EP1827081A2 - Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase - Google Patents
Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphataseInfo
- Publication number
- EP1827081A2 EP1827081A2 EP05849969A EP05849969A EP1827081A2 EP 1827081 A2 EP1827081 A2 EP 1827081A2 EP 05849969 A EP05849969 A EP 05849969A EP 05849969 A EP05849969 A EP 05849969A EP 1827081 A2 EP1827081 A2 EP 1827081A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- plant
- dna molecule
- polynucleotide
- promoter
- molecule according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
Definitions
- the present invention encompasses the stress-responsive expression of a nucleic acid sequence capable of down-regulating trehalose-6-phosphate phosphatase activity for the purpose of increasing yield and/or improving abiotic stress tolerance of plants.
- Abiotic stress can affect plant development in different ways depending on the timing, severity, and duration of the stress.
- Maize plants are, for example, relatively drought tolerant, and can withstand moderate to severe drought in the early and late stages of the growing season.
- maize is quite susceptible to water stress during a 10-14 day period around flowering.
- Non-irrigated maize grown in the U.S. Corn Belt typically experiences water stress in late summer during flowering. This stress usually manifests itself in the form of reduced kernel set due to ovule/embryo abortion.
- ABA abscisic acid
- the trehalose pathway in plants is shown in Figure 1.
- the pathway is positioned to demonstrate similarity to sucrose synthesis via sucrose-6-phosphate synthase (8) and sucrose- 6-phosphate phosphatase (9).
- Trehalose synthesis is catalyzed by trehalose-6-phosphate synthase (T6PS) (10), yielding trehalose-6-phosphate (T6P) and trehalose-6-phosphate phosphatase (T6PP) (11), yielding trehalose, Trelialase (12) cleaves trehalose into two glucose molecules.
- T6PS trehalose-6-phosphate synthase
- T6P trehalose-6-phosphate
- T6PP trehalose-6-phosphate phosphatase
- Trelialase (12) cleaves trehalose into two glucose molecules.
- T6PS and T6PP were cloned in the early 1990's (Kaasen et al., 1992), and formed the basis for early work to use genetic engineering to improve plant tolerance to water stress (Holmstrom et al., 1996; Goddijn et al., 1997).
- Trehalose pathway genes are expressed at low levels, but expression has been detected in all tissues examined. Sequence data from several plant species indicate the presence of trehalose metabolism genes (Leyman et al., 2001; Wingler, 2002; ⁇ astmond and Graham, 2003; ⁇ astmond et al., 2003).
- trehalose pathway enzymes or genes designed to influence a trehalose pathway enzyme activity (for example, an antisense RNA construct) are targeted to the cytosol (Holmstrom et al., 1996; Goddijn et al., 1997; Romero et al., 1997; Pilon-Smits et al., 1998; Garg et al., 2002; Jang et al., 2003).
- the experiments do little to influence trehalose or trehalose-6-phosphate in these plants.
- tobacco and potato plants expressing the E. coli T6PS and T6PP genes tend to suffer pleotropic growth defects (Goddijn et al., 1997).
- the present invention relates to transgenic plants comprising a polypeptide encoding a nucleic acid that targets an endogenous T6PP gene, wherein the isolated DNA molecule is under the control of a promoter that is stress-inducible in vegetative tissue.
- the nucleic acid may also be developmentally expressed in maturing kernels. Stress induced expression of the nucleic acid of the invention increases the availability of carbon to developing florets/kernels when plants are under stress conditions, such as a water deficit.
- the polypeptide of the present invention transformed into a plant thereby permits more photosynthate to be directed to the developing ovules/embryos resulting in stabilized yield in growing environments that are subject to periodic stress.
- the present invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, the isolated DNA sequence is operatively linked to a promoter that is stress induced in vegetative tissue, wherein the nucleic acid is capable of down-regulating a T6PP gene.
- the present invention includes a method of increasing the starch content in the kernel of a plant comprising the steps of transforming a plant cell with a DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP; generating a plant from the plant cell; inducing expression of the nucleic acid in the vegetative tissue of the plant when the plant is subjected to stress conditions during its reproductive stage; and increasing starch content in the kernel compared to the starch content in the kernel of an isogenic plant not containing the DNA molecule when the transgenic plant and the isogenic plant are grown under substantially the same stress conditions.
- the present invention further includes a double stranded short interfering nucleic acid
- siRNA RNA molecule that down regulates expression of a T6PP gene in the vegetative tissue of a plant, wherein said siRNA molecule comprises at least about 21 base pairs.
- the present invention encompasses a double stranded siKNA molecule that down regulates expression of a T6PP gene, wherein a first strand of the double stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of a T6PP gene or a portion thereof and, wherein a second strand of the double-stranded siRNA molecule comprises a nucleotide sequence that is complementary to the sequence of the first strand.
- the invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene.
- the invention includes an isolated DNA molecule comprising a polynucleotide wherein said polynucleotide is depicted by SEQ ID. NO 6.
- the invention includes an isolated DNA molecule comprising a polynucleotide , wherein said nucleotide sequence comprises at least about 21 consecutive base pairs of SEQ ID NO. 6.
- the invention includes an isolated DNA molecule comprising polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, and wherein said polynucleotide is placed in a sense or antisense orientation relative to said promoter.
- the invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is derived from the 5' region of a Rabl7 gene and exhibits promoter activity in plants.
- the invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is derived from the 5' region of a Rabl7 gene and exhibits promoter activity in plants and further comprises a 3' region derived from a Rabl7 gene and exhibits terminator activity in plants.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter comprises about 100-1649 contiguous nucleotides of DNA, wherein said contiguous nucleotides of DNA have from 85% to 100% identity to about 100 to 1649 contiguous nucleotides of DNA having the sequence of SEQ ID NO. 42.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid is capable of forming into a double stranded RNA.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid comprises co-suppressor RNA.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid comprises catalytic RNA.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid sequence is capable of forming into a triplex nucleic acid.
- the invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is also expressed in seed tissue.
- the invention also includes a plant cell having an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, and also includes a transgenic plant derived from said plant cell.
- the invention further includes an isolated DNA molecule wherein said DNA molecule is depicted by SEQ ID NO. 8 or SEQ. ID. NO. 18.
- FIG. 1 is a schematic representation of the primary sugar metabolism pathways in a typical plant cell. The various sugar and activated sugar pools associated with starch and sucrose synthesis are shown. A permanent block in trehalose synthesis has been shown in the art to be lethal. However, the present invention recognizes that a conditional block in the pathway from T-6-P to trehalose using a stress-inducible promoter to express T6PP-RNAi in vegetative tissue, redirects flux to sucrose or starch synthesis in a stress-inducible or developmental pattern.
- Fig. 2 is a schematic representation showing how the maize T6PP1 cDNA sequences were assembled, hi section (A), the cDNAs were identified by TBLASTN queries of maize EST and cDNA databases and assembled in Sequencher.
- the strands 1, 2, and 3 shown at the bottom of section A show the plus (+) open reading frames.
- Strand 1 (ZmT6PP-l) contains the largest continuous open reading frame and is highlighted.
- Section (B) depicts the ZmT ⁇ PP-1 protein sequence.
- Figs. 3A and 3B show the alignment of T6PP protein sequences.
- the Arabidopsis The Arabidopsis
- AtToPPA and AtToPPB sequences are aligned with the rice and maize homologs OsToPP-I, OsT6PP-2, ZmToPP-I, ZmT6PP-2, ZmT6PP-3.
- the alignment also includes ZmT ⁇ PP-target.
- the alignment was performed using AlignX within Vector NTI (Version 7.1).
- Fig. 4 A shows the phylo genetic relationship of the maize, rice and Arabidopsis T6PP proteins.
- Fig. 4B shows a similarity and divergence table illustrating similarity of each protein to the others along the horizontal axis and divergence of each protein from the others along the vertical axis. Similarity values are above and divergence values are below the '100' figure in each column.
- Fig. 5 is a bar chart showing the expression profile of the OsT6PP-l gene in various tissues. Relative expression above 100 is considered significant. The expression profile is consistent with the known expression of the Arabidopsis AtToPP-A gene.
- Fig. 6 is a diagram showing sequence alignment of the maize ESTs (GenBank Accession Nos. BE510187, AW171812, AW081181, AI855276, BE453688 and AI941695).
- ZmToPP clone sequence data are denoted by t3.rev.91331.abi and tl.rev.91323.abl.
- Fig. 7 is a map of the maize T6PP-1 cDNA fragment in the pCR 4 TOPO vector, referred to as pCR4-TOPO-ZmT6PP-NS.
- Fig. 8 is a map of the pNOV3210 expression cassette.
- Fig. 9 is a map of the pNOV3232 expression cassette.
- Fig. 10 is a map of the pRabl7-T6PP-RNAi construct. The complete Rabl7 expression cassette can be mobilized as a Kpnl fragment.
- Fig. 1 IA is a map of an Agrobacterium tumefaciens binary vector, pNOV2117, that contains the phosphmannose isomerase (cPMI-01) plant selectable marker within its T-DNA borders.
- Fig. HB is a map of an Agrobacterium tumefaciens Rabl7-T6PP-RNAi expression cassette cloned in pNOV2117.
- Fig. 14 illustrates kernel set yield data for Rabl7-T6PP-RNAi Event 78A18B in the field. Ears from each plant in the field were harvested and shelled. The kernels counted and weighed. The means for hemizygous and azygous plants were calculated. The asterisk indicates a statistically significant difference between azygous and hemizygous plants.
- Fig. 15 illustrates yield data for Rabl7-T6PP-RNAi Event 81A10B progeny in the field. Ears from each plant in the field were harvested and shelled. The kernels counted and weighed. The means for hemizygous and azygous plants were calculated. The asterisk indicates a statistically significant difference between azygous and hemizygous plants.
- Figs. 16A and 16B illustrate the alignment of the conserved T6PP cDNA sequence from several plant species.
- the alignment also includes T ⁇ PP-RNAi sequence.
- the alignment was performed using AlignX within Vector NTI (Version 7.1).
- Fig. 17 shows the phylogenetic relationship of conserved T6PP cDNA sequence from several plant species.
- the table illustrates percent similarity of each sequence to the others along the horizontal axis. The analysis was performed using AlignX within Vector NTI (Version 7.1).
- the trehalose pathway represents a level of flux control through central sugar metabolism.
- Several studies identified control mechanisms that regulate enzymes in the metabolic network shown in Figure 1. The data are by no means exhaustive. However, given the ubiquity of the trehalose pathway and pathway gene expression in plants (Wingler, 2002), and the lethality of a knockout at the pathway's entry point (Eastmond et al., 2002) the present invention recognizes that the trehalose pathway probably functions as a checkpoint to help regulate glucose- 1 -phosphate (g-l-P), glucose-6-phosphate (g-6-P) and fructose-6- phosphate (f-6-P) pool size in the cytosol.
- g-l-P glucose-6-phosphate
- f-6-P fructose-6- phosphate
- the trehalose pathway acts as a "spill way" to quickly inactivate g-6-P and uridine diphosphate glucose (UDP-g) and recycle the glucose moiety, hi this capacity the pathway sets up an apparent futile cycle that needlessly consumes energy, by converting substrates to products and later converts those products back to the original substrates.
- UDP-g uridine diphosphate glucose
- the present invention further recognizes that the trehalose pathway provides a rapid, probably low-capacity, control mechanism to stabilize cytosolic hexose phosphate pools.
- the trehalose pathway is poised to compete with other metabolic processes—such as starch synthesis, sucrose synthesis and glycolysis—for g-6-p and UDP-g.
- the present invention takes into account that engineering plants to express a heterologous protein(s), such as T6PP or T6PS, that may not be subject to endogenous regulation, using strong constitutive promoters pulls activated sugars out of central carbon metabolism. This wastes considerable energy and retards growth.
- composition and method of the present invention includes using promoters that are drought-inducible in vegetative tissue, that may also developmentally expressed in maturing kernels, operably linked to a nucleic acid molecule that when expressed in a plant cell, inhibits expression of the endogenous T6PP gene or the products thereof.
- promoters that are drought-inducible in vegetative tissue, that may also developmentally expressed in maturing kernels, operably linked to a nucleic acid molecule that when expressed in a plant cell, inhibits expression of the endogenous T6PP gene or the products thereof.
- the present invention uses genetic engineering to decrease or eliminate, via down- regulation, the expression of maize endogenous T6PP genes.
- Endogenous T6PP genes There are numerous methods known to those skilled in the art for modifying expression of endogenous genes.
- Post- transcriptional gene silencing (PTGS), triplex-forming nucleic acid, ribozymes, inactive protein subunits and single-stranded monoclonal antibodies can all be used to eliminate or repress gene expression, as discussed in more detail below.
- dsRNA double stranded RNA
- dsRNA double stranded RNA
- Dicer multi-domain RNAse III enzyme
- siRNAs small interfering RNAs
- Dicer also cleaves roughly 70 nt precursor stem-loop RNA structures into single-stranded 21-23 nt RNAs known as microRNAs (miRNAs) (Grishok et al., 2001; Reinhart et al., 2002). This is the basis for RNA interference (RNAi) technology that is used to suppress the expression of endogenous and heterologous genes in a sequence specific manner (Fire et al., 1998; Carthew, 2001; Elbashir et al., 2001).
- miRNAs RNA interference
- a RNAi suppressing construct can be designed in a number of ways, for example, transcription of a inverted repeat which can form a long hair pin molecule, inverted repeats separated by a spacer sequence that could be an unrelated sequence such as GUS or an intron sequence.
- the present invention also contemplates transcription of sense- and antisense-RNA strands by opposing promoters, or cotranscription of sense and antisense genes.
- Antisense RNA technology can be also be used to down-regulate expression of a specific endogenous gene. This is a down-regulation approach used to modify a desired plant enzyme level or activity. Antisense RNA results in down-regulation at the RNA translational level. Down-regulation by antisense RNA, as described by Shewmaker et al.
- antisense RNA may directly interfere with transcription or form duplexes with the heterogeneous nuclear RNA (hnRNA).
- hnRNA heterogeneous nuclear RNA
- antisense RNA may form a double-stranded molecule with the complimentary mRNA and prevent the translation of mRNA into protein.
- Co-suppression is another approach applicable for down-regulation of plant gene expression.
- Co-suppressor RNA in contrast to anti-sense RNA, is in the same orientation as the RNA transcribed from the target gene, i.e., the "sense" orientation. It has been used extensively to produce transgenic plants having modified gene expression levels (Napoli et al., 1990; Brusslan et al., 1993; Vaucheret et al., 1995; Jorgensen et al., 1996).
- RNA-mediated gene silencing The mechanism of co-suppression is thought to be caused by the production of antisense RNA by read-through transcription from distal promoters located on the opposite strand of the chromosomal DNA (Grierson et al. 1991). It's now understood that there are common features associated with all forms of RNA-mediated gene silencing (Matzke et al., 2002; Tijsterman et al., 2002).
- Ribozyme technology like antisense methodologies, also works at the RNA translational level and involves making catalytic RNA molecules that bind to, and cleave the mRNA of interest. Ribozymes have recently been demonstrated as an effective method for the down-regulation of plant proteins (Waterhouse and Wang, 2002) and control of plant pathogens (Atkins et al., 2002).
- a further down-regulation method includes use of co-suppressor or 'sense' nucleic acids and dsRNAs.
- Nucleic acid sequences can be constructed which will bind to duplex nucleic acid either in the gene or the DNA:RNA complex of transcription, to form a stable triple helix-containing or triplex nucleic acid to inhibit transcription and/or expression of the target gene (Frank-Kamenetskii and Mirkin, 1995).
- Such nucleic acid sequences are constructed using the base-pairing rules of triple helix formation and the nucleotide sequence of the gene or mRNA of interest. These nucleic acid sequences can block target gene-type activity in a number of ways, including prevention of transcription of the gene or by binding to mRNA as it is transcribed by the gene.
- a dominant-negative genetic approach can also be used to down-regulate specific types of enzymes.
- the presence of a dominant trait i.e. the expression of a transgene, results in a reduction of enzyme activity or reduced production of the enzymatic end-product.
- Some enzymes are complexes of two or more protein subunits. Such an enzyme's activity relies on the proper assembly of these subunits to form functional enzyme.
- Expression of a nonfunctional subunit that can interact with the other subunit(s) can produce a non-functional enzyme and hence reduce enzymatic activity.
- the non-functional aspect may be in respect to, but not limited to, subunit interaction, substrate binding or enzyme catalysis, for example.
- MAb monoclonal antibodies
- SCAb single chain antibodies
- the present invention includes down-regulating the endogenous maize T6PP gene by constructing a chimeric polynucleotide comprising a promoter that is drought-inducible in vegetative tissue operatively linked to a nucleic acid, wherein when expressed in a plant cell the nucleic acid, or a portion thereof, is capable of reducing the expression of an endogenous T6PP gene of a plant cell.
- the promoter is drought- inducible in vegetative tissue.
- the promoter is derived from the 5' region of a Rabl7 gene.
- the invention encompasses the polypeptide also having a terminator sequence derived from the 3' region of the Rabl7 gene.
- the promoter can also be selected to cause expression of T ⁇ PP-RNAi in a manner that is different than how the ZmToPP-I protein is expressed by the plant in its native state.
- the promoter may have no effect on the level at which the ZmToPP-I protein is expressed, express the T6PP-RNAi without being induced by an environmental stress and/or express the T ⁇ PP-RNAi in response to a different form or degree of environmental stress than would otherwise be needed to induce expression of the Zm-T6PP-l protein.
- the present invention recognizes that strong constitutive promoters should not be used to cause decreased levels of ZmT6PP-l gene expression.
- Such strong constitutive promoters include, but are not limited to, the nopaline synthase (NOS) and octopine synthase (OCS) promoters (Jones et al., 1992), the cauliflower mosaic virus (CaMV) 19S and 35S promoters (Odell et al., 1985) or the enhanced CaMV 35S promoters (Kay et al., 1987).
- NOS nopaline synthase
- OCS octopine synthase
- tissue specific promoter could be used to alter ZmTGPP-I gene expression in tissues that are highly sensitive to stress.
- tissue-specific promoters include, but are not limited to, seed-specific promoters for the B. napus napin gene (Kridl and Knauf, 1995), the soybean 7S promoter (Fujiwara and Beachy, 1994), the Arabidopsis 12S globulin (cruciferin) promoter (Pang et al., 1988), the maize 27 kD zein promoter (Ueda et al., 1992) and the rice glutelin 1 promoter (Goto et al., 1999), fruit active promoters such as the E8 promoter from tomatoes (Mehta et al., 2002), tuber-specific promoters such as the patatin promoter (Kuehn et al., 2003), and the promoter for the small subunit of ribulose-l,5-bis- phosphate carboxylase (ssRUBISCO)
- a promoter could be used to induce the expression of the T6PP-RNAi gene only at a proper time, such as prior to a drought that occurs at or around the time of flowering, thereby improving the reproductive capability of the crop and increasing the productivity of the land. This may be accomplished by applying an exogenous inducer by a grower whenever desired (Chua and Aoyama, 2000; Caddock et al., 2003). Similarly, a promoter can be used which turns on at a dehydration condition that is wetter than the dehydration condition at which the plant normally exhibits dehydration tolerance. This would enable the level at which a plant responds to dehydration to be altered.
- Promoters which are known or are found to cause inducible transcription of the DNA into mRNA in plant cells can be used in the present invention.
- Such promoters may be obtained from a variety of sources such as plant and inducible microbial sources, and may be activated by a variety of exogenous stimuli, such as cold, heat, dehydration, pathogenesis and chemical treatment.
- the particular promoter selected is preferably capable of causing sufficient expression of the T ⁇ PP-RNAi to enhance plant tolerance to environmental stress conditions such as water deficit.
- promoters which may be used include, but are not limited to, the promoter for the DRE (C-repeat) binding protein gene dreb2a (Liu et al., 1998) that is activated by dehydration and high-salt stress; the promoter for delta 1-pyrroline- 5-carboxylate synthetase (P5CS) whose expression is induced by dehydration, high salt and treatment with the plant hormone abscisic acid (ABA) (Yoshiba et al., 1995; Zhang et al., 1997); the promoter for the rd22 gene from Arabidopsis whose transcription is induced by salt stress, water deficit and endogenous ABA (Yamaguchi-Shinozaki and Shinozaki, 1993a); the promoter for the rd29b gene (Yamaguchi-Shinizaki and Shinozaki, 1993b) whose expression is induced by desiccation, salt stress and exogenous ABA treatment (Ishitani e
- the promoters described above may be further modified to alter their expression characteristics.
- the drought/ABA inducible promoter for the rabl ⁇ gene may be incorporated into seed-specific promoters such that the rabl8 promoter is drought/ABA inducible only in developing seeds.
- any number of chimeric promoters can be created by ligating a DNA fragment sufficient to confer environmental stress inducibility from the promoters described above to constitute promoters with other specificities such as tissue-specific promoters, developmentally regulated promoters, light- regulated promoters, hormone-responsive promoters, etc. This should result in the creation of chimeric promoters capable of being used to cause expression of the T ⁇ PP-RNAi gene in any plant tissue or combination of plant tissues. Expression can also be made to occur either at a specific time during a plant's life cycle or throughout the plant's life cycle.
- the promoter of the instant invention modulates ZmToPP-I expression in plants experiencing various abiotic or environmental stresses, including cold, heat, dehydration, and/or salt stress that directly affect plant water relations.
- These promoters come from genes, and the like, that include, but are not limited to, the CBF/DREB family of transcription factors shown to be induced by cold, salt, and dehydration stress (Jaglo-Ottosen et al., 1998); the maize Rabl7 promoter that is drought-inducible in vegetative tissue and developmentally expressed in maturing kernels (Vilardell et al., 1991); the LP3 water-deficit- induced gene (Wang et al., 2002); the Arabidopsis CIPK3 gene that is responsive to ABA and stress conditions, including cold, high salt, wounding, and drought (Kim et al., 2003); the barley (Hordeum vulgar e) HVA22 gene that is induced dehydration, salinity, extreme temperatures,
- Expression cassettes containing the above promoters can function with a transcriptional terminator.
- NOS nopaline synthase
- expression cassette . performance improves when the NOS terminator is replaced with a similar sequence derived from the same gene the promoter is based on (No et al., 2000; Nuccio and Thomas, 2000; Moreno-Fonseca and Covarrubias, 2001). These exceptions often arise when use of the NOS terminus yields unsatisfactory results.
- the role gene terminator sequences play in overall regulation is not fully understood.
- ovary abortion can be reversed by increasing carbohydrate flux to ovules during periods of stress (Zinselmeier et al., 1995b).
- the present invention is directed to genetic engineering solutions to reduce environmental stress related yield loss in maize by increasing carbohydrate flux to developing kernels when such kernels are developing during periods of environmental stress, by using a promoter that is drought- inducible in vegetative tissue and that may also be developmentally expressed in maturing kernels.
- Examples of suitable plants for which stress tolerance may be induced according to the methods of the present invention and which may be transformed with the expression cassettes of the invention include monocotyledonous and dicotyledonous plants such as field crops, cereals, fruit and vegetables such as: canola, sunflower, tobacco, sugarbeet, cotton soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrots, lettuce, cabbage and onion.
- Example 1 Identification and acquisition of the ZmTPPl gene
- the first vascular plant trehalose-6-phosphate phosphatase genes were cloned from Arabidopsis thaliana by complementation of a yeast tps2 deletion mutant (Vogel et al. 1998).
- the genes designated AtTPPA and AtTPPB (GenBank accessions AF007778 and AF007779) were shown at that time to have trehalose-6-phosphate phosphatase activity.
- the AtTPPA and AtTTPB protein sequences were used in TBLASTN queries of maize and rice sequence databases. Sequence alignments organized the hits into individual genes.
- Fig. 2A is a cartoon depicting the alignment that defines ZmToPP-I. Three maize and two rice T6PP homologs were identified.
- the cDNA sequences corresponding to the predicted protein sequence for each gene-ZmT6PP-l, -2 and -3 and OsToPP-I and -2 ⁇ are depicted by SEQ. ID NOS. 1, 2, 3, 4 and 5, respectively. These T6PPs are shown in global alignment the Arabidopsis T6PPs in Figure 3. The relationship between each protein to the others is further analyzed using a phylogenetic tree (Fig. 4A) and a similarity/divergence table (Fig. 4B). Results suggest that ZmT6PP-l is the likely maize homolog of AtTPPA and ZmT6PP-2 is the likely maize homolog of AtTPPB.
- the ZmToPP-I gene was targeted for inactivation because the EST data show it is expressed in a pattern consistent with AtToPPA. However, the EST data are limited due to unequal tissue representation among the maize EST libraries. To compensate, the OsToPP-I cDNA sequence was used to query Expression Profiling data. The results, in Figure 5, show the OsT6PP-l is expressed at a relatively low level in most tissues, which agrees with the data for AtToPPA (Vogel et al., 1998).
- a partial ZmT6PP-l cDNA (SEQ ID NO. 13) was amplified from a maize mixed tissue cDNA library in two steps (Fig. 6).
- T6PP1 was produced in a 50 ⁇ L reaction mixture consisting of 1 ⁇ L maize cDNA library, 200 ⁇ M dNTPs (dATP, dCTP, dGTP, TTP), 1 ⁇ L 20 ⁇ M oligonucleotide primer ZmTPP-Ib (5'-TTCTCCCTATCTATGTTGGAG-S') (SEQ ID NO. 19), 1 ⁇ L 20 ⁇ M oligonucleotide primer ZmTPP-2 (5'-CGCAACACAGTGAAACACTAGAAGG-S') (SEQ ID NO.
- thermocycling program was 94°C for 2 minutes followed by 40 cycles of (94 0 C for 15 seconds, 58 0 C for 30 seconds, 68°C for 1.0 minute) followed by 68°C for 5.0 minutes.
- T6PP2 A second fragment, referred to as T6PP2 (SEQ ID NO. 14), was produced in a 50 ⁇ L reaction mixture consisting of 1 ⁇ L maize cDNA library, 200 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M oligonucleotide primer ZmTPP-2r (5'-CCTTCTAGTGTTTCACTGTGTTGCG-S') (SEQ ID NO. 21), 1 ⁇ L 20 ⁇ M oligonucleotide primer psport-forward (5'- GCCAGTGCCTAGCTTATAATACG-S') (SEQ ID NO. 22), 1 ⁇ L 1OX Expand High Fidelity buffer and 1 ⁇ L Expand High Fidelity polymerase (Roche Diagnostics, Cat. No.
- thermocycling program was 94 0 C for 2 minutes followed by 40 cycles of (94 0 C for 15 seconds, 58°C for 30 seconds, 68°C for 1.0 minute) followed by 68 0 C for 5.0 minutes.
- the T6PP1 and T6PP2 fragments were joined using the splicing by overlap extension
- the 50 ⁇ L reaction mixture consisted of 2 ⁇ L T6PP1 reaction mix, 2 ⁇ L T6PP2 reaction mix, 200 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M oligonucleotide primer ZmTPP-Ib, 1 ⁇ L 20 ⁇ M oligonucleotide primer psport-forward, 1 ⁇ L 1OX Expand High Fidelity buffer and 1 ⁇ L Expand High Fidelity polymerase (Roche Diagnostics, Cat. No. 1 759 078).
- thermocycling program was 5 cycles of (94 0 C for 30 seconds, 68 0 C for 1.0 minute) followed by 35 cycles of (94°C for 30 seconds, 58 0 C for 30 seconds, 68 0 C for 1.0 minute) followed by 68°C for 7.0 minutes.
- the pCR-4-TOPO-ZmT6PP-NS recombinants containing the ZmT6PP-l fragment were identified by digesting 5 ⁇ L ⁇ CR-4-TOPO-ZmT6PP-NS miniprep DNA (prepared using the QIAprep Spin Miniprep procedure from Qiagen, Cat. No. 27106) with EcoRI (New England Biolabs) in a 20 ⁇ L reaction containing 2 ⁇ g BSA and 2 ⁇ L 1OX EcoRI restriction endonuclease buffer (New England Biolabs). The reaction was incubated at 37 0 C for 2 hours then pCR-4-TOPO-ZmT6PP-NS (EcoRI) products were resolved on 1% TAE agarose.
- the pCR-4-TOPO-ZmT6PP-NS clones were sequenced using the ABI PRISM dye terminator cycle sequencing kit (Perkin Elmer).
- the pCR-4-TOPO-ZmT6PP-NS map is shown in Fig. 7.
- One embodiment of the present invention is to provide a nucleic acid construct that comprises a promoter that is drought inducible in vegetative tissue operatively linked to a nucleic acid molecule, wherein when expressed in a plant cell the nucleic acid molecule is capable of reducing the expression of an endogenous T6PP gene of a plant cell.
- the invention includes a nucleic acid construct having a promoter derived from the 5' region of a Rabl7 gene and that exhibits promoter activity in plants.
- the invention also includes the nucleic acid construct comprising all or part of a nucleic acid sequence encoding T6PP-RNAi, wherein the Rabl7 promoter drives the T6PP- RNAi expression cassette to create a conditional block in the trehalose pathway.
- the T6PP- RNAi expression cassette of the invention re-directs carbohydrate to sucrose or starch synthesis in reproductive tissue and in vegetative tissue during periods of water deficit.
- the nucleic acid construct of the invention further includes both the 5' and 3 '-regions derived from the maize Rabl7 gene, wherein the regions exhibit promoter and terminator activity in plants, respectively.
- both the 5' and 3' regions were used in the nucleic acid construct to assure that the transgene expression mimics maize Rabl7 expression.
- cDNA sequence was gathered, aligned and annotated.
- the published gDNA sequence (GenBank Accession No. Xl 59940) was used to query public and proprietary databases.
- the Rabl7 cDNA sequence was broken into exons and aligned with Rabl7 gDNA to provide the requisite annotation and map the translation start and stop codons onto the gDNA.
- the ZmRab 17 promoter was amplified from maize gDNA in a 50 ⁇ L reaction mixture consisting of 100 ng maize gDNA, 200 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M oligonucleotide primer 000426A (5'-GGTACCAAGCTTAATTCGCCCTTATAAACT-S') (SEQ ID NO. 33), 1 ⁇ L 20 ⁇ M oligonucleotide primer 000426B (5'-
- thermocycling program was 94 0 C for 2 minutes followed by 40 cycles of (94 0 C for 15 seconds, 58 0 C for 30 seconds, 68 0 C for 2.0 minutes) followed by 68 0 C for 5.0 minutes.
- the 0.6 kb DNA product encoding the ZmRab 17 promoter was cloned with the TOPO TA cloning kit for sequencing following manufactures' instructions. 2.0 ⁇ L of the reaction mix was transformed into 50 ⁇ L Top 10 competent cells following manufactures' instructions.
- pCR-4-TOPO-pZmRabl7 recombinants containing the ZmRab 17 promoter were identified by digesting 5 ⁇ L pCR-4- TOPO-pZmRabl7 miniprep DNA with EcoRI in a 20 ⁇ L reaction containing 2 ⁇ g BSA and 2 ⁇ L 1OX EcoRI restriction endonuclease buffer. The reaction was incubated at 37 0 C for 2 hours then ⁇ CR-4-TOPO-pZmRabl7 (EcoRI) products were resolved on 1% TAE agarose.
- the pCR-4-TOPO-pZmRabl7 clones were sequenced using the ABI PRISM dye terminator cycle sequencing kit.
- the pCR-4-TOPO-pZrnRabl7 sequence is given as SEQ ID NO. 11.
- the ZmRab 17 terminator was amplified from maize gDNA in a 50 ⁇ L reaction mixture consisting of 100 ng maize gDNA, 200 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M oligonucleotide primer 000426C (5'-ACTGCAGTACGTGGCTGTGCTGTG-S') (SEQ ID NO. 25), 1 ⁇ L 20 ⁇ M oligonucleotide primer 000426D (5'-CGGTACCAATTGCATGCGTCTAATCA-S ') (SEQ ID NO. 26), 1 ⁇ L 1OX Expand High Fidelity buffer and 1 ⁇ L Expand High Fidelity polymerase.
- thermocycling program was 94 0 C for 2 minutes followed by 40 cycles of (94 0 C for 15 seconds, 58 0 C for 30 seconds, 68 0 C for 2.0 minutes) followed by 68 0 C for 5.0 minutes.
- the 0.6 kb DNA product encoding the ZmRabl7 terminus was cloned with the TOPO TA cloning kit. 2.0 ⁇ L of the reaction mix was transformed into 50 ⁇ L ToplO competent cells.
- pCR-4-TOPO-tZmRabl7 recombinants containing the ZmRabl7 terminator were identified by digesting 5 ⁇ L pCR-4-TOPO-tZmRabl7 miniprep DNA with EcoRI in a 20 ⁇ L reaction containing 2 ⁇ g BSA and 2 ⁇ L 1OX EcoRI restriction endonuclease buffer. The reaction was incubated at 37°C for 2 hours then pCR-4-TOPO-tZmRabl7 (EcoRI) products were resolved on 1% TAE agarose. The pCR-4-TOPO-tZmRabl7 clones were then sequenced. The pCR-4-TOPO-tZmRabl7 sequence is given as SEQ ID NO. 12. pZmRabl7 and tZmRabl7 were amplified from ⁇ CR-4-TOPO- ⁇ ZmRabl7 and pCR-
- PCR products were purified with the MinElute PCR purification kit (Qiagen, Cat. No. 28004), digested in 50 ⁇ L reactions containing 5 ⁇ g BSA, 5 ⁇ L 1OX restriction endonuclease buffer 1, 2.5 ⁇ L Kpnl and 2.5 ⁇ L Pstl (New England Biolabs). The reactions were incubated at 37 0 C for more than 6 hours, then at 7O 0 C for 20 minutes.
- MinElute PCR purification kit Qiagen, Cat. No. 28004
- the 0.5 kb pRAB17 (Kpnl/Pstl) and 0.7 kb tZmRabl7 (Kpnl/Pstl) DNA were resolved on 1.0% TAE agarose and the bands were excised.
- 40 ⁇ L of ⁇ RAB17 (Kpnl/Pstl) was ligated to 40 ⁇ L tZmRabl7 (Kpnl/Pstl) in a 100 ⁇ L reaction containing 10 ⁇ L 1OX T4 DNA ligase buffer (New England Biolabs) and 10 ⁇ L T4 DNA ligase (400 Units/ ⁇ L- New England Biolabs).
- the ligation reaction was incubated more than 8 hours at 16 0 C.
- the ligation was precipitated with 20 ⁇ g glycogen, 0.3 M CH 2 COONa (pH 5.2) and 2.5 volumes ethanol at -2O 0 C for more than 2 hours.
- the ligation products were recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 14 ⁇ L ddH 2 O.
- the ligation products were digested in a 20 ⁇ L reaction containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer 1 and 2 ⁇ L Kpnl.
- the reaction was incubated at 37 0 C for more than 6 hours, then at 7O 0 C for 20 minutes.
- the resolved DNA was digested on 1.0% TAE agarose and excised the 1.3 kb pZniRabl7-tZmRabl7 (Kpnl) band.
- the pZmRabl7- tZmRabl7 (Kpnl) DNA was extracted and recovered it using the QIAquick Gel extraction kit (Qiagen, Cat. No.28704).
- the recovered pZmRabl7-tZmRabl7 (Kpnl) DNA was precipitated with 20 ⁇ g glycogen, 0.3 M CH 2 COONa (pH 5.2) and 2.5 volumes ethanol at - 20 0 C for more than 2 hours.
- the pZmRabl7-tZmRabl7 (Kpnl) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 ⁇ L ddH 2 O.
- 2 ⁇ g of pBluescript II (KS-)--aka pBS-DNA (QIAprep Spin Miniprep procedure from Qiagen, Cat. No. 27106) was digested in a 20 ⁇ L reaction containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer 1 and 2 ⁇ L Kpnl. Incubated the reaction at 37 0 C for more than 6 hours, then at 70 0 C for 20 minutes. 1 ⁇ L 1OX restriction endonuclease buffer 1, 1 ⁇ L 1 Unit/ ⁇ L calf-intestinal alkaline phosphatase and 8 ⁇ L ddH 2 O were then added to the reaction and incubated at 37 0 C for 30 minutes.
- KS- pBluescript II
- pBS-DNA QIAprep Spin Miniprep procedure from Qiagen, Cat. No. 27106
- the pBS (Kpnl/CIP) DNA was resolved on 1.0% TAE agarose and the 3.0 kb pBS (Kpnl/CIP) band was excised.
- the pBS (Kpnl/CIP) DNA was recovered and precipitated with 20 ⁇ g glycogen, 0.3 M CH 2 COONa (pH 5.2) and 2.5 volumes ethanol at -20 0 C for more than 2 hours.
- the pBS (Kpnl/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 ⁇ L ddH 2 O.
- ⁇ ZmRabl7-tZmRabl7 (Kpnl) was ligated to 4.0 ⁇ L pBS (Kpnl/CIP) in a 10 ⁇ L reaction containing 1 ⁇ L 1OX T4 DNA ligase buffer and 1 ⁇ L T4 DNA ligase (400 Units/ ⁇ L) and incubated more than 8 hours at 16 0 C. 5.0 ⁇ L of ligation mix was transformed into 50 ⁇ L ToplO competent cells.
- pBS-pZmRabl7/tZmRabl7 recombinants were verified by digesting 2 ⁇ L pBS-pZmRabl7/tZmRabl7 miniprep DNA with 1.0 ⁇ L Kpnl in 10 ⁇ L reactions containing 1 ⁇ g BSA and 1 ⁇ L 1OX restriction endonuclease buffer 1. The reactions were incubated at 37 0 C for 2 hours then pBS- ⁇ ZmRabl7/tZmRabl7 (Kpnl) DNA was resolved on 1% TAE agarose. The pBS-pZmRabl7/tZmRabl7 clones were then sequenced.
- the pBS-pZniRabl7/tZmRabl7 sequence was designated as pNOV3010 (SEQ ID NO. 17).
- the pNOV3010 map is shown in Fig. 8.
- pNOV3010 lacks flexibility to clone genes of interest. Additional restriction sites were added at the pZmRabl7/tZmRabl7 junction to increase flexibility by ligating a synthetic adapter to the vector.
- the adapter (Synthetic Adaptor I) was made by combining 40 ⁇ L of 50 ⁇ M oligonucleotide 000809A (5'-PGATCGGCGCGCCTGTTAATTAATTGC GGCCGC-3') (SEQ ID NO.
- oligonucleotide 000809B 5 1 - PGATCGCGGCCGCAATTAATTAACAGGCGCGCC-S') (SEQ ID NO. 28)-where P is a 5'-phosphate group-in a 100 ⁇ L mixture that is 25 mM in Tris-HCl (pH 8.0) and 10 mM in MgCl 2 . The mixture was boiled for 5 minutes, removed from heat and naturally cooled to room temperature (about 60 minutes). This yields a 20 ⁇ M Synthetic Adaptor I solution.
- pNOV3010 was prepared by digesting 14 ⁇ L of miniprep pNOV3010 DNA with 2 ⁇ L BgIII in a 20 ⁇ L reaction containing 2 ⁇ g BSA and 2 ⁇ L 1OX restriction endonuclease buffer 3. The reaction was incubated at 37°C for 6 hours, then at 70 0 C for 20 minutes. 1 ⁇ L 1OX of the restriction endonuclease buffer 3, 1 ⁇ L 1 Unit/ ⁇ L calf-intestinal alkaline phosphatase (CIP-New England Biolabs) and 8 ⁇ L ddH 2 O was added to the reaction and then incubated at 37 0 C for 30 minutes.
- pNOV3010 (Bglll/CIP) digestion products were resolved on 1% TAE agarose, the pNOV3010 (Bglll/CIP) DNA band was extracted and recovered.
- the pNOV3010 (Bglll/CrP) DNA was then precipitated with 20 ⁇ g glycogen, 0.3 M CH 2 COONa (pH 5.2) and 2.5 volumes ethanol at -2O 0 C for more than 2 hours.
- pNOV3010 (Bglll/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 ⁇ L ddH 2 O.
- Synthetic Adaptor I was ligated to 2.5 ⁇ L pNOV3010 (Bglll/CIP) in a 10 ⁇ L reaction containing 1 ⁇ L 1OX T4 DNA ligase buffer (New England Biolabs) and 1 ⁇ L T4 DNA ligase (400 U/ ⁇ L- New England Biolabs) and incubated more than 8 hours at 16 0 C. 4 ⁇ L of ligation was transformed into 50 ⁇ L XL-I supercompetent cells (Stratagene, Cat. No. 200236).
- pNOV3232 (SEQ ID NO. 7).
- the map for pNOV3232 is shown in Fig. 9.
- Fig. 6 The primers used to produce the T ⁇ PP-RNAi gene are shown in Fig. 6.
- Two PCR fragments were produced from ⁇ CR-4-TOPO-ZmT6PP-NS template (Fig. 7).
- Fragment 1 (SEQ ID NO. 15) contains a portion of the CMV ⁇ SPORT6 vector that functions as the loop in the T6PP-RNAi gene product.
- High-fidelity PCR was used to amplify Fragment 1 from ⁇ CR-4-TOPO-ZmT6PP-l in a 50 ⁇ L reaction mixture consisting of 1 ⁇ L ⁇ CR-4-TOPO- ZmT6PP-NS miniprep DNA, 200 ⁇ M dNTPs, 20 ⁇ M oligonucleotide primer 00 IL (5'- ATAGGCGCGCCATGTTGGAGATGACAGAACAGATC-S') (SEQ JD NO. 38), 20 ⁇ M oligonucleotide primer 002R (5 l -ATACCGCGGGGACTGTCCTGCAGGTTTAAACG-3 1 ) (SEQ ID NO.
- Fragment 2 is given as SEQ ID NO. 16.
- High-fidelity PCR was used to amplify Fragment 2 from pCR-4-TOPO-ZmT6PP-NS in a 50 ⁇ L reaction mixture consisting of 1 ⁇ L pCR-4-TOPO-ZmT6PP-NS miniprep DNA, 200 ⁇ M dNTPs, 20 ⁇ M oligonucleotide primer 003L (5'-GCGTTAATTAAATGTTGGAGATGACAGAACAGATC-3 1 ) (SEQ ID NO. 40), 20 ⁇ M oligonucleotide primer 004R (5'-
- Fragment 1 and Fragment 2 DNA were digested, separately, in a 20 ⁇ L reaction mixtures containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer and 2 ⁇ L SacII.
- the digests were incubated at 37 0 C for 2 hours.
- the enzyme was inactivated by incubation for 15 minutes at 65 0 C.
- the T6PP-RNA ⁇ gene was digested in a 20 ⁇ L reaction mixture containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer, 1 ⁇ L Pad and l ⁇ L Ascl. The digest was incubated at 37°C for 2 hours.
- pRabl7-T6PP-RNAi recombinants were verified by digesting 2 ⁇ L pRabl7-T6PP-RNAi miniprep DNA with 1.0 ⁇ L Kpnl in 10 ⁇ L reactions containing 1 ⁇ g BSA and 1 ⁇ L 1OX restriction endonuclease buffer 1. The reactions were incubated at 37°C for 2 hours then the ⁇ Rabl7-T6PP-RNAi (Kpnl) DNA was resolved on 1% TAE agarose. The pRabl7-T6PP-RNAi DNA sequence was verified and the construct designated SEQ ID NO. 8. The pRabl7-T6PP-RNAi expression cassette map is shown in Fig. 10.
- the maize Rabl7 promoter sequence was modified to incorporate the complete Rabl7 5'-UTR, the first intron from the maize Rabl7 gene and about 15 nucleotides of the second maize Rabl7 exon.
- This modified 5'-regulatory sequence of the invention was designed to replace the Rabl7 promoter in pNOV3240. Specific changes made in the Rabl7 5'-regulatory sequence (Seq Id. No.
- 7) to construct the modified promoter are: (1) The 1 G' at nucleotide 604 was changed to 'C, (2) The 1 A' at nucleotide 665 was changed to 'T 1 , (3) The 'A at nucleotide 718 was changed to 'T', (4) The 'A' at nucleotide 748 was changed to 'T' and (5) The 'G' at nucleotide 783 was changed to 'C. Finally, to facilitate recombinant DNA procedures, the Pad and Ascl restriction endonuclease sites were added after the '...TCGGAGGAC nucleotides of Rabl7 exon 2.
- the maize Rabl7 5 '-regulatory sequence was amplified from gDNA using high- fidelity PCR.
- a 50 ⁇ L reaction mixture contains 100 ng maize gDNA (Cv. 6N615), 200 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M prRabl7-F3 (5'-TCAAAACTATAGTATTTTAAAATTGC-S') (SEQ ED NO. 29), 1 ⁇ L 20 ⁇ M prRabl7-R3 (5'-GTCCTCCGACTTAAACACG-S') (SEQ ID NO. 30), 5 ⁇ L 1OX Expand High Fidelity buffer and 1 ⁇ L Expand High Fidelity polymerase.
- thermocycling program is 95 0 C for 2 minutes followed by 40 cycles of (94 0 C for 15 seconds, 68 0 C for 7.5 minutes) followed by 68 0 C for 10 minutes.
- the Rabl7 5'-regulatory sequence was cloned with the TOPO XL PCR cloning kit.
- pCR-XL-TOPO-Rabl7-gDNA recombinants were identified by digesting 5 ⁇ L pCR-XL-TOPO-Rabl7-gDNA miniprep DNA in 20 ⁇ L reactions containing 2 ⁇ g BSA and 2 ⁇ L 1OX EcoRI restriction endonuclease buffer.
- the modified Rabl7 promoter required several sequence changes. First, potential translation initiation codons were eliminated. First, potential translation initiation codons were eliminated using the Stratagene QuikChange Multi Site-Directed Mutagenesis Kit (Cat. No. 200513). The primers that were used to make the changes are: RabATGl (5'-CGTGCAAGCATCATCGAGTACGGTCAGCAG-S ')(SEQ ID NO. 31), RabATG2 (5'-CGCCACGGGCCTTGTCGACCAGTACG-S') (SEQ ID NO. 32), RabATG3(S'-GCACCGGCGGCTTGAGGCACGGCA-S')(SEQIDNO.33),
- RabATG4 (5'-CCACCGGCGGCTTGGGCCAGCTGG-S')(SEQIDNO.34),and RabATG5(5'-GGCGCTGGCATCGGTGGCGGGCAG-S')(SEQIDNO.35).
- the 50 ⁇ L reaction mixture contained 1 ⁇ L pCR-XL-TOPO-Rabl7-gDNA mini-prep DNA, 300 ⁇ M dNTPs, 1 ⁇ L 20 ⁇ M Ascl-Rabl7 (5'- TTAATTAAGGCGCGCCTTCAAAACTATAGTATTTTAAAATTGC-S') (SEQ ID NO. 36), 1 ⁇ L 20 ⁇ M Rabl7-Paci-Asc-3 (5'-
- thermocycling program was 95 0 C for 5 minutes followed by 45 cycles of (94 0 C for 30 seconds, 5O 0 C for 1 minute, 72 0 C for 4 minutes) followed by 72 0 C for 15 minutes.
- the PCR product was purified and digested in 50 ⁇ L reactions containing 5 ⁇ g BSA, 5 ⁇ L 1OX restriction endonuclease buffer 4 and 5.0 ⁇ L Ascl.
- the reaction was incubated at 37 0 C for more than 6 hours, then at 7O 0 C for 20 minutes.
- the 1.0 kb ⁇ Rabl7- mod (Ascl) was resolved on 1.0% TAE agarose and the band was excised.
- the DNA was extracted and recovered.
- the recovered pRabl7-mod (Ascl) DNA was ethanol precipitated with glycogen carrier.
- the pRabl7-mod (Ascl) DNA fragment was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 ⁇ L ddH 2 O.
- 2 ⁇ g of pNOV3240 miniprep DNA was digested in a 20 ⁇ L reaction mixture containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer 4 and 2 ⁇ L Ascl.
- the reaction mixture was incubated at 37 0 C for more than 6 hours, then at 7O 0 C for 20 minutes.
- 1 ⁇ L restriction endonuclease buffer 4, 1 ⁇ L 1 Unit/ ⁇ L calf-intestinal alkaline phosphatase and 8 ⁇ L ddH 2 O were added to the reaction mixture and incubated at 37 0 C for 30 minutes.
- the pNOV3240 (AscI/CIP) DNA was resolved on 1.0% TAE agarose and the 11 kb ⁇ NOV3240 (AscI/CIP) band was excised.
- the ⁇ NOV3240 (AscI/CIP) DNA was extracted and recovered.
- the recovered pNOV3240 (AscI/CIP) DNA was ethanol precipitated with glycogen carrier.
- the pNOV3240 (AscI/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, and dried under vacuum and resuspended in 5 ⁇ L ddH 2 O.
- 4.0 ⁇ L pRabl7-mod (Ascl) was ligated to 4.0 ⁇ L pNOV3240 (AscI/CIP) in a 10 ⁇ L ligation mixture containing 1 ⁇ L 1OX T4 DNA ligase buffer and 1 ⁇ L T4 DNA ligase (400 Units/ ⁇ L). The ligation mixture was incubated for more than 8 hours at 16 0 C. 5.0 ⁇ L of ligation mixture was transformed into 50 ⁇ L ToplO competent cells.
- the modified- pNOV3240 recombinants were verified by digesting 2 ⁇ L modif ⁇ ed-pNOV3240 miniprep DNA with 1 ⁇ L Sail in 10 ⁇ L reactions containing 1 ⁇ g BSA and 1 ⁇ L of the appropriate 1OX restriction endonuclease buffer. Digests were incubated at 37 0 C for 2 hours then resolved on 1% TAE agarose. The positive modified-pNOV3240 recombinants were sequenced. The nucleotide sequence of the modified Rabl7-T6PP-RNAi expression cassette is depicted in SEQ ID NO. 18.
- Example 5 Construction of the Binary Agrobacterium tumefaciens Plasmid 2 ⁇ g of pNOV2117 (Fig. 1 IA) was digested in a 20 ⁇ L reaction containing 2 ⁇ g BSA,
- 2 ⁇ L 1OX restriction endonuclease buffer 1 and 2 ⁇ L Kpnl The reaction was incubated at 37 0 C for more than 6 hours, then at 70 0 C for 20 minutes.
- 1 ⁇ L 1OX restriction endonuclease buffer 1, 1 ⁇ L 1 Unit/ ⁇ L calf-intestinal alkaline phosphatase (CIP) and 8 ⁇ L ddEbO was then added and incubated at 37°C for 30 minutes.
- 2 ⁇ g pRabl7-T6PP-RNAi miniprep DNA was digested in a 20 ⁇ L reaction containing 2 ⁇ g BSA, 2 ⁇ L 1OX restriction endonuclease buffer 1 and 2 ⁇ L Kpnl.
- the reaction was incubated at 37 0 C for more than 6 hours.
- the digested plasmid DNAs, pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi (Kpnl) were resolved on 1.0% TAE agarose and the 9.2 kb ⁇ NOV2117 (KpnI/CIP) and the 2.5 kb pRabl7-T6PP-RNAi (Kpnl) DNA bands were excised.
- the pNOV2117 (KpnI/CIP) and ⁇ Rabl7-T6PP-RNAi (Kpnl) DNAs were extracted and then precipitated with 20 ⁇ g glycogen, 0.3 M CH 2 COONa (pH 5.2) and 2.5 volumes ethanol at -20 0 C for more than 2 hours.
- the pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi (Kpnl) DNA fragments were recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended each in 5 ⁇ L ddH 2 O.
- 4.0 ⁇ L pNOV2117 (KpnI/CIP) was ligated to 4.0 ⁇ L pRabl7-T6PP-RNAi (Kpnl) in a 10 ⁇ L reaction containing 1 ⁇ L 1OX T4 DNA ligase buffer and 1 ⁇ L T4 DNA ligase (400 U/ ⁇ L) and incubated more than 8 hours at 16 0 C. 5.0 ⁇ L of ligation mix was transformed into 50 ⁇ L ToplO competent cells.
- pNOV2117-pRabl7-T6PP-RNAi recombinants were identified by digesting 7.5 ⁇ L pNOV2117-pRabl7-T6PP-RNAi miniprep DNA with 1.0 ⁇ L Kpnl in 10 ⁇ L reactions containing 1 ⁇ g BSA and 1 ⁇ L 1OX restriction endonuclease buffer 1. The reactions were incubated at 37 0 C for 2 hours and then ⁇ NOV2117-pRabl7-T6PP-RNAi (Kpnl) DNA products were resolved on 1% TAE agarose. The pNOV2117- ⁇ Rabl7-T6PP- RNAi junction sequence was verified and it was designated as pNOV3240. Its map is shown in Fig. HB.
- transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors.
- the selection of vector depends upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers are preferred.
- Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanatnycin and related antibiotics (Vieira and Messing, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., 1990; Spencer et al., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochlinger and Diggelmann, 1984), the manA gene, which allows for positive selection in the presence of mannose (Miles and Guest, 1984; Bojsen et al., 1998), and the dhfr gene, which confers resistance to methotrexate (Bourouis and Bruno, 1983), and the EPSPS gene, which confers resistance to glyphosate (Shah et al., 1990; 1993).
- T-DNA border sequence typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, 1984).
- Typical vectors suitable for Agr-obacterium transformation include the binary vectors pCIB200 and pCIB2001, as well as the binary vector pCIBlO and hygromycin selection derivatives thereof. ⁇ See, for example, Ligon et al., 1997).
- Other vectors are available for non-Agrobacterium tumefaciens transformation. Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences are utilized in addition to vectors such as the ones described above which contain
- Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake ⁇ e.g. PEG and electroporation) and microinjection.
- the choice of vector depends largely on the preferred selection for the species being transformed.
- Typical vectors suitable for mm-Agrobacteriwn transformation include pCIB3064, ⁇ SOG19, and pSOG35. (See, for example, Ligon et al., 1997).
- DNA sequence of interest is cloned into an expression system, it is transformed into a plant cell.
- Methods for transformation and regeneration of plants are well known in the art.
- Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles.
- bacteria from the genus Agrobacterium can be utilized to transform plant cells.
- Transformation techniques for dicotyledons are well known in the art and include Agrobacteriwn-based techniques and techniques that do not require Agrobacterium.
- Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This is accomplished by PEG- or electroporation-mediated uptake, particle bombardment-mediated delivery, or microinjection. In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
- Transformation of most monocotyledon species has now also become routine.
- Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, particle bombardment into callus tissue, as well as Agrobacterium-mediated transformation. Plants from transformation events are grown, propagated and bred to yield progeny with the desired trait, and seeds are obtained with the desired trait, using processes well known in the art
- a nucleic acid sequence of the invention Once cloned into an expression system, it is transformed into a plant cell.
- the receptor and target expression cassettes of the present invention can be introduced into the plant cell in a number of art-recognized ways.
- Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake via electroporation, microinjection, and microprojectiles.
- bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants, as well as a representative plastid transformation technique.
- Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium.
- Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG- or electroporation-mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described (Paszkowski et al, 1984; Potrykus et al., 1985; Reich et al., 1986; Klein et al., 1987). In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
- Agrobacterium-mcdiated transformation is a preferred technique for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species.
- Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain. This may depend on the complement of Vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or on the chromosome (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al., 1993)).
- the transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E.
- a helper E. coli strain which carries a plasmid such as ⁇ RK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain.
- the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (H ⁇ fgen and Willmitzer, 1988). Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant to be transformed and follows protocols well known in the art. Transformed tissue is regenerated on selection medium containing the antibiotic, herbicide or other compound that the selectable marker, present between the binary plasmid T-DNA borders, is designed to provide resistance.
- Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in Sanford et al. (1990; 1991; 1992). Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof.
- the vector can be introduced into the cell by coating the particles with the vector containing the desired gene.
- the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle.
- Biologically active particles e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced
- Transformation of most monocotyledon species has now also become routine.
- Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species or multiple DNA species (i.e. co-transformation) and both these techniques are suitable for use with this invention.
- Co-transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable.
- a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher et al., 1986).
- Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment.
- Protoplast-mediated transformation has been described for Japonica-types and Indica-types (Zhang et al., 1988; Shimamoto et al, 1989; Datta et al., 1990). Both types are also routinely transformable using particle bombardment (Christou et al., 1991).
- Gobel and Nakakido (1993) describe techniques for the transformation of rice via electroporation.
- each target plate Prior to bombardment, 0.75-1.0 millimeter embryos are plated onto MS medium with 3% sucrose (Murashige and Skoog, 1962) and 3 mg/L 2,4-D for induction of somatic embryos, which proceeds in the dark. On the chosen day of bombardment, embryos are removed from the induction medium and placed onto the osmoticum (induction medium with sucrose or maltose added at the desired concentration, typically 15%). Embryos plasmolyze for 2-3 hours, then they are bombarded. Although not critical, each target plate usually contains twenty embryos.
- An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size gold particles using standard procedures.
- Each plate of embryos is shot with the DuPont Biolistics® helium device using a burst pressure of ⁇ 1000 psi using a standard 80 mesh screen.
- the embryos (still on osmoticum) are placed back into the dark to recover for about 24 hours. Then embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration.
- Embryo explants with developing embryogenic callus are then transferred to regeneration medium (MS + 1 mg/L NAA, 5 mg/L GA), and further containing the appropriate selection agent (10 mg/L basta in the case of pCIB3064 and 2 mg/L methotrexate in the case of pSOG35).
- regeneration medium MS + 1 mg/L NAA, 5 mg/L GA
- selection agent 10 mg/L basta in the case of pCIB3064 and 2 mg/L methotrexate in the case of pSOG35.
- GA7s sterile containers which contain half-strength MS, 2% sucrose, and the same concentration of selection agent.
- the plasmid, pNOV3240 was introduced in Agrobacterium tumefaciens using electroporation.
- Transformed Agrobacterium cells were used to transfer the Rabl7-T6PP- RNAi expression cassette into the maize (A188xHiII) genome.
- the T-DNA enables positive identification of transformants via regeneration on media containing mannose. Sixty-three events were generated. Of these, Taqman analysis identified 15 events with a single copy of the transgene and no beyond border sequence. When possible, TO plants were self-pollinated; otherwise they were pollinated with JHAF031.
- Example 7 Greenhouse Growth Conditions Corn seed is sown into 2.5 SVD pots (Classic 600, ⁇ 2 gallon nursery containers) in
- Universal mix (Sungrow Horticulture, Pine Bluff, AR). Universal mix is 45% Peat moss, 45% bark , 5% perlite, 5% vermiculite.
- Environmental conditions for greenhouse maize cultivation is typically 16 hour days (average light intensity 600 ⁇ mol m ' V 2 ), day time temperature of 80-86 0 F, night time temperature 70-76 0 F and relative humidity greater than 50%. Plants are placed on 2" platforms to avoid contact with the greenhouse floor. Plants are hand watered until daily irrigation is required, then they are placed on irrigation drip. The irrigation schedule is 4 minutes every other day. Plants were routinely treated with insecticides to control pests.
- the greenhouse evaluation is a controlled water-stress experiment that quantifies ovule viability in water-stressed and unstressed plants.
- Data from unstressed plants represent the genotype's potential to set seed under ideal conditions.
- Data from water-stressed plants quantify kernel abortion that results from drought at the time of flowering. The results of these experiments can be predictive of field performance.
- This tool to select transgenic events for field evaluations. Seed from selfed plants were sown as above. Taqman analysis was used to divide the progeny hemizygous (containing Rabl7-T6PP-RNAi) and azygous (lost the Rabl7-T6PP- RNAi) groups.
- Seedlings were transferred to 600 pots, above, and maintained using standard greenhouse procedures until they reached the V6 growth stage (Ritchie et al., 1997). All plants were treated with the systemic pesticide, Marathon, to reduce susceptibility to pests. Water stress was gradually imposed, using salt as the osmoticum (Nuccio et al. 1998). The salt consisted of sodium chloride/calcium chloride at a 10:1 molar ratio, delivered in 0.5X Hoagland's Solution, to prevent sodium-induced disruption of potassium uptake. Salt concentration in the irrigant was increased from 50 mM to 100 mM to 150 mM every three days to give plants time to adjust to the salt. Plants were maintained on 150 mM salt solution through the flowering period, typically two weeks, after which pots were thoroughly flushed with water and plants were returned to normal irrigation. This protocol typically reduced kernel set by 40-60%, compared to control plants that received no salt.
- Each plant's ability to adjust to the imposed water stress was measured by sampling the first fully expanded leaf, at its mid-point, for solute potential. Three 3/4 inch circular leaf punches were collected and analyzed for leaf-sap solute potential using a dewpoint vapor pressure osmometer. Plants were sampled three days after the 150 mM salt treatment between 10:00-11:00 AM. The leaf sap solute potentials were compared to soil solute potentials to determine how well the plant adjusted to the water stress. Typically plants did not differ in their adjustment to the imposed water stress.
- Rabl7-T6PP-RNAi events were studied for their ability to set seed under water stress. Twenty-four Tl seed from each event (a selfed TO parent) were germinated. Taqman analysis was used to establish zygosity in each seedling. Homozygotes were set aside for seed bulking. Hemizygotes and azygotes were analyzed using the greenhouse water stress protocol, above (Example 8). In this experiment non-transformed Al 88 plants served as the benchmark. The kernel set data, summarized in Figure 12, show that each event is unique. The water stress protocol was somewhat severe in that the benchmark Al 88 plants suffered more than 70% reduction in kernel set.
- Two Rabl7-T6PP-RNAi events, 78A18B(13) and 81AlOB(IO) were studied for their ability to set seed under water stress.
- Ninety-six T2 seed from each event (a selfed Tl parent) were germinated. Taqman analysis was used to establish zygosity in each seedling. Hemizygotes and azygotes were analyzed using the greenhouse water stress protocol, above (Example 8).
- 81AlOB(IO) azygotes served as the benchmark.
- the water stress protocol was effective in that the benchmark 81AlOB(IO) azygotes suffered about a 45% reduction in kernel set.
- the presence of the transgene may reduce kernel set in well-watered plants. However, the transgene either has little effect on, or slightly improves kernel set in water-stressed plants.
- the field evaluations were conducted to test transgene performance under conditions typically used by growers.
- the general field criteria were four-row plots, 17.5 feet long separated by 2-3 foot alleys with about 40 plants per row.
- the outer rows were planted with azygotes and the inner rows were planted with segregating transgenics.
- the field was divided into a well-watered treatment block and a water-stressed treatment block, and drip irrigation was used to water the fields.
- Each block had a dedicated irrigation manifold. To maintain uniformity the most remote plot was less than 100 feet from the irrigation manifold.
- Tl homozygous seed from Event 78A18B and Event 81A10B were back-crossed twice with JHAF031, and the 1:1 segregating seed were planted in the summer of 2003 in Hawaii.
- the planting site has well drained sandy soil and typically gets less than 3" of rainfall during the summer.
- Taqman analysis of seedlings was performed to establish the presence of the transgene. In this way, azygotes and hemizygotes were randomly dispersed in each plot.
- the well-watered block was irrigated optimally throughout the experiment.
- the water-stress block was watered optimally until plants reached approximately V6, at which time water was withheld. Plants were returned to optimal irrigation after 90% silk emergence. The amount of water applied to the field and rainfall were recorded. After plants transitioned to reproductive development, pollen shed and silk emergence dates were recorded for each plant. Plant response to water deficit was also recorded by monitoring appearance of physiological stress symptoms such as leaf greying and curling, and sampling leaf tissue to measure solute potential. Each plant's ability to adjust to the imposed water stress was measured by sampling the first fully expanded leaf, at its mid-point, for solute potential.
- RNA silencing activity of a double-stranded RNA is sequence specific. Studies in plant, insect, nematode, mammalian and other eukaryotic systems indicate that a homologous 21-23 base sequence is sufficient to cause gene silencing (Waterhouse and Helliwell, 2003; McManus and Sharp, 2002). The length requirement of 21 bases is a lower limit and there is evidence that mismatches can be tolerated (McManus and Sharp, 2002). With this in mind, it's clear that more effective RNA-mediated gene silencing is achieved with longer templates (Thomas et al, 2001). Furthermore gene regulatory sequence does function in a predictable way across species boundaries (See, for example, Nuccio and Thomas, 2000). The transgenic constructs of the present invention can be used to reduce expression of
- T6PP in other plants species Cross-species efficacy was established by querying public and proprietary cDNA databases to identify T6PP encoding sequences in other plant species. The "hits" were aligned and used to generate contigs as described in Fig. 2. T6PP homologues from sorghum, barley, wheat, sugar cane and rye were identified. The sequence fragments from each gene corresponding to the T ⁇ PP-RNAi fragment were compared by alignment (Fig. 16) and similarity (Fig. 17). For comparison ZmToPP-I amino acids 334-393, in Fig. 3, are encoded by nucleotides 1-180 of the ZmT6PP-l cDNA shown in Fig. 16.
- GMTREl Purification of the trehalase GMTREl from Soybean nodules and cloning of its cDNA. GMTREl is expressed at a low level in multiple tissues. Plant Physiol. 119, 489-495.
- a ribozyme gene and an antisense gene are equally effective in conferring resistance to tobacco mosaic virus on transgenic tobacco. MoI. Gen. Genet. 250, 329-338.
- Trehalose-6-phosphate synthase 1 which catalyses the first step in trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J. 29, 225-235.
- Trehalose metabolism a regulatory role for trehalose-6- phosphate synthase? Current Opin. Plant Biol. 6, 231-235.
- Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc. Natl. Acad. Sci. USA. 99, 15898-15903.
- RNAi nature abhors a double-strand. Curr. Opin. Genet. Dev. 12, 225-232.
- HOSl a genetic locus involved in cold-responsive gene expression in Arabidopsis. Plant Cell. 10, 1151-1161. Jaglo-Ottosen, K.R., Gilmour, SJ., Zarka, D.G., Scazaberger, O., Thomashow, M.F. (1998). Arabidopsis CBFl overexpression induces COR genes and enhances freezing tolerance. Science. 280, 104-106.
- sucrose transporter StSUTl localizes to sieve elements in potato tuber phloem and influences tuber physiology and development. Plant Physiol. 131, 102-113.
- Trehalose-6- phosphate phosphatases from Arabidopsis thaliana identification by functional complementation of the yeast tps2 mutant. Plant J. 13, 673-683.
- Trehalose metabolism in Arabidopsis occurrence of trehalose and molecular cloning and characterization of trehalose-6-phosphate synthase homologues. J. Exp. Botany. 52, 1817-1826.
- the plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. MoI. Gen. Genet. 238, 17-25.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to transgenic plants comprising an isolated DNA molecule comprising a polynucleotide that encodes a nucleic acid that down-regulates an endogenous T6PP gene, wherein the polynucleotide is under the control of a promoter that is stress-inducible and is expressed predominantly in vegetative tissue. The promoter may also be developmentally expressed in maturing kernels. Expression of the polynucleotide results in the increased availability of carbon to developing florets/kernels when plants are subject to environmental stress, such as a water deficit. The DNA molecule of the invention thereby permits more photosynthate to be directed to the developing ovules/embryos resulting in stabilized yield in growing environments that are subject to periodic stress.
Description
STRESS TOLERANCE IN PLANTS THROUGH SELECTIVE INHIBITION OF TREHALOSE-6-PHOSPHATE PHOSPHATASE
FIELD OF THE INVENTION
The present invention encompasses the stress-responsive expression of a nucleic acid sequence capable of down-regulating trehalose-6-phosphate phosphatase activity for the purpose of increasing yield and/or improving abiotic stress tolerance of plants.
BACKGROUND OF THE INVENTION
Abiotic stress can affect plant development in different ways depending on the timing, severity, and duration of the stress. Maize plants are, for example, relatively drought tolerant, and can withstand moderate to severe drought in the early and late stages of the growing season. However, maize is quite susceptible to water stress during a 10-14 day period around flowering. Non-irrigated maize grown in the U.S. Corn Belt typically experiences water stress in late summer during flowering. This stress usually manifests itself in the form of reduced kernel set due to ovule/embryo abortion. In the simplest terms, when roots are experiencing osmotic stress, they produce abscisic acid (ABA) which is translocated throughout the plant. In the leaf, this triggers closure of the stomata, thus reducing water loss through transpiration. Unfortunately, this also limits gas exchange and consequently photosynthesis is reduced. Without sucrose from photosynthesis, the developing ovule or embryo rapidly depletes its starch reserve and aborts. The trehalose pathway in plants is shown in Figure 1. The pathway is positioned to demonstrate similarity to sucrose synthesis via sucrose-6-phosphate synthase (8) and sucrose- 6-phosphate phosphatase (9). Trehalose synthesis is catalyzed by trehalose-6-phosphate synthase (T6PS) (10), yielding trehalose-6-phosphate (T6P) and trehalose-6-phosphate phosphatase (T6PP) (11), yielding trehalose, Trelialase (12) cleaves trehalose into two glucose molecules. These enzymes are well characterized in microbes and were thought to occur in only a few plants, such as the dessication tolerant Myrothanmnus flabellifolia, because measurable trehalose accumulates when they dry down (reviewed in Muller et al, 1995). Many crops do not accumulate detectable trehalose, therefore most researchers believed they lacked the ability to make it. Furthermore, exogenously applied trehalose can be toxic to plant tissues (Veluthambi et al., 1981). The E. coli genes encoding T6PS and
T6PP were cloned in the early 1990's (Kaasen et al., 1992), and formed the basis for early work to use genetic engineering to improve plant tolerance to water stress (Holmstrom et al., 1996; Goddijn et al., 1997).
This early plant genetic engineering work was based on evidence obtained with microorganisms. It is well established that trehalose improves desiccation tolerance of microorganisms and macromolecules (Weimken, 1990). These experiments provided a direct correlation between trehalose levels and desiccation tolerance. Many groups attempted to genetically engineer trehalose synthesis in plants (Rontein et al., 2002). Much of their work is aimed to increase trehalose levels (Hoekema et al., 1999). A number of inventions used the E. coli or yeast trehalose synthesis genes. In summary, engineered plants produced only small amounts of trehalose despite increasing the plant's capacity to make trehalose by as much as ten-fold (Londesborough et al., 2000).
Further investigation showed the low trehalose accumulation in transgenics was due, in part, to endogenous trehalase activity (Goddijn et al., 1997). Other workers believed that sucrose and starch synthesis limited the plant's capacity to make trehalose (Hoekema et al., 1999). More recent publications disclosed methods to improve trehalose accumulation in transgenic plants by inhibiting trehalase (Goddijn et al., 2003), expressing an E. coli T6PS- T6PP fusion protein (Garg et al., 2002; Jang et al., 2003) and expressing the E. coli trehalose synthesis gene in plastids (Lebel et al., 2004). Some groups achieved improved trehalose accumulation and, most reported small improvements in drought tolerance even though overall growth defects were observed in the transgenic plants.
Advances in genome information and complementation work in yeast identified plant genes encoding functional T6PS, T6PP and trehalase (Vogel et al., 1998; Blazquez et al., 1998; Aescherbacher et al., 1999; Muller et al., 2001; Vogel et al., 2001). Trehalose pathway genes are expressed at low levels, but expression has been detected in all tissues examined. Sequence data from several plant species indicate the presence of trehalose metabolism genes (Leyman et al., 2001; Wingler, 2002; Εastmond and Graham, 2003; Εastmond et al., 2003).
In most plant genetic engineering studies the trehalose pathway enzymes, or genes designed to influence a trehalose pathway enzyme activity (for example, an antisense RNA construct), are targeted to the cytosol (Holmstrom et al., 1996; Goddijn et al., 1997; Romero et al., 1997; Pilon-Smits et al., 1998; Garg et al., 2002; Jang et al., 2003). Despite their enormous increase—or change in—synthetic capacity, the experiments do little to influence trehalose or trehalose-6-phosphate in these plants. In fact, tobacco and potato plants
expressing the E. coli T6PS and T6PP genes tend to suffer pleotropic growth defects (Goddijn et al., 1997).
Thus, there is a need to develop stress tolerant plants that do not also exhibit growth defects.
SUMMARY
The present invention relates to transgenic plants comprising a polypeptide encoding a nucleic acid that targets an endogenous T6PP gene, wherein the isolated DNA molecule is under the control of a promoter that is stress-inducible in vegetative tissue. The nucleic acid may also be developmentally expressed in maturing kernels. Stress induced expression of the nucleic acid of the invention increases the availability of carbon to developing florets/kernels when plants are under stress conditions, such as a water deficit. The polypeptide of the present invention transformed into a plant thereby permits more photosynthate to be directed to the developing ovules/embryos resulting in stabilized yield in growing environments that are subject to periodic stress.
The present invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, the isolated DNA sequence is operatively linked to a promoter that is stress induced in vegetative tissue, wherein the nucleic acid is capable of down-regulating a T6PP gene. The present invention includes a method of increasing the starch content in the kernel of a plant comprising the steps of transforming a plant cell with a DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP; generating a plant from the plant cell; inducing expression of the nucleic acid in the vegetative tissue of the plant when the plant is subjected to stress conditions during its reproductive stage; and increasing starch content in the kernel compared to the starch content in the kernel of an isogenic plant not containing the DNA molecule when the transgenic plant and the isogenic plant are grown under substantially the same stress conditions. The present invention further includes a double stranded short interfering nucleic acid
(siRNA) molecule that down regulates expression of a T6PP gene in the vegetative tissue of a plant, wherein said siRNA molecule comprises at least about 21 base pairs.
The present invention encompasses a double stranded siKNA molecule that down regulates expression of a T6PP gene, wherein a first strand of the double stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of a T6PP gene or a portion thereof and, wherein a second strand of the double-stranded siRNA molecule comprises a nucleotide sequence that is complementary to the sequence of the first strand.
The invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene.
The invention includes an isolated DNA molecule comprising a polynucleotide wherein said polynucleotide is depicted by SEQ ID. NO 6.
The invention includes an isolated DNA molecule comprising a polynucleotide , wherein said nucleotide sequence comprises at least about 21 consecutive base pairs of SEQ ID NO. 6.
The invention includes an isolated DNA molecule comprising polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, and wherein said polynucleotide is placed in a sense or antisense orientation relative to said promoter.
The invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is derived from the 5' region of a Rabl7 gene and exhibits promoter activity in plants.
The invention also includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is derived from the 5' region of a Rabl7 gene and exhibits promoter activity in plants and further comprises a 3' region derived from a Rabl7 gene and exhibits terminator activity in plants.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a
promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter comprises about 100-1649 contiguous nucleotides of DNA, wherein said contiguous nucleotides of DNA have from 85% to 100% identity to about 100 to 1649 contiguous nucleotides of DNA having the sequence of SEQ ID NO. 42.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid is capable of forming into a double stranded RNA.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid comprises co-suppressor RNA.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid comprises catalytic RNA.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid wherein said nucleic acid sequence is capable of forming into a triplex nucleic acid.
The invention further includes an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, wherein said promoter is also expressed in seed tissue.
The invention also includes a plant cell having an isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene, and also includes a transgenic plant derived from said plant cell.
The invention further includes an isolated DNA molecule wherein said DNA molecule is depicted by SEQ ID NO. 8 or SEQ. ID. NO. 18.
DESCRIPTION OF THE FIGURES Fig. 1 is a schematic representation of the primary sugar metabolism pathways in a typical plant cell. The various sugar and activated sugar pools associated with starch and sucrose synthesis are shown. A permanent block in trehalose synthesis has been shown in the art to be lethal. However, the present invention recognizes that a conditional block in the
pathway from T-6-P to trehalose using a stress-inducible promoter to express T6PP-RNAi in vegetative tissue, redirects flux to sucrose or starch synthesis in a stress-inducible or developmental pattern.
Fig. 2 is a schematic representation showing how the maize T6PP1 cDNA sequences were assembled, hi section (A), the cDNAs were identified by TBLASTN queries of maize EST and cDNA databases and assembled in Sequencher. The strands 1, 2, and 3 shown at the bottom of section A show the plus (+) open reading frames. Strand 1 (ZmT6PP-l) contains the largest continuous open reading frame and is highlighted. Section (B) depicts the ZmTόPP-1 protein sequence. Figs. 3A and 3B show the alignment of T6PP protein sequences. The Arabidopsis
AtToPPA and AtToPPB sequences are aligned with the rice and maize homologs OsToPP-I, OsT6PP-2, ZmToPP-I, ZmT6PP-2, ZmT6PP-3. The alignment also includes ZmTβPP-target. The alignment was performed using AlignX within Vector NTI (Version 7.1).
Fig. 4 A shows the phylo genetic relationship of the maize, rice and Arabidopsis T6PP proteins.
Fig. 4B shows a similarity and divergence table illustrating similarity of each protein to the others along the horizontal axis and divergence of each protein from the others along the vertical axis. Similarity values are above and divergence values are below the '100' figure in each column. Fig. 5 is a bar chart showing the expression profile of the OsT6PP-l gene in various tissues. Relative expression above 100 is considered significant. The expression profile is consistent with the known expression of the Arabidopsis AtToPP-A gene.
Fig. 6 is a diagram showing sequence alignment of the maize ESTs (GenBank Accession Nos. BE510187, AW171812, AW081181, AI855276, BE453688 and AI941695). ZmToPP clone sequence data are denoted by t3.rev.91331.abi and tl.rev.91323.abl. Also identified are the primers used to clone the ZmToPP-I cDNA fragment and to construct the ZmT6PP-dsRNA cassette.
Fig. 7 is a map of the maize T6PP-1 cDNA fragment in the pCR 4 TOPO vector, referred to as pCR4-TOPO-ZmT6PP-NS. Fig. 8 is a map of the pNOV3210 expression cassette.
Fig. 9 is a map of the pNOV3232 expression cassette. Fig. 10 is a map of the pRabl7-T6PP-RNAi construct. The complete Rabl7 expression cassette can be mobilized as a Kpnl fragment.
Fig. 1 IA is a map of an Agrobacterium tumefaciens binary vector, pNOV2117, that contains the phosphmannose isomerase (cPMI-01) plant selectable marker within its T-DNA borders.
Fig. HB is a map of an Agrobacterium tumefaciens Rabl7-T6PP-RNAi expression cassette cloned in pNOV2117.
Fig. 12 illustrates kernel set yield data from a greenhouse experiment. Plants representing each genotype were subjected to well-watered (WW) or salt-stressed (SS) conditions during the two-week period around flowering. Azygotes (WT) and hemizygotes (TPP) were then scored for kernel set. Data are the means, n=3-5. Fig. 13 illustrates kernel set yield data from a second greenhouse experiment. Plants representing each genotype were subjected to well-watered (WW) or salt-stressed (SS) conditions during the two-week period around flowering. Azygotes (WT) and hemizygotes (TPP) were then scored for kernel set. Data are the means, n=14-20.
Fig. 14 illustrates kernel set yield data for Rabl7-T6PP-RNAi Event 78A18B in the field. Ears from each plant in the field were harvested and shelled. The kernels counted and weighed. The means for hemizygous and azygous plants were calculated. The asterisk indicates a statistically significant difference between azygous and hemizygous plants.
Fig. 15 illustrates yield data for Rabl7-T6PP-RNAi Event 81A10B progeny in the field. Ears from each plant in the field were harvested and shelled. The kernels counted and weighed. The means for hemizygous and azygous plants were calculated. The asterisk indicates a statistically significant difference between azygous and hemizygous plants.
Figs. 16A and 16B illustrate the alignment of the conserved T6PP cDNA sequence from several plant species. The alignment also includes TόPP-RNAi sequence. The alignment was performed using AlignX within Vector NTI (Version 7.1). Fig. 17 shows the phylogenetic relationship of conserved T6PP cDNA sequence from several plant species. The table illustrates percent similarity of each sequence to the others along the horizontal axis. The analysis was performed using AlignX within Vector NTI (Version 7.1).
DETAILED DESCRIPTION OF THE INVENTION The trehalose pathway represents a level of flux control through central sugar metabolism. Several studies identified control mechanisms that regulate enzymes in the metabolic network shown in Figure 1. The data are by no means exhaustive. However, given the ubiquity of the trehalose pathway and pathway gene expression in plants (Wingler, 2002),
and the lethality of a knockout at the pathway's entry point (Eastmond et al., 2002) the present invention recognizes that the trehalose pathway probably functions as a checkpoint to help regulate glucose- 1 -phosphate (g-l-P), glucose-6-phosphate (g-6-P) and fructose-6- phosphate (f-6-P) pool size in the cytosol. hi situations where the capacity to generate these molecules exceeds capacity to utilize them, the trehalose pathway acts as a "spill way" to quickly inactivate g-6-P and uridine diphosphate glucose (UDP-g) and recycle the glucose moiety, hi this capacity the pathway sets up an apparent futile cycle that needlessly consumes energy, by converting substrates to products and later converts those products back to the original substrates. This assertion is not without precedence in plant biochemical networks (Rontein et al., 2002b; Ronocha et al., 2001). Such control mechanisms are worth the slight, but necessary, energy expenditure because of their greater role in maintaining the stability of the system. Thus, the present invention further recognizes that the trehalose pathway provides a rapid, probably low-capacity, control mechanism to stabilize cytosolic hexose phosphate pools. The trehalose pathway is poised to compete with other metabolic processes—such as starch synthesis, sucrose synthesis and glycolysis—for g-6-p and UDP-g. The present invention takes into account that engineering plants to express a heterologous protein(s), such as T6PP or T6PS, that may not be subject to endogenous regulation, using strong constitutive promoters pulls activated sugars out of central carbon metabolism. This wastes considerable energy and retards growth. Therefore, the composition and method of the present invention includes using promoters that are drought-inducible in vegetative tissue, that may also developmentally expressed in maturing kernels, operably linked to a nucleic acid molecule that when expressed in a plant cell, inhibits expression of the endogenous T6PP gene or the products thereof. By doing so, sugars are directed to synthesis of starch and sucrose for their availability to developing kernels when plants are subject to. environmental stress.
The present invention uses genetic engineering to decrease or eliminate, via down- regulation, the expression of maize endogenous T6PP genes. There are numerous methods known to those skilled in the art for modifying expression of endogenous genes. Post- transcriptional gene silencing (PTGS), triplex-forming nucleic acid, ribozymes, inactive protein subunits and single-stranded monoclonal antibodies can all be used to eliminate or repress gene expression, as discussed in more detail below.
In diverse eukaryotes, including plants, double stranded RNA (dsRNA) triggers destruction of any RNA sharing sequence with the double stranded RNA molecule
(Hutvagner and Zamore, 2002). It begins by the conversion of dsRNA into short 21-23 nucleotide fragments by the multi-domain RNAse III enzyme, Dicer (Lee et al., 2004; Pham et al., 2004). These small interfering RNAs (siRNAs) direct the degradation of target RNAs complementary to the siRNA sequence (Elbashir et al., 2001). In addition Dicer also cleaves roughly 70 nt precursor stem-loop RNA structures into single-stranded 21-23 nt RNAs known as microRNAs (miRNAs) (Grishok et al., 2001; Reinhart et al., 2002). This is the basis for RNA interference (RNAi) technology that is used to suppress the expression of endogenous and heterologous genes in a sequence specific manner (Fire et al., 1998; Carthew, 2001; Elbashir et al., 2001). A RNAi suppressing construct can be designed in a number of ways, for example, transcription of a inverted repeat which can form a long hair pin molecule, inverted repeats separated by a spacer sequence that could be an unrelated sequence such as GUS or an intron sequence. The present invention also contemplates transcription of sense- and antisense-RNA strands by opposing promoters, or cotranscription of sense and antisense genes. Antisense RNA technology can be also be used to down-regulate expression of a specific endogenous gene. This is a down-regulation approach used to modify a desired plant enzyme level or activity. Antisense RNA results in down-regulation at the RNA translational level. Down-regulation by antisense RNA, as described by Shewmaker et al. (1992) has been shown effective with a variety of plant genes (Rothstein et al., 1987; Smith et al., 1988; van der Krol et al., 1988; Bird et al., 1991; Bartley et al., 1992; Gray et al., 1992; Knutzon et al., 1992; Shimada et al., 1993; KuIl, et al., 1995; Slabas and Elborough, 2000). In the nucleus, antisense RNA may directly interfere with transcription or form duplexes with the heterogeneous nuclear RNA (hnRNA). Alternatively, in the cytoplasm, antisense RNA may form a double-stranded molecule with the complimentary mRNA and prevent the translation of mRNA into protein.
Co-suppression, as described by Seymour et al., (1993) is another approach applicable for down-regulation of plant gene expression. Co-suppressor RNA, in contrast to anti-sense RNA, is in the same orientation as the RNA transcribed from the target gene, i.e., the "sense" orientation. It has been used extensively to produce transgenic plants having modified gene expression levels (Napoli et al., 1990; Brusslan et al., 1993; Vaucheret et al., 1995; Jorgensen et al., 1996). The mechanism of co-suppression is thought to be caused by the production of antisense RNA by read-through transcription from distal promoters located on the opposite strand of the chromosomal DNA (Grierson et al. 1991). It's now understood that there are
common features associated with all forms of RNA-mediated gene silencing (Matzke et al., 2002; Tijsterman et al., 2002).
Another down regulation approach involves the use of ribozyme technology (Atkins et al., 1995; De-Feyter et al., 1996). Ribozyme technology, like antisense methodologies, also works at the RNA translational level and involves making catalytic RNA molecules that bind to, and cleave the mRNA of interest. Ribozymes have recently been demonstrated as an effective method for the down-regulation of plant proteins (Waterhouse and Wang, 2002) and control of plant pathogens (Atkins et al., 2002).
A further down-regulation method includes use of co-suppressor or 'sense' nucleic acids and dsRNAs. Nucleic acid sequences can be constructed which will bind to duplex nucleic acid either in the gene or the DNA:RNA complex of transcription, to form a stable triple helix-containing or triplex nucleic acid to inhibit transcription and/or expression of the target gene (Frank-Kamenetskii and Mirkin, 1995). Such nucleic acid sequences are constructed using the base-pairing rules of triple helix formation and the nucleotide sequence of the gene or mRNA of interest. These nucleic acid sequences can block target gene-type activity in a number of ways, including prevention of transcription of the gene or by binding to mRNA as it is transcribed by the gene.
A dominant-negative genetic approach can also be used to down-regulate specific types of enzymes. The presence of a dominant trait, i.e. the expression of a transgene, results in a reduction of enzyme activity or reduced production of the enzymatic end-product. Some enzymes are complexes of two or more protein subunits. Such an enzyme's activity relies on the proper assembly of these subunits to form functional enzyme. Expression of a nonfunctional subunit that can interact with the other subunit(s) can produce a non-functional enzyme and hence reduce enzymatic activity. The non-functional aspect may be in respect to, but not limited to, subunit interaction, substrate binding or enzyme catalysis, for example.
Another approach to down-regulate proteins in plants relies on the use of monoclonal antibodies (MAb) and/or functional fragments thereof, such as single chain antibodies (SCAb) that specifically recognize and bind transit peptides (Sukhapinda et al., 2004). As a result, steady-state levels of corresponding passenger proteins can be reduced. The above described technologies and other technologies known to those skilled in the art for down regulating genes may be used in the present invention.
The present invention includes down-regulating the endogenous maize T6PP gene by constructing a chimeric polynucleotide comprising a promoter that is drought-inducible in
vegetative tissue operatively linked to a nucleic acid, wherein when expressed in a plant cell the nucleic acid, or a portion thereof, is capable of reducing the expression of an endogenous T6PP gene of a plant cell. In one embodiment of the invention, the promoter is drought- inducible in vegetative tissue. In another embodiment of the invention, the promoter is derived from the 5' region of a Rabl7 gene. The invention encompasses the polypeptide also having a terminator sequence derived from the 3' region of the Rabl7 gene.
When a recombinant promoter is used, the promoter can also be selected to cause expression of TόPP-RNAi in a manner that is different than how the ZmToPP-I protein is expressed by the plant in its native state. For example, the promoter may have no effect on the level at which the ZmToPP-I protein is expressed, express the T6PP-RNAi without being induced by an environmental stress and/or express the TόPP-RNAi in response to a different form or degree of environmental stress than would otherwise be needed to induce expression of the Zm-T6PP-l protein. The present invention recognizes that strong constitutive promoters should not be used to cause decreased levels of ZmT6PP-l gene expression. Examples of such strong constitutive promoters include, but are not limited to, the nopaline synthase (NOS) and octopine synthase (OCS) promoters (Jones et al., 1992), the cauliflower mosaic virus (CaMV) 19S and 35S promoters (Odell et al., 1985) or the enhanced CaMV 35S promoters (Kay et al., 1987). Constitutively down-regulating the trehalose pathway is known to cause pleotropic growth defects. Specific down-regulation of T6PP to direct photosynthate to starch and sucrose in select cells is desirable.
A tissue specific promoter could be used to alter ZmTGPP-I gene expression in tissues that are highly sensitive to stress. Examples tissue-specific promoters include, but are not limited to, seed-specific promoters for the B. napus napin gene (Kridl and Knauf, 1995), the soybean 7S promoter (Fujiwara and Beachy, 1994), the Arabidopsis 12S globulin (cruciferin) promoter (Pang et al., 1988), the maize 27 kD zein promoter (Ueda et al., 1992) and the rice glutelin 1 promoter (Goto et al., 1999), fruit active promoters such as the E8 promoter from tomatoes (Mehta et al., 2002), tuber-specific promoters such as the patatin promoter (Kuehn et al., 2003), and the promoter for the small subunit of ribulose-l,5-bis- phosphate carboxylase (ssRUBISCO) whose expression is activated in photosynthetic tissues such as leaves (Laporte et al., 2001).
Alternatively, a promoter could be used to induce the expression of the T6PP-RNAi gene only at a proper time, such as prior to a drought that occurs at or around the time of flowering, thereby improving the reproductive capability of the crop and increasing the
productivity of the land. This may be accomplished by applying an exogenous inducer by a grower whenever desired (Chua and Aoyama, 2000; Caddock et al., 2003). Similarly, a promoter can be used which turns on at a dehydration condition that is wetter than the dehydration condition at which the plant normally exhibits dehydration tolerance. This would enable the level at which a plant responds to dehydration to be altered.
Promoters which are known or are found to cause inducible transcription of the DNA into mRNA in plant cells can be used in the present invention. Such promoters may be obtained from a variety of sources such as plant and inducible microbial sources, and may be activated by a variety of exogenous stimuli, such as cold, heat, dehydration, pathogenesis and chemical treatment. The particular promoter selected is preferably capable of causing sufficient expression of the TόPP-RNAi to enhance plant tolerance to environmental stress conditions such as water deficit. Examples of promoters which may be used include, but are not limited to, the promoter for the DRE (C-repeat) binding protein gene dreb2a (Liu et al., 1998) that is activated by dehydration and high-salt stress; the promoter for delta 1-pyrroline- 5-carboxylate synthetase (P5CS) whose expression is induced by dehydration, high salt and treatment with the plant hormone abscisic acid (ABA) (Yoshiba et al., 1995; Zhang et al., 1997); the promoter for the rd22 gene from Arabidopsis whose transcription is induced by salt stress, water deficit and endogenous ABA (Yamaguchi-Shinozaki and Shinozaki, 1993a); the promoter for the rd29b gene (Yamaguchi-Shinizaki and Shinozaki, 1993b) whose expression is induced by desiccation, salt stress and exogenous ABA treatment (Ishitani et al., 1998); the promoter for the rablδ gene, or other dehydrins, from Arabidopsis whose transcripts accumulate in plants exposed to water deficit or exogenous ABA treatment (Nylander et al., 2001); the maize Rabl7 promoter that is drought-inducible in vegetative tissue and developmentally expressed in maturing kernels (Vilardell et al., 1991); and the promoter for the pathogenesis-related protein Ia (PR- Ia) gene whose expression is induced by pathogenesis organisms or by chemicals such as salicylic acid and polyacrylic acid (Uknes et al., 1993).
It should be noted that the promoters described above may be further modified to alter their expression characteristics. For example, the drought/ABA inducible promoter for the rablδ gene may be incorporated into seed-specific promoters such that the rabl8 promoter is drought/ABA inducible only in developing seeds. Similarly, any number of chimeric promoters can be created by ligating a DNA fragment sufficient to confer environmental stress inducibility from the promoters described above to constitute promoters with other
specificities such as tissue-specific promoters, developmentally regulated promoters, light- regulated promoters, hormone-responsive promoters, etc. This should result in the creation of chimeric promoters capable of being used to cause expression of the TόPP-RNAi gene in any plant tissue or combination of plant tissues. Expression can also be made to occur either at a specific time during a plant's life cycle or throughout the plant's life cycle.
In one embodiment, the promoter of the instant invention modulates ZmToPP-I expression in plants experiencing various abiotic or environmental stresses, including cold, heat, dehydration, and/or salt stress that directly affect plant water relations. These promoters come from genes, and the like, that include, but are not limited to, the CBF/DREB family of transcription factors shown to be induced by cold, salt, and dehydration stress (Jaglo-Ottosen et al., 1998); the maize Rabl7 promoter that is drought-inducible in vegetative tissue and developmentally expressed in maturing kernels (Vilardell et al., 1991); the LP3 water-deficit- induced gene (Wang et al., 2002); the Arabidopsis CIPK3 gene that is responsive to ABA and stress conditions, including cold, high salt, wounding, and drought (Kim et al., 2003); the barley (Hordeum vulgar e) HVA22 gene that is induced dehydration, salinity, extreme temperatures, and ABA (Brands and Ho, 2002); the betaine aldehyde dehydrogenase (AcBADH) gene from the halophyte Atriplex centralasiatica Iljin that is induced by drought, salinity, cold stress and ABA (Yin et al., 2002); and the wheat Esi47 gene which is induced by salt stress and ABA (Shen et al., 2001). Expression of endogenous or exogenous nucleotides under the direction of a stress-induced promoter may result in maintenance of a desirable plant phenotype under adverse environmental conditions such as water deficit.
Expression cassettes containing the above promoters can function with a transcriptional terminator. In many cases the nopaline synthase (NOS) terminator performs this function. Many skilled in the art consider this terminator adequate for most applications (Lessard et al., 2002). However, there are exceptions. In some cases expression cassette . performance improves when the NOS terminator is replaced with a similar sequence derived from the same gene the promoter is based on (No et al., 2000; Nuccio and Thomas, 2000; Moreno-Fonseca and Covarrubias, 2001). These exceptions often arise when use of the NOS terminus yields unsatisfactory results. The role gene terminator sequences play in overall regulation is not fully understood. Those who recognize this potential and require faithful reproduction of an endogenous gene expression pattern will replace the NOS terminator with similar sequence derived from the gene used to produce the promoter. Likewise, those skilled
in the art may also choose a gene terminator derived from a gene other than that used for the promoter in order to construct an expression cassette with the desired regulatory properties.
Stress-induced yield reduction in maize is most pronounced when plants experience stress approximately during the two- week period prior to anthesis and during the first week of anthesis. This corresponds to the V12-V18 period of maize development (Ritchie et al., 1997). During this time the ear is formed, and the number and arrangement of ear spikelets is determined (Kiesselbach, 1999). Ovules, the kernel progenitors, develop within spikelets and are very susceptible to stress (Zinselmeier et al., 1995a), such as drought. One study showed a correlation between ovule starch depletion and the propensity to abort (Zinselmeier et al., 1999). Other work suggested ovary abortion can be reversed by increasing carbohydrate flux to ovules during periods of stress (Zinselmeier et al., 1995b). The present invention is directed to genetic engineering solutions to reduce environmental stress related yield loss in maize by increasing carbohydrate flux to developing kernels when such kernels are developing during periods of environmental stress, by using a promoter that is drought- inducible in vegetative tissue and that may also be developmentally expressed in maturing kernels.
Examples of suitable plants for which stress tolerance may be induced according to the methods of the present invention and which may be transformed with the expression cassettes of the invention include monocotyledonous and dicotyledonous plants such as field crops, cereals, fruit and vegetables such as: canola, sunflower, tobacco, sugarbeet, cotton soya, maize, wheat, barley, rice, sorghum, tomatoes, mangoes, peaches, apples, pears, strawberries, bananas, melons, potatoes, carrots, lettuce, cabbage and onion. Example 1: Identification and acquisition of the ZmTPPl gene
The first vascular plant trehalose-6-phosphate phosphatase genes were cloned from Arabidopsis thaliana by complementation of a yeast tps2 deletion mutant (Vogel et al. 1998). The genes designated AtTPPA and AtTPPB (GenBank accessions AF007778 and AF007779) were shown at that time to have trehalose-6-phosphate phosphatase activity. The AtTPPA and AtTTPB protein sequences were used in TBLASTN queries of maize and rice sequence databases. Sequence alignments organized the hits into individual genes. Fig. 2A, is a cartoon depicting the alignment that defines ZmToPP-I. Three maize and two rice T6PP homologs were identified. The cDNA sequences corresponding to the predicted protein sequence for each gene-ZmT6PP-l, -2 and -3 and OsToPP-I and -2~ are depicted by SEQ. ID NOS. 1, 2, 3, 4 and 5, respectively. These T6PPs are shown in global alignment the Arabidopsis T6PPs
in Figure 3. The relationship between each protein to the others is further analyzed using a phylogenetic tree (Fig. 4A) and a similarity/divergence table (Fig. 4B). Results suggest that ZmT6PP-l is the likely maize homolog of AtTPPA and ZmT6PP-2 is the likely maize homolog of AtTPPB. The ZmToPP-I gene was targeted for inactivation because the EST data show it is expressed in a pattern consistent with AtToPPA. However, the EST data are limited due to unequal tissue representation among the maize EST libraries. To compensate, the OsToPP-I cDNA sequence was used to query Expression Profiling data. The results, in Figure 5, show the OsT6PP-l is expressed at a relatively low level in most tissues, which agrees with the data for AtToPPA (Vogel et al., 1998). A partial ZmT6PP-l cDNA (SEQ ID NO. 13) was amplified from a maize mixed tissue cDNA library in two steps (Fig. 6). The library was cloned in the Notl and Sail restriction sites of the Invitrogen vector pCMVSPORTβ. A first fragment referred to as T6PP1 was produced in a 50 μL reaction mixture consisting of 1 μL maize cDNA library, 200 μM dNTPs (dATP, dCTP, dGTP, TTP), 1 μL 20 μM oligonucleotide primer ZmTPP-Ib (5'-TTCTCCCTATCTATGTTGGAG-S') (SEQ ID NO. 19), 1 μL 20 μM oligonucleotide primer ZmTPP-2 (5'-CGCAACACAGTGAAACACTAGAAGG-S') (SEQ ID NO. 20), 1 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase (Roche Diagnostics, Cat. No. 1 759 078). The thermocycling program was 94°C for 2 minutes followed by 40 cycles of (940C for 15 seconds, 580C for 30 seconds, 68°C for 1.0 minute) followed by 68°C for 5.0 minutes.
A second fragment, referred to as T6PP2 (SEQ ID NO. 14), was produced in a 50 μL reaction mixture consisting of 1 μL maize cDNA library, 200 μM dNTPs, 1 μL 20 μM oligonucleotide primer ZmTPP-2r (5'-CCTTCTAGTGTTTCACTGTGTTGCG-S') (SEQ ID NO. 21), 1 μL 20 μM oligonucleotide primer psport-forward (5'- GCCAGTGCCTAGCTTATAATACG-S') (SEQ ID NO. 22), 1 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase (Roche Diagnostics, Cat. No. 1 759 078). The thermocycling program was 940C for 2 minutes followed by 40 cycles of (940C for 15 seconds, 58°C for 30 seconds, 68°C for 1.0 minute) followed by 680C for 5.0 minutes. The T6PP1 and T6PP2 fragments were joined using the splicing by overlap extension
PCR method. The 50 μL reaction mixture consisted of 2 μL T6PP1 reaction mix, 2 μL T6PP2 reaction mix, 200 μM dNTPs, 1 μL 20 μM oligonucleotide primer ZmTPP-Ib, 1 μL
20 μM oligonucleotide primer psport-forward, 1 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase (Roche Diagnostics, Cat. No. 1 759 078). The thermocycling program was 5 cycles of (940C for 30 seconds, 680C for 1.0 minute) followed by 35 cycles of (94°C for 30 seconds, 580C for 30 seconds, 680C for 1.0 minute) followed by 68°C for 7.0 minutes. Cloned the 0.8 kb DNA product, encoding the ZmT6PP-l fragment, with the TOPO TA cloning kit for sequencing (Invitrogen, Cat. No. K4575-01). 2.0 μL of the reaction mix was transformed into 50 μL Top 10 competent cells (hivitrogen, Cat. No. C4040-03). The pCR-4-TOPO-ZmT6PP-NS recombinants containing the ZmT6PP-l fragment were identified by digesting 5 μL ρCR-4-TOPO-ZmT6PP-NS miniprep DNA (prepared using the QIAprep Spin Miniprep procedure from Qiagen, Cat. No. 27106) with EcoRI (New England Biolabs) in a 20 μL reaction containing 2 μg BSA and 2 μL 1OX EcoRI restriction endonuclease buffer (New England Biolabs). The reaction was incubated at 370C for 2 hours then pCR-4-TOPO-ZmT6PP-NS (EcoRI) products were resolved on 1% TAE agarose. The pCR-4-TOPO-ZmT6PP-NS clones were sequenced using the ABI PRISM dye terminator cycle sequencing kit (Perkin Elmer). The pCR-4-TOPO-ZmT6PP-NS map is shown in Fig. 7.
Example 2: Construction of the Rabl7 Expression Cassette
An expression cassette based on the maize Rabl7 gene was discovered to be drought inducible (Vilardell et al., 1990) in vegetative tissue and developmentally expressed in maturing seeds (Vilardell et al., 1991). One embodiment of the present invention is to provide a nucleic acid construct that comprises a promoter that is drought inducible in vegetative tissue operatively linked to a nucleic acid molecule, wherein when expressed in a plant cell the nucleic acid molecule is capable of reducing the expression of an endogenous T6PP gene of a plant cell.
The invention includes a nucleic acid construct having a promoter derived from the 5' region of a Rabl7 gene and that exhibits promoter activity in plants.
The invention also includes the nucleic acid construct comprising all or part of a nucleic acid sequence encoding T6PP-RNAi, wherein the Rabl7 promoter drives the T6PP- RNAi expression cassette to create a conditional block in the trehalose pathway. The T6PP- RNAi expression cassette of the invention re-directs carbohydrate to sucrose or starch synthesis in reproductive tissue and in vegetative tissue during periods of water deficit.
The nucleic acid construct of the invention further includes both the 5' and 3 '-regions derived from the maize Rabl7 gene, wherein the regions exhibit promoter and terminator activity in plants, respectively. In one embodiment of the invention, both the 5' and 3' regions were used in the nucleic acid construct to assure that the transgene expression mimics maize Rabl7 expression. To begin, cDNA sequence was gathered, aligned and annotated. The published gDNA sequence (GenBank Accession No. Xl 59940) was used to query public and proprietary databases. The Rabl7 cDNA sequence was broken into exons and aligned with Rabl7 gDNA to provide the requisite annotation and map the translation start and stop codons onto the gDNA. The ZmRab 17 promoter was amplified from maize gDNA in a 50 μL reaction mixture consisting of 100 ng maize gDNA, 200 μM dNTPs, 1 μL 20 μM oligonucleotide primer 000426A (5'-GGTACCAAGCTTAATTCGCCCTTATAAACT-S') (SEQ ID NO. 33), 1 μL 20 μM oligonucleotide primer 000426B (5'-
ACTGCAGTTAGATCTAGTCTTCGTGCTTGTGT-3') (SEQ ID NO. 24), 1 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase. The thermocycling program was 940C for 2 minutes followed by 40 cycles of (940C for 15 seconds, 580C for 30 seconds, 680C for 2.0 minutes) followed by 680C for 5.0 minutes. The 0.6 kb DNA product encoding the ZmRab 17 promoter was cloned with the TOPO TA cloning kit for sequencing following manufactures' instructions. 2.0 μL of the reaction mix was transformed into 50 μL Top 10 competent cells following manufactures' instructions. pCR-4-TOPO-pZmRabl7 recombinants containing the ZmRab 17 promoter were identified by digesting 5 μL pCR-4- TOPO-pZmRabl7 miniprep DNA with EcoRI in a 20 μL reaction containing 2 μg BSA and 2 μL 1OX EcoRI restriction endonuclease buffer. The reaction was incubated at 370C for 2 hours then ρCR-4-TOPO-pZmRabl7 (EcoRI) products were resolved on 1% TAE agarose. The pCR-4-TOPO-pZmRabl7 clones were sequenced using the ABI PRISM dye terminator cycle sequencing kit. The pCR-4-TOPO-pZrnRabl7 sequence is given as SEQ ID NO. 11.
The ZmRab 17 terminator was amplified from maize gDNA in a 50 μL reaction mixture consisting of 100 ng maize gDNA, 200 μM dNTPs, 1 μL 20 μM oligonucleotide primer 000426C (5'-ACTGCAGTACGTGGCTGTGCTGTG-S') (SEQ ID NO. 25), 1 μL 20 μM oligonucleotide primer 000426D (5'-CGGTACCAATTGCATGCGTCTAATCA-S ') (SEQ ID NO. 26), 1 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase. The thermocycling program was 940C for 2 minutes followed by 40 cycles of
(940C for 15 seconds, 580C for 30 seconds, 680C for 2.0 minutes) followed by 680C for 5.0 minutes. The 0.6 kb DNA product encoding the ZmRabl7 terminus was cloned with the TOPO TA cloning kit. 2.0 μL of the reaction mix was transformed into 50 μL ToplO competent cells. pCR-4-TOPO-tZmRabl7 recombinants containing the ZmRabl7 terminator were identified by digesting 5 μL pCR-4-TOPO-tZmRabl7 miniprep DNA with EcoRI in a 20 μL reaction containing 2 μg BSA and 2 μL 1OX EcoRI restriction endonuclease buffer. The reaction was incubated at 37°C for 2 hours then pCR-4-TOPO-tZmRabl7 (EcoRI) products were resolved on 1% TAE agarose. The pCR-4-TOPO-tZmRabl7 clones were then sequenced. The pCR-4-TOPO-tZmRabl7 sequence is given as SEQ ID NO. 12. pZmRabl7 and tZmRabl7 were amplified from ρCR-4-TOPO-ρZmRabl7 and pCR-
4-TOPO-tZmRabl7, respectively, as described above. The PCR products were purified with the MinElute PCR purification kit (Qiagen, Cat. No. 28004), digested in 50 μL reactions containing 5 μg BSA, 5 μL 1OX restriction endonuclease buffer 1, 2.5 μL Kpnl and 2.5 μL Pstl (New England Biolabs). The reactions were incubated at 370C for more than 6 hours, then at 7O0C for 20 minutes. The 0.5 kb pRAB17 (Kpnl/Pstl) and 0.7 kb tZmRabl7 (Kpnl/Pstl) DNA were resolved on 1.0% TAE agarose and the bands were excised. The DNA and extracted and recovered using the QIAquick Gel extraction kit (Qiagen, Cat. No.28704). Each fragment was eluted in 40 μL ddH2O.
40 μL of ρRAB17 (Kpnl/Pstl) was ligated to 40 μL tZmRabl7 (Kpnl/Pstl) in a 100 μL reaction containing 10 μL 1OX T4 DNA ligase buffer (New England Biolabs) and 10 μL T4 DNA ligase (400 Units/μL- New England Biolabs). The ligation reaction was incubated more than 8 hours at 160C. The ligation was precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -2O0C for more than 2 hours. The ligation products were recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 14 μL ddH2O.
The ligation products were digested in a 20 μL reaction containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer 1 and 2 μL Kpnl. The reaction was incubated at 370C for more than 6 hours, then at 7O0C for 20 minutes. The resolved DNA was digested on 1.0% TAE agarose and excised the 1.3 kb pZniRabl7-tZmRabl7 (Kpnl) band. The pZmRabl7- tZmRabl7 (Kpnl) DNA was extracted and recovered it using the QIAquick Gel extraction kit (Qiagen, Cat. No.28704). The recovered pZmRabl7-tZmRabl7 (Kpnl) DNA was precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -
200C for more than 2 hours. The pZmRabl7-tZmRabl7 (Kpnl) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 μL ddH2O.
2 μg of pBluescript II (KS-)--aka pBS-DNA (QIAprep Spin Miniprep procedure from Qiagen, Cat. No. 27106) was digested in a 20 μL reaction containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer 1 and 2 μL Kpnl. Incubated the reaction at 370C for more than 6 hours, then at 700C for 20 minutes. 1 μL 1OX restriction endonuclease buffer 1, 1 μL 1 Unit/μL calf-intestinal alkaline phosphatase and 8 μL ddH2O were then added to the reaction and incubated at 370C for 30 minutes. The pBS (Kpnl/CIP) DNA was resolved on 1.0% TAE agarose and the 3.0 kb pBS (Kpnl/CIP) band was excised. The pBS (Kpnl/CIP) DNA was recovered and precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -200C for more than 2 hours. The pBS (Kpnl/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 μL ddH2O. 4.0 μL of ρZmRabl7-tZmRabl7 (Kpnl) was ligated to 4.0 μL pBS (Kpnl/CIP) in a 10 μL reaction containing 1 μL 1OX T4 DNA ligase buffer and 1 μL T4 DNA ligase (400 Units/μL) and incubated more than 8 hours at 160C. 5.0 μL of ligation mix was transformed into 50 μL ToplO competent cells. pBS-pZmRabl7/tZmRabl7 recombinants were verified by digesting 2 μL pBS-pZmRabl7/tZmRabl7 miniprep DNA with 1.0 μL Kpnl in 10 μL reactions containing 1 μg BSA and 1 μL 1OX restriction endonuclease buffer 1. The reactions were incubated at 370C for 2 hours then pBS-ρZmRabl7/tZmRabl7 (Kpnl) DNA was resolved on 1% TAE agarose. The pBS-pZmRabl7/tZmRabl7 clones were then sequenced. The pBS-pZniRabl7/tZmRabl7 sequence was designated as pNOV3010 (SEQ ID NO. 17). The pNOV3010 map is shown in Fig. 8. pNOV3010 lacks flexibility to clone genes of interest. Additional restriction sites were added at the pZmRabl7/tZmRabl7 junction to increase flexibility by ligating a synthetic adapter to the vector. The adapter (Synthetic Adaptor I) was made by combining 40 μL of 50 μM oligonucleotide 000809A (5'-PGATCGGCGCGCCTGTTAATTAATTGC GGCCGC-3') (SEQ ID NO. 27), 40 μL of 50 μM oligonucleotide 000809B (51- PGATCGCGGCCGCAATTAATTAACAGGCGCGCC-S') (SEQ ID NO. 28)-where P is a 5'-phosphate group-in a 100 μL mixture that is 25 mM in Tris-HCl (pH 8.0) and 10 mM in
MgCl2. The mixture was boiled for 5 minutes, removed from heat and naturally cooled to room temperature (about 60 minutes). This yields a 20 μM Synthetic Adaptor I solution. pNOV3010 was prepared by digesting 14 μL of miniprep pNOV3010 DNA with 2 μL BgIII in a 20 μL reaction containing 2 μg BSA and 2 μL 1OX restriction endonuclease buffer 3. The reaction was incubated at 37°C for 6 hours, then at 700C for 20 minutes. 1 μL 1OX of the restriction endonuclease buffer 3, 1 μL 1 Unit/μL calf-intestinal alkaline phosphatase (CIP-New England Biolabs) and 8 μL ddH2O was added to the reaction and then incubated at 370C for 30 minutes. pNOV3010 (Bglll/CIP) digestion products were resolved on 1% TAE agarose, the pNOV3010 (Bglll/CIP) DNA band was extracted and recovered. The pNOV3010 (Bglll/CrP) DNA was then precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -2O0C for more than 2 hours. pNOV3010 (Bglll/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 μL ddH2O.
4.5 μL Synthetic Adaptor I was ligated to 2.5 μL pNOV3010 (Bglll/CIP) in a 10 μL reaction containing 1 μL 1OX T4 DNA ligase buffer (New England Biolabs) and 1 μL T4 DNA ligase (400 U/μL- New England Biolabs) and incubated more than 8 hours at 160C. 4 μL of ligation was transformed into 50 μL XL-I supercompetent cells (Stratagene, Cat. No. 200236). The recombinants were verified by digesting 5 μL miniprep DNA in a 20 μL reaction containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer 4 and 1 μL Ascl. The products were resolved on 1.0% TAE agarose. The finished clone was designated as pNOV3232 (SEQ ID NO. 7). The map for pNOV3232 is shown in Fig. 9.
Example 3: Construction of the T6PP-RNAi Expression Cassette
The primers used to produce the TόPP-RNAi gene are shown in Fig. 6. Two PCR fragments were produced from ρCR-4-TOPO-ZmT6PP-NS template (Fig. 7). Fragment 1 (SEQ ID NO. 15) contains a portion of the CMVρSPORT6 vector that functions as the loop in the T6PP-RNAi gene product. High-fidelity PCR was used to amplify Fragment 1 from ρCR-4-TOPO-ZmT6PP-l in a 50 μL reaction mixture consisting of 1 μL ρCR-4-TOPO- ZmT6PP-NS miniprep DNA, 200 μM dNTPs, 20 μM oligonucleotide primer 00 IL (5'- ATAGGCGCGCCATGTTGGAGATGACAGAACAGATC-S') (SEQ JD NO. 38), 20 μM oligonucleotide primer 002R (5l-ATACCGCGGGGACTGTCCTGCAGGTTTAAACG-31) (SEQ ID NO. 39), 5 μL 1OX cloned Pfu buffer and 2.5 Units of Pfuturbo DNA polymerase
(Stratagene, Cat. No. 600252) in a final volume of 50 u_L. The thermocycling program was 950C for 30 seconds then 40 cycles of (95°C for 10 seconds, 650C for 60 seconds, 720C for 2 minutes) then 720C for 10 minutes. The Fragment 1 DNA product was recovered and the DNA was ethanol precipitated with glycogen carrier. The Fragment 1 DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 14 μL ddH2O.
Fragment 2 is given as SEQ ID NO. 16. High-fidelity PCR was used to amplify Fragment 2 from pCR-4-TOPO-ZmT6PP-NS in a 50 μL reaction mixture consisting of 1 μL pCR-4-TOPO-ZmT6PP-NS miniprep DNA, 200 μM dNTPs, 20 μM oligonucleotide primer 003L (5'-GCGTTAATTAAATGTTGGAGATGACAGAACAGATC-31) (SEQ ID NO. 40), 20 μM oligonucleotide primer 004R (5'-
ATACCGCGGCGCAACACAGTGAAACACTAGAAGG-S') (SEQ ID NO. 41), 5 μL 1OX cloned Pfu buffer and 2.5 Units of Pfuturbo DNA polymerase in a final volume of 50 μL. The thermocycling program was 950C for 30 seconds then 40 cycles of (950C for 10 seconds, 650C for 60 seconds, 720C for 2 minutes) then 720C for 10 minutes. The Fragment 2 DNA product was recovered and the DNA was ethanol precipitated with glycogen carrier. The Fragment 2 DNA was recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 14 μL ddH2O.
Fragment 1 and Fragment 2 DNA were digested, separately, in a 20 μL reaction mixtures containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer and 2 μL SacII. The digests were incubated at 370C for 2 hours. The enzyme was inactivated by incubation for 15 minutes at 650C. 4.0 μL of Fragment 1 (SacII) DNA was ligated to 4.0 μL Fragment 2 (SacII) DNA in a 10 μL ligation mixture containing 1 μL 1OX T4 DNA ligase buffer and 1 μL T4 DNA ligase (400 Units/μL), which was incubated more than 24 hours at 160C. The enzyme was inactivated by incubation for 15 minutes at 650C. This yielded the T6PP-RNAi gene (SEQ ID NO. 6).
The T6PP-RNAΪ gene was digested in a 20 μL reaction mixture containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer, 1 μL Pad and lμL Ascl. The digest was incubated at 37°C for 2 hours. The ZmRabl7 expression cassette plasmid, pNOV3232 (Fig. 9) (SEQ ID NO. 7), was digested in a 20 μL reaction mixture containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer, 1 μL Pad and 1 μL Ascl. Resolved the T6PP-RNAi gene (Ascl/Pacl) and pNOV3232 (Ascl/Pacl) digestion products on 1% TAE agarose, extracted the 1136 bp
TόPP-RNAi gene (Ascl/Pacl) and 4262 bp pNOV3232 (Ascl/Pacl) DNA bands and recovered the DNAs. The recovered DNAs were precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -2O0C for more than 2 hours. The DNAs were recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended each in 5 μL ddEbO.
4.0 μL of the T6PP-RNAi gene (Ascl/Pacl) was ligated to 4.0 μL ρNOV3232 (Ascl/Pacl) in a 10 μL reaction containing 1 μL 1OX T4 DNA ligase buffer and 1 μL T4 DNA ligase (400 Units/μL) and incubated more than 8 hours at 16°C. 5.0 μL of the ligation mix was transformed into 50 μL Top 10 competent cells. pRabl7-T6PP-RNAi recombinants were verified by digesting 2 μL pRabl7-T6PP-RNAi miniprep DNA with 1.0 μL Kpnl in 10 μL reactions containing 1 μg BSA and 1 μL 1OX restriction endonuclease buffer 1. The reactions were incubated at 37°C for 2 hours then the ρRabl7-T6PP-RNAi (Kpnl) DNA was resolved on 1% TAE agarose. The pRabl7-T6PP-RNAi DNA sequence was verified and the construct designated SEQ ID NO. 8. The pRabl7-T6PP-RNAi expression cassette map is shown in Fig. 10.
Example 4: Construction of a modified Rabl7-T6PP-RNAi expression cassette
To improve trait performance the maize Rabl7 promoter sequence was modified to incorporate the complete Rabl7 5'-UTR, the first intron from the maize Rabl7 gene and about 15 nucleotides of the second maize Rabl7 exon. This modified 5'-regulatory sequence of the invention was designed to replace the Rabl7 promoter in pNOV3240. Specific changes made in the Rabl7 5'-regulatory sequence (Seq Id. No. 7) to construct the modified promoter are: (1) The 1G' at nucleotide 604 was changed to 'C, (2) The 1A' at nucleotide 665 was changed to 'T1, (3) The 'A at nucleotide 718 was changed to 'T', (4) The 'A' at nucleotide 748 was changed to 'T' and (5) The 'G' at nucleotide 783 was changed to 'C. Finally, to facilitate recombinant DNA procedures, the Pad and Ascl restriction endonuclease sites were added after the '...TCGGAGGAC nucleotides of Rabl7 exon 2.
The maize Rabl7 5 '-regulatory sequence was amplified from gDNA using high- fidelity PCR. A 50 μL reaction mixture contains 100 ng maize gDNA (Cv. 6N615), 200 μM dNTPs, 1 μL 20 μM prRabl7-F3 (5'-TCAAAACTATAGTATTTTAAAATTGC-S') (SEQ ED NO. 29), 1 μL 20 μM prRabl7-R3 (5'-GTCCTCCGACTTAAACACG-S') (SEQ ID NO. 30), 5 μL 1OX Expand High Fidelity buffer and 1 μL Expand High Fidelity polymerase. The
thermocycling program is 950C for 2 minutes followed by 40 cycles of (940C for 15 seconds, 680C for 7.5 minutes) followed by 680C for 10 minutes. The Rabl7 5'-regulatory sequence was cloned with the TOPO XL PCR cloning kit. pCR-XL-TOPO-Rabl7-gDNA recombinants were identified by digesting 5 μL pCR-XL-TOPO-Rabl7-gDNA miniprep DNA in 20 μL reactions containing 2 μg BSA and 2 μL 1OX EcoRI restriction endonuclease buffer. The reactions were incubated at 370C for 2 hours and the pCR-XL-TOPO-Rabl7- gDNA (EcoRI) products are resolved on 1% TAE agarose. The pCR-XL-TOPO-Rabl7- gDNA clone was then sequenced.
The modified Rabl7 promoter required several sequence changes. First, potential translation initiation codons were eliminated. First, potential translation initiation codons were eliminated using the Stratagene QuikChange Multi Site-Directed Mutagenesis Kit (Cat. No. 200513). The primers that were used to make the changes are: RabATGl (5'-CGTGCAAGCATCATCGAGTACGGTCAGCAG-S ')(SEQ ID NO. 31), RabATG2 (5'-CGCCACGGGCCTTGTCGACCAGTACG-S') (SEQ ID NO. 32), RabATG3(S'-GCACCGGCGGCTTGAGGCACGGCA-S')(SEQIDNO.33),
RabATG4(5'-CCACCGGCGGCTTGGGCCAGCTGG-S')(SEQIDNO.34),and RabATG5(5'-GGCGCTGGCATCGGTGGCGGGCAG-S')(SEQIDNO.35).
High-fidelity PCR was used to attach restriction endonuclease sites to the modified Rabl7 promoter. The 50 μL reaction mixture contained 1 μL pCR-XL-TOPO-Rabl7-gDNA mini-prep DNA, 300 μM dNTPs, 1 μL 20 μM Ascl-Rabl7 (5'- TTAATTAAGGCGCGCCTTCAAAACTATAGTATTTTAAAATTGC-S') (SEQ ID NO. 36), 1 μL 20 μM Rabl7-Paci-Asc-3 (5'-
TTGGCGCGCCTTAATTAAGTCCTCCGACTTAAACAC-S') (SEQ ID NO. 37), 5 μL 1OX Proofstart High Fidelity buffer, 10 μL Q solution and 2 μL Proofstart High Fidelity polymerase. The thermocycling program was 950C for 5 minutes followed by 45 cycles of (940C for 30 seconds, 5O0C for 1 minute, 720C for 4 minutes) followed by 720C for 15 minutes. The PCR product was purified and digested in 50 μL reactions containing 5 μg BSA, 5 μL 1OX restriction endonuclease buffer 4 and 5.0 μL Ascl. The reaction was incubated at 370C for more than 6 hours, then at 7O0C for 20 minutes. The 1.0 kb ρRabl7- mod (Ascl) was resolved on 1.0% TAE agarose and the band was excised. The DNA was extracted and recovered. The recovered pRabl7-mod (Ascl) DNA was ethanol precipitated with glycogen carrier. The pRabl7-mod (Ascl) DNA fragment was recovered by micro
centrifugation, washed with 70% ethanol, dried under vacuum and resuspended in 5 μL ddH2O.
2 μg of pNOV3240 miniprep DNA was digested in a 20 μL reaction mixture containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer 4 and 2 μL Ascl. The reaction mixture was incubated at 370C for more than 6 hours, then at 7O0C for 20 minutes. Then 1 μL restriction endonuclease buffer 4, 1 μL 1 Unit/μL calf-intestinal alkaline phosphatase and 8 μL ddH2O were added to the reaction mixture and incubated at 370C for 30 minutes. The pNOV3240 (AscI/CIP) DNA was resolved on 1.0% TAE agarose and the 11 kb ρNOV3240 (AscI/CIP) band was excised. The ρNOV3240 (AscI/CIP) DNA was extracted and recovered. The recovered pNOV3240 (AscI/CIP) DNA was ethanol precipitated with glycogen carrier. The pNOV3240 (AscI/CIP) DNA was recovered by micro centrifugation, washed with 70% ethanol, and dried under vacuum and resuspended in 5 μL ddH2O.
4.0 μL pRabl7-mod (Ascl) was ligated to 4.0 μL pNOV3240 (AscI/CIP) in a 10 μL ligation mixture containing 1 μL 1OX T4 DNA ligase buffer and 1 μL T4 DNA ligase (400 Units/μL). The ligation mixture was incubated for more than 8 hours at 160C. 5.0 μL of ligation mixture was transformed into 50 μL ToplO competent cells. The modified- pNOV3240 recombinants were verified by digesting 2 μL modifϊed-pNOV3240 miniprep DNA with 1 μL Sail in 10 μL reactions containing 1 μg BSA and 1 μL of the appropriate 1OX restriction endonuclease buffer. Digests were incubated at 370C for 2 hours then resolved on 1% TAE agarose. The positive modified-pNOV3240 recombinants were sequenced. The nucleotide sequence of the modified Rabl7-T6PP-RNAi expression cassette is depicted in SEQ ID NO. 18.
Example 5: Construction of the Binary Agrobacterium tumefaciens Plasmid 2 μg of pNOV2117 (Fig. 1 IA) was digested in a 20 μL reaction containing 2 μg BSA,
2 μL 1OX restriction endonuclease buffer 1 and 2 μL Kpnl. The reaction was incubated at 370C for more than 6 hours, then at 700C for 20 minutes. 1 μL 1OX restriction endonuclease buffer 1, 1 μL 1 Unit/μL calf-intestinal alkaline phosphatase (CIP) and 8 μL ddEbO was then added and incubated at 37°C for 30 minutes. 2 μg pRabl7-T6PP-RNAi miniprep DNA was digested in a 20 μL reaction containing 2 μg BSA, 2 μL 1OX restriction endonuclease buffer 1 and 2 μL Kpnl. The reaction was incubated at 370C for more than 6 hours.
The digested plasmid DNAs, pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi (Kpnl), were resolved on 1.0% TAE agarose and the 9.2 kb ρNOV2117 (KpnI/CIP) and the 2.5 kb pRabl7-T6PP-RNAi (Kpnl) DNA bands were excised. The pNOV2117 (KpnI/CIP) and ρRabl7-T6PP-RNAi (Kpnl) DNAs were extracted and then precipitated with 20 μg glycogen, 0.3 M CH2COONa (pH 5.2) and 2.5 volumes ethanol at -200C for more than 2 hours. The pNOV2117 (KpnI/CIP) and pRabl7-T6PP-RNAi (Kpnl) DNA fragments were recovered by micro centrifugation, washed with 70% ethanol, dried under vacuum and resuspended each in 5 μL ddH2O.
4.0 μL pNOV2117 (KpnI/CIP) was ligated to 4.0 μL pRabl7-T6PP-RNAi (Kpnl) in a 10 μL reaction containing 1 μL 1OX T4 DNA ligase buffer and 1 μL T4 DNA ligase (400 U/μL) and incubated more than 8 hours at 160C. 5.0 μL of ligation mix was transformed into 50 μL ToplO competent cells. pNOV2117-pRabl7-T6PP-RNAi recombinants were identified by digesting 7.5 μL pNOV2117-pRabl7-T6PP-RNAi miniprep DNA with 1.0 μL Kpnl in 10 μL reactions containing 1 μg BSA and 1 μL 1OX restriction endonuclease buffer 1. The reactions were incubated at 370C for 2 hours and then ρNOV2117-pRabl7-T6PP-RNAi (Kpnl) DNA products were resolved on 1% TAE agarose. The pNOV2117-ρRabl7-T6PP- RNAi junction sequence was verified and it was designated as pNOV3240. Its map is shown in Fig. HB.
Example 6: Maize Transformation
Numerous transformation vectors available for plant transformation are known to those of ordinary skill in the plant transformation arts, and the genes pertinent to this invention can be used in conjunction with any such vectors. The selection of vector depends upon the preferred transformation technique and the target species for transformation. For certain target species, different antibiotic or herbicide selection markers are preferred. Selection markers used routinely in transformation include the nptll gene, which confers resistance to kanatnycin and related antibiotics (Vieira and Messing, 1982; Bevan et al., 1983), the bar gene, which confers resistance to the herbicide phosphinothricin (White et al., 1990; Spencer et al., 1990), the hph gene, which confers resistance to the antibiotic hygromycin (Blochlinger and Diggelmann, 1984), the manA gene, which allows for positive selection in the presence of mannose (Miles and Guest, 1984; Bojsen et al., 1998), and the
dhfr gene, which confers resistance to methotrexate (Bourouis and Bruno, 1983), and the EPSPS gene, which confers resistance to glyphosate (Shah et al., 1990; 1993).
Many vectors are available for transformation using Agrobacterium tumefaciens.
These typically carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, 1984). Typical vectors suitable for Agr-obacterium transformation include the binary vectors pCIB200 and pCIB2001, as well as the binary vector pCIBlO and hygromycin selection derivatives thereof. {See, for example, Ligon et al., 1997). Other vectors are available for non-Agrobacterium tumefaciens transformation. Transformation without the use of Agrobacterium tumefaciens circumvents the requirement for T-DNA sequences in the chosen transformation vector and consequently vectors lacking these sequences are utilized in addition to vectors such as the ones described above which contain
T-DNA sequences. Transformation techniques that do not rely on Agrobacterium include transformation via particle bombardment, protoplast uptake {e.g. PEG and electroporation) and microinjection. The choice of vector depends largely on the preferred selection for the species being transformed. Typical vectors suitable for mm-Agrobacteriwn transformation include pCIB3064, ρSOG19, and pSOG35. (See, for example, Ligon et al., 1997).
Once the DNA sequence of interest is cloned into an expression system, it is transformed into a plant cell. Methods for transformation and regeneration of plants are well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake, liposomes, electroporation, microinjection, and microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant cells.
Transformation techniques for dicotyledons are well known in the art and include Agrobacteriwn-based techniques and techniques that do not require Agrobacterium. Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This is accomplished by PEG- or electroporation-mediated uptake, particle bombardment-mediated delivery, or microinjection. In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
Transformation of most monocotyledon species has now also become routine. Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, particle bombardment into callus tissue, as well as Agrobacterium-mediated transformation.
Plants from transformation events are grown, propagated and bred to yield progeny with the desired trait, and seeds are obtained with the desired trait, using processes well known in the art
Once a nucleic acid sequence of the invention has been cloned into an expression system, it is transformed into a plant cell. The receptor and target expression cassettes of the present invention can be introduced into the plant cell in a number of art-recognized ways.
Methods for regeneration of plants are also well known in the art. For example, Ti plasmid vectors have been utilized for the delivery of foreign DNA, as well as direct DNA uptake via electroporation, microinjection, and microprojectiles. In addition, bacteria from the genus Agrobacterium can be utilized to transform plant cells. Below are descriptions of representative techniques for transforming both dicotyledonous and monocotyledonous plants, as well as a representative plastid transformation technique.
Transformation techniques for dicotyledons are well known in the art and include Agrobacterium-based techniques and techniques that do not require Agrobacterium. Non- Agrobacterium techniques involve the uptake of exogenous genetic material directly by protoplasts or cells. This can be accomplished by PEG- or electroporation-mediated uptake, particle bombardment-mediated delivery, or microinjection. Examples of these techniques are described (Paszkowski et al, 1984; Potrykus et al., 1985; Reich et al., 1986; Klein et al., 1987). In each case the transformed cells are regenerated to whole plants using standard techniques known in the art.
Agrobacterium-mcdiated transformation is a preferred technique for transformation of dicotyledons because of its high efficiency of transformation and its broad utility with many different species. Agrobacterium transformation typically involves the transfer of the binary vector carrying the foreign DNA of interest (e.g. pCIB200 or pCIB2001) to an appropriate Agrobacterium strain. This may depend on the complement of Vir genes carried by the host Agrobacterium strain either on a co-resident Ti plasmid or on the chromosome (e.g. strain CIB542 for pCIB200 and pCIB2001 (Uknes et al., 1993)). The transfer of the recombinant binary vector to Agrobacterium is accomplished by a triparental mating procedure using E. coli carrying the recombinant binary vector, a helper E. coli strain which carries a plasmid such as ρRK2013 and which is able to mobilize the recombinant binary vector to the target Agrobacterium strain. Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation (Hδfgen and Willmitzer, 1988).
Transformation of the target plant species by recombinant Agrobacterium usually involves co-cultivation of the Agrobacterium with explants from the plant to be transformed and follows protocols well known in the art. Transformed tissue is regenerated on selection medium containing the antibiotic, herbicide or other compound that the selectable marker, present between the binary plasmid T-DNA borders, is designed to provide resistance. Another approach to transforming plant cells with a gene involves propelling inert or biologically active particles at plant tissues and cells. This technique is disclosed in Sanford et al. (1990; 1991; 1992). Generally, this procedure involves propelling inert or biologically active particles at the cells under conditions effective to penetrate the outer surface of the cell and afford incorporation within the interior thereof. When inert particles are utilized, the vector can be introduced into the cell by coating the particles with the vector containing the desired gene. Alternatively, the target cell can be surrounded by the vector so that the vector is carried into the cell by the wake of the particle. Biologically active particles (e.g., dried yeast cells, dried bacterium or a bacteriophage, each containing DNA sought to be introduced) can also be propelled into plant cell tissue.
Transformation of most monocotyledon species has now also become routine. Preferred techniques include direct gene transfer into protoplasts using PEG or electroporation techniques, and particle bombardment into callus tissue. Transformations can be undertaken with a single DNA species or multiple DNA species (i.e. co-transformation) and both these techniques are suitable for use with this invention. Co-transformation may have the advantage of avoiding complete vector construction and of generating transgenic plants with unlinked loci for the gene of interest and the selectable marker, enabling the removal of the selectable marker in subsequent generations, should this be regarded desirable. However, a disadvantage of the use of co-transformation is the less than 100% frequency with which separate DNA species are integrated into the genome (Schocher et al., 1986).
Several U.S. Patents describe techniques for the preparation of callus and protoplasts from an elite inbred line of maize, transformation of protoplasts using PEG or electroporation, and the regeneration of maize plants from transformed protoplasts (Tomes et al., 1999; Dudits et al., 2001; Koziel et al., 2002). Gordon-Kamm et al. (1990) and Fromm et al. (1990) have published techniques for transformation of A188-derived maize lines using particle bombardment. Furthermore, Koziel et al. (1993, 2002) describe techniques for the transformation of elite inbred lines of maize by particle bombardment. This technique utilizes
immature maize embryos of 1.5-2.5 mm length excised from a maize ear 14-15 days after pollination and a PDS-1000He Biolistics device for bombardment.
Transformation of rice can also be undertaken by direct gene transfer techniques utilizing protoplasts or particle bombardment. Protoplast-mediated transformation has been described for Japonica-types and Indica-types (Zhang et al., 1988; Shimamoto et al, 1989; Datta et al., 1990). Both types are also routinely transformable using particle bombardment (Christou et al., 1991). Furthermore, Gobel and Nakakido (1993) describe techniques for the transformation of rice via electroporation.
Horn et al. (1989) describe techniques for the generation, transformation and regeneration of Pooideae protoplasts. These techniques allow the transformation of Dactylis and wheat. Furthermore, wheat transformation has been described by Vasil et al. (1992) using particle bombardment into cells of type C long-term regenerable callus, and also by Vasil et al. (1993) and Weeks et al. (1993) using particle bombardment of immature embryos and immature embryo-derived callus. A preferred technique for wheat transformation, however, involves the transformation of wheat by particle bombardment of immature embryos and includes either a high sucrose or a high maltose step prior to gene delivery. Prior to bombardment, 0.75-1.0 millimeter embryos are plated onto MS medium with 3% sucrose (Murashige and Skoog, 1962) and 3 mg/L 2,4-D for induction of somatic embryos, which proceeds in the dark. On the chosen day of bombardment, embryos are removed from the induction medium and placed onto the osmoticum (induction medium with sucrose or maltose added at the desired concentration, typically 15%). Embryos plasmolyze for 2-3 hours, then they are bombarded. Although not critical, each target plate usually contains twenty embryos.
An appropriate gene-carrying plasmid (such as pCIB3064 or pSG35) is precipitated onto micrometer size gold particles using standard procedures. Each plate of embryos is shot with the DuPont Biolistics® helium device using a burst pressure of ~1000 psi using a standard 80 mesh screen. After bombardment, the embryos (still on osmoticum) are placed back into the dark to recover for about 24 hours. Then embryos are removed from the osmoticum and placed back onto induction medium where they stay for about a month before regeneration. Embryo explants with developing embryogenic callus are then transferred to regeneration medium (MS + 1 mg/L NAA, 5 mg/L GA), and further containing the appropriate selection agent (10 mg/L basta in the case of pCIB3064 and 2 mg/L methotrexate in the case of pSOG35). After approximately one month, developed shoots are transferred to
larger sterile containers known as "GA7s" which contain half-strength MS, 2% sucrose, and the same concentration of selection agent.
Transformation of monocotyledons using Agrobacterium has also been described (See, Hiei and Komari, 1994; 1997; and Negrotto et al., 2000) incorporated herein by reference.
The plasmid, pNOV3240, was introduced in Agrobacterium tumefaciens using electroporation. Transformed Agrobacterium cells were used to transfer the Rabl7-T6PP- RNAi expression cassette into the maize (A188xHiII) genome. The T-DNA enables positive identification of transformants via regeneration on media containing mannose. Sixty-three events were generated. Of these, Taqman analysis identified 15 events with a single copy of the transgene and no beyond border sequence. When possible, TO plants were self-pollinated; otherwise they were pollinated with JHAF031.
Example 7: Greenhouse Growth Conditions Corn seed is sown into 2.5 SVD pots (Classic 600, ~ 2 gallon nursery containers) in
Universal mix (Sungrow Horticulture, Pine Bluff, AR). Universal mix is 45% Peat moss, 45% bark , 5% perlite, 5% vermiculite. Environmental conditions for greenhouse maize cultivation is typically 16 hour days (average light intensity 600 μmol m'V2), day time temperature of 80-860F, night time temperature 70-760F and relative humidity greater than 50%. Plants are placed on 2" platforms to avoid contact with the greenhouse floor. Plants are hand watered until daily irrigation is required, then they are placed on irrigation drip. The irrigation schedule is 4 minutes every other day. Plants were routinely treated with insecticides to control pests.
Example 8: Evaluation of Transgenic Maize Expressing Rabl7-T6PP-RNAi in the
Greenhouse
The greenhouse evaluation is a controlled water-stress experiment that quantifies ovule viability in water-stressed and unstressed plants. Data from unstressed plants represent the genotype's potential to set seed under ideal conditions. Data from water-stressed plants quantify kernel abortion that results from drought at the time of flowering. The results of these experiments can be predictive of field performance. We used this tool to select transgenic events for field evaluations.
Seed from selfed plants were sown as above. Taqman analysis was used to divide the progeny hemizygous (containing Rabl7-T6PP-RNAi) and azygous (lost the Rabl7-T6PP- RNAi) groups. Seedlings were transferred to 600 pots, above, and maintained using standard greenhouse procedures until they reached the V6 growth stage (Ritchie et al., 1997). All plants were treated with the systemic pesticide, Marathon, to reduce susceptibility to pests. Water stress was gradually imposed, using salt as the osmoticum (Nuccio et al. 1998). The salt consisted of sodium chloride/calcium chloride at a 10:1 molar ratio, delivered in 0.5X Hoagland's Solution, to prevent sodium-induced disruption of potassium uptake. Salt concentration in the irrigant was increased from 50 mM to 100 mM to 150 mM every three days to give plants time to adjust to the salt. Plants were maintained on 150 mM salt solution through the flowering period, typically two weeks, after which pots were thoroughly flushed with water and plants were returned to normal irrigation. This protocol typically reduced kernel set by 40-60%, compared to control plants that received no salt.
Each plant's ability to adjust to the imposed water stress was measured by sampling the first fully expanded leaf, at its mid-point, for solute potential. Three 3/4 inch circular leaf punches were collected and analyzed for leaf-sap solute potential using a dewpoint vapor pressure osmometer. Plants were sampled three days after the 150 mM salt treatment between 10:00-11:00 AM. The leaf sap solute potentials were compared to soil solute potentials to determine how well the plant adjusted to the water stress. Typically plants did not differ in their adjustment to the imposed water stress.
Typically 15-20 seed per transgenic event were sown to give 7-10 individual azygotes and 7-10 individual hemizygotes. Plants were arranged in a complete, randomized block design consisting of three replicates per treatment. Developing ears were covered with pollination bags before silk emergence. Pollen shed and silk emergence dates were recorded and individual ears were hand pollinated 2-3 times with donor pollen on successive days. Pollination bags were removed after completing all pollinations. Ears were harvested 30 days after pollinations, and dried for 4 days to 15% moisture content. Ears were shelled and the kernels were counted and weighed.
Example 9: Greenhouse Experiment 1
Eight Rabl7-T6PP-RNAi events were studied for their ability to set seed under water stress. Twenty-four Tl seed from each event (a selfed TO parent) were germinated. Taqman analysis was used to establish zygosity in each seedling. Homozygotes were set aside for seed
bulking. Hemizygotes and azygotes were analyzed using the greenhouse water stress protocol, above (Example 8). In this experiment non-transformed Al 88 plants served as the benchmark. The kernel set data, summarized in Figure 12, show that each event is unique. The water stress protocol was somewhat severe in that the benchmark Al 88 plants suffered more than 70% reduction in kernel set. In general the presence of the transgene improves kernel set in water stressed plants, the average improvement across all transgenic events was 39%. hi particular, in Event 8 IAl OB, hemizygotes had more than double the kernel set of corresponding azygotes. Also, water-stressed hemizygotes from Event 78Al 8B set six times more kernels than azygotes. The data indicate the Rabl7-T6PP-RNAi expression cassette improves kernel set in maize.
Example 10: Greenhouse Experiment 2
Two Rabl7-T6PP-RNAi events, 78A18B(13) and 81AlOB(IO) were studied for their ability to set seed under water stress. Ninety-six T2 seed from each event (a selfed Tl parent) were germinated. Taqman analysis was used to establish zygosity in each seedling. Hemizygotes and azygotes were analyzed using the greenhouse water stress protocol, above (Example 8). In this experiment 81AlOB(IO) azygotes served as the benchmark. The water stress protocol was effective in that the benchmark 81AlOB(IO) azygotes suffered about a 45% reduction in kernel set. In general the presence of the transgene may reduce kernel set in well-watered plants. However, the transgene either has little effect on, or slightly improves kernel set in water-stressed plants.
Example 11: Evaluation of Transgenic Maize Expressing Rabl7-T6PP-RNAi in the Field
The field evaluations were conducted to test transgene performance under conditions typically used by growers. The general field criteria were four-row plots, 17.5 feet long separated by 2-3 foot alleys with about 40 plants per row. The outer rows were planted with azygotes and the inner rows were planted with segregating transgenics. The field was divided into a well-watered treatment block and a water-stressed treatment block, and drip irrigation was used to water the fields. Each block had a dedicated irrigation manifold. To maintain uniformity the most remote plot was less than 100 feet from the irrigation manifold. There were 3 plots per Event per treatment (a total of six per Event). Event plots were planted at a different distance from the irrigation manifold in a randomized complete block design. Well- watered and water-stress treatment blocks were separated by 16 rows (50 ft).
Tl homozygous seed from Event 78A18B and Event 81A10B were back-crossed twice with JHAF031, and the 1:1 segregating seed were planted in the summer of 2003 in Hawaii. The planting site has well drained sandy soil and typically gets less than 3" of rainfall during the summer. Taqman analysis of seedlings was performed to establish the presence of the transgene. In this way, azygotes and hemizygotes were randomly dispersed in each plot.
The well-watered block was irrigated optimally throughout the experiment. The water-stress block was watered optimally until plants reached approximately V6, at which time water was withheld. Plants were returned to optimal irrigation after 90% silk emergence. The amount of water applied to the field and rainfall were recorded. After plants transitioned to reproductive development, pollen shed and silk emergence dates were recorded for each plant. Plant response to water deficit was also recorded by monitoring appearance of physiological stress symptoms such as leaf greying and curling, and sampling leaf tissue to measure solute potential. Each plant's ability to adjust to the imposed water stress was measured by sampling the first fully expanded leaf, at its mid-point, for solute potential. Three 3/4 inch circular leaf punches were collected and analyzed for leaf-sap solute potential using a dewpoint vapor pressure osmometer. Plants in the water-stressed block were sampled during the period of maximum stress. Plants in the well-watered block were sampled a few days after the water-stressed block. Sampling took place between 8:00-10:00 AM. The leaf sap solute potentials for plants within each plot were compared to establish field uniformity.
Ears from each plant were harvested and shelled. Kernels were counted and weighed. The data from hemizygous individuals were compared to azygous individuals to gauge the transgene 's effect on kernel set. Results for the two Rabl7-T6PP-RNAi events are summarized in Figures 14 and 15. On average, the water-stress reduced kernel set in azygous A78A18B (Fig. 14) individuals by 47 %, whereas the hemizygous individuals suffered only a 30% yield reduction under the same conditions. Figure 15 shows the A81A10B hemizygous individuals suffered a slightly greater drought-induced yield reduction than the corresponding azygotes (30% vs. 25%, respectively). However, this yield reduction is significantly offset by the more than 10% yield enhancement afforded by the transgene. Results from this field experiment demonstrate the effectiveness of the Rabl7-T6PP-RNAi transgene in stabilizing kernel set in drought stressed maize.
Example 12: Application of the Rabl7-T6PP-RNAi to other plant species
The gene silencing activity of a double-stranded RNA is sequence specific. Studies in plant, insect, nematode, mammalian and other eukaryotic systems indicate that a homologous 21-23 base sequence is sufficient to cause gene silencing (Waterhouse and Helliwell, 2003; McManus and Sharp, 2002). The length requirement of 21 bases is a lower limit and there is evidence that mismatches can be tolerated (McManus and Sharp, 2002). With this in mind, it's clear that more effective RNA-mediated gene silencing is achieved with longer templates (Thomas et al, 2001). Furthermore gene regulatory sequence does function in a predictable way across species boundaries (See, for example, Nuccio and Thomas, 2000). The transgenic constructs of the present invention can be used to reduce expression of
T6PP in other plants species. Cross-species efficacy was established by querying public and proprietary cDNA databases to identify T6PP encoding sequences in other plant species. The "hits" were aligned and used to generate contigs as described in Fig. 2. T6PP homologues from sorghum, barley, wheat, sugar cane and rye were identified. The sequence fragments from each gene corresponding to the TόPP-RNAi fragment were compared by alignment (Fig. 16) and similarity (Fig. 17). For comparison ZmToPP-I amino acids 334-393, in Fig. 3, are encoded by nucleotides 1-180 of the ZmT6PP-l cDNA shown in Fig. 16.
The results demonstrate there the transgenic construct of the present invention will function to silence T6PP in other crop species. This shows the construct can be used to improve environmental stress tolerance in not only maize, but also other important cereal crops.
References
Aeschbacher, R. A., Miiller, J., Boiler, T., Wiemken, A. (1999). Purification of the trehalase GMTREl from Soybean nodules and cloning of its cDNA. GMTREl is expressed at a low level in multiple tissues. Plant Physiol. 119, 489-495.
Atkins, D., Young, M., Uzzell, S., Kelly, L., Fillatti, J., Gerlach, WX. (1995). The expression of antisense and ribozyme genes targeting citrus exocortis viroid in transgenic plants. J. Gen. Virol. 76, 1781-1790.
Atkins, D.G., Gerlach, W.L., Young, MJ. (2002). Ribozyme nucleic acids and methods of use thereof for controlling viral pathogens. U.S. Patent 6,451,603. Filed March 2, 1995, issued Sept. 17, 2002. Bartley, G.E., Viitanen, P.V., Bacot, K.O., Scolnik, P.A. (1992). A tomato gene expressed during fruit ripening encodes an enzymes of the carotenoid biosynthesis pathway. J. Biol. Chem. 267, 5036-5039.
Batzer, M.A., Carlton, J.E., Deininger, P.L. (1991). Enhanced evolutionary PCR using oligonucleotides with inosine at the 3'-terminus. Nucl. Acids Res. 19, 5081.
Bevan, M.W., Flavell, R.B., Chilton, M.-D. (1983) A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. Nature. 304,184-187. Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucl. Acids Res. 12, 8711-8721.
Bird, C.R., Ray, J.A., Fletcher, J.D., Boniwell, J.M., Bird, A.M., Teulieres, C, Blain, L, Bramley, P.M. (1991). Using antisense RNA to study gene function: inhibition of carotenoid biosynthesis in transgenic tomatoes. Bio/Technol. 9, 635-639.
Blazquez, M.A., Santos, E., Flores, C-L., Martinez-Zapater, J.M., Salinas, J., Gancedo, C. (1998). Isolation and molecular characterization of the Arabidopsis TPSl gene, encoding trehalose-6-phosphate synthase. Plant J. 13, 685-689.
Blochlinger, K., Diggelmann, H. (1984). Hygromycin B phosphotransferase as a selectable marker for DNA transfer experiments with higher eucaryotic cells, MoI. Cell. Biol. 4, 2929- 2931. Bojsen, K., Donaldson, L, Haldrup, A., Joersboe, M., Kreiberg, J.D., Nielsen, J., Okkels, F.T., Petersen, S. G. (1998). Mannose or xylose based positive selection. U.S. Pat. No. 5,767,378.
Bourouis, M., Bruno, J. (1983). Vectors containing a prokaryotic dihydrofolate reductase gene transform Drosophila cells to methotrexate-resistance. EMBO J. 2, 1099-1104.
Brands, A., Ho, T.H.D. (2002). Function of a plant stress-induced gene, HVA22. Synthetic enhancement screen with its yeast homolog reveals its role in vesicular traffic. Plant Physiol. 130, 1121-1131.
Brusslan, J.A., Karlin-Neumann, G.A., Huang, L., Tobin, E.M. (1993). An Arabidopsis mutant with a reduced level of cab 140 RNA is a result of cosuppression. Plant Cell. 5, 667- 677.
Caddick, M.X., Greenland, AJ., Riddell, K.V., Schuch, W.W., Tomsett, A.B. (2003). DNA constructs and plants incorporating them. U.S. Pat. No. 6,605,754.
Carthew, R. W. (2001). Gene silencing by double-stranded RNA. Current Opin. Cell Biol. 13, 244-248.
Christou, P., Ford, T.L., Kofron, M. (1991). Production of transgenic rice (Oryza sativa L.) plants from agronomically important Indica and Japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos. Bio/Technol. 9, 957-962.
Chua, N.-H., Aoyama, T. (2000). Chemical inducible promoter used to obtain transgenic plants with a silent marker. U.S. Pat. No. 6,063,985. Datta, S.K., Peterhans, A., Datta, K., Potrykus, I. Genetically engineered fertile Indica rice recovered from protoplasts. Bio/Technol. 8, 736-740.
De-Feyter, R., Young, M., Schroeder, K., Dennis, E.S., Gerlach, W. (1996). A ribozyme gene and an antisense gene are equally effective in conferring resistance to tobacco mosaic virus on transgenic tobacco. MoI. Gen. Genet. 250, 329-338.
Dudits, D., Morocz, S., Nemeth, J., Donn, G. (2001). Zea mays (L.) with capability of long term, highly efficient plant regeneration including fertile transgenic maize plants having a heterologous gene, and their preparation. U.S. Pat. No. 6,284,945.
Eastmond, PJ., van Dijken, A.J.H., Spielman, M., Kerr, A., Tissier, A.F., Dickinson, H.G., Jones, J.D.G., Smeekens, S. C, Graham, LA. (2002). Trehalose-6-phosphate synthase 1, which catalyses the first step in trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J. 29, 225-235.
Eastmond, PJ., Graham, LA. (2003). Trehalose metabolism: a regulatory role for trehalose-6- phosphate synthase? Current Opin. Plant Biol. 6, 231-235.
Eastmond, PJ., Li, Y., Graham, LA. (2003). Is trehalose-6-phosphate a regulator of sugar metabolism in plants? J. Exp. Botany. 54, 533-537.
Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., Tuschl, T. (2001). Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 411, 494-498.
Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, CC. (1998). Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811.
Frank-Kamenetskii, M.D., Mirkin, S.M. (1995). Triplex DNA structures. Ann. Rev. Biochem. 64, 65-95.
Fromm, M.E., Moπish, F., Armstrong, C, Williams, R., Thomas, J., Klein, T.M. (1990). Inheritance and expression of chimeric genes in the progeny of transgenic maize plants. Bio/Technol. 8, 833-839.
Garg, A.K., Kim, J.-K., Owens, T.G., Ranwala, A.P., Choi, Y.D., Kochian, L.V., and Wu, RJ. (2002). Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc. Natl. Acad. Sci. USA. 99, 15898-15903.
Gobel, E., Nakakido, F. (1993). Transformation of monocot cells. WO 93/21335.
Goddijn, O.J.M., Verwoerd, T.C., Voogd, E., Krutwagen, R.W.H.H., de Graaf, P.T.H.M., Poels, J., van Dun, K., Ponstein, A.S., Damm, B., Pen, J. (1997). Inhibition of trehalase activity enhances trehalose accumulation in transgenic plants. Plant Physiol. 113, 181-190.
Goddijn, O J.M., Pen, J., Smeekens, J.C.M., Smits, M.T. (2003). Regulating metabolism by modifying the level of trehalose-6-phosphate by inhibiting endogenous trehalase levels. U.S. Pat. Application 20030177531.
Goddijn, O. J.M., Pen, J., Smeekens, J.C.M., (2004). Regulating metabolism by modifying the level of trehalose-6-phosρhate. U.S. Pat. Application 20040093641. Gordon-Kamm, W. J., Spencer, T. M., Mangano, M. L., Adams, T. R., Daines, R. J., Start, W. G., O'Brien, J. V., Chambers, S. A, Adams, W. R. Jr, Willetts, N. G., Rice, T. B., Mackey, C. J., Krueger, R. W., Kausch, A. P., Lemaux, P. G. (1990). Transformation of Maize Cells and Regeneration of Fertile Transgenic Plants. Plant Cell. 2, 603-618. Goto, F., Yashihara, T., Shigemoto, N., Toki, S., Takaiwa, F. (1999). Iron fortification of rice seed by the soybean ferritin gene. Nat. Biotechnol. 17, 282-286.
Gray, J., Pictra, S., Shabber, J., Schuch, W., Grierson, D. (1992). Molecular biology of fruit ripening and its manipulation with antisense genes. Plant MoI. Biol. 19, 69-87.
Grierson, D., Fray, R.G., Hamilton, AJ., Smith, C.J.S., Watson, C.F., (1991) Does co- suppression of sense genes in transgenic plants involve antisense RNA? Trends Biotech. 9, 122-123. Grishok, A., Pasquinelli, A.E., Conte, D., Li, N., Parrish, S., Ha, I., Baillie, D.L., Fire, A., Ruvkun, G., Mello, CM. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell. 106, 23-34. Hiei, Y., Komari, T. (1994). Method for transforming monocotyledons. WO 94/00977.
Hiei, Y., Komari, T. (1997). Method for transforming monocotyledons. U.S. Pat. No. 5,591,616.
Hoekema, A., Pen, J., Does, M.P., Van Den Elzen, P.J.M. (1999). Production of trehalose in plants. U.S. Pat. No. 5,925,804.
Hδfgen, R., Willmitzer, L. (1988). Storage of competent cells for Agrobacterium transformation. Nucl. Acids Res. 16, 9877.
Holmstrom, K.-O., Mantyla, E., Welin, B., Mandal, A., Palva, T.E., Tunnela, O.E., Londesborough, J. (1996). Drought tolerance in tobacco. Nature. 379, 683-684. Horn, M.E., Harms, C.T., Shillito, R.D. (1989). Regeneration von Grarnineen-Pflanzen aus der Unterfamilie Pooideae ausgehenc von Protoplasten. EP 0 332 581. Filed Mar. 8, 1988, issued Mar. 2, 1989.
Hutvagner, G., Zamore, P.D. (2002). RNAi: nature abhors a double-strand. Curr. Opin. Genet. Dev. 12, 225-232.
Ishitani, M., Xiong, L., Lee, H., Stevenson, B., Zhu, J.K. (1998). HOSl, a genetic locus involved in cold-responsive gene expression in Arabidopsis. Plant Cell. 10, 1151-1161. Jaglo-Ottosen, K.R., Gilmour, SJ., Zarka, D.G., Schabenberger, O., Thomashow, M.F. (1998). Arabidopsis CBFl overexpression induces COR genes and enhances freezing tolerance. Science. 280, 104-106.
Jang, L-C, Oh, S.-L, Seo, J.-S., Choi, W.-B., Song, S.I., Kim, C.H., Kim, Y.S., Seo, H.-S., Choi, Y.D., Nahm, B.H., and Kim, L-K. (2003). Expression of a bifunctional fusion of the Escherichia coli genes for trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in transgenic rice plants increases trehalose accumulation and abiotic stress tolerance without stunting growth. Plant Physiol. 131 516-524. Jones, J.D.G., Shlumukov, L., Carland, F., English, J., Scofield, S.R., Bishop, G.J., Harrison, K. (1992). Effective vectors for transformation, expression of heterologous genes, and assaying transposon excision in transgenic plants. Transgenic Res. 1, 285-297.
Jorgensen, R.A., Cluster, P.D., English, J., Que, Q., Napoli, CA. (1996). Chalconse synthase cosuppression phenotypes in petunia flowers: comparison of sense vs. antisense constructs and single-copy vs. complex T-DNA sequences. Plant MoI. Biol. 31, 957-973.
Kaasen, L, Falkenberg, P., Styrvold, O.B., Strom, A.R. (1992). Molecular cloning and physical mapping of the ostBA genes, which encode the osmoregulatory pathway of Escherichia coli: evidence that transcription is activated by KatF (AppR). J. Bacteriol. 174, 889-898.
Kay, R., Chan, A., Daly, M., McPherson, J. (1987). Duplication of CaMV 35S Promoter sequences creates a strong enhancer for plant genes. Science. 236, 1299-1302.
Kiesselbach, T. A. (1999). The Structure and Reproduction of Corn, 50th Anniversary Edition. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York. Pgs. 51-63.
Kim, K.N., Cheong, Y.H., Grant, J.J., Pandey, G.K., Luan, S. (2003). CIPK3, a calcium sensor-associated protein kinase that regulates abscisic acid and cold signal transduction in Arabidopsis. Plant Cell. 15, 411-423. Klein, T.M., Wolf, E.D., Wu, R., Sanford, J.C.. (1987). High-velocity microprojectiles for delivering nucleic acids into living cells. Nature. 327, 70-73.
Knutzon, D.S., Thompson, G.A., Radke, S.E., Johnson, W.B., Knauf, V.C., Kridle, J.C. (1992). Modification of Brassica seed oil by antisense expression of a stearoyl-acyl carrier protein desaturase gene. Proc. Natl. Acad. Sci. USA. 89, 2624-2628.
Koziel, M.G., Beland, G.L., Bowman, C, Carozzi, N.B., Crenshaw, R., Crossland, L., Dawson, J., Desai, N., Hill, M., Kadwell, S. (1993). Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Bio/Technol. 11, 194-200.
Koziel, M.G. et al. (2002). Method of producing transgenic maize using direct transformation of commercially important genotypes. U.S. Pat. No. 6,403,865. Kridl, J.C, Knauf, V.C. (1995). Seed-specific transcriptional regulation. U.S. Pat. No. 5,420,034.
Kuehn, C, Hajirezaei, M.R., Fernie, A.R., Roessner-Tunali, U., Czechowski, T., Hirner, B., Frommer, W.B. (2003). The sucrose transporter StSUTl localizes to sieve elements in potato tuber phloem and influences tuber physiology and development. Plant Physiol. 131, 102-113.
KuIl, B., Salamini, F., Rohde, W. (1995). Genetic engineering of potato starch composition: inhibition of amylose biosynthesis in tubers from transgenic potato lines by the expression of antisense sequences of the gene for granule-bound starch synthase. J. Genet. Breed. 49, 67- 76.
Laporte, M.M., Galagan, J.A., Prasch, A.L., Vanderveer, P.J., Hanson, D.T., Shewmaker, C.K., Sharkey, T.D. (2001). Promoter strength and tissue specificity effects on growth of tomato plants transformed with maize sucrose-phosphate synthase. Planta. 212, 817-822.
Lebel, E.G., Heifetz, P.B., Goff, S.A. (2004). Expression of trehalose-6-phosphate synthase in plant plastids. U.S. Pat. No. 6,686,516.
Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z., Sontheimer, E.J., Carthew, R.W. (2004). Distinct Roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell. 117, 69-81.
Lessard, P.A., Kulaveerasingam, H., York, G.M., Strong, A., Sinskey, AJ. (2002). Manipulating gene expression for the metabolic engineering of plants. Metab. Eng. 4, 67-79.
Leyman, B., Van Dijck, P., Thevelein, J.M. (2001). An unexpected plethora of trehalose biosynthesis genes in Arabidopsis thaliana. Trends Plant Sci. 6, 510-513.
Ligon, J.M., Hill, D.S., Ryals, J.A., Lam, S.T., Hammer, P.E. (1997). Genes for the synthesis of antipathogenic substances. U.S. Pat. No. 5,639,949.
Liu, Q., Kasuga, M., Sakuma, Y., Abe, H., Miura, S., Yamaguchi-Shinozaki, K., Shinozaki, K. (1998). Two transcription factors, DREBl and DREB2, with an EREBP/AP2 DNA binding domain separated two cellular signal transduction pathways in drought- and low- temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell 10, 1391- 1406. Londesborough, J., Tunnela, O., Holmstrom, K.-O., Mantyla, E., Welin, B., Mandal, A., Palva, T.E. (2000). Transgenic plants producing trehalose. U. S. Pat. No. 6,130,368.
Matzke, M.A., Aufsatz, W., Kanno, T., Mette, M.F., Matzke, AJ. (2002). Homology- dependent gene silencing and host defense in plants. Adv. Genet. 46, 235-275.
McManus, M.T., Sharp, P.A. (2002). Gene silencing in mammals by small interfering RNAs. Nature Rev. Genet. 3, 737-747.
Mehta, R.A., Cassol, T., Li, N., AIi, N., Handa, A.K., Mattoo, A.K. (2002). Engineered polyamine accumulation in tomato enhances phytonutrient content, juice quality, and vine life. Nat. Biotechnol. 20, 613-618.
Miles, J.S., Guest, J.R. (1984). Nucleotide sequence and transcriptional start point of the phosphomannose isomerase gene (manA) of Escherichia coli. Gene. 32, 625-631.
Moreno-Fonseca, L.P., Covarrubias, A.A. (2001). Downstream DNA sequences are required to modulate Pvlea-18 gene expression in response to dehydration. Plant MoI. Biol. 45, 501- 515. Mϋller, J., Aeschbacher, R.A., Wingler, A., Boiler, T. and Wiemken, A. (2001). Trehalose and trehalase in Arabidopsis. Plant Physiol. 125, 1086-1093.
Murashige, T. & Skoog, F. (1962). A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiologia Plantarum. 15, 473-497.
Napoli, C, Lemieux, C, Jorgensen, R., (1990). Introduction of a chimeric chalcone synthase gene into petunia results in reversible co-suppression of homologous genes in trans. Plant Cell. 2, 279-289. Negrotto, D., Jolley, M., Beer, S., Wenck, A.R., Hansen, G. (2000). The use of phosphomannose-isomerase as a selectable marker to recover transgenic maize plants (Zea mays L.) via Agrobacterium transformation. Plant Cell Rep. 19, 798-803.
No, E.G., Zhou, Y., Loopstra, CA. (2000). Sequences upstream and downstream of two xylem-specific pine genes influence their expression. Plant Sci. 160, 77-86.
Nuccio, MX., Russell, B.L., Nolte, K.D., Rathinasabapathi, B., Gage, D.A., Hanson, D.A. (1998). The endogenous choline supply limits glycine betaine synthesis in transgenic tobacco expressing choline monooxygenase. Plant J. 16, 487-496.
Nuccio. M.L., Thomas, T.L. (2000). Seed specific promoters based on Arabidopsis genes. U.S. Pat. No. 6,100,450. Nylander, M., Svensson, J., Palva, E.T., Welin, B.V. (2001). Stress-induced accumulation and tissue-specific localization of dehydrins in Arabidopsis thaliana. Plant MoI. Biol. 45, 263-279.
Odell, J.T., Nagy, F., Chua, N.-H. (1985). Identification of DNA sequences required for the activity of the cauliflower mosaic virus 35S promoter. Nature. 313, 810-812.
Pang, P.P., Pruitt, R.E., Meyerowitz, E.M. (1988). Molecular cloning, genomic organization, expression and evolution of 12S seed storage protein genes of Arabidopsis thaliana. Plant MoI. Biol. 11, 805-820.
Paszkowski, J., Shillito, D., Saul, M., Mandak, V., Hohn, T., Hohn, B., Potrykus, I. (1984). Direct gene transfer to plants. EMBO J. 3, 2717-2722.
Pilon-Smits, E.A.H., Terry, N., Sears, T., Kim, H., Zayed, A., Hwang, S.B., van Dun, K., Voogd, E., Verwoerd, T.C., Krutwagen, R.W.H.H., Goddijn, OJ.M. (1998). Trehalose- producing transgenic tobacco plants show improved growth performance under drought stress. J. Plant Physiol. 152, 525-532.
Potrykus, L, Paszkowski, J., Saul, M.W., Petruska, J., Shillito, R.D. (1985). Molecular and general genetics of a hybrid foreign gene introduced into tobacco by direct gene transfer. MoI. Gen. Genet. 199, 169-177.
Ranocha, P., McNeil, S.D., Ziemak, MJ., Li, C, Tarczynski, M.C., and Hanson, A.D. (2001). The S-methylmethionine cycle in angiosperms: ubiquity, antiquity and activity. Plant J. 25, 575-584.
Reich, TJ., Iyer, V.N., Miki, B.L. (1986). Efficient transformation of alfalfa protoplasts by the intranuclear microinjection of Ti plasmids. Bio/Technol. 4, 1001-1004. Reinhart, BJ., Weinstein, E.J., Rhoades, M.W., Bartel, B., Bartel, D.P. (2002). MicroRNAs in plants. Genes Dev. 16, 1616-1626.
Ritchie, S.W., Hanway, J.J., Benson, G.O. (1997). How a Corn Plant Develops. Special Report No. 48. Iowa State University of Science and Technology Cooperative Extension Service. Ames, Iowa.
Romero, C, Belles, J.M., Vaya, J.L., Serrano, R., Culianez-Macia, F.A. (1997). Expression of the yeast trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleotropic phenotypes include drought tolerance. Planta. 201, 293-297.
Rontein, D., Dieuaide-Noubhani, M., Dufourc, EJ., Raymond, P., Rolin, D. (2002b). The metabolic architecture of plant cells. Stability of central metabolism and flexibility of anabolic pathways during the growth cycle of tomato cells. J. Biol. Chem. 277, 42948-43960.
Rothstein, S.J., DiMaio, J., Strand, M., Rice, D. (1987). Stable and heritable inhibition of the expression of nopaline synthase in tobacco expressing antisense RNA. Proc. Natl. Acad. Sci. USA. 84, 8439-8443. Sanford, J.C., Wolf, E.D., Allen, N.K. (1990). Method for transporting substances into living cells and tissues and apparatus therefor. U.S. Pat. No. 4,945,050.
Sanford, J.C., Wolf, E.D., Allen, N.K. (1991). Method for transporting substances into living cells and tissues and apparatus therefor. U.S. Pat. No. 5,036,006.
Sanford, J.C., Wolf, E.D., Allen, N.K. (1992). Method for transporting substances into living cells and tissues. U.S. Pat. No. 5,100,792.
Schocher, RJ., Shillito, R.D., Saul, M.W., Paszkowski, J., Potrykus, I. (1986). Co- transformation of unlinked foreign genes into plants by direct gene transfer. Bio/technol. 4, 1093-1096.
Seymour, J.F., Kurzrock, R., Freireich, E. J., Estey, E.H. (1993). Down-regulation of two nonhomologous endogenous tomato genes with a single chimaeric sense gene construct. Plant MoI. Biol. 23, 1-9.
Shah, D.M., Rogers, S.G., Horsch, R.B., Fraley, R.T. (1990). Glyphosate-resistant plants. U.S. Pat. No. 4,940,835. Shah, D.M., Rogers, S.G., Horsch, R.B., Fraley, R.T. (1993). Glyphosate-resistant plants. U.S. Pat. No. 5,188,642.
Shen, W., Gomez-Cadenas, A., Routly, EX., Ho, T.H.D., Simmonds, J.A., Gulick, PJ.
(2001). The salt stress-inducible protein kinase gene, Esi47, from the salt-tolerant wheatgrass Lophopyrum elongatum is involved in plant hormone signaling. Plant Physiol. 125, 1429-
1441.
Shewmaker, C.K., Kridl, J.C., Hiatt, W.R., Knauf, V. (1992). Anti-sense regulation of gene expression in plant cells. U.S. Pat. No. 5,107,065.
Shimada, H., Tada, Y., Kawasaki, T., Fujimura, T. (1993). Antisense regulation of the rice waxy gene expression using a PCR amplified fragment of the rice genome reduces the amylose content in grain starch. Theor. Appl. Genet. 86, 665-672. Shimamoto, K., Terada, R., Izawa, T., Fujimoto, H. (1989). Fertile transgenic rice plants regenerated from transformed protoplasts. Nature. 338, 274-277.-
Slabas, A.R., Elborough, K.M. (1998). Plant gene encoding acetyl coenzyme a carboxylase biotin carboxyl carrier protein. U.S. Pat. No. 6,150,586.
Smith, C.J.S., Watson, C.F., Ray, J., Bird, C.R., Morris, P.C., Schuch, W., Grierson, D. (1988). Antisense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature. 334, 724-726.
Sukhapinda, K., Hasler, J.M., Petell, J.K., Strickland, J.A., Folkerts, O. (2004). Antibody- mediated down-regulation of plant proteins. U.S. Pat. No. 6,767,742.
Thomas, C.L., Jones, L., Baulcombe, D.C., Maule, AJ. (2001). Size constraints for targeting post-transcriptional gene silencing and for RNA-directed methylation in Nicotiana benthamiana using a potato virus X vector. Plant J. 25, 417-425.
Tijsterman, M., Ketting, R.F., Plasterk, R.H.A. (2002). The genetics of RNA silencing. Ann. Rev. Genet. 36, 489-519.
Tomes, D.T., Weissinger, A., Sanford, J.C., Klein, T.M. (1999). Stable transformation of plant cells. U.S. Pat. No. 5,990,387.
Ueda, T., Piscataway, NJ., Waverczak, W., Ward, K., Sher, N., Ketudat, M., Schmidt, RJ., Messing, J. (1992). Mutations of the 22- and 27-kD zein promoters affect transactivation by the opaque-2 protein. Plant Cell 4, 701-709.
Uknes, S., Dincher, S., Friedrich, L., Negrotto, D., Williams, S., Thompson-Taylor, H., Potter, S., Ward, E., Ryals, J. (1993). Regulation of pathogenesis-related protein-la gene expression in tobacco. Plant Cell. 5, 159-169. van der Krol, A.R., Lenting, P.E., Veenstra, J., van der Meer, I.M., Koes, R.E., Gerats, A.G.M., MoI, J.N.M., Suitje, A.R. (1988). An anti-sense chalcone synthase gene in transgenic plants inhibits flower pigmentation. Nature. 333, 866-869.
Vasil, V., Castillo, A.M., Fromm, M.E., Vasil, LK. (1992). Herbicide resistant fertile transgenic wheat plants obtained by microprojectile bombardment of regenerable embryogenic callus. Bio/Technol. 10, 662-674. Vasil,V., Srivastava,V., Castillo, A.M., Fromm, M.E., Vasil, LK. (1993). Rapid production of transgenic wheat plants by direct bombardment of cultured immature embryos. Bio/Technol. 11, 1553-1558.
Vaucheret, H., Palauqui, J.-G., Elmayan, T., Moffatt, B. (1995). Molecular and genetic analysis of nitrite reductase co-suppression in transgenic tobacco plants. MoI. Gen. Genet. 248, 311-317.
Veluthambi, K., Mahadevan, S., Maheshwari, R. (1981). Trehalose toxicity in Cuscuta reflexa. Plant Physiol. 68, 1369-1374.
Vieira, J., Messing, J. (1982). The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19, 259-268.
Vilardell, J., Goday, A., Freire, M.A., Torrent, M., Martinez, M.C., Torne, J.M. and Pages, M. (1990). Gene sequence, developmental expression, and protein phosphorylation of RAB- 17 in maize. Plant MoI. Biol. 14, 423-432.
Vilardell, J., Mundy, J., Stilling, B., Leroux, B., PIa, M., Freyssinet, G., Pages, M. (1991). Regulation of the maize rabl7gene promoter in transgenic heterologous systems. Plant MoI. Biol. 17, 985-993. Vogel, G., Aeschbacher, R. A., Mϋller, J., Boiler, T. and Wiemken, A. (1998). Trehalose-6- phosphate phosphatases from Arabidopsis thaliana: identification by functional complementation of the yeast tps2 mutant. Plant J. 13, 673-683.
Vogel, G., Feihn, O., Jean-Richard-dit-Bressel, L., Boiler, T., Wiemken, A., Aeschbacher, R.A., Wingler, A. (2001). Trehalose metabolism in Arabidopsis: occurrence of trehalose and molecular cloning and characterization of trehalose-6-phosphate synthase homologues. J. Exp. Botany. 52, 1817-1826.
Wang, J.T., Gould, J.H., Padmanabhan, V., Newton, RJ. (2002). Analysis and localization of the water-deficit stress-induced gene (Ip3). J. Plant Growth Reg. 21, 469-478.
Waterhouse, P.M., Wang, M.-B. (2002). Methods for obtaining modified phenotypes in plants. U.S. Pat. No. 6,423,885. Waterhouse, P.M. and Helliwell, CA. (2003). Exploring plant genomes by RNA-induced gene silencing. Nature Rev. Genet. 4, 29-38.
Weeks et al. (1993). Rapid Production of Multiple Independent Lines of Fertile Transgenic Wheat (Triticum aestivum). Plant Physiol. 102, 1077-1084.
Weimken, A. (1990). Trehalose in yeast, stress protectant rather than reserve carbohydrate. Ant. Van Leeuwenhoek J. Gen. Microbiol. 58, 209-217.
Wingler, A. (2002). The function of trehalose biosynthesis in plants. Phytochem. 60, 437- 440.
Yamaguchi-Shinozaki, K., Shinozaki, K. (1993a). The plant hormone abscisic acid mediates the drought-induced expression but not the seed-specific expression of rd22, a gene responsive to dehydration stress in Arabidopsis thaliana. MoI. Gen. Genet. 238, 17-25.
Yamaguchi-Shinozaki, K., Shinozaki, K. (1993b). Arabidopsis DNA encoding two desiccation-responsive rd29 genes. Plant Physiol. 101, 1119-1120.
Yin, Z., Zhao, Y., Luo, D., Zhang, H. (2002). Isolating the promoter of a stress-induced gene encoding betaine aldehyde dehydrogenase from the halophyte Atriplex centralasiatica Iljin. Biochim. Biophys. Acta. 1577, 452-456.
Yoshiba, Y., (1995). Correlation between the induction of a gene for DELTA-I -pyrroline-5- carboxylate synthetase and the accumulation of proline in Arabidopsis thaliana under osmotic stress. Plant J. 7, 751-760.
Zhang, H.M., Yang, H., Rech, E.L., Golds, TJ., Davis, A.S., Mulligan, BJ., Cocking, E.G., Davey, M.R. (1988). Transgenic rice plants produced by electroporation-mediated plasmid uptake into protoplasts. Plant Cell Rep. 7, 379-384.
Zhang, C.S., Lu, Q., Verma, D.P.S. (1997). Characterization of DELTA-l-pyrroline-5- carboxylate synthetase gene promoter in transgenic Arabidopsis thaliana subjected to water stress. Plant Sci. 129, 81-89.
Zinselmeier, C, Westgate, M.E., Schussler, J.R., Jones, RJ. (1995a). Low water potential disrupts carbohydrate metabolism in maize (Zea mays L.) ovaries. Plant Physiol. 107, 385- 391. Zinselmeier, C, Lauer, M.J., Boyer, J.S. (1995b). Reversing drought-induced losses in grain yield: sucrose maintains embryo growth in maize. Crop Sci. 35, 1390-1400.
Zinselmeier, C3 Byeong-Ryong, J., Boyer, J.S. (1995b). Starch and the control of kernel number in maize at low water potentials. Plant Physiol. 121, 25-25.
Claims
1) An isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is stress inducible in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene.
Z) The DNA molecule according to claim 1, wherein said polynucleotide is depicted by
SEQ ID. NO 6. 3) The DNA molecule according to claim 1, wherein said polynucleotide comprises at least about 21 consecutive base pairs of SEQ ID NO. 6. 4) The DNA molecule according to claim 1, wherein said polynucleotide is placed in a sense orientation relative to said promoter.
5) The DNA molecule according to claim 1, wherein said polynucleotide is placed in an antisense orientation relative to said promoter.
6) The DNA molecule according to claim 3, wherein said polynucleotide is a complement to said 21 consecutive base pairs.
7) The DNA molecule according to claim 3, wherein said polynucleotide is placed in a sense orientation relative to said promoter.
8) The DNA molecule according to claim 3, wherein said polynucleotide is placed in an antisense orientation relative to said promoter. 9) The DNA molecule according to claim 1, wherein said promoter is derived from the
5' region of a Rabl7 gene and exhibits promoter activity in plants. 10) The DNA molecule according to claim 1, wherein said DNA molecule further comprises a 3' region derived from a Rabl7 gene and exhibits terminator activity in plants. 11) The DNA molecule according to claim 1 , wherein said promoter comprises about 100-1649 contiguous nucleotides of DNA, wherein said contiguous nucleotides of DNA have from 85% to 100% identity to about 100 to 1649 contiguous nucleotides of DNA having the sequence of SEQ ID NO. 42.
12) The DNA molecule according to claim 1, wherein said nucleic acid is capable of forming into a double stranded RNA.
13) The polynucleotide according to claim 1, wherein said nucleic acid comprises co- suppressor RNA.
14) The DNA molecule according to claim 1, wherein said nucleic acid comprises catalytic RNA.
15) The DNA molecule according to claim 1, wherein said nucleic acid is capable of forming into a triplex nucleic acid.
16) The DNA molecule according to claim 1 wherein said promoter is also expressed in seed tissue. 17) A plant cell comprising the DNA molecule according to claim 1.
18) A transgenic plant, or a part thereof, comprising the plant cell according to claim 17.
19) The plant cell according to claim 17, wherein said nucleotide sequence of claim 1 comprises at least about 21 consecutive base pairs of SEQ ID NO. 6.
20) The transgenic plant, or part thereof, according to claim 18, wherein said polynucleotide of claim 1 comprises at least about 21 consecutive base pairs of SEQ
ID NO. 6.
21) The transgenic plant according to claim 1, wherein said plant is a monocot plant.
22) The transgenic plant according to claim 1, wherein said plant is a barley, rice, maize, wheat, sorghum, sugar cane or rye. 23) The transgenic plant according to claim 1 , wherein said plant is a maize plant.
24) The DNA molecule according to claim 1, wherein said nucleic acid is expressed in seed tissue.
25) The DNA molecule according to claim 1, wherein said DNA molecule is depicted by SEQ ID NO. 8 or SEQ. ID. NO. 18. 26) The DNA molecule according to claim 1, wherein said promoter is also developmentally expressed in kernels of said transgenic plant.
27) An isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue and encoding a TPP protein or antibody capable of down-regulating a TPP gene.
28) The isolated DNA molecule according to claim 27, wherein said promoter is expressed in seed tissue.
29) An isolated DNA molecule comprising a polynucleotide encoding an RNAi, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein when said RNAi is capable of down-regulating the expression of a T6PP gene.
30) The DNA molecule according to claim 29, wherein said polynucleotide is depicted by SEQ ID. NO 6.
31) The DNA molecule according to claim 30, wherein said polynucleotide comprises at least about 21 consecutive base pairs of SEQ ID NO. 6.
32) The DNA molecule according to claim 31 , wherein said polynucleotide is a complement to said 21 consecutive base pairs. 33) The DNA molecule according to claim 29, wherein said promoter is derived from the 5' region of a Rabl7 gene and exhibits promoter activity in plants.
34) The DNA molecule according to claim 29, wherein said DNA molecule comprises a 3' region derived from a Rabl7 gene and exhibits terminator activity in plants.
35) The DNA molecule according to claim 29, wherein said promoter comprises about 100-1649 contiguous nucleotides of DNA, wherein said contiguous nucleotides of
DNA have from 85% to 100% identity to about 100 to 1649 contiguous nucleotides of DNA having the sequence of SEQ ID NO. 42.
36) A plant cell comprising the DNA molecule according to claim 29.
37) A transgenic plant, or a part thereof, comprising the plant cell according to claim 36. 38) The plant cell according to claim 36, wherein said polynucleotide of claim 29 comprises at least about 21 consecutive base pairs of SEQ ID NO. 1. 39) The transgenic plant, or part thereof, according to claim 37, wherein said polynucleotide of claim 29 comprises at least about 21 consecutive base pairs of SEQ
ID NO. 6.
40) The transgenic plant according to claim 39, wherein said plant is a monocot plant.
41) The transgenic plant according to claim 39, wherein said plant is a barley, rice, maize, wheat, sorghum, sugar cane or rye.
42) The DNA molecule according to claim 29, wherein said DNA molecule is depicted by
SEQ ID NO. 8 or SEQ. ID. NO. 18.
43) A method of increasing the starch content in the kernel of a plant comprising the steps of: a) transforming a plant cell with said DNA molecule of claim 1 ; b) generating a plant from said plant cell; c) inducing expression of said nucleic acid sequence of claim 1 in the vegetative tissue of said plant when said plant is subjected to drought conditions during its reproductive stage; and
d) increasing starch content in the kernel compared to the starch content in the kernel of an isogenic plant not containing said DNA molecule when said transgenic plant and said isogenic plant are grown under substantially the same drought conditions.
44) The method for increasing the starch content in the kernel of a plant according to claim 43, wherein said promoter is endogenous to said plant species.
45) The method for increasing the starch content in the kernel of a plant according to claim 43, wherein said promoter comprises the 5 'non-coding regulatory region of a Rabl7 gene.
46) The method for increasing the starch content in the kernel of a plant according to claim 45, wherein said nucleic acid sequence further comprises the 3 '-terminator non- coding region of a Rabl7 gene.
47) A transgenic plant prepared by the method of claim 43.
48) Transgenic seeds derived from the plant of claim 47.
49) A double stranded short interfering nucleic acid (siRNA) molecule that down regulates expression of a T6PP gene in the vegetative tissue of a plant, wherein said siRNA molecule comprises at least about 21 base pairs.
50) The siRNA molecule of claim 49, wherein one of the strands of said double stranded siRNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of a T6PP gene or a portion thereof and, wherein the second strand of said double-stranded siRNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of said first strand.
51) The siRNA molecule of claim 49, wherein said siRNA molecule is encoded by at least about 21 consecutive base pairs of SEQ ID NO. 6.
52) The siNA molecule of claim 49, wherein said siNA molecule comprises ribonucleotides.
53) An isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is drought induced in vegetative tissue, wherein said nucleic acid is capable of down-regulating a T6PP gene.
54) The DNA molecule according to claim 53, wherein said polynucleotide is depicted by SEQ ID. NO 6.
55) The DNA molecule according to claim 53, wherein said polynucleotide comprises at least about 21 consecutive base pairs of SEQ ID NO. 6. 56) The DNA molecule according to claim 53, wherein said polynucleotide is placed in a sense orientation relative to said promoter.
57) The DNA molecule according to claim 53, wherein said polynucleotide is placed in an antisense orientation relative to said promoter.
58) The DNA molecule according to claim 53, wherein said polynucleotide is a complement to said 21 consecutive base pairs.
59) The DNA molecule according to claim 53, wherein said polynucleotide is placed in a sense orientation relative to said promoter.
60) The DNA molecule according to claim 53, wherein said polynucleotide is placed in an antisense orientation relative to said promoter. 61) The DNA molecule according to claim 53, wherein said promoter is derived from the
5' region of a Rabl7 gene and exhibits promoter activity in plants. 62) The DNA molecule according to claim 53, wherein said DNA molecule further comprises a 3' region derived from a Rabl7 gene and exhibits terminator activity in plants. 63) The DNA molecule according to claim 53, wherein said promoter comprises about 100-1649 contiguous nucleotides of DNA, wherein said contiguous nucleotides of DNA have from 85% to 100% identity to about 100 to 1649 contiguous nucleotides of DNA having the sequence of SEQ ID NO. 42.
64) The DNA molecule according to claim 53, wherein said nucleic acid is capable of forming into a double stranded RNA.
65) The DNA molecule according to claim 53, wherein said polynucleotide comprises co- suppressor RNA.
66) The DNA molecule according to claim 53, wherein said polynucleotide comprises catalytic RNA. 67) The DNA molecule according to claim 53, wherein said polynucleotide is capable of forming into a triplex nucleic acid.
68) The DNA molecule according to claim 53 wherein said promoter is also expressed in seed tissue.
69) A plant cell comprising the DNA molecule according to claim 53.
70) A transgenic plant, or a part thereof, comprising the plant cell according to claim 69.
71) The plant cell according to claim 69, wherein said polynucleotide of claim 53 comprises at least about 21 consecutive base pairs of SEQ ID NO. 6. 72) The transgenic plant, or part thereof, according to claim 70, wherein said polynucleotide of claim 53 comprises at least about 21 consecutive base pairs of SEQ ID NO. 6.
73) The transgenic plant according to claim 70, wherein said plant is a monocot plant.
74) The transgenic plant according to claim 70, wherein said plant is a barley, rice, maize, wheat, sorghum, sugar cane or rye.
75) The transgenic plant according to claim 70, wherein said plant is a maize plant.
76) The DNA molecule according to claim 53, wherein said nucleic acid is expressed in seed tissue.
77) The DNA molecule according to claim 53, wherein said DNA molecule is depicted by SEQ ID NO. 8 or SEQ. ID. NO. 18.
78) A method of increasing the starch content in the kernel of a plant comprising the steps of: a) obtaining a plant comprising the DNA molecule of claim 1 ; b) growing said plant under drought conditions; c) inducing expression of said nucleic acid sequence of claim 1 in the vegetative tissue of said plant when said plant is subjected to drought conditions during its reproductive stage; and d) increasing starch content in the kernel of said plant compared to the starch content in the kernel of an isogenic plant not containing said DNA molecule when said plant and said isogenic plant are grown under substantially the same drought conditions.
79) An isolated DNA molecule comprising a polynucleotide encoding a nucleic acid, said polynucleotide is operatively linked to a promoter that is stress inducible in vegetative tissue of a plant and developmentally expressed in kernels of said plant, wherein said nucleic acid is capable of down-regulating a T6PP gene.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US63278104P | 2004-12-03 | 2004-12-03 | |
| PCT/US2005/043097 WO2006060376A2 (en) | 2004-12-03 | 2005-11-28 | Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1827081A2 true EP1827081A2 (en) | 2007-09-05 |
| EP1827081A4 EP1827081A4 (en) | 2009-04-01 |
Family
ID=36565624
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP05849969A Withdrawn EP1827081A4 (en) | 2004-12-03 | 2005-11-28 | Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase |
Country Status (8)
| Country | Link |
|---|---|
| EP (1) | EP1827081A4 (en) |
| CN (1) | CN101115385A (en) |
| AU (1) | AU2005312023A1 (en) |
| BR (1) | BRPI0518596A2 (en) |
| CA (1) | CA2588372A1 (en) |
| MX (1) | MX2007006452A (en) |
| WO (1) | WO2006060376A2 (en) |
| ZA (1) | ZA200704131B (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080189805A1 (en) * | 2006-12-13 | 2008-08-07 | Serbin John J | Novel genes and rna molecules that confer stress tolerance |
| CN103710376A (en) * | 2006-12-15 | 2014-04-09 | 克罗普迪塞恩股份有限公司 | Plants having enhanced seed yield-related traits and a method for making the same |
| MX2009005514A (en) * | 2006-12-15 | 2009-06-04 | Cropdesign Nv | Plants having enhanced seed yield-related traits and a method for making the same. |
| WO2010121316A1 (en) * | 2009-04-24 | 2010-10-28 | Australian Centre For Plant Functional Genomics Pty Ltd | Drought responsive expression of genes from the zea mays rab17 promoter |
| CN110643627A (en) * | 2018-06-25 | 2020-01-03 | 中国农业大学 | Application of CIPK3 protein and its encoding gene in plant drought resistance |
| CN110358776B (en) * | 2019-07-09 | 2021-03-12 | 华南农业大学 | A pathogenicity-related gene of Rhizoctonia solani and its application |
| CN116694659B (en) * | 2023-05-26 | 2024-02-02 | 中国农业科学院生物技术研究所 | Application of GhTPPA2 gene in promoting the accumulation of soluble sugar and starch in plant leaves |
| CN119331070A (en) * | 2024-12-04 | 2025-01-21 | 华中农业大学 | Maize drought resistance gene ZmYPT3 and its application |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IN1997CH00924A (en) * | 1996-05-03 | 2005-03-04 | Syngenta Mogen Bv | Regulating metabolism by modifying the level of trehalose-6-phosphate |
| ZA989886B (en) * | 1997-10-30 | 1999-04-30 | Mogen Int | Nuclear male sterile plants method of producing same and methods to restore fertility |
| HUP0102598A3 (en) * | 1998-03-11 | 2003-03-28 | Syngenta Participations Ag | Expression of trehalose biosynthetic genes in plants |
| US20100293669A2 (en) * | 1999-05-06 | 2010-11-18 | Jingdong Liu | Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement |
| WO2002010365A2 (en) * | 2000-08-02 | 2002-02-07 | The Board Of Regents Of The University Of Nebraska | Down-regulation of single genes and simultaneous down-regulation of multiple genes by nuclear localization of rna transcripts |
| EP1375669A1 (en) * | 2002-06-13 | 2004-01-02 | Stichting Voor De Technische Wetenschappen | Method for enhancing the disease resistance in plants by altering trehalose-6-phosphate levels |
| US20040123347A1 (en) * | 2002-12-20 | 2004-06-24 | Hinchey Brendan S. | Water-deficit-inducible plant promoters |
-
2005
- 2005-11-28 BR BRPI0518596-3A patent/BRPI0518596A2/en not_active Application Discontinuation
- 2005-11-28 MX MX2007006452A patent/MX2007006452A/en not_active Application Discontinuation
- 2005-11-28 AU AU2005312023A patent/AU2005312023A1/en not_active Abandoned
- 2005-11-28 WO PCT/US2005/043097 patent/WO2006060376A2/en not_active Ceased
- 2005-11-28 CN CNA2005800477166A patent/CN101115385A/en active Pending
- 2005-11-28 CA CA002588372A patent/CA2588372A1/en not_active Abandoned
- 2005-11-28 EP EP05849969A patent/EP1827081A4/en not_active Withdrawn
-
2007
- 2007-05-22 ZA ZA200704131A patent/ZA200704131B/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| CA2588372A1 (en) | 2006-06-08 |
| ZA200704131B (en) | 2008-08-27 |
| AU2005312023A1 (en) | 2006-06-08 |
| WO2006060376A3 (en) | 2007-05-03 |
| BRPI0518596A2 (en) | 2008-11-25 |
| EP1827081A4 (en) | 2009-04-01 |
| WO2006060376A2 (en) | 2006-06-08 |
| CN101115385A (en) | 2008-01-30 |
| MX2007006452A (en) | 2007-07-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10287598B2 (en) | Methods for preparing pecific polypeptide-binding antibodies | |
| Cho et al. | Constitutive expression of abiotic stress-inducible hot pepper CaXTH3, which encodes a xyloglucan endotransglucosylase/hydrolase homolog, improves drought and salt tolerance in transgenic Arabidopsis plants | |
| CA2336227C (en) | Genes involved in tolerance to environmental stress | |
| EP1742527B1 (en) | Regulatory sequences for expressing gene products in plant reproductive tissue | |
| KR101269930B1 (en) | Plants having enhanced yield-related traits and a method for making the same | |
| Park et al. | Increased tolerance to salt-and water-deficit stress in transgenic lettuce (Lactuca sativa L.) by constitutive expression of LEA | |
| CN107022563A (en) | Genetically modified plants | |
| AU2019261797A1 (en) | Plants having enhanced abiotic stress resistance | |
| CN102482683B (en) | Expression of transcriptional regulators capable of conferring heat tolerance | |
| CA2700981C (en) | Plants having increased biomass | |
| WO2006060376A2 (en) | Stress tolerance in plants through selective inhibition of trehalose-6-phosphate phosphatase | |
| WO2012149883A1 (en) | Method for speeding up plant growth and improving yield by altering expression levels of kinases and phosphatases | |
| Karimi et al. | Arabidopsis Cold Stress Tolerance Improvement via AthHOS1-targeting HOS1-amiRNA Approach | |
| BRPI0820741B1 (en) | METHOD FOR REDUCING Cd LEVELS IN A TOBACCO PLANT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20070618 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA HR MK YU |
|
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20090227 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20090519 |