Definitions

• the tumor necrosis factor receptor (TNFR) family consists of a number of integral membrane glycoprotein receptors many of which, in conjunction with their respective ligands, are believed to regulate interactions between different hematopoietic cell lineages (Smith et al., The TNF Receptor Superfamily of Cellular and Viral Proteins: Activation. Costimulation and Death, 76:959-62, 1994; Cos an, Stem Cells 12:440-55, 1994).
• TNFR tumor necrosis factor receptor
• the TNF receptor family is composed primarily of type I integral membrane glycoproteins which exhibit sequence homology, particularly with respect to cysteine-rich repeats in their extracellular domains.
• the TNF receptor family includes over 29 members (reviewed in Bodmer et al. TRENDS in Biochem. Sci. 27:19-26, 2002).
• a subgroup of this family whose members have particular structural similarities includes BAFF-R (Thompson et al., Science 293:2108-2111, 2001), BCMA (Gross et al., Nature 404, 995-9, 2000), TWEAKR (Wiley et al., Immunity 15: 837-46, 2001), EDAR (Monreal et al., Nat. Gen. 22:315-6, 1999), XEDAR (Yan et al., 290:523-7), TACI (von Bulow and Bram, Science 278:138-141, 1997), and MK61 (Theill et al, WO0220762, 14 March 2002).
• TNFRs are distinguished by having two or fewer cysteine-rich domains along with a more variable cysteine-rich pattern than what is commonly seen.
• members of the TNF receptor family are characterized by a multi-domain structure comprising an extracellular region, a transmembrane domain, a linker region between the extracellular ligand-binding region and the transmembrane domain, and a cytoplasmic domain.
• this cytoplasmic domain contains a death domain associated with apoptosis.
• TNFR family As well as others that do not include death domains such as TACI and BCMA, have been shown to bind one or more of the six tumor necrosis factor receptor-associated factors (TRAF1-6). These factors bind to the intracellular domain of the receptor at a short consensus sequence and act to couple the receptor to internal cell signaling pathways.
• the extracellular ligand-binding region is characterized by the presence of one to six cysteine-rich motifs each containing about six cysteines and approximately 40 amino acids, although variation in the size and number of these motifs occurs among members of this family.
• the cysteine-rich regions provide the motif for binding to shared structures in the ligands. The highest degree of homology among the TNFR family members is within this extracellular cysteine-rich region.
• TNFRs Among human TNFRs the average homology is in the range of 25% to 30%. Between the last cysteine-rich repeat and the transmembrane domain is a small spacer region of between 8 to 70 amino acid residues. Cell surface TNF receptors are anchored in the cell membrane by a transmembrane domain characterized by a sequence of hydrophobic amino acid residues. On the opposite end of the protein from the extracellular ligand-binding region and separated from it by the transmembrane domain is the cytoplasmic domain. The cytoplasmic domains of TNFR family members are small, from 46 to 221 amino acid residues, which suggests possible differences in the signaling mechanisms among family members.
• TNF receptor for example, activation is triggered by the aggregation of cytoplasmic domains of three receptors when their corresponding extracellular domains bind to trimeric ligand, which may be a common method of activation for the receptor family.
• One member of the TNF receptor family, osteoprotegerin (Simonet et al., ibid-) is unique in that it is a secreted protein. Soluble forms of other TNF receptors have been described for TNFR-I, TNFR-II, low-affinity NGFR, FAS, CD27, CD30, CD40 and 4- IBB, but these were generated either by cleaving from the cell membrane or secreted by alternatively spliced mRNA.
• OPG inhibits osteoclast maturation and it is thought that it might serve to regulate bone density by modulating osteoclast differentiation from hematopoietic precursors.
• OPG provided protection from normal osteoclast remodeling and ovariectomy-associated bone loss.
• the X-ray crystallographic structures have been resolved for human TNF (Jones et al., Nature 338:225-28, 1989), LT-a (Eck et al., J. Biol. Chem. 267:2119-122, 1992) and the LT-a/TNFR complex (Banner et al., Cell 73:431-45, 1993). This complex features three receptor molecules bound symmetrically to one LT-a trimer.
• a model of trimeric ligand binding through receptor oligomerization has been proposed to initiate signal transduction pathways.
• the identification of biological activity of several TNF members has been facilitated through use of monoclonal antibodies specific for the corresponding receptor. These monoclonal antibodies tend to be stimulatory when immobilized and antagonistic in soluble form. This is further evidence that receptor crosslinking is a prerequisite for signal transduction in this receptor family.
• the use of receptor-specific monoclonal antibodies or soluble receptors in the form of multimeric Ig fusion proteins has been useful in determining biological function in vitro and in vivo for several family members.
• Soluble receptor-Ig fusion proteins have been used successfully in the cloning of the cell surface ligands corresponding to the CD40, CD30, CD27, 4-1BB and Fas receptors. Ligands for these receptors have been identified, and with one exception (NGF) belong to the TNF ligand family.
• the members of the TNF ligand family share approximately 20% sequence identity in the extracellular ligand-binding regions, and exist mainly as type ⁇ membrane glycoproteins, biologically active as trimeric or multimeric complexes.
• most ligands are synthesized as membrane-bound proteins, soluble forms can be generated by limited proteolysis. For some receptors, solublization is necessary for activity, while for others, their activity is inhibited upon cleavage.
• the invention provides an isolated polypeptide comprising residues 18 to 108 of SEQ ID NO:2.
• the invention provides an isolated polypeptide comprising residues 1 to 108 of SEQ ID NO:2.
• Another aspect of the invention is an isolated polypeptide comprising residues 18 to 131 of SEQ ID NO:2, as well as an isolated polypeptide comprising residues 1 to 131 of SEQ ID NO:2.
• a further aspect of the present invention is an isolated polypeptide comprising residues 18 to 198 of SEQ ID NO:2.
• the invention provides an isolated polypeptide selected from the group consisting of: a) polypeptides comprising residues 1 to 198 of SEQ ID NO:2; b) polypeptides comprising residues 1 to 308 of SEQ ID NO: 30; and c) polypeptides comprising residues 1 to 185 of SEQ TD NO:32.
• an isolated polypeptide comprising residues 18 to X, wherein X is an integer between 80 and 108.
• the invention provides an expression vector comprising the following operably linked elements: a) a transcription promoter; b) a DNA segment wherein the DNA segment is a polynucleotide molecule encoding the polypeptide molecule of comprising residues 18 to 108 of SEQ ID NO:2; and a transcription terminator.
• the DNA segment contains an affinity tag.
• the invention provides a cultured cell into which has been introduced the expression vector, wherein said cell expresses the polypeptide encoded by the DNA segment.
• the invention provides a method of producing a polypeptide comprising culturing the cell, whereby said cell expresses the polypeptide encoded by the DNA segment; and recovering the polypeptide.
• the polypeptide produced by the cell also provides a method for detecting a genetic abnormality in a patient, including obtaining a genetic sample from a patient; producing a first reaction product by incubating the genetic sample with a polynucleotide comprising at least 14 contiguous nucleotides of SEQ ID NO:l or the complement of SEQ ID NO:l, under conditions wherein said polynucleotide will hybridize to complementary polynucleotide sequence; visualizing the first reaction product; and comparing the first reaction product to a control reaction product from a wild type patient, wherein a difference between said first reaction product and said control reaction product is indicative of a genetic abnormality in the patient.
• a further method of the present invention is for detecting a cancer in a patient obtaining a tissue or biological sample from a patient incubating the tissue or biological sample with an antibody of claim 18 under conditions wherein the antibody binds to its complementary polypeptide in the tissue or biological sample visualizing the antibody bound in the tissue or biological sample; and comparing levels of antibody bound in the tissue or biological sample from the patient to a normal control tissue or biological sample, where an increase or decrease in the level of antibody bound to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.
• a second method for detecting a cancer in a patient involves obtaining a tissue or biological sample from a patient, labeling a polynucleotide comprising at least 14 contiguous nucleotides of SEQ ID NO.T or the complement of SEQ ID NO:l, incubating the tissue or biological sample with under conditions wherein the polynucleotide will hybridize to complementary polynucleotide sequence, visualizing the labeled polynucleotide in the tissue or biological sample; and comparing the level of labeled polynucleotide hybridization in the tissue or biological sample from the patient to a normal control tissue or biological sample, where an increase or decrease in the labeled polynucleotide hybridization to the patient tissue or biological sample relative to the normal control tissue or biological sample is indicative of a cancer in the patient.
• a further aspect of the present invention is a method of killing cancer cells comprising, obtaining ex vivo a tissue or biological sample containing cancer cells from a patient, or identifying cancer cells in vivo; producing a polypeptide by recombinant means, formulating the polypeptide in a pharmaceutically acceptable vehicle; and administering to the patient or exposing the cancer cells to the polypeptide; wherein the polypeptide kills the cells.
• This method can also be done where the polypeptide is conjugated to a toxin.
• the invention provides a method of detecting neuroblastoma, melanoma, or lymphoma, particularly T-cell lymphoma, comprising, contacting said neuroblastoma, melanoma, or lymphoma with a polynucleotide consisting of the polynucleotide sequence as shown in SEQ ID NOS: 1, 3, 29 or 31, wherein the polynucleotide hybridizes to the mRNA in the neuroblastoma, melanoma, or lymphoma.
• the polynucleotide is selected from the group consisting of: a polynucleotide consisting of at least 16 contiguous nucleotides as shown in SEQ ID NO.T; a polynucleotide consisting of from 17 to 25 contiguous nucleotides as shown in SEQ ID NO:l; a polynucleotide consisting of 40 contiguous nucleotides as shown in SEQ ID NO:l; a polynucleotide consisting of 60 contiguous nucleotides as shown in SEQ ID NO:l; a polynucleotide consisting of at least 16 contiguous nucleotides as shown in SEQ ID NO: 29; a polynucleotide consisting of from 17 to 25 contiguous nucleotides as shown in SEQ ID NO: 29; a polynucleotide consisting of 40 contiguous nucleotides as shown in SEQ ID NO:29; a polynucleotide consist
• the antibody is generated to a polypeptide selected from the group consisting of: a polypeptide comprising residues 18 to 108 of SEQ ID NO:2; a polypeptide comprising residues 30 to 80 of SEQ ID NO:2; a polypeptide comprising residues 50 to 80 of SEQ ID NO:2; and a polypeptide comprising residues 131 to 198 of SEQ ID NO:2.
• Another aspect of the present invention is a method of detection and, additionally, a method of separation of activated immune cells from those that are in the resting state.
• the invention provides an expression vector comprising the following operably linked elements: a transcription promoter; a ,DNA segment wherein the DNA segment is a polynucleotide molecule encoding the polypeptide molecule of claim 1; and a transcription terminator.
• the expression vector contains an affinity tag.
• a cultured cell into which has been introduced the expression vector according, and the cell expresses the polypeptide encoded by the DNA segment.
• the invention provides a method of producing a polypeptide comprising culturing the cell, whereby said cell expresses the polypeptide encoded by the DNA segment; and recovering the polypeptide.
• the invention provides a method of producing an antibody comprising the following steps in order: inoculating an animal with a polypeptide selected from the group consisting of: a polypeptide molecule consisting of a polypeptide comprising residues 18 to 108 of SEQ ID NO:2; a polypeptide comprising residues 30 to 80 of SEQ ID NO:2; a polypeptide comprising residues 50 to 80 of SEQ ID NO:2; or a polypeptide comprising residues 131 to 198 of SEQ ID NO: 2, wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
• a polypeptide selected from the group consisting of: a polypeptide molecule consisting of a polypeptide comprising residues 18 to 108 of SEQ ID NO:2; a polypeptide comprising residues 30 to 80 of SEQ ID NO:2; a polypeptide comprising residues 50 to 80 of SEQ ID NO:2; or a polypeptid
• the antibody produced by the method binds to a residues 1 to 269 of SEQ ID NO:2.
• the antibody specifically binds to the polypeptide.
• the invention provides a method of producing an antibody comprising the following steps in order: inoculating an animal with an epitope bearing portion of a polypeptide wherein the epitope bearing portion is selected from the group consisting of: a polypeptide molecule consisting of a polypeptide comprising residues 18 to 108 of SEQ ID NO:2; a polypeptide comprising residues 30 to 80 of SEQ ID NO:2; a polypeptide comprising residues 50 to 80 of SEQ ID NO:2; or a polypeptide comprising residues 131 to 198 of SEQ ID NO: 2 wherein the polypeptide elicits an immune response in the animal to produce the antibody; and isolating the antibody from the animal.
• the antibody produced by the method binds to a residues 1 to 269 of SEQ ID NO:2.
• the antibody is a monoclonal antibody.
• the antibody specifically binds to the polypeptide.
• the invention provides a method of forming a reversible peptide-receptor complex comprising; providing a receptor wherein the receptor comprises residues 18 to 108 of SEQ ID NO:2; and contacting the receptor with a peptide; wherein the receptor binds the peptide.
• the invention provides an isolated polypeptide molecule selected from the groups consisting of: a polypeptide molecule comprising residues 18 to 198 of SEQ ID NO:2; a polypeptide molecule comprising residues 18 to 308 of SEQ ID NO:29; and a polypeptide comprising residues 1 to 185 of SEQ ID NO:31.
• the invention provides a polynucleotide encoding the isolated polypeptide.
• the invention provides a method of detecting carcinoma in neural tissue, skin tissue, or cells of the hematopoetic lineage comprising, contacting said carcinoma with an antibody to the polypeptide as shown in SEQ ID NO:2.
• the antibody is generated to a polypeptide selected from the group consisting of: 18 to 108 of SEQ ID NO:2; a polypeptide comprising residues 30 to 80 of SEQ ID NO:2; a polypeptide comprising residues 50 to 80 of SEQ ID NO:2; or a polypeptide comprising residues 131 to 198 of SEQ ID NO: 2.
• the invention provides a method of modulating receptor activation in cells comprising administering to the cells an isolated polypeptide, wherein the isolated polypeptide comprises an amino acid as shown in SEQ ID NO:2 from residue 18 to residue X, wherein X is an integer from 80 to 108.
• the cells express a polypeptide sequence comprising the amino acid sequence of SEQ ID NO:l.
• the isolated polypeptide consists of an amino acid as shown in SEQ ID NO:2 from residue 1 to residue X, wherein X is an integer from 80 to 108.
• a method of modulating proliferation of carcinoma cells comprising administering to the cells an isolated polypeptide wherein the isolated polypeptide comprises an amino acid as shown in SEQ ID NO:2 from residue 18 to X, wherein X is an integer from 80 to 108.
• the carcinoma cells are neuroblastoma, melanoma, or lymphoma cells.
• FIGURES Figure 1 shows a comparison of the amino acid sequence of the human and mouse ztnfrl4 (SEQ ID NOS:l and 3, respectively) with related members of the TNFR family.
• the other listed sequences include: human and mouse ztnfrl2 (BAFF-R, SEQ ID NOS: 5 and 7); human and mouse BCMA (SEQ ID NOS: 8 and 10); human and mouse TWEAKR (SEQ ID NOS: 11 and 13); human and mouse EDAR (SEQ ID NOS: 14 and 16); human XEDAR (SEQ ID NO: 17); human and mouse TACI (SEQ ID NOS:19 and 21); and human and mouse MK61 (SEQ ID NOS:22 and 24).
• human and mouse ztnfrl2 BAFF-R, SEQ ID NOS: 5 and 7
• human and mouse BCMA SEQ ID NOS: 8 and 10
• human and mouse TWEAKR SEQ ID NOS: 11 and 13
• human and mouse EDAR SEQ ID NOS: 14 and 16
• human XEDAR SEQ ID NO: 17
• human and mouse TACI SEQ ID NOS:19 and 21
• human and mouse MK61 SEQ ID NOS
• Figure 2 compares a section of the cysteine-rich domain of human and mouse ztnfrl4 (SEQ ID NOS:34 and 35) to at least one cysteine-rich domain of each of the following receptors: human ztnfrl2 (BAFF-R, SEQ ID NO: 6); human BCMA (SEQ ID NO:9); human TWEAKR (SEQ ID NO: 12); human EDAR (SEQ ID NO: 15); human XEDAR (SEQ ID NO: 18); human TACI (SEQ TD NO:20); and human MK61 (SEQ ID NO:23).
• Figure 3 is a species comparison of the human (SEQ ID NO: 2), mouse
• FIG. 4 is a graphic representation of the results of real time PCR analysis to access the expression of ztnrfl4xl, ztnfrl4x2, and ztnfrl4x3 in various unstimulated B cell lines.
• Figure 5 is a graphic representation of the results of real time PCR analysis to access the expression of ztnrfl4xl, ztnfrl4x2, and ztnfrl4x3 in various unstimulated monocyte, T cell lines, as well as a transformed bone marrow endothelial cell line (TRBMEC), (MLR) and fibroblast lines.
• Figure 6 is a graphic representation of the results of real time PCR analysis to access the expression of ztnrfl4xl, ztnfrl4x2, and ztnfrl4x3 in various resting and stimulated human monocyte lines.
• affinity tag is used herein to denote a polypeptide segment that can be attached to a second polypeptide to provide for purification of the second polypeptide or provide sites for attachment of the second polypeptide to a substrate.
• Affinity tags include a poly-histidine tract, protein A (Nilsson et al, EMBO J. 4:1075, 1985; Nilsson et al., Methods Enzymol.
• amino-termina ' and “carboxyl-terminal” are used herein to denote positions within polypeptides. Where the context allows, these terms are used with reference to a particular sequence or portion of a polypeptide to denote proximity or relative position.
• a certain sequence positioned carboxyl-terminal to a reference sequence within a polypeptide is located proximal to the carboxyl terminus of the reference sequence, but is not necessarily at the carboxyl terminus of the complete polypeptide.
• the term "complements of a polynucleotide molecule” is a polynucleotide molecule having a complementary base sequence and reverse orientation as compared to a reference sequence. For example, the sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
• corresponding to when applied to positions of amino acid residues in sequences, means corresponding positions in a plurality of sequences when the sequences are optimally aligned.
• degenerate nucleotide sequence denotes a sequence of nucleotides that includes one or more degenerate codons (as compared to a reference polynucleotide molecule that encodes a polypeptide). Degenerate codons contain different triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and GAC triplets each encode Asp).
• expression vector is used to denote a DNA molecule, linear or circular, that comprises a segment encoding a polypeptide of interest operably linked to additional segments that provide for its transcription.
• Such additional segments include promoter and terminator sequences, and may also include one or more origins of replication, one or more selectable markers, an enhancer, a polyadenylation signal, etc.
• Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both.
• isolated when applied to a polynucleotide, denotes that the polynucleotide has been removed from its natural genetic milieu and is thus free of other extraneous or unwanted coding sequences, and is in a form suitable for use within genetically engineered protein production systems.
• isolated molecules are those that are separated from their natural environment and include cDNA and genomic clones.
• Isolated DNA molecules of the present invention are free of other genes with which they are ordinarily associated, but may include naturally occurring 5' and 3' untranslated regions such as promoters and terminators. The identification of associated regions will be evident to one of ordinary skill in the art (see for example, Dynan and Tijan, Nature 316:774-78. 1985).
• An "isolated" polypeptide or protein is a polypeptide or protein that is found in a condition other than its native environment, such as apart from blood and animal tissue.
• the isolated polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin. It is preferred to provide the polypeptides in a highly purified form, i.e.
• operably linked means that two or more entities are joined together such that they function in concert for their intended purposes.
• DNA segments the phrase indicates, for example, that coding sequences are joined in the correct reading frame, and transcription initiates in the promoter and proceeds through the coding segment(s) to the terminator.
• operably linked includes both covalently (e.g., by disulfide bonding) and non-covalently (e.g., by hydrogen bonding, hydrophobic interactions, or salt-bridge interactions) linked sequences, wherein the desired function(s) of the sequences are retained.
• ortholog or "species homolog”, denotes a polypeptide or protein obtained from one species that is the functional counterpart of a polypeptide or protein from a different species. Sequence differences among orthologs are the result of speciation.
• polynucleotide is a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
• Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules. Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"), nucleotides ("nt”), or kilobases ("kb”). Where the context allows, the latter two terms may describe polynucleotides that are single-stranded or double-stranded.
• a “polypeptide” is a polymer of amino acid residues joined by peptide bonds, whether produced naturally or synthetically.
• polypeptides of less than about 10 amino acid residues are commonly referred to as "peptides".
• a "peptide-receptor complex” is formed when a peptide, or ligand, binds to a receptor resulting in a change in the properties of the receptor. This change can result in an initiation of sequences of reactions leading to a change in cellular function, or the inability of the receptor to bind additional peptides.
• the forming of a peptide- receptor complex can be reversible.
• promoter is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase and initiation of transcription.
• a “protein” is a macromolecule comprising one or more polypeptide chains.
• a protein may also comprise non-peptidic components, such as carbohydrate groups. Carbohydrates and other non-peptidic substituents may be added to a protein by the cell in which the protein is produced, and will vary with the type of cell. Proteins are defined herein in terms of their amino acid backbone structures; substituents such as carbohydrate groups are generally not specified, but may be present nonetheless.
• the term "receptor” denotes a cell-associated protein that binds to a bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on the cell.
• Membrane-bound receptors are characterized by a multi-domain or multi-peptide structure comprising an extracellular ligand-binding domain and an intracellular effector domain that is typically involved in signal transduction. Binding of ligand to receptor results in a conformational change in the receptor that causes an interaction between the effector domain and other molecule(s) in the cell. This interaction in turn leads to an alteration in the metabolism of the cell. Metabolic events that are linked to receptor- ligand interactions include gene transcription, phosphorylation, dephosphorylation, increases in cyclic AMP production, mobilization of cellular calcium, mobilization of membrane lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of phospholipids.
• receptors can be membrane bound, cytosolic or nuclear; monomeric (e.g., thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric (e.g., PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF receptor, erythropoietin receptor and IL-6 receptor).
• secretory signal sequence denotes a DNA sequence that encodes a polypeptide (a "secretory peptide”) that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized.
• the larger polypeptide is commonly cleaved to remove the: secretory peptide during transit through the secretory pathway.
• a “segment” is a portion of a larger molecule (e.g., polynucleotide or polypeptide) having specified attributes.
• a DNA segment encoding a specified polypeptide is a portion of a longer DNA molecule, such as a plasmid or plasmid fragment, that, when read from the 5' to the 3' direction, encodes the sequence of amino acids of the specified polypeptide.
• a "soluble receptor” is a receptor polypeptide that is not bound to a cell membrane.
• Soluble receptors are most commonly ligand-binding receptor polypeptides that lack transmembrane and cytoplasmic domains. Soluble receptors can comprise additional amino acid residues, such as affinity tags that provide for purification of the polypeptide or provide sites for attachment of the polypeptide to a substrate. Many cell- surface receptors have naturally occurring, soluble counterparts that are produced by proteolysis or translated from alternatively spliced mRNAs. Receptor polypeptides are said to be substantially free of transmembrane and intracellular polypeptide segments when they lack sufficient portions of these segments to provide membrane anchoring or signal transduction, respectively.
• the term "splice variant" is used herein to denote alternative forms of
• RNA transcribed from a gene Splice variation arises naturally through use of alternative splicing sites within a transcribed RNA molecule, or less commonly between separately transcribed RNA molecules, and may result in several mRNAs transcribed from the same gene. Splice variants may encode polypeptides having altered amino acid sequence.
• the term splice variant is also used herein to denote a protein encoded by a splice variant of an mRNA transcribed from a gene. Molecular weights and lengths of polymers determined by imprecise analytical methods (e.g., gel electrophoresis) will be understood to be approximate values.
• the present invention is based in part upon the discovery of a novel DNA sequences (SEQ ED NOs:l) and corresponding polypeptide sequences (SEQ ID NOs:2) which have homology to members of the tumor necrosis factor receptor family. Novel receptor-encoding polynucleotides and polypeptides of the present invention were identified by the discovery of unannotated protein sequence with a transmembrane domain and a non-EGF (epidermal growth factor) cysteine-rich extracellular domain.
• SEQ ED NOs:l novel DNA sequences
• SEQ ID NOs:2 polypeptide sequences
• the TNF receptor family is characterized by an extracellular portion composed of several modules called, historically, "cysteine-rich pseudo-repeats.”
• a prototypical family member has four of these pseudo-repeats, each about 29-43 residues long, one right after the other, although members of the family have been found with as few as one repeat.
• a typical pseudo-repeat has 6 cysteine residues. They are called pseudo-repeats because, although they appear to originate from a common ancestral module, they may not repeat exactly.
• the crystal structures of TNF receptors revealed that each pseudo-repeat commonly corresponds to one folding domain, and that generally, multiple copies of pseudo-repeats fold into the same tertiary structure, held together internally by disulfide bonds.
• Sequence analysis of a deduced amino acid sequence of ztnfrl4 indicates the presence of one extracellular, cysteine-rich pseudo-repeat (comprising generally residues 50 to 80 of SEQ ED NO:2, although cysteines present upstream of this sequence may also be involved in biological function).
• This type of pseudo-repeat structure is most closely related to those of the TACITBCMA/BAFF-R/TWEAKR subgroup of TNF receptors.
• Figure 2 is an alignment of the cysteine-rich domains for this group of receptors.
• cysteine-rich domain of ztnfrl4 conserves four of the six cysteines typically seen in TNFR cysteine-rich domains (i.e., Cys51, Cys63, Cys66, and Cys79). Additionally, the Asp58 of ztnfrl4 conserves the Asp26 of BAFF-R that has been recently shown to be required for activity (Gordon et al. Biochemistry, 42: 5977-5983, 2003). Although there are typically twelve residues between the "cysteine 1-2" pair, in both XEDAR and ztnfrl4, there are eleven.
• cysteines in the general vicinity of this domain may also be involved in disulfide bonds important to the protein structure of the ztnfrl4 extracellular domain necessary for biological function, i.e., the binding of the ztnfrl4 ligand.
• the cysteine-rich pseudo-repeats are the known ligand binding sites for TNF ligands.
• the amino acid residues of ztnfrl4 most likely to be involved in ligand binding are within residues 18 to 80 of SEQ ID NO:2.
• the protein further comprises a signal sequence located at approximately residues 1 to 18 of SEQ ED NO:2.
• the protein also comprises a transmembrane domain (approximately residues 108 to 131 of SEQ ED NO:2) and a cytoplasmic, or signaling, domain (approximately residues 131 to 198 of SEQ ED NO:2).
• the mature membrane-bound ztnfrl4 protein comprises amino acid residue 18 to 198 of SEQ ED NO:2.
• the receptors encoded by the DNA sequences of SEQ ED NO: 1 is a member of the TNF receptor family.
• the linker region of ztnfrl4 may not be necessary for binding of the receptor to the ligand. Thus, portions of it may be deleted from a construct for the soluble receptor. Therefore, a construct for a soluble receptor would be predicted range between residues 18 to 108 of SEQ ED NO:2 to as long as residues 1 to 131 of SEQ ED NO:2, although shorter molecules that exhibit the desired biological activity, i.e., binding of the ligand of ztnfrl4, are also contemplated.
• the polynucleotides of the present invention have been seen in EST libraries derived from many tissues, however they are more predominant than average in those of the stomach, uterus, and cancerous tissues. En particular, expression in tumors such as neuroblastomas, melanomas, and lymphomas are over represented. Expression in tumor cells is consistent with other members of the TNFR family that have been found to be associated with growth regulation, differentiation and tumorigenesis. Chromosomal localization of the human ztnfrl4 to genomic clone AL390719 on human chromosome 1 has been determined and localized to lq36.3.
• TNFR genes Within 150 kb are two other TNFR genes: OX40 (TNRSF4) and GffR (TNRSF18), and four others (DR3, TNFR2, CD30, and 4- IBB) are within this genomic locus.
• mouse ztnfrl4 is located in a syntenic region on chromosome 4 (E region). As in the human genome, the same set of mouse TNFR genes is found in this location.
• the present invention provides polynucleotide molecules, including DNA and RNA molecules, that encode the ztnfrl4 polypeptides disclosed herein. Those skilled in the art will readily recognize that, in view of the degeneracy of the genetic code, considerable sequence variation is possible among these polynucleotide molecules.
• SEQ ED NO:33 is a degenerate DNA sequence that encompasses all DNAs that encode the ztnfrl4 polypeptide of SEQ ED NO:2. Those skilled in the art will recognize that the degenerate sequence of SEQ ED NO: 33 also provides all RNA sequences encoding SEQ ED NO:2 by substituting U for T. Thus, ztnfrl4 polypeptide-encoding polynucleotides comprising nucleotide 1 to nucleotide 1853 of SEQ ED NO:l and their RNA equivalents are contemplated by the present invention. Table 1 sets forth the one-letter codes used within SEQ ED NO:33 to denote degenerate nucleotide positions.
• “Resolutions” are the nucleotides denoted by a code letter. “Complement” indicates the code for the complementary nucleotide(s). For example, the code Y denotes either C or T, and its complement R denotes A or G, A being complementary to T, and G being complementary to C.
• Amino Letter Codons Degenerate Acid Code Codon Cys C TGC, TGT TGY Ser S AGC, AGT, TCA, TCC, TCG, TCT WSN Thr T ACA, ACC, ACG, ACT CAN Pro P CCA, CCC, CCG, CCT CCN Ala A GCA, GCC, GCG, GCT GCN Gly G GGA, GGC, GGG, GGT GGN Asn N AAC, AAT AAY Asp D GAC, GAT GAY Glu E GAA, GAG GAR Gin Q CAA, CAG CAR His H CAC, CAT CAY Arg R AGA, AGG, CGA, CGC, CGG, CGT MGN Lys K AAA, AAG AAR Met M ATG ATG lie I ATA, ATC, ATT ATH Leu L CTA, CTC, CTG, CTT, TTA, TTG YTN Val V GTA, GTC, GTG, GTT GTN Phe F TTC, TTT T
• Gln Z SAR Any X NNN One of ordinary skill in the art will appreciate that some ambiguity is introduced in determining a degenerate codon, representative of all possible codons encoding each amino acid.
• the degenerate codon for serine can, in some circumstances, encode arginine (AGR), and the degenerate codon for arginine (MGN) can, in some circumstances, encode serine (AGY).
• WSN degenerate codon for serine
• MGN degenerate codon for arginine
• AGY encode serine
• polynucleotides encompassed by the degenerate sequence may encode variant amino acid sequences, but one of ordinary skill in the art can easily identify such variant sequences by reference to the amino acid sequences of SEQ ED NO:2, 4, 30 or 32. Variant sequences can be readily tested for functionality as described herein.
• the present invention further provides polynucleotide molecules, including DNA and RNA molecules, encoding ztnfrl4 proteins.
• the polynucleotides of the present invention include the sense strand; the anti-sense strand; and the DNA as double-stranded, having both the sense and anti-sense strand annealed together by their respective hydrogen bonds.
• DNA sequences encoding ztnfrl4 proteins are set forth in SEQ ED NOs.T, 3, 29 and 31. DNA sequences encoding other ztnfrl4 proteins can be readily generated by those of ordinary skill in the art based on the genetic code. One of ordinary skill in the art will also appreciate that different species can exhibit "preferential codon usage.” Preferential codons for a particular species can be introduced into the polynucleotides of the present invention by a variety of methods known in the art. Introduction of preferential codon sequences into recombinant DNA can, for example, enhance production of the protein by making protein translation more efficient within a particular cell type or species.
• the degenerate codon sequences disclosed in SEQ ED NO:33 serves as a template for optimizing expression of polynucleotides in various cell types and species commonly used in the art and disclosed herein. Sequences containing preferential codons can be tested and optimized for expression in various species, and tested for functionality as disclosed herein.
• the isolated polynucleotides will hybridize to similar sized regions of SEQ ID NOs:l, 3, 29, 31, or a sequence complementary thereto under stringent conditions. Polynucleotide hybridization is well known in the art and widely used for many applications, see for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition.
• Polynucleotide hybridization exploits the ability of single stranded complementary sequences to form a double helix hybrid. Such hybrids include DNA-DNA, RNA-RNA and DNA-RNA.
• a nucleic acid molecule encoding a variant ztnfrl4 polypeptide can be hybridized with a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs:l, 3, 29 or 31 (or their complements) at 65°C overnight in ExpressHybTM Hybridization Solution (CLONTECH Laboratories, Inc., Palo Alto, CA).
• ExpressHybTM Hybridization Solution CLONTECH Laboratories, Inc., Palo Alto, CA.
• the nucleic acid molecules can be washed to remove non-hybridized nucleic acid molecules under stringent conditions, or under highly stringent conditions.
• Typical stringent washing conditions include washing in a solution of 0.5x - 2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55 - 65°C. That is, nucleic acid molecules encoding a variant ztnfrl4 polypeptide hybridize with a nucleic acid molecule having the nucleotide sequences of SEQ ED NOs:l, 3, 29 or 31 (or their complements) under stringent washing conditions, in which the wash stringency is equivalent to O.lx - 2x SSC with 0.1% SDS at 55 - 65°C, including O.lx SSC with 0.1% SDS at 55°C, or 2xSSC with 0.1% SDS at 65°C.
• SDS sodium dodecyl sulfate
• the present invention also contemplates ztnfrl4 variant nucleic acid molecules that can be identified using two criteria: a determination of the similarity between the encoded polypeptides with the amino acid sequences of SEQ ED NOs:2, 4, 30 and 32 (as described below), and a hybridization assay, as described above.
• Such ztnfrl4 variants include nucleic acid molecules that hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ED NOs:l, 3, 29 or 31 (or their complements) under stringent washing conditions, in which the wash stringency is equivalent to O.lx - 2x SSC with 0.1% SDS at 55 - 65°C, and (2) that encode a polypeptide having at least 80%, preferably 90%, more preferably, 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ED NOs:2, 4, 30 or 32.
• ztnfrl4 variants can be characterized as nucleic acid molecules (1) that hybridize with a nucleic acid molecule having the nucleotide sequence of SEQ ED NOs:l, 3, 29 or 31 (or their complements) under highly stringent washing conditions, in which the wash stringency is equivalent to O.lx - 0.2x SSC with 0.1% SDS at 50 - 65°C, and (2) that encode a polypeptide having at least 80%, preferably 90%, more preferably 95% or greater than 95% sequence identity to the amino acid sequence of SEQ ED NOs:2, 4, 30 or 32.
• the highly conserved amino acids in the cysteine-rich pseudo-repeat domains of ztnf ⁇ l4 can be used as a tool to identify new family members.
• reverse transcription-polymerase chain reaction RT-PCR
• RT-PCR reverse transcription-polymerase chain reaction
• highly degenerate primers designed from the ztnfrl4 sequences are useful for this purpose.
• the isolated polynucleotides of the present invention include DNA and RNA. Methods for preparing DNA and RNA are well known in the art.
• RNA is isolated from a tissue or cell that produces large amounts of ztnfrl4 RNA. Such tissues and cells are identified by Northern blotting (Thomas, Proc. Natl. Acad. Sci. USA 77:5201, 1980) and in situ hybridization. Total RNA can be prepared using guanidine isothiocyante extraction followed by isolation by centrifugation in a CsCl gradient (Chirgwin et al., Biochemistry 18:52-94, 1979). Poly (A)+ RNA is prepared from total RNA using the method of Aviv and Leder (Proc. Natl. Acad. Sci. USA 69:1408-12, 1972). Complementary DNA (cDNA) is prepared from poly(A)+
• genomic DNA can be isolated.
• Polynucleotides encoding ztnfrl4 polypeptides are then identified and isolated by, for example, hybridization or PCR.
• a full-length clone encoding ztnfrl4 can be obtained by conventional cloning procedures.
• Complementary DNA (cDNA) clones are preferred, although for some applications (e.g., expression in transgenic animals) it may be preferable to use a genomic clone, or to modify a cDNA clone to include at least one genomic intron.
• Methods for preparing cDNA and genomic clones are well known and within the level of ordinary skill in the art, and include the use of the sequence disclosed herein, or parts thereof, for probing or priming a library.
• Expression libraries can be probed with antibodies to ztnfrl4 or other specific binding partners.
• the invention also provides isolated and purified ztnfrl4 polynucleotide probes.
• Such polynucleotide probes can be RNA or DNA.
• DNA can be either cDNA or genomic DNA.
• Polynucleotide probes are single or double-stranded DNA or RNA, generally synthetic oligonucleotides, but may be generated from cloned cDNA or genomic sequences and will generally comprise at least 16 nucleotides, more often from 17 nucleotides to 25 or more nucleotides, sometimes 40 to 60 nucleotides, and in some instances a substantial portion, domain or even the entire ztnfrl4 gene or cDNA.
• the synthetic oligonucleotides of the present invention have at least 80% identity to a representative ztnfrl4 DNA sequence (SEQ ED NOs.T, 3, 29 or 31) or their complements.
• the invention also provides oligonucleotide probes or primers comprising at least 14 contiguous nucleotides of a polynucleotide of SEQ ED NOs:l, 3, 29 or 31 or a sequence complementary to SEQ ED NOs:l, 3, 29 or 31.
• Preferred regions from which to construct probes include the 5' and/or 3' coding sequences, ligand binding regions, and signal sequences, and the like.
• Techniques for developing polynucleotide probes and hybridization techniques are known in the art, see for example, Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY, 1991.
• the molecules can be labeled to provide a detectable signal, such as with an enzyme, biotin, a radionuclide, fluorophore, chemiluminescer, paramagnetic particle and the like, which are commercially available from many sources, such as Molecular Probes, Inc., Eugene, OR, and Amersham Corp., Arlington Heights, EL, using techniques that are well known in the art.
• a detectable signal such as with an enzyme, biotin, a radionuclide, fluorophore, chemiluminescer, paramagnetic particle and the like, which are commercially available from many sources, such as Molecular Probes, Inc., Eugene, OR, and Amersham Corp., Arlington Heights, EL, using techniques that are well known in the art.
• Such probes can also be used in hybridizations to detect the presence or quantify the amount of ztnfrl4 gene or mRNA transcript in a sample.
• ztnfrl4 polynucleotide probes could be used to hybridize to DNA or RNA targets for diagnostic purposes, using such techniques such as fluorescent in situ hybridization (FISH) or immunohistochemistry.
• Polynucleotide probes can be used to identify genes encoding ztnfrl4-like proteins.
• ztnfrl4 polynucleotides can be used as primers and/or templates in PCR reactions to identify other novel members of the TNFR family.
• Such probes can also be used to screen libraries for related sequences encoding novel tumor necrosis factor receptors. Such screening would be carried out under conditions of low stringency which would allow identification of sequences which are substantially homologous, but not requiring complete homology to the probe sequence.
• telomeres could be used to hybridize to counterpart sequences on individual chromosomes.
• Chromosomal identification and/or mapping of the ztnfrl4 gene could provide useful information about gene function and disease association.
• Many mapping techniques are available to one skilled in the art, for example, mapping somatic cell hybrids, and fluorescence in situ hybridization (FISH).
• FISH fluorescence in situ hybridization
• a preferred method is radiation hybrid mapping. Radiation hybrid mapping is a somatic cell genetic technique developed for constructing high-resolution, contiguous maps of mammalian chromosomes (Cox et al., Science 250:245-50, 1990). Partial or full knowledge of a gene's sequence allows the designing of PCR primers suitable for use with chromosomal radiation hybrid mapping panels.
• ztnfrl4 polynucleotide sequences disclosed herein can also be used as probes or primers to clone 5' non-coding regions of a ztnfrl4 gene.
• the upstream region includes AP-1 binding sites.
• binding site predictions in isolation are of little or no practical use for the identification of binding sites with functional roles in vivo.
• predicted binding sites likely to have sequence-specific functions can be selected by means of a conservation-based filter: The biological observation that regulatory regions are often more strongly conserved between species than other non-coding regions can be quantified to reveal patterns of conservation which have been called phylogenetic footprints (Fickett and Wasserman, Curr. Opin. Biotechnol. 11: 19-24, 2000). In particular, human-rodent comparisons have proven a valuable resource for the identification of functional regulatory elements (Wasserman et al., Nat. Genet.
• the transcription factor AP-2 is implicated in differentiation and transformation. Putative binding sites have been found in promoters of TNFR family members (Yoo et al, DNA Cell Biol. 15: 377-385, 1996). Recently published findings suggest that AP-2 inhibits the growth of cells by inducing cell cycle arrest and apoptosis and that the use of AP-2 alpha should be explored as a therapeutic strategy either alone or in combination with chemotherapy (Wajapeyee et al., J. Biol. Chem. epub Oct 9, 2003). Genes which are controlled by AP-2 may be over-expressed in cancer cells.
• NF-AT plays an important role in the control of T cell activation and differentiation and likely also of the cell cycle and apoptosis of T lymphocytes (Serfling et al., Biochim Biophys Acta. 1498: 1-18, 2000).
• This gene region is expected to provide for specific expression in tissues of the stomach, uterus, and various cancers including neuroblastomas, melanomas, and lymphomas
• promoter elements from a ztnfrl4 gene including the NF- AP and AP-2 binding sites could thus be used to direct the tissue-specific expression of heterologous genes in, for example, transgenic animals or patients treated with gene therapy.
• Cloning of 5' flanking sequences also facilitates production of ztnfrl4 proteins by "gene activation" as disclosed in U.S. Patent No. 5,641,670. Briefly, expression of an endogenous ztnfrl4 gene in a cell is altered by introducing into the ztnfrl4 locus a DNA construct comprising at least a targeting sequence, a regulatory sequence, an exon, and an unpaired splice donor site.
• the targeting sequence is a ztnfrl4 5' non-coding sequence that permits homologous recombination of the construct with the endogenous ztnfrl4 locus, whereby the sequences within the construct become operably linked with the endogenous ztnfrl4 coding sequence.
• an endogenous ztnfrl4 promoter can be replaced or supplemented with other regulatory sequences to provide enhanced, tissue-specific, or otherwise regulated expression.
• the polynucleotides of the present invention can also be synthesized using DNA synthesizers. Currently the method of choice is the phosphoramidite method.
• each complementary strand is made separately.
• the production of short genes 60 to 80 bp is technically straightforward and can be accomplished by synthesizing the complementary strands and then annealing them.
• longer genes >300 bp
• synthetic genes double-stranded
• synthetic genes are assembled in modular form from single-stranded fragments that are from 20 to 100 nucleotides in length.
• the present invention further provides counterpart polypeptides and polynucleotides from other species (orthologs). These species include, but are not limited to mammalian, avian, amphibian, reptile, fish, insect and other vertebrate and invertebrate species.
• ztnfrl4 polypeptides from other mammalian species, including murine, porcine, ovine, bovine, canine, feline, equine, and other primate polypeptides.
• Orthologs of human ztnf ⁇ l4 can be cloned using information and compositions provided by the present invention in combination with conventional cloning techniques.
• a cDNA can be cloned using mRNA obtained from a tissue or cell type that expresses ztnfrl4 as disclosed herein.
• tissue would include, for example, tissues of the stomach, uterus, neuroblastomas, melanomas, and lymphoma.
• Suitable sources of mRNA can be identified by probing Northern blots with probes designed from the sequences disclosed herein.
• a library is then prepared from mRNA of a positive tissue or cell line.
• a ztnfrl4 -encoding cDNA can then be isolated by a variety of methods, such as by probing with a complete or partial human cDNA or with one or more sets of degenerate probes based on the disclosed sequences.
• a cDNA can also be cloned using the polymerase chain reaction, or PCR (Mullis, U.S. Patent No. 4,683,202), using primers designed from the representative human ztnfrl4 sequences disclosed herein.
• the cDNA library can be used to transform or transfect host cells, and expression of the cDNA of interest can be detected with an antibody to ztnfrl4 polypeptide. Similar techniques can also be applied to the isolation of genomic clones. Those skilled in the art will recognize that the sequences disclosed in SEQ ID NO:l represents a single allele of human ztnfrl4 and that allelic variation and alternative splicing are expected to occur.
• the exon locations for the gene disclosed in SEQ ID NO: 1 are nucleotide positions 1-32, 33-145, 146-239, 240-315, 316-411, 412- 477, 478-612, 613-638, 639-669, and 670-1834.
• ztnfrl4x2 has been identified and is disclosed in SEQ ED NOS: 29 and 30 and ztnfrl4x3 has been identified and disclosed in SEQ ED NOS: 31 and 32.
• These variants differ from the base ztnfrl4 sequence in that ztnfrl4x2 adds an exon 9B, while ztnfrx3 adds an exon 7B, which contains a stop codon.
• Allelic variants of all three of these sequences can be cloned by probing cDNA or genomic libraries from different individuals according to standard procedures.
• Allelic variants of the DNA sequences shown in SEQ ED NO:l are within the scope of the present invention, as are proteins which are allelic variants of SEQ ED NO:2.
• cDNAs generated from alternatively spliced mRNAs, which retain the properties of the ztnfrl4 polypeptide are included within the scope of the present invention, as are polypeptides encoded by such cDNAs and mRNAs.
• Allelic variants and splice variants of these sequences can be cloned by probing cDNA or genomic libraries from different individuals or tissues according to standard procedures known in the art.
• the present invention also provides isolated ztnfrl4 polypeptides that are substantially similar to the polypeptides of SEQ ED NOs:2, 4, 30 and 32 and their orthologs. Such polypeptides will more preferably be at least 90% identical, and more preferably 95% or more identical to SEQ ID NOs:2, 4, 30 and 32 and their orthologs. Percent sequence identity is determined by conventional methods. See, for example, Altschul et al, Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9, 1992.
• Sequence identity of polynucleotide molecules is determined by similar methods using a ratio as disclosed above. Those skilled in the art appreciate that there are many established algorithms available to align two amino acid sequences.
• the "FASTA" similarity search algorithm of Pearson and Lipman is a suitable protein alignment method for examining the level of identity shared by an amino acid sequence disclosed herein and the amino acid sequence of a putative variant ztnfrl4 .
• the FASTA algorithm is described by Pearson and Lipman, Proc. Nat'l Acad. Sci. USA 85:2444 (1988), and by Pearson, Meth. Enzvmol. 183:63 (1990).
• the trimmed initial regions are examined to determine whether the regions can be joined to form an approximate alignment with gaps.
• the highest scoring regions of the two amino acid sequences are aligned using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman and Wunsch, J. Mol. Biol. 48:444 (1970); Sellers, SLAM J. Appl. Math. 26:787 (1974)), which allows for amino acid insertions and deletions.
• the present invention includes nucleic acid molecules that encode a polypeptide having one or more conservative amino acid changes, compared with the amino acid sequences of SEQ ED NOs:2, 4, 30 and 32.
• the BLOSUM62 table is an amino acid substitution matrix derived from about 2,000 local multiple alignments of protein sequence segments, representing highly conserved regions of more than 500 groups of related proteins (Henikoff and Henikoff, Proc. Nat'l Acad. Sci. USA 89:10915 (1992)). Accordingly, the BLOSUM62 substitution frequencies can be used to define conservative amino acid substitutions that may be introduced into the amino acid sequences of the present invention.
• the language "conservative amino acid substitution” refers to a substitution represented by a BLOSUM62 value of greater than -1.
• an amino acid substitution is conservative if the substitution is characterized by a BLOSUM62 value of 0, 1, 2, or 3.
• Preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 1 (e.g., 1, 2 or 3), while more preferred conservative amino acid substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or 3).
• Conservative amino acid changes in an ztnfrl4 gene can be introduced by substituting nucleotides for the nucleotides recited in SEQ ED NOs:l, 3, 29 and 31.
• Such “conservative amino acid” variants can be obtained, for example, by oligonucleotide- directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the polymerase chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22; and McPherson (ed.), Directed Mutagenesis: A Practical Approach (ERL Press 1991)).
• the ability of such variants to modulate cell-cell interactions, apoptosis, and inflammation can be determined using a standard method, such as the assay described herein.
• a variant ztnfrl4 polypeptide can be identified by the ability to specifically bind anti- ztnfrl4 antibodies.
• Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-502, 1991).
• site-directed mutagenesis or alanine-scanning mutagenesis Cunningham and Wells, Science 244: 1081-5, 1989; Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-502, 1991.
• single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for biological activity as disclosed below to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., X Biol. Chem. 271:4699-708, 1996.
• Sites of receptor-ligand interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related TNFR-like molecules.
• variant DNAs are generated by in vitro homologous recombination by random fragmentation of a parent DNA followed by reassembly using PCR, resulting in randomly introduced point mutations.
• This technique can be modified by using a family of parent DNAs, such as allelic variants or DNAs from different species, to introduce additional variability into the process. Selection or screening for the desired activity, followed by additional iterations of mutagenesis and assay provides for rapid "evolution" of sequences by selecting for desirable mutations while simultaneously selecting against detrimental changes. Mutagenesis methods as disclosed herein can be combined with high- throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides in host cells.
• Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using modern equipment. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide of interest, and can be applied to polypeptides of unknown structure.
• the gene encodes a polypeptide that is characterized by its cell-cell interaction activity, including but not limited to ztnfrl4 ligand binding, tumorigensis, cell proliferation, or by the ability to bind specifically to an anti-ztnfrl4 antibody.
• variant ztnfrl4 genes encode polypeptides which exhibit at least 50%, and preferably, greater than 70, 80, or 90%, of the activity of polypeptide encoded by the human ztnfrl4 gene described herein.
• Variant ztnfrl4 polypeptides or substantially homologous ztnfrl4 polypeptides are characterized as having one or more amino acid substitutions, deletions or additions.
• polypeptides of from 40 to 2000 amino acid residues that comprise a sequence that is at least 85%, preferably at least 90%, and more preferably 95% or more identical to the corresponding region of SEQ ID NOs:2, 4, 30 and 32.
• Polypeptides comprising affinity tags can further comprise a proteolytic cleavage site between the ztnfrl4 polypeptide and the affinity tag. Preferred such sites include thrombin cleavage sites and factor Xa cleavage sites.
• a proteolytic cleavage site between the ztnfrl4 polypeptide and the affinity tag. Preferred such sites include thrombin cleavage sites and factor Xa cleavage sites.
• any ztnfrl4 polypeptide, including variants and fusion proteins one of ordinary skill in the art can readily generate a fully degenerate polynucleotide sequence encoding that variant using the information set forth in Tables 1 and 2 above.
• those of skill in the art can use standard software to devise ztnfrl4 variants based upon the nucleotide and amino acid sequences described herein.
• the present invention includes a computer-readable medium encoded with a data structure that provides at least one of the following sequences: SEQ ED NOs:l, 2, 3, 4, 29, 30, 31, or 32.
• Suitable forms of computer-readable media include magnetic media and optically- readable media. Examples of magnetic media include a hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk cache, and a ZEP disk.
• Optically readable media are exemplified by compact discs (e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, andDVD+RW).
• compact discs e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-recordable
• DVD digital versatile/video discs
• the present invention further provides a variety of other polypeptide fusions and related multimeric proteins comprising one or more polypeptide fusions.
• the cysteine-rich pseudo-repeat, or cytoplasmic polypeptide domains can be prepared as a fusion to a dimerizing protein, as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584.
• Preferred dimerizing proteins in this regard include other cysteine-rich pseudo-repeat or cytoplasmic polypeptide domains, or polypeptides comprising other members of the TNF receptor family of proteins, such as, for example, APO4, TNFR-I, TNFR-U, and TNFR-III .
• chimeras can be prepared with the extracellular portion of cytokine receptors.
• the extracellular domain of erythropoietin can be fused to the linker, transmembrane, and cytoplasmic domain of ztnfrl4 polypeptides to produce dimerization.
• These polypeptide domain fusions can be expressed in genetically engineered cells to produce a variety of multimeric TNFR-like analogs.
• Fusion proteins can be prepared by methods known to those skilled in the art by preparing each component of the fusion protein and chemically conjugating them.
• a polynucleotide encoding both components of the fusion protein in the proper reading frame can be generated using known techniques and expressed by the methods described herein.
• part or all of a domain(s) conferring a biological function may be swapped between ztnfrl4 of the present invention with the functionally equivalent domain(s) from another family member, such as APO4, TNFR-I, TNFR-U, and TNFR-III.
• domains include, but are not limited to, conserved motifs such as the cysteine-rich pseudo-repeat, transmembrane, and cytoplasmic domains.
• fusion proteins would be expected to have a biological functional profile that is the same or similar to polypeptides of the present invention or other known TNFR family proteins (e.g. APO4, TNFR-I, TNFR-EI, and TNFR-IH), depending on the fusion constructed. Moreover, such fusion proteins may exhibit other properties as disclosed herein. Moreover, using methods described in the art, polypeptide fusions, or hybrid ztnfrl4 proteins, are constructed using regions or domains of the inventive ztnfrl4 in combination with those of other TNFR molecules, (e.g.
• APO4, TNFR-I, TNFR-U, and TNFR-EH), or heterologous proteins (Sambrook et al., ibid., Altschul et al., ibid., Picard, Cur. Opin. Biology, 5:511-5, 1994, and references therein). These methods allow the determination of the biological importance of larger domains or regions in a polypeptide of interest. Such hybrids may alter reaction kinetics, binding, constrict or expand the substrate specificity, or alter tissue and cellular localization of a polypeptide, and can be applied to polypeptides of unknown structure.
• Auxiliary domains can be fused to ztnfrl4 polypeptides to target them to specific cells, tissues, or macromolecules (e.g., tissues of the stomach, uterus, neuroblastoma, melanoma and lymphoma).
• a protease domain could be targeted to a predetermined cell type by fusing it to the cysteine-rich pseudo-repeat domains (i.e., residues 30 to 108 of SEQ ED NO:2, or a portion thereof which has been shown to bind the ztnfrl4 ligand).
• cysteine-rich pseudo-repeat domains i.e., residues 30 to 108 of SEQ ED NO:2, or a portion thereof which has been shown to bind the ztnfrl4 ligand.
• cysteine-rich pseudo-repeat domains can be fused to two or more moieties, such as an affinity tag for purification and a targeting domains.
• Polypeptide fusions can also comprise one or more cleavage sites, particularly between domains. See, Tuan et al., Connective Tissue Research 34:1-9, 1996.
• Polypeptide fusions of the present invention will generally contain not more than about 1,500 amino acid residues, preferably not more than about 1,200 residues, more preferably not more than about 1,000 residues, and will in many cases be considerably smaller. For example, residues of ztnfrl4 polypeptide can be fused to E.
• coli b-galactosidase (1,021 residues; see Casadaban et al., J. Bacteriol. 143:971-980, 1980), a 10-residue spacer, and a 4-residue factor Xa cleavage site.
• residues of ztnfrl4 polypeptide can be fused to maltose binding protein (approximately 370 residues) or a 4-residue cleavage site.
• ztnfrl4 polypeptides or fragments thereof may also be prepared through chemical synthesis.
• ztnfrl4 polypeptides may be monomers or multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may not include an initial methionine amino acid residue.
• the invention also provides soluble ztnfrl4 receptors, used to form fusion or chimeric proteins with human Ig, as Glu-Glu tagged proteins, or FLAGTM-tagged proteins.
• One such construct is comprises residues 30 to 108 of SEQ ID NO:2, fused to human Ig, another comprises residues 50 to 108 of SEQ ED NO:2 fused to human Ig.
• ztnfrl4 or ztnfrl4-Ig chimeric proteins are used, for example, to confirm ztnfrl4 binds to its ligand, as well as to test agonists and antagonists of ligand binding.
• soluble ztnfrl4 cells expressing the ztnfrl4 ligand can be identified by fluorescence immunocytometry or immunohistochemistry.
• the soluble fusion proteins or soluble Ig fusion protein is useful in studying the distribution of the ztnfrl4 ligand in tissues or specific cell lineages, and to provide insight into receptor/ligand biology.
• a soluble ztnfrl4 receptor extracellular ligand- binding region can be expressed as a chimera with immunoglobulin heavy chain constant regions, typically an F c fragment, which contains two constant region domains and a hinge region, but lacks the variable region.
• immunoglobulin heavy chain constant regions typically an F c fragment, which contains two constant region domains and a hinge region, but lacks the variable region.
• Such fusions are typically secreted as multimeric molecules, wherein the Fc portions are disulfide bonded to each other and two receptor polypeptides are arrayed in close proximity to each other. Fusions of this type can be used to affinity purify the cognate ligand from solution, as an in vitro assay tool, to block signals in vitro by specifically titrating out ligand, and as antagonists in vivo by administering them to block ligand stimulation.
• a ztnfrl4 -Ig fusion protein (chimera) is added to a sample under conditions that facilitate receptor- ligand binding (typically near-physiological temperature, pH, and ionic strength).
• the chimera-ligand complex is then separated by the mixture using protein A, which is immobilized on a solid support (e.g., insoluble resin beads).
• the ligand is then eluted using conventional chemical techniques, such as with a salt or pH gradient.
• the chimera itself can be bound to a solid support, with binding and elution carried out as above.
• the chimeras are bound to a support via the F c region and used in an ELIS A format.
• the ztnfrl4 DNA may be linked to a second DNA segment encoding a sequence other than its own secretory peptide, such as a t-PA secretory peptide.
• a C-terminal extension such as substance P, Flag peptide (Hopp et al., Bio/Technology 6:1204-1210, 1988; available from Eastman Kodak Co., New Haven, CT), maltose binding protein, or another polypeptide or protein for which an antibody or other specific binding agent is available, can be fused to the ztnfrl4 polypeptide.
• the present invention also includes "functional fragments" of ztnfrl4 polypeptides and nucleic acid molecules encoding such functional fragments.
• Routine deletion analyses of nucleic acid molecules can be performed to obtain functional fragments of a nucleic acid molecule that encodes an ztnfrl4 polypeptide.
• DNA molecules having the nucleotide sequence of SEQ ED NOs:l and 3 can be digested with Bal3l nuclease to obtain a series of nested deletions.
• the fragments are then inserted into expression vectors in proper reading frame, and the expressed polypeptides are isolated and tested for cell-cell interactions, the ability to bind the ztnfrl4 ligand, the ability to reduce known ligand activity, or for the ability to bind anti-ztnfrl4 antibodies.
• exonuclease digestion is to use oligonucleotide-directed mutagenesis to introduce deletions or stop codons to specify production of a desired fragment.
• particular fragments of an ztnfrl4 gene can be synthesized using the polymerase chain reaction. Standard methods for identifying functional domains are well-known to those of skill in the art.
• the present invention also contemplates functional fragments of an ztnfrl4 gene that has amino acid changes, compared with the amino acid sequences of SEQ ED NOs:2, 4, 30 and 32.
• a variant ztnfrl4 gene can be identified on the basis of structure by determining the level of identity with nucleotide and amino acid sequences of SEQ ED NOs:l, 2, 3, 4, 29, 30, 31, and 32 as discussed above.
• An alternative approach to identifying a variant gene on the basis of structure is to determine whether a nucleic acid molecule encoding a potential variant ztnfrl4 gene can hybridize to a nucleic acid molecule having the nucleotide sequence of SEQ ED NO:l, as discussed above.
• Using the methods discussed herein one of ordinary skill in the art can identify and/or prepare a variety of polypeptide fragments or variants of SEQ ED NO:2 or that retain the ligand-binding, or intracellular signaling activity of the wild-type ztnfrl4 protein.
• Such polypeptides may include additional amino acids from, for example, cysteine-rich pseudo-repeats, a linker domain, a transmembrane and cytoplasmic domains, including amino acids responsible for intracellular signaling; fusion domains; affinity tags; and the like.
• cysteine -rich pseudo repeats i.e., residues 30 to 80 of SEQ ED NO:2, residues 50 to 80 of SEQ ED NO:2, and/or residues 30 to 108 of SEQ ED NO:2
• cysteine-rich pseudo repeats can be substituted for the cysteine-rich pseudo repeats from other TNFR family member to increase or decrease ligand binding, or specificity.
• polypeptides of the present invention are polypeptides that comprise an epitope-bearing portion of a protein as shown in SEQ ED NO:2.
• An "epitope” is a region of a protein to which an antibody can bind. See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002, 1984.
• Epitopes can be linear or conformational, the latter being composed of discontinuous regions of the protein that form an epitope upon folding of the protein. Linear epitopes are generally at least 6 amino acid residues in length.
• Relatively short synthetic peptides that mimic part of a protein sequence are routinely capable of eliciting an antiserum that reacts with the partially mimicked protein. See, Sutcliffe et al., Science 219:660-666, 1983.
• Antibodies that recognize short, linear epitopes are particularly useful in analytic and diagnostic applications that employ denatured protein, such as Western blotting (Tobin, Proc. Natl. Acad. Sci. USA 76:4350-4356, 1979), or in the analysis of fixed cells or tissue samples.
• Antibodies to linear epitopes are also useful for detecting fragments of ztnfrl4 , such as might occur in body fluids or cell culture media.
• Antigenic, epitope-bearing polypeptides of the present invention are useful for raising antibodies, including monoclonal antibodies, that specifically bind to a ztnfrl4 protein.
• Antigenic, epitope-bearing polypeptides contain a sequence of at least six, preferably at least nine, more preferably from 15 to about 30 contiguous amino acid residues of a ztnfrl4 protein (e.g., SEQ ED NO:2). Polypeptides comprising a larger portion of a ztnfrl4 protein, i.e. from 30 to 50 residues up to the entire sequence, are included.
• the amino acid sequence of the epitope-bearing polypeptide is selected to provide substantial solubility in aqueous solvents, that is the sequence includes relatively hydrophilic residues, and hydrophobic residues are substantially avoided.
• Preferred such regions include the cysteine-rich pseudo-repeats, the linker domain, the transmembrane domain, or the cytoplasmic domain ztnfrl4 and fragments thereof.
• the present invention also provides polypeptide fragments or peptides comprising an epitope-bearing portion of an ztnfrl4 polypeptide described herein.
• Such fragments or peptides may comprise an "immunogenic epitope," which is a part of a protein that elicits an antibody response when the entire protein is used as an immunogen.
• Immunogenic epitope-bearing peptides can be identified using standard methods (see, for example, Geysen et al, Proc. Nafl Acad. Sci. USA 81:3998 (1983)).
• polypeptide fragments or peptides may comprise an "antigenic epitope,” which is a region of a protein molecule to which an antibody can specifically bind.
• Certain epitopes consist of a linear or contiguous stretch of amino acids, and the antigenicity of such an epitope is not disrupted by denaturing agents.
• antigenic epitope-bearing peptides and polypeptides of the present invention are useful to raise antibodies that bind with the polypeptides described herein.
• Antigenic epitope-bearing peptides and polypeptides contain at least four to ten amino acids, preferably at least ten to fifteen amino acids, more preferably 15 to 30 amino acids of SEQ ED NOs:2, 4, 30 and 32.
• epitope-bearing peptides and polypeptides can be produced by fragmenting an ztnfrl4 polypeptide, or by chemical peptide synthesis, as described herein.
• epitopes can be selected by phage display of random peptide libraries (see, for example, Lane and Stephen. Curr. Opin. Immunol. 5:268 (1993), and Cortese et al, Curr. Opin. Bio ⁇ echnol. 7:616 (1996)). Standard methods for identifying epitopes and producing antibodies from small peptides that comprise an epitope are described, for example, by Mole, "Epitope Mapping," in Methods in Molecular Biology, Vol.
• ztnfrl4 polypeptides can also be used to prepare antibodies that specifically bind to ztnfrl4 epitopes, peptides or polypeptides.
• antigenic, epitope- bearing polypeptides contain a sequence of at least 6, preferably at least 9, and more preferably at least 15 to about 30 contiguous amino acid residues of a ztnfrl4 polypeptide.
• Polypeptides comprising a larger portion of a ztnfrl4 polypeptide, i.e., from 30 to 10 residues up to the entire length of the amino acid sequence are included.
• Antigens or immunogenic epitopes can also include attached tags, adjuvants and carriers, as described herein.
• Suitable antigens include the ztnfrl4 polypeptides encoded by SEQ ED NO: 2 from amino acid number 1 to amino acid number 198; polypeptides encoded by SEQ ED NO: 30 from amino acid number 1 to amino acid number 308; polypeptides encoded by SEQ ED NO: 32 from amino acid number 1 to amino acid number 185.
• potential antigenic sites in ztnfrl4 can be identified using the Jameson-Wolf method, Jameson and Wolf, CABIOS 4:181, (1988), as implemented by the PROTEAN program (version 3.14) of LASERGENE (DNASTAR; Madison, WI). Default parameters were used in this analysis.
• Antibodies from an immune response generated by inoculation of an animal with these antigens can be isolated and purified as described herein. Methods for preparing and isolating polyclonal and monoclonal antibodies are well known in the art. See, for example, Current Protocols in Immunology, Cooligan, et al. (eds.), National Institutes of Health, John Wiley and Sons, Inc., 1995; Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, NY, 1989; and Hurrell, J. G. R., Ed., Monoclonal Hybridoma Antibodies: Techniques and Applications, CRC Press, Inc., Boca Raton, FL, 1982.
• polyclonal antibodies can be generated from inoculating a variety of warm-blooded animals such as horses, cows, goats, sheep, dogs, chickens, rabbits, mice, and rats with a ztnfrl4 polypeptide or a fragment thereof.
• the immunogenicity of a ztnfrl4 polypeptide may be increased through the use of an adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant.
• Polypeptides useful for immunization also include fusion polypeptides, such as fusions of ztnfrl4 or a portion thereof with an immunoglobulin polypeptide or with maltose binding protein.
• the polypeptide immunogen may be a full-length molecule or a portion thereof. Ii the polypeptide portion is "hapten-like", such portion may be advantageously joined or linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for immunization.
• a macromolecular carrier such as keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid
• KLH keyhole limpet hemocyanin
• BSA bovine serum albumin
• tetanus toxoid tetanus toxoid
• antibodies includes polyclonal antibodies, affinity-purified polyclonal antibodies, monoclonal antibodies, and antigen-binding fragments, such as F(ab')2 and Fab proteolytic fragments.
• Non-human antibodies may be humanized by grafting non-human CDRs onto human framework and constant regions, or by incorporating the entire non- human variable domains (optionally "cloaking" them with a human-like surface by replacement of exposed residues, wherein the result is a "veneered” antibody).
• humanized antibodies may retain non-human residues within the human variable region framework domains to enhance proper binding characteristics.
• Alternative techniques for generating or selecting antibodies useful herein include in vitro exposure of lymphocytes to ztnfrl4 protein or peptide, and selection of antibody display libraries in phage or similar vectors (for instance, through use of immobilized or labeled ztnfrl4 protein or peptide).
• Genes encoding polypeptides having potential ztnfrl4 polypeptide binding domains can be obtained by screening random peptide libraries displayed on phage (phage display) or on bacteria, such as E. coli.
• Nucleotide sequences encoding the polypeptides can be obtained in a number of ways, such as through random mutagenesis and random polynucleotide synthesis.
• random peptide display libraries can be used to screen for peptides which interact with a known target which can be a protein or polypeptide, such as a ligand or receptor, a biological or synthetic macromolecule, or organic or inorganic substances.
• a known target which can be a protein or polypeptide, such as a ligand or receptor, a biological or synthetic macromolecule, or organic or inorganic substances.
• Techniques for creating and screening such random peptide display libraries are known in the art (Ladner et al., US Patent NO. 5,223,409; Ladner et al., US Patent NO. 4,946,778; Ladner et al., US Patent NO. 5,403,484 and Ladner et al., US Patent NO.
• Random peptide display libraries can be screened using the ztnfrl4 sequences disclosed herein to identify proteins which bind to ztnfrl4 .
• binding proteins which interact with ztnf ⁇ l4 polypeptides can be used for tagging cells; for isolating homolog polypeptides by affinity purification; they can be directly or indirectly conjugated to drugs, toxins, radionuclides and the like. These binding proteins can also be used in analytical methods such as for screening expression libraries and neutralizing activity. The binding proteins can also be used for diagnostic assays for determining circulating levels of polypeptides; for detecting or quantitating soluble polypeptides as marker of underlying pathology or disease. These binding proteins can also act as ztnfrl4 "antagonists" to block ztnfrl4 binding and signal transduction in vitro and in vivo.
• binding proteins additionally includes antibodies to ztnfrl4 polypeptides, the cognate ligand of ztnfrl4 polypeptides, proteins useful for purification of ztnfrl4 polypeptides, and proteins associated with the cytoplasmic domain (residues 131 to 198 of SEQ ID NO:2).
• cytoplasmic domain associated peptides also called cytoplasmic mediators, function in intracellular signaling of ztnfrl4 polypeptides.
• cytoplasmic mediators include, but are not limited to TRAP-1, TRADD, RIP, TRAF-1-6, LAP-1, FADD/MORT-1, and CAP-1.
• Antibodies are determined to be specifically binding if they exhibit a threshold level of binding activity (to a ztnfrl4 polypeptide, peptide or epitope) of at least 10-fold greater than the binding affinity to a control (non-ztnfrl4 ) polypeptide.
• the binding affinity of an antibody can be readily determined by one of ordinary skill in the art, for example, by Scatchard analysis (Scatchard, G., Ann. NY Acad.
• assays known to those skilled in the art can be utilized to detect antibodies which specifically bind to ztnfrl4 proteins or peptides. Exemplary assays are described in detail in Antibodies: A Laboratory Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988. Representative examples of such assays include: concurrent immunoelectrophoresis, radioimmunoassay, radioimmuno- precipitation, enzyme-linked immunosorbent assay (ELISA), dot blot or Western blot assay, inhibition or competition assay, and sandwich assay. Ln addition, antibodies can be screened for binding to wild-type versus mutant ztnfrl4 protein or polypeptide.
• Antibodies to ztnfrl4 may be used for immunohistochemical tagging cells that express ztnfrl4; for isolating ztnfrl4 by affinity purification; for diagnostic assays for determining circulating levels of ztnfrl4 polypeptides; for detecting or quantitating soluble ztnfrl4 as marker of underlying pathology or disease; in analytical methods employing FACS; for screening expression libraries; for generating anti-idiotypic antibodies; and as neutralizing antibodies or as antagonists to block ztnfrl4 in vitro and in vivo.
• Suitable direct tags or labels include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like; indirect tags or labels may feature use of biotin-avidin or other complement/anti-complement pairs as intermediates.
• Antibodies herein may also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications.
• antibodies to ztnfrl4 or fragments thereof may be used in vitro to detect denatured ztnfrl4 or fragments thereof in assays, for example, Western Blots or other assays known in the art.
• the soluble ztnfrl4 is useful in studying the distribution of ligands on tissues or specific cell lineages, and to provide insight into receptor/ligand biology. Using labeled ztnfrl4, cells expressing the ligand are identified by fluorescence immunocytometry or immunocytochemistry. Application may also be made of the specificity of TNF receptors for their ligands. Antibodies can be made to soluble ztnfrl4 polypeptides which are FLAGTM tagged. Alternatively, such polypeptides form a fusion protein with Human Ig.
• antiserum containing polypeptide antibodies to FLAGTM-tagged soluble ztnfrl4 can be used in analysis of tissue distribution of ztnfrl4 by immunohistochemistry on human or primate tissue.
• These soluble ztnfrl4 polypeptides can also be used to immunize mice in order to produce monoclonal antibodies to a soluble human ztnfrl4 polypeptide.
• Monoclonal antibodies to a soluble human ztnfrl4 polypeptide can also be used to mimic ligand receptor coupling, resulting in activation or inactivation of the ligand/receptor pair.
• cross-linking anti- soluble CD40 monoclonal antibodies provides a stimulatory signal to B cells that have been sub-optimally activated with anti-IgM or LPS, and results in proliferation and immunoglobulin production.
• monoclonal antibodies act as antagonists when used in solution by blocking activation of the receptor.
• Monoclonal antibodies to ztnfrl4 can be used to determine the distribution, regulation and biological interaction of the ztnfrl4 /ztnfrl4 -ligand pair on specific cell lineages identified by tissue distribution studies.
• Soluble receptors or antibodies to the receptor can also be directly or indirectly conjugated to drugs, toxins, radionuclides and the like, and these conjugates used for in vivo diagnostic or therapeutic applications.
• polypeptides or antibodies of the present invention can be used to identify or treat tissues or organs that express a corresponding anti-complementary molecule (ligand or antigen, respectively, for instance).
• ztnfrl4 polypeptides or anti-ztnfrl4 antibodies, or bioactive fragments or portions thereof can be coupled to detectable or cytotoxic molecules and delivered to a mammal having cells, tissues or organs that express the anti-complementary molecule.
• Suitable detectable molecules may be directly or indirectly attached to the polypeptide or antibody, and include radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles and the like.
• Suitable cytotoxic molecules may be directly or indirectly attached to the polypeptide or antibody, and include bacterial or plant toxins (for instance, diphtheria toxin, Pseudomonas exotoxin, ricin, abrin and the like), as well as therapeutic radionuclides, such as iodine-131, rhenium-188 or yttrium-90 (either directly attached to the polypeptide or antibody, or indirectly attached through means of a chelating moiety, for instance).
• Polypeptides or antibodies may also be conjugated to cytotoxic drugs, such as adriamycin.
• cytotoxic drugs such as adriamycin.
• the detectable or cytotoxic molecule can be conjugated with a member of a complementary/ anticomplementary pair, where the other member is bound to the polypeptide or antibody portion.
• biotin/streptavidin is an exemplary complementary/ anticomplementary pair.
• polypeptide-toxin fusion proteins or antibody- toxin fusion proteins can be used for targeted cell or tissue inhibition or ablation (for instance, to treat cancer or inflammatory cells or tissues).
• a fusion protein including only the cysteine-rich pseudo-repeats may be suitable for directing a detectable molecule, a cytotoxic molecule or a complementary molecule to a cell or tissue type of interest.
• the corresponding ligand to ztnfrl4 can be conjugated to a detectable or cytotoxic molecule and provide a generic targeting vehicle for cell/tissue-specific delivery of generic anti-complementary-detectable/ cytotoxic molecule conjugates.
• certain molecular markers can aid in identifying the existence and prognosis of disease. Such markers include, for example, p53, C-Ki-ras, and c-erbB-2.
• polynucleotide probes can be used as a diagnostic marker to determine if such disease tissues are present.
• Hybridization techniques are taught elsewhere in this application and are widely known by one of skill in the art.
• Such polynucleotides, fragments thereof, and fusions thereto can also be used to incorporate the proper polynucleotide sequence into a tissue, cell line or organism defective in the proper gene, as is also taught elsewhere in this application.
• said polunucleotides, fragments thereof, and fusions thereto can also be administered in the presence of an agent that allows the DNA to traverse the cell membrane and act as a tag for cell ablation to a therapeutic agent with an appropriate binding partner. Ln this manner cells which contain ztnfrl4 polynucleotides can be inhibited or destroyed. Ztnfrl4 polypeptides, fragments thereof, and fusions thereto, can be used both diagnostically and therapeutically.
• Such ztnfrl4 polypeptides can be used as a marker for identifying tumor cells, such as, for example, melanoma, lung carcinoma, breast carcinoma, osteosarcoma, and lymphoma.
• tumor cells such as, for example, melanoma, lung carcinoma, breast carcinoma, osteosarcoma, and lymphoma.
• this diagnosis can be determined by measuring ztnfrl4 polypeptides, fragments thereof, and fusions thereto in body fluids, including, but not limited to, blood, plasma, saliva, urine, lavage fluid and biopsy fluid.
• membrane bound polypeptide ztnfrl4 polypeptides, fragments thereof, and fusions thereto can be measured in tissue biopsies (i.e., excised from the body) as well as locally (i.e., epithlelial surfaces) using imaging and or visualization.
• tissue biopsies i.e., excised from the body
• locally i.e., epithlelial surfaces
• the targeting of such disease tissues will be helpful in treatment options. For example, if the spread of disease is limited, such visualization will aid a surgeon in resection of disease tissue.
• the presence of membrane bound ztnfrl4 can be used as a target for a ztnfrl4 binding protein (including its ligand or antibodies) that has been fused or conjugated to an inhibitory or ablative agent.
• ztnfrl4 -cytokine fusion proteins or antibody- cytokine fusion proteins can be used for enhancing in vivo killing of target tissues (for example, stomach, uterus, as well as in neuroblastoma, melanoma, and lymphoma), if the ztnfrl4 polypeptide or anti-ztnfrl4 antibody targets hyperproliferative tissues from these organs.
• target tissues for example, stomach, uterus, as well as in neuroblastoma, melanoma, and lymphoma
• ztnfrl4 polypeptide or anti-ztnfrl4 antibody targets hyperproliferative tissues from these organs.
• Suitable ztnfrl4 polypeptides or anti-ztnfrl4 antibodies target an undesirable cell or tissue (i.e., a tumor or a leukemia), and the fused cytokine mediates improved target cell lysis by effector cells.
• Suitable cytokines for this purpose include interleukin 2 and granulocyte-macrophage colony- stimulating factor (GM-CSF), for instance.
• ztnfrl4 polynucleotides and/or polypeptides may be useful for regulating the maturation of TNF ligand-bearing cells, such as T cells, B cells, lymphocytes, peripheral blood mononuclear cells, polymorphonuclear leukocytes, fibroblasts and hematopoietic cells.
• TNF ligand-bearing cells such as T cells, B cells, lymphocytes, peripheral blood mononuclear cells, polymorphonuclear leukocytes, fibroblasts and hematopoietic cells.
• ztnfrl4 polypeptides will also find use in mediating metabolic or physiological processes in vivo. The effects of a compound on proliferation and differentiation can be measured in vitro using cultured cells.
• Bioassays and ELISAs are available to measure cellular response to ztnfrl4, in particular are those which measure changes in cytokine production as a measure of cellular response (see for example, Current Protocols in Immunology ed. John E. Coligan et al., NTH, 1996). Assays to measure other cellular responses, including antibody isotype, monocyte activation, NK cell formation, antigen presenting cell function, apoptosis are known in the art.
• the ztnfrl4 polypeptides of the present invention including full-length polypeptides, biologically active fragments, and fusion polypeptides, can be produced in genetically engineered host cells according to conventional techniques.
• Suitable host cells are those cell types that can be transformed or transfected with exogenous DNA and grown in culture, and include bacteria, fungal cells, and cultured higher eukaryotic cells. Eukaryotic cells, particularly cultured cells of multicellular organisms, are preferred. Techniques for manipulating cloned DNA molecules and introducing exogenous DNA into a variety of host cells are disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY, 1987.
• a DNA sequence encoding a ztnfrl4 polypeptide is operably linked to other genetic elements required for its expression, generally including a transcription promoter and terminator, within an expression vector.
• the vector will also commonly contain one or more selectable markers and one or more origins of replication, although those skilled in the art will recognize that within certain systems selectable markers may be provided on separate vectors, and replication of the exogenous DNA may be provided by integration into the host cell genome. Selection of promoters, terminators, selectable markers, vectors and other elements is a matter of routine design within the level of ordinary skill in the art. Many such elements are described in the literature and are available through commercial suppliers.
• a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) can be provided in the expression vector.
• the secretory signal sequence may the native ztnfrl4 sequence or be derived from another secreted protein (e.g., APO4, or t- PA) or synthesized de novo.
• the secretory signal sequence is operably linked to the ztnfrl4 DNA sequence, i.e., the two sequences are joined in the correct reading frame and positioned to direct the newly synthesized polypeptide into the secretory pathway of the host cell.
• Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the polypeptide of interest, although certain secretory signal sequences may be positioned elsewhere in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
• the cytoplasmic domain of ztnfrl4 can be substituted by a heterologous sequence providing a different cytoplasmic domain.
• the fusion product can be secreted, and the cysteine-rich pseudo-repeat domain of ztnfrl4 can direct the new cytoplasmic domain to a specific tissue described above.
• This substituted cytoplasmic domain can be chosen from the cytoplasmic domain represented by the TNFR protein families.
• the cysteine-rich pseudo-repeat domain of ztnf ⁇ l4 protein can be substituted by a heterlogous sequence providing a different cysteine-rich pseudo-repeat domain.
• the fusion product can be secreted and the substituted cysteine-rich pseudo-repeat domain can target the cytoplasmic domain of ztnfrl4 to a specific tissue.
• the substituted cysteine-rich pseudo-repeat domain can be chosen from the cysteine-rich pseudo-repeat domains of the TNFR protein families. Ln these cases, the fusion products can be soluble or membrane-bound proteins. Cultured mammalian cells are suitable hosts within the present invention.
• Methods for introducing exogenous DNA into mammalian host cells include calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978; Corsaro and Pearson, Somatic Cell Genetics 7:603, 1981: Graham and Van der Eb, Virology 52:456, 1973), electroporation (Neumann et al., EMBO J.
• Suitable cultured mammalian cells include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK (ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL 1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary (e.g. CHO-K1; ATCC No. CCL 61) cell lines.
• COS-1 ATCC No. CRL 1650
• COS-7 ATCC No. CRL 1651
• BHK ATCC No. CRL 1632
• BHK 570 ATCC No. CRL 10314
• 293 ATCC No. CRL 1573
• Chinese hamster ovary e.g. CHO-K1; ATCC No. CCL 61
• Suitable cell lines are known in the art and available from public depositories such as the American Type Culture Collection, Rockville, Maryland. Ln general, strong transcription promoters are preferred, such as promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288. Other suitable promoters include those from metallothionein genes (U.S. Patent Nos. 4,579,821 and 4,601,978) and the adenovirus major late promoter. Drug selection is generally used to select for cultured mammalian cells into which foreign DNA has been inserted. Such cells are commonly referred to as "transfectants".
• stable transfectants Cells that have been cultured in the presence of the selective agent and are able to pass the gene of interest to their progeny are referred to as "stable transfectants.”
• a preferred selectable marker is a gene encoding resistance to the antibiotic neomycin. Selection is carried out in the presence of a neomycin-type drug, such as G-418 or the like. Selection systems can also be used to increase the expression level of the gene of interest, a process referred to as "amplification.” Amplification is carried out by culturing transfectants in the presence of a low level of the selective agent and then increasing the amount of selective agent to select for cells that produce high levels of the products of the introduced genes.
• a preferred amplifiable selectable marker is dihydrofolate reductase, which confers resistance to methotrexate.
• Other drug resistance genes e.g., hygromycin resistance, multi-drug resistance, puromycin acetyltransferase
• Alternative markers that introduce an altered phenotype such as green fluorescent protein, or cell surface proteins, such as CD4, CD8, Class I MHC, or placental alkaline phosphatase, may be used to sort transfected cells from untransfected cells by such means as FACS sorting or magnetic bead separation technology.
• Other higher eukaryotic cells can also be used as hosts, including plant cells, insect cells and avian cells.
• Agrobacterium rhizogenes as a vector for expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci. (Bangalore) 11:47-58, 1987. Transformation of insect cells and production of foreign polypeptides therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222 and WEPO publication WO 94/06463. Insect cells can be infected with recombinant baculovirus, commonly derived from Autographa californica nuclear polyhedrosis virus (AcNPV). See, King, L.A.
• This system which utilizes transfer vectors, is sold in the Bac-to- BacTM kit (Life Technologies, Rockville, MD).
• This system utilizes a transfer vector, pFastBaclTM (Life Technologies) containing a Tn7 transposon to move the DNA encoding the ztnfrl4 polypeptide into a baculovirus genome maintained in E. coli as a large plasmid called a "bacmid.”
• the pFastBaclTM transfer vector utilizes the AcNPV polyhedrin promoter to drive the expression of the gene of interest, in this case ztnfrl4 .
• pFastBaclTM can be modified to a considerable degree.
• the polyhedrin promoter can be removed and substituted with the baculovirus basic protein promoter (also known as Peer, p6.9 or MP promoter) which is expressed earlier in the baculovirus infection, and has been shown to be advantageous for expressing secreted proteins.
• the baculovirus basic protein promoter also known as Peer, p6.9 or MP promoter
• Peer also known as Peer, p6.9 or MP promoter
• transfer vectors can be constructed which replace the native ztnfrl4 secretory signal sequences with secretory signal sequences derived from insect proteins.
• a secretory signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to replace the native ztnfrl4 secretory signal sequence.
• transfer vectors can include an in- frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the expressed ztnfrl4 polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer, T. et al., Proc. Natl. Acad. Sci. 82:7952-4, 1985).
• a transfer vector containing ztnfrl4 is transformed into E. coli, and screened for bacmids which contain an inteirupted lacZ gene indicative of recombinant baculovirus.
• the bacmid DNA containing the recombinant baculovirus genome is isolated, using common techniques, and used to transfect Spodoptera frugiperda cells, e.g. Sf9 cells.
• Recombinant virus that expresses ztnfrl4 is subsequently produced.
• Recombinant viral stocks are made by methods commonly used the art.
• the recombinant virus is used to infect host cells, typically a cell line derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick and Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant DNA, ASM Press, Washington, D.C., 1994.
• Another suitable cell line is the High FiveOTM cell line (Invitrogen) derived from T ⁇ choplusia ni (U.S. Patent #5,300,435).
• Commercially available serum-free media are used to grow and maintain the cells. Suitable media are Sf900 LF M (Life Technologies) or ESF 921TM (Expression Systems) for the Sf9 cells; and Ex-cellO405TM (JRH Biosciences, Lenexa, KS) or Express FiveOTM (Life Technologies) for the T. ni cells.
• the cells are grown up from an inoculation density of approximately 2-5 x 10 5 cells to a density of 1-2 x 10 6 cells at which time a recombinant viral stock is added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
• MOI multiplicity of infection
• Procedures used are generally described in available laboratory manuals (King, L. A. and Possee, R.D., ibid.; O'Reilly, D.R. et al., ibid.; Richardson, C. D., ibid.).
• Subsequent purification of the ztnfrl4 polypeptide from the supernatant can be achieved using methods described herein.
• Fungal cells, including yeast cells can also be used within the present invention.
• Yeast species of particular interest in this regard include Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica.
• Methods for transforming S. cerevisiae cells with exogenous DNA and producing recombinant polypeptides therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311; Kawasaki et al, U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008; Welch et al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
• Transformed cells are selected by phenotype determined by the selectable marker, commonly drug resistance or the ability to grow in the absence of a particular nutrient (e.g., leucine).
• a preferred vector system for use in Saccharomyces cerevisiae is the POT1 vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373), which allows transformed cells to be selected by growth in glucose-containing media.
• Suitable promoters and terminators for use in yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al., U.S. Patent No. 4,615,974; and Bitter, U.S. Patent No.
• Aspergillus cells may be utilized according to the methods of McKnight et al., U.S. Patent No. 4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed by Lambowitz, U.S. Patent No. 4,486,533. The use of Pichia methanolica as host for the production of recombinant proteins is disclosed in U.S. patents 5,716,808, 5,736,383, 5,854,039, and 5,888,768.
• Prokaryotic host cells including strains of the bacteria Escherichia coli, Bacillus and other genera are also useful host cells within the present invention. Techniques for transforming these hosts and expressing foreign DNA sequences cloned therein are well known in the art (see, e.g., Sambrook et al., ibid.).
• the polypeptide When expressing a ztnfrl4 polypeptide in bacteria such as E. coli, the polypeptide may be retained in the cytoplasm, typically as insoluble granules, or may be directed to the periplasmic space by a bacterial secretion sequence.
• the cells are lysed, and the granules are recovered and denatured using, for example, guanidine isothiocyanate or urea.
• the denatured polypeptide can then be refolded and dimerized by diluting the denaturant, such as by dialysis against a solution of urea and a combination of reduced and oxidized glutathione, followed by dialysis against a buffered saline solution.
• the polypeptide can be recovered from the periplasmic space in a soluble and functional form by disrupting the cells (by, for example, sonication or osmotic shock) to release the contents of the periplasmic space and recovering the protein, thereby obviating the need for denaturation and refolding.
• Transformed or transfected host cells are cultured according to conventional procedures in a culture medium containing nutrients and other components required for the growth of the chosen host cells.
• suitable media including defined media and complex media, are known in the art and generally include a carbon source, a nitrogen source, essential amino acids, vitamins and minerals. Media may also contain such components as growth factors or serum, as required.
• the growth medium will generally select for cells containing the exogenously added DNA by, for example, drug selection or deficiency in an essential nutrient which is complemented by the selectable marker carried on the expression vector or co-transfected into the host cell.
• P. methanolica cells are cultured in a medium comprising adequate sources of carbon, nitrogen and trace nutrients at a temperature of about 25°C to 35°C. Liquid cultures are provided with sufficient aeration by conventional means, such as shaking of small flasks or sparging of fermentors. A preferred culture medium for P.
• methanolica is YEPD (2% D-glucose, 2% BactoTM Peptone (Difco Laboratories, Detroit, ML), 1% BactoTM yeast extract (Difco Laboratories), 0.004% adenine and 0.006% L-leucine).
• the proteins of the present invention can also comprise non-naturally occurring amino acid residues.
• Non-naturally occurring amino acids include, without limitation, tr ⁇ ns-S-methylproline, 2,4-methanoproline, c 5 , -4-hydroxyproline, trans-A- hydroxyproline, N-methylglycine, ⁇ Z/othreonine, methylthreonine, hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine, pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-dimethylproline, tert- leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, and 4- fluorophenylalanine.
• coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine).
• a natural amino acid that is to be replaced e.g., phenylalanine
• the desired non-naturally occurring amino acid(s) e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine.
• the non-naturally occurring amino acid is incorporated into the protein in place of its natural counterpart. See, Koide et al., Biochem. 33:7470-6, 1994.
• Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further
• polypeptides of the present invention may be substituted for ztnfrl4 amino acid residues. It is preferred to purify the polypeptides of the present invention to >80% purity, more preferably to >90% purity, even more preferably >95% purity, and particularly preferred is a pharmaceutically pure state, that is greater than 99.9% pure with respect to contaminating macromolecules, particularly other proteins and nucleic acids, and free of infectious and pyrogenic agents.
• a purified polypeptide is substantially free of other polypeptides, particularly other polypeptides of animal origin.
• Expressed recombinant ztnf ⁇ l4 proteins are purified by conventional protein purification methods, typically by a combination of chromatographic techniques. See, in general, Affinity Chromatography: Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988; and Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York, 1994. Proteins comprising a polyhistidine affinity tag (typically about 6 histidine residues) are purified by affinity chromatography on a nickel chelate resin. See, for example, Houchuli et al., Bio/Technol. 6: 1321-1325, 1988.
• Proteins comprising a glu-glu tag can be purified by immunoaffinity chromatography according to conventional procedures. See, for example, Grussenmeyer et al., ibid. Maltose binding protein fusions are purified on an amylose column according to methods known in the art.
• the polypeptides of the present invention can be isolated by a combination of procedures including, but not limited to, anion and cation exchange chromatography, size exclusion, and affinity chromatography. Other methods of purification include purification of glycosylated proteins by lectin affinity chromatography and ion exchange chromatography (Methods in Enzvmol., Vol. 182, "Guide to Protein Purification", M. Deutscher, (ed.), Acad.
• a fusion of the polypeptide of interest and an affinity tag may be constructed to facilitate purification.
• an affinity tag e.g., maltose-binding protein, an immunoglobulin domain
• ztnfrl4 polypeptides can also be prepared through chemical synthesis according to methods known in the art, including exclusive solid phase synthesis, partial solid phase methods, fragment condensation or classical solution synthesis. See, for example, Merrifield, J Am. Chem. Soc. 85:2149, 1963; Stewart et al, Solid Phase Peptide Synthesis (2nd edition), Pierce Chemical Co., Rockford, EL, 1984; Bayer and Rapp, Chem. Pept. Prot.
• ztnfrl4 proteins can be prepared as monomers or multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and may or may not include an initial methionine amino acid residue.
• the activity of ztnfrl4 polypeptides can be measured using a variety of assays that measure, for example, cell-cell interactions, ztnfrl4 ligand binding, tumor cell proliferation, B-cell activation, NK-cell activation, T-cell activation and other biological functions associated with ztnfrl4 ligand/receptor binding.
• Proteins, including alternatively spliced peptides, of the present invention are useful for tumor suppression, immunologic recognition, and growth and differentiation either worldng in isolation, or in conjunction with other molecules (growth factors, cytokines, etc.) in stomach, uterus, and in cancerous conditions such as neuroblastomas, melanomas, and lymphomas.
• Alternative splicing of ztnfrl4 may cell- type specific and confer activity to specific tissues.
• polynucleotides of the present invention have been identified in stomach, uterus, neuroblastomas, melanomas, and lymphoma cells among other cancerous cell lines
• polynucleotides of ztnfrl4 can be used to detect these cell types by hybridization, or with ztnfrl4 binding proteins.
• antibodies to the ztnfrl4 polypeptides can detect cells expressing the surface bound ztnfrl4 receptor. Such detection can be useful to determine metastasis, disease stage, or primary diagnosis of disease.
• proliferation, differentiation and/or apoptosis of these cell types can be modulated by contacting the cells with ztnfrl4 binding proteins, including a ztnfrl4-cognate ligand, or an antibody to ztnfrl4, for example.
• the proliferation, and/or differentiation cells can also be mediated by ztnfrl4 polypeptides, or fragments thereof, as an antagonist of cell signaling by binding to the ztnfrl4 ligand and thereby reducing the interaction between ligand and membrane-bound ztnfrl4 proteins.
• Additional activities likely associated with the polypeptides of the present invention include proliferation of lymphoid cells directly or indirectly through other growth factors.
• the ztnfrl4 polypeptides of the present invention can be used to study proliferation or differentiation in stomach and uterus, as well as in neuroblastoma, melanoma, and lymphoma.
• Such methods of the present invention generally comprise incubating cells derived from these tissues in the presence and absence of ztnfrl4 polypeptide, monoclonal antibody, agonist or antagonist thereof and observing changes in cell proliferation or differentiation.
• Cell lines from these tissues are commercially available from, for example, American Type Culture Collection (Manasas, VA).
• Proliferation can be measured using cultured uterine or stomach cells or in vivo by administering molecules of the claimed invention to an appropriate animal model. Generally, proliferative effects are observed as an increase in cell number and therefore, may include inhibition of apoptosis, as well as mitogenesis.
• Cultured cells include uterine fibroblasts, neuroblastomas, melanoma, and lymphoma, as well as from primary cultures. Established cell lines are easily identifiable by one skilled in the art and are available from ATCC (Manasas, VA). Assays measuring cell proliferation are well known in the art.
• assays measuring proliferation include such assays as chemosensitivity to neutral red dye (Cavanaugh et al., Lnvestigational New Drugs 8:347-354, 1990), incorporation of radiolabelled nucleotides (Cook et al., Analytical Biochem. 179:1-7, 1989), incorporation of 5-bromo-2'-deoxyuridine (BrdU) in the DNA of proliferating cells (Porstmann et al., J. Immunol. Methods 82:169-179, 1985), and use of tetrazolium salts (Mosmann, J. Immunol. Methods 65:55-63, 1983; Alley et al., Cancer Res.
• assays measuring proliferation include such assays as chemosensitivity to neutral red dye (Cavanaugh et al., Lnvestigational New Drugs 8:347-354, 1990), incorporation of radiolabelled nucleotides (Cook et al.,
• Differentiation is a progressive and dynamic process, beginning with pluripotent stem cells and ending with terminally differentiated cells.
• Pluripotent stem cells that can regenerate without commitment to a lineage express a set of differentiation markers that are lost when commitment to a cell lineage is made.
• Progenitor cells express a set of differentiation markers that may or may not continue to be expressed as the cells progress down the cell lineage pathway toward maturation.
• Differentiation markers that are expressed exclusively by mature cells are usually functional properties such as cell products, enzymes to produce cell products and receptors and receptor-like complementary molecules.
• the stage of a cell population's differentiation is monitored by identification of markers present in the cell population. For example, myocytes, osteoblasts, adipocytes, chrondrocytes, fibroblasts and reticular cells are believed to originate from a common mesenchymal stem cell (Owen et al., Ciba Fdn. Symp. 136:42- 46, 1988). Markers for mesenchymal stem cells have not been well identified (Owen et al., J. of Cell Sci. 87:731-738, 1987), so identification is usually made at the progenitor and mature cell stages.
• novel polypeptides of the present invention are useful for studies to isolate mesenchymal stem cells and uterine myocyte progenitor cells, both in vivo and ex vivo. There is evidence to suggest that factors that stimulate specific cell types down a pathway towards terminal differentiation or dedifferentiation affect the entire cell population originating from a common precursor or stem cell. Thus, ztnfrl4 polypeptides may stimulate inhibition or proliferation of endocrine and exocrine cells of the uterus, stomach as well as-in melanoma, neuroblastoma, and lymphoma.
• Molecules of the present invention may, while stimulating proliferation or differentiation of uterine fibroblasts, inhibit proliferation or differentiation of adipocytes, by virtue of their effect on common precursor/stem cells.
• the novel polypeptides of the present invention are useful to study neural and epithelial stem cells and uterus, as well as in melanoma, neuroblastoma, and lymphoma, both in vivo and ex vivo.
• Assays measuring differentiation include, for example, measuring cell- surface markers associated with stage-specific expression of a tissue, enzymatic activity, functional activity or morphological changes (Watt, FASEB, 5:281-284, 1991; Francis, Differentiation 57:63-75, 1994; Raes, Adv. Anim.
• Proteins, including alternatively spliced peptides, and fragments, of the present invention are useful for studying cell-cell interactions, fertilization, development, immune recognition, growth control, tumor suppression, and embryo maturation.
• ztnfrl4 molecules, variants, and fragments can be applied in isolation, or in conjunction with other molecules (growth factors, cytokines, etc.) in the stomach and uterus, as well as in melanoma, neuroblastoma, and lymphoma.
• Proteins of the present invention are useful for delivery of therapeutic agents such as, but not limited to, proteases, radionuclides, chemotherapy agents, and small molecules.
• Adenovirus a double-stranded DNA virus, is currently the best studied gene transfer vector for delivery of heterologous nucleic acid (for a review, see T.C. Becker et al., Meth. Cell Biol. 43:161-89, 1994; and J.T. Douglas and D.T.
• adenovirus can (i) accommodate relatively large DNA inserts; (ii) be grown to high-titer; (iii) infect a broad range of mammalian cell types; and (iv) be used with a large number of available vectors containing different promoters. Also, because adenoviruses are stable in the bloodstream, they can be administered by intravenous injection. By deleting portions of the adenovirus genome, larger inserts (up to 7 kb) of heterologous DNA can be accommodated.
• inserts can be incorporated into the viral DNA by direct ligation or by homologous recombination with a co-transfected plasmid.
• the essential El gene has been deleted from the viral vector, and the virus will not replicate unless the El gene is provided by the host cell (the human 293 cell line is exemplary).
• adenovirus When intravenously administered to intact animals, adenovirus primarily targets the liver. If the adenoviral delivery system has an El gene deletion, the virus cannot replicate in the host cells. However, the host's tissue (e.g., liver) will express and process (and, if a secretory signal sequence is present, secrete) the heterologous protein.
• adenoviral vectors containing various deletions of viral genes can be used in an attempt to reduce or eliminate immune responses to the vector.
• Such adenoviruses are El deleted, and in addition contain deletions of E2A or E4 (Lusky, M. et al., J. Virol. 72:2022-2032, 1998; Raper, S.E. et al., Human Gene Therapy 9:671-679, 1998).
• deletion of E2b is reported to reduce immune responses (Amalfitano, A. et al., J. Virol. 72:926-933, 1998).
• adenovirus system can also be used for protein production in vitro. By culturing adenovirus-infected non-293 cells under conditions where the cells are not rapidly dividing, the cells can produce proteins for extended periods of time.
• BHK cells are grown to confluence in cell factories, then exposed to the adenoviral vector encoding the secreted protein of interest. The cells are then grown under serum-free conditions, which allows infected cells to survive for several weeks without significant cell division.
• adenovirus vector infected 293S cells can be grown in suspension culture at relatively high cell density to produce significant amounts of protein (see Gamier et al., Cytotechnol. 15:145-55, 1994). With either protocol, an expressed, secreted heterologous protein can be repeatedly isolated from the cell culture supernatant. Within the infected 293S cell production protocol, non-secreted proteins may also be effectively obtained.
• the activity of ztnfrl4 polypeptide or a peptide to which ztnfrl4 binds can be measured by a silicon-based biosensor microphysiometer which measures the extracellular acidification rate or proton excretion associated with cell-surface protein interactions and subsequent physiologic cellular responses.
• An exemplary device is the CytosensorTM Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA.
• CytosensorTM Microphysiometer manufactured by Molecular Devices, Sunnyvale, CA.
• a variety of cellular responses, such as cell proliferation, ion transport, energy production, inflammatory response, regulatory and receptor activation, and the like, can be measured by this method. See, for example, McConnell, H.M. et al., Science 257:1906-1912, 1992; Pitchford, S.
• the microphysiometer can be used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By measuring extracellular acidification changes in cell media over time, the microphysiometer directly measures cellular responses to various stimuli, including proteins, agonists, and antagonists which affect a ztnfrl4-mediated pathway.
• ztnfrl4-responsive eukaryotic cells comprise cells into which a polynucleotide for ztnfrl4 has been transfected creating a cell that is responsive to activation of ztnfrl4; or cells naturally responsive to activation of ztnfrl4 .
• Differences, measured by a change in the response of cells exposed to ztnfrl4 activation, relative to a control not exposed to ztnfrl4 activation are a direct measurement of ztnfrl4-mediated cellular responses.
• such ztnfrl4- mediated responses can be assayed under a variety of stimuli.
• the present invention provides a method of identifying agonists and antagonists of ztnfrl4 protein, comprising providing cells responsive to activation of ztnfrl4 polypeptide, culturing a first portion of the cells in the absence of a test compound, culturing a second portion of the cells in the presence of a test compound, and detecting a change in a cellular response of the second portion of the cells as compared to the first portion of the cells.
• the change in cellular response is shown as a measurable change in extracellular acidification rate.
• culturing a third portion of the cells in the presence of ztnfrl4 polypeptide and the absence of a test compound provides a positive control for the ztnfrl4 - responsive cells, and a control to compare the agonist activity of a test compound with that of the ztnfrl4 polypeptide.
• Antagonists of ztnfrl4 can be identified by exposing the cells to ztnfrl4 protein in the presence and absence of the test compound, whereby a reduction in ztnfrl4-stimulated activity is indicative of antagonist activity in the test compound.
• the microphysiometer can be used to rapidly identify cells, tissues, or cell lines which activate a ztnfrl4-stimulated pathway.
• tissue and cell lines can be used to identify ligands, antagonists and agonists of ztnfrl4 polypeptide as described above.
• cells expressing ztnfrl4 can be used to identify cells which stimulate or block a ztnfrl4-signaling pathway.
• agonists including the native cysteine-rich pseudo-repeat and cytoplasmic domains
• antagonists to ztnfrl4/ztnfrl4 ligand binding have enormous potential in both in vitro and in vivo applications.
• Compounds identified as ztnfrl4 agonists and antagonists are useful for studying cell-cell interactions, apoptosis, tumor proliferation and suppression, infection, and inflammation in vitro and in vivo.
• ztnfrl4 and agonist compounds are useful as components of defined cell culture media, and may be used alone or in combination with cytokines and hormones to replace serum that is commonly used in cell culture.
• Agonists are thus useful in specifically promoting the growth and/or development of cells of the myeloid and lymphoid lineages in culture.
• ztnfrl4 polypeptides and ztnfrl4 agonists are useful as a research reagent, such as for the expansion, differentiation, proliferation, and/or cell-cell interactions of uterus, as well as in melanoma, osteosarcoma, breast carcinoma, and lymphoma, and in tumors of the lung.
• ztnfrl4 polypeptides are added to tissue culture media for these cell types.
• Compounds identified as ztnfrl4 agonists are useful for modifying the proliferation and development of target cells in vitro and in vivo.
• agonist compounds are useful alone or in combination with other cytokines and hormones as components of defined cell culture media.
• Agonists are thus useful in specifically mediating the growth and/or development of ztnfrl4 -bearing T lymphocytes or other ztnfrl4-bearing cells in culture.
• Agonists and antagonists may also prove useful in the study of effector functions of T lymphocytes, in particular T lymphocyte activation and differentiation.
• Antagonists are useful as research reagents for characterizing ligand- receptor interaction.
• ztnfrl4 polypeptides are likely to be involved in the immune response to infection.
• Lymphotoxin-beta receptor another member of this receptor family, has been shown to regulate HEV-l replication. (Marshall, W.L. et al., J. Lrnmun. 162: 6016-6023, 1999). Further, it has been shown that cosignaling via the lymphotoxin-beta receptor and TNF- receptors is probably involved in the modulation of HEV-l replication and the subsequent determination of HEV-l viral burden in monocytes.
• ztnfrl4 polypeptides, agonists, and antagonists can be used to treat microbial infections. Such infections include bacterial, yeast, and viral infections. Anti-microbial activity of proteins is evaluated by techniques that are known in the art.
• anti-microbial activity can be assayed by evaluating the sensitivity of microbial cell cultures to test agents and by evaluating the protective effect of test agents on infected mice. See, for example, Musiek et al., Antimicrob. Agents Chemothr. 3:40, 1973. Antiviral activity can also be assessed by protection of mammalian cell cultures.
• Known techniques for evaluating anti-microbial activity include, for example, Barsum et al., Eur. Respir. J. 8:709-714. 1995; Sandovsky-Losica et al., J. Med. Vet. Mvcol (England) 28:279-287, 1990; Mehentee et al., J. Gen.
• Assays specific for anti-viral activity include, for example, those described by Daher et al., X Virol. 60:1068-1074, 1986.
• assays measuring IJLV-1 viral burden on cells can be used. Shock is a manifestation of infection. Studies show that increased serum TNF levels are associated with high mortality rates. See Wage, A. et al., Lancet i:355- 357, 1987, and Girardin et al., New. Eng. J. Med. 39: 397-400, 1988.
• Soluble TNF receptors including ztnfrl4 polypeptides of the present invention, may be useful to reduce serum concentrations of TNF, and minimize the effects of sepsis.
• the invention also provides antagonists, which either bind to ztnfrl4 polypeptides or, alternatively, to a ligand to which ztnfrl4 polypeptides bind, thereby inhibiting or eliminating the function of ztnfrl4.
• Such ztnfrl4 antagonists would include antibodies; polypeptides which bind either to the ztnfrl4 polypeptide or to its ligand; natural or synthetic analogs of ztnfrl4 ligands which retain the ability to bind the receptor but do not result in either ligand or receptor signaling. Such analogs could be peptides or peptide-like compounds. Natural or synthetic small molecules which bind to ztnfrl4 polypeptides and prevent signaling are also contemplated as antagonists. Also contemplated are soluble ztnfrl4 receptors.
• ztnfrl4 antagonists would be useful as therapeutics for treating certain disorders where blocking signal from either a ztnfrl4 receptor or ligand would be beneficial.
• Antagonists are useful as * research reagents for characterizing ligand-receptor interaction.
• ztnfrl4 polypeptides may be used within diagnostic systems to detect the presence of ligand polypeptides.
• Antibodies or other agents that specifically bind to ztnfrl4 may also be used to detect the presence of circulating or membrane bound receptor or ligand polypeptides. Such detection methods are well known in the art and include, for example, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay.
• ELISA enzyme-linked immunosorbent assay
• radioimmunoassay radioimmunoassay.
• Immunohistochemically labeled ztnfrl4 antibodies can be used to detect ztnfrl4 receptor and/or ligands in tissue samples. ztnfrl4 levels can also be monitored by such methods as RT-PCR, where ztnfrl4 mRNA can be detected and quantified. The information derived from such detection methods would provide insight into the significance of ztnfrl4 polypeptides in various diseases, and as such would serve as diagnostic tools for diseases for which altered levels of ztnfrl4 are significant. Altered levels of ztnfrl4 receptor polypeptides may be indicative of pathological conditions including cancer, autoimmune disorders, bone disorders, inflammation and immunodeficiencies .
• Antagonists are also useful as research reagents for characterizing sites of interactions between members of complement/anti-complement pairs as well as sites of cell-cell interactions.
• Inhibitors of ztnfrl4 activity include anti- ztnfrl4 antibodies and soluble ztnfrl4 polypeptides (such as described above), as well as other peptidic and non-peptidic agents (including ribozymes).
• ztnfrl4 can also be used to identify inhibitors (antagonists) of its activity. Test compounds are added to the assays disclosed herein to identify compounds that inhibit the activity of ztnfrl4.
• samples can be tested for inhibition of ztnfrl4 activity within a variety of assays designed to measure receptor/ligand binding or the stimulation/inhibition of ztnf ⁇ l4-dependent cellular responses.
• ztnfrl4-responsive cell lines can be transfected with a reporter gene construct that is responsive to a ztnfrl4-stimulated cellular pathway.
• Reporter gene constructs of this type are known in the art, and will generally comprise a DNA response element operably linked to a gene encoding an assayable protein, such as luciferase, or a metabolite, such as cyclic AMP.
• DNA response elements can include, but are not limited to, cyclic AMP response elements (CRE), hormone response elements (HRE), insulin response element (ERE) (Nasrin et al., Proc. Natl. Acad. Sci. USA 87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-72, 1989).
• Cyclic AMP response elements are reviewed in Roestler et al., J. Biol. Chem. 263 (19):9063-6; 1988 and Habener, Molec. Endocrinol. 4 (8): 1087-94; 1990.
• Hormone response elements are reviewed in Beato, Cell 56:335-44; 1989.
• Such a reporter gene construct would contain a cysteine-rich pseudo-repeat that, upon binding a TNF, would signal intracellularly through, for example, a SRE reporter.
• Candidate compounds, solutions, mixtures or extracts are tested for the ability to inhibit the activity of ztnfrl4 on the target cells, as evidenced by a decrease in ztnfrl4 stimulation of reporter gene expression. Assays of this type will detect compounds that directly block ztnfrl4 binding to a cell- surface protein, i.e., ligand, or the anti-complementary member of a complementary/anti- complementary pair, as well as compounds that block processes in the cellular pathway subsequent to complement/anti-complement binding.
• compounds or other samples can be tested for direct blocking of ztnfrl4 binding to a ligand using ztnfrl4 tagged with a detectable label (e.g., biotin, horseradish peroxidase, FITC, and the like).
• a detectable label e.g., biotin, horseradish peroxidase, FITC, and the like.
• TNFs used within binding assays may be cellular TNFs, soluble TNFs, or isolated, immobilized TNFs.
• the activity of agonists and antagonists can be determined by activity assays which determine the potency of receptor/ligand engagement.
• Stably transfected cell lines which co-express high levels of reporter gene constructs for NfKB, NFAT-1 and AP-1 can be made which express ztnfrl4.
• a ztnfrl4 ligand can be found to signal through the reporter genes in these constructs. Soluble ztnfrl4 and antibodies can be used to measure binding.
• a ztnfrl4 ligand-binding polypeptide can also be used for purification of ligand.
• the polypeptide is immobilized on a solid support, such as beads of agarose, cross-linked agarose, glass, cellulosic resins, silica-based resins, polystyrene, cross- linked polyacrylamide, or like materials that are stable under the conditions of use.
• a solid support such as beads of agarose, cross-linked agarose, glass, cellulosic resins, silica-based resins, polystyrene, cross- linked polyacrylamide, or like materials that are stable under the conditions of use.
• Methods for linking polypeptides to solid supports are known in the art, and include amine chemistry, cyanogen bromide activation, N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, and hydrazide activation.
• the resulting medium will generally be configured in the form of a column, and fluids containing ligands are passed through the column one or more times to allow ligands to bind to the receptor polypeptide.
• the ligand is then eluted using changes in salt concentration, chaotropic agents (guanidine HCl), or pH to disrupt ligand-receptor binding.
• An assay system that uses a ligand-binding receptor (or an antibody, one member of a complementary/ anti-complementary pairor other cell-surface binding protein) or a binding fragment thereof, and a commercially available biosensor instrument (BIAcore, Pharmacia Biosensor, Piscataway, NJ) may be advantageously employed.
• Such receptor, antibody, member of a complement/anti-complement pair or fragment is immobilized onto the surface of a receptor chip.
• Use of this instrument is disclosed by Karlsson, J. Immunol. Methods 145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol. 234:554-63, 1993.
• a receptor, antibody, member or fragment is covalently attached, using amine or sulfhydryl chemistry, to dextran fibers that are attached to gold film within the flow cell.
• a test sample is passed through the cell.
• Ligand binding receptor polypeptides can also be used within other assay systems known in the art. Such systems include Scatchard analysis for determination of binding affinity (see Scatchard, Ann. NY Acad. Sci.
• a "soluble protein” is a protein that is not bound to a cell membrane.
• Soluble proteins are most commonly ligand-binding receptor polypeptides that lack transmembrane and cytoplasmic domains. Soluble proteins can comprise additional amino acid residues, such as affinity tags that provide for purification of the polypeptide or provide sites for attachment of the polypeptide to a substrate, or immunoglobulin constant region sequences. Many cell-surface proteins have naturally occurring, soluble counterparts that are produced by proteolysis or translated from alternatively spliced mRNAs. Proteins are said to be substantially free of transmembrane and intracellular polypeptide segments when they lack sufficient portions of these segments to provide membrane anchoring or signal transduction, respectively.
• Soluble forms of ztnfrl4 polypeptides may act as antagonists to or agonists of ztnfrl4 polypeptides, and would be useful to modulate the effects of ztnfrl4 in stomach, uterus, as well as in melanoma, neuroblastomas, and lymphoma.
• the isoform of ztnfrl4 that does not contain a transmembrane domain will be soluble, and may act as an agonist or antagonist of ztnfrl4 activity. Since polypeptides of this nature are not anchored to the membrane, they can act at sites distant from the tissues in which they are expressed.
• the activity of the soluble form of ztnfrl4 polypeptides can be more wide spread than its membrane-anchored counterpart. Both isoforms would be useful in studying the effects of the present invention in vitro an in vivo.
• Molecules of the present invention can be used to identify and isolate TNFs, or members of complement/anti-complement pairs involved in cell-cell interactions.
• proteins and peptides of the present invention can be immobilized on a column and membrane preparations run over the column (Immobilized Affinity Ligand Techniques, Hermanson et al., eds., Academic Press, San Diego, CA, 1992, pp.195-202).
• Proteins and peptides can also be radiolabeled (Methods in Enzymol., vol. 182, "Guide to Protein Purification", M. Deutscher, ed., Acad. Press, San Diego, 1990, 721-37) or photoaffinity labeled (Brunner et al., Ann. Rev. Biochem. 62:483-514, 1993 and Fedan et al., Biochem. Pharmacol. 33:1167-80, 1984) and specific cell-surface proteins can be identified.
• the molecules of the present invention will be useful in modulating abnormal cell growth, proliferation and differentiation.
• the polypeptides, nucleic acid and/or antibodies of the present invention can be used in treatment of disorders associated with infection, tumor growth, immunodeficiency, auto-immunity, and fertility.
• the molecules of the present invention can be used to modulate cell adhesion, cell fusion, and signaling or to treat or prevent development of pathological conditions in such diverse tissue as stomach, uterus, neuroblastoma, melanoma, and lymphoma.
• certain diseases may be amenable to such diagnosis, treatment or prevention. These diseases include, but are not limited to, melanoma, neuroblastoma, autoimmune disease, and immunodeficiency.
• the molecules of the present invention can be used to modulate inhibition and proliferation of tissues in the stomach and uterus, as well as cells of melanoma, neuroblastoma, and lymphoma.
• Polynucleotides encoding ztnfrl4 polypeptides are useful within gene therapy applications where it is desired to increase or inhibit ztnfrl4 activity. If a mammal has a mutated or absent ztnfrl4 gene, the ztnfrl4 gene can be introduced into the cells of the mammal. In one embodiment, a gene encoding a ztnfrl4 polypeptide is introduced in vivo in a viral vector.
• Such vectors include an attenuated or defective DNA virus, such as, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like.
• HSV herpes simplex virus
• EBV Epstein Barr virus
• AAV adeno-associated virus
• Defective viruses which entirely or almost entirely lack viral genes, are preferred.
• a defective virus is not infective after introduction into a cell.
• Use of defective viral vectors allows for administration to cells in a specific, localized area, without concern that the vector can infect other cells.
• Examples of particular vectors include, but are not limited to, a defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al., Molec. Cell. Neurosci.
• adenovirus vector such as the vector described by Stratford-Perricaudet et al., J. Clin. Invest. 90:626-30, 1992; and a defective adeno- associated virus vector (Samulski et al., J. Virol. 61:3096-101, 1987; Samulski et al., X Virol. 63:3822-8, 1989).
• a ztnfrl4 gene can be introduced in a retroviral vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann et al.
• the vector can be introduced by lipofection in vivo using liposomes.
• Synthetic cationic lipids can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7, 1987; Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027-31, 1988).
• the use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages.
• Molecular targeting of liposomes to specific cells represents one area of benefit. More particularly, directing transfection to particular cells represents one area of benefit.
• directing transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, such as the pancreas, liver, kidney, and brain.
• Lipids may be chemically coupled to other molecules for the purpose of targeting.
• Targeted peptides e.g., hormones or neurotransmitters
• proteins such as antibodies
• non-peptide molecules can be coupled to liposomes chemically.
• the ztnfrl4 polynucleotides SEQ ED NOs:l, 3, 29 and 31
• can be used to target specific tissues such as tissues of the stomach and uterus, as well as in cells of melanoma, neuroblastoma, and lymphoma.
• Various techniques can be used to inhibit ztnffl4 gene transcription and translation, such as to inhibit cell proliferation in vivo.
• Polynucleotides that are complementary to a segment of a ztnfrl4 - encoding polynucleotide e.g., a polynucleotide as set forth in SEQ ID NOs:l or 3
• Such antisense polynucleotides are used to inhibit expression of ztnfrl4 polypeptide- encoding genes in cell culture or in a subject.
• mice engineered to express the ztnfrl4 gene referred to as "transgenic mice,” and mice that exhibit a complete absence of ztnfrl4 gene function, referred to as “knockout mice,” may also be generated (Snouwaert et al., Science 257:1083, 1992), may also be generated (Lowell et al tension Nature 366:740-42, 1993; Capecchi, M.R., Science 244: 1288-1292, 1989; Palmiter, R.D. et al. Annu Rev Genet. 20: 465-499, 1986).
• a transgenic mouse to engineer is one that over-expresses the soluble ztnfrl4 polypeptide or the membrane-bound receptor. Moreover, such over-expression may result in a phenotype that shows similarity with human diseases.
• knockout ztnfrl4 mice can be used to determine where ztnfrl4 is absolutely required in vivo. The phenotype of knockout mice is predictive of the in vivo effects of that a ztnfrl4 antagonist, such as those described herein, may have.
• the human ztnfrl4 cDNA can be used to isolate murine ztnfrl4 mRNA, cDNA and genomic DNA, which are subsequently used to generate knockout mice.
• mice may be employed to study the ztnfrl4 gene and the protein encoded thereby in an in vivo system, and can be used as in vivo models for corresponding human diseases.
• transgenic mice expression of ztnfrl4 antisense polynucleotides or ribozymes directed against ztnfrl4, described herein, can be used analogously to transgenic mice described above.
• Another use for in vivo models includes delivery of an antigen challenge to the animal followed by administration of soluble ztnfrl4 or its ligand, and measuring the T cell response, or the proliferation or decline of ztnfrl4-expressing cells.
• T-cell dependent and T-cell independent immune response can be measured as described in Perez-Melgosa et al., J. Immunol. 163: 1123-7, 1999.
• Pharmacokinetic studies can be used in association with radiolabeled, soluble ztnfrl4 polypeptides or fusions to determine the distribution and half life of such polypeptides in vivo. Additionally animal models can be used to determine the effects of soluble ztnfrl4 on tumors and tumor development in vivo.
• ztnfrl4 polypeptides as surrogate markers for abnormal cell growth, especially, such growth as related to melanoma, neuroblastoma, and lymphoma.
• ztnfrl4 gene may be useful to as a probe to identify humans who have a defective ztnfrl4 gene or to identify mutations which have occurred in its region of chromosome 1 as it includes many TNFR family members.
• the polynucleotides of the present invention may also be used in conjunction with a regulatable promoter, thus allowing the dosage of delivered protein to be regulated.
• the activity and effect of ztnfrl4 on tumor progression and metastasis can be measured in vivo.
• Tumor models include the Lewis lung carcinoma (ATCC No. CRL-1642) and B16 melanoma (ATCC No. CRL-6323), amongst others. These are both commonly used tumor lines, syngeneic to the C57BL6 mouse, that are readily cultured and manipulated in vitro. Tumors resulting from implantation of either of these cell lines are capable of metastasis to the lung in C57BL6 mice.
• mice The Lewis lung carcinoma model has recently been used in mice to identify an inhibitor of angiogenesis (O'Reilly MS, et al. Cell 79: 315-328,1994).
• C57BL6/J mice are treated with an experimental agent either through daily injection of recombinant protein, agonist or antagonist or a one time injection of recombinant adenovirus.
• an experimental agent either through daily injection of recombinant protein, agonist or antagonist or a one time injection of recombinant adenovirus.
• 10 to 10 cells Three days following this treatment, 10 to 10 cells are implanted under the dorsal skin.
• the cells themselves may be infected with recombinant adenovirus, such as one expressing ztnfrl4, before implantation so that the protein is synthesized at the tumor site or intracellularly, rather than systemically.
• the mice normally develop visible tumors within 5 days.
• the tumors are allowed to grow for 3 a period of up to 3 weeks, during which time they may reach a size of 1500 - 1800 mm in the control treated group. Tumor size and body weight are carefully monitored throughout the experiment. At the time of sacrifice, the tumor is removed and weighed along with the lungs and the liver. The lung weight has been shown to correlate well with metastatic tumor burden. As an additional measure, lung surface metastases are counted. The resected tumor, lungs and liver are prepared for histopathological examination, immunohistochemistry, and in situ hybridization, using methods known in the art and described herein.
• the implanted cells can be transiently transfected with ztnfrl4.
• purified ztnfrl4 or ztnfrl4-conditioned media can be directly injected in to this mouse model, and hence be used in this system.
• Ztnfrl4 polypeptides and antibodies may be used within diagnostic systems to detect the presence of its ligand polypeptides, such as a tumor necrosis factor ligand.
• ztnfrl4 polypeptides in various diseases, and as a would serve as diagnostic tools for diseases for which altered levels of ztnfrl4 are significant. Altered levels of ztnfrl4 polypeptides may be indicative of pathological conditions including cancer, autoimmune disorders and infectious diseases.
• a single-stranded probe molecule is incubated with RNA, isolated from a biological sample, under conditions of temperature and ionic strength that promote base pairing between the probe and target ztnfrl4 species. After separating unbound probe from hybridized molecules, the amount of hybrids is detected.
• RNA detection include northern analysis and dot/slot blot hybridization (see, for example, Ausubel ibid, and Wu et al. (eds.), "Analysis of Gene Expression at the RNA Level," in Methods in Gene Biotechnology, pages 225-239 (CRC Press, Lnc. 1997)).
• Nucleic acid probes can be detectably labeled with radioisotopes such as 32 P or 35 S.
• ztnfrl4 RNA can be detected with a nonradioactive hybridization method (see, for example, Isaac (ed.), Protocols for Nucleic Acid Analysis by Nonradioactive Probes, Humana Press, Lnc, 1993).
• nonradioactive detection is achieved by enzymatic conversion of chromogenic or chemiluminescent substrates.
• Illustrative nonradioactive moieties include biotin, fluorescein, and digoxigenin.
• ztnfrl4 oligonucleotide probes are also useful for in vivo diagnosis.
• 18 F-labeled oligonucleotides can be administered to a subject and visualized by positron emission tomography (Tavitian et al, Nature Medicine 4:467, 1998). Numerous diagnostic procedures take advantage of the polymerase chain reaction (PCR) to increase sensitivity of detection methods.
• PCR polymerase chain reaction
• PCR primers can be designed to amplify a sequence encoding a particular ztnfrl4 domain or motif, such as the ztnfrl4 cysteine rich pseudo repeat.
• PCR for diagnostic assays is reverse transcriptase-PCR
• RNA is isolated from a biological sample, reverse transcribed to cDNA, and the cDNA is incubated with ztnfrl4 primers (see, for example,
• RNA is isolated from biological sample using, for example, the guanidinium-thiocyanate cell lysis procedure described above.
• a solid-phase technique can be used to isolate mRNA from a cell lysate.
• a reverse transcription reaction can be primed with the isolated RNA using random oligonucleotides, short homopolymers of dT, or ztnfrl4 anti-sense oligomers.
• Oligo-dT primers offer the advantage that various mRNA nucleotide sequences are amplified that can provide control target sequences.
• Ztnfrl4 sequences are amplified by the polymerase chain reaction using two flanking oligonucleotide primers that are typically at least 5 bases in length. PCR amplification products can be detected using a variety of approaches.
• PCR products can be fractionated by gel electrophoresis, and visualized by ethidium bromide staining.
• fractionated PCR products can be transferred to a membrane, hybridized with a detectably-labeled ztnfrl4 probe, and examined by autoradiography.
• Additional alternative approaches include the use of digoxigenin-labeled deoxyribonucleic acid triphosphates to provide chemiluminescence detection, and the C-TRAK colorimetric assay.
• Another approach is real time quantitative PCR (Perkin-Elmer Cetus, Norwalk, Ct.).
• a fluorogenic probe consisting of an oligonucleotide with both a reporter and a quencher dye attached, anneals specifically between the forward and reverse primers.
• the reporter dye is separated from the quencher dye and a sequence-specific signal is generated and increases as amplification increases.
• the fluorescence intensity can be continuously monitored and quantified during the PCR reaction.
• CPT cycling probe technology
• NASBA nucleic acid sequence-based amplification
• CATCH cooperative amplification of templates by cross-hybridization
• LCR ligase chain reaction
• Ztnfrl4 probes and primers can also be used to detect and to localize ztnfrl4 gene expression in tissue samples. Methods for such in situ hybridization are well-known to those of sldll in the art (see, for example, Choo (ed.), In Situ Hybridization
• Radiation hybrid mapping is a somatic cell genetic technique developed for constructing high-resolution, contiguous maps of mammalian chromosomes (Cox et al., Science 250:245-50, 1990). Partial or full knowledge of a gene's sequence allows the designing of PCR primers suitable for use with chromosomal radiation hybrid mapping panels.
• Commercially available radiation hybrid mapping panels which cover the entire human genome, such as the Stanford G3 RH Panel and the GeneBridge 4 RH Panel (Research Genetics, Inc., Huntsville, AL), are available.
• These panels enable rapid, PCR based, chromosomal localizations and ordering of genes, sequence-tagged sites (STSs), and other non-polymorphic- and polymorphic markers within a region of interest. This includes establishing directly proportional physical distances between newly discovered genes of interest and previously mapped markers.
• the precise knowledge of a gene's position can be useful in a number of ways including: 1) determining if a sequence is part of an existing contig and obtaining additional surrounding genetic sequences in various forms such as YAC-, BAC- or cDNA clones, 2) providing a possible candidate gene for an inheritable disease which shows linkage to the same chromosomal region, and 3) for cross-referencing model organisms such as mouse which may be beneficial in helping to determine what function a particular gene might have.
• the ztnfrl4 polynucleotides of SEQ ED NO:2 have been mapped to chromosome lq36.3.
• the present invention also provides reagents which will find use in diagnostic applications.
• the ztnfrl4 gene a probe comprising ztnfrl4 DNA or RNA or a subsequence thereof can be used to determine if the ztnfrl4 gene is present on chromosome lq36.3 or if a mutation has occurred.
• Detectable chromosomal aberrations at the ztnfrl4 gene locus include, but are not limited to, aneuploidy, gene copy number changes, insertions, deletions, restriction site changes and rearrangements in this gene or the other six members of the TNFR family located in the locus.
• aberrations can occur within the coding sequence, within introns, or within flanking sequences, including upstream promoter and regulatory regions, and may be manifested as physical alterations within a coding sequence or changes in gene expression level.
• Such aberrations can be detected using polynucleotides of the present invention by employing molecular genetic techniques, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid.; Ausubel et. al., ibid.; Marian, Chest 108:255-65, 1995).
• RFLP restriction fragment length polymorphism
• STR short tandem repeat
• these diagnostic methods comprise the steps of (a) obtaining a genetic sample from a patient; (b) incubating the genetic sample with a polynucleotide probe or primer as disclosed above, under conditions wherein the polynucleotide will hybridize to complementary polynucleotide sequence, to produce a first reaction product; and (iii) comparing the first reaction product to a control reaction product. A difference between the first reaction product and the control reaction product is indicative of a genetic abnormality in the patient.
• Genetic samples for use within the present invention include genomic DNA, cDNA, and RNA.
• the polynucleotide probe or primer can be RNA or DNA, and will comprise a portion of SEQ ED NOs:l or 3, the complement of SEQ ED NOs:l or 3, or an RNA equivalent thereof.
• Suitable assay methods in this regard include molecular genetic techniques known to those in the art, such as restriction fragment length polymorphism (RFLP) analysis, short tandem repeat (STR) analysis employing PCR techniques, ligation chain reaction (Barany, PCR Methods and Applications 1:5-16, 1991), ribonuclease protection assays, and other genetic linkage analysis techniques known in the art (Sambrook et al., ibid. ; Ausubel et. al., ibid.
• Ribonuclease protection assays comprise the hybridization of an RNA probe to a patient RNA sample, after which the reaction product (RNA-RNA hybrid) is exposed to RNase. Hybridized regions of the RNA are protected from digestion.
• PCR assays a patient's genetic sample is incubated with a pair of polynucleotide primers, and the region between the primers is amplified and recovered. Changes in size or amount of recovered product are indicative of mutations in the patient.
• PCR-based technique that can be employed is single strand conformational polymorphism (SSCP) analysis (Hayashi, PCR Methods and Applications 1:34-8, 1991).
• Antisense methodology can be used to inhibit ztnfrl4 gene transcription, such as to inhibit T cell development and interaction with other cells.
• Polynucleotides that are complementary to a segment of a ztnfrl4-encoding polynucleotide e.g., a polynucleotide as set forth in SEQ ED NOs:2, 27, or 38
• SEQ ED NOs:2, 27, or 38 are designed to bind to ztnfrl4- encoding mRNA and to inhibit translation of such mRNA.
• antisense polynucleotides are used to inhibit expression of ztnfrl4 polypeptide-encoding genes in cell culture or in a subject. Additionally, polynucleotides of the present invention can be used as a marker for the X chromosome. Diseases which map to the lq36.3 include those associated with the six other TNFR members at this location.
• the polypeptides of ztnfrl4 may represent an antigenic marker for neuroblastoma, melanoma, or lymphoma, as well as tumors of the stomach and uterus. Thus, these polypeptides, or fragments thereof may be useful as antigens to produce humanized antibodies for treatment of these specific tumors.
• polypeptides and polypeptide fragments can be useful to generate vaccines for use cancer therapy.
• the proteins of the present invention can be administered intravaginally, orally, rectally, parenterally (particularly intravenous or subcutaneous), intracisternally, intraperitoneally, topically (as douches, powders, ointments, drops or transdermal patch) bucally, or as a pulmonary or nasal inhalant.
• Intravenous administration will be by bolus injection or infusion over a typical period of one to several hours.
• compositions will include a ztnfrl4 protein, alone, or in conjunction with a dimeric partner, in combination with a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5% dextrose in water or the like.
• a pharmaceutically acceptable vehicle such as saline, buffered saline, 5% dextrose in water or the like.
• Formulations may further include one or more excipients, preservatives, solubilizers, buffering agents, albumin to prevent protein loss on vial surfaces, etc.
• Methods of formulation are well known in the art and are disclosed, for example, in Remington: The Science and Practice of Pharmacy, Gennaro, ed., Mack Publishing Co., Easton, PA, 19th ed., 1995.
• Therapeutic doses will generally be in the range of 0.1 to 100 ⁇ g/kg of patient weight per day, preferably 0.5-20 mg kg per day, with the exact dose determined by the clinician according to accepted standards, taking into account the nature and severity of the condition to be treated, patient traits, etc. Determination of dose is within the level of ordinary skill in the art.
• the proteins may be administered for acute treatment, over one week or less, often over a period of one to three days or may be used in chronic treatment, over several months or years.
• a therapeutically effective amount of ztnfrl4 is an amount sufficient to produce a clinically significant change in, tumor suppression, apoptosis, myogenesis, inflammation, and infection in tissues of the uterus, lung carcinoma and breast carcinoma, as well as in cells of melanoma, osteosarcoma, and lymphoma.
• a therapeutically effective amount of ztnfrl4 is an amount sufficient to produce a clinically significant change in disorders associated with tissues of the stomach, uterus, melanoma, neuroblastoma, and lymphoma.
• the novel ztnfrl4 polypepti de-encoding polynucleotides of the present invention were initially identified by querying a database of partial sequences.
• a partial sequence was identified in stomach, uterus, and cancer cDNA libraries.
• the polynucleotide sequence (SEQ ED NO:l) of the insert corresponding to the cDNA clone was sequenced.
• the deduced amino acid sequence of the insert was determined to be full-length and is shown in SEQ ED NO:2.
• Screening of additional ESTs provided the partial sequences for the two splice variants, ztnfrl4x2 (SEQ ED NO:29) and ztnfrl4x3 (SEQ ED NO:31).
• Example 2 Tissue Distribution Human Multiple Tissue Northern Blots (MTN I, MTN JL and MTN EE; Human Cancer Cell Line; Human Immune Blot; Clontech, En-house human lymphocyte subset blot; Clontech, Palo Alto, CA) are probed to determine the tissue distribution of human ztnfrl4 expression.
• a probe is amplified as a template and appropriate oligonucleotides are prepared as primers. The amplification is carried out as follows: 1 cycle at 94°C for 1.5 minutes, 35 cycles of 94°C for 15 seconds and 60°C for 30 seconds, followed by one cycle at 72°C for 10 minutes.
• the PCR products are visualized by agarose gel electrophoresis and is purified using a Gel Extraction Kit (Qiagen, Chatsworth, CA) according to manufacturer's instructions.
• the probe is radioactively labeled using the MULTLPRIME DNA labeling kit (Amersham, Arlington Heights, EL) according to the manufacturer's instructions.
• the probe is purified using a NUCTRAP push column (Stratagene).
• EXPRESSHYB (Clontech) solution is used for prehybridization and as a hybridizing solution for the Northern blots. Hybridization takes place overnight at 65°C using 1 x 10 6 cpm/ml of labeled probe.
• the blots are then washed four times in 2X SSC and 0.1% SDS at RT, followed by 2 washes in 0.1X SSC and 0.1% SDS at 55°C.
• Example 3 Chromosomal Assignment and Placement of ztnfr!4 ztnfrl4 is mapped to human chromosome 1 using the commercially available version of the "Stanford G3 Radiation Hybrid Mapping Panel" (Research Genetics, Lnc, Huntsville, AL).
• the "Stanford G3 RH Panel” contains PCRable DNAs from each of 83 radiation hybrid clones of the whole human genome, plus two control DNAs (the RM donor and the A3 recipient).
• a publicly available WWW server http://shgc-www.stanford.edu) allows chromosomal localization of markers.
• Each of the 85 PCR reactions consists of 2 ⁇ l 10X KlenTaq PCR reaction buffer (CLONTECH Laboratories, Inc., Palo Alto, CA), 1.6 ⁇ l dNTPs mix (2.5 mM each, PERKLN-ELMER, Foster City, CA), 1 ⁇ l sense primer, ZC 25352 (SEQ ED NO: 14), 1 ⁇ l antisense primer, ZC 25353 (SEQ ED NO: 15), 2 ⁇ l "RediLoad” (Research Genetics, Lnc, Huntsville, AL), 0.4 ⁇ l 50X Advantage KlenTaq Polymerase Mix (Clontech Laboratories, Inc.), 25 ng of DNA from an individual hybrid clone or control and x ⁇ l ddH2O for a total volume of 20 ⁇ l.
• the reactions are overlaid with an equal amount of mineral oil and sealed.
• the PCR cycler conditions are as follows: an initial 1 cycle 5 minute denaturation at
• An expression vector is prepared to express the soluble ztnfrl4 polypeptide (ztnfrl4sR) fused to a C-terminal Glu-Glu tag (SEQ ED NO:36).
• a PCR generated ztnfrl4 DNA fragment is created using appropriate oligonucleotides as PCR primers to add suitable restriction sites at 5' and 3' ends of the soluble ztnfrl4 DNA, respectively.
• a plasmid containing the ztnfrl4 cDNA SEQ ED
• PCR amplification of the ztnfrl4 fragment is performed as follows: One cycle at 94°C for 1 minute; 25 cycles at 94°C for 30 seconds, 68°C for 90 seconds, followed by an additional 68°C incubation for 4 minutes, and hold at 10°C.
• the reaction is purified by chloroform/phenol extraction and isopropanol precipitation, and digested with the selected restriction endonucleases (Boehringer Mannheim, Indianapolis, LN).
• a band of the appropriate length is visualized by 1% agarose gel electrophoresis, excised, and the DNA was purified using a QiaexLTTM purification kit (Qiagen, Valencia, CA) according to the manufacturer's instruction.
• About 30ng of the restriction digested ztnfrl4sR insert and about lOng of an appropriate digested expression vector is ligated at room temperature for 2 hours.
• One microliter of ligation reaction is electroporated into DH10B competent cells (Gibco BRL, Rockville, MD) according to manufacturer's direction and plated onto LB plates containing 50mg/ml ampicillin, and incubated overnight.
• Colonies are screened by restriction analysis of DNA, which is prepared from 2 ml liquid cultures of individual colonies. The insert sequence of positive clones is verified by sequence analysis. Thus, the excised ztnfrl4sR DNA is subcloned into the appropriate expression vector.
• a large- scale plasmid preparation is done using a Qiagen® Mega prep kit (Qiagen) according to manufacturer's instruction. The same process was used to prepare the ztnfrl4 soluble receptor with a C-terminal Fc4 tag (SEQ ED NO:37), creating the ztnfrl4sR/Fc4.
• Fc4 is the Fc region derived from human IgG, which contains a mutation so that it no longer binds the Fc receptor.
• Fc4 is utilized in the present example, one of ordinary sldll recognizes that other Fc constructs (i.e., those derived from other Ig molecules) can be used to prepare a soluble ztnfrl4 receptor utilizing this same protocol.
• BHK 570 cells ATCC No. CRL-10314; ATCC, Manasas, VA
• BHK DMEM Gibco/BRL High Glucose
• the day of the transfection the cells are washed once with Serum Free (SF) DMEM, followed by transfection with the ztnfrl4sR/Fc4 or ztnfrl4sR/CEE expression plasmids.
• SF Serum Free
• each DNA construct Sixteen micrograms of each DNA construct are separately diluted into a total final volume of 640 ⁇ l SF DMEM.
• a diluted LipofectAMENETM mixture (35 ⁇ l LipofectAMENETM in 605 ⁇ l SF meida) is added to the DNA mix, and incubated for 30 minutes at room temperature.
• Five milliliters of SF media is added to the DNA LipofectAMENETM mixture, which is then added to BHK cells. The cells are incubated at 37°C/5% CO 2 for 5 hours, after which 6.4ml of BHK media with 10% FBS is added. The cells are incubated overnight at 37°C/5% CO 2 .
• the BHK cells are split into selection media with luM methotrexate (MTX).
• MTX methotrexate
• the cells are repeatedly split in this manner until stable ztnfrl4sR/CEE and ztnfrl4sR/Fc4 cell lines are identified.
• To detect the expression level of the ztnfrl4 soluble receptor fusion proteins the BHK cells are washed with PBS and incubated in SF media for 72 hours. The SF condition media is collected and 20 ⁇ l of the sample is run on 10% SDS-PAGE gel under reduced conditions.
• the protein bands are transferred to nitrocellulose filter by Western blot, and the fusion proteins are detected using either goat-anti-human IgG/HRP conjugates for the ztnfrl4sR/Fc4 fusion or mouse-anti-Glu-Glu tag/HRP conjugates for the ztnfrl4sR/CEE fusion.
• Expression vectors containing a different soluble receptor fused to the Fc4 or the CEE tags are used as controls.
• Transfected BHK cells are transferred into T-162 flasks. Once the BHK cells reached about 80% confluence, they are washed with PBS and incubated in 100ml SF media for 72 hours, and then the condition media is collected for protein purification.
• Example 6 Purification and Analysis of ztnfrl4sR/CEE Recombinant carboxyl terminal Glu-Glu tagged ztnfrl4sR is produced from transfected BHK cells as described in Example 5 above. About six liters of conditioned media are harvested from 60 dishes after roughly 72 hours incubation. A portion of the media is sterile filtered using filtration units from different manufactures. The Nalgene 0.2 ⁇ m and 0.45 ⁇ m filters, and Millipore Express 0.22 ⁇ m filter are compared and the one providing the best recovery of the protein and flow rate is used. The level of protein expression reaches the optimal concentration after about 72 hours in new media. Three harvests of the ztnfrl4sR/CEE conditioned media are collected.
• Protein is purified from the filtered media by a combination of Anti-Glu- Glu (Anti-EE) peptide antibody affinity chromatography and S-100 gel exclusion chromatography.
• Culture medium is directly loaded onto a 20x185mm (58-ml bed volume) anti-EE antibody affinity column at a flow of about 4 ml/minute.
• bound protein is eluted with two column volumes of 0.4mg/ml EYMPTD peptide (Princeton Biomolecules, NJ). Fractions of 5 ml were collected.
• Samples from the anti-EE antibody affinity column are analyzed by SDS-PAGE with silver staining and western blotting for the presence of ztnfrl4sR/CEE.
• Fractions containing the ztnfrl4sR/CEE protein are pooled and concentrated to 4 mis using Biomax-5 concentrator (Millipore), and loaded onto a 16 x 1000 mm Sephacryl S-100 HR gel filtration column (Amersham Pharmacia Biotech).
• the fractions containing purified ztnfrl4sR/CEE are pooled, filtered through 0:2 ⁇ m filter, aliquoted into 100 ⁇ l each, and frozen at -80°C.
• the concentration of the final purified protein is determined by BCA assay (Pierce) and HPLC-amino acid analysis.
• Recombinant ztnfrl4sR CEE is analyzed by SDS-PAGE (Nupage 4- 12%), Novex) with either coomassie and silver staining method (Fast Silver, Geno Tech), and Western blotting using monoclonal anti-EE antibody.
• Either the conditioned media or purified protein is electrophoresed using a Novex's Xcell TT mini-cell (San Diego, CA) and transferred to nitrocellulose (0.2 ⁇ m; Bio-Rad Laboratories, Hercules, CA) at room temperature using Novex's Xcell JJ blot module with stirring according to directions provided in the instrument manual.
• the transfer is run at 500 mA for one hour in a buffer containing 25 mM Tris base, 200 mM glycine, and 20% methanol.
• the filters are then blocked with 10% non-fat dry milk in PBS for 10 minutes at room temperature.
• the nitrocellulose is quickly rinsed, then primary antibody is added in PBS containing 2.5% non-fat dry milk.
• the blots are incubated for two hours at room temperature or overnight at 4°C with gentle shaking. Following the incubation, blots are washed three times for 10 minutes each in PBS.
• the blots are developed using commercially available chemiluminescent substrate reagents (SuperSignal® ULTRA reagents 1 and 2 mixed 1:1; reagents obtained from Pierce Chemical Co.), and the signal is captured using Lumi-Imager's Lumi Analyst 3.0 software (Boehringer Mannheim GmbH, Germany) for exposure times ranging from 10 second to 5 minutes or as necessary.
• chemiluminescent substrate reagents SuperSignal® ULTRA reagents 1 and 2 mixed 1:1; reagents obtained from Pierce Chemical Co.
• Example 7 Purification and Analysis of ztnfrl4sR/Fc4 Recombinant carboxyl terminal Fc4 tagged ztnfrl4sR is produced from transfected BHK cells as described in Example 5 above. Approximately five-liters of conditioned media were harvested from 60 dishes after about 72 hours of incubation. A portion of the media was sterile filtered using filtration units from different manufactures. The Nalgene 0.2 ⁇ m and 0.45 ⁇ m filters, Millipore Express 0.22 ⁇ m ⁇ filter, and Durapore 0.45 ⁇ m filter are compared and the one providing the best yield and flow rate is used. The level of protein expression reaches the optimal concentration after about 72 hours in the new media. Normally three to four harvests of the media were collected.
• Protein is purified from the filtered media by a combination of Poros 50 protein A affinity chromatography (PerSeptive Biosystems, 1-5559-01, Framingham, MA) and S-200 gel exclusion chromatography column (Amersham Pharmacia Biotech). Culture medium is directly loaded onto a 10x80mm (6.2-ml bed volume) protein A affinity column at a flow of about 4 ml/minute. Following column washing for ten column volumes of PBS, bound protein is eluted by five column volumes of 0.1 M glycine, pH 3.0 at 10 ml/minute). Fractions of 1.5 ml each are collected into tubes containing 38 ⁇ l of 2.0 M Tris, pH 8.8, in order to neutralize the eluted proteins.
• the nitrocellulose is quickly rinsed, then the human Ig- HRP antibody (1:2000) is added in PBS containing 2.5% non-fat dry milk.
• the blots are incubated for two hours at room temperature, or overnight at 4°C, with gentle shaking. Following the incubation, the blots are washed three times for 10 minutes each in PBS, then quickly rinsed in H 2 O.
• the blots are developed using commercially available chemiluminescent substrate reagents (SuperSignal® ULTRA reagents 1 and 2 mixed 1:1; reagents obtained from Pierce Chemical Co.), and the signal is captured using Lumi- Lmager's Lumi Analyst 3.0 software (Boehringer Mannheim GmbH, Germany) for exposure times ranging from 10 second to 5 minutes or as necessary.
• chemiluminescent substrate reagents SuperSignal® ULTRA reagents 1 and 2 mixed 1:1; reagents obtained from Pierce Chemical Co.
• Example 8 Identification of Cells Expressing ztnfr!4 Using In situ Hybridization
• Various human tissues prepared, sectioned and subjected to in situ hybridization includes normal stomach, normal uterus, neuroblastomas and melanoma, among other cancers. The tissues are fixed in 10% buffered formalin and blocked in paraffin using standard techniques. Tissues are sectioned at 4 to 8 microns. Tissues are prepared using a standard protocol ("Development of non-isotopic in situ hybridization" at http://dir.niehs.nih.gov/dirlep/ish.html).
• tissue sections are deparaffinized with HistoClear (National Diagnostics, Atlanta, GA) and then dehydrated with ethanol. Next they are digested with Proteinase K (50 ⁇ g/ml) (Boehringer Diagnostics, Indianapolis, LN) at 37°C for 2 to 20 minutes. This step is followed by acetylation and re-hydration of the tissues.
• Two in situ probes generated by PCR are designed against the human ztnfrl4 sequence. Two sets of oligos are designed to generate probes for separate regions of the ztnf ⁇ l4 cDNA.
• the antisense oligo from each set also contains the worldng sequence for the T7 RNA polymerase promoter to allow for easy transcription of antisense RNA probes from these PCR products.
• the PCR reaction conditions are as follows: 2 cycles at 95°C for 30 sec, 50°C for 1 min, 72°C for 1 min followed by 33 cycles of 95°C for 30 sec, 72°C for 2 min.
• Probes are subsequently labeled with digoxigenin (Boehringer) or biotin (Boehringer) using an In Vitro transcription System (Promega, Madison, WE) as per manufacturer's instruction. In situ hybridization is performed with a digoxigenin- or biotin-labeled ztnfrl4 probe (above).
• the probe is added to the slides at a concentration of 1 to 5 pmol/ml for 12 to 16 hours at 60°C. Slides are subsequently washed in 2XSSC and 0.1XSSC at 55°C.
• the signals are amplified using tyramide signal amplification (TSA) (TSA, in situ indirect kit; NEN) and visualized with Vector Red substrate kit (Vector Lab) as per manufacturer's instructions.
• TSA tyramide signal amplification
• Vector Lab Vector Red substrate kit
• the slides are then counter-stained with hematoxylin (Vector Laboratories, Burlingame, CA).
• Example 9 Human ztnfr!4 Polyclonal Antibodies
• Polyclonal antibodies are prepared by immunizing 2 female New Zealand white rabbits with the purified recombinant protein ztnfrl4-CEE protein expressed in BHK from Example 6. The rabbits are each given an initial intraperitoneal (ip) injection of 200 ⁇ g of purified protein in Complete Freund's Adjuvant followed by booster ip injections of 100 ⁇ g peptide in Incomplete Freund's Adjuvant every three weeks. Seven to ten days after the administration of the second booster injection (3 total injections), the animals are bled and the serum is collected. The animals are then boosted and bled every three weeks.
• the ztnfrl4sR-specific polyclonal antibodies are affinity purified from the rabbit serum using a CNBr-SEPHAROSE 4B protein column (Pharmacia LKB) that is prepared using 10 mg of purified recombinant huztnfrl4-Fc protein (as prepared in Example 6) per gram of CNBr-SEPHAROSE, followed by 20X dialysis in PBS overnight.
• Ztnfrl4sR-specific antibodies are characterized by ELISA using 1 ⁇ g/ml of the specific purified recombinant huztnfrl4-CEE-BHK protein as antibody target.
• Example 10 Human ztnfr!4 Northern An appropriate probe is made by PCR using plasmid DNA containing
• SEQ ED NO:l as a template and suitable oligonucleotides as primers.
• the amplification is carried out as follows: 1 cycle at 94°C for 1 minutes, 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 seconds, followed by 1 cycle at 72°C for 10 minutes.
• the PCR products are visualized by agarose gel electrophoresis and the probe was purified using a Gel Extraction Kit (Qiagen, Chatsworth, CA) according to manufacturer's instructions.
• the probe is radioactively labeled using the REDEPRIME DNA labeling kit (Amersham, Arlington Heights, EL) according to the manufacturer's instructions.
• the probe is purified using a NUCTRAP push column (Stratagene).
• An in-house blot containing poly A+ RNA from at least human normal stomach, human normal uterus and human neuroblastoma cells lines and human melanoma cell lines such as C32, Malme 3M, SK-MEL-2, and WM-115 is prehybridized in EXPRESSHYB (Clontech) for 3 hours at 65°C. Hybridization takes place overnight at 65°C using 10 6 cpm/ml of labeled probe. The blots are then washed four times in 2X SSC and 0.1% SDS at room temp, followed by 2 washes in 0.1X SSC and 0.1% SDS at 50°C.
• Example 11 Human ztnfrl4 Tumor Polymerase Chain Reaction A nested 5' RACE reaction was performed using marathon cDNAs from a neuroblastoma cell line, a melanoma cell line and lymphoma cell lines. A 50 ul PCR reaction is run under the following conditions: 20 pmol of a sense primer corresponding to the vector sequence and 20 pmol of an antisense primer corresponding to the polynucleotide sequence as shown in SEQ ED NO:l.
• the experiment is performed using a 3-step, 2-temperature reaction including an initial one minute at 94°C followed by 5 cycles of 94°C for 30 seconds and 72°C for 5 minutes, then 5 cycles of 94°C for 30 seconds and 70°C for 5 minutes, then 25 cycles of 94°C for 30 seconds and 68°C for 5 minutes. A final extension of 72°C for 10 min completes the reaction.
• One ul of a 1:50 dilution of the above reactions is used for nested 5' RACE using 20 pmol of an nested sense primer corresponding to the vector sequence and 20 pmol of an antisense primer for a second section of SEQ ED NO.T.
• a 50 ⁇ l reaction is set up and ran under the following conditions.
• a composite of the polypeptide sequence of SEQ ED NO:2 with SEQ ED NO:34 results in a 299 residue protein shown in SEQ ED NO:35.
• This variant of ztnfrl4 differs from the polypeptide sequence as shown in SEQ ED NO:2 by a two amino acid insertion (Val-Ala) at residue 172 and a 28 residue insertion at residue 204 relative to the corresponding region of SEQ ED NO:2.
• the resulting nucleotide sequence for the clone containing the 431 bp band (lower) is shown in SEQ ED NO:36, which corresponds to the 142 residue amino acid sequence shown in SEQ ED NO: 37.
• This variant of ztnfrl4 differs from the polypeptide sequence as shown in SEQ ED NO:2 by a translation stop codon resulting in a truncated soluble ztnfrl4 receptor.
• Example 12 Construction of an Assay Cell Line A BaF3 assay cell line is constructed for ztnfrl4 ligand cloning. A ztnfrl4/TNFRl chimera is built in which the transmembrane and cytoplasmic domain of ztnfrl4 are replaced by those of the TNF ⁇ receptor (TNFRl) (SEQ LD NO:38). The ztnfrl4/TNFRl chimera was transfected into a BaF3 cell line that contains a KZ159/mJL4 reporter gene (SEQ ED NO:39).
• KZ159/mLL4 responds to the activation of TNFRl receptor by TNF ⁇ , triggering the expression and secretion of mLL4 that leads to the proliferation of BaF3 cells.
• the extracellular domain of ztnfrl4 is amplified with appropriate PCR primers using ztnfrl4 full-length cDNA as a template.
• the PCR reaction is as follows: 20 cycles of 94°C for 30 sec and 68°C for 2 min, then four more min at 68°C and soak at 10°C.
• the transmembrane and cytoplasmic domain of mouse TNFRl is amplified with appropriate PCR primers using mouse placenta marathon cDNA as a template.
• the PCR reaction is as follows: 35 cycles of 94°C for 30 sec and 68°C for 2 min, then four more min at 68°C and soak at 10°C.
• the PCR products were separated on 1% Agarose, the ztnfrl4 and TNFRl bands are excised and the DNA is purified using a QiaexLTTM purification kit (Qiagen, Valencia, CA) according to the manufacturer's instruction.
• the pZP7Z plasmid is a mammalian expression vector containing an expression cassette having the CMV promoter and a human growth hormone terminator.
• the plasmid also has an E.
• coli origin of replication a mammalian selectable marker expression unit having an SV40 promoter, an enhancer and an origin of replication, as well as a Zeocin resistant gene, and SV40 terminator.
• About 30 ng of the restriction digested ztnfrl4 insert and TNFRl insert and about 10 ng of the digested vector are ligated at 11°C overnight.
• One microliter of ligation reaction is electroporated into DH10B competent cells (Gibco BRL, Rockville, MD) according to manufacturer's direction and plated onto LB plates containing 50 ug/ml ampicillin, and incubated overnight. Colonies are screened by restriction analysis of DNA, which is prepared from 2ml liquid cultures of individual colonies.
• the insert sequence of positive clones is verified by sequencing analysis.
• Ten million BaF3 cells that contain KZ159/mLL4 reporter are transfected with ztnfrl4/TNFRl/pZP7Z plasmid by electroporation, and selected for Zeocin resistant stable transfectants.
• the proliferation of this stable cell line in response to TNF ⁇ without mEL-3 was assayed, and the activation of ztnfrl4/TNFRl chimera is tested using cross- linked anti-ztnfrl4 reagent which is prepared by incubating rabbit anti-ztnfrl4 antibody at 1 ug/ml with anti-rabbit immunoglobulin G (IgG) antibody-coupled magnetic beads.
• IgG immunoglobulin G
• Example 13 Construction of a Transgenic Plasmid Twenty ⁇ g of the pzp9 plasmid containing the ztnfrl4-Fc4 soluble receptor sequence from Example 5 was digested with appropriate restriction endonucleases. The ztnfrl4-Fc4 soluble receptor fragment is then isolated by running the digested vector on a 1.2% SeaPlaque GTG ® gel and excising the fragment. DNA is purified using the QiaQuickTM (Qiagen) gel extraction kit.
• QiaQuickTM Qiagen
• the EcoRI and Xbal overhangs were then converted to blunt ends using Klenow polymerase.
• the ztnfrl4-Fc4 soluble receptor fragment is then ligated into a apoAl Cl-17 transgenic vector, which was previously digested with an appropriate restriction enzyme.
• the apoAl Cl-17 plasmid is designed for expression of a gene of interest in transgenic mice. It contains an expression cassette comprised of the apoAl promoter, the first apoAl exon and a portion of the first intron, the ztnfrl4-Fc4 coding sequence, a polylinker for the insertion of the desired clone and the human growth hormone poly A sequence. About one microliter of the ligation reaction is electroporated into
• DH10B ElectroMax ® competent cells (GEBCO BRL) according to manufacturer's direction, plated onto LB plates containing 100 ⁇ g/ml ampicillin, and incubated overnight at 37°C. Colonies are picked and grown in LB media containing 100 ⁇ g/ml ampicillin.
• Miniprep DNA is prepared from the picked clones and screened for the correctly oriented ztnfrl4-Fc4 soluble receptor insert by restriction digestion analysis and subsequent agarose gel electrophoresis. Maxipreps of the correct apoAl Cl-17 ztnfrl4- Fc4 soluble receptor construct are performed.
• An appropriate fragment containing the expression cassette is prepared and used for microinjection into fertilized murine oocytes.
• Pellets were prepared using RNeasy Midiprep Kit (Qiagen, Valencia, CA) per the manufacturer's instructions. Real Time-PCR was performed on these human mRNA samples as described below with measurements designed to assess levels of human zTNFR14xl, zTNFR14x2 and zTNFR14x3 expression. Primers and Probes for Quantitative RT-PCR Real-time quantitative RT-PCR using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems, Inc., Foster City, CA) has been previously described (See, Heid, CA. et al, Genome Research 6:986-994, 1996; Gibson, U.E.M.
• This method incorporates use of a gene specific probe containing both reporter and quencher fluorescent dyes. When the probe is intact the reporter dye emission is negated due to the close proximity of the quencher dye. During PCR extension using additional gene-specific forward and reverse primers, the probe is cleaved by 5' nuclease activity of Taq polymerase. This cleavage releases the reporter dye from the probe, resulting in a measurable increase in fluorescent emission.
• Three sets of primers and probes were generated for use in real-time quantitative RT-PCR and each was designed to specifically amplify either zTNFR14xl or zTNFR14x2 or zTNFR14x3.
• the forward primer for human zTNFR14xl, zc49573 (SEQ ED NO:40) (5'CTGGCGAAGCCGCTGC) was used at 200nM and the reverse primer, zc49579 (SEQ ED NO:41) (5'GATCCGTGGCCCTGTCCAGG) was used at 800nM concentration to synthesize a 67bp product.
• the forward primer for human zTNFR14x2, zc49277 (SEQ ED NO:42)
• zc49280 SEQ ED NO:43
• zc49284 SEQ ED NO:44
• zc49233 SEQ ED NO:45
• the corresponding TaqMan probe for zTNFR14xl, ZG49714 (SEQ LD NO:46) (5'AGTCCTCAGTACGGAAGC) was used at 200nM.
• the corresponding TaqMan probe for zTNFR14x2, ZG49360 (SEQ ED NO:47)
• TaqMan probe for zTNFR14x3, ZG48404 (SEQ ED NO:48) was used at lOOnM.
• FAM reporter fluorescent dye
• ECM non-fluorescent quencher
• RNA samples were screened for either rRNA and the human form of the housekeeping gene Glucouronidase (hGUS) using primer and probe sets either ordered from PE Applied Biosystems (rRNA kit Catalog No. 4304483) or designed in-house (hGUS) using standard primer, probe protocols.
• the rRNA kit contains the forward primer, the rRNA reverse primer, and the rRNA TaqMan® probe.
• the rRNA probe was labeled at the 5'end with a reporter fluorescent dye VLC (PE Applied Biosystems, Foster City, CA) and at the 3' end with the quencher fluorescent dye TAMRA (PE Applied Biosystems, Foster City, CA) as per manfacturer's instructions.
• the hGUS primers and probe were used in each PCR reaction at 200nM and lOOnM respectively.
• the forward primer is zc40574 (SEQ ED NO:#49) (5' CTCATTTGGAATTTTGCCGATT) and the reverse primer was zc40575 (SEQ ED NO:50) (5' CCGAGTGAAGATCCCCTTTTTA.
• the hGUS probe zc43228 (SEQ LD NO:51) (5'
• TGAACAGTCACCGACGAGAGTGCTGG was labeled at the 5'end with a reporter fluorescent dye Yakima Yellow (Epoch Biosciences, Bothell, WA) and at the 3'end with a non-fluorescent quencher dye (ECLIPSE) (Epoch Biosciences, Bothell, WA).
• ECLIPSE non-fluorescent quencher dye
• the rRNA and hGUS results also serve as an endogenous control and allow for the normalization of the zTNFR14xl, zTNFR14x2 zTNFR14x3 mRNA expression results seen in the test samples.
• Real-time quantitative RT-PCR Relative levels of human zTNFR14xl, zTNFR14x2 zTNFR14x3 mRNA were determined by analysis of total RNA samples using RT-PCR.
• the total RNA samples were analyzed in triplicate for transcript levels of each human zTNFR14 mRNA splice variant, zTNFR14xl, zTNFR14x2, and zTNFR14x3 and for levels of hGUS as an endogenous control.
• En a total volume of 10 ⁇ l each RNA sample was subjected to an RT-PCR reaction containing: approximately 70 ng of total RNA in ABsolute QPCR dUTP Mix (Abgene, Rochester, NY, Product No.
• PCR thermal cycling conditions were as follows: an initial reverse transcription (RT) step of one cycle at 50°C for 20 minutes; followed by a DNA polymerase activation step of one cycle at 95°C for 10 minutes; followed by 40 cycles of amplification at 95°C for 15 seconds and 60°C for 1 minute.
• RT reverse transcription
• TaqMan RT-PCR was used to assess human zTNFR14xl, zTNFR14x2 and zTNFR14x3 mRNA expression in unstimulated human B cell lines (DOHH-2, Granta519, REH, Ramos, WSU-NHL, CESS, BJAB, RPMI1788, OMP-2, HS Sultan, 697, L363, RPMI8226, U266, ARH77, Raji), in unstimulated human T cell lines (HUT78, CCRF-CEM), a transformed bone marrow endothelial cell line (TRBMEC), in unstimulated human monocyte lines (K652, KG-1, HEL 92.1.7, MV4-11), unstimulated dendritic cells (DC), in a mixed lymphocyte reaction (two donors, one irradiated) (MLR), both with and without interferon gamma (EFNg) and fibroblasts.
• unstimulated human B cell lines DOHH-2, Grant
• Activation was achieved by various standard means including addition of stimulating factors such as dimethyl sulfoxide (DMSO, with RNA from various sources, abbreviated CGAT and MKMA), 12-myristate 13-acetate (PMA with and without ionomycin), vitamin D 3 , retinoic acid, butyric acid, lipolysaccaride (LPS, with or without EFNg), as is well known in the art.
• DMSO dimethyl sulfoxide
• PMA 12-myristate 13-acetate
• retinoic acid retinoic acid
• butyric acid butyric acid
• lipolysaccaride LPS, with or without EFNg

Landscapes

• Peptides Or Proteins (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Medicinal Preparation (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=36406424

Family Applications (1)

Country Status (3)

Family Cites Families (4)

• 2004
  • 2004-10-18 EP EP04795522A patent/EP1673390A2/de not_active Withdrawn
  • 2004-10-18 JP JP2006535407A patent/JP2008500804A/ja active Pending
  • 2004-10-18 CA CA002542482A patent/CA2542482A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events