EP1697529A1

EP1697529A1 - Viral particles containing an alpha virus derived vector and method for preparing said viral particle

Info

Publication number: EP1697529A1
Application number: EP04805869A
Authority: EP
Inventors: Jean-Christophe Pages
Original assignee: Universite Francois Rabelais de Tours
Current assignee: BOULIKAS PARTHENIOS (TENI)
Priority date: 2003-12-02
Filing date: 2004-11-30
Publication date: 2006-09-06
Also published as: FR2862982B1; FR2862982A1; JP2007512827A; AU2004297379A1; US20080118956A1; WO2005056805A1; BRPI0417126A; KR20070085044A; RU2398875C2; CN101006180A; CA2547922A1; RU2006123079A

Abstract

The inventive viral particle consists of structural elements not originally from an alpha-virus and containing an alpha-virus derived vector deactivated for replication, by means of deletion or substitution by at least one transgene. Said particle also consisting of structural genes and is characterised in that the structural elements of said viral particle are not encoded by the genome of the alpha-virus derived vector. The inventive method for producing said particle consists in expressing in trans the genes coding the structural elements not originally from an alpha-virus and the alpha-virus derived vector in a cell line and, afterwards in recovering the viral particles contained in a supernatant cell culture.

Description

VIRAL PARTICLES CONTAINING AN ALPHA VIRUS-DERIVED VECTOR AND PROCESS FOR THE PREPARATION OF SAID VIRAL PARTICLE

The invention relates to new viral particles containing a vector derived from an alpha-virus rendered defective for autonomous propagation and therefore for replication. It also relates to the process for the preparation of said particles.

In the following description, the invention is more particularly illustrated in relation to the Semliki forest virus (SFV) which falls into the category of alpha-viruses. Of course, this particular example in no way limits the scope of the invention and all the alpha-iruses can be considered, such as for example the Sindbis virus.

The alpha-virus genome is in the form of a single-strand RNA of positive polarity comprising two open reading phases, respectively a first phase coding the proteins with enzymatic function, and a second phase coding the structural proteins. Replication takes place in the cytoplasm of the cell. In the first stage of the infectious cycle, the 5 ′ end of the genomic RNA is translated into a polyprotein (nsP 1-4) with RNA polymerase activity producing a negative strand complementary to the genomic RNA. In a second step, the negative strand is used as a template for the production of two RNAs, respectively:

- a positive genomic RNA corresponding to the genome of secondary viruses producing, by translation, other nsp proteins and serving as a genome for viruses, - a subgenomic RNA encoding the structural proteins of the virus forming the infectious particles.

More specifically, the subgenomic RNA is transcribed from the p26S promoter present at the 3 ′ end of the RNA sequence coding for the nsp4 protein. The ratio of positive genomic RNA / subgenomic RNA is regulated by the proteolytic self-cleavage of the polyprotein into nsp 1, nsp 2, nsp 3 and nsp 4. In practice, expression of viral genes takes place in two phases. In a first phase, there is a main synthesis of positive genomic strands and negative strands. During the second phase, the synthesis of sub-genomic RNA is almost exclusive, thus leading to the production of structural proteins in very large quantities.

Knowledge of the mode of replication of alpha-viridae and the simplicity of their genome has led to the emergence of gene transfer systems using these viruses, the latter making it possible to obtain a high expression of the transgene in the target cell.

One of the essential conditions for a vector derived from alpha-virus to be used in gene therapy is that it has no ability to replicate. Several solutions have been proposed to make the Semliki virus defective for replication.

The first solution consists in deleting the structural genes of the Semliki RNA in favor of the transgene, the transgene being placed under the dependence of the p26S promoter. Such a vector can be transferred to cells in the form of RNA or in the form of DNA. However, this solution is of little interest for in vivo applications, insofar as there is a low transfer efficiency using these genetic elements used in the absence of particles.

Another solution is to infect the target cells with a Semliki vector not in the form of DNA or RNA alone, but in the form of recombinant viral particles. To do this, a cell line is transfected with at least two plasmids, respectively, a plasmid carrying the RNA of the Semliki vector devoid of structural genes and a second plasmid carrying the Semliki structural genes under the control of the p26S promoter. Within the cell are formed viral particles which encapsulate only the defective RNA, that is to say the Semliki RNA carrying the transgene since it alone also carries an encapsidation sequence contained in the sequence of nsP2. Even if, in theory, this process does not generate any replicative particle, the recombination events remain frequent of the is, in particular, the overlap of the complementation sequences and the recombinant virus, and the abundance of viral RNA in the cytoplasm of producer cells.

The Rolls documents (1, 2) describe an SFV vector whose genome has been modified by replacing the structural genes with the gene encoding the VSV-G envelope, possibly associated with a transgene. The infectious particles thus obtained therefore consist of a VSV-G envelope and contain a vector derived from alpha virus. However, the system described is particularly dangerous because of its ability to replicate autonomously. An equivalent system is described in document WO 03/072771.

The document Lebedeva et al. (3) describes the coelectroporation of BHK cells by: the capsid and the envelope of SFV as a control, or a derived vector in which the env gene of SFV is replaced by env sequences of the MLV retrovirus (Moloney murine leukemia), and the analysis of the viral particles thus produced. However, in this system, the mobilization of the vector SFV carrying the transgene, in this case that of β-galactosidase, is dependent on the packaging of this recombinant genomic RNA by the capsid protein of SFV.

In other words, the problem which the invention proposes to solve is to improve the mode of mobilization of the vectors derived from alpha-virus, in particular from the Semliki forest virus (SFV), so as to avoid any risk of recombination within the producing lines which can generate replicative particles. Another problem which the invention proposes to solve is to prepare viral particles containing a vector derived from alpha-virus, the tropism of which is not limited to the target cells of wild viruses.

The Applicant has succeeded in producing viral particles which simultaneously meet the two above objectives by expressing in trans, in a cell line, the genes coding for structural elements not derived from the alpha virus and the vector derived from alpha- virus made defective for replication.

According to a first embodiment, the genes coding for structural elements not originating from the alpha-virus correspond to the only ENV gene of the vesicular stomatitis virus coding for the NSN-G envelope protein.

Using a VSV-G envelope has several advantages. First of all, the envelope protein of the vesicular stomatitis virus allows a mode of cellular entry by endocytosis which can be superimposed on that of alpha-viruses. In addition, VSV-G is a very stable protein, capable of being concentrated by ultra-centrifugation and making it possible to envisage parenteral administrations. Furthermore, this protein confers a very large tropism on the particles which contain it, thus widening the field of use of the viral particles of the invention to organisms as different as Drosophila and mammals.

According to this first embodiment, the expression in trans is obtained by co-transfection advantageously carried out in two distinct stages respectively, the transfection of the line with the plasmid expressing the gene of the envelope VSV-G, then a second transfection by the vector derived from alpha virus. In practice, co-transfection is carried out on 293T cells.

In a second embodiment, the genes coding for structural elements not derived from the alpha virus correspond to the genes coding for the structural proteins of a retro irus. In this case, expression in trans is obtained by transfection of an encapsidation cell line, producer of retroviruses defective for replication, with the vector derived from alpha virus. This type of line is well known in the art, such as Phoenix ^® system (http://www.stanford.edu/group/nolan/retroviral systems / plixiitml). In particular, packaging lines using structural genes of MLN (muiïne leukemia virus) can be used.

In known manner, these lines are obtained by stable transfection of a first plasmid expressing the GAG-POL genes and of a second plasmid expressing an ENV gene of a retrovirus or of another enveloped virus (4).

However, it is also possible to prepare the viral particles by triple transfection of a cell line, for example 293T cells, by introduction of a first viral element expressing the GAG and POL genes of retrovirus, of a second viral element expressing the ENV gene of retrovirus and of the vector derived from alpha-virus.

It is possible to further accentuate the defective nature of the transcomplementing retroviral sequences by mutation, in particular deletion of the nucleotide sequences of the POL gene coding for integrase (IN) and reverse transcriptase (RT).

In the two embodiments of the invention as previously described, the vector derived from alpha-virus is made defective for replication. This property is in practice obtained by the deletion of structural genes or their substitution for the benefit of the transgene (s) of interest in the vector genome.

According to another characteristic, the genome of the vector derived from alpha-virus contains a signal allowing the packaging by the viral particle, called psi sequence. According to a first embodiment, the sequence psi corcespond to the extended packaging sequence of MLN vectors obtained by amplification by PCR method (polymerase chain reaction) of the vector PLΝCX (Clontech ^®) from primers: - 5 'primer: LΝCX Psi 2a: 5'- GGGACCACCGACCCACCACC -3 'and - primer 3': LΝCX Psi 2b: 5'- GATCCTCATCCTGTCTCTTG -3 '.

Advantageously, the psi sequence is reduced in size and corresponds to the minimum sequence. This modification is interesting insofar as the psi sequence can have an anchor point function for the entry of ribosomes (IRES). The IRES function thus makes it possible to remove the p26S promoter from the SFV, so that the translation of the transgene is obtained from the genomic ARΝ.

Paradoxically, the Applicant also demonstrated that the presence of a retroviral packaging signal was not necessarily necessary. In fact, the quantity of ARΝ recombinants of the Semliki vector, found in the cytoplasm of the transfected cells, is such that the latter are preferentially packaged in retroviral particles. This phenomenon is accentuated by the extinction of cellular genes, induced by the expression of the non-structural proteins of the Semliki virus. The sub-cellular localization of the replication complexes of the SFV virus could also play an important role (5). Therefore, and in a preferred embodiment, the vector genome is devoid of psi sequence.

The applicant has also shown that it is possible to mobilize a vector as described above, containing a retroviral encapsidation sequence, by means of retroviral particles produced using a transcomplementation system based on vectors derived from the Semliki forest virus. (11). In this system, it is shown that one can obtain tiu-es of the order of 10 particles per milliliter. D. is also demonstrated that the presence of a retroviral packaging signal improves the titer of the particles by approximately one log. These particles are effectively used to transduce cells expressing the receptor for amphotropic viruses (Pit 2), corresponding to the retroviral envelope. used. This observation has a direct consequence on the biosecurity of the retroviral particles produced by the method of Li and Garoff (11). In this context, it is demonstrated that the particles produced according to the method of Li and Garoff contain, in a titer close to 10 ⁶ part ml, genomes of recombinant SFV vectors expressing the GAG / POL or ENV sequences of the retroviruses.

The Applicant has moreover found that the mode of transfection generally used for the recombinant ARs of the Semliki vectors, namely electroporation, leads to significant cellular suffering. Also, and to allow transfection of the producer cells by methods which are gentler than electroporation, the vector derived from alpha-virus has been modified to be expressed from a eukaryotic promoter, for example a CMN promoter positioned at 5 'of the vector sequence.

Finally, the p26S promoter of the alpha-virus vector is advantageously mutated. The vector SFV 26Sm2, and to a lesser extent the vector SFV 26Sml, no longer expresses detectable sub-genomic AR, capable of reducing the encapsidation of genomic ARΝ by competition.

Thus, a particle according to the invention is like a viral particle made up of structural elements not derived from an alpha-virus and containing a vector derived from alpha-virus made defective for replication, by deletion or replacement by at at least one transgene, structural genes, the structural elements of said particle not being encoded by the genome of the vector derived from alpha-virus.

Furthermore, the invention relates to the use of the viral particles according to the invention for infecting cells in vitro. The Applicant has shown that the particles thus produced can infect a wide variety of eukaryotic cells, both human and non-human.

The invention also relates to a pharmaceutical composition comprising the viral particles of the invention. Likewise, it relates to the use of viral particles for the preparation of a medicament intended for the treatment of cancer.

The invention and the advantages which ensue therefrom will emerge clearly from the following examples.

Figure 1 is a schematic representation of the structure of the vector derived from the Semliki Forest Virus (SFV).

Figure 2 shows the mutations made in the p26S promoter. The mutations introduced into the p26Sml and p26Sm2 mutants with respect to the wild-type sequence (Wt) are boxed. The amino acid in bold indicates a change in the coding sequence.

FIG. 3 is the result of a Northern-blot carried out from producer cells, expressing modified SFV vectors (pEGFPCl; 2: p26Sml; 3: p26Sm2; 4: SFV without transgene), with a GFP probe of pEGFPCl. FIG. 4 shows the capacity of the 293T and BHK 21 cells to express the vectors derived from SFV (p26Sml and p26Sm2) and mobilized by the pseudo-particles VSV-G.

FIG. 5 is the result of a northern blot carried out from the cells infected with the supernatant of 293 T cells transfected with the plasmid pMDG and of the vectors

Modified SFV (LpEGFPCl; 2: p26Sml; 3: p26Sm2), with a GFP probe of pEGFPCl.

EXAMPLE 1 Production of Viral Particles from Cell Lines Expressing the VSV-G Envelope METHODS

1 / Cell lines and cultures - 293T / 17: primary line of human embryonic kidneys (ATCC CRL- 11268), - Hela: human cell line (ATCC CCL-2), - QM7: quail muscle line (ATCC, CRL- 1962), - LMH: chicken liver line (ATCC CRL-2117). The above four cell lines are grown in DMEM (Invitrogen) containing 10% fetal calf serum (FCS) (Biowest). - HepG2: human hepatoma line cultivated in EM containing 10% FCS (ATCC HB-8065), - BHK21: baby hamster kidney line cultivated in GMEM containing 5% FCS and 8% liquid tryptose solution phosphate (ATCC CCL- 10), - CESC: Chicken embryo obtained and cultivated according to reference 26, - High Five cell cultivated at 27 ° C in a medium of Grace's insect cells (cat n ° B85502 Invitrogen) containing 10% FCS, - Sp2 / O: Murine line of lymphoplastoids cultivated in RPMI 1640 containing 10% FCS (ATCC CRL1581). 21 Construction of the SFV vector

The structure of the vector SFV is shown in Figure 1.

a / 26Sml Vector

The internal promoter 26S of the SFV is mutated by PCR from the vector pSFVl (Invitrogen), which is devoid of structural genes and used as template in the presence of two primers, respectively: - a primer 26SmlF containing the restriction site Bgl U appearing in bold in the following sequence: 5'-ATCCTCGAAGATCTAGGG-3 ', - a second mutated primer 26SmlR containing the Cla l restriction site appearing in bold in the following sequence: 5 -CAATATCGAT TACTAGCGAACTAATCTAGGA-3'.

Silent mutations are then introduced into the p26S promoter to lead to the p26Sml promoter as shown in FIG. 2. The product thus amplified is then cloned into a plasmid pIRES2-EGFP (Invitrogen) (FIG. 1). A retroviral sequence designated RS, derived from an MLV virus is then inserted between the 26S mutated promoter and the IRES sequence. Fragments containing the sequence 26S mutated, the MLV retroviral sequence and the EGFP gene are then excised with Bgl II and Hpa I and then cloned into the vector pSFVl between the Bgl JJ and Sma I restriction sites. The 10.5 kbp fragment containing the modified SFV replicon is finally cloned between the promoter IE CMV and the polyadenylation signal SV40 pA in a vector pJRES2-EGFP in which the sequence IRES GFP has been deleted.

b / Vector SFV26Sm2

The internal promoter is mutated by PCR from the plasmid SFV1 used as template in the presence of two primers respectively, a first primer 26SmlF and a second primer 26Sm2R containing a restriction site appearing in bold in the following sequence:

5'-ATATCGATTACTAGCGAACTAATCTACGACCCCCGTAAAGGTGT-3 ^* .

The primer 26Sm2R leads to modifications of the p26S promoter as illustrated in FIG. 2. The amplified product is then digested with Bgl JJ and Cla I and ligated into the vector 26Sml also digested with Bgl JJ and Cla I to remove the cross-cutting fragment .

31 Transfection of the 293T cell line with the SFV vectors 26Sml or 26Sm2 and the plasmid pMDG and collection of viral particles A transient transfection of 293T cells using a calcium / phosphate transfection kit (Invitrogen) is carried out. The 293T cells are seeded at the rate of 8 × 10 ⁵ cells per well on 6-well plates and incubated at 37 ° C. overnight, before transfection. The transfection is carried out in two stages. On the first day, the 293T cells are transfected with 5 μg of a pMDG plasmid containing the gene coding for the VSV-G envelope, under the influence of a JE CMV promoter (6). In a second step, on the second day, the cells are transfected with 5 μg of the SFV 26Sml or 26Sm2 vectors. The second transfection medium is left in contact with the cells between 1 pm and 5 pm. On day 3, the medium is removed and replaced with fresh medium allowing the release of the infecting particles. The culture medium containing the viral particles is collected 5 to 6 hours later. 41 Transfection of the BHK21 cell line with the vectors SFV 26Sml or 26Sm2 and the vectors SFV GAGPOL and SFV ENV and collection of viral particles

The BHK 21 cells are electroporated 5 10 ⁶ / ml (i.e. 4 10 ⁶ cells), at a voltage of 350 V, and a capacitance of 750 μF. The RNAs used for electroporation, corresponding to the different vectors (26Sml or m2, SFV GAGPOL and SFV ENV), are transcribed using 1.5 μg of linearized DNA using an Invitrogen Sp6 polymerase kit. For electroporation, 22 μl of the transcription product are electroporated. The harvesting of the recombinant particles is carried out 14 to 16 hours later. The supernatants are filtered and deposited on the target cells in the presence of 2 μg / ml of polybrene.

5 / Infection of cell lines with viral particles

The supernatant of transfected 293T cell lines was collected and then filtered through 0.45 .mu.m filter (Millex ^® HA, Millipore) and incubated with different cell lines in the presence of fresh medium containing polybrene used at 5 micrograms per ml (Sigma). The control of GFP expression in infected cells is carried out using a 1 × 50 Olympus fluorescence microscope. Quantification of transfection is performed using a FACScalibur flow cytometer from Becton Dickinson ^®. For control tests, the supernatants are used in different reagents: 10 μg per ml of RNAse A (Sigma), 1 μg per milliliter of actinomycin D (Sigma), 100 units per milliliter of DNAse I (Invitrogen), 1 mg per milliliter of geneticin (Sigma), and 3 μg per milliliter of puromycin (Cayla). 67 Concentration of viral particles

The supernatant of the transfected 293 cells is centrifuged at 150,000 g in a rotor SW41 for one hour at 4 ° C. The concentrated viruses are resuspended in 300 μl of PBS and 25 μl of the solution are used to infect 5.10 ⁵ cells (293T, BHK-21, Hela, HepG2, Sp2 / O, LMH, QM7).

7 / Northern Blot

The RNA from the 10 ⁶ transfected or infected cells is extracted using a total RNA isolation system (Promega ^® ). RNA from untransfected 293T cells is extracted as a control. 2 μg of each RNA is subjected to electrophoresis on a denaturing gel, formaldehyde, and the RNA is transferred to a positively charged nylon membrane (Hybond-XL; Amersham). The hybridization of the Northern Blot is carried out according to standard procedures. The probes correspond to a fragment of 790 bp Age I-BamH I GFP plasmid pEGFPCl (Clontech), the fragment being labeled (Rediprime ^® JJ DNA labeling system; Amersham) and column purified (ProbeQuant ^® G-50 Micro Columns, Amersham ) before use.

IV RESULTS 1 / Functionality of the vectors

The vectors SFV 26Sml and 26Sm2 correspond to vectors SFV, whose promoter 26S has been mutated in order to avoid possible competition between the packaging of the genomic RNA of SFV and the subgenomic RNA produced by transcription under the influence of the 26S promoter. The functionality of the two vectors was checked by transfection of 293T cells. The intense expression of GFP observed suggests that the transcription and translation of the modified SFV vector are correct. This first result is then confirmed by analysis on Northern Blot from the RNA extracted from 293 cells transfected with the vector SFV 26Sml.

As shown in Figure 3, line 2, the GFP probe reveals the existence of two bands corresponding to genomic RNA and subgenomic RNA, the latter suggesting that the 26S promoter is still functional. The same test is carried out on the second vector SFV 26Sm2 comprising additional mutations. The detection of GFP and the analysis by Northern Blot confirm that the mutations made in the 26Sm2 promoter inhibit the production by transcription, of the subgenomic RNA (see FIG. 3, line 3).

2 / Production of viral particles 293T cells are co-transfected with the plasmid pMDG, then the vector SFV 26Sml or SFV 26Sm2 as indicated above. The supernatant of the transfected cells is transferred to fresh 293T cells or to BHK 21 cells. The strong and rapid expression of the GFP obtained shows that it is possible to mobilize SFV vectors by means of cells expressing the VSV-G envelope ( figure 4).

3 / Ability of the viral particles obtained to infect the BHK21 cell lines. 293T and OM7 The results are shown in the table below. Viral titers are detected 24 hours after infection by FACS analysis. The percentage of cells expressing GFP, relative to the number of cells on the day of infection, makes it possible to calculate a titer of recombinant particles (IP / ml).

Table 1

As this table shows, the highest titer is obtained with the BHK21 cells compared to the 293T and QM7 cells. 41 The expression of the GFP containing the target cells is due to a true transduction by the viral particles SFV To ensure that the expression of the GFP is due to the expression of the SFV vectors and not to the mobilization of plasmids derived of the initial transfection or of a pseudo- transduction of free GFP, the following controls are carried out.

First, the SFV RNA is detected by Northern Blot from RNA extracted from the infected cells (see FIG. 5). As for the producing cells, in cells infected with the vector SFV 26Sml, both genomic RNA and subgenomic RNA are observed. On the contrary, in cells infected with the vector SFV 26Sm2, only the genomic RNA is detected. The signal strength suggests intense replication of the SFV vectors. However, to ensure that the high expression of GFP in the target cells corresponds well to the mobilization of the RNA of SFV, and therefore that the plasmids have indeed been transferred into the target cells, in this case the 293T cells. , high concentration DNase I (1000 UJ / mi) is added to the transducing supernatant. The titers in SFV viral particles are similar to the titers obtained in the absence of DNase I, which suggests more transduction than a second transfection. However, such a result could be obtained in the hypothesis that the plasmid is encapsulated in the transfected cells after its entry and then delivered into the transduced cell. To control this possible phenomenon, the target cells are pretreated with actinomycin D at the rate of one microgram per milliliter, then incubated with the infectious supernatant. Actinomycin D inhibits gene expression controlled by RNA POL JJ, such as the genome of the vector SFV in the plasmid pSFV26Sml or m2, but has no action on the replicase of SFV. A similar expression of GFP is observed in the presence or in the absence of actinomycin D, which confirms that it is indeed an RNA which is transferred (see Table 2).

It is then checked whether the expression of GFP is due to the expression of the SFV vectors or to a pseudo-transduction in the target cells. Indeed, certain publications (7) have shown that GFP can be passively transferred via retroviral particles independently of any expression. For to ensure otherwise, the target cells are pretreated with two translation inhibitors, respectively geneticin and puromycin. After treatment, the target cells show a barely detectable expression of GFP, which shows that the observed GFP results from translation and not from passive transfer (Table 2). In addition, the co-transfection of a plasmid pEGFPCl strongly expressing GFP with a plasmid coding for VSV-G does not lead to any pseudo-transduction of GFP. Likewise, supernatants from cells transfected with SFV vectors alone do not induce GFP expression, which proves that VSV-G must be present to promote the formation of pseudoparticles. To confirm that the SFV RNA is protected in the VSV-G vesicles, the supernatants are treated with RNase A, before transduction. It appears that the treatment with RNase A has no effect on the infectious titers confirming that the RNA of SFV is truly protected (Table 2). In view of all of these results, it is deduced that the expression of GFP in the target cells is due to true transduction by the viral particles SFV.

Table 2

EXAMPLE 2:

V METHODS

Il Constructions: The constructions described in example 1 were used. Two other derivative constructions, having a substitution of the CMV promoter by the prokaryotic promoter SP6, were also used: - The first construction, spSFV26Sml, is directly derived from SFV26Sml. - The second construction, spSFV26SmlΨ, is obtained by digestion Bgl JJ- Sma I of a plasmid pSFNl (Invitrogen ^® ), within which is cloned a fragment Bgl II- Hpa I of the plasmid ρIRES2 GFP (Clontecb ^® ), modified by introduction of a PCR fragment containing the 3 ′ end of the nsp4 gene and generated using the primers 26SmlF and 26SmlR (cf. example 1, section 2a).

These constructions are transcribed in vitro and the ARΝs are introduced by electroporation into the producer cells. In vitro transcription is carried out after linearization of the plasmids by cleavage BstB I. The transcription is performed in the presence of cap analog (Invitrogen ^®), SP6 polymerase (Invitrogen ^®) and ribonucleotides (Promega ^®). 2 / Cells:

Producing recombinant retroviruses cells, derived from 293 cells, phoenix ^® (http://www.stanford.edu/group/nolan/retiOviral systems / phx.html) are cultured in DMEM medium (GJJ3CO) in the presence of serum decomplemented fetal calf (Abcys). The producer cells are transfected using the plasmids SFV26Sml or

26Sm2, at a rate of 4 μg of DNA for 5.10 ⁵ cells, in a six-well plate well.

The transfection is carried out using calcium phosphate (Calcium Phosphate transfection kit, Invitrogen ^® ).

For the two constructions expressing the SFV vectors in the form of RNA, the transfection is carried out by electroporation: 40 μl of replicons produced in vitro are placed in the presence of 40 × 10 ⁵ cells and electroporated using the EasyjecT system.

Plus (Equibio ^® ).

20 hours after transfection, whatever the transfection method used, the medium is changed. 16 hours after this change, the medium is harvested to carry out the infections. During the harvest, the medium is filtered using 0.45 μm filters

(Millipore ^® ). 3 / Infections:

The filtered supernatants are used to infect 293T cells, cultured in 12-well plates. Infection is carried out in the presence of a polycation necessary for virus / cell interactions, polybrene (Sigma ^® ) at 5 μg / ml. On the day of infection, a well of 293T target cells is trypsinized for counting. 24 hours after infection, the cells are tryp sinized for a passage in flow cytometry (FACScalibur, Becton-Dickinson ^® ). The percentage of cells expressing GFP, relative to the number of cells on the day of infection, makes it possible to calculate a titer of recombinant particles (JP / ml) (Table 3).

4 / Controls:

Controls, identical to those carried out in Example 1, were carried out: - 10 μg per ml of RNAse A (Sigma ^® ), 1 μg per milliliter of actinomycin D (Sigma ^® ), - 100 units per milliliter of DNAse I (Invitrogen ^® ), 1 mg per milliliter of geneticin (Sigma ^® ).

117 RESULTS 1 / Infections:

The results of the infections are reported in Table 3. PI / ml: infectious particles per ml; NR: not carried out.

Table 3

The presence of cells expressing GFP confirms the possibility of mobilizing the recombinant SFV RNAs by means of a retroviral particle. However, the low titers observed indicate that it is necessary to control the cytotoxicity of the SFV vector in order to obtain higher titers. Indeed, there is an antagonism between the production of RNAs from SFV and the production of retroviral proteins. The latter see their production decrease when the production of SFV proteins increases. Several mutants of SFV have so far been described and can be used with profit (8).

The presence or absence of the retrovirus packaging sequence does not seem to have a significant influence on the efficiency of the packaging. Here, the high intracellular concentration of RNA seems to have a decisive role in promoting packaging, in agreement with the observations of Muriaux et al. (9). The influence of the psi retroviral sequence should be reassessed in the context of vectors with reduced toxicity. Furthermore, these results seem to indicate that there is probably contamination of the production of recombinant retroviruses when using a "helper" system based on the SFV vectors (10, 11). These contaminants are formed of retroviral particles containing either the SFV vectors used to express the transcomplementation sequences of the retroviruses, or the SFV vectors comprising the sequence of the recombinant retrovirus. This observation calls into question the use of these modes of production of retroviral vectors for clinical purposes, unlike the viral particles of the invention.

BIBLIOGRAPHY

1. Rolls, M.M., Webster, P., Balba, N.H. & Rose, J.K. Novel infectious particles generated by expression of the vesicular stomatitis virus glycoprotein from a self-replicating RNA. CeU 79, 497-506. (1994).

2. Rolls, M.M., Haglund, K. & Rose, J.K. Expression of additional genes in a vector derived from a minimal RNA virus. Virology 218, 406-411. (1996).

3. Lebedeva, L, Fujita, K., Nihrane, A. & Silver, J. Infectious particles derived from Semliki Forest Virus Vectors encoding Murine I ukemia virus envelopes. Journal of Virology 71 (9), 7061-7067. (1997). 4. Russell S J, Cosset FL. Modifying the host range properties of retroviral vectors. J Gen Med 1, 300-11. (1999).

5. Salonen A, Vasiljeva L, Merits A, Magden J, Jokitalo E, Kaariainen L. Properly folded nonstructural polyprotein direct the semliki forest virus replication complex to the endosomal compartment. J Virol. 77, 1691-702. (2003).

6. Naldini, L. et al. In vivo gene delivery and stable transduction of non-dividing cells by a lentiviral vector. Science 272, 263-267 (1996). 7. Liu, ML, Winther, BL & Kay, MA Pseudotransduction of hepatocytes by using concentrated pseudotyped vesicular stomatitis virus G glycoprotein (VSV-G) - Moloney murine leukemia virus-derived retrovirus vectors: comparison of VSV-G and amphotropic vectors for hepatic gene transfer. J Virol 70, 2497-2502. (1996). δ.Lundstrom K, Abenavoli A, Malgaroli A, Ehrengruber MU. Novel semliki forest virus vectors with reduced cytotoxicity and temperature sensitivity for long-term enhancement of transgene expression. Mol Ther. 2, 7202-9. (2003).

9. Muriaux, D., J. Mirro, et al. . RNA is a structural element in retrovirus particles. Proc Natl Acad Sci U S A 98, 5246-51. (2001).

10. Walilfors JJ, Xanthopoulos KG, Morgan RA. Semliki Forest virus-mediated production of retroviral vector RNA in retro viral packaging cells. Hum Gen Ther 8, 2031-41. (1997)

11. Li ICJ, Garoff H. Packaging of intron-containing genes into retrovirus vectors by alphavirus vectors. Proc Natl Acad Sci U S A 95,3650-4. (1998).

Claims

1 / Viral particle consisting of structural elements not derived from an alpha-virus and containing a vector derived from an alpha-virus made defective for the replication, by deletion or replacement with at least one transgene, of structural genes characterized in that the structural elements of said particle are not coded by the genome of the vector derived from alpha virus.

2 / viral particle according to claim 1, characterized in that the structural elements correspond to the envelope protein VSV-G alone.

3 / viral particle according to claim 1, characterized in that the structural elements correspond to the structural proteins of a retrovirus.

4 / Particle according to one of claims 1 to 3, characterized in that the alpha-virus is a forest virus from SEMLJKI.

5 / Particle according to one of claims 1 to 4, characterized in that the genome of the vector derived from alpha-virus contains the extended packaging sequence of the MLV vectors.

6 / Particle according to one of claims 1 to 5, characterized in that the genome of the vector derived from alpha-virus is devoid of psi sequence.

Particle according to one of claims 1 to 6, characterized in that the genome of the vector derived from alpha-virus comprises a eukaryotic promoter positioned at 5 '.

8 / Particle according to one of claims 1 to 7, characterized in that the vector derived from alpha-virus contains a mutated p26S promoter. 9 / Use of the viral particle object of one of claims 1 to 8 to infect a eukaryotic cell in vitro.

10 / A pharmaceutical composition comprising the viral particle which is the subject of one of claims 1 to 8.

11 / Use of the viral particle object of one of claims 1 to 8 for the manufacture of a medicament for the treatment of cancer.

12 / Process for obtaining viral particles, consisting of structural elements not derived from an alpha-virus and containing a vector derived from alpha-irus rendered defective for replication, by deletion or replacement with at least one transgene, structural genes consisting in: expressing, in trans, in a cell line, the genes encoding the structural elements not derived from the alpha-virus and the vector derived from the alpha-virus, recovering the viral particles present in the culture supernatant cellular.

13 / A method according to claim 12, characterized in that the structural elements correspond to the envelope protein VSV-G.

14 / A method according to claim 13, characterized in that the expression in trans is obtained by co-transfection of a cell line by the expression vector of the envelope VSV-G and the vector derived from alpha-virus , the co-transfection being carried out in two distinct stages respectively, the transfection of the line by the vector expressing the gene of the envelope VSV-G, then a second transfection by the vector derived from alpha-virus.

15 / A method according to claim 14, characterized in that the transfected cell line is a 293T cell line. 16 / A method according to claim 12, characterized in that the structural elements correspond to the structural proteins of a retrovirus.

17 / A method according to claim 16, characterized in that the expression in trans is obtained by transfection of an encapsidation cell line, producer of retroviruses defective for replication, with the vector derived from alpha virus.

18 / A method according to claim 17, characterized in that the packaging cell line is obtained by stable transfection of a cellulaύ-e line with a first viral element expressing the GAG and POL genes of retrovirus and a second viral element expressing the retrovirus ENV gene.

19 / A method according to claim 16, characterized in that the expression in trans is obtained by triple transfection of a 293 T cell line, by introduction of a first viral element expressing the GAG and POL genes of retrovirus, of a second viral element expressing the ENV ^" gene of retrovirus and of the vector derived from alpha-virus.

20 / Method according to one of claims 12 to 19, characterized in that the alpha-virus is a virus from the SEMLIKI forest.

21 / Method according to one of claims 12 to 20, characterized in that the genome of the vector derived from alpha-virus contains the extended packaging sequence of the MLV vectors.

22 / Method according to one of claims 12 to 21, characterized in that the genome of the vector derived from alpha-virus is devoid of psi sequence.

23 / Method according to one of claims 12 to 22, characterized in that the genome of the vector derived from alpha-virus comprises a eukaryotic promoter positioned in 5 '.

24 / A method according to one of claims 12 to 23, characterized in that the vector derived from alpha virus contains a mutated p26S promoter.