution.
  • One approach for quantifying the amount of target nucleic acid present in the test solution involved comparing the results from the test solution to the results obtained from two control solutions that each contain known but differing amounts of the target nucleic acid. Thus, measurements of the photoluminescent property are obtained from the test solution and the two control solutions. Based on the photoluminescence of each solution, it is possible to calculate the quantity of the target nucleic acid in the test solution relative to the quantity of the target nucleic acid present in the first and second control solutions. Alternatively, the quantity of the target nucleic acid in the test solution can be calculated using the measured optical property (from the test solution) and a calibration curve of measured optical (e.g., photoluminescence) properties versus quantity of target nucleic acid.
  • the improvement described below resolves two limitations of the fiuorimetric assay described above.
  • the first limitation involves the contrast between unquenched fluorescence and fluorescence of hybridized probe. This can arise when the target to be hybridized represents a small enough fraction of the sample that it is overwhelmed by probe fluorescence that is not completely quenched. This can also arise if there were trace luminescence from the gold particles themselves.
  • the second limitation is that single (or very few) molecule sensitivity can be achieved when it is known that the fluorescent molecule is within a very limited area.
  • an improvement of the present invention relates to overcoming the limits of sensitivity of the fluorimetric assay described above.
  • the product of the hybridization procedure (which contains unbound ss-probe, ss-nontarget nucleic acid, and ds-target nucleic acid) is treated to allow for separation of the ds-target nucleic acid from the unbound ss-probe and ss-nontarget nucleic acid.
  • Exemplary approaches for treating the hybridization product for separating the ds-target nucleic acid include, without limitation: (1) the use of immobilized, electrostatically charged nanoparticles (e.g., citrate-coated gold or polyanion-coated glass); (2) causing electrostatically charged nanoparticles, with ss- nucleic acids bound thereto, to form insoluble aggregates (the so-called "crashout” approach); (3) concentrating ds-nucleic acid onto a charged solid surface (which can be performed alone or in combination with either of (1) or (2)); (4) the use of magnetic, electrostatically charged nanoparticles, which can be removed from solution with ss-nucleic acid adsorbed thereto; (5) the use of surfaces functionalized with thiol moieties to remove gold from solution; (6) addition of soluble dithiol or thioamine compounds to react with gold nanoparticles and remove them from solution via aggregation; or (7) mechanical methods to filter and remove the nanoparticles,
  • a modified approach for aggregation and separation involves the use of functionalized gold nanoparticles.
  • relatively large gold nanoparticles about 30 run up to about 100 nm, preferably about 40 to about 60 nm
  • whose surface is modified with mixed thiol self-assembled layers can be used.
  • Most of the surface can contain HS-(CH 2 ) n COOH to make the particle nominally water soluble and negatively charged so as not to adsorb ds-DNA.
  • a few sites per particle can be thiolated with HS-(CH 2 ) m SH dithiols that would allow for attachment to other gold nanoparticles, thereby forming aggregates that would crash out the gold/ss-DNA. It is preferably for m>n to facilitate the process. Though slow, the process should be effective in aggregating the gold nanoparticles.
  • Thiolated surfaces can also be prepared using of a variety of glass surfaces, e.g., a column of glass beads with an exposed thiol can be fabricated using standard silanization chemistry.
  • non-fluorescent labeling can be utilized, such as electrochemical or radioactive labeling using known (or hereafter developed) electrochemical or radioactive labels. These detection procedures can be used with separation, and preferably also with concentration of the ds-nucleic acid (carrying the probe). Electrochemical and radiation detection procedures are known in the art and can easily be adapted for detection of the labels, especially following separation protocols described above.
  • PCR can quickly amplify the total amount of nucleic acid in a sample, it is often used with hybridization-based detection procedures.
  • One of the significant benefits of the present invention is that the assay can be performed using the hybridization medium employed in the thermocycler. The only requirement, however, is that the product of PCR (typically a double-stranded cDNA) must be denatured prior to introducing the negatively charged nanoparticles. Specifically, the double-stranded cDNA can be denatured before or ⁇
  • Another important use of the assays of the present invention is for detecting a single nucleotide polymorphism ("SNP") in a target nucleic acid molecule. This is performed in slightly different manners depending on whether the colorimetric assay or the fluorimetric (or electrochemical or radiation) assay is to be performed. [0098] Basically, the colorimetric assay is performed in parallel using a test solution and a control solution.
  • the test hybridization solution contains a target nucleic acid molecule and at least one first single-stranded oligonucleotide probe having a nucleotide sequence that hybridizes to a region of the target nucleic acid molecule that may contain a SNP.
  • the probe contains a nucleotide sequence that does not hybridize perfectly to the region containing the SNP (i.e., no base-pairing occurs with the SNP).
  • the control hybridization solution contains the target nucleic acid molecule and at least one second single-stranded oligonucleotide probe including a nucleotide sequence that hybridizes perfectly to a region of the target nucleic acid molecule that does not contain a single-nucleotide polymorphism. Both the test and control hybridization solutions are then exposed to the metal nanoparticles, allowing any unhybridized probes in the hybridization solutions to electrostatically associate with the metal nanoparticles.
  • the hybridization solutions are maintained at a temperature that is between the melting temperature of the at least one first single-stranded oligonucleotide probe and the melting temperature of the at least one second single-stranded oligonucleotide probe (which has a higher melting temperature because it is perfectly complementary).
  • a determination is made whether an optical property of the test and control hybridization solutions are substantially different. A substantial difference indicates the presence of the single nucleotide polymorphism in the target nucleic acid molecule.
  • the first and second single-stranded oligonucleotide probes can possess the same nucleotide sequence (and be the same length) or a different nucleotide sequence. That is, the two oligonucleotide probes can hybridize to the same region of the target nucleic acids or different regions. If the latter, then the target nucleic acid molecule in the control solution is, e.g., a cDNA molecule that is known not to possess the particular SNP being detected in the test solution. If the former, then the hybridization region of the target nucleic acid molecule in the control solution is known to be stable and free of SNPs (i.e., contains a wild-type sequence).
  • the oligonucleotide probe for the control assay can be longer or can possess a modified structure (e.g., modified bases, backbone, etc.) that enhances the stability between the probe and target.
  • the fluorimetric assay is performed substantially as described above, except that the temperature of the hybridization solution is measured when quenching of photoluminescence from the fluorescent label begins (i.e., the temperature is slowly reduced until quenching begins). The measured temperature represents the melting temperature between the probe and the target nucleic acid.
  • This measured melting temperature is then compared to a known melting temperature of a perfectly complementary probe (this measurement can either be provided with a commercial kit or measured by performing the assay in parallel). A difference between the melting temperatures indicates the presence of the single nucleotide polymorphism in the target nucleic acid molecule.
  • these assays can also be performed when using the separation and detection procedures described above.
  • Yet another important use of the assays of the present invention is for detecting the presence of a pathogen in a sample. Basically, a sample is obtained
  • nucleic acid is isolated from the sample. Having isolated the nucleic acid, either RNA or DNA, an assessment can be made as to whether enough of the sample is present to afford detection using the assays or whether PCR or RT-PCR is necessary to amplify the isolated nucleic acid. Thus, amplification may or may not be necessary. For example, total RNA isolated from a sample may be of sufficient quantity to proceed without RT-PCR; whereas total DNA isolated from a sample may require amplification.
  • the assay of the present invention is performed and the optical property (color or fluorescence intensity) of the hybridization solution is measured or assessed to determine whether or not the single-stranded oligonucleotide probe has hybridized to the target nucleic acid, indicating presence of the pathogen.
  • This assay can also be performed when using the separation and detection procedures described above.
  • Yet another important use for the assays of the present invention is for genetic screening. Basically, a sample is obtained from a patient and nucleic acid is isolated from the sample. Because genetic screening will typically involve DNA isolation and analysis, it will typically (though not necessarily) require amplification.
  • the assay of the present invention is performed and the photoluminescent property of the hybridization solution is measured or assessed to determine whether or not the single-stranded oligonucleotide probe has hybridized to the target nucleic acid, indicating presence of a genetic marker for a genetic condition, a hereditary condition (e.g., paternity, maternity, relatedness, etc.), or identifying an organism.
  • This assay can also be performed when using the separation and detection procedures described above.
  • a further use of the assays of the present invention is detection of a protein or antibody in a sample.
  • Immuno-PCR is a procedure that can afford cDNA amplification only if a targeted protein is present in a sample.
  • the assays of the present invention can be coupled with the amplification detection procedure of immuno-PCR to confirm presence of the amplified cDNA in the hybridization medium and, thus, the target protein in a sample.
  • a sample is obtained and immuno-PCR is performed using the sample, wherein the immuno-PCR results in amplification of a nucleic acid that is conjugated to a protein.
  • the assays of the present invention are performed where the nucleic acid that is conjugated to the protein (or its complement) becomes the target of the colorimetric or fluorimetric assay of the present invention.
  • This assay can also be performed when using the separation and detection procedures described above.
  • a further use of the assays of the present invention is quantifying the amount of amplified nucleic acid prepared by polymerase chain reaction (or similar amplified procedure).
  • one or more, and preferably two or more fluorescently labeled oligonucleotide primers are provided that each have a nucleotide sequence capable of hybridizing to a nucleic acid molecule, or its complement, that us to be amplified.
  • Amplification using the primers is carried out using any of a variety of known amplification procedures (such as polymerase chain reaction) using a target nucleic acid molecule, and/or its complement, and the provided fluorescently labeled oligonucleotide primers.
  • the fluorimetric method of the present invention is performed on a sample obtained after the amplification procedure has been performed.
  • the level of fluorescence detected from the sample indicates the amount of primer that has been incorporated into an amplified nucleic acid molecule.
  • the amount of fluorescence from a given sample should increase due to the reduced rate at which longer nucleic acid electrostatically associate to the metal nanoparticles.
  • Unextended primers on the other hand, will rapidly associate with the metal nanoparticles, which results in quenching of fluorescence by labels attached thereto.
  • This assay can also be performed when using the separation and detection procedures described above.
  • kits that can be used to practice the assays of the present invention.
  • the kits can include, among other components, various containers that contain individual components that are used in accordance with the methods of the present invention, as well as instructions for carrying out one or more embodiments of the invention.
  • the kit includes a first container that contains a colloidal solution of metal nanoparticles, and a second container that contains an aqueous solution containing at least one single-stranded oligonucleotide probe having a nucleotide sequence that is substantially complementary to a target nucleic acid molecule.
  • the oligonucleotide probe in the second container may or may not be conjugated to a fluorescent label of the types described above.
  • the second container can optionally contain additional oligonucleotide probes (directed to the same or different target nucleic acid molecules), each having a distinct fluorescent emission pattern.
  • containers containing control solutions, salt solutions, and various instructions can also be provided.
  • the kit includes a first container that contains a colloidal solution of negatively charged nanoparticles, and a second container that contains an aqueous salt solution suitable to induce aggregation of the negatively charged nanoparticles.
  • This particular kit format is desired when the user intends to supply their own probe (with labels) and detection equipment. That is, depending upon the probes employed, detection devices suitable for electrochemical labels, radioactive labels, or fluorescence labels can be employed as desired.
  • the kit can optionally include a filter that is suitable to remove salt-induced aggregates while allowing passage of non-aggregated nanoparticles and ds-nucleic acids, as well as instructions for performing the assays of the present invention.
  • the kit includes a plurality of negatively charged nanoparticles bound to a substrate, for example, glass beads.
  • the substrate can be packed into a column, where they act as a filter to remove short, ss- nucleic acid while allowing ds-nucleic acid to flow through.
  • the kit can also include instructions for performing the assays of the present invention.
  • Example 1 Materials and Methods for Example 1 [0110] A colloidal solution of gold nanoparticles of about 13 nm diameter synthesized via citrate reduction OfHAuCl 4 (Grabar et al., Anal. Chem. 67:735-743 (1995), which is hereby incorporated by reference in its entirety) was used. The concentration of the colloidal solution was typically 17 nM. Lyophilized oligonucleotide sequences and their complements were purchased from MWG Biotech (High Point, NC) and dissolved in 10 mM phosphate buffer solution.
  • oligonucleotides purchased from MWG Biotech (High Point, NC) were used. Solutions in quartz cells with 1 cm path length were studied on a Jobin-Yvon Fluorolog-3 spectrometer with front face collection geometry and 4 nm resolution. Resonance Raman spectra were taken on these dye labeled oligonucleotides with steady state 532 nm excitation and detection by an Ocean Optics CCD array with a holographic notch filter to reject Rayleigh scattering. The resolution was approximately 10 cm "1 . Photographs were taken with a Canon S-30 digital camera.
  • Example 1 Gold Nanoparticles Preferentially Adsorb Single-Stranded Nucleic Acid Rather Than Double-Stranded Nucleic Acid
  • FIGS 4A-B DNA and gold nanoparticles is illustrated in Figures 4A-B.
  • dye tagged ss-DNA quenching of the dye photoluminescence and enhancement of resonant Raman scattering from the dye were observed. Both of these require intimate contact between the dye and the gold since they are effects of electronic interactions with the gold plasmons.
  • Figure 5 A presents spectra of the colloid prior to and after addition of ss-DNA or ds-DNA and salt/buffer solution.
  • Figure 5B illustrates a condensed form of the same data for two ss-
  • analyte solution contains a mixture of oligonucleotide sequences as might occur in products of polymerase chain amplification, where primers and other fragments are present (Rolfs et al., PCR: Clinical Diagnostics and Research, Springer- Verlag, Berlin Heidelberg (1992), which is hereby incorporated by reference in its entirety).
  • Figure 6 A illustrates the result for a mixed oligonucleotide analyte with various fractions of target sequence and it is clear that as little as 30% target is easily detected. A situation similar to concentration mismatch occurs when the target and probe sequences are complementary but have different lengths.
  • a 1 cm path length provides optical densities near unity. Empirically, it is easy to visually identify the colour in 5 ⁇ L droplets that contain less than 100 femtomoles of gold particles.
  • Figure 5B illustrates that ss-DNA concentrations only slightly greater than the nanoparticle concentration are sufficient to stabilize the colloid against aggregation when exposed to salt. Consequently, one would expect to be able to differentiate between amounts of ss- and ds-DNA of order 100 femtomoles without instrumentation.
  • the method is easily adapted to identifying single base pair mismatches between probe and target as is essential for detection of biologically important single nucleotide polymorphisms (Rolfs et al., PCR: Clinical Diagnostics and Research, Springer- Verlag, Berlin Heidelberg (1992), which is hereby incorporated by reference in its entirety). Utilized was the fact that the kinetics of ds- DNA dissociation into ss-DNA fragments depend on the binding strength (Owczarzy et al, Biopofymers 44:217-239 (1997); Santalucia et al., J. Am. Chem. Soc.
  • ds'-DNA mismatched ds-DNA
  • the ds-DNA from the trial solution was allowed to dehybridize briefly in water without salt before adding gold colloid and the salt/buffer solution.
  • the assay described has additional benefits beyond its speed and simplicity. Because of the ability to exploit the electrostatic properties of the DNA, hybridization is separated from detection so that the kinetics and thermodynamics of DNA binding are unperturbed by steric constraints associated with probe functionalized surfaces. In addition, the assay is homogeneous as it occurs exclusively in the liquid phase, a feature that makes it easy to automate using standard robotic manipulation of microwell plates. The ability to differentially adsorb ss-DNA onto the gold particles can also form the basis for a sensitive assay based on fluorescence that still avoids tagging of the analyte.
  • the fluorescence of the ss-DNA can be selectively quenched as in Figure 4A since it forces the dye to be near the gold nanoparticles where the fluorescence is quenched (Dubertret et al., Nature Biotechnol. 19:365-370 (2001); Du et al., J. Am. Chem. Soc. 125:4012-4013 (2003), which are hereby incorporated by reference in their entirety). If the tagged probe ss-DNA binds the target, however, the ds-DNA does not adsorb on the gold and the fluorescence persists.
  • Colloidal Au-np suspensions are stabilized against Au-np aggregation by adsorption of negatively charged ions that lead to strong electrostatic repulsion between the nanoparticles (Hunter, Foundations of Colloid Science. Oxford University Press Inc., NY (2001), which is hereby incorporated by reference in its entirety).
  • sodium citrate is added to gold nanoparticles during their synthesis so that citrate adsorption makes the Au-np surfaces negatively charged.
  • Both the colorimetric and fluorescent detection protocols take advantage of the rapid adsorption of single stranded oligonucleotides to the Au-np. This adsorption has been documented using fluorescence quenching and Raman experiments ⁇ see Examples infra).
  • oligonucleotides are themselves commonly regarded as negatively charged species presenting negatively charged phosphate backbones that would be repelled by citrate.
  • the rapid ss-DNA adsorption can be rationalized with a model where single stranded oligonucleotides can configure themselves with hydrophobic bases facing the Au-np. In this geometry, dipolar attraction can reduce the barrier to adsorption of ss-DNA and ss-RNA ⁇ see Examples infra).
  • Double stranded oligonucleotides are unable to achieve an uncoiled geometry with exposed bases and, therefore, experience much larger repulsion by the ions on the Au-np surface. Consequently, they take much longer times to adsorb or do not adsorb to the Au-np at all under some conditions.
  • the single stranded oligonucleotides add negative charge density to the Au-np surface and act to enhance the stability of the colloid. It is therefore possible to protect the colloid from aggregation upon exposure to amounts of salt that would ordinarily screen the electrostatic repulsion between Au-np and induce aggregation. Hence, the gold will remain pink upon exposure to salt following exposure to ss-DNA or ss-RNA, while it will turn grayish-blue following exposure to ds-DNA or ds-RNA. This observation forms the basis for the colorimetric hybridization assay. The preferential adsorption of short ss-DNA probe sequences on Au-np can also be exploited to perform the fluorescent assay. When the ss-DNA probe is fluorescently tagged, adsorption to the metallic surface results in fluorescence quenching (Lakowicz, Principles of Fluorescence Spectroscopy, Kluwer ⁇
  • HAuCl 4 (Gradar et al., Anal. Chem. 67:735-743 (1995), which is hereby incorporated by reference in its entirety). Briefly, 500 mL of 1 mM HAuCl 4 was brought to a rolling boil with vigorous stirring. 50 mL of 38.8 mM sodium citrate was quickly added to the solution, and boiling was continued for 10 min. The heating mantle was then removed and the stirring was continued for an additional 15 minutes.
  • AU oligonucleotides were purchased from MWG Biotech, Inc. (High Point, NC) without further purification. Probes hybridize with targets in 10 mM phosphate buffer solution with 0.3 M NaCl for more than 5 minutes at room temperature or proper temperature.
  • Rhodamine red-labeled probe AGGAATTCCATAGCT (SEQ ID NO: 25); and Target nucleic acid: AGCTATGGAATTCCT (SEQ ID NO: 26).
  • Rhodamine red-labeled probe AGGAATTCCATAGCT (SEQ ID NO: 25);
  • Complementary Target A ACT AGGC ACTGTACGCCAGCTATGGAATTCCTT
  • Noncomplementary Target C TGTGTTGAACCTGGTGAAGTTGTAATCTGGAA
  • Rhodamine red-labeled probe AGGAATTCCATAGCT (SEQ ID NO: 25); Complementary Target A': ACTAGGC ACTGTACGCCAGCTATCGAATTCCT TAGCTATGAGATCCTTCG (SEQ ID NO: 27); and Complementary Target B' : GTTAGCTATGAGATCCTTCGTAGGCACTGTAC GCO4 GCTATCGAATTCCT (SEQ ID NO: 28).
  • Rhodamine red-labeled probe 1 CTGAATCCAGGAGCA (SEQ ID NO: 29); Complementary Target 1: the complement of probe 1; Cy5-labeled probe 2: TAGCTATGGAATTCCTCGTAGGCA (SEQ ID NO: 6); Complementary Target 2: the complement of probe 2; and Non-complement target: ATGGCAACTATACGCGCTAC (SEQ ID NO: 30).
  • a fraction of hybridized solution was added to 500 ⁇ L of 17 nM gold colloid solution, and an additional 500 ⁇ L of the 0.1 M saline 10 mM phosphate buffer solution was added if without specific illustration.
  • the fluorescence of this mixture was recorded immediately using either a fluorimeter, or a fluorescence microscope and camera. Fluorescence spectra were measured on a fluorimeter with excitation at 570 nm, and emission range from 585 to 680 nm, with slits set for 4 run bandpass unless specific illustration was given. Fluorescence images were recorded with a fluorescence confocol microscope equipped with notch filter and narrow bandpass interference filter. Fluorescence was excited by a 532 nm laser source.
  • Example 2 Differential Fluorescence Quenching of Dye-Tagged Single- Stranded DNA and Double-Stranded DNA
  • DNA oligonucleotides labeled with rhodamine red fluorescent dye covalently attached at the 5' end were used as probes.
  • Several microliters of ⁇ M solutions of probe were exposed to the target sequences for trial hybridization in 10 mM phosphate buffer with 0.3 M NaCl.
  • the hybridization solutions were added to colloidal gold suspensions and additional phosphate buffer saline solution was added to assist in stabilizing ds-DNA.
  • Figure 7A illustrates the result of a measurement comparing the photoluminescence from trial solutions with complementary and non-complementary targets. Fluorescence contrast larger than 100:1 was observed because unhybridized probes efficiently adsorb on the gold nanoparticles so that their fluorescence is quenched. The adsorption mechanism is entirely electrostatic, as discussed in Example 1 above. The adsorption and concomitant fluorescence quenching are irreversible. [0130] Addition of the trial hybridization solutions and salt to the gold colloid eventually cause aggregation of the colloid. The latter leads to precipitation so that the nanoparticles are no longer an effective quencher of the probe fluorescence.
  • Figure 7A illustrates that this is not necessary as long as the fluorescence measurements are made within about 15 minutes.
  • Figure 7B illustrates measuring the fluorescence of a very small aliquot of the solution containing only 0.1 femtomoles of target and this is easily detected with a fluorescence microscope and camera.
  • the assay can work to determine whether target strands are present even in complex mixtures of DNA oligonucleotides as demonstrated by the data of Figure 8B. In that case, 1% complementary target was mixed with 99% non-complementary target to verify the presence of the target sequence.
  • the tolerance of the assay to mixtures, along with its sensitivity, provides the potential for it to be used without target amplification by PCR.
  • Figure 9 shows the detection by one long target complementary to the probe in the middle portion and another long target complementary to the probe at one end.
  • This procedure should be applicable to rapid detection of single nucleotide polymorphisms in genomic DNA, an exciting prospect for eliminating time-consuming and expensive gel sequencing procedures that are currently the standard protocol (Rolfs et al., PCR: Clinical Diagnostics and Research, Springer- Verlag, Berlin Heidelberg (1992), which is hereby incorporated by reference in their entirety).
  • PCR Clinical Diagnostics and Research, Springer- Verlag, Berlin Heidelberg (1992)
  • the differential quenching assay can also be multiplexed to simultaneously look for several sequences on a single target or for several targets.
  • Figure 10 illustrates this where two different probes with two different dyes are hybridized with a mixture of targets. If spectroscopic detection is used, it is plausible to imagine expanding this approach to 5 or 6 targets with conventional dyes and even more with semiconductor nanoparticle fluorophores that have spectrally sharp emission. This, of course, presumes that these do not perturb the essential electrostatics that is the basis of the method.
  • the entire assay can be completed in less than 10 minutes because the hybridization step occurs in solution under optimized conditions and is separated from the detection step.
  • a sensitivity to less than 0.1 femtomole of DNA oligonucleotides has been demonstrated, but, because the method is nearly a null method and relies on fluorescence detection, it is probably possible to improve this by several orders of magnitude. It is believed that the method has enormous promise for applications to pathogen detection, clinical analysis of SNPs, and biomolecular research.
  • UV/VIS/NIR spectrometer Lambda 19 Quartz cells with 2 mm or 5 mm path length were used and water was used as reference. Fluorescence spectra and intensities versus time were recorded on a Jobin-Yvon Fluorolog-3 spectrometer with excitation at 570 nm and emission at 590 nm, each with slits set for 4 nm bandpass. Quartz cells with 1 cm path length and front face collection were used for the fluorescence measurements.
  • Example 7 Effects of Oligonucleotide Probe Length and Temperature on Adsorption of ss-DNA to Gold Nanoparticles
  • 300 ⁇ L gold colloid was mixed with 300 picomole 24 mer ss-DNA (5'-TGC CTA CGA GGA ATT CCA TAG CTA-3' (SEQ ID NO: 4)) in 10 ⁇ L of 10 mM PBS containing 0.2 M NaCl, and then 100 ⁇ L of 10 mM PBS containing 0.2 M NaCl was added.
  • ss-DNA sequences were 10 mer (5'- CAG GAA TTC C-3' (SEQ ID NO: 5)), 24 mer (5'-TAG CTA TGG AAT TCC TCG TAG GCA-3' (SEQ ID NO: 6)), and 50 mer (5'-GAA CCT CTG CTC AAC AAG TTC CAG ATT ACA ACT TCA CCA GGT TCA ACA CA-3' (SEQ ID NO: I)).
  • the color of gold colloid is very sensitive to the degree of aggregation of nanoparticles in suspension (Quinten et al., Surf. ScL 172:557 (1986); Lazarides et al., J. Phys. Chem. B 104:460 (2000); Storhoff et al., J. Am. Chem. Soc. 122:4640- 4650 (2000), which are hereby incorporated by reference in their entirety), and the aggregation can be easily induced with electrolytes such as salt (Hunter, Foundations of Colloid Science, Oxford University Press Inc., New York (2001); Shaw, Colloid and Surface Chemistry, Butterworth-Heinemann Ltd., Oxford (1991), which are hereby incorporated by reference in their entirety).
  • gold nanoparticles have surface plasma resonance absorption peak at 520 nm (Figure 1 IA: red) and appear pink (Figure 1 IA, inset: left vial). Immediate aggregation of the gold nanoparticles occurs when enough salt is added to screen the electrostatic repulsion between the ion-coated gold nanoparticles. The result is a broad featureless absorption spectrum (Figure 1 IA: blue) and blue-gray color ( Figure 1 IA, inset: middle vial) characteristic of the surface plasma resonance of gold nanoparticle aggregates (Quinten et al., Surf. Sd. 172:557 (1986); Lazarides et al., J.
  • Figure 1 ID illustrates the proof of principle for each of these assays with synthesized 50 base oligonucleotide targets and rhodamine-labeled 15 base probe.
  • KCNEl gene indicative of long QT syndrome was amplified in Promega PCR master mix (Promega, Madison, WI) with Tag DNA polymerase for 5 min at 95°C; 35 cycles of 30s at 95°C, 30s at 56 0 C and 30s at 72°C; 10 min at 72°C and then held at 4 0 C, yielding 189 bp PCR product.
  • the method takes less than ten minutes to verify amplification of the appropriate sequence and test for SNPs with the same thermal cycler used to do the PCR.
  • the protocol illustrated schematically in Figure 13A was followed.
  • Two ss-DNA probes were chosen with sequences complementary to the desired PCR product that have melting temperatures lower than the primers and add these to the PCR product solution.
  • the PCR amplified ds-DNA is dehybridized at 95°C to produce ss-DNA. These mixtures are annealed below the probe melting temperature so that the probes can hybridize with the PCR amplified sequence if it is present.
  • the unconsumed primers also bind to the PCR product since they have melting temperatures higher than those of the probes.
  • competition for binding locations from rehybridization of the PCR amplified complement is negligible since it is slower for steric reasons.
  • the salt in the hybridization solution causes immediate gold nanoparticle aggregation and a color change if the probes have hybridized to the amplified DNA target ( Figure 13B, left vial).
  • the probes adsorb to the gold nanoparticles and prevent aggregation ( Figure 13B, right vial).
  • Example 9 Sequence Detection and Single Base-Pair Mismatch Detection of PCR-Amplif ⁇ ed Target cDNA
  • 8 ⁇ L of unmodified PCR product was mixed with 6 ⁇ L of 1 ⁇ M probe solution containing either two complementary probes or two non-complementary probes in 10 mM PBS containing 0.3 M NaCl. After 5 minute denaturation at 95 0 C and 1 minute annealing at 5O 0 C, 60 ⁇ L gold colloid was added and photographs were taken.
  • probe sequences are as follows: 5'-CCT GTC TAA CAC CAC AG-3 ' (SEQ ID NO: 14) and 5'-CCA CAG CTT GGT CAG AA-3' (SEQ ID NO: 15) (complementary probes);
  • hybridization occurs under optimized conditions that can be regulated independent of the assay.
  • the assay has also been applied to clinical samples of genomic DNA that screen for SNPs associated with a hereditary cardiac arrhythmia known as long QT syndrome. It is believed that this approach can replace some traditional analytical methods for post-processing of PCR amplified DNA and that it will find broad application.
  • RNA target containing either one complementary probe or one non-complementary probe in 10 mM PBS and 0.3M NaCl solution.
  • RNA and gold colloid were added and photographs were taken.
  • the amount of RNA and gold colloid can be increased or decreased accordingly. In this case, a relatively large amount RNA and gold was used to measure visible spectra on regular spectrometer.
  • RNA probe AGGAAUUCCAUAGCU (SEQ ID NO: 21); perfect matched target: AGCUAUGGAAUUCCU (SEQ ID NO: 22); and non-complementary target: CGAUCACGAGAUCGA (SEQ ID NO: 23).
  • RNA probe AGGAAUUCCAUAGCU (SEQ ID NO: 21); perfect matched target: AGCUAUGGAAUUCCU (SEQ ID NO: 22); and single mismatched target: AGCUAUAGAAUUCCU (SEQ ID NO: 24).
  • an RNA probe can be used to effectively discriminate between a SNP and a wild-type sequence.
  • a detection protocol employing a capture antibody and a biotinylated detection antibody coupled via streptavidin to a biotinylated DNA molecule can be employed in detecting the presence of an antigen using standard immuno-PCR procedures. If the antigen is present, PCR will result in amplification of the biotinylated DNA molecule. Assuming the antigen was present, the amplified PCR product will be detected by colorimetric or fluorimetric detection methods described in the above examples.
  • citrate-coated gold nanoparticles prepared as described above were attached to the surface of glass beads, the beads were loaded into a column, and then the hybridization product was introduced into the column to collect the eluted solution (which contains the double stranded DNA labeled with fluorophores).
  • This approach effectively solved the contrast problem identified above. This process can be repeated more than once to optimize the results.
  • the detailed procedure included the following steps:
  • Cleaning glass beads Glass beads of 1 mm diameter were washed with piranha solution for 20 min, rinsed with clean water thoroughly, and then dried on a hot plate. 2. Coating glass beads with amino-group terminal molecules: glass beads were immersed in aminopropyl triethoxysilane (APTES) in toluene solution for 30 min, and then washed thoroughly with toluene. The APTES-modif ⁇ ed glass beads were then baked in an oven at 100 0 C. 3. Coating glass beads with gold nanoparticles: APTES-modified glass beads were immersed in gold colloid for 30 min, then rinsed with clean water thoroughly, dried on a hot plate, and cooled to room temperature for use.
  • APTES aminopropyl triethoxysilane
  • Small anion glass beads can be made by exposure of glass beads to aqueous solution containing the anions. Under appropriate conditions of temperature and pH, the glass surface will be effectively coated with the anions.
  • Polyanionic coatings of a wide variety of substrates can be accomplished by simply dipping substrates in polyelectrolyte solutions according to the methods of Shiratori and Rubner, "pH-dependent Thickness Behavior of Sequentially Adsorbed Layers of Weak Polyelectrolytes," Macromolecules 33(11):4213-4219 (2000), which is hereby incorporated by reference in its entirety.
  • Example 14 Formation of Patterned Charged Films on a Substrate
  • Patterned charged films to be used to concentrate ds-nucleic acid can be fabricated in accordance with the procedures described in Zhang et al., "Particle Assembly On Patterned “Plus/Minus” Polyelectrolyte Surfaces Via Polymer-On- Polymer Stamping," Langmuir 18(11):4505-4510 (2002), which is hereby incorporated by reference in its entirety.
  • Example 15 Separating Citrate-Coated Gold Nanoparticles (and ss-DNA
  • the crashout method involves first using the interactions in solution to adsorb the ss-DNA preferentially on the gold (or other negatively charged) nanoparticles, but then removing the nanoparticles and ss-DNA bound thereto, leaving the ds-DNA (target) to be analyzed. This is called the "crashout” method since it involves removing the nanoparticles from solution rather than removing the ss-DNA from solution.
  • the protocol for this method is similar to the fluorescence method described above.
  • the analyte was first hybridized against the fluorescently tagged probe with sequence complementary to the target (whose presence is being screened).
  • the hybridization solution was then introduced into gold colloid, and followed by the addition of salt solution.
  • the salt concentration should be provided within the range of about 0.1- 1 M, because too much salt will permit the repulsion of the nanoparticle coating to be screened so that ds-DNA will adsorb, whereas too little salt will not cause the gold to aggregate.
  • anion- or polyanion-coated non-metallic nanoparticles can be substituted for the colloidal gold nanoparticles in the crash out method given that quenching of fluorescence is no longer relied upon for signal detection perse.
  • immobilized beads and crashout methods solve the contrast problem, but they also allow for the use of other labels besides fluorescent tags.
  • Two suitable labels are radioactive tags and electrochemical (“redox”) tags.
  • electrochemical detection can be carried out using either cyclic voltammetry (De-los- Santos-Alvarez, Anal. Chem. 74:3342-3347 (2002), which is hereby incorporated by reference in its entirety), stripping potentiometry (Wang et al., Anal. Chem.
  • the part of the analyte that comes through the column can be easily analyzed for fluorescence (or radioactivity or electrochemical activity).
  • fluorescence or radioactivity or electrochemical activity
  • the charged spot can be prepared using a polycation (e.g., polyamine), and detection equipment (e.g., fluorescence microscope) can be focused on the predefined location.
  • detection equipment e.g., fluorescence microscope
  • the charged spot can be a micro-electrode (e.g., gold, platinum, etc.) functionalized with a monolayer whose end group is positively charged, e.g., NH 2 .
  • a patterned polyelectrolyte can be made as follows. First, a negatively charged surface to which DNA will not adhere is formed on a glass slide by standard electrostatic self-assembly techniques. For example, a multilayer structure can be formed with a PAA (polyacrylic acid) top layer. A PDMS stamp can be fabricated with a predefined recessed region the size of the desired microscope focus. The stamp is inked with a monolayer to pattern that surface to be hydrophobic everywhere except for the place where the stamp is recessed. An ink made of ODA (CH 3 (CHa) 17 NH 2 ) in an organic solvent is suitable for this purpose; the applicants have previously demonstrated use of this ink.
  • ODA CH 3 (CHa) 17 NH 2
  • the amine is attracted to the carboxylate terminations of the PAA surface, thereby transforming the hydrophilic PAA to hydrophobic in the region where the ink layer is applied.
  • a positively charged electrolyte can be applied to the resulting patterned surface, and the electrolyte will only stick where there is no ODA.
  • the ODA can then be removed by rinsing with organic solvent, leaving the patterned charged surface.
  • Application of the processed analyte, where only tagged ds-nucleic acid should remain, will allow the DNA to be concentrated onto the positively charged spot for analysis.
  • Example 18 Formation of Positively Charged Microparticles
  • Polycationic polystyrene or silica microspheres can be made by exposure of microspheres to aqueous solutions containing cations. Under proper conditions of temperature and pH, the microsphere surface will effectively be coated with the cations. Polycationic coatings of a wide variety of substrates can be accomplished by simply dipping substrates in polyelectrolyte solutions.
  • Polycationic microparticles can be introduced into eluent that comes through a separation column of the type described in Example 17 above.
  • the microparticles will adsorb labeled ds-DNA onto a small volume.
  • the microparticles can be introduced onto a negatively biased electrode for analysis using a confocal microscope.
  • Gold colloid an aqueous suspension of Au-nps stabilized against aggregation by sodium citrate, was prepared as described elsewhere (Grabar et al., "Preparation and Characterization of Au Colloid Monolayers," Anal. Chem. 67:735-743 (1995), which is hereby incorporated by reference in its entirety). Briefly, 250 mL of 1 mM HAuCl 4 (Alfa Aesar, Ward Hill, MA) aqueous solution was heated to its boiling point while stirring.
  • RNA oligonucleotide targets and probes A 2- o-methyl RNA oligonucleotide (5'-AGG AAU UCC AUA GCU-3 ', SEQ ID NO: 34) was synthesized and purified by IDT (Coralville, IA) to be used as a probe sequence for the colorimetric assay. Three RNA sequences with the same length as the probe were used as targets. These were synthesized and purified (RNase-free HPLC purification, RNA oligos of greater than 85% foil length product) by IDT.
  • c-target One sequence (c-target) was complementary to probe, the second (mc-target: 5'-AGC UAU AGA AUU CCU-3 ', SEQ ID NO: 35) had a one base-pair mismatch with the probe and the third (nc-target: 5'-CGA UCA CGA GAU CGA-3', SEQ ID NO: 33) is not complementary to the probe.
  • rhodamine red labeled DNA were used as probes (wild-type probe: rhodamine red-5'-AGG AAT TCC ATA GCT-3', SEQ ID NO: 8, and mutant probe: rhodamine red-5'-AGG AAT GCC ATA GCT-3', SEQ ID NO: 36).
  • Rhodamine red labeled DNA sequences were purchased from MWG Biotech (High Point, NC). 2'-ACE protected 50 mer RNA50a and RNA50b were purchased from DHARMACOM RNA Technologies (Lafayette, CO). These two sequences only have a single base difference in their sequences (RNA50a (/RNA50b): 5'-ACU AGG CAC UGU ACG CCA GCU AUG GA(/C)A UUC CUU AGC UAU GAG AUC CUU CG-3', SEQ ID NOS: 31-32, respectively. RNA50a contains a sequence perfectly matched with the wild-type probe while the analogous segment of RNA50b has a single base-pair mismatch with the wild-type probe.
  • RNA and DNA solutions with concentrations of salt and phosphate buffer as specified in the text were made.
  • the requisite potassium phosphate (monobasic, anhydrous 99.999%) and sodium phosphate (dibasic, anhydrous, 99.999%) were obtained from Aldrich Chemical (Milwaukee, WI) and used as supplied.
  • Sodium chloride crystals were purchased from Mallinckrodt (Hazelwood, MO).
  • the trial solution was heated to 95°C for 3 minutes and then cooled to an appropriate temperature for the desired assay for 1 minute.
  • the temperature used for simple sequence detection was typically ambient while single base mismatch detection requires that hybridization takes place at a temperature between the melting temperature of the mismatch and that of the perfect match.
  • the gold colloid was used at ambient temperature regardless of the temperature of the trial solution.
  • Fluorescence Detection 5 ⁇ L trial hybridization solution was added to 500 ⁇ L gold colloid, then mixed with 500 ⁇ L of 10 PBS containing 0.3 M NaCl. The fluorescence spectrum of the mixture was recorded within 2 minutes after mixing in a fluorimeter (Fluorolog 3, Jobin Yvon) with excitation at 570 ran over the range of emission wavelengths from 585 to 680 nm. Spectrometer slits were set for 4 nm bandpass. Traces of photoluminescence versus time were recorded with at 590 nm near the rhodamine emission maximum.
  • FIGS 19A-D are images taken immediately after mixing trial hybridization solutions with gold colloid. The quantity of salt in the hybridization solution was adequate to cause Au-np aggregation in the absence of RNA. Each vial contains 10 ⁇ L trial hybridization solution that contains 10 mM PBS and 0.3 M NaCl and 50 ⁇ L gold colloid. In the hybridization solution, there were 20 picomoles of RNA probe and target.
  • RNA 2'-o-methyl RNA was used because of its high stability (Majlessi et al., "Advantages of 2'-O-methyl Oligoribonucleotide Probes for Detecting RNA Targets," Nucleic Acids Res. 26:2224-2229 (1998), which is hereby incorporated by reference in its entirety).
  • Complementary (c), single base mismatched (mc), and unrelated (nc) target sequences were used in the left, center and right vials, respectively. All trial hybridization solutions were heated at 95 0 C for 3 minutes, then annealed for 1 minutes at the specified temperatures (A: 20°C, B: 50°C, C: 59°C and D: 64°C).
  • Example 21 Fluorescent Detection of RNA Long-mers
  • colorimetric detection There are some limitations on colorimetric detection that can be ameliorated by using the fluorescent assay described above. Since traditional absorption spectroscopy is, by its nature, not a null experiment, its sensitivity is limited. Moreover, a number of ambiguities arise in the context of using the colorimetric method illustrated in the preceding examples. For example, it is easy to imagine circumstances where the quantities of target and probe differ so that the trial hybridization solution contains both single and double strands, hi addition, situations where the length of the probe does not match that of the target leaves a single stranded overhang on a double stranded complex. Using the fluorescent assay, these practical difficulties do not arise.
  • RNA sequence detection DNA sequences were labeled with rhodamine red as probes because RNA oligonucleotides are difficult to fluorescently label.
  • Long synthetic targets 50 bases
  • 15 base probes were used to assay for a complementary sequence on the targets.
  • the hybridization solution was heated to 94 0 C for 3 minutes to break up secondary structure and annealed for 1 minute at a lower temperature.
  • single base mutations can be detected by careful choice of annealing temperature for hybridization.
  • the duplex formed from a probe and mutant target has a lower melting temperature than the duplex formed from the probe and wild-type target.
  • Figure 22 depicts the time course of the luminescence after mixing the trial hybridization solution with Au-nps as monitored at the wavelength maximum of the fluorescence in an experiment analogous to that of Figure 21, but where the hybridization solution contains 5 picomoles probe, 5 picomoles target and 50 picomoles of short RNA noncomplementary segments.
  • the hybridization solution contains 5 picomoles probe, 5 picomoles target and 50 picomoles of short RNA noncomplementary segments.
  • Each combination of wild type and mutant probe and targets are illustrated at an annealing temperature below the wild type melting temperature.
  • Figure 22 An important implication of Figure 22 is that the fluorescent assay can tolerate substantial amounts of RNA degradation into short sequences as often occurs. As long as there is an adequate concentration of Au-np, these do not interfere with adsorption of unhybridized probes and the attendant fluorescence quenching essential to the assay. [0189]
  • the dynamics reflected in Figure 22 are important in the performance of the assay since the fluorescence should be evaluated at a time long enough to allow for adsorption of the unhybridized probes but short enough relative to the lifetime or adsorption rate of the hybridized complex formed between probe and target. Under the conditions of Figure 22, the adsorption of unhybridized probes on the Au-np is very rapid and occurs prior to the beginning of the trace.
  • the subsequent slow decay seen in Figure 22 has several possible explanations.
  • the complex formed between the probe and target may not be perfectly stable in the gold colloid and may slowly dehybridize. Even if it does not, single stranded portions of the long target strand may adsorb and bring the probe fluorophore close to the Au-np so that quenching is observed.
  • the above examples demonstrate a simple approach to detection of specific RNA sequences based on the differential adsorption rates for single and double stranded oligonucleotides onto Au-nps.
  • a colorimetric assay for target RNA sequences with 2-o-methyl RNA probes and a fluorescent assay based on hybridization of target RNA with fluorescently labeled DNA probes have been developed.
  • the assays require only commercially available reagents.
  • a key strength of the methods is that the hybridization step is completed independent of the assay so that it can be performed under optimal conditions for rapid, efficient hybridization. Each assay therefore takes less than 10 minutes so that issues concerning RNA instability are minimized. Single base mismatches between probe and target sequences are easily detected with high contrast.
  • the fluorescent assay is particularly promising since it is effective even for complex target mixtures and in cases where the probe and target have quite different length. This will allow its use in searching for target sequences in samples of genomic RNA.

Abstract

L'invention porte sur des procédés et des kits permettant de détecter la présence ou l'absence de séquences d'acide nucléique cible dans un échantillon. Ces procédés et ces kits reposent sur l'utilisation de nanoparticules à charge négative et sur les interactions électrostatiques entre les nanoparticules métalliques et les molécules d'acide nucléique. Les procédés sont fondés sur l'interaction différentielle d'acides nucléiques ss et d'acides nucléiques ds avec les nanoparticules à charge négative qui distinguent les sondes d'oligonucléotide marquées qui s'hybrident avec une cible de celles qui ne le font pas. Des améliorations de sensibilité apportées à la variation de fluorescence du procédé ont été obtenues en incluant une étape de séparation des acides nucléiques ds dans la solution des nanoparticules à charge négative auxquelles les acides nucléiques ss sont liés, puis de détection de la présence des acides nucléiques cibles ds dans la solution. Les mêmes protocoles de séparation peuvent servir à la viabilité de la détection au moyen d'étiquettes électrochimiques ou radioactives.
EP06719184A 2005-01-21 2006-01-23 Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes Withdrawn EP1848823A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US64582105P 2005-01-21 2005-01-21
PCT/US2006/002233 WO2006079009A2 (fr) 2005-01-21 2006-01-23 Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes

Publications (2)

Publication Number Publication Date
EP1848823A2 EP1848823A2 (fr) 2007-10-31
EP1848823A4 true EP1848823A4 (fr) 2008-06-25

Family

ID=36692981

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06719184A Withdrawn EP1848823A4 (fr) 2005-01-21 2006-01-23 Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes

Country Status (3)

Country Link
EP (1) EP1848823A4 (fr)
JP (1) JP2008527999A (fr)
WO (1) WO2006079009A2 (fr)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101171635B1 (ko) 2006-08-08 2012-08-09 아크레이 가부시키가이샤 변이의 검출 방법 및 그것에 이용하는 키트
EP2224017A4 (fr) * 2007-12-26 2011-05-04 Arkray Inc Procédé pour l'amplification d'une séquence d'acide nucléique cible et sonde utilisée à cet effet
KR101974577B1 (ko) * 2012-05-21 2019-05-02 삼성전자주식회사 나노입자 제작용 주형 및 이를 이용한 나노입자의 제조 방법
US20130316462A1 (en) * 2012-05-25 2013-11-28 Health Diagnostic Laboratory, Inc. Rapid and high-throughput analysis of sterols/stanols or derivatives thereof
JP6070246B2 (ja) * 2013-02-15 2017-02-01 ニプロ株式会社 試験片を含むキット
CN108298502B (zh) * 2018-01-15 2021-06-01 东南大学 一种制备分散纳米金属氧化物及纳米金属粉的方法
CN110878344A (zh) * 2019-12-17 2020-03-13 臻准生物科技（上海）有限公司 一种缩短pcr扩增时间的方法
CN115555576B (zh) * 2022-09-26 2024-03-12 青牧科技南京有限公司 一种等离子共振表面多层自组装小分子结构、组装方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0667398A2 (fr) * 1994-02-14 1995-08-16 Kyoto Dai-ichi Kagaku Co., Ltd. Procédé et appareil de détection de la séquence spécifique des bases d'ADN
WO1998004740A1 (fr) * 1996-07-29 1998-02-05 Nanosphere Llc Nanoparticules sur lesquelles sont attaches des oligonucleotides et utilisations desdites nanoparticules
WO2003027678A1 (fr) * 2001-09-26 2003-04-03 Psychiatric Genomics, Inc. Dosage de proximite par fluorescence
WO2004111602A2 (fr) * 2003-05-16 2004-12-23 University Of Rochester Procedes de colorimetrie et de fluorescence permettant de detecter des oligonucleotides

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6258264B1 (en) * 1998-04-10 2001-07-10 Transgenomic, Inc. Non-polar media for polynucleotide separations
AU2907201A (en) 1999-12-09 2001-06-18 Motorola, Inc. Methods and compositions relating to electrical detection of nucleic acid reactions
US20030018179A1 (en) * 2001-06-22 2003-01-23 Technische Universitat Dresden Method for generating nucleation centers for selective heterogeneous growth of metal clusters on DNA molecules
IN192520B (fr) * 2001-08-01 2004-04-24 Univ Delhi
JP3955225B2 (ja) * 2002-03-27 2007-08-08 日立ソフトウエアエンジニアリング株式会社 半導体ナノ粒子を用いる反応の反応測定方法及び該測定方法を用いる半導体ナノ粒子の品質評価方法
US20040038264A1 (en) * 2002-05-14 2004-02-26 Souza Glauco R. Fractal dimension analysis of nanoparticle aggregates using angle dependent light scattering for the detection and characterization of nucleic acids and proteins

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0667398A2 (fr) * 1994-02-14 1995-08-16 Kyoto Dai-ichi Kagaku Co., Ltd. Procédé et appareil de détection de la séquence spécifique des bases d'ADN
WO1998004740A1 (fr) * 1996-07-29 1998-02-05 Nanosphere Llc Nanoparticules sur lesquelles sont attaches des oligonucleotides et utilisations desdites nanoparticules
WO2003027678A1 (fr) * 2001-09-26 2003-04-03 Psychiatric Genomics, Inc. Dosage de proximite par fluorescence
WO2004111602A2 (fr) * 2003-05-16 2004-12-23 University Of Rochester Procedes de colorimetrie et de fluorescence permettant de detecter des oligonucleotides

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
DEMERS L M ET AL: "A FLUORESCENCE-BASED METHOD FOR DETERMINING THE SURFACE COVERAGE AND HYBRIDIZATION EFFICIENCY OF THIOL-CAPPED OLIGONUCLEOTIDES BOUND TO GOLD THIN FILMS AND NANOPARTICLES", ANALYTICAL CHEMISTRY, AMERICAN CHEMICAL SOCIETY. COLUMBUS, US, vol. 72, no. 22, 15 November 2000 (2000-11-15), pages 5535 - 5541, XP001204824, ISSN: 0003-2700 *
DUBERTRET B ET AL: "Single-mismatch detection using gold-quenched fluorescent oligonucleotides", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 19, no. 4, 1 April 2001 (2001-04-01), pages 365 - 370, XP002224627, ISSN: 1087-0156 *
ELGHANIAN ET AL: "Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles", SCIENCE, WASHINGTON, DC, vol. 277, 27 August 1997 (1997-08-27), pages 1078 - 1081, XP002294466, ISSN: 0036-8075 *
JIN R: "What controls the melting properties of DNA-linked gold nanoparticle assemblies?", JOURNAL OF THE AMERICAN CHEMICAL SOCIETY, AMERICAN CHEMICAL SOCIETY, WASHINGTON, DC, US, vol. 125, 15 January 2003 (2003-01-15), pages 1643 - 1654, XP002294467, ISSN: 0002-7863 *
See also references of WO2006079009A2 *

Also Published As

Publication number Publication date
JP2008527999A (ja) 2008-07-31
WO2006079009A3 (fr) 2007-11-08
EP1848823A2 (fr) 2007-10-31
WO2006079009A2 (fr) 2006-07-27

Similar Documents

Publication Publication Date Title
US20060166249A1 (en) Methods for separating short single-stranded nucleic acid from long single-and double-stranded nucleic acid, and associated biomolecular assays
Xiao et al. Rationally engineered nucleic acid architectures for biosensing applications
US20050059042A1 (en) Colorimetric and fluorescent methods for sensing of oligonucleotides
Zhu et al. Application of nanomaterials in the bioanalytical detection of disease-related genes
Nie et al. Applications of gold nanoparticles in optical biosensors
Li et al. DNA sequence detection using selective fluorescence quenching of tagged oligonucleotide probes by gold nanoparticles
Khalil et al. Graphene oxide and gold nanoparticle based dual platform with short DNA probe for the PCR free DNA biosensing using surface-enhanced Raman scattering
Hu et al. Sensitive detection of nucleic acids with rolling circle amplification and surface-enhanced Raman scattering spectroscopy
Zhang et al. Recent advances in biosensors for in vitro detection and in vivo imaging of DNA methylation
Wang et al. Label-free microRNA detection based on fluorescence quenching of gold nanoparticles with a competitive hybridization
US9605304B2 (en) Ultra-stable oligonucleotide-gold and-silver nanoparticle conjugates and method of their preparation
Agasti et al. Nanoparticles for detection and diagnosis
Zanoli et al. Functionalized gold nanoparticles for ultrasensitive DNA detection
EP1848823A2 (fr) Procedes de separation d'acide nucleique a brin unique court d'acide nucleique a brin unique et double long, et dosages biomoleculaires associes
Zhu et al. Quantum dots for DNA biosensing
US20090298197A1 (en) Sers-based methods for detection of bioagents
Lin et al. DNA functionalized gold nanoparticles for bioanalysis
EP2121974A1 (fr) Détection d'analytes utilisant à la fois un procédé de mesure optique et un procédé de mesure électrique
Bichenkova et al. DNA-mounted self-assembly: new approaches for genomic analysis and SNP detection
WO2005001113A2 (fr) Procedes de detection de variations d'acides nucleiques
Dharanivasan et al. Scanometric detection of tomato leaf curl new delhi viral DNA using mono-and bifunctional AuNP-conjugated oligonucleotide probes
Tao et al. Colocalized particle counting platform for zeptomole level multiplexed quantification
Cai et al. Sequence-specific electrochemical recognition of multiple species using nanoparticle labels
Hosseini et al. Perspectives and trends in advanced DNA biosensors for the recognition of single nucleotide polymorphisms
Yang et al. Sensitive fluorescent sensing for DNA assay

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070816

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA HR MK YU

R17D Deferred search report published (corrected)

Effective date: 20071108

RIC1 Information provided on ipc code assigned before grant

Ipc: G01N 33/00 20060101AFI20071231BHEP

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20080528

RIC1 Information provided on ipc code assigned before grant

Ipc: C12Q 1/68 20060101ALI20080522BHEP

Ipc: G01N 33/00 20060101AFI20071231BHEP

17Q First examination report despatched

Effective date: 20080814

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAC Information related to communication of intention to grant a patent modified

Free format text: ORIGINAL CODE: EPIDOSCIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20111011