EP1670899A2 - Vaccines for cancer, autoimmune disease and infections - Google Patents

Vaccines for cancer, autoimmune disease and infections

Info

Publication number
EP1670899A2
EP1670899A2 EP04809624A EP04809624A EP1670899A2 EP 1670899 A2 EP1670899 A2 EP 1670899A2 EP 04809624 A EP04809624 A EP 04809624A EP 04809624 A EP04809624 A EP 04809624A EP 1670899 A2 EP1670899 A2 EP 1670899A2
Authority
EP
European Patent Office
Prior art keywords
peptide
seq
hla
cells
vaccine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04809624A
Other languages
German (de)
French (fr)
Inventor
Jeffrey Molldrem
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Texas System
University of Texas at Austin
Original Assignee
University of Texas System
University of Texas at Austin
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Texas System, University of Texas at Austin filed Critical University of Texas System
Publication of EP1670899A2 publication Critical patent/EP1670899A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • A61K39/001154Enzymes
    • A61K39/001158Proteinases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/20Cellular immunotherapy characterised by the effect or the function of the cells
    • A61K40/22Immunosuppressive or immunotolerising
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/418Antigens related to induction of tolerance to non-self
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4244Enzymes
    • A61K40/4247Proteinases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/38Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/46Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
    • A61K2239/48Blood cells, e.g. leukemia or lymphoma

Definitions

  • the present invention relates generally to the fields of cancer and immunotherapy. More particularly, it concerns the ideutificatiou of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of cancer. It also concerns the identification of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of autoimmune diseases, transplant rejection, post-transplant antitumor immunity and vasculitis.
  • CML chronic myelogenous leukemia
  • BMT allogeneic bone marrow transplant
  • IFN- ⁇ 2b interferon - ⁇ 2b
  • Lymphocyte transfusion from the original bone marrow (BM) donor induces both hematological and cytogenetic responses in approximately 70% to 80% of patients with chronic myelocytic leukemia (CML) in chronic phase (CP) (Kolb et al., 1996, Holler, 1997), Remissions after DLI for AML are generally not as durable as those obtained in chronic phase CML, which may reflect the rapid kinetics of tumor growth outpacing the kinetics of the developing inrmune response. Additionally, most patients with myeloid forms of leukemia will die from the disease unless they can be treated with allogeneic bone marrow transplant, where the associated graft versus leukemia (GVL) effect cures patients.
  • CML chronic myelocytic leukemia
  • CP chronic phase
  • graft-versus-host disease GVHD
  • transplant-related toxicity limit this treatment. It is believed that GVL may be separable from GHND, and that targeting the immune response toward leukemia-associated antigens will allow for the transfer of GVL to patients without GVHD.
  • antigens i.e., leukemia antigens or antigens aganist other cancers
  • CTLs cytotoxic T lymphocytes
  • tissue-restricted minor histocompatibility antigens that are derived from proteins expressed only in recipient hematopoietic tissue have been shown to be the targets of alloreactive donor T cells.
  • Heterologous T cell clones that demonstrate alloreactivity toward different mHA have been established from patients with severe GVHD following BMT with an HLA-matched donor (Faber et al, 1995a; Faber ⁇ t al, 1995b; Faber et al., 1996; van der Harst et al, 1994; Molldrem et al, 2000; Gao et al, 2000; den Haan et al, 1998; Clark et al, 2001). Some of these rnHA- specific CTL clones react only with hematopoietic-derived cells, suggesting tissue specificity (Faber et al, 1996; den Haan et al, 1998), and therefore potentially shared antigens on leul emia.
  • HA-2 was identified as a peptide derived from the non-filament-forming class I rnyosin family by using mHA-reactive CTL clones to screen peptide fractions eluted from MHC class I molecules (den Haan et al, 1995; Faber et al, 1995a).
  • CTL alloantigens it is extremely labor intensive and it is unclear whether CTL specific for any minor antigens identified thus far convey leukemia-specific immunity without concomitant GVHD.
  • GVHD correlated closely with differences in the minor antigen HA-1 in HLA identical sibling transplants (Goul y et al, 1996; Dolstra et al, 1997). Furthermore, a practical lirnit of any immunotherapy approach targeting these mHAs is that only 10% of individuals would be expected to have the relevant HA-1 alternate allele, and ⁇ 1% would have the HA-2 alternate allele, which makes donor availability quite limiting.
  • An alternative immunological or deductive method to determine leukemia-specific CTL epitopes has been applied to determine whether BCR-ABL fusion region peptides could elicit CML-specific T cell responses.
  • Peptides are synthesized based upon an "educated guess" of which proteins are potential target antigens for a selective anti-leukemia CTL response. The proteins are then examined for short peptides that fit the binding motif of the most common HLA alleles based on the amino acid sequence. Using this method, these peptides are then synthesized, tested for binding to the HLA allele, and used to elicit peptide-specific CTL responses in vitro. Since BCR-ABL is present in nearly all (92%) Philadelphia chromosome- positive CML patients, it is thought to represent a potentially unique leukemia antigen.
  • the ABL coding sequences upstream (5 ') of exon II on chromosome 9 are translocated to chromosome 22 and fused inframe with the BCR gene downstream (3') of exon III, resulting in a chimeric mRNA (b3a2) (the most common transcript) which is translated into a chimeric protein (p210BCR-ABL).
  • b3a2 mRNA results in the coding of a unique amino acid (lysine) within the fusion region.
  • HLA-B8-restricted overlapping peptides inclusive of this lysine could bind to HLA-B8 and could be used to elicit T cell proliferative responses when the peptide was either pulsed onto HLA-matched normal antigen presenting cells or onto HLA- B8 positive CML cells (Dermime et al, 1995; Bocchia et al, 1995; Bocchia et al, 1996; Faber et al, 1995b; Faber et al, 1996; van der Harst et al, 1994).
  • the resulting T cells could not specifically lyse fresh CML cells which had not previously been pulsed with the peptide (Bocchia et al, 1996; van der Harst et al, 1994). This could be due to a low affinity of the peptide-specific CTL or the peptide may not be processed or presented on CML cells. More recently, b3a2-specific CTL were identified in the peripheral blood of CML patients using soluble b3a2 peptide/MHC tetramers (Clark et al, 2001).
  • CTL immunity to the Wilm's tumor antigen WT-1 which is aberrantly expressed in various forms of leukemia, has been demonstrated to kill CML CD34+ progenitor cells (Gao et al, 2000).
  • Melanoma peptide antigens that are derived from MAGE-3 proteins for example, are presented to melanoma-specific CTLs by HLA-A1 and HLA-A2 (Nanda and Sercarz, 1995; Boon et al, 1997; Rosenberg and White, 1996).
  • This protein belongs to a family of proteins which are expressed in melanoma cells and in normal testis.
  • a MAGE-3 derived peptide was determined to be immunogenic by separate groups using different techniques, one using an immunological method (Pardoll, 2002) and the other a genetic method that uses tumor antigen- deficient mutants (Nanda and Sercarz, 1995). Recently, a phase I clinical trial using MAGE-3 to vaccinate melanoma patients resulted in some clinical responses (Pardoll, 1994).
  • tyrosinase, gplOO, and Melan-A-MART-1 are also normal self-proteins specific to the melanocyte lineage and T-cells specific for determinants on each of these antigens can be found in a large majority of melanoma patients (Sturrock et al, 1992; Chen et al, 1994). Two recent phase II vaccine trials demonstrated clinical efficacy of active immunotherapy using these target antigens as a peptide vaccine or as a antigen-pulsed dendritic cell vaccine.
  • PRl an HLAA2.1 -restricted nonamer derived from proteinase 3 (P3)
  • P3 proteinase 3
  • PRl was identified as a leukemia-associated antigen (Molldrem et al, 2000; Molldrem et al, 1996; Molldrem et al, 1997; Molldrem et al, 1999; Molldrem et al, 2003 each incorporated herein by reference in their entirety).
  • the finding that PRl is a leukemia-associated antigen has been independently confirmed by Burchert et ⁇ / (2002) and Scheibenbogen et al. (2002).
  • the present invention provides a vaccine comprising a first tumor associated HLA restricted peptide.
  • the peptide is selected from the group consisting of a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
  • the cyclin D peptide may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof
  • the cyclin El peptide may comprise the sequence ILLDWLMEV (SEQ LD NO:62) or a fragment thereof
  • the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ LD NO:63) or a fragment thereof.
  • the vaccine may further comprise a tumor-associated HLA- A3 restricted peptide, a tumor- associated HLA- All restricted peptide, a tumor-associated HLA-B7 restricted peptide, a tumor- associated HLA-B27 restricted peptide, or a tumor-associated HLA-B35 restricted peptide, and in particular may further comprise a myeloperoxidase peptide, such as MY4 (SEQ ID NO:30), MY2 (SEQ ID NO:32), or a fragment of either.
  • a myeloperoxidase peptide such as MY4 (SEQ ID NO:30), MY2 (SEQ ID NO:32), or a fragment of either.
  • the vaccine may further comprise an adjuvant, such as complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette-Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21.
  • the vaccine may further comprise an immunostimulant.
  • the vaccine may further comprise more than one distinct peptide, for example, where the peptides depend on the tumor to be treated and/or the HLA type of the patient
  • the vaccine may further comprise an antigen presenting cell, such as a dendritic cell.
  • the dendritic cell may be (a) is pulsed or loaded with the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, and thereby against the tumor, or (b) comprises an expression construct that encodes the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, or and thereby against the tumor.
  • the vaccine may further comprising a second tumor-associated HLA-restricted peptide.
  • the vaccine may further comprise a third, fourth or fifth tumor-associated HLA-restricted peptide.
  • the second, third, fourth or fifth tumor-associated HLA-restricted peptide may be an HLA-A3, HLA-A11, HLA-B7, HLA-B27 or HLA-B35 restricted peptide.
  • a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising a peptide selected from a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
  • the vaccine may be administered more than once.
  • the therapeutically effective amount may be in the range of 0.20 mg to 5.0 mg, or in the range of 0.025 mg to 1.0 mg, or in the range of 2.0 mg to 5.0 mg of the peptide.
  • the cancer cell may be a leukemic cell, such as a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell.
  • T-LGL T-large granular lymphocytic
  • the cancer cell may be a solid tumor cell, such as a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphatic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft tissue cancer cell.
  • the method may use vaccine administered systemicaUy, intravenously, intra-arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermally, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration.
  • the vaccine may be administered locally, by direct intratumoral injection, by injection into tumor vasculature or by an antigen-presenting cell pulsed or loaded with the peptide, wherein the antigen presenting cell may be a dendritic cell.
  • the antigen-presenting cell may comprise one or more distinct peptides.
  • the method may utilize a cellular vaccine.
  • the method may further comprise treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent.
  • the second anticancer agent may be administered simultaneously with the vaccine, or administered at a different time than the vaccine.
  • the immunotherapeutic agent may be GM-CSF, CD40 ligand, anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-lBB (CD137) mAbs, and an oligonucleotide.
  • the chemotherapeutic agent may be doxorubicin, daunorubicin, dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, semustine, streptozocin, dacarbazine, adriamycin, 5-fluorouracil (5FU), camptothecin,
  • a method for treating or preventing cancer in a patient comprising (a) contacting CTLs of the patient with a a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient.
  • the method may further comprising expanding the CTL's by ex vivo or in vivo methods prior to administration.
  • Contacting comprises providing (a) an antigen presenting cell loaded with the peptide, (b) an antigen presenting cell transfected with an expression construct encoding the peptide, or (c) an antigen presenting cell infected with a viral vector that expresses the peptide.
  • the method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide.
  • the therapeutically effective amount of CTL cells required to provide therapeutic benefit may be from about 0.1 x 10 5 to about 5 x 10 7 cells per kilogram weight of the subject.
  • a peptide comprising the amino acid sequence of MY4 (SEQ ID NO: 30) or MY2 (SEQ ID NO: 32) or a fragment thereof or an expression vector comprising a nucleic acid sequence that encodes the MY2 sequence (SEQ LD NO: 32) or the MY4 sequence (SEQ ID NO:30) or a fragment thereof.
  • a peptide comprising the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO: 11), VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ TD NO:29) or a fragment thereof, or an expression vector comprising a nucleic acid that encodes the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ LD NO
  • a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor-associated peptide, wherein the peptide is a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
  • the expression construct may be a non-viral expression construct or a a viral expression construct.
  • the expression construct may encode a second tumor associated peptide.
  • a pmethod of treating an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide.
  • the HLA-A2-restricted peptide may be a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
  • the cyclin D may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof
  • the cyclin El peptide may comprise the sequence ILLDWLMEV (SEQ ID NO:62)
  • the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ ID NO:63) or a fragment thereof
  • the myleoperoxidase peptide may comprise the sequence of MY2 (SEQ LD NO:32) or MY4 (SEQ ID NO:30) or a fragment thereof.
  • the vaccine may further comprise a disease-associated HLA-A3 restricted peptide, a disease-associated HLA-A11 restricted peptide, a disease-associated HLA-B7 restricted peptide, a disease-associated HLA-B27 restricted peptide, and/or a disease-associated HLA-B35 restricted peptide.
  • the proteinase-3 peptide may be selected from the group consisting of VLQELNVTV
  • SEQ ID NO:l RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ LD NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO:ll) or a fragment thereof.
  • the proteinase-3 peptide may be a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ 3D NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ LD NO:29) or a fragment thereof.
  • the autoimmune disease may be vasculitis, Wegener's granulomatosis, Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's
  • a method of treating or preventing an infectious disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2 -restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
  • the infectious disease may be a viral hepatitis, such as hepatitis B or hepatitis C.
  • the cyclin D may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof
  • the cyclin El peptide may comprise the sequence LLLDWLMEV (SEQ ID NO:62)
  • the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ ID NO:63) or a fragment thereof
  • the myleoperoxidase peptide may comprise the sequence of MY2 (SEQ ID NO:32) or
  • the vaccine may further comprise a disease-associated HLA-A3 restricted peptide, a disease-associated HLA-A11 restricted peptide, a disease-associated HLA-B7 restricted peptide, a disease-associated HLA-B27 restricted peptide, and/or a disease-associated HLA-B35 restricted peptide.
  • the proteinase-3 peptide may be selected from the group consisting of VLQELNVTV (SEQ LD NO:l), RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ LD NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ ID NO: 11) or a fragment thereof.
  • the proteinase-3 peptide may be a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof.
  • a method of generating HLA-restricted peptide specific cytotoxic T-lymphocytes comprising (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating high affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA-restricted peptide specific CTLs.
  • the target peptide may be provided in a limited amount such as at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 35, 40, 45, 50 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, or more ⁇ M.
  • the method may further comprise purifying the concentrated HLA-restricted peptide specific CTLs.
  • Step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs.
  • Purifying may comprise high-speed flow cytometry.
  • the target peptide may depend upon the donor and the peptide epitope.
  • Concentrating high affinity HLA-restricted peptide specific CTLs comprises using microbeads and/or high speed sorting.
  • the method may further comprise concentrating low affinity HLA- restricted peptide specific CTLs, and may even further comprise expanding the concentrated low affinity HLA-restricted peptide specific CTLs.
  • the method may also further comprising adoptive T cell immunotherapy, and may also further comprise expansion of adoptively transferred peptide-specific T lymphocytes, and may also further comprise vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide- specific T lymphocytes.
  • a method for treating or preventing an autoimmune or infectious disease in a patient comprising (a) contacting CTLs of said patient with a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase 3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of said CTLs to the patient.
  • the method may further comprise expanding said CTL's by ex vivo or in vivo methods prior to administration.
  • Contacting may comprise providing an antigen presenting cell containing said peptide.
  • the method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide/HLA-A2 ligand.
  • the autoimmune disease may be vasculitis, Wegner's granulomatoses Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, s
  • the infectious disease may be a viral hepatitis, such as hepatitis B or hepatitis C.
  • the therapeutically effective amount of CTL cells required to provide therapeutic benefit is from about 0.1 x 10 5 to about 5 x 10 7 cells per kilogram weight of the subject.
  • a method for treating or preventing an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor associated HLA-A2 -restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
  • the expression construct may be a non-viral expression construct or a viral expression construct.
  • a method for preventing an autoimmune disease in a patient comprising (a) identifying a patient at risk of developing an autoimmune disease, and (b) administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase- 3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
  • a method of generating HLA- restricted peptide specific cytotoxic T-lymphocytes comprising (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating low affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA- restricted peptide specific CTLs.
  • the target peptide may be provided in a limited amount such as at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 35, 40, 45, 50 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, or more ⁇ M.
  • the method may further comprise purifying the concentrated HLA-restricted peptide specific CTLs.
  • Step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs.
  • Purifying may comprise high-speed flow cytometry.
  • the target peptide may depend upon the donor and the peptide epitope.
  • Concentrating low affinity HLA-restricted peptide specific CTLs comprises using microbeads and/or high speed sorting.
  • the method may further comprise concentrating high affinity HLA- restricted peptide specific CTLs, and may even further comprise expanding the concentrated high affinity HLA-restricted peptide specific CTLs.
  • the method may also further comprising adoptive T cell immunotherapy, and may also further comprise expansion of adoptively transferred peptide-specific T lymphocytes, and may also further comprise vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide- specific T lymphocytes.
  • a method of generating HLA-restricted peptide specific regulatory T-cells comprising (a) obtaining a target peptide pulsed onto antigen- presenting cells to expand the T-cells ex vivo; (b) concentrating HLA-restricted peptide specific regulatory T-cells; and (c) expanding the concentrated HLA-restricted peptide specific regulatory T-cells.
  • FIG. 1 Peptide-specific cytotoxicity of CTL against peptide-loaded T2 cells. Effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1. CTL raised against T2 cells pulsed with PR-1 or PR-2 were tested for specific lysis against the same respective target cell/target peptide combination. Six replicate wells were used for each dilution of effector cells. Data were pooled from 3 separate experiments using 3 separate CTL lines and displayed as mean specific lysis ⁇ standard deviation.
  • FIGS. 2A-2B PRl specific CTL preferentially lyse fresh myeloid leukemia cells.
  • FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls).
  • FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls).
  • FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (
  • FIG. 3 HMY-A2.1+ cells transfected with Pr3 gene express cytoplasmic protein.
  • HMy2.CIR-A2 cells were transfected with the Pr3 -containing vector pRTZ.2 and grown in culture in the presence of Zeocin. Cells were then grown in limiting dilution using increasingly higher concentrations of Zeocin.
  • FIG. 4 PRl specific CTL lyse Pr3 -transfected HMY-A2.1+ cells. CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratio of 25 : 1. Six replicate wells were used, and data is displayed as mean specific lysis ⁇ standard deviation.
  • CTL specific for PR-1 demonstrate 36% specific lysis of HMy2.CIR-A2 cells transfected with Pr3 (Clone 1.4), and 73%) specific lysis of marrow cells from a patient with chronic myelogenous leukemia in blast crisis (CML-BC), (positive control). There was only background lysis of HL-60 cells (low proteinase 3 expression, HLA-A2.1 negative), non-Pr3 transfected HMy2.CIR-A2 cells, CAT transfected HMy2.CIR cells, and marrow cells from a normal donor (negative controls).
  • PRl -specific CTL can be identified by a PRl-tetramer.
  • FIG. 5A An HLA-A2 tetramer specific for a new shock peptide stained 0.2% of the PRl -specific CTL.
  • FIG. 5B An HLA-A2 tetramer specific for a new shock peptide stained 0.2% of the PRl -specific CTL.
  • a day 17 CTL line elicited against influenza nucleoprotein was also labeled with anti-CD8-FITC and the PRl-tetramer-PE and is shown as a negative control.
  • FIG. 6. The PR-tetramer can be used to sort CTL with PRl -specificity.
  • a day 32 CTL line elicited against PRl was stained for 2 hr with anti-CD8-FITC, washed 3 times with PBS, then labeled for 2 hr on ice with the PRl-tetramer-PE conjugate.
  • FIG. 10 Tissue Expression of Proteinase 3.
  • FIGS. 11A-11D HLA-A*0201 Expression on T2. Lower doses of PRl peptide induce
  • FIG. 11 A PBMCs collected from healthy HLA- A2.1 + donors were stimulated weekly with PRl peptide-pulsed T2 cells at the peptide concentrations indicated above each FACS plot. After 4 weeks, resulting cultures were stained with CD8 (FITC) Ab and PR1/HLA-A2 tetramer, and the percentage of CD8 + cells that stain with tetramer are noted within each FACS plot.
  • FIG. 11B Surface HLA-A2 expression on T2 cells increases linearly with increasing concentration of PRl peptide from 2 ⁇ M and 200 ⁇ M.
  • FIG. 11C - CTLs elicited with PRl at 0.2 ⁇ M (open circles) or 20 ⁇ M (filled squares) PRl were incubated for 4 hr at 37°C with PRl peptide- pulsed T2 cells at the indicated peptide concentrations at an effector/target (E/T) ratio of 10:1 (adjusted based on the number of tetramer-positive CTLs), and percentage of specific lysis was determined.
  • E/T effector/target
  • 11D - Tetramer decay (t 2 ) was determined to be 58 min and 19 min by plotting normalized antigen-specific fluorescence at the indicated time points for 28-day-old PR1/HLA-A2 tetramer-stained CTLs elicited with 0.2 ⁇ M (open circles) or 20 ⁇ M PRl (filled squares), respectively.
  • Dissociation kinetics of PR1/HLA-A2 tetramer staining were determined at 4°C in the presence of saturating concentrations of BB7.2 Ab to prevent rebinding of tetramer and in the presence of PI (1 ⁇ g/ml) to eliminate dead cells from the FACS gate.
  • FIGS. 12A-12B The results suggest that are dead cells in the FACS gate.
  • High-avidity PRl -specific CTLs cause more specific lysis of CML BM cells than low-avidity PRl-specific CTLs.
  • PRl- stimulated CTLs were coincubated in a 4-hr microcytotoxicity assay with bone marrow cells, and specific lysis was determined. Six replicate wells were used for each dilution of effector cells.
  • FIG. 13 A High-avidity PRl -specific CTLs from a healthy donor showed greater specific lysis of CML target cells than low-avidity PRl -specific CTLs.
  • FIG. 13B PRl -specific CTL line from a CML patient 3 months after IFN treatment preferentially lyse autologous BM target cells taken at time of diagnosis over healthy HLA-A2 + BM cells from a third party, and the amount of CML target cell lysis is similar to that produced by healthy donor-derived low-avidity PRl -specific CTLs.
  • FIGS. 14A-14C Only low-avidity PRl-specific CTLs are elicited from peripheral blood of CML patients.
  • PBMCs from three different HLA-A2 + CML patients were stimulated weekly with PRl -pulsed T2 cells with PRl ranging from 0.002 ⁇ M to 200 ⁇ M.
  • resultant cultures were stained with CD8 Ab and PR1/HLA-A2 tetramer and analyzed by FACS. The percentage of CD8 + cells that stain with relevant tetramer is indicated within each FACS plot.
  • FIG. 14A Cultures elicited with 0.2 ⁇ M, 0.02 ⁇ M, and 0.002 ⁇ M PRl resulted in CTLs with lower-intensity tetramer staining than CTLs from healthy donors elicited with similar doses of PRl.
  • FIG. 14A Cultures elicited with 0.2 ⁇ M, 0.02 ⁇ M, and 0.002 ⁇ M PRl resulted in CTLs with lower-intensity tetramer staining than CTLs from healthy donors elicited with similar doses
  • FIGS. 15A-15C High-avidity PRl-specific CTLs are identified in the peripheral blood of IFN sensitive CML patients (FIG. 15 ) in cyto genetic remission, but not in (FIG. 15B) IFN- resistant or in (FIG. 15C) untreated newly diagnosed CML patients.
  • PBMCs were stained with CD8, dump (CD14 + CD19), and PR1-HLA-A2 tetramer.
  • FIGS. 16A-16B High-avidity PRl-specific CTLs undergo apoptosis 18 hr after stimulation with high-concentration PRl peptide.
  • the resulting PRl -CTLs were washed and combined in a 1:1 ratio, based on the number of tetramer-positive cells, with T2 cells pulsed with either 0.2 ⁇ M or 20 ⁇ M PRl peptide. After 16 to 18 hr, cells were stained with Annexin V Ab, and live cells were analyzed based on PI staining. The percentage of CD8 + cells that are tetramer-positive is shown in the far left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels.
  • FIGS. 17A-17D show that 16A - Annexin V expression increased on high-avidity PRl -CTLs exposed to high-concentration (20 ⁇ M) PRl, but not after exposure to low (0.2 ⁇ M) concentration PRl .
  • Annexin V upregulation was blocked by pretreating peptide-pulsed T2 cells with anti-HLA-A2 (BB7.2) prior to coculture with PRl -CTL.
  • FIG. 16B - Annexin V was not upregulated 18 hr after coculture of low-avidity PRl -CTLs with either low-concentration (0.2 ⁇ M) or high concentration (20 ⁇ M) PRl peptide.
  • FIGS. 17A-17D show that
  • High-avidity PRl-CTLs undergo apoptosis 18 hr after coincubation with HLA-A2 + CML cells that overexpress proteinase 3.
  • High- and low-avidity PRl-CTLs were combined in a 1:1 ratio, based upon the number of tetramer-positive cells, with CML BM cells from untreated HLA-A2 + and HLA-A2- patients.
  • Annexin V staining was measured on live cells, based on PI staining, 18 hr after coincubation. The percentage of CD8 + cells that are tetramer- positive is shown in the left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels.
  • FIG. 17A Annexin V was upregulated in the high-avidity PRl-CTLs after coincubation with HLA-A2 + cells, but not after coincubation with HLA-A2- cells. Remaining low-avidity PRl-CTLs in the culture did not upregulate annexin V.
  • FIG. 17B hi contrast, low-avidity PRl-CTLs did not upregulate annexin V after coincubation with either HLA-A2 + or HLA-A2 " CML BM cells.
  • FIG. 17C Overall MHC-I expression and proteinase 3 expression was similar in both CML BM target cells, as measured by surface staining with pan-HLA-A,B,C Ab.
  • FIG. 17C Overall MHC-I expression and proteinase 3 expression was similar in both CML BM target cells, as measured by surface staining with pan-HLA-A,B,C Ab.
  • FIG. 17D Proteinase 3 expression was 2.8- and 3.3-fold higher in the HLA-A2 + and the HLA-AT patient BM, respectively, compared with healthy donor BM cells.
  • FIG. 18. High avidity PRl -CTL in IFN-sensitive CML patients off therapy.
  • FIG. 19. PRl -CTL phenotype in CML patients in CCR off interferon: High avidity PR1- CTL have an effector memory phenotype.
  • PRl vaccine elicits PRl -CTL immunity at injection site.
  • FIG. 21. PRl vaccine induces immune responses and clinical responses.
  • FIG. 22. PRl vaccine induces PRl -CTL immunity and molecular remission in UPN4 with AML.
  • FIG. 23 PRl vaccine elicits functional PRl -CTL immunity that persiste beyond 6 months.
  • UPN9 PBMC analyzed six months after 3 rd injection of PRl (1.0 mg) for tetramer + and CD69/IFN + PR1-CTL.
  • FIGS. 24A-24B In UPN4 patient with AML t(15;17) long term molecular remission after vaccine-induced expansion of PRl -CTL was test (FIG. 24A) and vaccine-induced PR1- CTL was shown to preferentially kill leukemia cells (FIG. 24B).
  • FIG. 25 In UPN4 patient with AML t(15;17) long term molecular remission after vaccine-induced expansion of PRl -CTL was test (FIG. 24A) and vaccine-induced PR1- CTL was shown to preferentially kill leukemia cells.
  • PRl vaccine induces molecular remission in UPN15 patient with inv(16) AML.
  • FIGS. 27A-27D High avidity PRl -CTL are preferentially lost after vaccination and remaining low avidity PRl -CTL specifically kill autologous leukemia cells in UPN6 patient.
  • FIG. 27A - Using sample from patient 6 (UPN 6) percent antigens specific CTL was assessed.
  • FIG. 27B Pre and Post-vaccine.
  • FIG. 27C PR1/A2 Tetramer-Sorted CTL Are Peptide
  • FIG. 27D Tetramer-Sorted PRl -CTL Preferentially Kill CML.
  • FIG. 28 High affinity PR1-CTL are absent in UPN 6 after vaccination.
  • UPN6 (CML) and UPN4 (AML) patient samples are compared 30 days post-PRl at 200 ⁇ M and 0.2 ⁇ M.
  • High PRl -CTL avidity was found to be expanded in UPN4 but not UPN6I patient.
  • FIGS. 29A-29B PR1-CTL immunity at day 60 correlates with remission at 1 year after NST for AML.
  • FIG. 30 Efficiency of various APC populations to elicit CTL.
  • FIGS. 31A-31B Cytotoxicity comparison of PR1-CTL elicited with various APCs.
  • FIG. 31A Percent specific lysis for T2 alone versus T2 + PRl in DC/IGM (FIG. 31A) or DC/4GM (FIG. 31B) antigen presenting cells is shown.
  • FIG. 32 Comparison of DC growth conditions on CTL stimulation. Cell proliferation of PRl -CTL lines stimulated with autologous DC/IGM under various culture conditions is shown.
  • FIGS. 33A-33C IFN-Induced P3 expression correlates with PRl -CTL response and
  • FIG. 34 Five MPO-Deduced Peptides Bind to HLA-A2.1.
  • FIG. 35 MY2-Specific CTL Kill Leukemia Cells and Also Healthy Donor Marrow Cells.
  • FIG. 36 MY4-Sepcific CTL Preferentially Kill AML Bone Marrow Cells And Not
  • FIG. 37 MY4-Specific CTL Lysis of MY4-Pulsed T2 Cells is HLA-A2-Restricted.
  • FIG. 38 MY4-CTL Inhibit Leukemia Progenitors.
  • FIG. 39 MPO Protem is Present in CD34 + Leukemia Cells, but not Normal CD34 + Cells.
  • FIG. 40 Tissue Expression of Myeloperoxidase.
  • FIG. 41 Multiple Peptide/HLA-A2-Tetramers Can Be Used To Simultaneously Stain Single Patient Samples.
  • PR1-, MY2- & MY4-CTL Are Not Present In Healthy Donors Or NST Recipients With Lymphoid Malignancies.
  • FIG. 43 PRl -CTL & MY4-CTL, But No MY2-CTL, Are Detectable hi Nonmyeloablative Stem Cell Transplant (NST) Recipients In Complete Remission.
  • FIG. 44 Percentage of PR1-TL, MY4-CTL & HA1-CTL All Correlate with Remission
  • FIG. 45 PRl -CTL Kill Leukemia but not Normal Marrow.
  • FIG. 46 PRl -CTL Lysis of Targets is HLA-A2-Restricted.
  • the present invention serves to overcome the deficiencies in the art by providing HLA- restricted peptides, derived from myeloid self-proteins, that can be used to elicit peptide-reactive CTL that preferentially target myeloid leukemia.
  • HLA- restricted peptides derived from myeloid self-proteins
  • These peptides and the peptide-reactive CTL will be used in vaccines or as adoptive cellular immunotherapy, to treat patients with myeloid leukemia.
  • these same peptides also will find use in the treatment of autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infectious disease.
  • PRl peptide is an important tumor antigen for CTL immune responses against this form of leukemia, and provide the first direct evidence that an antigen-specific T cell response contributes to its control.
  • PRl-specific CTL are found in the majority of patients that achieve remission with IFN- ⁇ 2b therapy or with allogeneic BMT, therapies thought to potentially work through an immune mechanism.
  • the inventors have shown that normal healthy donors have existent CTL immunity to PRl and that CML patients who have a cyto genetic remission after treatment with interferon also have effective PRl- specific CTL immunity toward their leukemia cells, while patients without cytogenetic responses do not, thus establishing PRl as the first leukemia-associated tumor antigen.
  • the present invention also seeks to determine whether vaccination with PRl peptide can enhance immunity toward leukemia, whether the responding T lymphocytes are memory or na ⁇ ve, and whether the PRl-specific CTL exhibit T cell receptors (TCRs) with higher or lower affinity for PR1/HLA-A2 compared to healthy individuals.
  • TCRs T cell receptors
  • the in vivo relevance of MY2 and MY4 as leukemia antigens is examined since the peptides were identified using in vitro techniques. Preexisting MY2 and MY4 reactivity by CTL in leukemia patients and their HLA-matched marrow donors will also be examined.
  • the present invention will determine whether MY2- and MY4- specific CTL can be elicited in vitro from leukemia patients using the established methods for eliciting similar responses in normal donors.
  • HLA-A2.1 -restricted, HLA-A3- restricted, and HLA-B7-restricted peptides from MPO with predicted high MHC binding will be examined for their capacity to elicit myeloid leukemia-reactive CTL responses similar to MY4 and PRl.
  • isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
  • isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
  • MHC Major histocompatibility complex
  • HLA complex HLA complex
  • HLA Human leukocyte antigen
  • MHC major histocompatibility complex
  • motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
  • Peptide motifs are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues.
  • a "supermotif ' is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Thus, a preferably is recognized with high or intermediate affinity (as defined herein) by two or more HLA antigens.
  • Cross-reactive binding indicates that a peptide is bound by more than one HLA molecule; a synonym is degenerate binding.
  • a "protective immune response” refers to a CTL and/or an HTL response to an antigen derived from an infectious agent or a tumor antigen, which prevents or at least partially arrests disease symptoms or progression. The immune response may also include an antibody response which has been facilitated by the stimulation of helper T cells.
  • HLA-Restricted Peptides The present provides a vaccine comprising a tumor-associated HLA-restricted peptide.
  • HLA Human leukocyte antigen
  • MHC major histocompatibility complex
  • HLA-restricted molecules of the present invention may include HLA-A2, HLA- A3, HLA-A11, HLA-B7, HLA-B27, or HLA-B35; but are not limited to such.
  • HLA-restricted antigens/peptides include, but are not limited to: 707 alanine proline
  • DAM-6 is also called MAGE-B2 and DAM- 10 is also called MAGE-B1) (DAM); elongation factor 2 mutated (ELF2M); Ets variant gene 6/acute myeloid leukemia 1 gene ETS (ETV6-AM1); glycoprotein 250 (G250); G antigen (GAGE); N-acetylglucosaminyltransferase V (GnT-V); glycoprotein 100 Kd (GplOO); helicose antigen (HAGE); human epidermal receptor-2/neurological (HER-2/neu); arginine (R) to isoleucine (I) exchange at residue 170 of the ⁇ -helix of the 2-domain in the HLA-A2 gene (HLA-A*0201-R170I); human papilloma virus E7 (HPV-E7); heat shock protein 70 - 2 mutated (HSP70-2M); human signet ring tumor - 2 (HST-2); human telome
  • Myeloid-Restricted Antigens To adapt what has been learned about immunity against melanoma antigens to the study of myeloid leukemia antigens, myeloid-restricted normal proteins that are highly expressed in the leukemia are studied. Myeloid leukemias express a number of differentiation antigens associated with granule formation. These antigens may include proteinease-3 (Pr3 or P3), neutrophil elastase, myeloperoxidase, cylcin El, cyclin D, or a cyclin E2; but are not limited to such. Particular examples of myeloid-restricted peptides, such as Pr3 and myeloperoxidase, are provided herein.
  • P3 and two other azurophil granule proteins, neutrophil elastase and azurocidin, are coordinately regulated and the transcription factors PU.l and C/EBP ⁇ , which are responsible for normal myeloid differentiation from stem cells to monocytes or granulocytes, are important in mediating their expression (Lewin et al, 2002). These transcription factors have been implicated in leukemogenesis (Behre et al, 1999), and P3 itself may also be important in maintaining a leukemia phenotype since P3 antisense oligonucleotides halt cell division and induce maturation of the HL-60 promyelocytic leukemia cell line (Bories et al, 1989). Critical to identifying T cell antigens in these proteins is the observation that P3 is the target of autoimmune attack in Wegener's granulomatosis (Franssen et al, 1994).
  • Proteinase3 Peptides and Vaccines Pr3 is a 26 kDa neutral serine protease that is stored in primary azurophil granules and is maximally expressed at the promyelocyte stage of myeloid differentiation (Sturrock et al, 1992; Chen et al, 1994; Muller-Berat et al, 1994; Lewin et al, 2002; Behre et al, 1999).
  • the human gene contains 5 exons, is localized on chromosome 19p and has been cloned (Sturrock et al, 1992).
  • Pr3 is overexpressed in a variety of myeloid leukemia cells including 75% of CML patients, approximately 50% of acute myeloid leukemia patients, and approximately 30% of the cases of myelodysplastic syndrome patients (Dengler et al, 1995). Pr3 also has several characteristics that make it an appealing target for vaccine and T cell directed therapy. It is overexpressed in human myeloid leukemia and is generally homogeneous throughout the leukemia. An immune response generated against the antigen could result in complete eradication of the leukemia.
  • Pr3 may be important for maintenance of the leukemia phenotype, any selective pressure resulting in Pr3-loss mutants following immunotherapy may not result in "tumor escape.”
  • any TAP-def ⁇ cient tumor mutants might remain susceptible to an anti-leukemia immune response since the protein would still be available to the MHC class I antigen processing pathway.
  • the use of a synthetic peptide derived from Pr3 as the immunizing antigen in a leukemia vaccine offers practical advantages: relatively easy construction and production, chemical stability, and a lack of infectious or oncogenic potential.
  • PRl a small peptide that a small peptide called PRl, a portion of the larger molecule of proteinase 3 (P3) found in myeloid leukemia cells, can be used to generate immune cells, particularly, cytotoxic T lymphocytes (CTL).
  • CTL cytotoxic T lymphocytes
  • PRl is a 9 aa peptide comprising amino acid 169- 177, that binds to HLA-A2.1, thereby eliciting CTL from an HLA-A2.1+ normal donor in vitro.
  • CTL cytotoxic T lymphocytes
  • PRl-specific CTL also inhibit colony-forming unit granulocyte-macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA-matched donors (Molldrem et al, 1997). These CTL, generated from normal healthy donors, preferentially kill leukemia cells while leaving normal bone marrow cells unharmed. More recently, it was found that CML patients who enter remission after treatment with either BMT or interferon have highly increased numbers of very effective PRl-specific CTL that kill their leukemia cells. PRl is therefore the first peptide antigen identified that can elicit specific CTL lysis of fresh human myeloid leukemia cells. B.
  • Myeloperoxidase (MPO) Peptides and Vaccines The invention also provides peptides of myeloperoxidase (MPO), another myeloid- restricted protein, which is a heme protem synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains (Franssen et al, 1996). This enzyme produces hypohalous acids central to the microbicidal activity of netrophils.
  • MPO myeloperoxidase
  • MPO myeloid leukemia cells
  • CML chronic myeloid leukemia
  • MPO myeloid leukemia cells
  • Pr3 is the target of autoimmune attack in Wegener's granulomatosis
  • MPO is the target antigen in small vessel vasculitis (Franssen et al, 1996; Brouwer et al, 1994; Molldrem et al, 1996) respectively, with evidence for both T-cell and antibody immunity in patients with these diseases.
  • the present invention concerns tumor-associated HLA-restricted peptide or antigen compositions comprising at least one HLA-restricted peptide, such as proteinase3 (P3 or Pr3) or myeloperoxidase (MYO) for use as a vaccine in treating cancers, autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infections.
  • HLA-restricted peptide such as proteinase3 (P3 or Pr3) or myeloperoxidase (MYO)
  • an "antigenic composition” may comprise an antigen (e.g., a peptide or polypepide), a nucleic acid encoding an antigen (e.g., an antigen expression vector), or a cell expressing or presenting an antigen.
  • an antigenic composition such as a tumor-associated HLA-restricted peptide or antigen of the present invention, to be useful as a vaccine, the antigenic composition must induce an immune response to the antigen in a cell, tissue or animal (e.g., a human).
  • the antigenic composition comprises or encodes all or part of the sequences shown in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ LD NO:7, SEQ ID NO:8, SEQ LD NO:9, SEQ ID NO:10, SEQ LD NO:ll, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ LD NO:20, SEQ LD NO:21, SEQ LD NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ LD NO:32, SEQ ID NO:33, SEQ ID NO:
  • an "amino acid molecule" or “amino acid residue” refers to any naturally occurring amino acid, any amino acid derivative or any amino acid mimic known in the art, including modified or unusual amino acids.
  • the residues of the protein or peptide are sequential, without any non-amino acid interrupting the sequence of amino acid residues.
  • the sequence may comprise one or more non-amino acid moieties.
  • the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties.
  • the composition of the present invention employs a peptide of from about 5 to about 100 amino acids or greater in length.
  • Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides.
  • the nucleotide and protein, polypeptide and peptide sequences corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art.
  • One such database is the National Center for Biotechnology Information's Genbank and GenPept databases located at the National Institutes of Health website.
  • the coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be know to those of ordinary skill in the art.
  • peptide is used interchangeably with "oligopeptide” in the present specification to designate a series of residues, typically L-amino acids, connected one to the other, typically by peptide bonds between the ⁇ -amino and carboxyl groups of adjacent amino acids.
  • the preferred CTL-inducing oligopeptides of the invention are 13 residues or less in length and usually consist of between about 8 and about 11 residues, preferably 9 or 10 residues.
  • the preferred HTL-inducing oligopeptides are less than about 50 residues in length and usually consist of between about 6 and about 30 residues, more usually between about 12 and 25, and often between about 15 and 20 residues.
  • the size of the at least one peptide molecule may comprise, but is not limited to, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 60, or greater amino molecule residues, and any range derivable therein.
  • immunogenic peptide or “peptide epitope” is a peptide which comprises an allele- specific motif or supermotif such that the peptide will bind an HLA molecule and induce a CTL and/or HTL response.
  • immunogenic peptides of the invention are capable of binding to an appropriate HLA molecule and thereafter inducing a cytotoxic T cell response, or a helper T cell response, to the antigen from which the immunogenic peptide is derived.
  • proteinaceous composition encompasses amino molecule sequences comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid, including but not limited to those shown on Table 2 below.
  • the proteinaceous composition comprises at least one protein, polypeptide or peptide.
  • the proteinaceous composition comprises a biocompatible protein, polypeptide or peptide.
  • biocompatible refers to a substance which produces no significant untoward effects when applied to, or administered to, a given organism according to the methods and amounts described herein. Such untoward or undesirable effects are those such as significant toxicity or adverse immunological reactions.
  • biocompatible protein, polypeptide or peptide containing compositions will generally be mammalian proteins or peptides or synthetic proteins or peptides each essentially free from toxins, pathogens and harmful immunogens.
  • a proteinaceous compound may be purified. Generally,
  • purified will refer to a specific or protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as would be known to one of ordinary skill in the art for the specific or desired protein, polypeptide or peptide.
  • the proteinaceous composition may comprise at least one antibody, for example, an antibody against PRl or myeloperoxidase.
  • antibody is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE.
  • IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting.
  • antibody is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like.
  • DABs single domain antibodies
  • Fv single domain antibodies
  • scFv single chain Fv
  • any protein, polypeptide or peptide containing component may be used in the compositions and methods disclosed herein.
  • the proteinaceous material is biocompatible.
  • the formation of a more viscous composition will be advantageous in that will allow the composition to be more precisely or easily applied to the tissue and to be maintained in contact with the tissue throughout the procedure.
  • the use of a peptide composition, or more preferably, a polypeptide or protem composition is contemplated.
  • Ranges of viscosity include, but are not limited to, about 40 to about 100 poise, h certain aspects, a viscosity of about 80 to about 100 poise is preferred.
  • a specialized kind of insertional variant is the fusion protein.
  • This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide.
  • fusions typically employ leader sequences from other species to permit the recombinant expression of a protem in a heterologous host.
  • Another useful fusion includes the addition of an immunologically active domain, such as an antibody epitope, to facilitate purification of the fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification.
  • Other useful fusions include linking of functional domains, such as active sites from enzymes such as a hydrolase, glycosylation domains, cellular targeting signals or transmembrane regions.
  • peptides of the present invention may further employ amino acid sequence variants such as substitutional, insertional or deletion variants.
  • Deletion variants lack one or more residues of the native protein. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide. Substitutions are changes to an existing amino acid.
  • sequence variants may generate truncations, point mutations, and frameshift mutations. As is known to one skilled in the art, synthetic peptides can be generated by these mutations.
  • amino acids sequence variants may include additional residues, such as additional N- or C-terminal amino acids, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological activity.
  • additional residues such as additional N- or C-terminal amino acids
  • HLA-restricted peptide or protein of the invention to create a mutated, truncated, or modified protein.
  • certain amino acids may be substituted for other amino acids in the tumor- associated HLA-restricted peptide or protein such as a Pr3 or MYO protein, resulting in a greater CTL immune response in cells such as a myeloid cell. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying nucleic acid coding sequence, thereby producing a mutated, truncated or modified protein. In making such changes, the hydropathic index of amino acids may be considered.
  • hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ⁇ 1), glutamate (+3.0 ⁇ 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (- 0.5 ⁇ 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3).
  • amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein.
  • substitution of amino acids whose hydrophilicity values are within ⁇ 2 is preferred, those that are within ⁇ 1 are particularly preferred, and those within ⁇ 0.5 are even more particularly preferred.
  • amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
  • substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
  • the present invention may also employ the use of peptide mimetics for the preparation of polypeptides (see e.g., Johnson, 1993) having ' many of the natural properties of a tumor- associated HLA-restricted peptide such as Pr3 or MYO protein, but with altered and/or improved characteristics.
  • the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen.
  • These principles may be used, in conjunction with the principles outline above, to engineer second generation molecules having many of the natural properties of a tumor-associated HLA-restricted peptide but with altered and even improved characteristics.
  • C. Tumor-Associated HLA-Restricted Peptide Purification the protein(s) of the present invention may be purified. It may be desirable to purify the tumor-associated HLA-restricted peptides, polypeptides or proteins or variants thereof.
  • purified protein or peptide as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state.
  • a purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
  • purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity.
  • substantially purified this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition.
  • Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity).
  • Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing.
  • Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques.
  • the polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. Although this preparation will be purified in an inactive form, the denatured material will still be capable of transducing cells. Once inside of the target cell or tissue, it is generally accepted that the polypeptide will regain full biological activity. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide. Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure.
  • peptides corresponding to one or more antigenic determinants of the tumor-associated HLA-restricted peptides or polypeptides may be prepared so that an immune response against the tumor-associated HLA-restricted peptides, polypeptides or proteins, such as Pr3 or MYO is raised.
  • vaccination with a tumor-associated HLA-restricted peptides, or polypeptides may generate an autoimmune response in an immunized animal such that autoantibodies that specifically recognize the animal's endogenous tumor-associated HLA-restricted protein. This vaccination technology is shown in U.S.
  • Patents 6,027,727; 5,785,970, and 5,609,870 which are hereby incorporated by reference.
  • Such peptides should generally be at least five or six amino acid residues in length and will preferably be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or about 30 amino acid residues in length, and may contain up to about 35-50 residues.
  • these peptides may comprise a amino acid sequence, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, and 50 or more contiguous amino acids from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ JD NO:7, SEQ JD NO:8, SEQ ID NO:9, SEQ LD NO:10, SEQ JD NO.l l, SEQ JD NO:26, SEQ JD NO:27, SEQ JD NO:28, SEQ JD NO:29, SEQ JD NO:30, SEQ ID NO:31, SEQ JD NO:32, SEQ JD NO:33, SEQ ID NO:34, SEQ JD NO:35, SEQ JD NO:36, SEQ JD NO:37, SEQ ID NO:38, SEQ JD NO:39, SEQ JD NO:42, SEQ JD NO:
  • Synthetic peptides will generally be about 35 residues long, which is the approximate upper length limit of automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA). Longer peptides also may be prepared, e.g., by recombinant means.
  • U.S. Patent 4,554,101 incorporated herein by reference, teaches the identification and preparation of epitopes from Primary amino acid sequences on the basis of hydrophilicity.
  • a tumor-associated HLA- restricted peptide may be identified by an empirical approach in which portions of the gene encoding the tumor-associated HLA-restricted peptides are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response.
  • PCRTM can be used to prepare a range of peptides lacking successively longer fragments of the C- terminus of the protein. The immunoactivity of each of these peptides is determined to identify those fragments or domains of the polypeptide that are immunodominant.
  • the antigenic determinants of the peptides which are initially identified can be further localized by perfonning subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive peptide. Once one or more such analyses are completed, polypeptides are prepared that contain at least the essential features of one or more antigenic determinants. The peptides are then employed in the generation of antisera against the polypeptide. Minigenes or gene fusions encoding these determinants also can be constructed and inserted into expression vectors by standard methods, for example, using PCRTM cloning methodology.
  • Alum is an adjuvant that has proven sufficiently non-toxic for use in humans. Methods for performing this conjugation are well known in the art.
  • Other immunopotentiating compounds are also contemplated for use with the compositions of the invention such as polysaccharides, including chitosan, which is described in U.S. Patent 5,980,912, hereby incorporated by reference.
  • tumor-associated HLA- restricted epitopes may be crosslinked to one another (e.g., polymerized).
  • a nucleic acid sequence encoding a tumor-associated HLA-restricted peptides, or polypeptides may be combined with a nucleic acid sequence that heightens the immune response.
  • Such fusion proteins may comprise part or all of a foreign (non-self) protein such as bacterial sequences, for example.
  • Antibody titers effective to achieve a response against endogenous tumor-associated HLA-restricted peptides, or polypeptides will vary with the species of the vaccinated animal, as well as with the sequence of the administered peptide.
  • titers may be readily determined, for example, by testing a panel of animals with varying doses of the specific antigen and measuring the induced titers of autoantibodies (or anti-self antibodies) by known techniques, such as ELISA assays, and then correlating the titers with a related cancer characteristics, e.g., tumor growth or size.
  • ELISA assays ELISA assays
  • One of ordinary skill would know various assays to determine whether an immune response against a tumor-associated HLA-restricted peptide was generated.
  • the phrase "immune response" includes both cellular and humoral immune responses.
  • cytotoxic T lymphocyte (CTL) assays such as chromium release assays, proliferation assays using peripheral blood lymphocytes (PBL), tetramer assays, and cytokine production assays. See Benjamini et al. (1991), hereby incorporated by reference.
  • the antigenic composition such a tumor- assoicated HLA-restricted peptide or antigen, may comprises an additional immunostimulatory agent or nucleic acids encoding such an agent.
  • Immunostimulatory agents include but are not limited to an additional antigen, an immunomodulator, an antigen presenting cell or an adjuvant.
  • one or more of the additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination, hi certain embodiments, the antigenic composition is conjugated to or comprises an HLA anchor motif amino acids.
  • Adjuvants As also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Patent 4,877,611). Immunization protocols have used adjuvants to stimulate responses for many years, and as such adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation.
  • the immune system participates in host defense against the tumor cells, but only a fraction of the likely total number of tumor-specific antigens are believed to have been identified to date.
  • the use of the tumor- associated HLA-restricted antigens of the present invention with the inclusion of a suitable adjuvant will likely increase the anti-tumor response of the antigens.
  • molecule adjuvants mclude all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions.
  • Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
  • adjuvants that may also be used include IL-1, IL-2, IL-4, JL-7, IL-12, interferon, GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL).
  • MDP compounds such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL).
  • REBI which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion also is contemplated.
  • MHC antigens may even be used.
  • an adjuvant effect is achieved by use of an agent, such as alum, used in about 0.05 to about 0.1% solution in phosphate buffered saline.
  • the antigen is made as an admixture with synthetic polymers of sugars (Carbopol®) used as an about 0.25 % solution.
  • Adjuvant effect may also be made my aggregation of the antigen in the vaccine by heat treatment with temperatures ranging between about 70° to about 101°C for a 30 second to 2- inute period, respectively. Aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, mixture with bacterial cell(s) such as C.
  • Fab pepsin treated
  • an endotoxin or a lipopolysaccharide component of Gram-negative bacteria emulsion in physiologically acceptable oil vehicles, such as mamiide mono-oleate (Aracel A), or emulsion with a 20% solution of a perfluorocarbon (Fluosol-DA®) used as a block substitute, also maybe employed.
  • Some adjuvants for example, certain organic molecules obtained from bacteria, act on the host rather than on the antigen.
  • An example is muramyl dipeptide (N-acetylmuramyl- L-alanyl-D-iso glutamine [MDP]), a bacterial peptidoglycan.
  • MDP muramyl dipeptide
  • MDP a bacterial peptidoglycan
  • MDP stimulates macrophages but also appears to stimulate B cells directly.
  • the effects of adjuvants are not antigen-specific. If they are administered together with a purified antigen, however, they can be used to selectively promote the response to the antigen.
  • hemocyanins and hemoerythrins may also be used in the invention.
  • KLH keyhole limpet
  • Various polysaccharide adjuvants may also be used.
  • U.S. Patent 4,950,645 describes a lipophilic disaccharide-tripeptide derivative of muramyl dipeptide which is described for use in artificial liposomes formed from phosphatidyl choline and phosphatidyl glycerol. It is the to be effective in activating human ⁇ onocytes and destroying tumor cells, but is non-toxic in generally high doses.
  • the compounds of U.S. Patent 4,950,645 and PCT Patent Application WO 91/16347 are contemplated for use with cellular carriers and other embodiments of the present invention.
  • BCG Bacillus Cahnette-Guerin, an attenuated strain of Mycobacterium
  • CWS BCG-cell wall skeleton
  • Trehalose dimycolate may be used itself. Trehalose dimycolate administration has been shown to correlate with augmented resistance to influenza virus infection in mice (Azuma et al, 1988). Trehalose dimycolate may be prepared as described in U.S. Patent 4,579,945.
  • BCG is an important clinical tool because of its immunostimulatory properties. BCG acts to stimulate the reticulo-endothelial system, activates natural killer cells and increases proliferation of hematopoietic stem cells.
  • BCG Cell wall extracts of BCG have proven to have excellent immune adjuvant activity. Molecular genetic tools and methods for mycobacteria have provided the means to introduce foreign genes into BCG (Jacobs et al, 1987; Snapper et al, 1988; Husson et ⁇ /., 1990; Martin et al, 1990). Live BCG is an effective and safe vaccine used worldwide to prevent tuberculosis. BCG and other mycobacteria are highly effective adjuvants, and the immune response to mycobacteria has been studied extensively. With nearly 2 billion immunizations, BCG has a long record of safe use in man (Luelmo, 1982; Lotte et al, 1984).
  • An exemplary BCG vaccine is sold as TICE BCG (Organon Inc., West Orange, NJ).
  • Amphipathic and surface active agents e.g., saponin and derivatives such as QS21 (Cambridge Biotech), form yet another group of adjuvants for use with the immunogens of the present invention.
  • Nonionic block copolymer surfactants Rospanich et al, 1994
  • Oligonucleotides are another useful group of adjuvants (Yamamoto et al, 1988).
  • Quil A and lentinen are other adjuvants that may be used in certain embodiments of the present invention.
  • Another group of adjuvants are the detoxified endotoxins, such as the refined detoxified endotoxin of U.S. Patent 4,866,034. These refined detoxified endotoxins are effective in producing adjuvant responses in mammals.
  • the detoxified endotoxins may be combined with other adjuvants to prepare multi-adjuvant-incorporated cells.
  • combination of detoxified endotoxins with trehalose dimycolate is particularly contemplated, as described in U.S. Patent 4,435,386.
  • Combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids is also contemplated (U.S.
  • Patent 4,505,899 is combination of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose dimycolate, as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900. Combinations of just CWS and trehalose dimycolate, without detoxified endotoxins, is also envisioned to be useful, as described in U.S. Patent 4,520,019.
  • Those of skill in the art will know the different kinds of adjuvants that can be conjugated to cellular vaccines in accordance with this invention and these include alkyl lysophosphilipids (ALP); BCG; and biotin (including biotinylated derivatives) among others.
  • ALP alkyl lysophosphilipids
  • BCG BCG
  • biotin including biotinylated derivatives
  • Certain adjuvants particularly contemplated for use are the teichoic acids from Gram-cells. These include the lipoteichoic acids (LT ), ribitol teichoic acids (R ) and glycerol teichoic acid (GTA). Active forms of their synthetic counterparts may also be employed in connection with the invention (Takada et ⁇ /., 1995). Various adjuvants, even those that are not commonly used in humans, may still be employed in animals, where, for example, one desires to raise antibodies or to subsequently obtain activated T cells.
  • LT lipoteichoic acids
  • R ribitol teichoic acids
  • GTA glycerol teichoic acid
  • Adjuvants may be encoded by a nucleic acid (e.g., DNA or RNA). It is contemplated that such adjuvants may be also be encoded in a nucleic acid (e.g., an expression vector) encoding the antigen, or in a separate vector or other construct. Nucleic acids encoding the adjuvants can be delivered directly, such as for example with lipids or liposomes.
  • B. Biological Response Modifiers In addition to adjuvants, it may be desirable to coadminister biologic response modifiers (BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity.
  • BRMs biologic response modifiers
  • Such BRMs include, but are not limited to, Cimetidine (CM; 1200 mg/d) (Smith Kline, PA); low-dose Cyclophosphamide (CYP; 300 mg/m2) (Johnson/ Mead, NJ), cytokines such as interferons, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.
  • C. Chemokines Chemokines, nucleic acids that encode for chemokines, and/or cells that express such also may be used as vaccine components.
  • Chemokines generally act as chemoattractants to recruit immune effector cells to the site of chemokine expression. It may be advantageous to express a particular chemokine coding sequence in combination with, for example, a cytokine coding sequence, to enhance the recruitment of other immune system components to the site of treatment. Such chemokines include, for example, RANTES, MCAF, MIP1 -alpha, MIPl-Beta, IP- 10 and combinations thereof. The skilled artisan will recognize that certain cytokines are also known to have chemoattractant effects and could also be classified under the term chemokines. D.
  • an antigenic composition may be chemically coupled to a carrier or recombinantly expressed with a immunogenic carrier peptide or polypetide (e.g., a antigen- carrier fusion peptide or polypeptide) to enhance an immune reaction.
  • a immunogenic carrier peptide or polypetide e.g., a antigen- carrier fusion peptide or polypeptide
  • exemplary and preferred immunogenic carrier amino acid sequences include hepatitis B surface antigen, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA).
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as immunogenic carrier proteins.
  • Means for conjugating a polypeptide or peptide to a immunogenic carrier protein are well known in the art and include, for example, glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis-biazotized benzidine.
  • Antibodies and Antibody Generation Another embodiment of the present invention are antibodies, in some cases, a human monoclonal antibody immunoreactive with the polypeptide sequence of a tumor-associated HLA-restricted peptide of the invention comprising SEQ ED NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ JD NO:5, SEQ JD NO:6, SEQ JD NO:7, SEQ JD NO:8, SEQ JD NO:9, SEQ ED NO:10, SEQ ID NO.ll, SEQ ID NO-.26, SEQ ID NO:27, SEQ ID NO:28, SEQ ED NO:29, SEQ ED NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ JD NO:35, SEQ ID NO:36, SEQ JD NO:37, SEQ JD NO:38, SEQ JD NO:39, SEQ ID NO:42, SEQ JD NO:
  • this antibody is useful for screening samples from human patients for the purpose of detecting a particular tumor-associated HLA-restricted peptide present in the samples.
  • the antibody also may be useful in the screening of expressed DNA segments or peptides and proteins for the discovery of related antigenic sequences.
  • the antibody maybe useful in passive immunotherapy for cancer, autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infection. All such uses of the antibodies and any antigens or epitopic sequences so discovered fall within the scope of the present invention.
  • examples of other antibodies that may be employed in the present invention may include antibodies that react with T cells such as CD1, CD2, CD3, CD5, CD7 CD4, CD6, CD8 and CD27.
  • Antibodies that react with myeloid cells may also be employed and include CD1 lb, CDllc, CD13, CD14, CD15, CD16, CD33, CD48, CD63, CD74, CD65, CD66, CD67 and CD68.
  • Antibodies that react with undifferentiated cells may include HLA-DR, CD34 and CD38. It should be appreciated that multiple combinations of antibodies selected from the ones mentioned above are possible. Accordingly, it will be apparent to one skilled in the art that one can vary the antibody combinations In certain embodiments, the present invention involves antibodies. For example, all or part of a monoclonal, single chain, or humanized antibody may function as a vaccine for cancer.
  • antibodies as a form of treatment or as a diagnostic to identify or quantify a particular polypeptide, such as tumor-associated HLA- restricted polypeptide, for example Pr3 or MYO polypeptide.
  • a particular polypeptide such as tumor-associated HLA- restricted polypeptide, for example Pr3 or MYO polypeptide.
  • antibodies also may be generated in response to smaller constructs comprising epitopic core regions, including wild-type and mutant epitopes.
  • the term "antibody” is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting.
  • antibody is may also be used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like.
  • antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like.
  • DABs single domain antib odies
  • Fv single domain antib odies
  • scFv single chain Fv
  • the invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin.
  • the methods for generating monoclonal antibodies generally begin along the same lines as those for preparing polyclonal antibodies.
  • a polyclonal antibody may be prepared by immunizing an animal with an immunogenic polypeptide composition in accordance with the present invention and collecting antisera from that immunized animal.
  • serum is collected from persons who may have been exposed to a particular antigen. Exposure to a particular antigen may occur a work environment, such that those persons have been occupationally exposed to a particular antigen and have developed polyclonal antibodies to a peptide, polypeptide, or protein.
  • polyclonal serum from occupationally exposed persons is used to identify antigenic regions in the gelonin toxin through the use of immunodetection methods.
  • a wide range of animal species can be used for the production of antisera.
  • the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.
  • a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier.
  • Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as carriers.
  • Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis- biazotized benzidine.
  • the amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization.
  • a variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal).
  • the production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection also may be given. The process of boosting and titering is repeated until a suitable titer is achieved.
  • the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate mAbs.
  • mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference.
  • this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified polypeptide, peptide or domain, be it a wild-type or mutant composition.
  • a selected immunogen composition e.g., a purified or partially purified polypeptide, peptide or domain
  • the immunizing composition is administered in a manner effective to stimulate antibody producing cells.
  • mAbs may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography.
  • Fragments of the monoclonal antibodies of the invention can be obtained from the monoclonal antibodies so produced by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction.
  • monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer. It also is contemplated that a molecular cloning approach may be used to generate mAbs. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this 4 approach over conventional hybridoma techniques are that approximately 10 times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies. Humanized monoclonal antibodies are antibodies of animal origin that have been modified using genetic engineering techniques to replace constant region and/or variable region framework sequences with human sequences, while retaining the original antigen specificity.
  • Such antibodies are commonly derived from rodent antibodies with specificity against human antigens. Such antibodies are generally useful for in vivo therapeutic applications. This strategy reduces the host response to the foreign antibody and allows selection of the human effector functions.
  • “Humanized” antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof.
  • the techniques for producing humanized immunoglobulins are well known to those of skill in the art. For example U.S. Patent 5,693,762 discloses methods for producing, and compositions of, humanized immunoglobulins having one or more complementarity determining regions (CDR's).
  • the humanized immunoglobulins When combined into an intact antibody, the humanized immunoglobulins are substantially non- immunogenic in humans and retain substantially the same affinity as the donor immunoglobulin to the antigen, such as a protein or other compound containing an epitope.
  • the antigen such as a protein or other compound containing an epitope.
  • Examples of other teachings in this area include U.S. Patents 6,054,297; 5,861,155; and 6,020,192, all specifically incorporated by reference.
  • Methods for the development of antibodies that are "custom-tailored" to the patient's disease are likewise known and such custom-tailored antibodies are also contemplated.
  • nucleic Acids Encoding HLA-Restricted Protein, Peptides and Polypeptides may be encoded by a nucleic acid sequence.
  • a nucleic acid may be derived from genomic DNA, complementary DNA (cDNA) or synthetic DNA. Where incorporation into an expression vector is desired, the nucleic acid may also comprise a natural intron or an intron derived from another gene.
  • cDNA is intended to refer to DNA prepared using messenger RNA (mRNA) as template.
  • a cDNA as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.
  • a tumor-associated HLA-restricted peptide or polypeptide cDNA, such as a Pr3 or MYO cDNA, for use in the present invention, may be derived from human cDNA but are not limited such.
  • nucleic acid segment refers to a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a nucleic acid segment encoding a polypeptide refers to a nucleic acid segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term “nucleic acid segment” are a polypeptide or polypeptides, DNA segments smaller than a polypeptide, and recombinant vectors, such as, plasmids and other non-viral vectors.
  • Recombinant may be used in conjunction with a polypeptide or the name of a specific polypeptide, and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule.
  • Recombinant vectors and isolated nucleic acid segments may variously include the PRl or myeloperoxidase-coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include PRl or myeloperoxidase-coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.
  • nucleic acid as used herein includes single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogs. It is contemplated that a nucleic acid within the scope of the present invention may be of about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about
  • the nucleic acid region encodes a tumor-associated HLA- restricted peptide, or polypeptide
  • the nucleic acid region can be quite long, depending upon the number of amino acids in the fusion protein. It is contemplated that the tumor-associated HLA-restricted peptide, or polypeptide may be encoded by any nucleic acid sequence that encodes the appropriate amino acid sequence.
  • the design and production of nucleic acids encoding a desired amino acid sequence is well known to those of skill in the art, using standardized codon tables (Table 3). hi preferred embodiments, the codons selected for encoding each amino acid may be modified to optimize expression of the nucleic acid in the host cell of interest.
  • Codons that encode the same amino acid such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids. Codon preferences for various species of host cell are well known in the art. Codons preferred for use in humans, are well known to those of skill in the art (Wada et.a , 1990). Codon preferences for other organisms also are well known to those of skill in the art (Wada et al, 1990, included herein in its entirety by reference). Table 3: Codon Table
  • Prokaryote- and or eukaryote-based systems can be used to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides.
  • the present invention contemplates the use of such an expression system to produce the tumor-associated HLA- restricted peptide, or polypeptide. More specifically, the present invention employs the use of the insect cell baculovirus system.
  • the insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S.
  • Patents 5,871,986, 4,879,236, both herein incorporated by reference and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH®.
  • MAXBAC® 2.0 from INVITROGEN®
  • BACPACKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH® BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH®.
  • numerous expression systems exists which are commercially and widely available.
  • STRATAGENE®'S COMPLETE CONTROL Inducible Mammalian Expression System which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system.
  • INVITROGEN® which carries the T-REXTM (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter.
  • INVITROGEN® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica.
  • a vector such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.
  • the expression vector comprises a virus or engineered vector derived from a viral genome.
  • the first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986).
  • papovaviruses simian virus 40, bovine papilloma virus, and polyoma
  • adenoviruses Rosgeway, 1988; Baichwal and Sugden, 1986.
  • Adenoviral Vectors A particular method for delivery of the nucleic acid involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors.
  • Adenovirus expression vector is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue or cell-specific construct that has been cloned therein.
  • AAV Vectors The nucleic acid may be introduced into the cell using adenovirus assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten t ⁇ , 1992; Curiel, 1994).
  • Adeno-associated virus (AAV) is an attractive vector system for use in the vaccines of the present invention (Muzyczka, 1992).
  • AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin et al, 1986; Lebkowski et al, 1988; McLaughlin et al, 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patents 5,139,941 and 4,797,368, each incorporated herein by reference.
  • Retro viral Vectors Retroviruses have promise as gene delivery vectors in vaccines due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992).
  • a nucleic acid e.g., one encoding an antigen of interest
  • a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983).
  • Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
  • Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. Lentiviral vectors are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al, 1991; Blomer et al, 1997; U.S. Patents 6,013,516 and 5,994,136). Some examples of lentivirus include the Human Immunodeficiency Viruses: HIV-1, HEV-2 and the Simian Immunodeficiency Virus: S .
  • Lentiviral vectors have been generated by multiply attenuating the HIN virulence genes, for example, the genes env, vifi vpr, vpu and nefaxe deleted making the vector biologically safe.
  • Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences.
  • recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No.
  • a sequence (including a regulatory region) of interest into the viral vector, along with another gene 5 which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific.
  • viral vectors may be employed as vaccine constructs in the present invention.
  • Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et ⁇ ., 1988), Sindbis virus, cytomegalovirus and herpes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990). 5 5. Delivery Using Modified Viruses A nucleic acid to be delivered may be housed within an infective virus that has been engineered to express a specific binding ligand.
  • the virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell.
  • a novel approach designed to allow specific targeting of retrovirus vectors was developed based on the chemical0 modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors.
  • Another approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor5 were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al, 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al, 1989).
  • nucleic Acid Delivery O Suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S.
  • Patent 5,384,253, incorporated herein by reference by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990); by using DEAE- dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al, 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987; Wong et al, 1980; Kaneda et al, 1989; Kato et al, 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S.
  • a method of treatment and prevention of cancers such as leukemia.
  • cancers contemplated for treatment include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases that may be treated or prevented by a tumor-associated HLA-restricted peptides, or polypeptides of the present invention.
  • a method of treatment and prevention of autoimmune diseases or conditions; transplant rejection; or vasculitis, by the delivery of an HLA-restricted peptide, or polypeptide or expression construct is contemplated.
  • Autoimmune diseases/conditions that may be treated or prevented include but are not limited to asculitis, Wegner's granulomatoses Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (FTP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis,
  • An effective amount of the pharmaceutical vaccine composition is defined as that amount sufficient to detectably and repeatedly to ameliorate, reduce, minimize or limit the extent of the disease or condition or symptoms thereof. More rigorous definitions may apply, including elimination, eradication or cure of disease.
  • patients will have adequate bone marrow function (defined as a peripheral 3 3 absolute granulocyte count of > 2,000 / mm and a platelet count of 100,000 / mm ), adequate liver function (bilirubin ⁇ 1.5 mg / dl) and adequate renal function (creatinine ⁇ 1.5 mg / dl).
  • A. HLA-Restricted Vaccine Administration To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size and otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one would generally contact a cancer cell with the therapeutic compound such as a polypeptide or an expression construct encoding a polypeptide.
  • the routes of administration will vary, naturally, with the location and nature of the lesion, and include, e.g., intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration and formulation.
  • any of the formulations and routes of administration discussed with respect to the treatment or diagnosis of cancer may also be employed with respect to neoplastic diseases and conditions.
  • Intratumoral injection, or injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors.
  • Local, regional or systemic administration also may be appropriate.
  • the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of ⁇ 4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).
  • Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes.
  • the viral particles may advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals.
  • the present invention may be used preoperatively, to render an inoperable tumor subject to resection.
  • the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease.
  • a resected tumor bed may be injected or perfused with a formulation comprising a tumor-associated HLA restricted peptide or construct encoding therefor.
  • the perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery.
  • Periodic post-surgical treatment also is envisioned.
  • Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is preferred.
  • Such continuous perfusion may take place for a period from about 1-2 hr, to about 2-6 hr, to about 6-12 hr, to about 12-24 hr, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment.
  • the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.
  • limb perfusion may be used to administer therapeutic compositions of the present invention, particularly in the treatment of melanomas and sarcomas. Treatment regimens may vary as well, and often depend on tumor type, tumor location, disease progression, and health and age of the patient.
  • the tumor being treated may not, at least initially, be resectable. Treatments with therapeutic viral constructs may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection will serve to eliminate microscopic residual disease at the tumor site. A typical course of treatment, for a primary tumor or a post-excision tumor bed, will involve multiple doses.
  • Typical primary tumor treatment involves a 6 dose application over a two-week period.
  • the two-week regimen may be repeated one, two, three, four, five, six or more times.
  • the treatments may include various "unit doses."
  • Unit dose is defined as containing a predetermined-quantity of the therapeutic composition.
  • the quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts.
  • a unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time.
  • Unit dose of the present invention may conveniently be described in terms of 3 4 5 ⁇ 7 plaque forming units (pfu) for a viral construct.
  • Unit doses range from 10 , 10 , 10 , 10 , 10 , O Q i - ⁇ 1 1 ⁇ o ⁇
  • compositions and Formulations One method for the delivery of a pharmaceutical according to the present invention is systemically.
  • the pharmaceutical compositions disclosed herein may alternatively be administered parenterally, intravenously, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Patent 5,543,158; U.S. Patent 5,641,515 and U.S. Patent 5,399,363 (each specifically incorporated herein by reference in its entirety).
  • Injection of pharmaceuticals may be by syringe or any other method used for injection of a solution, as long as the agent can pass through the particular gauge of needle required for injection.
  • a novel needleless injection system has been described (U.S.
  • Patent 5,846,233 having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery.
  • a syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).
  • Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety).
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., vegetable oils.
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like, hi many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
  • Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
  • the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration.
  • sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
  • one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermolysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035- 1038 and 1570-1580).
  • Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
  • the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by inco ⁇ orating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions disclosed herein may be formulated in a neutral or salt form.
  • Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
  • phrases "pharmaceutically-acceptable” or “pharmacologically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
  • the preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art.
  • such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
  • the compounds and methods of the present invention may be used in the context of neoplastic diseases/conditions including cancer.
  • Types of diseases/conditions contemplated to be treated with the peptides of the present invention include, but are not limited to leukemias such as, AML, MDS and CML.
  • Other types of cancers may include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases.
  • compositions of the present invention such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor
  • other agents effective in the treatment of those diseases and conditions such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor
  • the treatment of a cancer may be implemented with therapeutic compounds of the present invention and other anti-cancer therapies, such as anti-cancer agents or surgery.
  • the compounds and methods of the present invention may be used in the context of autoimmune diseases/conditions.
  • HLA-restricted compositions of the present invention such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor
  • the treatment of autoimmune diseases or infections with therapeutic compounds of the present invention may be enhanced by combination with and other therapies.
  • Various combinations may be employed; for example, the tumor-associated HLA- restricted peptide is "A" and the secondary therapy is "B":
  • an "anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.
  • Anti-cancer agents include biological agents (biotherapy), chemotherapy agents, and radiotherapy agents. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell.
  • This process may involve contacting the cells with the expression construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the expression construct and the other includes the second agent(s).
  • Tumor cell resistance to chemotherapy and radiotherapy agents represents a major problem in clinical oncology.
  • One goal of current cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy.
  • the he ⁇ es si plex-thymidine kinase (HS-tK) gene when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver et al, 1992).
  • ganciclovir a retroviral agent
  • tumor-associated HLA- restricted peptide therapy could be used similarly in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic or other biological intervention, in addition to other pro- apoptotic or cell cycle regulating agents.
  • the gene therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks, hi embodiments where the other agent and expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and expression construct would still be able to exert an advantageously combined effect on the cell.
  • one may contact the cell with both modalities within about 12- 24 h of each other and, more preferably, within about 6-12 h of each other.
  • Chemotherapy Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments.
  • Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine and methotrexate, Temazolomide (an aqueous form of DTIC), or any analog or derivative variant of the foregoing.
  • CDDP
  • Radiotherapy Other factors that cause DNA damage and have been used extensively include what are commonly known as ⁇ -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV- irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens.
  • Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
  • the terms "contacted” and “exposed,” when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
  • Immunotherapy I munotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
  • the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
  • the antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing.
  • the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
  • the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
  • Various effector cells include cytotoxic T cells and NK cells.
  • Immunotherapy could also be used as part of a combined therapy.
  • the general approach for combined therapy is discussed below.
  • the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention.
  • Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), g ⁇ 68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55.
  • An alternative aspect of immunotherapy is to anticancer effects with immune stimulatory effects.
  • Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-JFN, chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand.
  • immune stimulating molecules either as proteins or using gene delivery in combination with a tumor suppressor such as mda-7 has been shown to enhance anti-tumor effects (Ju et al, 2000).
  • examples of immunoiherapies currently under investigation or in use are immune adjuvants (e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds) (U.S. Patent 5,801,005; U.S.
  • cytokine therapy e.g., interferons, and; IL-1, GM-CSF and TNF
  • gene therapy e.g., TNF, IL-1, IL-2, p53
  • Patent 5,846,945 and monoclonal antibodies (e.g., anti- ganglioside GM2, anti-HER-2, anti- ⁇ l85) (Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311).
  • Herceptin trastuzumab
  • Herceptin is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). Combination therapy of cancer with tierceptin and chemotherapy has been shown to be more effective than the individual therapies.
  • one or more anti-cancer therapies may be employed with the tumor- associated HLA-restricted peptide therapies described herein.
  • adoptive immunotherapy the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al, 1988; 1989). To achieve this, one would administer to an animal, or human patient, an immunologically effective amount of activated lymphocytes in combination with an adjuvant-inco ⁇ orated antigenic peptide composition as described herein.
  • the activated lymphocytes will most preferably be the patient's o"wn cells that were earlier isolated from a blood or tumor sample and activated (or "expanded") in vitro.
  • This form of immunotherapy has produced several cases of regression of melanoma and renal carcinoma, but the percentage of responders were few compared to those who did not respond.
  • ii) Passive Immunotherapy A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.
  • human monoclonal antibodies are employed in passive immunotherapy, as they produce few or no side effects in the patient.
  • their application is somewhat limited by their scarcity and have so far only been administered intralesionally.
  • Human monoclonal antibodies to ganglioside antigens have been administered intralesionally to patients suffering from cutaneous recurrent melanoma (hie & Morton, 1986). Regression was observed in six out of ten patients, following, daily or weekly, intralesional injections.
  • moderate success was achieved from intralesional injections of two human monoclonal antibodies (Erie et ⁇ l, 1989). It may be favorable to administer more than one monoclonal antibody directed against two different antigens or even antibodies with multiple antigen specificity.
  • Treatment protocols also may include administration of lymphokines or other immune enhancers as described by Bajorin et ⁇ l. (1988). The development of human monoclonal antibodies is described in further detail elsewhere in the specification.
  • Active Immunotherapy an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine” is administered, generally with a distinct bacterial adjuvant (Ravindranath and Mitchell et ⁇ l, 1990; Mitchell et ⁇ l, 1993).
  • melanoma immunotherapy those patients who elicit high IgM response often survive better than those who elicit no or low IgM antibodies (Morton et ⁇ l, 1992).
  • IgM antibodies are often transient antibodies and the exception to the rule appears to be anti-ganglioside or anticarbohydrate antibodies.
  • the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the tumor- associated HLA-restricted peptide is administered. Delivery of a vector encoding a the tumor- associated HLA-restricted peptide in conjunction with a second vector encoding one of the following gene products will have a combined anti-hype ⁇ roliferative effect on target tissues. Alternatively, a single vector encoding both genes may be used. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention are will known to one of ordinary skill in the art and may comprise any gene involved in cancers.
  • the proteins that induce cellular proliferation further fall into various categories dependent on function.
  • the commonality of all of these proteins is their ability to regulate cellular proliferation.
  • a form of PDGF the sis oncogene
  • Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor.
  • anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression of the inducer of cellular proliferation.
  • the proteins FMS, ErbA, ErbB and neu are growth factor receptors. Mutations to these receptors result in loss of regulatable function.
  • a point mutation affecting the transmembrane domain of the Neu receptor protem results in the neu oncogene.
  • the erbA oncogene is derived from the intracellular receptor for thyroid hormone.
  • the modified oncogenic ErbA receptor is believed to compete with the endogenous thyroid hormone receptor, causing uncontrolled growth.
  • the largest class of oncogenes includes the signal transducing proteins (e.g., Src, Abl and Ras).
  • the protein Src is a cytoplasmic protein-tyrosine kinase, and its transformation from proto-oncogene to oncogene in some cases, results via mutations at tyrosine residue 527.
  • transformation of GTPase protein ras from proto-oncogene to oncogene results from a valine to glycine mutation at amino acid 12 in the sequence, reducing ras GTPase activity.
  • the proteins Jun, Fos and Myc are proteins that directly exert their effects on nuclear functions as transcription factors.
  • Inhibitors of Cellular Proliferation The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation.
  • the tumor suppressors p53, pi 6 and C-CAM are described below. In addition to p53, which has been described above, another inhibitor of cellular proliferation is pi 6.
  • CDK cyclin-dependent kinases
  • One CDK cyclin-dependent kinase 4 (CDK4), regulates progression through the G ⁇ .
  • the activity of this enzyme maybe to phosphorylate Rb at late G ⁇ .
  • the activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the pl ⁇ NK ⁇ h as been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al, 1993; Serrano et al, 1995).
  • pl ⁇ 11 ⁇ 4 protein is a CDK4 inhibitor (Serrano, 1993)
  • deletion of this gene may increase the activity of CDK4, resulting in hype ⁇ hosphorylation of the Rb protein, pi 6 also is known to regulate the function of CDK6.
  • pX6 ⁇ NK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6 B , pl9, p21 WAF1 , and p27 KIP1 .
  • the pl *NK4 gene maps to 9p2 i 5 a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl6lNK4 gene are frequent in human tumor cell lines.
  • genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, ⁇ 27, p27/ ⁇ l6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS,
  • the Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be important regulators and effectors of apoptosis in other systems.
  • the Bcl-2 protein discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al, 1985; Cleary and Sklar, 1985; Cleary et al, 1986; Tsujimoto et al, 1985; Tsujimoto and Croce, 1986).
  • the evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists.
  • Bcl-2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., Bcl ⁇ L,
  • Bcl y y B ⁇ S' Mcl-1, Al, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax,
  • Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery).
  • the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
  • a cavity may be formed in the body.
  • Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy.
  • Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.
  • Adjunct Autoimmune Therapy Typical treatments for autoimmune diseases include various anti-inflammatories.
  • aminosalicylates drugs that contain 5-aminosalicyclic acid (5-ASA)
  • 5-ASA agents such as olsalazine, mesalamine, and balsalazide
  • Other non-steroidal anti-inflammatories include COX-selective and COX- preferential inhibitors.
  • Corticosteroids - such as prednisone and hydrocortisone - also reduce inflammation. They may be used by people who have moderate to severe ulcerative colitis or who do not respond to 5-ASA drugs.
  • Corticosteroids also known as steroids
  • These drugs can cause side effects such as weight gain, acne, facial hair, hypertension, mood swings, and an increased risk of infection. For this reason, they are not recommended for long-term use.
  • Immunomodulators such as azathioprine and 6-mercapto-purine (6-MP) - reduce inflammation by affecting the immune system. They are used for patients who have not responded to 5-ASAs or corticosteroids or who are dependent on corticosteroids. However, immunomodulators are slow-acting and may take up to 6 months before the full benefit is seen.
  • Cyclosporine A may be used with 6-MP or azathioprine to treat active, severe ulcerative colitis in people who do not respond to intravenous corticosteroids.
  • Adjunct Therapy for Infections A varient of a biologicals are available to treat infectious diseases and include antibacterial (antibiotics, antiseptics), anti-virals, and anti-parastic agents. Any of these agents may be used in combinantion with the present invention.
  • EXAMPLE 1 METHODOLOGY Patients and donors. Donors and patients were treated at the University of Texas M.D.
  • CM complete medium
  • AB heat-inactivated pooled human AB serum
  • DMSO heat-inactivated pooled human AB serum
  • CM CM plus 10% FBS (Atlanta Biologicals Inc., Norcross, Georgia, USA).
  • PRl peptide was incubated at increasing concentrations for 18 hr at 37°C with 100 ⁇ g/ml ⁇ 2 m (Sigma-Aldrich) with 10 6 T2 cells in 1 ml CM. Cells were washed twice with CM, stained with BB7.2 Ab, washed again, and then stained with FITC-labeled secondary Ab (Becton Dickinson Jmmunocytometry Systems, San Jose, California, USA). HLA-A*0201 expression was measured by FACS.
  • Peptide-specific CTLs were expanded in culture using methods described previously (Molldrem et al, 1996; Molldrem et al, 1997). Briefly, PBMCs from healthy donors or CML patients were stimulated in vitro with PRl, pp65, or flu peptides. T2 cells were washed tliree times in serum-free CM and incubated with peptide at the indicated peptide concentration for 2 hr in CM. The peptide-loaded T2 cells were then irradiated with 7,500 cGy, washed once, and suspended with freshly isolated PBMCs at a 1:1 to a 1:2 ratio in CM supplemented with 10% AB.
  • rhIL-2 human interleukin-2
  • BioSource International Camarillo, California, USA
  • rhIL-2 recombinant human interleukin-2
  • a third stimulation was performed, followed on day 15 by addition of rhIL-2.
  • a fourth stimulation was performed on day 21, followed on day 22 by the addition of rhIL-2.
  • the peptide- stimulated T cells were obtained and tested for peptide-specific and leukemia-specific cytotoxicity as well as for phenotypic analyses. Tetramer synthesis.
  • MHC/peptide tetramers were described in detail elsewhere (Altman et al, 1996; Molldrem, 2000). Briefly, a 15-amino acid substrate peptide (BSP) for BirA-dependent biotinylation has been engineered onto the COOH terminus of HLA- A2.
  • BSP 15-amino acid substrate peptide
  • the A2-BSP fusion protein and human /3 m were expressed in Escherichia coli and were folded in vitro with the specific peptide ligand.
  • the properly folded MHC-peptide complexes were extensively purified using FPLC and anion exchange and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, Colorado, USA).
  • Tetramers were produced by mixing the biotinylated MHC-peptide complexes with phycoerythrin-conjugated (PE-conjugated) Neutravidin (Molecular Probes Inc., Eugene, Oregon, USA) at a molar ratio of 4:1.
  • PRl tetramers were validated by staining against a CTL line specific for PRl.
  • CMV tetramers were validated by staining PBMCs from a CMV-immune individual. Ab's and flow cytometry. For routine surface-antigen staining, 10 6 PBMCs were incubated at 4°C with Ab.
  • PI Propidium iodide
  • Becton Dickinson hnmi nocytometry Systems staining (1 ⁇ g/ml) was performed to exclude dead cells, according to the manufacturer's instructions.
  • a "dump" channel was used with tetramer staining to eliminate monocytes and B lymphocytes with nonspecific binding to the HLA-A2 heavy chain by staining with PerCP-labeled CD14 and CD19 (both Becton Dickinson Immunocytometry Systems).
  • PerCP-labeled CD14 and CD19 both Becton Dickinson Immunocytometry Systems.
  • Detailed methodology for detection of t ⁇ n of tetramer dissociation was described elsewhere (Savage et al, 1999).
  • T cells were stained for 45 min with PR1 HLA-A2 tetramer, washed, and cooled to 4°C. To prevent rebinding of tetramer, cells were incubated in the presence of PI (1 ⁇ g/ml) with saturating amounts of BB7.2 Ab, and flow cytometry was used to measure fluorescence decay at 10-min intervals. A constant number of CD8 + events was acquired at each time point. Total fluorescence within the tetramer-positive gate was normalized per CD8 + cell, and the antigen-specific fluorescence was determined by subtracting the total fluorescence of control healthy donor lymphocytes from the observed total fluorescence of the lymphocyte populations following peptide stimulation.
  • This antigen-specific fluorescence was normalized to the percentage of the total fluorescence at the initial time point and plotted on a logarithmic scale. Tetramer dissociation t ⁇ / 2 was determined by plotting ln (normalized fluorescence) versus time, and is given by 0.693/&, where k is the slope of the normalized fluorescence decay curve determined by the method of linear least squares.
  • CTL cytotoxicity assay A semiauto ated minicytotoxicity assay was used to determine specific lysis as described previously (Molldrem, 2000; Molldrem et al, 1996).
  • effector cells were prepared in doubling dilutions from 6 10 3 to 25 x 10 3 cells/well and were plated in 40 ⁇ l, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, California, USA) with six replicates per dilution.
  • Target cells T2 cells, marrow-derived leukemic cells, or BM from a healthy donor
  • T2 cells, marrow-derived leukemic cells, or BM from a healthy donor were stained with 10 ⁇ g/ml of Calcein-AM (Molecular Probes Inc.) for 60 min at 37°C.
  • PBMC peripheral blood mononuclear cells
  • CTLf cytotoxic T lymphocyte precursor frequency
  • Phase I In Phase I of this study, patients are assigned to three escalating peptide dose levels starting with dose level 1. Patients are followed in dose cohorts of size 3 for signs of dose limiting toxicity.
  • Patients are assigned to the next highest dose level cohort only if no more than 1 of the 3 patients at any time at any dose level has > grade 3 non-hematological toxicity or autoimmune phenomena (i.e., dose limiting toxicity).
  • the first patient entered must complete two of the three vaccinations prior to initiation of the second patient in that cohort at that dose level.
  • the first patient in each dose cohort must complete all vaccinations and the second patient must complete at least two vaccinations prior to initiation of vaccination in the third patient.
  • the next dose level will accrue patients in a similar manner.
  • Phase ⁇ of the study will be conducted according to a continuous reassessment statistical model. Up to 60 patients will, be randomized among three dose levels, with a maximum of 20 patients per dose level. Only those dose levels without dose limiting toxicity as determined in Phase I of this study will be examined in Phase II. Both toxicity and efficacy will be determined as primary endpoints. Patients will be monitored in cohorts of size 4, and all patients in any cohort will be observed for at least 2 weeks from the first dose of the last patient in the group in the absence of grade III or EV non-hematological toxicity before continuing to the next cohort. Toxicity information will be carefully accrued using established.
  • grade III or IN non-hematological toxicity is observed during the 9 week study period in 2 of the first 4 patients (the first cohort), 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups, then that dose level will be terminated and patients will be treated only on the remaining dose levels. Moving to the next cohort will occur only if dose-limiting toxicity is not reached in the number of patients defined above for each cohort. There will be a two-week observation period before the next vaccination will be given in any patient that experiences grade II non-hematological toxicity ⁇ dose limiting toxicity. If the toxicity decreases to grade I or less within those two weeks, the patient will be given the next vaccination.
  • grade II toxicity does not decrease to grade I or less within two weeks, the patient will be taken off protocol (removed from study). Any grade toxicity that provides clear evidence of an autoimmune reaction will be considered a dose limiting toxicity. Such a reaction will preclude further administration of peptide under this protocol, and the study will be terminated. If there is evidence that vaccine administration has produced a Wegener's-like vasculitis or inflammatory disease, then the study will be terminated. Efficacy, defined as an immune response to PRl vaccine, will also be determined as a primary endpoint of the study. If none of the first 12 patients have an immune response at a particular dose level, then that dose level will be terminated.
  • the maximal tolerated dose is defined as the highest peptide dose that does not cause dose-limiting non-hematological toxicity beyond the allowable number of patients stated for each phase at each dose level cohort (dose limiting toxicity).
  • the MTD will be determined in either Phase I or Phase II of this study if: (1) dose-limiting toxicity is reached in more than 1 patient of 3 at each dose level cohort in Phase I, or (2) if dose-limiting non-hematological toxicity is exceeded in 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups in Phase II.
  • lymphocytes from HLA-matched allogeneic normal donors exert a powerful graft-versus-leukemia (GVL) effect when used to treat patients with myeloid leukemia (Drobyski et al, 1994; Horowitz et al, 1996).
  • Donor lymphocyte infusions (DLI) alone when administered to patients that have relapsed after allogeneic bone marrow transplantation (BMT) can cure patients with myeloid leukemia (Collins et al, 1997; Kolb and Holler, 1997).
  • graft-versus-host disease GVHD is an unwanted and sometimes lethal complication of DLI treatment that occurs in nearly 50% of patients.
  • GVL and GVHD target antigens of these lymphocytes are largely unknown.
  • GVL may be enhanced and GVHD eliminated after DLI if (1) antigens that were the favored targets of GVL are known and (2) an efficient ex vivo process for enrichment of GVL-causing lymphocytes based on antigen specificity is developed.
  • high and low affinity PRl-specific CTL can be expanded from normal donors ex vivo and then enriched using antigen-coated microbeads for transfer to myeloid leukemia patients, in place of conventional DLI, in order to deliver GVL without GVHD.
  • PRl peptide was combined into the binding region of the HLA-A2 heavy chain, and the resulting protein folded with ⁇ 2 -microglobulin and attached the resulting PRl /HLA- A2 monomer onto 50 nm magnetic microbeads (Miltenyi Co.) (Wang et al, 2000).
  • the technology used was adapted to assemble PR1/HLA-A2 tetramers, where heavy chain monomers are biotinylated at the C terminus and combined in a 4:1 molar ratio with streptavidin, which has in turn been conjugated to phycoerythrin (PE).
  • the PRl monomer- conjugated microbeads can then be passed through a sterile column that is surrounded by a magnet that traps microbead-adherent T cells. After the non-adherent cells pass through the column, the column is removed from the magnet and the PRl-specific T cells attached to the microbeads can be collected.
  • This method allows for the selection of PRl-specific T cells, which could be further expanded and given to patients with myeloid leukemia to facilitate GVL without GVHD. Determining the most efficient in vitro method for short-term expansion of PRl antigen-specific T lymphocytes.
  • the results show that PRl-specific cytotoxic T lymphocytes (CTL) are present at frequencies from 1/15,000 to 1/300,000 in normal donors. Therefore, the PRl-specific CTL will first be expanded so enough cells are available for subsequent enrichment by magnetic bead separation.
  • APC antigen presenting cells
  • PBMC Peripheral blood mononuclear cells
  • DC dendritic cells
  • One week-old DC will be derived after incubating adherent cells from the same healthy HLA-A2+ donors with either 10 ng/ml IL-4 + 1000 U/ml GM-CSF or 1000 U/ml IFN- ⁇ + 1000 U/ml GM-CSF (Verdijk et al, 1999; Santini et al, 2000).
  • the resulting APC will be pulsed weekly with PRl at 10 ⁇ g/ml plus IL-2 at 20 U/ml and combined with responder PBMC in ratios from 1 : 1 to 1 :20.
  • PRl 10 ⁇ g/ml plus IL-2 at 20 U/ml
  • responder PBMC in ratios from 1 : 1 to 1 :20.
  • These APC will be compared to standard T2 cells, a cell line unable to present endogenous antigens due to TAP 1/2 deficiency and can only present peptides pulsed onto the cell surface (Salter and Cresswell, 1986).
  • Preliminary studies using T2 cells as peptide-pulsed APCs expanded the PRl-specific CTL to between 2% to 8% of the total lymphocyte culture by 28 days (Molldrem et al, 2000).
  • the resulting PRl-specific CTL will be quantified and characterized using the PR1/HLA-A2 tetramer in combination with antibodies to CD8, CD69, HLA-DR, CD25, LFA-1, CD54, CD2, intracellular ⁇ -interferon, and CD45(RO) conjugated to different fluorochromes (Molldrem et al, 1999; Molldrem et al, 2000). Cells will subsequently be analyzed using a MoFlo cytometer capable of simultaneous 10-color cytofluorometric analysis.
  • Efficiency of the various APC conditions can be directly compared by quantifying PRl-specific CTL using the tetramer and the other markers will allow comparison of activation state, functional state and memory phenotype.
  • TCR T cell receptor
  • ⁇ 2 of tetramer binding has been shown to correlate with staining intensity, and specific lysis of CML target cells correlates with TCR affinity.
  • High affinity PRl -CTL were elicited from normal donors in the presence of low-dose PRl (2 ⁇ g/ml) and low affinity PR1- CTL were elicited using high-dose PRl (200 ⁇ g/ml) (Molldrem et al, 1998).
  • streptavidin-coated microbeads from Miltenyi, Inc.
  • Beads will be conjugated with PRl plus HLA-A2 through the biotin-labeled C-terminus of the heavy chain (Wang et al, 2000).
  • PRl -pulsed short-tenn CTL lines will be incubated for 30 min with PR1/HLA-A2 coated microbeads and selected using the MACSTM magnetic column.
  • Bead-selected and non-selected CTL will be quantified by flow cytometry using the PRl /HLA- A2 tetramer and compared to the starting polyclonal CTL lines. It is estimated that yields will range from 85% to 100% and PRl-specific CTL purity will range from 11% to 21% after the selection process (i.e.
  • the method to select the highest affinity PRl-specific CTL will be optimized using different ratios of PRl /HLA- A2 monomers, microbeads, and starting cell populations to achieve the highest yield and greatest purity of high affinity PRl-specific CTL.
  • lymphocytes separated using PR1/HLA-A2 monomer-coated microbeads, can be expanded to a sufficient number for use in adoptive immunotherapy of myeloid leukemia. It is estimated that from 1 to 5 x 10 6 CTL may be needed to treat patients with relapsed leukemia after BMT (Mackinnon et al, 1995).
  • the requirement of a leukapheresis product may be reduced to as little as 100 ml of peripheral blood.
  • it will be determined whether the bead-enriched PRl-specific CTL can be further expanded in short term culture. Two methods will be directly compared: the optimized technique, as determined previously, will be used to expand PRl -CTL by weekly restimulation with PRl -coated APCs, versus a non-specific .method.
  • Anti-CD3 + anti-CD28 coated Dynal beads will be coincubated with the bead-enriched PRl-specific CTL in culture media containing varying doses of IL-2 (Garlie et al, 1999; Levine et al, 1998). In controlled experiments, other cytokines such as IL- 12 and interferon will be supplemented in order to optimize the number of PR1-CTL (Fallarino et al, 1996). PRl -specificity will be confirmed at the end of culture using PR1/HLA-A2 tetramers and CTL functional activity will be ascertained using standard cytotoxicity experiments against PRl -coated T2 cells and HLA-A2+ leukemia cell targets.
  • CTL with anti-CD3 and anti-CD28
  • this method will also be tested PRl or to bead selection and compared to the PRl-specific expansion method described above. This may eliminate the requirement for further CTL expansion after bead enrichment.
  • These methods once optimized, can be easily transferred to the clinical setting to treat patients with myeloid leukemia using a Miltenyi MACSTM magnetic bead system to select CD34 + progenitor cells from marrow donors for clinical use. Furthermore, these methods may be used to select CTL with different specificities for other tumor antigens, minor antigens, and viral antigens. Such CTL may be elicited and selected in a single step and adoptively transferred using the methods described herein. Based on the techniques described herein efficient clinical scale-up procedures will be determined for adoptive transfer of antigen-specific T lymphocytes.
  • HLA-A2.1 Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and TAP2 genes and therefore cannot present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with ( ⁇ 2-microglobulin and increased HLA-A2.1 surface expression, which could be measured using flow cytometry.
  • HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CalTag Laboratories, Burlingame, CA) was used to measure surface expression of HLA-A2.1.
  • FITC-labeled secondary antibody CalTag Laboratories, Burlingame, CA
  • T binding half-life
  • the labeled heterotrimer complex was separated from uninco ⁇ orated ( ⁇ 2-microglobulin by high-performance liquid chromatography gel filtration, and the half-time of dissociation of ⁇ 2-microglobulin was determined by subjecting aliquots of the complex to a second round of gel filtration.
  • Both PRl and PR2 showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide, as the background for HLA-A2.1 expression, (Table 5).
  • the control influenza peptide is an Influenza B nucleoprotein (aa 85-94; Flu)
  • Tax is an HTLV-1 peptide (aa 11-19), both with known high binding affinity to HLA-A2.1.
  • the long measured T ⁇ /2 as measured using ( ⁇ 2-microglobulin dissociation confirmed the binding of PRl and PR2 to HLA- A2.1.
  • T2 cells which co-express the costimulatory molecule B7.1
  • CM penicillin/streptomycin and glutamine
  • peptide at 20 ⁇ g/mL for 2 hr in CM.
  • the peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO).
  • HS human serum
  • FIG. 1 shows the peptide-specific lysis of the CTL lines against T2 cells loaded with either
  • PRl specific CTL preferentially lyse human myeloid leukemia cells. It was next determined whether the PRl-specific CTL line was capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals. Table 6 lists the HLA type and leukemia type of target cells used. As controls, two cell lines expressing low levels of Pr3 were used: HLA-A2.1 transfected K562 cells and U937 cell line which lack HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2.1 -restricted manner.
  • FIG. 2 shows the combined results of tliree separate experiments from three PRl-specific CTL lines.
  • FIG. 2A the specific lysis by PRl-specific CTL, at various E:T ratios, of either U937 cells, HLA-A2.1 -transfected K562 cells, or T2 cells with or without exogenously added PRl peptide at 1.0 ⁇ g/mL is shown.
  • FIG. 2B demonstrates the cytotoxicity of the CTL line against HLA-A2.1 -positive human myeloid leukemia cells.
  • Marrow cells from three patients with CML (P 1, P2, and P3) as well as one patient with AML M4 (P4) were readily lysed, with 53% specific lysis against PI (a patient with CML in chronic phase) at an E:T ratio of only 6:1 (Molldrem et al, 1996).
  • Marrow cells taken from a normal healthy donor (D2) demonstrate only background lysis ( ⁇ 20% lysis), similar to that of the control T2 cells without added PRl peptide.
  • HLA-A HLA-B HLA-DR Dl Normal PBMC 1, 2 8, 27 3, 16 D2 Normal Marrow 2, 26 13, 58 7, 7 U937 Cell Line 3, 3 18, 51 14, 16 PI CML-CP 2, 28 35, 51 9, 14 P2 CML-AP 1, 2 63, 63 8, 13 P3 CML-BC 2, 26 13, 58 7, 7 P4 AML 2, 3 35, 52 4, 13 P5 MDS (RAEB) 2, 24 27, 62 1, 13
  • PBMC peripheral blood monouclear cells
  • CML-CP chronic myelogenous leukemia, chronic phase
  • CML-AP chronic myelogenous leukemia, accelerated phase
  • CML-BC chronic myelogenous leukemia, blast crisis
  • MDS RAEB - myelodysplastic syndrome, refractory anemia with excess of blasts.
  • Prl specific CTL was found to preferentially inhibit colony forming units in leukemia patient samples, but not in normal donor samples (Molldrem et al, 19997).
  • Cell contact was found to be required for inhibition of CFU-GM, and inhibitory factors elaborated into the supernatant by CTL1 effector cells were not responsible for colony inhibition (Molldrem et al, 1997).
  • Inhibition of CML CFU-GM correlates with Pr3 overexpression in target cells.
  • Target cells were examined for cytoplasmic Pr3 expression by flow cytometry. After permeabilizing the cell membrane, indirect staining was performed using an antibody to Pr3 and a second FITC-labeled antibody, followed by flow cytometry.
  • Pr3 is highly expressed in leukemia but not in normal CD34 cells.
  • marrow was collected from patients. Marrow was obtained from a patient with CML in BC (P3), and normal CD34 cells for comparison were obtained from G-CSF mobilized peripheral blood mononuclear cells from a normal donor (D3). Cells were first labeled with PE conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA), followed by cytoplasmic indirect staining for Pr3.
  • PE conjugated anti-CD34 antibody Becton Dickinson, San Jose, CA
  • the inventors have shown that CML blasts that were CD34 positive and highly expressed Pr3 as compared to CD34 negative blasts and normal CD34 positive cells. This shows that very early progenitor cells overexpress Pr3 whereas there is very little Pr3 expression in a small number of normal progenitor cells. Expression of proteinase 3 following transfection into and HMy2.CIR and
  • HMy2.CIR-A2 cells To provide further evidence that the PRl peptide was processed and presented on the surface of a cell, a human B cell line (that does not express Pr3) was transfected with Pr3 and tested whether PRl specific CTL could lyse the transfected cells.
  • the previously published DNA sequence encoding Pr3 was used to design primers for cloning the cDNA from a normal bone marrow sample (Sturrick et al, 1992).
  • Pr3C-F 5'- CTGGACCCCACCATGGCTCA-3' SEQ JD NO: 12
  • Pr3C-R 5'-CGCCACAGTGTTCGGGGAAG-3' SEQ ED NO:13
  • the PCR product was cloned into the pCR2 vector using the TA cloning kit (Invitrogen, Carlsbad, CA) and then subcloned into the mammalian expression vector pCDNA3.1 (Invitrogen) containing the CMV promoter and the Zeocin resistance marker.
  • the resulting plasmid DNA was named pRTZ.2.
  • Ten million HMy2.CIR (ATCC, Rockville, MD), or 10 million HMy2.CIR-A2 cells were each washed in phosphate buffered saline (PBS) and re-suspended in 0.8 L of ice-cold PBS and put into an electroporation cuvette with 20 ⁇ g of circular plasmid DNA.
  • PBS phosphate buffered saline
  • HMy2.CIR-A2 transfected either with the Pr3 -containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT, was tested for intracellular Pr3 expression by flow cytometry analysis of as previously described. Two clones with the highest expression are shown in FIG. 3. HMy.2.CIR-A2 cells transfected with Pr3 are susceptible to lysis by PRl specific
  • HMy2.CTR-A2 cells were lysed by PRl specific CTL.
  • the PRl specific CTL were elicited in the manner previously described, and after 22 days in culture were combined at a 25:1 E:T ratio with HMy2.CIR-A2 transfected either with the Pr3-containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT.
  • PRl specific CTL were also combined with control marrow cells from a CML patient in blast crisis (P3), HL-60 cells (which express Pr3, but lack HLA-A2.1), and marrow cells from a normal donor (D3).
  • PRl specific CTL demonstrated 36% specific lysis of the Pr3 -transfected cells (clone 1.4), but only background lysis of normal marrow cells, HL-60 cells, HMy2.CIR cells transfected with the empty vector (CAT), and the non-transfected parent B cell line HMy2.CIR (HMY A2; FIG. 4). These results suggest that the PRl peptide is processed and presented on the surface of the Pr3 transfected HMy2.CER cells. Although the level of Pr3 expression was lower than that found in leukemia cells, the B cell line may be more efficient at processing and presentation, thus compensating for the lower level of Pr3 expression.
  • PRl-specific CTL identified in PBMC from normal donors by limiting dilution analysis and by using a PR1-HLA-A2 heavy chain tetramer.
  • a modified limiting dilution assay designed for detecting low frequency lymphocyte precursors (CTLP) using a limited amount of patient material was used. This assay was used to determine the CTLP frequency (CTLPf) on day 0 and again after 20 days of PRl-stimulated expansion in bulk culture. The details of this assay are described herein.
  • the PRl-tetramer can be used to identify a distinct population of CTL with specificity for HLA-A2.1 -bound PRl amongst a 17 day-old bulk culture of PRl-stimulated PBMC. Selection of a purified population of PRl-specific CTL from bulk culture is possible using a PR1-HLA-A2 heavy chain tetramer. In order to determine whether a purified population of PRl-specific CTL could be obtained from bulk culture CTL stimulated with PRl , the PRl-tetramer to FACS sort for CTL that expressed PRl-specific TCR was used.
  • a 32 day-old PRl-stimulated CTL culture was obtained from a starting population of PBMC from an HLA-A2.1+ normal donor using the methods previously described. When the cells were dual-labeled with anti-CD8 and the PRl-tetramer, 4.3% of the bulk culture CTL were double-positive. An aliquot of 5 x 10 6 CTL was washed three times with PBS and labeled with anti-CD8 conjugated to FITC (Caltag Laboratories, Burlingame, CA) for 2 hr at 4°C.
  • the cells were then washed three times with PBS and labeled with the PE-conjugated PRl-tetramer for 2 hr at 4°C. This was followed by a third labeling with both anti-CD4 and PI which was used as a dump during sorting.
  • the cells were then sorted for dual-staining running CellQuest and CloneCyt software. 1.1 x 10 5 CTL were recovered with >95% vwbility (a yield of 2.2% of the total population, or 55% of the PRl-specific population) and the sorted population is shown in FIG. 6.
  • the sorted CTL were then placed back into culture at 1 x 10 cells/mL of CM supplemented with 10% human serum (Sigma) and 100 IU/mL IL-2 (Biosource International). After 24 hr, the cells were collected and tested for the ability to lyse fresh leukemia target cells.
  • the PRl -sorted CTL were then compared to the non-sorted bulk culture CTL in a 4-hr cytotoxicity assay. Effector cells were washed three times with PBS and co-incnbated at E:T ratios of 20:1 to 2.5:1 with target bone marrow cells from an HLA- A2.1+ patient with accelerated phase CML and with bone marrow cells from an HLA- matched normal donor for 4 hr.
  • Target cells 1000 cells/well were labeled with Calcein AM for 90 min prior to co -incubation, as in previous experiments.
  • FIG. 7 shows that the PRl -sorted CTL produced significantly greater specific lysis of CML marrow than non-sorted CTL at all E:T ratios, and that background lysis of normal marrow was reduced to near zero.
  • the CTL population depleted of PRl-specific CTL after FACS sorting was also examined for specific lysis of the CML marrow and no specific lysis was found at any E:T ratio.
  • PCR products were reamplified with the same primers to which were added an Ml 3 sequencing primer tail (M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 14) for the forward primer and M13 Reverse 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 15) for the reverse primer).
  • Ml 3 sequencing primer tail M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 14) for the forward primer
  • M13 Reverse 5'-CAGGAAACAGCTATGACC-3' SEQ ID NO: 15
  • Genotype of donors and recipients was determined using Sequence Specific primer (SSP) PCR.
  • SSP Sequence Specific primer
  • the PCRTM products were run in 2% agarose gel stained with Ethidium Bromide. Different patterns between individuals were noted in exons 1 through 4, but only exons 1 through 3 showed differences between donors and recipients of the same pair, as shown in FIG. 8. Since the amplified DNA product also contained portions of the flanking intronic regions and since all of the base differences in the coding region may not result in amino acid differences, the amplified products from donor-recipient pairs showing donor specific bands were sequenced.
  • Pr3 gene is polymo ⁇ hic for the following reasons: (1) The sequences as determined from the intronic regions conflicted several times with the published genomic sequence; (2) two different polymo ⁇ hic sites were found in exons 1, 2, and 3 that explained the multiple patterns observed on autoradiography; (3) only one DNA polymo ⁇ hism, in exon 3, was found to encode for an amino acid polymo ⁇ hism in the deduced amino acid sequence (Table 9). This polymo ⁇ hism encodes for either an isoleucine (ATT) or a valine (GTT) at position 119 of the amino acid sequence.
  • ATT isoleucine
  • GTT valine
  • Sequencings of the first 4 exons have been submited to Genbank (accession numbers: .AF015446; AF015447; AF015448 and AF015449).
  • Aa amino acid; He; isoleucine; Val: valine; UT: untranslated.
  • KLNDILLIQL SEQ ID NO:8
  • KLNDVLLIQL SEQ ID NO:9
  • PRl self peptide from Pr3 is irnrnunogenic, and these data suggested that T cell responses may be elicited against polymo ⁇ hic differences in Pr3 as well. These differences may be used as a basis for designing leukemia-specific adoptive T cell therapy of myeloid leukemia.
  • the leukemia-associated antigen PRl is derived from both proteinase 3 and neutrophil elastase proteins. The inventors have shown that killing of leukemia cells by PRl- specific CTL correlates with P3 overexpression. However, the PRl sequence is also contained within neutrophil elastase (NE), which is also aberrantly expressed in leukemia cells.
  • NE neutrophil elastase
  • P3- and NE-transfected B cells were used as target cells in a proliferation assay with PRl-specific T cells. Full-length P3 and NE cDNA was cloned from the promyelocytic HL-60 cell line based on published sequences.
  • the sequences were subcloned into an EGFP-containing vector (pCMS-EGFP) with a CMV promoter to drive constitutive expression.
  • the B cell line, HMy-CIR previously stably transfected with the HLA-A*0201 gene, was transfected with P3-pCMS-EGFP and NE-pCMS- .
  • EGFP by electroporation for 24 hr.
  • GFP-expressing cells P3-HMy.CIR-A2 and NE-HMy.CIR- A2, respectively) were selected by FACSorting and high transfection levels were confirmed by fluorescence microscopy.
  • Western blotting confirmed protein expression in the NE-HMy.CIR-A2-transfected cells, although expression was similarly less than in HL-60 cells.
  • PRl-specific CTL lines elicited from two healthy donors showed stimulation indices (SI) of 1.3 and 2.4 when co-incubated with P3-HMy.CIR-A2 target cells during BrDU inco ⁇ oration, confirming that PRl -CTL recognize PRl peptide processed and presented from P3.
  • PRl -CTL also recognized NE-transfected cells, with Si's of 1.5 and 2.1. No recognition of non-transfectants or parent HMy.CIR (A2-) was observed.
  • PRl could be used as a target antigen to stimulate both active and passive leukemia-specific immunity.
  • PRl will be given as a vaccine with incomplete adjuvant to boost leukemia immunity, and in additional clinical trials PRl- specific CTL will be selected and expanded ex vivo with the PRl antigen for the production of leukemia-reactive CTL.
  • PRl-specific CTL will be used alone or combined xvith existing treatments, such as allogeneic BMT, to produce a GVL effect.
  • PRl-specific donor-derived CTL added to a previously CD3 T cell-depleted graft, for instance, may allow selective GVL reactivity without GVHD.
  • CTLPf would be low in the donor, lower still in the recipient, but that it would increase following BMT.
  • a high CTLPf against PRl present in the recipient prior to BMT might indicate leukemia immune escape, which could h e addressed separately as detailed below.
  • LDA limiting dilution analysis
  • PBMC and BM from HLA-A2.1+ patient samples will be used to test for existing T cell reactivity toward PRl by using a limiting dilution CTLPf assay (Hensel et al, 1999).
  • PBMC and bone marrow mononuclear cells (BMC) will be obtained by Ficoll Hypaque separation and either used fresh, or frozen in liquid nitrogen for future use.
  • Samples from HLA-A 2.1 positive patients with CML, AML, and MDS will be collected.
  • PBMC and BM from the HLA-matched normal BMT donors to those patients will also be collected, cryopreserved, and assayed as well. The previously frozen samples will be thawed and washed three times in serum-free CM and counted.
  • a total of 19.5 million cells will be prepared for the assay (7.5 million stimulator cells, and 12 million responder cells).
  • One million additional PBMC will be used to generate phytohemagglutinin (PHA-P; Sigma Chemical, St. Louis, MO) stimulated blasts to be used as target cells on day 10 of the assay.
  • PHA-P phytohemagglutinin
  • One million unrelated HLA-disparate PBMC third party will also be used as a positive control, with half of the total number used as stimulator cells and the other half as responder cells.
  • PHA blasts will be generated by placing 10 6 cells in 1.0 mL of CM supplemented with
  • fetal bovine serum FBS; Sigma Chemical
  • CM + 10% FBS with 5 ⁇ L/mL PHA-P and 500 lU/mL rhIL-2 will be added. Cells will be counted and cultures will be maintained at 10 6 cells/mL. These cells will be used as target cells on day 10 of the CTLPf assay.
  • PBMC responder cells from patient samples will be plated into high profile Terasaki Trays (Robbins Scientific, Sunnyvale, CA) at 6 dilutions (from 5 x 10 4 to 5 x 10 5 PBMC/well) using 24 replicates at each dilution in CM + 10% human AB serum (AB; Sigma Chemical).
  • Third party responders from normal donors will be plated at a single dilution (5 x 10 4 PBMC/well).
  • Patient PBMC stimulator cells will either be pulsed with peptide (PRl or FLU, the influenza nuclear protein described previously, as a positive control peptide) at 20 ⁇ g/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, then irradiated with 2500 cGy. These cells will then be plated into the wells containing the responder cells, as well as 24 additional wells of stimulators alone. On days 3 and 7, 60 IU/mL of IL-2 will be added to each well.
  • peptide PRl or FLU, the influenza nuclear protein described previously, as a positive control peptide
  • the previously prepared PHA blasts from the same patient will either be pulsed with PRl at 20 mg/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, and then labeled with Calcein AM (Molecular Probes, Eugene, OR) as described in the cytotoxicity experiments above.
  • PRl at 20 mg/mL or no peptide for 90 min at 37°C
  • CM serum-free CM
  • Calcein AM Molecular Probes, Eugene, OR
  • the calculated CTLP ⁇ requencies will then be analyzed with respect to the amount of Pr3 expression in the patient's blast populations, since the amount of specific lysis of PRl-specific CTL in normal donors correlated with the amount of Pr3 overexpression in the target leukemia cells in the previous studies (Molldrem et al, 1996). Determining the percent of PBMC and BM specific for the PRl peptide.
  • CTL responses to PRl will be examined determining the percent of peripheral blood mononuclear cells (PBMC) and bone marrow cells (BM) that are specific for the HLA-A2.1 -bound PRl peptide by FACS analysis using a specific PRl -HLA- A2 tetramer (PRl-tetramer) linked to phycoerythrin (PE).
  • the PRl-tetramer will be used to identify the fraction of CTL that recognize HLA-A2-bound PRl in patient and donor PBMC and BM before transplant and again 6 months after transplant. This will be easier to study using patients that receive peripheral blood grafts since more patient material is available for the larger number of lymphocytes needed for flow cytometry determination of the percent of PRl-specific CTL.
  • PRl-specific CTL determined using the combination of PRl-tetramer plus CD8, will be analyzed by using three and four color FACS analysis to simultaneously determine the phenotype of the PRl-specific CTL.
  • the cells will be analyzed for state of activation using CD28, CD69, and CD25.
  • Memory CTL will be evaluated using CD45RO antibody. It is important to determine whether any PRl-specific CTL that are found in the leukemia patients are memory cells in an inactivated state which would suggest either that the leukemia is not a potent immunogen or perhaps the CTL are incapable of responding.
  • PBMC and BM 10 million mononvxclear cells will be thawed and washed 3 times with PBS. These cells will be placed into culture with 5 to 10 million T2 cells (previously pulsed with 10 ⁇ g/mL of PRl for 90 min at 37°C) in CM + 10% HS at 37°C and 5% C02 for one week and then re-stimulated with PRl-pulsed T2 cells on day 7. On day 8, IL-2 at 20 IU/mL will be added to the cultures and this process will be repeated at two and three weeks of cell culture.
  • T2 target cells will be pulsed with 10 ⁇ g/mL of PRl, control Flu peptide, or no peptide for the cytotoxicity assays.
  • a CTL line established from an HLA-matched normal donor using the sa ⁇ ne methods will be used as a positive control in the cytotoxicity assay, since this is an established method.
  • CTL responses to PRl will be examined determining the frequency of cells secreting cytokines in response to PRl peptide recognition using the ELISPOT assay.
  • Cytokine- secreting cells will be measured in response to PRl -coated targets by using the ELISPOT assay.
  • Recent clinical trials have used methods such as precursor frequency analysis by limiting dilution based on cytotoxicity ( 51 Cr), lymphocyte proliferation ( 3 H thymidine uptake), as well as cytokine responses by measuring single cell interferon- ⁇ or TNF- ⁇ secretion (using the commercially available ELISpot assay, Mabtech, Nacka, Sweden). Each of these methods measure different lymphocyte functional responses, and clinical response to tumor va cines does not always correlate with these in vitro measurements (Nelson et al, 166; Rosenberg et al, 1998).
  • PBMCs will be washed 6 times with CM and blocked with CM + 10% HS for 1 hr.
  • PBMCs will be thawed and washed 3 times with PBS and suspended in CM + 10% HS.
  • PBMCs will be added in 100 ⁇ L CM + lO% HS per well to the precoated plates at 5 x 10 5 /well, in duplicate wells.
  • duplicate wells with 5 x 10 5 and 2.5 x 10 5 PBMCs/well will be used. Detection of peptide-specific T cells from freshly isolated PBMCs will be performed using autologous PBMCs themselves to present PRl peptide.
  • T2 cells will be used in some assays as target cells and compared to the autologous PBMCs. In this case, T2 cells will be pulsed with 10 ⁇ g/mL of PRl peptide for 90 min and washed 3 times prior to plating with responder PBMCs. The plates will then be incubated for 6 hr at 37°C, 5% C0 2 and then arrested by shaking off the contents and washing 6 times with PBS 0.05% Tween 20 (Sigma Chemical, St. Louis, MO).
  • PBMCs will be pulsed with PRl peptide and exposed as stimulators to autologous PBMCs at a 1:1 responder: stimulator ratio on two occasions over 7 to 10 days with low-dose IL-2 added to each well at 60 IU/mL before the ELISPOT assay is performed.
  • the ELISPOT technique will also used to quantify the number of SFC in a TNF-a assay under similar conditions (Herr et al, 1996).
  • Cells will also be surface-labeled with anti-CD33, CD34, and CD14 monoclonal antibodies (Becton-Dickinson, San Jose, CA) in order to correlate the developmental stage of the blast population with Pr3 expression.
  • cells will be labeled for MHC class I and II, CD80 (B7.1) (ImmunoTech S.A., Marc Victors Cedex, France), CD86 (B7.2) (ImmunoTech), and CD54 (ICAM-1) (Becton Dickinson) to evaluate the potential of the blasts as suitable CTL targets.
  • CD80 B7.1
  • CD86 B7.2
  • ImmunoTech ImmunoTech
  • CD54 ImmunoTech
  • IMM-1 Becton Dickinson
  • the cells will " be washed in serum-free CM, permeabilized using Ortho PermeaFix for 30 min at room temperature, washed twice in serum-free CM, and then indirectly stained with an antibody to Pr3 (Accurate Chemicals, Westbury, NY) and a secondary FITC-conjugated antibody. This will he followed by an additional wash with serum-free CM and surface labeling of the other markers using direct staining with PE- or APC-conjugated antibodies at 4°C. As previously discussed, a high CTLPf in the recipient pre-BMT may indicate leukemia immune escape.
  • a low CTLPf but a high percent of PRl-specific CTL by flow cytometry may indicate a defect in CTL target recognition, which may be further investigated by examining TCR ⁇ chain tyrosine phosphorylation by Western blot analysis.
  • Humoral immune responses to Pr3 will be examined by measuring antineuroptiil cytoplasmic antibody (ANCA) titers. In Wegener's granulomatosis, the ANCA IgG titer correlates closely with disease activity. Since T lymphocytes taken from biopsy sites of active vasculitis in these patients show proliferation in response to Pr3, and since T cell help is required for IgG production, it is possible that measuring ANCA titers may be an indirect measure of Redirected activity of T lymphocytes.
  • ANCA antineuroptiil cytoplasmic antibody
  • ANCA titer has not been formally examined in patients with myeloid leukemia.
  • An inexpensive and reliable assay is commercially available and used in clinical laboratories to evaluate ANCA titers.
  • ANCA titers will be determined in all myeloid leukemia patients enrolled on phase I/II clinical vaccine trials as well as the transplant patients and their donors will be investigated using the above assays to measure cellular immunity. Patients of all HLA types will be evaluated for ANCA positivity.
  • EXAMPLE 7 DETERMINING WHETHER PRl CAN ELICIT SPECIFIC ANTILEUKEMIA IMMUNITY IN PATIENTS WITH MYELOID LEUKEMIA
  • PRl can be used to elicit specific antileukemia immunity in patients with myeloid leukemia.
  • Leukemia offers several advantages as a model disease for vaccine development and evaluation. First, since the leukemia cells circulate in the peripheral blood the tumor cells are readily available for study without the need for repeated invasive biopsies which allows for close monitoring of any changes in the tumor phenotype. In addition, the lymphocytes under study also reside in the peripheral blood in constant contact with the malignant cells. These are obvious advantages to the study of immune responses in the treatment of solid tumors. Enhancing CTL reactivity by PRl.
  • a phase I/II clinical protocol using the PRl peptide in combination with incomplete Freund's adjuvant (IF A) will be employed to vaccinate patients with myeloid leukemia to determine whether CTL reactivity to PRl peptide can be enhanced by subcutaneous vaccination with the PRl peptide combined with incomplete Freund's adjuvant (IF A) every 3 weeks for 3 injections.
  • CTLP frequency will be measured in PBMC and BM before and after vaccination using microtiter limiting dilution analysis.
  • IFA has been used in one successful clinical trial using gplOO to vaccinate patients with melanoma (Rosenberg et al, 1998).
  • HLA-A2+ patients Up to 60 HLA-A2+ patients (as confirmed with BB7.2 antibody labeling) with CML, AML, and MDS will receive a deep subcutaneous injection every 3 weeks for 9 weeks. Patients will be randomized to three dose levels of the PRl peptide (0.25 mg, 0.5 mg, and 1.0 mg) with a fixed amount of IFA, and then followed in cohorts of 4 for toxicity and evidence of an immune response to PRl as measured in vitro using the CTLPf assay by LDA.
  • a vaccine will be randomized to three different doses of vaccine, since it is not clear that increased dose will result in a greater anti-tumor response, hi fact, if toxicity of a vaccine is related to the augmentation of the immune response, that augmentation may be elicited by repeated immunization rather than increasing the dose of the immunizing antigen.
  • the "dose escalation" of a vaccine may not lie in the quantity of peptide delivered, but rather in the number of exposures to antigen, i.e. the number of immunizations.
  • the CTLPf by LDA
  • the percent PRl-specific CTL measured using the PRl-tetramer will be used to assay immune responses in the patients.
  • Approximately 20 million PBMC will be used in both assays derived from 100 ml peripheral blood samples before and 3 weeks after the last vaccination. Further experiments will be performed to evaluate any non-responsiveness found using both these assays.
  • An important aspect in the design of any phase I/II cancer vaccine trial targeting a self tumor antigen is the selection of the patients to be immunized. Toxicity such as vasculitis is possible and therefore patients with advanced stage leukemia will be eligible for this initial study. However, determination of safety requires that an immune response be mounted, and far advanced patients often lack a competent immune response.
  • patients with all types of myeloid leukemia at various stages of disease including patients with chronic phase CML who will have a stable low-leukemia burden and normal lymphocyte counts will be examined. It is anticipated that the chronic phase CML patients will be those without the option of of allogeneic BMT, who may be failing other forms of therapy such as interferon with or without chemotherapy, and who are therefore terminally ill.
  • Patients with CML offer the further advantage over solid tumor patients that molecular studies of the amount of Ph chromosome can be used to judge responses in the chronic phase patients with low tumor burden.
  • PCR analysis which is performed routinely on all CML patients to follow the disease course, will be performed at 3-week intervals during the course of the study, and again one month after the last vaccine.
  • GM-CSF as an adjuvant has produced greater immune responses in animal models of other hematological malignancies (Kwak et al, 1996).
  • Phase I trials using bcr-abl junction region peptides to vaccinate patients with CML are being conducted by other investigators. These investigators are using a combination of 5 HLA- A3 and HLA- All-restricted peptides from the b3a2 translocation region with the adjuvant QS-21 in a dose-escalation trial design starting with 10 ⁇ g of peptide.
  • the PRl peptide vaccine has greater potential to elicit immunity compared to bcr-abl junction region peptides for several reasons.
  • the pre-clinical data regarding bcr-abl junction region peptides indicates that CTL elicited in vitro against these peptides do not demonstrate cytotoxicity against fresh leukemia target cells, but only to leukemia cells that have been pre-pulsed with the target peptides.
  • PRl-specific CTL show cytotoxicity and leukemia progenitor inhibition of fresh leukemia cells with no prior peptide labeling of the target cells (FIG. 2).
  • clinical trials showing responses to melanoma peptide vaccines have used 10-fold higher peptide doses to vaccinate patients than what is used in the b3a2 peptide vaccine trial.
  • the PRl vaccine trial will use peptide doses similar to those used in the melanoma vaccine trials.
  • the 51 Cr-release CTLPf by LDA that was used to evaluate an immune response to the b3a2 peptides is less sensitive than the mirco- titer CalceinAM-based assay of the present invention.
  • the PRl vaccine trial will include patients with all types of myeloid leukemia, thereby broadening the opportunity to find immune responses. Potential non-responsiveness to PRl will be evaluated by generation of PRl-specific T cells in myeloid leukemia patients.
  • PRl-specific CTL responses can be elicited in patients by using the peptide vaccine will be determined. In those patients where no immune response is elicited, or in those patients that develop an immune response but do not have a clinical response to the vaccine, it will be important to know whether PRl-specific CTL from those patients can recognize and/or kill autologous leukemia cells.
  • PRl peptide synthesized to >95% purity (Biosynthesis, Lewisville, TX) will be added to the T2 cells at 10 ⁇ g/mL and the T2 cells will be placed in a humidified incubator at 37°C for 90 min.
  • the PRl -pulsed T2 cells will be irradiated with 7500 cGy, washed twice with serum-free CM, and combined at a 1:1 ratio with patient PBMC in 50 mL of CM + 10% human AB serum (10% AB) and placed in a 75 cm 2 tissue culture flask.
  • PBMC PBMC
  • CM + 10% AB CM + 10% AB
  • recombined at a 1:1 ratio with fresh T2 cells Similarly pulsed with PRl, irradiated, and washed.
  • 20 IU/mL of recombinant human interleukin-2 (rhIL-2) Biosource International, Camarillo, CA
  • rhIL-2 recombinant human interleukin-2
  • rhIL-2 Human interleukin-2
  • a fourth stimulation will be performed on day 21 followed on day 22 by the addition of 20 IU/mL rhIL-2.
  • the PRl-stimulated T cells will be tested for peptide-specific cytotoxicity toward T2 cells and leukemia cells from autologous and allogeneic BMC.
  • a semi-automated mircotiter cytotoxicity assay identical to that used in the previously published studies, will be used to determine specific lysis. Effector cells grown in the presence of PRl -pulsed T2 cells will be prepared in doubling from 6 x 10 3 to 25 x 10 3 cells/well and will be plated in 40 ⁇ L, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, CA) with six replicates per dilution.
  • Target cells T2 cells ⁇ PRl, autologous marrow-derived leukemia cells, or marrow derived from normal donors
  • CM Calcein-AM
  • target cells After washing three times in CM + 10% AB, target cells will be resuspended at 10 5 cells/mL.
  • Wells with target cells alone and medium alone will be used for maximum (max) and minimum (min) fluorescence emission, respectively.
  • FluoroQuench EB Stain-Quench Reagent (One Lambda, Inc, Canoga Park, CA) will be added to each well and the trays will be centrifuged for 1 min at 60g before measurement of fluorescence using an automated Lambda Fluoroscan (One Lambda, Inc).
  • a decrease in the fluorescence emission is proportional to the degree of lysis of target cells, once the hemoglobin contained in the FluoroQuench reagent quenches the released dye.
  • the mean and standard deviation fluorescence from the 6 wells at each E:T ratio will be calculated, and the percent lysis will be calculated.
  • PRl specificity will be confirmed by using Flu peptide-coated T2 cells as a negative control target cell population in the cytotoxicity assay.
  • Autologous BMC and HLA-A2+ BMC from a normal donor will be prepared similarly and also used as target cells to test for leukemia-reactivity.
  • patient PBMC will be used in parallel to generate Flu- specific CTL lines which will be similarly tested for lysis of Flu peptide-coated T2 cells.
  • PBMC blood will be collected and PBMC isolated over a Ficoll-Hypaque density gradient as previously described. PBMC will be allowed to adhere to a plastic 75-cm 2 flask for 2 hr at 37°C. Non-adherent cells will be removed, and the adherent cells will be cultured for 7 days with GM-CSF (800 U/mL; Sandoz, Germany) and IL-4 (500 U/mL; PharMingen, Hamburg, Germany). Phenotypic changes will be monitored by light microscopy and flow cytometry will be performed to confirm the DC phenotype.
  • GM-CSF 800 U/mL; Sandoz, Germany
  • IL-4 500 U/mL
  • PharMingen Hamburg, Germany
  • PRl will be used to pulse dendritic cells (DC) derived from the peripheral blood of normal donors, and these PRl -pulsed DC will be used like T2 cells in previous experiments to elicit PRl- specific CTL.
  • PRl-specific lysis will be evaluated using these DC-generated CTL using assays discussed previously and compared with T2-generated CTL.
  • Pr3 expression in patient BMC will be evaluated after the addition of interferon- ⁇ , interferon- ⁇ , and GM-CSF. These cytokines are known to increase
  • T cell MHC molecules and co-stimulatory molecules (Tsukada et al, 1997) and also increase
  • Pr3 expression (Mayet et al, 1997; Sibelius et al, 1998). Thus, cytokine co-administration might lead to more effective anti-PRl immunity (Dermime et al, 1997).
  • cytokine co-administration might lead to more effective anti-PRl immunity (Dermime et al, 1997).
  • the PRl-tetramer may be used to FACS sort for a homogeneous population of PRl -selected CTL that show high specific lysis of leukemia with no background lysis of normal marrow cells.
  • the PRl-tetramer will be used in the present invention to FACS sort homogeneous population of CTL from bulk culture CTL lines established at 2 to 3 wk of culture. These CTL lines will be generated using PBMC from HLA-A2.1+ patients with CML and AML as well as normal donors using PRl -pulsed T2 cells as antigen presenting cells. Using the PRl-tetramer, these cells will be FACS sorted and their state of activation and phenotype will be compared (by measuring CD28, CD69, CD25, and CD45RO) and their ability to lyse PRl-coated T2 and fresh autologous and allogeneic leukemia cells.
  • PRl -sorted CTL that demonstrate cytotoxicity toward the leukemia cells, will also be evaluated for their ability to inhibit leukemia CFU-GM and normal HLA-A2.1+ CFU-GM using normal donor bone marrow cells and the methods previously described.
  • the PRl -sorted CTL as shown in FIG. 16, contain some CD8+ cells that do not have apparent specificity for PRl. However, a much more homogeneous population of PRl-specific CTL are obtained using the PRl-tetramer, which will allow for more efficient cloning of these cells.
  • Cells will be cloned by limiting dilution according the Poisson distribution where 0.3 cells/well will be plated into 96 well plates containing 1 x 10 5 allogeneic PBMC (previously radiated with 7,500 cGy) in 300 ⁇ L CM + 10% HS and 60 IU/mL IL-2. These wells will be placed at 37°C and 5% CO 2 for 7 to 10 days. Media will be replaced after 7 to 10 days and wells that contain growing cells will be expanded and subsequently studied for specific lysis of PRl- coated T2 cells as previously described. These clones will also be evaluated for phenotype using the above antibodies.
  • Clones obtained using these methods will be used to investigate the Hmy2.CIR-A2 transfectants and other cells transfected with the Pr3 gene as discussed elsewhere in this application. Similar to that demonstrated in previous studies (Molldrem et al, 1999), CTL from a patient with CML that demonstrate high specific lysis of PRl -pulsed T2 target cells was not elicited. Therefore, to overcome the apparent non-reactivity to this self-peptide in patients with leukemia FACS-sorted populations of PRl-specific CTL from normal donors will be investigated.
  • Normal donor-derived allogeneic PRl-specific CTL that are FACS sorted using the PR1- tetramer may be used for the safe adoptive transfer into leukemia patients selected only for the HLA-A2.1 allele as demonstrated using CTL specific for adenovirus-associated tumors in mice (Toes et al, 1996).
  • This type of allogeneic therapy might allow for selective killing of host leukemia without the requirement of a traditional bone marrow transplant and without the requirement of a fully HLA-matched donor.
  • EXAMPLE 8 IDENTIFYING POTENTIAL HLA-A2.1-RESTRICTED PEPTIDE EPITOPES IN PR3 TO ELICIT LEUKEMIA-REACTIVE HUMAN CTL USING IMMUNOLOGICAL METHODS
  • PRl peptide seven additional peptides within Pr3 have been identified that contain the HLA- A2.1 binding motif (Table 4, PR3-PR9). These peptides have been identified to 95% purity
  • A2.1 expression on peptide-coated T2 cells using methods previously described. These peptides will be used to elicit CTL where peptide-coated T2 cells are radiated, pulsed with peptide, and used to stimulate PBMC from normal donors. These resultant CTL lines will be tested first for peptide-specific recognition of peptide-coated T2 cells (compared to non-coated T2), and then for lysis of fresh HLA-A2.1+ BMC from leukemia patients (compared to BMC from normal
  • HLA-A2.1+ donors Blocking studies with antibody to HLA-A2.1 (BB7.2) and irrelevant Flu peptide-coated T2 cell targets will be used to confirm the allele-specificity in cytotoxicity assays.
  • the relative binding affinities to HLA-A2.1 of these peptides compared to PRl will be determined by incubating serial dilutions of PRl plus each peptide with T2 cells and analyzing for surface HLA-A2.1 expression by flow cytometry. In this way, an IC 0 value will be determined for each peptide.
  • leucine and methionine or valine and leucine will be substituted for the existing amino acids and these peptides will be used to elicit CTL immunity again using T2 cells.
  • These amino acids are known to be relevant for high affinity binding to the HLA-A2.1 allele (Rammensee et al, 1995), and substitution of anchor amino acids has been shown to increase CTL lysis of the peptide-coated target cell (Parkhurst et al, 1996), presumably because of more stable binding of the peptide to the MHC class I heavy chain (Sette et al, 1994).
  • Peptides that do not elicit any immunity will be considered not to be within the TCR repertoire of the donor PBMC.
  • peptides will be synthesized (Biosynthesis Co.), tested for HLA-A2.1 binding using T2 cells, and tested in the mini-cytotoxicity assay where specific lysis will be compared to native PRl-coated T2 cells using TCL that are PRl-specific.
  • the PRl-specific bulk culture CTL will be generated using the methods described herein. If any additional HLA-A2.1 -binding peptide from Table 10 is found that can be used to generate CTL responses, then combinations of PRl with this peptide will be used to coat T2 target cells to test for specific lysis.
  • T2 cells Using CTL specific for this peptide, T2 cells will be coated with a fixed concentration of the peptide at 10 ⁇ g/mL, plus serial dilutions of PRl (0.1 to 50 ⁇ g/mL) to test for potential interference with TCR recognition, as measured by reduced specific lysis at fixed E:T ratios.
  • PRl 0.1 to 50 ⁇ g/mL
  • the results of these experiments plus the IC 50 of each of the peptides will be used to make comparisons of which are the possible dominant and subdominant peptides. This will be used to develop vaccines using combinations of peptides to stimulate CTL immunity (Nestle et al, 1998).
  • PRl-specific CTL that are obtained after PRl-tetramer sorting will be studied for their ability to recognize and lyse the PRl -variant peptide-coated T2 cells. Because these cells are a much more homogeneous population of CTL, they are expected be a more sensitive indicator of improved CTL immunity.
  • HLA-A2.1-restricted peptides spanning the known single amino acid polymorphism in Pr3 can be used to elicit CTL immunity from the PBMC of donors that possess the opposite polymorphism.
  • a polymo ⁇ hism in the third exon of Pr3 was found that encodes for a single amino acid difference in peptides that can bind with high affinity to HLA-A2.1.
  • the amino acid difference does not involve HLA-A2.1 the anchor regions, but it likely involves the region of the peptide recognized by the TCR.
  • This polymo ⁇ hism may therefore represent a new minor antigen that is restricted to hematopoietic tissue, and provide an ideal target for allogeneic adoptive immunotherapy strategies.
  • these two peptides will be synthesized and used to coat T2 cells for in vitro immunization of PBMC derived from the donors already known to have the opposite polymo ⁇ hism using the methods to generate PRl reactivity.
  • the resulting CTL lines will be tested for specific lysis of T2 cells pulsed with either the original or the polymo ⁇ hic peptide.
  • These peptides will also be evaluated for lysis of leukemia cells from patients that have previously been determined to contain the opposite polymo ⁇ hism.
  • HLA-A2.1 blocking studies will confirm A2.1 -restriction, and irrelevant Flu peptide will confirm peptide specificity.
  • Lysis of these leukemia target cells without lysis of autologous marrow progenitors will demonstrate PR7I and PR7V as the first potential new minor antigens found in humans.
  • PR7I and PR7V the first potential new minor antigens found in humans.
  • several PBMC donors will need to be studied since not all individuals would be expected to have T cells capable of recognizing the peptide.
  • controls where CTL are elicited against the autologous PR7 peptide from the donors that contain that polymo ⁇ hic peptide will need to be compared to CTL elicited from the donors that do not carry the polymo ⁇ hism.
  • the PRl-tetramer could be used to select for a homogeneous population of leukemia-reactive CTL and may allow for the first time the adoptive transfer of CTL against MHC barriers to treat leukemia(Toes et al, 1996a).
  • EXAMPLE 9 ANTIGEN PRESENTING CELLS (APC)
  • APC ANTIGEN PRESENTING CELLS
  • PBMC from 38 HLA-A2.1+ CML patients at different stages of disease and 5 healthy volunteer donors were obtained and and cryopreserved. Diagnosis of CML was defined by 100% Ph+ cells in bone marrow aspirates from all patients prior to treatment. Ten patients received chemotherapy alone, including hydroxyurea, cytarabine, cyclophosphamide, and topotecan. Nineteen patients received IFN- ⁇ 2b-based therapies, which consisted of IFN alone (6 patients) or combined with the chemotherapeutic drugs cytarabine and homoharingtonine (13 patients). Nine patients received an HLA-identical allogeneic BMT from a related donor.
  • the specificity of the PR1/HLA-A2 tetramer was demonstrated by its ability to stain a PRl-specific T cell line at 4°C that was derived from a healthy HLA-A2.1+ donor, but not from a CMV-specific line derived from the same donor (data not shown). None of the 10 patients that received chemotherapy alone without IFN and none of 5 HLA-A2.1+ healthy volunteer donor control samples had detectable PRl-specific CTL. Although one patient treated with chemotherapy alone had a response, no PRl-specific CTL were detectable (Table 11) by tetramer staining. Similarly, there were no detectable PRl- specific CTL in HLA-A2.1+ PBMC from three patients with multiple myeloma and two patients with newly diagnosed breast cancer that had received IFN. Table 11: Patient Characteristics
  • PRl-specific CTL with high and low TCR avidity can be elicited from healthy donors.
  • a modified tetramer staining technique (Savage et al, 1999) using limiting tetramer concentration to visualize high and low fluorescence intensity tetramer+ cells, which correlates with high and low TCR avidity was utilized.
  • Sufficient PRl -CTL was elicited by stimulating PBMC with increasing peptide concentrations for 28 days.
  • MCF median channel of fluorescence
  • PBMC stimulated with 2 ⁇ M PRl elicited PR1-CTL with intermediate TCR avidity (MCF 211).
  • Total TCR-ab expression was comparable for cells elicited with 0.2, 2.0, or 20 ⁇ M PRl, suggesting that differences in tetramer staining were not due to differences in TCR expression level.
  • Cultures stimulated with 2 ⁇ M PRl produced fewer PRl-specific CTL with mixed TCR avidities, while stimulation with ⁇ 0.02 ⁇ M PRl induced ⁇ 0.1% PRl -CTL.
  • PRl -CTL elicited with low (0.2 ⁇ M) PRl showed higher specific lysis of PRl -pulsed T2 target cells than PRl -CTL elicited with high (20 ⁇ M) PRl concentration (closed circles), when both were normalized at an E:T of 10:1 based on the total number of PR1/HLA- A2 tetramer+ events in the CTL cultures (FIG. 11C).
  • tetramer staining intensity correlates with TCR avidity
  • the kinetics of tetramer staining decay was determined using previously described techniques (Savage et al, 1999).
  • PRl -CTL elicited with either low (0.2 ⁇ M) or high (20 ⁇ M) PRl concentrations for 4 weeks were incubated with PR1/HLA-A2 tetramer and saturating concentration of BB7.2 anti-HLA-A2 monoclonal antibody to prevent rebinding. Normalized total fluorescence was measured at 4°C at the appropriate time points and linear tetramer staining decay plots were obtained, indicating tetramer staining half-lives (t 2 ) should be proportional to the t of the respective TCR peptide/HLA-A2 complexes (FIG. 1 ID).
  • PR1-CTL elicited with low (0.2 ⁇ M) PRl showed a 3-fold longer t 1/2 than PR1-CTL elicited with high (20 ⁇ M) PRl (58 vs 19 min), which correlates with overall high and low tetramer fluorescence (FIG. 11 A), respectively, and validates the use of overall tetramer fluorescence intensity to indicate relative TCR avidity.
  • Spectratype from high and low avidity PRl-specific CTL cultures supports unique clonal derivation.
  • PRl -CTL lines derived from a healthy donor or from patients with CML were tested for the ability to kill HLA-A2+ CML target cells from a patient with blast crisis CML, autologous chronic phase CML cells from patient CML #3 at time of diagnosis, or cells from healthy donors.
  • PRl -CTL derived from the healthy donor with high or low avidity were each combined with either bone marrow (BM) from the patient with CML or BM from the patient's healthy HLA matched sibling in a 4-hr cytotoxicity assay.
  • CTL from patients CML #1 and CML #2 elicited with 0.2 ⁇ M PRl showed lysis of CML #3 BM cells of 24% ⁇ 5% and 33% ⁇ 6%, respectively, at an E:T ratio of 20:1.
  • High avidity PRl-specific CTL are present only in interferon sensitive CML patients in cytogenetic remission. It was previously shown that detection of functional PR1- CTL in CML patients correlates with a cytogenetic response to interferon- ⁇ (Molldrem et al, 2000). This suggested that high avidity PR1-CTL would only be present in IFN-sensitive patients.
  • PBMCs from untreated HLA-A2 + patients with either blast crisis (CML # 1) or chronic phase CML (CML # 2) or a patient with chronic phase treated with IFN-G! for 3 months (CML # 3) were stimulated weekly with PRl.
  • CML # 1 blast crisis
  • CML # 2 chronic phase CML
  • CML # 3 a patient with chronic phase treated with IFN-G! for 3 months
  • low avidity PRl -CTL could be identified in the interferon resistant patients, but totaled less than 0.1% of CD8+ cells.
  • PBMC from untreated HLA-A2+ patients with either blast crisis (CML #1) or chronic phase CML (CML #2) or a patient with chronic phase treated with interferon- ⁇ for three months (CML #3) were stimulated weekly with PRl. Only low avidity PRl -CTL could be elicited from any of the three patients. This suggests that low numbers of high avidity PR1-CTL may be sufficient to contribute to cytogenetic remission in interferon sensitive patients, but leaves unanswered whether high numbers of low avidity PRl -CTL may contribute to remission.
  • High PRl concentration and proteinase 3-overexpressing CML cells induce apoptosis of high avidity PRl-specific CTL.
  • Previous studies showing that high affinity virus- specific T cells are eliminated by target cells infected with a high viral load (Alexander-Miller et al, 1998; Alexander-Miller et al, 1996a), and that CML cells frequently overexpressed proteinase 3 ((Molldrem et al, 1996; Molldrem et al, 1997), suggested that high avidity PR1- CTL might be undetectable in untreated CML patients due to selective elimination by CML cells that overexpress the target antigen.
  • Apoptosis was abrogated in the presence of the BB7.2 blocking antibody to HLA-A2.1, and no apoptosis was observed when 20 ⁇ M of the irrelevant peptide Flu was used instead of PRl.
  • low avidity PRl -CTL did not undergo apoptosis when challenged with either high or low concentrations of PRl.
  • co-incubation studies were performed with HLA matched BM cells from CML patients followed by staining for Annexin N, for 16 to 18 hr after co-incubation.
  • High avidity PRl -CTL underwent apoptosis by 18 hr after co-culture with BM from an HLA-matched patient with CML in chronic phase with 100% Ph+ cells (FIG. 17A).
  • No apoptosis was induced by co-incubation with BM cells from an HLA-A2 negative CML patient with 100% Ph+ cells, or by co-incubation with BM cells from an HLA-A2+ healthy donor.
  • less than 1% of the low avidity PRl -CTL underwent apoptosis when challenged with either the HLA-A2+ or HLA-A2- CML cells (FIG. 17B).
  • the only high affinity PRl -CTL were CD45RA+/CD28+/CCR7+/CCR5-, indicating an effector memory or possibly a naive phenotype.
  • PRl peptide vaccine can elicit PR1-CTL immunity in patients with myeloid leukemia.
  • Preliminary data suggesed that in myeloid leukemia patients in whom a PRl-specific CTL immune response could be elicited or increased, PRl -CTL would convey an anti-leukemia immune response and contribute to remission.
  • phase I/II vaccine study was initiated.
  • HLA-A2 + patients with CML (interferon-resistant or relapsed after BMT), AML (smoldering relapse or > 2nd CR) or MDS (RAEB or RAEBt) with no detectable antibodies to proteinase 3 (no detectable cANCA) were eligible.
  • Patients that relapsed after BMT or those ineligible for BMT were also eligible for study.
  • Pregnant patients, HIV+ patients, and those with known vasculitis were excluded.
  • Primary endpoints were (1) toxicity assessment including the induction of autoimmunity resembling Wegener's granulomatosis, the systemic vasculitis associated with cANCA antibodies; and (2) induction of an immune response assessed by cytokine flow cytometry (CFC) of ⁇ -JFN and PR1/HLA-A2 tetramer staining of PBMC before and 3 weeks after the last vaccination.
  • CFC cytokine flow cytometry
  • clinical responses were assessed by standard criteria with bone marrow biopsy, cytogenetic studies (standard chromosome banding) and molecular studies (PCR for bcr-abl or other known abnormalities such as t(15;17), invl ⁇ , etc.) 3 weeks after the last vaccination.
  • Phase I consisted of nine patients treated in cohorts of three at 1 of 3 dose levels of 0.25 mg, 0.5 mg, or 1.0 mg of PRl peptide given subcutaneously in incomplete Freund's adjuvant (Montanide ISA-51) and GM-CSF 75 mg subcutaneously every 3 weeks for 3 injections.
  • Any dose level would be discontinued if the number of patients with grade 3 or 4 toxicity, divided by the number of patients evaluated for toxicity, is greater than or equal to 3/4, 4/8, 5/12 or 6/16. Any dose level would be terminated if none of the first 12 patients in that dose level have an immune response. If an immune response was noted, patients would continue to be entered onto that dose level, by continued randomization, to a maximum of 20 patients per dose level. If any clinical response was noted during the study period either with or without a measurable immune response, this would be considered an efficacy endpoint and patients would be entered onto that dose level to a maximum of 20 patients per dose level.
  • a grade 2 cutaneous injection reaction was noted in one patient (UPN13, FIG. 20) at dose level 3 by two weeks after the first injection, which resolved after 1 week, and mild fatigue was noted in 4 patients.
  • Skin biopsy from UNP13 showed a perivascular lymphocytic infiltrate and PR1/HLA- A2 tetramer staining confirmed that 65% of CD8+ lymphocytes were PRl-specific, demonstrating a localized immune response (FIG. 20).
  • Immune response defined as a > 2-fold increase in the percentage of tetramer+ PRl -CTL, was noted in 8 of the 15 patients (FIG. 21).
  • Vaccine-induced PR1-CTL contribute to cytogenetic remission.
  • PR1- CTL induced remission cells were examined from UPN4, a 27-year-old man with APL in 4th relapse previously treated with allogeneic BMT and 3 escalating doses of DLI who separately consented to have PBMC collected by leukapheresis (LP) one month after the last vaccination.
  • LP leukapheresis
  • Donor-derived PR1-CTL increased from 0.1% to 0.54% after the 3rd vaccination, and were enriched for effector memory CD45RA+/ CD28+/CD57- donor-derived CTL (by PCR microsatellite analysis), which correlated with loss of t(15;17) transcripts by RT-PCR 6 weeks after the first vaccination(FIG. 24A).
  • PRl -CTL persist at 0.2% 22 months after completing the vaccinations.
  • Tetramer sort-purified PRl -CTL obtained after vaccination showed PRl specificity against peptide-pulsed T2 cells, and 44% lysis of the BMC collected at time of relapse versus only 14% lysis of BMC taken at time of remission, at E:T 10:1 (FIG. 24B).
  • PRl -CTL immunity was elicited at the time of 2nd relapse.
  • This 32-year-old man received an autologous transplant while in 2nd remission and had no evidence of AML by FISH using probes for invl ⁇ .
  • his platelet count fell to 24,000 and he had invl6 by FISH (FIG. 25).
  • dose level 1 dose level 1
  • T cell tolerance from loss of high avidity PR1-CTL and downregulation of P3 antigen correlates with progression of CML after vaccination.
  • UPN ⁇ a non-responder, was found to have both high and low avidity PRl -CTL prior to vaccination with 0.5 mg of PRl, but only low avidity PRl -CTL 3 weeks after the last injection (FIG. 27).
  • PRl/ HLA-A2 tetramer-sorted CTL showed peptide-specific lysis of T2 cells pulsed with 20 ⁇ M PRl that was similar to PRl -CTL from UPN4 that produced nearly equivalent lysis (on a per cell basis) of T2 cells pulsed with only 2 ⁇ M PRl.
  • UPN6 received the same peptide dose as the responder UPN4 during vaccination, this dose was sufficient to eliminate the high avidity PR1- CTL and allow outgrowth of CML.
  • Monocyte-derived dendritic cells can expand autologous PRl-specific CTL and PR1/HLA-A2 monomers can be used to select PR1-CTL for adoptive immunotherapy.
  • Another central aspect of this invention is that CTL that contribute to GVL and those that cause GVHD after allogeneic bone marrow transplantation (BMT) target unique antigens.
  • BMT allogeneic bone marrow transplantation
  • PRl-specific CTL could be identified in the peripheral blood of BMT recipients that were in cytogenetic remission using soluble peptide/MHC tetramers to stain peripheral blood mononuclear cells. More recently, the inventors have studied the peripheral blood of AML patients that received of nonmyeloablative stem cell transplant (NST) regimens for evidence of PRl -CTL. Patients were studied around day 60 post-NST using HLA-A2 tetramers folded with different peptide epitopes to determine whether immunity directed against minor histocompatibility antigens such as HA-1 coexisted with immunity against self peptides such as PRl.
  • NST nonmyeloablative stem cell transplant
  • DC expanded from peripheral blood monocytes were employed using both interferon- ⁇ 2b (IFN) and GM-CSF, as these cells would be useful as peptide-pulsed APC to expand antigen-specific T cells (Santini et al, 2000).
  • DC expanded for 7 days were compared using IFN (1,000 U/ml) and GM-CSF (500 ng/ml) versus DC expanded for 7 days with IL-4 and GM-CSF.
  • the yields of PRl-specific CTL from autologous PBMC were compared using each of these APCs from 7 healthy HLA-A2+ donors (FIG. 30).
  • PBMC from each of the patients were stimulated weekly with PRl peptide-pulsed T2, IFN + GM-CSF-treated DC (DC/IGM) or IL-4 + GM-CSF-treated DC (DC/4GM).
  • DC/IGM IFN + GM-CSF-treated DC
  • DC/4GM IL-4 + GM-CSF-treated DC
  • the inventors have shown that patients with CML that have a cytogenetic response to IFN- ⁇ or that are in remission after allogeneic BMT have circulating cytotoxic T lymphocytes (CTL) with specificity for the HLA-A2 restricted peptide PRl.
  • CTL cytotoxic T lymphocytes
  • the PRl -CTL show peptide- specific lysis of leukemia and are long-lived in some patients. Although this shows that PR1- CTL may be important in clearing the malignant cells, it is not clear whether PRl -CTL developed in response to the malignancy and are sufficient for the elimination of it.
  • PR1-CTL from UPN4 showed 49% specific lysis of CML bone marrow (BM) cells obtained prior to BMT compared to only 27% specific lysis by the tetramer- CTL at E:T 10:1.
  • PRl -CTL from UPN4 showed 44% lysis of BM at time of relapse versus only 14% lysis of BM taken at time of remission.
  • the CD8 + PRl /HLA- A2 tetramer negative cells showed only 25% and 6% lysis of relapse and remission BM, respectively, at E:T 10:1.
  • CTL CTL with high avidity T cell receptors ex vivo.
  • PRl -CTL preferentially kill leukemia over normal BM due to P3 overexpression, and because P3 is only expressed in hematopoietic tissue, it was indicated that adoptively transferred PR1-CTL will produce GVL without GVHD. It has also been shown that high avidity PRl -CTL are more efficient killers of leukemia cells, although they may also undergo apoptosis when incubated with highly P3-expressing leukemia cells.
  • PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines.
  • T2 cells were maintained in RPMI + 10% HS prior to co-culture with donor PBMC.
  • DC were pulsed with 20 ⁇ g/ml PRl peptide, irradiated and combined with fresh PBMC from the same donor at a 1 :2 ratio.
  • the culture was restimulated with PRl -pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures.
  • AAPC AAPC
  • HLA-A*0201 heavy chain and ⁇ 2- microglobulin were each produced in E. coli and the expressed protein was folded in vitro in the presence of PRl. Folded monomeric complexes were purified by gel filtration and ion exchange.
  • the PR1/HLA-A2 monomers were then mixed with dioleolyl phosphatidylcholine (DOPC) (Avanti Polar Lipids), at molar ratios of 1:100, 1:500 or 1:1000, frozen in dry ice/acetone bath, and lyophilized overnight to remove organic solvent.
  • DOPC dioleolyl phosphatidylcholine
  • the lyophilized product was stored at — 20°C and then hydrated in PBS buffer and vortexed vigorously before use.
  • T2 cells were incubated with PR1 HLA-A2 AAPC (1:100, 1:500, and 1:100 molar ratio) for 3 hr and 24 hrs. After incubation, the cells were surface stained with murine anti-HLA-A*0201 monoclonal antibody BB7.2 and secondarily stained with FITC-labeled goat anti-mouse antibody, and observed under the confocal fluorescent microscope to determine proper insertion of PRl /HLA- A2 into the artificial membrane.
  • Typical yields of antigen-specific tetramer+ cell numbers are 3% to 5% PR1-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to HA-1 and other putative target antigens of GVL (WT-1), but all of the comparative experiments will be repeated using these peptides.
  • serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures.
  • pooled human AB serum was nearly equivalent to FBS as a supplement to media used to expand DC/ IGM that could then be used as peptide-pulsed APC to expand PRl- CTL (FIG. 32).
  • a particular aspect of this study is to first determine the conditions that produce the highest numbers of functional high avidity PRl -CTL in the shortest period of time. Once conditions are optimized and the scale-up experiments show feasibility, an adoptive immunotherapy study will begin using PRl -CTL generated ex vivo. Weekly tetramer staining during bulk culture restimulations will be used to compare yields and avidity of PRl -CTL, and CFC and cytotoxicity experiments will be used to compare the effector function of the cells. Secondly, two methods to select antigen-specific CTL from bulk culture will be compared.
  • PRl -CTL will be selected from the bulk cultures using methods described below.
  • the use of high-speed flow cytometry will verify separate antigen-specific CTLs using soluble peptide/MHC tetramers.
  • PRl -CTL can be separated from the remainder of CD8+ lymphocytes, and these sorted cells can efficiently kill leukemia cells (FIGS. 24B and 27).
  • a dose of 0.9 x 10 6 PRl-CTL/kg could be adoptively transferred to the average 70 kg 5 recipient.
  • the cell purity was > 90% and the efficiency was > 95%.
  • the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen-specific CTL.
  • PRl -pulsed CTL quantified with a PRl -HLA- A2 tetramer conjugated to phycoerythrin (PE), comprised 2% to 8% of the culture.
  • PE phycoerythrin
  • a method using streptavidin-coated microbeads was developed and optimized. Beads were conjugated with HLA-A2.1 heavy chain plus PRl myeloid leukemia peptide via a biotin-labeled C-terminus of the heavy chain.
  • PRl -pulsed short-term CTL lines were incubated for 30 min with PR1/HLA-A2 coated microbeads and were selected using the magnetic MACS column. Bead-selected and non-selected CTL were quantified by FACSO analysis using the PR1-HLAA2 tetramer and compared to the initial polyclonal CTL lines. Yields ranged from 85% to 100%, and PRl-specific CTL purity ranged from 11% to 21% after selection (3- to 5-fold increase in purity of antigen-specific CTL). Specific lysis of both PRl- coated T2 cells and CML marrow cells increased in all 6 cultures and background lysis of normal HLA-A2.1 normal marrow was eliminated compared to non-selected PRl-specific CTL.
  • Another aspect of the invention is to enhance GVL and reduce GVHD by using a preparative regimen to achieve engraftment of transplanted allogeneic blood stem cell or bone marrow, which can then be used as a platform to deliver antigen-specific CTL therapy. It was postulated that GVHD could be eliminated and GVL enhanced by adoptively transferring antigen-specific T cells with preferential GVL activity.
  • PRl -CTL By skewing the ex vivo culture conditions with low doses of PRl as shown in the preliminary results, high avidity PRl -CTL will preferentially be expanded from the donors. These cells will be infused into PCR+ donors after 4 weeks of expansion at escalating doses starting at l x l0 , 5 x l0 and 1 x 10 bulk CTL/kg of recipient weight. At 4 weeks of culture, the bulk PRl -CTL cultures contain from 1.5% to 4% PRl- specific CTL, as observed, by tetramer staining and functional analyses, and based on expansions perviously performed.
  • LP leukapheresis products
  • APC cryopreserved aliquots of LP
  • PRl peptide at 0.2 mM
  • PRl -CTL bulk cultures Two leukapheresis products (LP) will be required to (1) elicit sufficient DC/IGM as APC (from cryopreserved aliquots of LP), which will be pulsed with PRl peptide at 0.2 mM to (2) elicit PRl -CTL bulk cultures.
  • Clinical-scale expansions will be performed before the adoptive cellular therapy trial with PRl -CTL is begun.
  • Quantitative PCR for bcr-abl/abl transcript ratios will be performed monthly to determine whether there is disease progression. If the ratio is increased by > 2-fold and if the patient has GVHD of ⁇ 2, then the next higher dose of bulk PRl -CTL will be infused.
  • an unmanipulated DLI from the original donor will be infused at a dose of 1 x 10 CD3 T cells/kg.
  • patients will be monitored monthly until there is no increase for 2 consecutive months. In this way, dose escalations within each patient and amongst cohorts of 3 patients each will be carried out. If patients develop > grade 2 GVHD after the first PRl -CTL infusion, then a selected PRl -CTL infusion will be given in escalating doses starting at 1 x 10 5 , 5 x 10 5 and 1 x 10 6 PRl -CTL/kg of recipient weight.
  • PR1-CTL The exact number of PR1-CTL will be determined by tetramer staining, and the PR1-CTL will be selected based on the optimal method determined above, h preliminary experiments, it was shown that peptide/tetramer-coated microbeads, in addition to PR1/HLA-A2 tetramer-based high speed cell sorting using the MoFlo cytometer can be used to enrich for a highly purified PRl -CTL population. Since patients that receive PRl -CTL might have an initial rise in tetramer cells and a simultaneous clinical response, it is possible they could lose immunity and suffer a relapse. This has been shown for a number of adoptive immunotherapy trials using T cells.
  • the protocol of the clinical trial will contain a provision for patients to receive the PRl vaccine at a dose of 0.25 mg SQ every 3 weeks for 3 injections, the dose and schedule that has elicited long- lasting PRl-CTL after vaccination.
  • the overall percentage of functional PRl-CTL in the recipients will be determined by tetramer staining and standard CFC assays.
  • the number of pp65-CTL in CMV immune patients will provide an internal control to determine whether the number of PRl-CTL is increased after infusion and whether those cells are long- lived.
  • the restorative immunity of unmanipulated DLI will be compared with that of patients receiving adoptively transferred PRl-CTL by determining TREC numbers, CD4 and CD8 counts, and the percentage of CFC+ cells. Based on the findings in the PRl vaccine trial, the quality of the PRl-CTL response, measured by both TCR avidity and function, is perhaps more important to produce a remission than the more simple measurement of the quantity of PRl-CTL.
  • the avidity of the PRl-CTL that exist will be compared in (1) the donor product, (2) the recipient prior to transplant and prior to CTL infusion, and (3) the recipient at time points after infusion using limiting doses of tetramer to stain PBMC.
  • This method will be compared to tetramer dissociation half times to confirm the validity of the measurements, hi addition, an aliquot of the PRl-CTL product will be used to study whether the high avidity PRl- CTL preferentially kill the patient's CML by using BM target cells cyropreserved prior to BMT, prior to CTL infusion and BM cells taken at time of molecular remission in a standard cytotoxicity assay.
  • peptide dose-response CFC assays will be performed, as shown in FIG. 11C for the patients that do not have sufficient cells that can be used as targets in a standard cytotoxicity assay.
  • the adoptive transfer of antigen- specific CTL clones does not result in long-lived immunity (Riddell et al, 1992)
  • vaccination with the PRl peptide does result in long-lived PRl-CTL for up to two years.
  • This apparently contradictory result may be because the PRl-specific response is not confined to a single clone.
  • the adoptive transfer protocol of the clinical trial will involve a broader oligo-clonal PRl- CTL repertoire expanded ex vivo.
  • PRl-CTL PRl-CTL
  • TCR avidity with those of circulating PRl-CTL.
  • PRl-CTL GVHD effector cells may be allo-antigen-independent, host APC are instrumental and maybe required to initiate GVHD (Teshima et al, 2002; Shlomchik et al, 1999).
  • PRl is a self-antigen, it is suggested that PRl-CTL at sites of GVHD would have lower avidity TCR than circulating PRl-CTL, which would potentially allow more cross-reactivity with other peptide ligands and less specificity for the PRl ligand.
  • the frequency and avidity of HA-Y-specific CTL in the skin and blood of recipients of sex-mismatched transplants will be determined and compared to the PRl-CTL. It will be determined whether deletional tolerance of the high avidity PRl-CTL occurs after adoptive transfer and compare this to clinical outcome. It is expected that the selective loss of high avidity PRl-CTL will result from the persistence of CML cells with high P3 expression relative to the P3 expression in BM cells from patients that retain high avidity PRl-CTL and who may be in clinical remission.
  • Deletional tolerance will be determined by comparing the relative disappearance of relatively high and low avidity PRl-CTL after transfer and comparing any disproportionate disappearance of the high avidity PRl-CTL to the rate of disappearance of high avidity pp65-CTL in CMV-immune patients.
  • CML escape from PRl-CTL immunity may be due to additional mechanisms such as decreased expression of the P3 antigen. Therefore, the amount of P3 expression in the recipient BM and PBMC will be determined by real-time PCRTM and by flow cytometry and compared to the healthy donors. Data regarding general immune status in each of the patients, will serve as a baseline for comparing the specific high avidity PRl-CTL within and amongst patients.
  • the phenotype data will allow for the comparison of the differentiation state of the PRl-CTL, since an altered maturation phenotype to a terminally differentiated state would be expected to result in ineffective anti-CML immunity.
  • TCR-V ⁇ spectratyping followed by repetitive sequencing of restricted TCR-V ⁇ families will be performed in selected patients.
  • PRl peptide vaccine can be used to elicit PRl-CTL immunity in patients with minimal residual disease after autologous bone marrow transplant or after imatinib mesylate (Gleevec) and interferon.
  • the preliminary results have shown no development of Wegener's granulomatosis or other vasculitis thus far, with only grade 2 toxicity seen in one patient. None of the 3 doses tested were eliminated due to toxicity, and the combined data shows evidence for both immune responses and clinical responses.
  • the breadth of the PRl-specific TCR repertoire may increase as well after vaccination, which may reflect a more robust and sustainable immune reaction to the peptide and therefore against the leukemia.
  • the post-transplant PRl vaccine will be given to recipients of autologous transplantation for CML who have progressive disease and are without a suitable allogeneic donor.
  • the clinical trial will also determine whether PRl vaccination will induce high avidity PRl-CTL and increase leukemia-free survival in HLA-A2+ patients compared to those without the HLA-A2 allele not given the vaccination (a biological randomization). Based on previous studies, it is expected that no impact of the HLA-A2 allele on outcome in chronic myeloid leukemias will be observed (Cortes et al, 1998).
  • Patients with HLA-A2 will be randomized to receive one of three dose levels of PRl peptide (0.25 mg, 0.50 mg, and 1.0 mg) given as three injections every 3 weeks.
  • the PRl peptide will be dissolved in water and mixed with a fixed dose of incomplete Freund's adjuvant (Montanide ISA-51).
  • GM- CSF 75 mg will be administered as a second injection into the same site as the vaccine.
  • PRl-CTL TCR avidity will be determined by using limiting dilutions of MHC-I tetramers, and a titer that produces maximal fluorescence intensity separation of a "high” and "low” intensity population, as discussed previously, will be established for each batch of reagent.
  • TCR-V ⁇ spectratype will be performed on selected patients in whom the number of PRl-CTL has either increased or decreased by 2-fold or greater to learn whether the breadth of the peptide-specific TCR repertoire has changed.
  • Peptide doses ranging from 0.2 ⁇ M to 200 ⁇ M will be used to compare the activation threshold of the CTL and this will be compared to TCR avidity measured with tetramer.
  • the HLA-A2 -restricted pp65 peptide antigen will be used to compare activation threshold and TCR avidity of the respective peptide-specific CTL. That PRl peptide elicits high avidity PRl-CTL in recipients of autologous BMT predicts that pp65-specific CTL will not change the overall avidity after PRl vaccination. If the avidity is noted to increase, however, it may reflect more general changes in the TCR repertoire in those patients that receive transplant.
  • the avidity to CTL from patients that have not received transplant will be compared.
  • An alternative is that the PRl peptide may fail to elicit any PRl-CTL responses due to nonresponsiveness or anergy. This will be evaluated by measuring surface expression of CD80, CD86, CD28, CTLA-4, and HLA-A2 and HLA-DR expression on BM cells and PRl-CTL. hi addition, P3 expression in the BM before and after vaccination will be compared. In addition; whether overexpression of P3 in leukemia cells leads to susceptibility to PRl-CTL-mediated lysis of the leukemia cells, and also preferentially induces apoptosis of high avidity PRl-CTL over low avidity PRl-CTL will be tested.
  • BM and PBMC will also be examined to compare any differences in TCR avidity and P3 expression between the two compartments since BM is the site of a larger number of leukemia cells and high avidity PRl-CTL may be absent in the marrow but still be present in PBMC.
  • cause and effect are more difficult to establish in patients compared to animal models where parameters can be more easily manipulated to establish that P3 overexpression in leukemia induces selective loss of high avidity leukemia- specific T cells, it is expected that these experiments are likely to yield important insights into the nature of tolerance since the antigen is well-defined, the tools are established and the patient samples necessary to conduct the experiments are avaiable.
  • JFN induces P3 expression in myeloid cells. This increased expression may alter susceptibility to PRl-CTL- mediated killing, but it may also cause apoptosis of the PRl-CTL.
  • IFN preferentially upregulates P3 only in the patients that achieve cytogenetic remission after treatment with IFN, and in whom a high avidity PRl-CTL immune response is noted by tetramer staining (FIG. 33). This may be inte ⁇ reted to mean that P3 overexpression does not lead to selective loss of high avidity PRl-CTL.
  • IFN-transduced mesenchymal stem cells MSC
  • increased expression of P3 after induction of IFN expression may increase susceptibility to immune attack by P3-specific T cells, while at the same time leading to their ultimate extinction by apoptosis.
  • the PRl vaccine administered as 3 injections every 3 weeks as previously described, will induce a PRl-CTL response and whether the vaccine induces cytogenetic and molecular responses in CML patients that are refractory to imatinib mesylate (Gleevec) will be determined. It is expected that the PRl vaccine will induce PRl-CTL in patients that are refractory to imatinib and improve cytogenetic remissions in those patients. It is also expected that potential downregulation of P3 by treatment with imatinib may facilitate expansion of high avidity PRl-CTL induced by the vaccine.
  • Patients will be randomized on the basis of HLA-A2 expression to receive IFN alone versus PRl peptide with or without IFN in patients with 10% to 90% Ph+ disease after 9 months of imatinib therapy.
  • P3 in BM samples cryopreserved at the time of diagnosis (when available) will be quantified and compared to the time of study entry, and again 3 weeks following the vaccine.
  • the P3 expression in vaccine recipients will be compared to patients that receive IFN alone or IFN plus PRl. Because imatinib down-regulates P3 while IFN upregulates P3 expression, it is not possible to predict which mechanism might prevail to alter P3 expression.
  • MPO Myeloperoxidase
  • MY4-specif ⁇ c CTL show preferential cytotoxicity toward allogeneic HLA-A2.1+ myeloid leukemia cells over HLA-identical normal donor marrow (Braunschweig et al, 2000). MY4-specific CTL also inhibit colony forming unit granulocyte- macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA- matched donors. Like PRl, MY4 is therefore a peptide antigen that can elicit specific CTL lysis of fresh human myeloid leukemia cells. Other peptides from MPO are predicted to bind to HLA- A2.1, but not all of these have been tested for their potential to stimulate immunity.
  • CFU-GM colony forming unit granulocyte- macrophage
  • LAA leukemia-associated antigen
  • the peptides were synthesized by Biosynthesis (LewisviUe, TX) or by the M. D. Anderson Protein CORE Facility (Houston, TX) to a minimum of 95% purity as measured by high-performance liquid chromatography (HPLC). Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and 2 genes and cannot therefore present endogenous MHC class I restricted antigens.
  • HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CALTAG) was used to measure surface expression of HLA-A2.1.
  • BB7.2 HLA-A2.1 specific monoclonal antibody
  • CAG FITC-labeled secondary antibody
  • the dissociation rate of I 125 -labeled ⁇ 2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and ⁇ 2-microglobulin was measured, which allowed calculation of binding half-life (t ⁇ /2 ).
  • the labeled heterotrimer complex was separated from uninco ⁇ orated ⁇ 2-microglobulin by high-performance liquid
  • MPO peptides predicted to bind HLA-A2.1 chromatography gel filtration, and the halftime of disassociation of ⁇ 2-microglobulin were determined by subjecting aliquots of the complex to a second round of gel filtration.
  • the control peptides are the PRl peptide and an Influenza B nucleoprotein (aa 85-94; Flu), both with known high binding affinity to HLA-A2.1.
  • the long measured ty 2 as measured using ⁇ 2-microglobulin disassociation confirmed the binding of MY1 through MY5 to HLAA2.1 (Molldrem et al, 1996).
  • EXAMPLE 13 INDUCTION OF PRIMARY CTL RESPONSES TO PEPTIDES The five MPO peptides discussed above, were used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL.
  • T2 cells which co-express the costimulatory molecule B7.1
  • CM penicillin/streptomycin and glutamine
  • peptide concentrations ranging from 0.2 to 200 ⁇ g/mL for 2 hr in CM.
  • the peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO).
  • HS human serum
  • rhIL-2 human interleukin-2
  • Biosource International Camarillo, CA
  • FIGS 35 and 36 show the peptide specific lysis of the CTL lines against T2 cells loaded with either 2.0 ⁇ g/mL of MY2 or MY4, or T2 cells without added peptide, at varying effector to target (E:T) ratios.
  • E:T effector to target
  • Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLAA2.1, was also measured and resulted in ⁇ 20% specific lysis at E:T ratios of 50:1 by CTL specific for either MY2 or MY4.
  • CTL stimulated weekly with either higher or lower peptide concentrations of MY2 or MY4 did not produce a short-term CTL line by 4 to 6 wk, as measured by specific lysis of peptide-coated T2 targets at the end of culture. Only CTL stimulated with 2.0 ⁇ g/ml of peptide produced effective short-term CTL lines. This observation was reproducible across 10 healthy HLA-A2.1+ donor PBMCs that were used in the studies to elicit the CTL. This phenomenon was noted previously for CTL elicited against other self-peptides.
  • T2 cells loaded or not loaded with 2.0 ⁇ g/mL MY2 or MY4 were prepared.
  • the CTL line generated against the respective peptides were also used to test for specific lysis.
  • Mouse monoclonal antibody against HLA-A2.1 (BB7.2) was used to hlock HLA-A2.1 -restricted recognition by the CTL line.
  • T2 cells without peptide, but with antibody present, were used to control for any potential non-specific antibody-mediated cytotoxicity.
  • FIG. 37 demonstrates that with the addition of antibody to HLA-A2.1, specific lysis was hlocked. Further, there was only background lysis of T2 cells in the presence of antibody alone.
  • the data shown in FIG. 37 is the combined results from three separate experiments using three separately generated CTL lines. This demonstrated that the observed cytotoxicity was HLA- A2.1 -restricted.
  • MY2 and MY4-specific CTL lines were capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals.
  • the targets were BM cells from pre-transplant HLA-A2.1 -positive AML patients.
  • BM cells from HLA-A2.1 -negative AML patients, BM from HLA-A2.1 -positive healthy donors and two cell lines expressing low levels of MPO were used: HLA-A2.1 transfected K562 cells and the U937 cell line which lacks HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2.1 -restricted manner.
  • MY4-specific CTL 35 shows the combined results of three separate experiments from tliree MY4- specific CTL lines.
  • the specific lysis by MY4-specific CTL, at various E:T ratios, of either BM from healthy HLA-A2.1 -positive donors, HLA-A2.1 -positive AML patients, HLA-A2.1- negatiVe AML patients, or T2 cells with or without exogenously added MY4 peptide at 2.0 ⁇ g/mL is shown.
  • the specific lysis of U937 and HLA-A2.1 -positive K562 cells by MY4- specific CTL was lower than the background lysis observed against T2 cells without added peptide.
  • FIG. 36 demonstrates typical cytotoxicity results from three experiments with three different MY2-specific CTL lines.
  • AML were readily lysed, at an E:T ratio of only 5:1.
  • marrow cells taken from an HLA-A 2.1 -positive normal healthy donor also demonstrated significant lysis (43 % lysis at E:T of 20: 1), similar to that of the HLA-A2.1 -positive AML cells.
  • Table 15 lists the percentage of cells in the sample population that stain positive for MPO, as well as the median fluorescence intensity of intracellular MPO staining.
  • the percentage of cells expressing surface MHC class I and CD80 (the costimulatory molecule B7.1) was also evaluated in the same target cell populations by staining with FITC labeled antibodies.
  • the MY2-specific CTL also showed specific lysis of normal donor marrow cells, which suggests that immunity elicited against this peptide in vivo might result in autoimmxinity that would be incapable of distinguishing leukemic cells from normal marrow progenitor cells.
  • the CTL were tested against whole marrow from leukemia patients in short-term assays, it was possible that leukemia progenitor cells, which might not aberrantly express MPO, could escape CTL recognition. Therefore, whether leukemia progenitor cells could be eliminated by MY4-specific CTL in an AML colony-forming assay was investigated. The MPO expression in both leukemia and normal CD34+ cells was also determined.
  • MPO myeloperoxidase
  • MFI median fluorescence intensity
  • FIG. 38 shows the results of colony inhibition assays using CTL derived from a 13 day MY4 peptide-pulsed culture (CTLl).
  • CTLl MY4 peptide-pulsed culture
  • CFUGM from normal marrow, Dl and D2 the corresponding HLA identical marrow donors for PI and P2.
  • Control CTLl plated alone in methylcellulose under identical experimental conditions at 5 x 10 5 cells/ml showed no CFU-GM by day 16.
  • EXAMPLE 18 MPO IS EXPRESSED IN LEUKEMIC CD34+ CELLS - EXPRESSION IS LIMITED TO HEMATOPOIETIC CELLS
  • MPO was expressed in early CD34 positive CML cells.
  • Marrow was obtained from a patient with CML in CP, a patient with AML, and normal CD34 cells from G-CSF mobilized peripheral blood mononuclear cells from a normal donor for comparison. Cells were first labeled with PE conjugated anti-CD34 antibody (Becton
  • FIG. 39 shows that 19% of the CML cells were CD34 positive and 16% of those cells highly expressed Pr3. In addition, CD34-negative cells also expressed MPO. In contrast, none of the normal CD34 positive cells expressed MPO. In cells from another patient with AML, 57% of AML cells were CD34- positive and 5% of those cells highly expressed MPO. This shows that very early progenitor cells overexpress MPO whereas there is no MPO expression normal progenitor cells. To confirm that MPO expression was limited to hematopoietic cells, a panel of human tissues for MPO RNA expression was analyzed using RT-PCR.
  • cDNA was amplified with 30 cycles of PCR.
  • Primers amplifying a region spanning the 3rd and 4 th coding regions (conjunction position 613, 5' primer 588-610 (CATCTGCTTCGGAGACTCAGGTG (SEQ ID NO:40)), 3' primer 689-672 (TCAGGGAAAAGGCGGGTG (SEQ JD NO:41)) were selected and used to generate PCR products that were then separated on a 2% agarose gel. The gel was imaged on a BioRad analyzer and GelDoc software was used to quantify the products.
  • FIG. 40 shows that expression of MPO is limited to bone marrow.
  • the properly folded MHC peptide complexes were extensively purified using FPLC and anion exchange, and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, CO). Tetramers were produced by mixing the biotinylated MHC peptide complexes with phycoerythrin (P ⁇ ) conjugated Neutravidin (Molecular Probes), or P ⁇ (Cy7)-conjugated Neutravidin at a molar ratio of 4:1.
  • P ⁇ phycoerythrin
  • MY4 tetramers were validated by staining against a CTL line specific for each peptide.
  • CMV tetramers were validated by staining with PBMC from a CMV immune individual.
  • staining method was modified to use 2 or more different tetramers simultaneously to stain PBMC samples.
  • MY2-CTL which showed 45% specific lysis of HLA-A2+ normal BMC in addition to killing leukemia
  • MY4-CTL showed no lysis of normal BMC and only killed leukemia cells, which suggested that MY4 may be a more biologically relevant leukemia antigen. It was predicted that high numbers of circulating MY2-CTL would not be found, but that MY4-CTL may be detectable in leukemia patients.
  • A2 tetramers were constructed with the following peptides: PRl, MY2, MY4, the CMV p ⁇ 65 peptide, and the minor antigens HA-1R (a negative control) (den Haan et al, 1998) and HA-1H (the allele against which CTL responses have been shown) (den Haan et al, 1995; den Haan et al, 1998; Marijt et al, 1995).
  • FIG. 41 shows that multiple-tetramer staining is associated with a 0.1% loss of sensitivity; however, ratios of antigen specific CTL were preserved when compared to single tetramer staining.
  • FIG. 42 staining PBMC from HLA-A2.1 -positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and chronic lymphocytic leukemia) showed there was no detectable CTL immunity against myeloid-specific antigens.
  • FIG. 42 shows that staining PBMC from HLA-A2.1 -positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and chronic lymphocytic leukemia) showed there was no detectable CTL immunity against myeloid-specific antigens.
  • FIG. 41 shows that multiple-tetramer staining is associated with a 0.1% loss of sensitivity; however, ratios of antigen specific CTL were preserved when compared to single tetramer staining.
  • both PRl-CTL and MY4-CTL are detected in the peripheral blood of these patients, but MY2-CTL is not detected (the limit of sensitivity is 0.01% in cell titration experiments).
  • This figure shows a representative patient sample of peripheral blood that was obtained on day 60 post-NST and stained using the multiple tetramer methodology and CD8 and then analyzed using CellQuest software. Next, a total of 9 HLA-A2+ NST recipients were examined on day 60 post-transplant for immunity against each of the 6 peptides. By comparing relapse rates, as summarized in FIG.
  • PR1/HLA-A2 tetramer+ CTL from a donor lymphocyte (DLI) product obtained from leukapheresis were stained, sorted and tested for lysis of both donor and recipient (which contained > 90% blasts) cryopreserved BM.
  • the recipient was in remission by 6 months after allogeneic BMT, but relapsed with chronic phase CML by 12 months with 100% Ph+ BM cells.
  • the patient was then treated with a total of 7 x 10 7 DLI per kilogram body weight from months 12 to 13 with no other therapy, and was in remission with 0% Ph+ BM cells by month 18 when PBMC were available for testing.
  • the yield of sorted PRl /HLA- A2 tetramer+ cells was 81%, with 90% purity, and the sorted tetramer- negative population contained no detectable PR1 HLA-A2 tetramer+ CTL.
  • the sorted PRl HLA- A2 tetramer positive CTL showed greater lysis of recipient marrow taken from time of relapse than the non-sorted PBMC.
  • the sorted PR1/HLA-A2 tetramer negative CTL showed less lysis of recipient BM than non-sorted PBMC, it was above background lysis against donor BM.
  • PR1/HLA-A2 tetramer sorted PBMC showed lysis of HLA-A2.1+ CML cells from 2 umelated patients, but no lysis of either HLA-A2.1- CML cells or HLA-A2.1+ nomial donor marrow cells at E:T ratio of 5 : 1.
  • CTL with specificity for peptides such as MY4 which are identified using a deductive strategy, can successfully be translated to the clinic, a phase I clinical trial using the PRl peptide as a vaccine with incomplete Freund's adjuvant and GM-CSF was initiated. This further demonstrates that highly useful LAA can be identified using these methods.
  • Patients eligible for the vaccine included HLA-A2+ CML and AML patients that had failed conventional therapy or AML patients that were in 2nd CR (i.e. at high risk of relapse).
  • PRl was administered subcutaneously at 0.25, 0.5 or 1.0 mg every 3 weeks for 3 injections, PRl-specific CTL immunity was elicited in 6 of 9 patients (by tetramer staining) and complete remissions were obtained in 2 patients (1 AML and 1 CML patient).
  • the patient with AML was positive for the t(15;17) translocation and subsequently became PCR negative after vaccination.
  • the expanded PRl-specific CTL from peripheral blood of that patient were isolated by tetramer staining and relapsed BM cells were killed, but not BM cells taken during remission.
  • This technique may be applied to the treatment of other forms of leukemia, to other HLA types and potentially to other tumors as well.
  • Pr3 and MPO were investigated as tissue-restricted proteins and it was found that the HL A- A2.1 -restricted self- peptides, PR.1 and MY4, derived from Pr3 and MPO, respectively, can be used to elicit peptide- specific CTL that preferentially attack myeloid leukemia based on aberrant expression of the parent proteins in the target cells.
  • PRl was established as a leukemia-associated antigen.
  • MY4-specific CTL will be given in an adoptive immunotherapy study with nonmyeloablative stem cell transplant, and in a clinical phase I trial other peptide antigens that are identified will be added to this approach.
  • MY4-specific CTL will be selected and expanded ex vivo with the MY4 antigen for the production of leukemia-reactive CTL to produce a GVL effect and minimize GVHD.
  • HLA-A2-restricted peptides Using the same method used to deduce HLA-A2-restricted peptides, several more peptides that are predicted to bind with high affinity to their respective HLA alleles have been identified. These peptides are shown in Table 16 and Table 17. As shown previously, peptides with predicted disassociation half-times of > 10 are the most likely to bind to the relevant HLA alleles' (Molldrem et al, 1996). Therefore, all 20 of the A3- and B7-restricted peptides will be synthesized and examined. All peptides will be synthesized to a minimum of 95% purity. The peptides will be dissolved in a minimum of DMSO and solubility characteristics will be noted.
  • Binding of each of the HLA-A2.1 -restricted peptides will be performed using wild type T2 cells using the method of determining HLA-A2 stabilization by indirect fluorescence and flow cytometry. Relative fluorescence will be obtained using the BB7.2 hybridoma (ATCC) and compared to peptides with known binding characteristics, PRl and pp65.
  • Table 16 MPO peptides predicted to bind HLA- A3 HLA- A3 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
  • HLA HLA
  • HLA-A3 and HLA-B7 alleles from EBV-transformed B cells derived from HLA-A3+ and HLA-B7+ normal donors were first cloned. These genes were inserted into the BirA- containing cassette that was used to construct the HLA-A2.1 tetramers and were then used to fold HLA-A3 and HLA-B7 tetramers using peptides with known high binding affinity to the respective alleles. Tetramers folded with the newly identified peptides will be used as reagents to test whether patients have evidence of circulating peptide-specific CTL.
  • the peptide-specific CTL lines generated in vitro from healthy donors that show peptide-specific lysis will be used as "reagents" to confirm the specificity of the tetramers.
  • the A3 and B7 alleles have also been cloned into a mammalian vector containing the CMV promoter (Clonetech). Electroporation will be used to transduce T2 cells with these vectors. The transduced T2 cells will then be expanded for up to 1 month and sort-purified using the MoFlo high-speed cell sorter based on increased A3 or B7 surface expression after the addition of stabilizing A3- and B7-binding peptides.
  • the resulting T2 cells can then be used to determine whether the predicted peptides from Tables 16 and 17 bind to A3 and B7 by using A3- and B7-specific monoclonal antibodies (Immunotech and Pharmingen), and measuring surface expression. These binding results will be compared to peptides with known binding affinities to A3 and B7, such as influenza matrix and CMV pp65-derived peptides. The relative binding affinities of these peptides to the HLA allele will be determined by serial dilutions of each peptide and comparing them to PRl after analyzing for surface HLA expression by flow cytometry. In this way, an IC 50 value will be determined for each peptide.
  • the resulting peptide-elicited CTL lines will be characterized for their ability to kill peptide-coated T2 cells, fresh leukemia cells and established leukemia cell lines such as U937 and K562.
  • HLA restriction will be confirmed using targets without the relevant allele and by blocking experiments with antibodies specific for the relevant alleles.
  • the amount of target cell killing will be determined using a standard 4-hr assay (Molldrem et al, 1996; Hensel et al, 1999) and will be correlated with target antigen expression and surface phenotype of the leukemia cells and healthy donor BM cells.
  • Table 17 MPO peptides predicted to bind HLA-B7HLA-B7 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
  • MPO intracellular protein expression will be determined using direct intracellular FACS staining for the MPO protein with a FITC-labeled murine monoclonal antibody. This intracellular stain will be combined with surfaced antibodies for myeloid differentiation markers such as CD34, CD33, CD13, CD14, CD16 and HLA-DR to determine which stage of differentiation might be more susceptible to CTL killing.
  • the MoFlo cytometer is capable of simultaneous 10-color analysis, which will greatly facilitate the analysis of progenitor stage of development. Both BM and PBMC will be examined similarly for MPO expression and surface phenotype and compared to determine whether there are differences in target susceptibility based on location (marrow vs. peripheral blood).
  • CTL with specificity for myeloperoxidase-derived peptides can be detected in vivo in patients at diagnosis, before and after NST and after treatment with chemotherapy. Because CTL lines against both MY2 and MY4 could be elicited from normal donors and kill AML cells, it was next determined whether it was possible to detect these CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2-specific CTL caused lysis of both leukemic and healthy bone marrow cells, which suggested it would be unlikely to find high circulating numbers of MY2-specif ⁇ c CTL since these might mediate autoimmunity in addition to anti-leukemia immunity.
  • LAA leukemia associated antigen
  • PBMC samples will be obtained prior to transplant and then weekly after transplant, beginning on day 10 and continuing until day 100. Patient samples will then be examined at each follow-up in the BMT clinic, which will be monthly until 1 year post- transplant.
  • PBMC samples will also be obtained from the donor pre-transplant.
  • BM cells will be obtained from the donor if BM is used as the graft, and from the recipient prior to transplant and again on days 30, 100 and day 365 post-transplant.
  • the PBMC and BM samples will be cryopreserved.
  • PBMC samples will be used for later evaluation as more peptides are identified as potential LAAs (as discussed herein).
  • the lymphocytes for surface expression of several markers will be examined including CD3, CD4, CD8, CD16 + 56, CD45RA, CD45RO, CD57, CD28, CD27 as well as tetramer staining.
  • the maximum number of tetramer + cells during the time course of study will be determined.
  • Prior experience with -viral antigen-specific CTL, with HA-1 -specific CTL and with PRl-specific CTL suggest that the peak number of tetramer+ cells occurs over a 3 to 4 week period and often coincides (or may lag by a week or two) with the time of documented remission. Furthermore, the peak for other peptide- specific CTL is usually in the range of 1% to 10%.
  • BM cells will be studied for MPO expression using intracytoplasmic staining combined with surface phenotypic makers that will allow the determination of the point of maturation of the BM cells. Expression of CDlla, CD13, CD14, CD16, CD33, CD34, CD80, CD86, HLA-ABC and HLA-DR will be examined.
  • MY4 and the other peptides in this study are self-antigens, it is possible that AML patients treated with chemotherapy alone may have circulating numbers of MY4/MHC tetramer+ cells based on a previous study of CML patients using the PR1/HLA-A2 tetramer, however, this would seem unlikely. If these peptides are detected in AML patients that are in remission it may indicate that post-chemotherapy recovery of immunity is important for obtaining remission and the length of remission duration. Blood samples will be obtained from 10 consecutive AML patients receiving chemotherapy as alternative to NST, with samples obtained at the same time points after start of therapy as for the NST group.
  • cytokine secretion cytokine secretion
  • CD69 upregulation cell proliferation
  • cytotoxicity Tetramer staining and cytokine flow cytometry (CFC) will simultaneously be determined on all patients since the MoFlo will greatly facilitate these experiments.
  • PE-labeled antibody to gamma- interferon and PECy7- labeled tetramers will be used to in these studies.
  • Cells will first be labeled for 10 min at 37°C with tetramer and FITC-labeled CD8 and then stimulated with MY4 peptide at 2 ⁇ g/ml.
  • Brefeldin A will be added during culture to inhibit secretion of cytokines, and after 6 hr cells will be permeabilized and stained for interferon. This technique has been successfully used to monitor PRl-CTL responses after vaccination and it was found that CFC positivity correlates with cytotoxicity.
  • the tetramer+ population will be purified by high-speed sorting using the MoFlo cytometer. Both the tetramer+ and tetramer-cells will be tested for cytotoxicity against cryopreserved leukemia targets prior to NST or chemotherapy.
  • the MoFlo is capable of 4-way simultaneous sorting, the killing of peptide-coated target cells of the MY4- CTL will be compared to other peptide-specific CTL (i.e. pp65 in se ⁇ ositive patients) to directly compare lytic potential.
  • peptide-specific CTL i.e. pp65 in se ⁇ ositive patients
  • CTL with myeloid self-antigen specificity are present at very low precursor frequencies (Molldrem et al, 1999), these CTL will need to be expanded before they could be used as part of an adoptive transfer immunotherapy strategy. While there are currently some commercially available methods for the separation of antigen-specific CTL based on cytokine secretion, they are presently not licensed for use in patients, and the best method to separate antigen-specific CTL has not been defined. Similarly, trie optimal method to expand CTL in short-term culture conditions is not yet defined, and expansions on large scale without the use of fetal calf serum remain a major obstacle to cellular immunotherapy. Two general expansion methods to elicit MY4-CTL in vitro will be compared.
  • peptide-pulsed dendritic cells will be used to stimulate responder PBMC weekly for 4 to 6 wk.
  • precursors to mature DC including CD 34+ cell-derived hematopoietic precursors, monocyte- derived DC have been chosen because they are more readily available in large numbers from donor leukapheresis products.
  • this methodology is most likely to yield the greatest potential number of DC, which will be needed to grow low precursor frequency self- antigen specific CTL.
  • IFN interferon
  • GM-CSF GM-CSF
  • DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon- 2b plus 500 U/ml GM-CSF (termed DC/IGM).
  • DC/4GM 1,000 U/ml IL-4 plus 500 U/ml GM-CSF
  • DC/IGM 1,000 U/ml interferon- 2b plus 500 U/ml GM-CSF
  • Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines.
  • HS human serum
  • T2 cells were maintained in RPMI + 10% HS prior to co-culture with donor PBMC.
  • DC were pulsed with 20 ⁇ g/ml PRl peptide, irradiated and combined with fresh PBMC from the same donor at a 1 :2 ratio.
  • the culture was restimulated with PRl -pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PRl-CTL cultures were tested for their ability to lyse PRl-coated target cells or CML cells.
  • the PRl-CTL were also evaluated for surface phenotype with the PR1 HLA-A2 tetramer and anti-CD8.
  • Typical yields of antigen-specific tetramer+ cell numbers were 3% to 5% PRl-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to MY4, but all of the comparative experiments will be repeated using this peptide.
  • serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. This will determine the optimal conditions that produce the highest numbers of functional MY4-CTL in the shortest period of time.
  • MY4-CTL obtained after 4 wk of weekly restimulation will be incubated with MY4 antigen and the bi-specific antibody with anti- CD45 and anti-IFN binding will be co-incubated with the cells.
  • a secondary antibody with anti- IFN antibody that is directly linked to microbeads supplied by Miltenyi, Inc., Germany
  • the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen- specific CTL.
  • the device may not capture all CTL with the potential to recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen- specific CTL might be required to maintain the more functional fraction in vivo, or whether the non-secreting CTL later become able to express effector function, too few CTL may be selected using the commercial product. Monomer coated beads are likely to capture all of the available antigen-specific CTL from the bulk culture, as shown in previous studies. To determine whether peptide antigen-specific CTL can be adoptively transferred to myeloid leukemia patients after T cell-depleted NST to facilitate engraftment, boost GVL and reduce GVHD.
  • the overall treatment strategy to enhance GVL and reduce GVHD is to use a nonablative preparative regimen to achieve engraftment of allogeneic blood stem cell or bone marrow transplant and to be the platform to deliver antigen-specific CTL therapy.
  • the goal is to determine the maximal dose of MY4-specific CTL that will provide engraftment in > 80% of patients while preventing development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD ⁇ 15%) and mediating a GVL effect.
  • T-cells have been shown to facilitate engraftment and are required to prevent rejection with the established nonablative preparative regimens.
  • this study extends this therapeutic strategy, with manipulation of donor cells to reduce alloreactive cells by enriching for MY4-CTL (and other antigen-specific CTL determined previously). This will be accomplished by selecting and adoptively transferring the MY4-CTL. These cells thus, would not be expected to react against the recipient tissues, but would still be able to mediate anti-leukemia effects.
  • Patients with AML who have an HLA compatible related or unrelated donor who failed to respond to initial chemotherapy or after relapse will be used. Lymphocytes will be collected from the donor by apheresis with a goal of collecting 2 x 10 CD3+ T-cells/kg.
  • Donor type peripheral-blood mononuclear cells are plated in 75-mm flasks at 2 x 10 6 cells/ml and stimulated with 2 x 10 6 irradiated donor-derived DC from the patient's donor. If other methods, as discussed above, produce superior results, the procedure will be modified to inco ⁇ orate those methods. CTL bulk ultures will be restimulated weekly, as described herein. After 28 days of co-culture, the cells will be harvested and live cells will be isolated on Ficoll gradient. The cultures are treated with IL-2 20 U/mL final concentration on day 8 and weekly thereafter.
  • All the responders and stimulators are suspended into RPMI-1640 medium with 2 mM L-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 25 mM Hepes, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 5 x 10 5 M 2-mercaptoethanol.
  • Autologous serum at 10% will be supplemented. This will be modified if the results show that albumin or serum-free conditions can be substituted.
  • Stem cells will be collected from the donor's blood after G-CSF administration according to standard procedures. If there is a medical contraindication to G-CSF administration, stem cells will be collected by bone marrow harvest.
  • Apheresis will occur daily for up to a total of four procedures in order to collect > 5 x 10 CD34+ cells/kg recipient weight after positive selection of CD34+ cells.
  • the minimal acceptable number is 2 x 10 6 CD34+ cells/kg recipient weight.
  • Cells will undergo CD34 selection using the Isolex or Miltenyi device with the final composition including > 2 x 10 CD34+ cells and ⁇ 1 x 10 5 T-cells/kg.
  • the apl eresis product from each day will be cryopreserved according to standard procedures.
  • patients will receive fludarabine 25 mg/m intravenously daily at the same time over 30 min on days 6, 5, 4, 3, 2 and melphalan 70 mg/m 2 on day 3 and 2 administered following completion of the fludarabine.
  • the allogeneic hematopoietic cell infusion consisting of > 2 x 10 6 CD34+ cells plus MY4-CTL is administered on day 0.
  • MY4-CTL will be administered in a phase I study to define the maximal dose that can be administered without producing GVHD. Tetramer staining will be performed at the end of bulk culture.
  • Dose levels will be 1: 5 x 10 7 CD8+ cells/kg; 2: 1 x 10 8 CD8+ cells/kg and 3: 5 x 10 8 CD8+ cells/kg.
  • Patients will not receive post transplant immunosuppressive therapy or growth factors, but will receive standard supportive care for prevention of infection. It is predicted, based upon previous results, that current expansion techniques will yield sufficient MY4-CTL from the collection of 2 x 10 8 CD3+ T-cells/kg. Patients will be assessed for engraftment and chimerism on days 28, 56, 90, 180, 365 and yearly post transplant.
  • Chimerism will be assessed by microsatellite STR (short tandem repeat) markers and analyzed using GeneScan software on peripheral blood, assaying both T-cells and myeloid cells separately. Engraftment is defined as documentation of > 50% donor derived T-cells on day 90. Disease remission will be assessed by bone marrow evaluation on day 28, 90 and 180 and as indicated thereafter. Acute and chronic GVHD will be assessed by standard criteria. Peripheral blood will be collected weekly for tetramer staining and for surface phenotyping, as performed above. Evaluation for Donor Leukocyte Infusion. If no GVHD is observed, and if antigen- specific CTL are no longer detectable, patients will be evaluated at day 45 for infusion of antigen specific T cells.
  • STR short tandem repeat
  • graft failure occurs in 2 of a given group without GVHD, the dose will be considered too low to ensure engraftment and subsequent patients will be entered at the next higher dose level. If grade 3 acute GVHD does not occur in a given group, subsequent patients will receive the next higher dose level. If grade 3 acute GVHD occurs in one patient, 6 additional patients will be treated at a given level. If grade 3 acute GVHD occurs in 2 patients (out of a maximum of 12) at a given level, the rate of GVHD will be considered excessive and that level will be terminated.
  • the MTD is the level, which allows engraftment in at least 5 of 6 patients without excessive GVHD. Ten additional patients will be treated at the MTD.
  • a phase I trial will be conducted in which a maximum of 60 patients will be assigned among the three levels of cell doses. Outcomes to be monitored are immune response and occurrence of GVHD, both defined over a 100-day period from receipt of transplant. Within each dose group, the goals are to achieve a rate of at least 20% of patients with immune response while maintaining at most a 20% rate of GVHD. Patient outcomes will be monitored and compared to stopping boundaries computed using a Bayesian method. Priors will be based on results of the PRl peptide vaccine trial of active immunotherapy, and doses are assumed independent.
  • the vaccine trial has shown a peak tetramer response of 2% of all CD8+ T-cells, which will provide a good starting estimate for the design of a passive adoptive transfer cell therapy protocol. Stopping boundaries will be computed using available software. This is intented to terminate a dose level if the computed probability of achieving at least a 20% immune response rate based on accumulated data is less than 10%, or the probability of 20% GVHD rate is at least 90%. Among dose levels not terminated early, the dose level having the highest observed immune response rate will be declared optimal, unless there are major differences in GVHD rates.
  • MY4/HLA-A2 tetramer could be used to select for a homogeneous population of leukemia- reactive CTL might allow for the first time the adoptive transfer of CTL across MHC barriers to treat leukemia (Toes et al, 1996).
  • cyclin E family of proteins were investigated, because it is well known that cyclin E is constitutively expressed in some tumor cells in dependent of the cell cycle, and aberrantly expressing cyclin E contributes to tumorigenesis as a result of chromosomal instability.
  • Cyclin E2 is a homologue of cyclin El and both proteins have restricted tissue distribution.
  • cyclin El and E2 are over-expressed in hematological malignancy, cyclin El and cyclin E2 mRNA expression were first analyzed in 21 patients with hematological malignancy (11 CML (CP), 5 CML (BC), 2 AML, 2 ALL, 1 NHL) and 12 normal donors by RT-PCR.
  • CML CML
  • Nonameric peptides derived from cyclin El and cyclin E2 and predicted to bind to the HLA-A2 allele have similar amino acid sequences, differing only at position 7.
  • the binding of CCNE1144452 (cyclin El derived) and CCNE2 144 _ 152 (cyclin E2 derived) was compared to that of PRl by a peptide-binding assay.
  • the ability of CCNE1 144 _ ⁇ 51 and CCNE2 M4 to stabilize HLA-A2 on the surface of T2 cells was almost the same as that of PRl (FI
  • A2 positive normal donors were stimulated with peptide-pulsed T2 cells.
  • 3 of 7 donors were stimulated with peptide-pulsed T2 cells.
  • CCNEl 144 152 -stimulated CTL lines killed both CCNE1 144 _ 152 and CCNE 2 144 _ 152 - ⁇ ulsed T2 cells but not non-peptide-pulsed T2 cells and irrelevant peptide-pulsed T2 cells.
  • CCNE2 144 152 -stimulated CTL lines killed both CCNE2 144 152 and CCNEl 144 _ 152 -pulsed
  • each peptide-specific CTLs can recognize both peptides with HLA-A2, but the immunogenicity of each peptide is different between individuals.
  • CCNEl 144 152 -specific CTL can distinguish leukemic cell lines from normal PBMCs. From the data, it was concluded that cyclin E1/E2 derived peptides are potential tumor- antigens, because 1) cyclin E1/E2 are highly over-expressed in hematological malignancy, 2) cyclin E1/E2 peptides can sufficiently bind to HLA-A2 to stimulate CTL and 3) CCLE1 144 152 specific CTL preferentially kills leukemic cell lines HLA-A2 restrictively.
  • compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Epidemiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides tumor-associated HLA-restricted antigens, and in particular HLA-A2 restricted antigens, as vaccines for treating or preventing cancers in a patient. In specific aspects, neutrophil elastase peptides other than PR1, cyclin E1 peptides, cyclin D peptides, or cyclin E2 peptides are provided. Such peptides can be used to elicit specific CTLs that preferentially attack tumor cells. The present invention also provides HLA-restricted antigens as vaccines for treating or preventing autoimmune diseases or conditions, transplant rejection or vasculitis in a patient. In particular aspects, there is provided Pr3, a myeloid tissue-restricted protein and a HLA-A2.1-restricted self-peptide, PRl, derived from Pr3, which can be used to elicit PR1-specific CTLs. The present invention also provides a HLA-restricted-peptide myeloperoxidases-based methods.

Description

DESCRIPTION
VACCINES FOR CANCER, AUTOIMMUNE DISEASE AND INFECTIONS BACKGROUND OF THE INVENTION
This application claims benefit of priority to U.S. Provisional Application Serial No. 60/498,238, filed August 26, 2003, the entire contents of which are hereby incorporated by reference. The government owns rights in the present invention pursuant to grant numbers ROl
CA81247-02 and ROl CA49639-11 from the National Institutes of Health.
1. Field of the Invention The present invention relates generally to the fields of cancer and immunotherapy. More particularly, it concerns the ideutificatiou of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of cancer. It also concerns the identification of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of autoimmune diseases, transplant rejection, post-transplant antitumor immunity and vasculitis.
2. Description of Related Art The immune system has long been implicated in the control of cancer, however, evidence for specific and efficacious immune responses in human cancer have been lacking. In chronic myelogenous leukemia (CML), either allogeneic bone marrow transplant (BMT) or interferon - α2b (IFN-<χ2b) therapy have resulted in complete remission, but the mechanism for disease control is unknown and may involve immune antileukemic responses. Based on evidence in the art, it is thought that lymphocytes play a role in meditating an anti-leukemia effect. Studies have demonstrated that allogeneic donor lymphocyte infusions (DLI) have been used to treat relapse of myeloid leukemia after allogeneic BMT (GiraU and Kolb, 1996; Kolb and Holler, 1997; Kolb et al., 1995; Kolb et al, 1996; Antin, 1993). Lymphocyte transfusion from the original bone marrow (BM) donor induces both hematological and cytogenetic responses in approximately 70% to 80% of patients with chronic myelocytic leukemia (CML) in chronic phase (CP) (Kolb et al., 1996, Holler, 1997), Remissions after DLI for AML are generally not as durable as those obtained in chronic phase CML, which may reflect the rapid kinetics of tumor growth outpacing the kinetics of the developing inrmune response. Additionally, most patients with myeloid forms of leukemia will die from the disease unless they can be treated with allogeneic bone marrow transplant, where the associated graft versus leukemia (GVL) effect cures patients. However, graft-versus-host disease (GVHD) and transplant-related toxicity limit this treatment. It is believed that GVL may be separable from GHND, and that targeting the immune response toward leukemia-associated antigens will allow for the transfer of GVL to patients without GVHD. Thus, if more antigens (i.e., leukemia antigens or antigens aganist other cancers) could be determined, and if large numbers of the most potent antigen-specific cytotoxic T lymphocytes (CTLs) could be obtained, it would allow for development of leukemia-specific therapies, "breast cancer specific therapies, etc. using the antigens as a targets for vaccines or for generating specific T cells for use in adoptive immunotherapy. Various methods have been used in the art to determine the nature of the target antigens, such as leukemia-specific antigens, of the GVL effect. For instance, tissue-restricted minor histocompatibility antigens (mHA) that are derived from proteins expressed only in recipient hematopoietic tissue have been shown to be the targets of alloreactive donor T cells. Heterologous T cell clones that demonstrate alloreactivity toward different mHA have been established from patients with severe GVHD following BMT with an HLA-matched donor (Faber et al, 1995a; Faber βt al, 1995b; Faber et al., 1996; van der Harst et al, 1994; Molldrem et al, 2000; Gao et al, 2000; den Haan et al, 1998; Clark et al, 2001). Some of these rnHA- specific CTL clones react only with hematopoietic-derived cells, suggesting tissue specificity (Faber et al, 1996; den Haan et al, 1998), and therefore potentially shared antigens on leul emia. Expression of two human mHAs, identified as HA-1 and HA-2, is confined to hematopoietic tissues. HA-2 was identified as a peptide derived from the non-filament-forming class I rnyosin family by using mHA-reactive CTL clones to screen peptide fractions eluted from MHC class I molecules (den Haan et al, 1995; Faber et al, 1995a). Thus, while various methodologies has successfully defined some CTL alloantigens, it is extremely labor intensive and it is unclear whether CTL specific for any minor antigens identified thus far convey leukemia-specific immunity without concomitant GVHD. Ln one study, GVHD correlated closely with differences in the minor antigen HA-1 in HLA identical sibling transplants (Goul y et al, 1996; Dolstra et al, 1997). Furthermore, a practical lirnit of any immunotherapy approach targeting these mHAs is that only 10% of individuals would be expected to have the relevant HA-1 alternate allele, and < 1% would have the HA-2 alternate allele, which makes donor availability quite limiting. An alternative immunological or deductive method to determine leukemia-specific CTL epitopes has been applied to determine whether BCR-ABL fusion region peptides could elicit CML-specific T cell responses. Peptides are synthesized based upon an "educated guess" of which proteins are potential target antigens for a selective anti-leukemia CTL response. The proteins are then examined for short peptides that fit the binding motif of the most common HLA alleles based on the amino acid sequence. Using this method, these peptides are then synthesized, tested for binding to the HLA allele, and used to elicit peptide-specific CTL responses in vitro. Since BCR-ABL is present in nearly all (92%) Philadelphia chromosome- positive CML patients, it is thought to represent a potentially unique leukemia antigen. The ABL coding sequences upstream (5 ') of exon II on chromosome 9 are translocated to chromosome 22 and fused inframe with the BCR gene downstream (3') of exon III, resulting in a chimeric mRNA (b3a2) (the most common transcript) which is translated into a chimeric protein (p210BCR-ABL). Translation of b3a2 mRNA results in the coding of a unique amino acid (lysine) within the fusion region. Some HLA-B8-restricted overlapping peptides inclusive of this lysine could bind to HLA-B8 and could be used to elicit T cell proliferative responses when the peptide was either pulsed onto HLA-matched normal antigen presenting cells or onto HLA- B8 positive CML cells (Dermime et al, 1995; Bocchia et al, 1995; Bocchia et al, 1996; Faber et al, 1995b; Faber et al, 1996; van der Harst et al, 1994). However, when the b3a2 peptides were used to elicit b3a2-specific T lymphocyte lines in vitro, the resulting T cells could not specifically lyse fresh CML cells which had not previously been pulsed with the peptide (Bocchia et al, 1996; van der Harst et al, 1994). This could be due to a low affinity of the peptide-specific CTL or the peptide may not be processed or presented on CML cells. More recently, b3a2-specific CTL were identified in the peripheral blood of CML patients using soluble b3a2 peptide/MHC tetramers (Clark et al, 2001). Although the tetramer-positive CTL from the patients were not tested to determine whether they could kill CML target cells, b3a2- specific CTL elicited in vitro from healthy donors were able to kill CML cells (den Haan et al, 1995). This suggests that bcr-abl fusion peptides may be targets of GVL reactions. Although peptides derived from the b3a2 fusion region given as a vaccine to CML patients elicited CTL immunity in 3 of 12 patients, no clinical benefit was noted (Pinilla-Ibarz et al, 2000). In tumors other than leukemia, such as melanoma and breast cancer, many peptide antigens have been identified as targets of tumor-specific CTL. What is clear from these studies is that nearly all of the tumor antigens identified are derived from normal tissue proteins (Nanda and Sercarz, 1995; Boon et al, 1997). It is now accepted that many self-antigenic determinants have not induced self-tolerance and that these peptide determinants supply target structures for autoimmune attack (Nanda and Sercarz, 1995; Rosenberg and White, 1996; Goulmy et al, 1996; Dermime et al, 1995). Since these proteins are often aberrantly expressed or overexpressed in the tumor, there is relative tumor specificity by CTL that recognize these epitopes (Pardoll, 2002; Pardoll, 1994; Bocchia et al, 1996; Pinilla-Ibarz et al, 2000). Similarly in leukemia, CTL immunity to the Wilm's tumor antigen WT-1, which is aberrantly expressed in various forms of leukemia, has been demonstrated to kill CML CD34+ progenitor cells (Gao et al, 2000). Melanoma peptide antigens that are derived from MAGE-3 proteins, for example, are presented to melanoma-specific CTLs by HLA-A1 and HLA-A2 (Nanda and Sercarz, 1995; Boon et al, 1997; Rosenberg and White, 1996). This protein belongs to a family of proteins which are expressed in melanoma cells and in normal testis. A MAGE-3 derived peptide was determined to be immunogenic by separate groups using different techniques, one using an immunological method (Pardoll, 2002) and the other a genetic method that uses tumor antigen- deficient mutants (Nanda and Sercarz, 1995). Recently, a phase I clinical trial using MAGE-3 to vaccinate melanoma patients resulted in some clinical responses (Pardoll, 1994). In addition, tyrosinase, gplOO, and Melan-A-MART-1 are also normal self-proteins specific to the melanocyte lineage and T-cells specific for determinants on each of these antigens can be found in a large majority of melanoma patients (Sturrock et al, 1992; Chen et al, 1994). Two recent phase II vaccine trials demonstrated clinical efficacy of active immunotherapy using these target antigens as a peptide vaccine or as a antigen-pulsed dendritic cell vaccine. PRl, an HLAA2.1 -restricted nonamer derived from proteinase 3 (P3), was identified as a leukemia-associated antigen (Molldrem et al, 2000; Molldrem et al, 1996; Molldrem et al, 1997; Molldrem et al, 1999; Molldrem et al, 2003 each incorporated herein by reference in their entirety). The finding that PRl is a leukemia-associated antigen has been independently confirmed by Burchert et α/ (2002) and Scheibenbogen et al. (2002). These studies have thus established PRl as a human leukemia-associated antigen and have established that PRl -specific CTL contribute to the elimination of CML. Although some tumor specific antigens have been identified as putative immunotherapeutic targets, there still is a great need in the art to identify more antigens and develop immunotherapeutic methods that target different cancers. New approaches for treatment of cancers are therefore needed. Insight into the occurring problem of why immune therapy often fails will help to modify or overcome tolerance and improve immunotherapies for leukemia and potentially other cancers as well. SUMMARY OF THE INVENTION
The present invention provides a vaccine comprising a first tumor associated HLA restricted peptide. The peptide is selected from the group consisting of a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide. The cyclin D peptide may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof, the cyclin El peptide may comprise the sequence ILLDWLMEV (SEQ LD NO:62) or a fragment thereof, and the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ LD NO:63) or a fragment thereof. The vaccine ma further comprise a tumor-associated HLA- A3 restricted peptide, a tumor- associated HLA- All restricted peptide, a tumor-associated HLA-B7 restricted peptide, a tumor- associated HLA-B27 restricted peptide, or a tumor-associated HLA-B35 restricted peptide, and in particular may further comprise a myeloperoxidase peptide, such as MY4 (SEQ ID NO:30), MY2 (SEQ ID NO:32), or a fragment of either. The vaccine may further comprise an adjuvant, such as complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette-Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21. The vaccine may further comprise an immunostimulant. The vaccine may further comprise more than one distinct peptide, for example, where the peptides depend on the tumor to be treated and/or the HLA type of the patient The vaccine may further comprise an antigen presenting cell, such as a dendritic cell.
The dendritic cell may be (a) is pulsed or loaded with the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, and thereby against the tumor, or (b) comprises an expression construct that encodes the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, or and thereby against the tumor. The vaccine may further comprising a second tumor-associated HLA-restricted peptide.
The vaccine may further comprise a third, fourth or fifth tumor-associated HLA-restricted peptide. The second, third, fourth or fifth tumor-associated HLA-restricted peptide may be an HLA-A3, HLA-A11, HLA-B7, HLA-B27 or HLA-B35 restricted peptide. hi another embodiment, there is provided a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising a peptide selected from a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide. The vaccine may be administered more than once. The therapeutically effective amount may be in the range of 0.20 mg to 5.0 mg, or in the range of 0.025 mg to 1.0 mg, or in the range of 2.0 mg to 5.0 mg of the peptide. The cancer cell may be a leukemic cell, such as a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell. The cancer cell may be a solid tumor cell, such as a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphatic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft tissue cancer cell. The method may use vaccine administered systemicaUy, intravenously, intra-arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermally, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration. The vaccine may be administered locally, by direct intratumoral injection, by injection into tumor vasculature or by an antigen-presenting cell pulsed or loaded with the peptide, wherein the antigen presenting cell may be a dendritic cell. The antigen-presenting cell may comprise one or more distinct peptides. The method may utilize a cellular vaccine. The method may further comprise treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent. The second anticancer agent may be administered simultaneously with the vaccine, or administered at a different time than the vaccine. The immunotherapeutic agent may be GM-CSF, CD40 ligand, anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-lBB (CD137) mAbs, and an oligonucleotide. The chemotherapeutic agent may be doxorubicin, daunorubicin, dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, semustine, streptozocin, dacarbazine, adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, hydrogen peroxide, nitrosurea, plicomycin, tamoxifen, taxol, transplatinum, vincristin, vinblastin, a TRAIL Rl and R2 receptor antibody or agonist, dolastatin-10, bryostatin, annamycin, mylotarg, sodium phenylacetate, sodium butyrate, methotrexate, dacitabine, imatinab mesylate (Gleevec), interferon- , bevacizumab, cetuximab, thalidomide, bortezomib, gefitinib, erlotinib, azacytidine, 5-AZA-2'deoxycytidine, Revlimid, 2C4, an anti-angiogenic factor, a signal transducer-targeting agent, interferon-γ, IL-2 and IL-12. In yet another embodiment, there is provided a method for treating or preventing cancer in a patient comprising (a) contacting CTLs of the patient with a a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient. The method may further comprising expanding the CTL's by ex vivo or in vivo methods prior to administration. Contacting comprises providing (a) an antigen presenting cell loaded with the peptide, (b) an antigen presenting cell transfected with an expression construct encoding the peptide, or (c) an antigen presenting cell infected with a viral vector that expresses the peptide. The method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide. The therapeutically effective amount of CTL cells required to provide therapeutic benefit may be from about 0.1 x 105 to about 5 x 107 cells per kilogram weight of the subject. Also are provided a peptide comprising the amino acid sequence of MY4 (SEQ ID NO: 30) or MY2 (SEQ ID NO: 32) or a fragment thereof or an expression vector comprising a nucleic acid sequence that encodes the MY2 sequence (SEQ LD NO: 32) or the MY4 sequence (SEQ ID NO:30) or a fragment thereof. Also provided are a peptide comprising the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO: 11), VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ TD NO:29) or a fragment thereof, or an expression vector comprising a nucleic acid that encodes the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ LD NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ LD NO:ll), VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ LD NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof. In still a further embodiment, there is provided a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor-associated peptide, wherein the peptide is a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide. The expression construct may be a non-viral expression construct or a a viral expression construct. The expression construct may encode a second tumor associated peptide. In a different aspect of the invention, there is provided a pmethod of treating an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide. The HLA-A2-restricted peptide may be a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide. The cyclin D may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof, the cyclin El peptide may comprise the sequence ILLDWLMEV (SEQ ID NO:62), the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ ID NO:63) or a fragment thereof, or the myleoperoxidase peptide may comprise the sequence of MY2 (SEQ LD NO:32) or MY4 (SEQ ID NO:30) or a fragment thereof. The vaccine may further comprise a disease-associated HLA-A3 restricted peptide, a disease-associated HLA-A11 restricted peptide, a disease-associated HLA-B7 restricted peptide, a disease-associated HLA-B27 restricted peptide, and/or a disease-associated HLA-B35 restricted peptide. The proteinase-3 peptide may be selected from the group consisting of VLQELNVTV
(SEQ ID NO:l), RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ LD NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO:ll) or a fragment thereof. Alternatively, the proteinase-3 peptide may be a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ 3D NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ LD NO:29) or a fragment thereof. The autoimmune disease may be vasculitis, Wegener's granulomatosis, Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's disease, ulcerative colitis, sarcoidosis, scleroderma, graft versus host disease (acute and chronic), aplastic anemia, or cyclic neutropenia. hi another embodiment, there is provided a method of treating or preventing an infectious disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2 -restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide. The infectious disease may be a viral hepatitis, such as hepatitis B or hepatitis C. The cyclin D may comprise the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof, the cyclin El peptide may comprise the sequence LLLDWLMEV (SEQ ID NO:62), the cyclin E2 peptide may comprise the sequence ILLDWLLEV (SEQ ID NO:63) or a fragment thereof, or the myleoperoxidase peptide may comprise the sequence of MY2 (SEQ ID NO:32) or
MY4 (SEQ ID NO:30) or a fragment thereof. The vaccine may further comprise a disease-associated HLA-A3 restricted peptide, a disease-associated HLA-A11 restricted peptide, a disease-associated HLA-B7 restricted peptide, a disease-associated HLA-B27 restricted peptide, and/or a disease-associated HLA-B35 restricted peptide. The proteinase-3 peptide may be selected from the group consisting of VLQELNVTV (SEQ LD NO:l), RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ LD NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ ID NO: 11) or a fragment thereof. Alternatively, the proteinase-3 peptide may be a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof. In yet another embodiment, there is provided a method of generating HLA-restricted peptide specific cytotoxic T-lymphocytes (CTLs) comprising (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating high affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA-restricted peptide specific CTLs. The target peptide may be provided in a limited amount such as at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 35, 40, 45, 50 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, or more μM. The method may further comprise purifying the concentrated HLA-restricted peptide specific CTLs. Step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs. Purifying may comprise high-speed flow cytometry. The target peptide may depend upon the donor and the peptide epitope. Concentrating high affinity HLA-restricted peptide specific CTLs comprises using microbeads and/or high speed sorting. The method may further comprise concentrating low affinity HLA- restricted peptide specific CTLs, and may even further comprise expanding the concentrated low affinity HLA-restricted peptide specific CTLs. The method may also further comprising adoptive T cell immunotherapy, and may also further comprise expansion of adoptively transferred peptide-specific T lymphocytes, and may also further comprise vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide- specific T lymphocytes. In still yet another embodiment, there is provided method for treating or preventing an autoimmune or infectious disease in a patient comprising (a) contacting CTLs of said patient with a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase 3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of said CTLs to the patient. The method may further comprise expanding said CTL's by ex vivo or in vivo methods prior to administration. Contacting may comprise providing an antigen presenting cell containing said peptide. The method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide/HLA-A2 ligand. The autoimmune disease may be vasculitis, Wegner's granulomatoses Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's disease, ulcerative colitis, sarcoidosis, scleroderma, graft versus host disease (acute and chronic), aplastic anemia, myelodysplastic syndrome, cyclic neutropenia, T-LGL (T-large granular lymphocytic) leukemia. The infectious disease may be a viral hepatitis, such as hepatitis B or hepatitis C. The therapeutically effective amount of CTL cells required to provide therapeutic benefit is from about 0.1 x 105 to about 5 x 107 cells per kilogram weight of the subject. In still even a further embodiment, there is provided a method for treating or preventing an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor associated HLA-A2 -restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide. The expression construct may be a non-viral expression construct or a viral expression construct. In yet another embodiment, there is provided a method for preventing an autoimmune disease in a patient comprising (a) identifying a patient at risk of developing an autoimmune disease, and (b) administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase- 3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide. In still yet a further embodiment, there is provided a method of generating HLA- restricted peptide specific cytotoxic T-lymphocytes (CTLs) comprising (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating low affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA- restricted peptide specific CTLs. The target peptide may be provided in a limited amount such as at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 35, 40, 45, 50 60, 70, 80, 90, 100, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, or more μM. The method may further comprise purifying the concentrated HLA-restricted peptide specific CTLs. Step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs. Purifying may comprise high-speed flow cytometry. The target peptide may depend upon the donor and the peptide epitope. Concentrating low affinity HLA-restricted peptide specific CTLs comprises using microbeads and/or high speed sorting. The method may further comprise concentrating high affinity HLA- restricted peptide specific CTLs, and may even further comprise expanding the concentrated high affinity HLA-restricted peptide specific CTLs. The method may also further comprising adoptive T cell immunotherapy, and may also further comprise expansion of adoptively transferred peptide-specific T lymphocytes, and may also further comprise vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide- specific T lymphocytes. In still a further embodiment, there is provided a method of generating HLA-restricted peptide specific regulatory T-cells comprising (a) obtaining a target peptide pulsed onto antigen- presenting cells to expand the T-cells ex vivo; (b) concentrating HLA-restricted peptide specific regulatory T-cells; and (c) expanding the concentrated HLA-restricted peptide specific regulatory T-cells. As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more. Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1. Peptide-specific cytotoxicity of CTL against peptide-loaded T2 cells. Effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1. CTL raised against T2 cells pulsed with PR-1 or PR-2 were tested for specific lysis against the same respective target cell/target peptide combination. Six replicate wells were used for each dilution of effector cells. Data were pooled from 3 separate experiments using 3 separate CTL lines and displayed as mean specific lysis ± standard deviation. FIGS. 2A-2B. PRl specific CTL preferentially lyse fresh myeloid leukemia cells. CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1. Six replicate wells were used for each dilution of effector cells. Data were pooled from 3 separate experiments using 3 separate CTL lines and displayed as mean specific lysis ± standard deviation. FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls). FIG. 2B - CTL specific for PR-1 demonstrate high specific lysis against marrow cells from patients with chronic myelogenous leukemia in chronic phase (CML-CP), accelerated phase (CML-AP), blast crisis (CML-BC), acute myelogenous leukemia (M4 subtype), and only background lysis toward marrow cells from a healthy marrow donor (D2) for patient P3. FIG. 3. HMY-A2.1+ cells transfected with Pr3 gene express cytoplasmic protein. HMy2.CIR-A2 cells were transfected with the Pr3 -containing vector pRTZ.2 and grown in culture in the presence of Zeocin. Cells were then grown in limiting dilution using increasingly higher concentrations of Zeocin. Two resulting cell lines, Clone 2.2 and Clone 1.4, and the non- transfected parent cell line HMy2.CIR-A2, were then analyzed for cytoplasmic Pr3 expression by flow cytometry using indirect staining with a FITC-labeled secondary antibody. Histograms of cell number versus the median channel of fluorescence (MCF) intensity of staining for cytoplasmic Pr3 are shown. FIG. 4. PRl specific CTL lyse Pr3 -transfected HMY-A2.1+ cells. CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratio of 25 : 1. Six replicate wells were used, and data is displayed as mean specific lysis ± standard deviation. CTL specific for PR-1 demonstrate 36% specific lysis of HMy2.CIR-A2 cells transfected with Pr3 (Clone 1.4), and 73%) specific lysis of marrow cells from a patient with chronic myelogenous leukemia in blast crisis (CML-BC), (positive control). There was only background lysis of HL-60 cells (low proteinase 3 expression, HLA-A2.1 negative), non-Pr3 transfected HMy2.CIR-A2 cells, CAT transfected HMy2.CIR cells, and marrow cells from a normal donor (negative controls). FIGS. 5A-5C. PRl -specific CTL can be identified by a PRl-tetramer. FIG. 5 A -A day 17 CTL line elicited against PRl was labeled for 30 min with anti-CD8-FITC, washed three times with PBS, and then labeled for 30 min with the PRl-tetramer-PE. Cells were then washed three more times with PBS and analyzed by flow cytometry. 2.4% of the CTL line was specific for PRl. FIG. 5B - An HLA-A2 tetramer specific for a new shock peptide stained 0.2% of the PRl -specific CTL. FIG. 5C - A day 17 CTL line elicited against influenza nucleoprotein was also labeled with anti-CD8-FITC and the PRl-tetramer-PE and is shown as a negative control. FIG. 6. The PR-tetramer can be used to sort CTL with PRl -specificity. A day 32 CTL line elicited against PRl was stained for 2 hr with anti-CD8-FITC, washed 3 times with PBS, then labeled for 2 hr on ice with the PRl-tetramer-PE conjugate. Cells were then labeled a third time with anti-CD4 and PI, washed 3 times with PBS, and sorted for dual-staining CD8 + PRl- tetramer positive cells. FL1-H is CD8-FITC and FL2-H is PRl-tetramer-PE. The CTL line following sorting is shown. FIG. 7. CTL sorted for PRl -specificity show higher specific lysis of leukemia targets than non-sorted bulk culture CTL, with less background lysis. Day 32 bulk culture PRl-pulsed CTL were compared to PRl-tetramer-sorted CTL as effector cells plated with marrow cells from an HLA-A2.1+ patient with CML in accelerated phase (CML BM) or marrow cells from an HLA identical normal donor (Normal BM). CTL were derived from an unrelated normal donor matched only for HLA-A2. FIG. 8. SSCP analysis of the 5 PR3 exons. Shown here are the best results obtained for each exon (Ex 1 to 5) in 10 pairs of donor-recipient (D-R) pairs. Arrowheads indicated bands present in the recipient but not in the donor. FIG. 9. Pr3 exon 3 containing polymorphism codes for peptides that bind to HLA-A2.1. Surface HLA-A2.1 expression after 18 hr of incubation of T2 cells with 100 microgram of either PR71, PR7V, or control influenza peptide. Isotype control is shown at far left. FIG. 10. Tissue Expression of Proteinase 3. FIGS. 11A-11D. HLA-A*0201 Expression on T2. Lower doses of PRl peptide induce
CTLs with higher intensity PRl /HLA- A2 tetramer staining that correlates with TCR avidity and inversely with effector function threshold. FIG. 11 A - PBMCs collected from healthy HLA- A2.1+ donors were stimulated weekly with PRl peptide-pulsed T2 cells at the peptide concentrations indicated above each FACS plot. After 4 weeks, resulting cultures were stained with CD8 (FITC) Ab and PR1/HLA-A2 tetramer, and the percentage of CD8+ cells that stain with tetramer are noted within each FACS plot. FIG. 11B - Surface HLA-A2 expression on T2 cells increases linearly with increasing concentration of PRl peptide from 2 μM and 200 μM. T2 cells were incubated with PRl peptide at the concentrations shown and surface HLA-A2 expression was measured by flow cytometry. FIG. 11C - CTLs elicited with PRl at 0.2 μM (open circles) or 20 μM (filled squares) PRl were incubated for 4 hr at 37°C with PRl peptide- pulsed T2 cells at the indicated peptide concentrations at an effector/target (E/T) ratio of 10:1 (adjusted based on the number of tetramer-positive CTLs), and percentage of specific lysis was determined. FIG. 11D - Tetramer decay (t 2) was determined to be 58 min and 19 min by plotting normalized antigen-specific fluorescence at the indicated time points for 28-day-old PR1/HLA-A2 tetramer-stained CTLs elicited with 0.2 μM (open circles) or 20 μM PRl (filled squares), respectively. Dissociation kinetics of PR1/HLA-A2 tetramer staining were determined at 4°C in the presence of saturating concentrations of BB7.2 Ab to prevent rebinding of tetramer and in the presence of PI (1 μg/ml) to eliminate dead cells from the FACS gate. FIGS. 12A-12B. Spectratyppe from high and low avidity PRl -specific CTL cultures. Vβ2 and Vβ 11 at day 0 and day 26 are shown. FIG. 12A - 0.2 μM PRl . FIG. 12B - 20 μPRl . FIGS. 13A-13B. High-avidity PRl -specific CTLs cause more specific lysis of CML BM cells than low-avidity PRl-specific CTLs. After 4 weeks in culture, PRl- stimulated CTLs were coincubated in a 4-hr microcytotoxicity assay with bone marrow cells, and specific lysis was determined. Six replicate wells were used for each dilution of effector cells. Specific lysis is plotted versus E/T ratio, and effector number was normalized for the number of PR1/HLA-A2 tetramer-staining cells in the bulk culture. FIG. 13 A - High-avidity PRl -specific CTLs from a healthy donor showed greater specific lysis of CML target cells than low-avidity PRl -specific CTLs. FIG. 13B - PRl -specific CTL line from a CML patient 3 months after IFN treatment preferentially lyse autologous BM target cells taken at time of diagnosis over healthy HLA-A2+ BM cells from a third party, and the amount of CML target cell lysis is similar to that produced by healthy donor-derived low-avidity PRl -specific CTLs. FIGS. 14A-14C. Only low-avidity PRl-specific CTLs are elicited from peripheral blood of CML patients. PBMCs from three different HLA-A2+ CML patients were stimulated weekly with PRl -pulsed T2 cells with PRl ranging from 0.002 μM to 200 μM. After 4 weeks, resultant cultures were stained with CD8 Ab and PR1/HLA-A2 tetramer and analyzed by FACS. The percentage of CD8+ cells that stain with relevant tetramer is indicated within each FACS plot. FIG. 14A - Cultures elicited with 0.2 μM, 0.02 μM, and 0.002 μM PRl resulted in CTLs with lower-intensity tetramer staining than CTLs from healthy donors elicited with similar doses of PRl. FIG. 14B - PBMCs from an untreated chronic phase CML patient (CML no. 4) were studied weekly prior to restimulation with PRl -pulsed T2 cells with PRl /HLA- A2 tetramer. Only PRl-specific CTLs with low-intensity tetramer staining emerge over the 4 weeks, and no relatively high tetramer intensity CTLs are present. FIG. 14C - PBMCs from CML no. 2 stimulated weekly with 0.2 μM pp65 peptide elicited CTLs with high-intensity pp65/HLA-A2 tetramer staining after 4 weeks in culture. FIGS. 15A-15C. High-avidity PRl-specific CTLs are identified in the peripheral blood of IFN sensitive CML patients (FIG. 15 ) in cyto genetic remission, but not in (FIG. 15B) IFN- resistant or in (FIG. 15C) untreated newly diagnosed CML patients. PBMCs were stained with CD8, dump (CD14 + CD19), and PR1-HLA-A2 tetramer. Patients 5-8 were treated for a minimum of 9 months with IFN. The percentage of Ph+ chromosomes in a simultaneous BM specimen is indicated above each FACS plot, and the percentage of CD8+ cells with high-avidity PRl-specific CTLs is indicated within each FACS plot. FIGS. 16A-16B. High-avidity PRl-specific CTLs undergo apoptosis 18 hr after stimulation with high-concentration PRl peptide. PBMCs from a healthy donor 28 days after weekly restimulation with either 0.2 μM or 20 μM PRl -pulsed T2 cells established relatively high- and low-avidity PRl -CTL, respectively (far left panels). The resulting PRl -CTLs were washed and combined in a 1:1 ratio, based on the number of tetramer-positive cells, with T2 cells pulsed with either 0.2 μM or 20 μM PRl peptide. After 16 to 18 hr, cells were stained with Annexin V Ab, and live cells were analyzed based on PI staining. The percentage of CD8+ cells that are tetramer-positive is shown in the far left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels. FIG. 16A - Annexin V expression increased on high-avidity PRl -CTLs exposed to high-concentration (20 μM) PRl, but not after exposure to low (0.2 μM) concentration PRl . Annexin V upregulation was blocked by pretreating peptide-pulsed T2 cells with anti-HLA-A2 (BB7.2) prior to coculture with PRl -CTL. FIG. 16B - Annexin V was not upregulated 18 hr after coculture of low-avidity PRl -CTLs with either low-concentration (0.2 μM) or high concentration (20 μM) PRl peptide. FIGS. 17A-17D. High-avidity PRl-CTLs undergo apoptosis 18 hr after coincubation with HLA-A2+ CML cells that overexpress proteinase 3. High- and low-avidity PRl-CTLs were combined in a 1:1 ratio, based upon the number of tetramer-positive cells, with CML BM cells from untreated HLA-A2+ and HLA-A2- patients. Annexin V staining was measured on live cells, based on PI staining, 18 hr after coincubation. The percentage of CD8+ cells that are tetramer- positive is shown in the left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels. FIG. 17A - Annexin V was upregulated in the high-avidity PRl-CTLs after coincubation with HLA-A2+ cells, but not after coincubation with HLA-A2- cells. Remaining low-avidity PRl-CTLs in the culture did not upregulate annexin V. FIG. 17B - hi contrast, low-avidity PRl-CTLs did not upregulate annexin V after coincubation with either HLA-A2+ or HLA-A2" CML BM cells. FIG. 17C - Overall MHC-I expression and proteinase 3 expression was similar in both CML BM target cells, as measured by surface staining with pan-HLA-A,B,C Ab. FIG. 17D - Proteinase 3 expression was 2.8- and 3.3-fold higher in the HLA-A2+ and the HLA-AT patient BM, respectively, compared with healthy donor BM cells. FIG. 18. High avidity PRl -CTL in IFN-sensitive CML patients off therapy. FIG. 19. PRl -CTL phenotype in CML patients in CCR off interferon: High avidity PR1- CTL have an effector memory phenotype. FIG. 20. PRl vaccine elicits PRl -CTL immunity at injection site. FIG. 21. PRl vaccine induces immune responses and clinical responses. FIG. 22. PRl vaccine induces PRl -CTL immunity and molecular remission in UPN4 with AML. The fraction of functional PR1-CTL vs pp65-CTL is similar in CMV+ patients with an immune response to the PRl vaccine. FIG. 23. PRl vaccine elicits functional PRl -CTL immunity that persiste beyond 6 months. UPN9: PBMC analyzed six months after 3rd injection of PRl (1.0 mg) for tetramer+ and CD69/IFN+ PR1-CTL. FIGS. 24A-24B. In UPN4 patient with AML t(15;17) long term molecular remission after vaccine-induced expansion of PRl -CTL was test (FIG. 24A) and vaccine-induced PR1- CTL was shown to preferentially kill leukemia cells (FIG. 24B). FIG. 25. PRl vaccine induces molecular remission in UPN15 patient with inv(16) AML. FIG. 26. Clinical response correlates with immune response and higher T Cell Receptor avidity of PRl -CTL. The data shows 5 clinical responses in 8 patients with immune response versus 0 clinical responses in 7 patients without immune response, p = 0.02. FIGS. 27A-27D. High avidity PRl -CTL are preferentially lost after vaccination and remaining low avidity PRl -CTL specifically kill autologous leukemia cells in UPN6 patient. FIG. 27A - Using sample from patient 6 (UPN 6) percent antigens specific CTL was assessed.
FIG. 27B - Pre and Post-vaccine. FIG. 27C - PR1/A2 Tetramer-Sorted CTL Are Peptide
Specific. FIG. 27D - Tetramer-Sorted PRl -CTL Preferentially Kill CML. FIG. 28. High affinity PR1-CTL are absent in UPN 6 after vaccination. UPN6 (CML) and UPN4 (AML) patient samples are compared 30 days post-PRl at 200 μM and 0.2 μM. High PRl -CTL avidity was found to be expanded in UPN4 but not UPN6I patient. FIGS. 29A-29B. PR1-CTL immunity at day 60 correlates with remission at 1 year after NST for AML. FIG. 30. Efficiency of various APC populations to elicit CTL. Cell count comparison of CTL cultures elicited with PRl -pulsed T2 DC/IGM or DC/4GM antigen presenting cells. FIGS. 31A-31B. Cytotoxicity comparison of PR1-CTL elicited with various APCs.
Percent specific lysis for T2 alone versus T2 + PRl in DC/IGM (FIG. 31A) or DC/4GM (FIG. 31B) antigen presenting cells is shown. FIG. 32. Comparison of DC growth conditions on CTL stimulation. Cell proliferation of PRl -CTL lines stimulated with autologous DC/IGM under various culture conditions is shown. FIGS. 33A-33C. IFN-Induced P3 expression correlates with PRl -CTL response and
CCR to IFN. FIG. 34. Five MPO-Deduced Peptides Bind to HLA-A2.1. FIG. 35. MY2-Specific CTL Kill Leukemia Cells and Also Healthy Donor Marrow Cells. FIG. 36. MY4-Sepcific CTL Preferentially Kill AML Bone Marrow Cells And Not
Healthy Bone Marrow Cells. FIG. 37. MY4-Specific CTL Lysis of MY4-Pulsed T2 Cells is HLA-A2-Restricted. FIG. 38. MY4-CTL Inhibit Leukemia Progenitors. FIG. 39. MPO Protem is Present in CD34+ Leukemia Cells, but not Normal CD34+ Cells. FIG. 40. Tissue Expression of Myeloperoxidase. FIG. 41. Multiple Peptide/HLA-A2-Tetramers Can Be Used To Simultaneously Stain Single Patient Samples. FIG. 42. PR1-, MY2- & MY4-CTL Are Not Present In Healthy Donors Or NST Recipients With Lymphoid Malignancies. FIG. 43. PRl -CTL & MY4-CTL, But No MY2-CTL, Are Detectable hi Nonmyeloablative Stem Cell Transplant (NST) Recipients In Complete Remission. FIG. 44. Percentage of PR1-TL, MY4-CTL & HA1-CTL All Correlate with Remission
Status. FIG. 45. PRl -CTL Kill Leukemia but not Normal Marrow. FIG. 46. PRl -CTL Lysis of Targets is HLA-A2-Restricted.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
I. The Present Invention The present invention serves to overcome the deficiencies in the art by providing HLA- restricted peptides, derived from myeloid self-proteins, that can be used to elicit peptide-reactive CTL that preferentially target myeloid leukemia. These peptides and the peptide-reactive CTL will be used in vaccines or as adoptive cellular immunotherapy, to treat patients with myeloid leukemia. In addition, these same peptides also will find use in the treatment of autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infectious disease. The findings of the present invention suggest that the PRl peptide is an important tumor antigen for CTL immune responses against this form of leukemia, and provide the first direct evidence that an antigen-specific T cell response contributes to its control. PRl-specific CTL are found in the majority of patients that achieve remission with IFN-α2b therapy or with allogeneic BMT, therapies thought to potentially work through an immune mechanism. The inventors have shown that normal healthy donors have existent CTL immunity to PRl and that CML patients who have a cyto genetic remission after treatment with interferon also have effective PRl- specific CTL immunity toward their leukemia cells, while patients without cytogenetic responses do not, thus establishing PRl as the first leukemia-associated tumor antigen. The present invention also seeks to determine whether vaccination with PRl peptide can enhance immunity toward leukemia, whether the responding T lymphocytes are memory or naϊve, and whether the PRl-specific CTL exhibit T cell receptors (TCRs) with higher or lower affinity for PR1/HLA-A2 compared to healthy individuals. In other aspects of the present invention the in vivo relevance of MY2 and MY4 as leukemia antigens is examined since the peptides were identified using in vitro techniques. Preexisting MY2 and MY4 reactivity by CTL in leukemia patients and their HLA-matched marrow donors will also be examined. The present invention will determine whether MY2- and MY4- specific CTL can be elicited in vitro from leukemia patients using the established methods for eliciting similar responses in normal donors. In the present invention, there is also provided a phase I clinical trial to adoptively transfer MY4-specific CTL to acute myeloid leukemia patients following NST as a way to enhance GVL while abrogating GVHD. Ways to enhance MY4 responses in vitro will also be assessed, and the remainder of the HLA-A2.1 -restricted, HLA-A3- restricted, and HLA-B7-restricted peptides from MPO with predicted high MHC binding will be examined for their capacity to elicit myeloid leukemia-reactive CTL responses similar to MY4 and PRl.
II. Definitions The phrases "isolated" or "biologically pure" refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state. Thus, isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment. "Major histocompatibility complex" or "MHC" is a cluster of genes that plays a role in control of the cellular interactions responsible for physiologic immune responses, hi humans, the MHC complex is also known as the HLA complex. For a detailed description of the MHC and HLA complexes (see Paul, 1993). "Human leukocyte antigen" or "HLA" is a human class I or class II major histocompatibility complex (MHC) protein (see, e.g., Stites, 1994). An "HLA supertype or family", as used herein, describes sets of HLA molecules grouped on the basis of shared peptide-bindmg specificities. HLA class I molecules that share somewhat similar binding affinity for peptides bearing certain amino acid motifs are grouped into HLA supertypes. The terms HLA superfamily, HLA supertype family, HLA family, and HLA xx-like supertype molecules (where xx denotes a particular HLA type), are synonyms. The term "motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule. Peptide motifs are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues. A "supermotif ' is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Thus, a preferably is recognized with high or intermediate affinity (as defined herein) by two or more HLA antigens. "Cross-reactive binding" indicates that a peptide is bound by more than one HLA molecule; a synonym is degenerate binding. A "protective immune response" refers to a CTL and/or an HTL response to an antigen derived from an infectious agent or a tumor antigen, which prevents or at least partially arrests disease symptoms or progression. The immune response may also include an antibody response which has been facilitated by the stimulation of helper T cells.
III. HLA-Restricted Peptides The present provides a vaccine comprising a tumor-associated HLA-restricted peptide.
"Human leukocyte antigen" or "HLA" is a human class I or class II major histocompatibility complex (MHC) protein (see, e.g., Stites, 1994). An "HLA supertype or family", as used herein, describes sets of HLA molecules grouped on the basis of shared peptide-binding specificities. HLA class I molecules that share somewhat similar binding affinity for peptides bearing certain amino acid motifs are grouped into HLA supertypes. The terms HLA superfamily, HLA supertype family, HLA family, and HLA xx-like supertype molecules (where xx denotes a particular HLA type), are synonyms. HLA-restricted molecules of the present invention may include HLA-A2, HLA- A3, HLA-A11, HLA-B7, HLA-B27, or HLA-B35; but are not limited to such. HLA-restricted antigens/peptides include, but are not limited to: 707 alanine proline
(707-AP); alpha (α)-fetoprotein (AFP); adenocarcinoma antigen recognized by T cells 4 (ART- 4); B antigen (BAGE); -catenin/m, β-catenin/mutated; breakpoint cluster region-Abelson (Bcr- abl); CTL-recognized antigen on melanoma (CAMEL); carcinoembryonic antigen peptide - 1 (CAP-1); caspase-8 (CASP-8); cell-division-cycle 27 mutated (CDC27m); cycline-dependent kinase 4 mutated (CDK4/m); carcinoembryonic antigen (CEA); cancer/testis (antigen) (CT); cyclophilin B (Cyp-B); differentiation antigen melanoma (the epitopes of DAM-6 and DAM-10 are equivalent, but the gene sequences are different. DAM-6 is also called MAGE-B2 and DAM- 10 is also called MAGE-B1) (DAM); elongation factor 2 mutated (ELF2M); Ets variant gene 6/acute myeloid leukemia 1 gene ETS (ETV6-AM1); glycoprotein 250 (G250); G antigen (GAGE); N-acetylglucosaminyltransferase V (GnT-V); glycoprotein 100 Kd (GplOO); helicose antigen (HAGE); human epidermal receptor-2/neurological (HER-2/neu); arginine (R) to isoleucine (I) exchange at residue 170 of the α-helix of the 2-domain in the HLA-A2 gene (HLA-A*0201-R170I); human papilloma virus E7 (HPV-E7); heat shock protein 70 - 2 mutated (HSP70-2M); human signet ring tumor - 2 (HST-2); human telomerase reverse transcriptase (hTERTox hTRT); intestinal carboxyl esterase (iCE); name of the gene as it appears in databases (KIAA0205); L antigen (LAGE); low density lipid receptor/GDP-L-fucose (LDLR/FUT); β-D- galactosidase 2- -L-fucosyltransferase; melanoma antigen (MAGE); melanoma antigen recognized by T cells- 1 /Melanoma antigen A (MART-1/Melan-A); melanocortin 1 receptor (MCIR); myosin mutated (Myosin/m); mucin 1 (MUCl); melanoma (MUM-1, -2, -3); ubiquitous mutated 1, 2, 3; NA cDNA clone of patient M88 (NA88-A); New York - esophageous 1 (NY- ESO-1); protein 15 (PI 5); protein of 190 (pi 90 minor bcr-abl); KD bcr-abl; promyelocytic leukaemia/retinoic acid receptor α (Pml/RARa); preferentially expressed antigen of melanoma (PRAME); prostate-specific antigen (PSA); prostate-specific membrane antigen (PSM); renal antigen (RAGE); renal ubiquitous 1 or 2 (RUl or RU2); sarcoma antigen (SAGE); squamous antigen rejecting tumor 1 or 3 (SART-1 or SART-3); translocation Ets-family leukemia acute myeloid leukemia 1 (TEL/AML1); triosephosphate isomerase mutated (TPI/m); tyrosinase related protein 1, or gp75 (TRP-1); tyrosinase related protein 2 (TRP-2); TRP-2/intron 2 (TRP-2/1NT2); Wilms' tumor gene (WT1) or any such HLA-restricted antigen or peptide known to one of ordinary in the art. In particular embodiments, the present invention contemplates the use of HLA-restricted peptide for treating diseases or conditions including but not limited to cancers, autoimmune diseases, transplant rejection, post-transplant antitumor immunity and vasculitis and infections.
IV. Myeloid-Restricted Antigens To adapt what has been learned about immunity against melanoma antigens to the study of myeloid leukemia antigens, myeloid-restricted normal proteins that are highly expressed in the leukemia are studied. Myeloid leukemias express a number of differentiation antigens associated with granule formation. These antigens may include proteinease-3 (Pr3 or P3), neutrophil elastase, myeloperoxidase, cylcin El, cyclin D, or a cyclin E2; but are not limited to such. Particular examples of myeloid-restricted peptides, such as Pr3 and myeloperoxidase, are provided herein. P3 and two other azurophil granule proteins, neutrophil elastase and azurocidin, are coordinately regulated and the transcription factors PU.l and C/EBPα, which are responsible for normal myeloid differentiation from stem cells to monocytes or granulocytes, are important in mediating their expression (Lewin et al, 2002). These transcription factors have been implicated in leukemogenesis (Behre et al, 1999), and P3 itself may also be important in maintaining a leukemia phenotype since P3 antisense oligonucleotides halt cell division and induce maturation of the HL-60 promyelocytic leukemia cell line (Bories et al, 1989). Critical to identifying T cell antigens in these proteins is the observation that P3 is the target of autoimmune attack in Wegener's granulomatosis (Franssen et al, 1994).
A. Proteinase3 Peptides and Vaccines Pr3 is a 26 kDa neutral serine protease that is stored in primary azurophil granules and is maximally expressed at the promyelocyte stage of myeloid differentiation (Sturrock et al, 1992; Chen et al, 1994; Muller-Berat et al, 1994; Lewin et al, 2002; Behre et al, 1999). The human gene contains 5 exons, is localized on chromosome 19p and has been cloned (Sturrock et al, 1992). Pr3 is overexpressed in a variety of myeloid leukemia cells including 75% of CML patients, approximately 50% of acute myeloid leukemia patients, and approximately 30% of the cases of myelodysplastic syndrome patients (Dengler et al, 1995). Pr3 also has several characteristics that make it an appealing target for vaccine and T cell directed therapy. It is overexpressed in human myeloid leukemia and is generally homogeneous throughout the leukemia. An immune response generated against the antigen could result in complete eradication of the leukemia. Since Pr3 may be important for maintenance of the leukemia phenotype, any selective pressure resulting in Pr3-loss mutants following immunotherapy may not result in "tumor escape." As a protein that is targeted to the endoplasmic reticulum by means of a pre-propeptide leader sequence, any TAP-defϊcient tumor mutants might remain susceptible to an anti-leukemia immune response since the protein would still be available to the MHC class I antigen processing pathway. Additionally, the use of a synthetic peptide derived from Pr3 as the immunizing antigen in a leukemia vaccine offers practical advantages: relatively easy construction and production, chemical stability, and a lack of infectious or oncogenic potential. It has been shown that a small peptide called PRl, a portion of the larger molecule of proteinase 3 (P3) found in myeloid leukemia cells, can be used to generate immune cells, particularly, cytotoxic T lymphocytes (CTL). PRl is a 9 aa peptide comprising amino acid 169- 177, that binds to HLA-A2.1, thereby eliciting CTL from an HLA-A2.1+ normal donor in vitro. These PRl-specific CTL show preferential cytotoxicity toward allogeneic HLA-A2.1+ myeloid leukemia cells over HLA-identical normal donor marrow (Molldrem et al, 1996). PRl-specific CTL also inhibit colony-forming unit granulocyte-macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA-matched donors (Molldrem et al, 1997). These CTL, generated from normal healthy donors, preferentially kill leukemia cells while leaving normal bone marrow cells unharmed. More recently, it was found that CML patients who enter remission after treatment with either BMT or interferon have highly increased numbers of very effective PRl-specific CTL that kill their leukemia cells. PRl is therefore the first peptide antigen identified that can elicit specific CTL lysis of fresh human myeloid leukemia cells. B. Myeloperoxidase (MPO) Peptides and Vaccines The invention also provides peptides of myeloperoxidase (MPO), another myeloid- restricted protein, which is a heme protem synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains (Franssen et al, 1996). This enzyme produces hypohalous acids central to the microbicidal activity of netrophils. Importantly, MPO (like Pr3) is overexpressed in a variety of myeloid leukemia cells including 75% of CML patients, approximately 50% of acute myeloid leukemia patients, and approximately 30% of the cases of myelodysplastic syndrome patients (Williams et al, 1994). While Pr3 is the target of autoimmune attack in Wegener's granulomatosis MPO is the target antigen in small vessel vasculitis (Franssen et al, 1996; Brouwer et al, 1994; Molldrem et al, 1996) respectively, with evidence for both T-cell and antibody immunity in patients with these diseases. Wegener's granulomatosis is associated with production of cytoplasmic antineutrophil cytoplasmic antibodies (cANCA) with specificity for Pr3 (Molldrem et al, 1997), while microscopic polyangiitis and Churg-Strauss syndrome are associated with perinuclear ANCA (pANCA) with specificity for MPO (Molldrem et al, 1999; Savage et al, 1999). T-cells taken from such leukemia patients proliferate in response to crude extracts from neutrophil granules and to the purified proteins (Brouwer et al, 1994; Yee et al, 1999). These findings (summarized in Table 1) indicate that T cell responses against these proteins might be relatively easy to elicit. Table 1 : T cell Responses Myeloperoxidase (MPO)
Granule protein of 80kD, gene on chromosome 17q Target antigen of the pANCA antibody in small vessel Vasculitis, Churg-Strauss syndrome, and crescentic Glomerulonephritis Expressed in very early myeloid progenitors Most abundant protein in myeloid cells Aberrantly expressed in CD34+ myeloid leukemia cells (MDS, AML & CML)
V. Tumor-Associated HLA-Restricted Peptides and Vaccines In certain embodiments, the present invention concerns tumor-associated HLA-restricted peptide or antigen compositions comprising at least one HLA-restricted peptide, such as proteinase3 (P3 or Pr3) or myeloperoxidase (MYO) for use as a vaccine in treating cancers, autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infections. As used herein, an "antigenic composition" may comprise an antigen (e.g., a peptide or polypepide), a nucleic acid encoding an antigen (e.g., an antigen expression vector), or a cell expressing or presenting an antigen. For an antigenic composition, such as a tumor-associated HLA-restricted peptide or antigen of the present invention, to be useful as a vaccine, the antigenic composition must induce an immune response to the antigen in a cell, tissue or animal (e.g., a human). In particular embodiments, the antigenic composition comprises or encodes all or part of the sequences shown in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ LD NO:7, SEQ ID NO:8, SEQ LD NO:9, SEQ ID NO:10, SEQ LD NO:ll, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ LD NO:20, SEQ LD NO:21, SEQ LD NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ LD NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ LD NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ LD NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ LD NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ LD NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63 or an immunologically functional equivalent thereof. As used herein, an "amino acid molecule" or "amino acid residue" refers to any naturally occurring amino acid, any amino acid derivative or any amino acid mimic known in the art, including modified or unusual amino acids. In certain embodiments, the residues of the protein or peptide are sequential, without any non-amino acid interrupting the sequence of amino acid residues. In other embodiments, the sequence may comprise one or more non-amino acid moieties. In particular embodiments, the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties. In specific aspects, the composition of the present invention employs a peptide of from about 5 to about 100 amino acids or greater in length. Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides. The nucleotide and protein, polypeptide and peptide sequences corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases located at the National Institutes of Health website. The coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be know to those of ordinary skill in the art. Alternatively, various commercial preparations of proteins, polypeptides and peptides are known to those of skill in the art. The term "peptide" is used interchangeably with "oligopeptide" in the present specification to designate a series of residues, typically L-amino acids, connected one to the other, typically by peptide bonds between the α-amino and carboxyl groups of adjacent amino acids. The preferred CTL-inducing oligopeptides of the invention are 13 residues or less in length and usually consist of between about 8 and about 11 residues, preferably 9 or 10 residues. The preferred HTL-inducing oligopeptides are less than about 50 residues in length and usually consist of between about 6 and about 30 residues, more usually between about 12 and 25, and often between about 15 and 20 residues. In certain embodiments the size of the at least one peptide molecule may comprise, but is not limited to, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 60, or greater amino molecule residues, and any range derivable therein. An "immunogenic peptide" or "peptide epitope" is a peptide which comprises an allele- specific motif or supermotif such that the peptide will bind an HLA molecule and induce a CTL and/or HTL response. Thus, immunogenic peptides of the invention are capable of binding to an appropriate HLA molecule and thereafter inducing a cytotoxic T cell response, or a helper T cell response, to the antigen from which the immunogenic peptide is derived. Accordingly, the term "proteinaceous composition" encompasses amino molecule sequences comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid, including but not limited to those shown on Table 2 below.
Table 2: Modified and Unusual Amino Acids
Abbr. Amino Acid Abbr. Amino Acid Aad 2-Aminoadipic acid EtAsn N-Ethylasparagine Baad 3- Aminoadipic acid Hyl Hydroxylysine Bala 2-alanine, -Amino-propionic acid Ahyl Allo-Hydroxylysine Abu 2-Aminobutyric acid 3Hyp 3 -Hydroxyproline 4Abu 4- Aminobutyric acid, piperidinic acid 4Hyp 4-Hydroxyproline Acp 6-Aminocaproic acid Ide Isodesmosine Ahe 2-Aminoheptanoic acid Aile Allo-Isoleucine Aib 2-Aminoisobutyric acid MeGly N-Methylglycine, sarcosine Baib 3-Aminoisobutyric acid Melle N-Methylisoleucine Apm 2-Aminopimeιic acid MeLys 6-N-Methyllysine Dbu 2,4-Diaminobutyric acid MeVal N-Methylvaline Des Desmosine Nva Norvaline Dpm 2,2'-Diaminopimelic acid Nle Norleucine Dpr 2,3-Diaminopropionic acid Orn Ornithine EtGly N-Ethylglycine
In certain embodiments the proteinaceous composition comprises at least one protein, polypeptide or peptide. In further embodiments the proteinaceous composition comprises a biocompatible protein, polypeptide or peptide. As used herein, the term "biocompatible" refers to a substance which produces no significant untoward effects when applied to, or administered to, a given organism according to the methods and amounts described herein. Such untoward or undesirable effects are those such as significant toxicity or adverse immunological reactions. In preferred embodiments, biocompatible protein, polypeptide or peptide containing compositions will generally be mammalian proteins or peptides or synthetic proteins or peptides each essentially free from toxins, pathogens and harmful immunogens. In certain embodiments a proteinaceous compound may be purified. Generally,
"purified" will refer to a specific or protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as would be known to one of ordinary skill in the art for the specific or desired protein, polypeptide or peptide. In certain embodiments, the proteinaceous composition may comprise at least one antibody, for example, an antibody against PRl or myeloperoxidase. As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. The term "antibody" is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (See, e.g., Harlow et al, 1988; incorporated herein by reference). It is contemplated that virtually any protein, polypeptide or peptide containing component may be used in the compositions and methods disclosed herein. However, it is preferred that the proteinaceous material is biocompatible. In certain embodiments, it is envisioned that the formation of a more viscous composition will be advantageous in that will allow the composition to be more precisely or easily applied to the tissue and to be maintained in contact with the tissue throughout the procedure. In such cases, the use of a peptide composition, or more preferably, a polypeptide or protem composition, is contemplated. Ranges of viscosity include, but are not limited to, about 40 to about 100 poise, h certain aspects, a viscosity of about 80 to about 100 poise is preferred.
A. Fusion Proteins of HL A-Restiricted Peptides A specialized kind of insertional variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide. For example, fusions typically employ leader sequences from other species to permit the recombinant expression of a protem in a heterologous host. Another useful fusion includes the addition of an immunologically active domain, such as an antibody epitope, to facilitate purification of the fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification. Other useful fusions include linking of functional domains, such as active sites from enzymes such as a hydrolase, glycosylation domains, cellular targeting signals or transmembrane regions.
B. Variants of HLA-Restiricted Peptides It is contemplated that peptides of the present invention may further employ amino acid sequence variants such as substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide. Substitutions are changes to an existing amino acid. These sequence variants may generate truncations, point mutations, and frameshift mutations. As is known to one skilled in the art, synthetic peptides can be generated by these mutations. It also will be understood that amino acids sequence variants may include additional residues, such as additional N- or C-terminal amino acids, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological activity. The following is a discussion based upon changing the amino acids of a protein, such as a
HLA-restricted peptide or protein of the invention, to create a mutated, truncated, or modified protein. For example, certain amino acids may be substituted for other amino acids in the tumor- associated HLA-restricted peptide or protein such as a Pr3 or MYO protein, resulting in a greater CTL immune response in cells such as a myeloid cell. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying nucleic acid coding sequence, thereby producing a mutated, truncated or modified protein. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 ± 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (- 0.5 ± 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3). It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within ± 0.5 are even more particularly preferred. As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine. The present invention may also employ the use of peptide mimetics for the preparation of polypeptides (see e.g., Johnson, 1993) having' many of the natural properties of a tumor- associated HLA-restricted peptide such as Pr3 or MYO protein, but with altered and/or improved characteristics. The underlying rationale behind the use of peptide mimetics is that the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen. These principles may be used, in conjunction with the principles outline above, to engineer second generation molecules having many of the natural properties of a tumor-associated HLA-restricted peptide but with altered and even improved characteristics. C. Tumor-Associated HLA-Restricted Peptide Purification In certain embodiments the protein(s) of the present invention may be purified. It may be desirable to purify the tumor-associated HLA-restricted peptides, polypeptides or proteins or variants thereof. The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur. Generally, "purified" will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques. In purifying a tumor-associated HLA-restricted peptide of the present invention, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. Although this preparation will be purified in an inactive form, the denatured material will still be capable of transducing cells. Once inside of the target cell or tissue, it is generally accepted that the polypeptide will regain full biological activity. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide. Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "- fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity. It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al, 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary.
VI. HLA-Restricted Antigenic Sequences It is also contemplated in the present invention that peptides corresponding to one or more antigenic determinants of the tumor-associated HLA-restricted peptides or polypeptides may be prepared so that an immune response against the tumor-associated HLA-restricted peptides, polypeptides or proteins, such as Pr3 or MYO is raised. Thus, it is contemplated that vaccination with a tumor-associated HLA-restricted peptides, or polypeptides may generate an autoimmune response in an immunized animal such that autoantibodies that specifically recognize the animal's endogenous tumor-associated HLA-restricted protein. This vaccination technology is shown in U.S. Patents 6,027,727; 5,785,970, and 5,609,870, which are hereby incorporated by reference. Such peptides should generally be at least five or six amino acid residues in length and will preferably be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or about 30 amino acid residues in length, and may contain up to about 35-50 residues. For example, these peptides may comprise a amino acid sequence, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, and 50 or more contiguous amino acids from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ JD NO:7, SEQ JD NO:8, SEQ ID NO:9, SEQ LD NO:10, SEQ JD NO.l l, SEQ JD NO:26, SEQ JD NO:27, SEQ JD NO:28, SEQ JD NO:29, SEQ JD NO:30, SEQ ID NO:31, SEQ JD NO:32, SEQ JD NO:33, SEQ ID NO:34, SEQ JD NO:35, SEQ JD NO:36, SEQ JD NO:37, SEQ ID NO:38, SEQ JD NO:39, SEQ JD NO:42, SEQ JD NO:43, SEQ JD NO:44, SEQ JD NO:45, SEQ JD NO:46, SEQ JD NO:47, SEQ JD NO:48, SEQ JD NO:50, SEQ JD NO:51, SEQ JD NO:52, SEQ JD NO:53, SEQ LD NO:54, SEQ JD NO:55, SEQ JD NO:56, SEQ JD NO:57, SEQ JD NO:58, SEQ ED NO:59, SEQ ED NO:60, SEQ JD NO:61, SEQ ID NO:62, SEQ ID NO:63. Synthetic peptides will generally be about 35 residues long, which is the approximate upper length limit of automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA). Longer peptides also may be prepared, e.g., by recombinant means. U.S. Patent 4,554,101, incorporated herein by reference, teaches the identification and preparation of epitopes from Primary amino acid sequences on the basis of hydrophilicity. Through the methods disclosed in Hopp, one of skill in the art would be able to identify epitopes from within an amino acid sequence such as the tumor-associated HLA-restricted peptides sequences disclosed herein in SEQ ID NO:l, SEQ ED NO:2, SEQ ED NO:3, SEQ ED NO:4, SEQ ED NO:5, SEQ JD NO:6, SEQ ID NO:7, SEQ JD NO:8, SEQ JD NO:9, SEQ JD NO: 10, SEQ JD NO:ll, SEQ JD NO:26, SEQ JD NO:27, SEQ JD NO:28, SEQ JD NO:29, SEQ ED NO:30, SEQ ED NO:31, SEQ JD NO:32, SEQ ID NO:33, SEQ ED NO:34, SEQ ED NO:35, SEQ ED NO:36, SEQ ED NO:37, SEQ ID NO:38, SEQ ED NO:39, SEQ ED NO:42, SEQ ED NO:43, SEQ ED NO:44, SEQ JD NO:45, SEQ JD NO:46, SEQ JD NO:47, SEQ JD NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ JD NO:53, SEQ ED NO:54, SEQ ED NO:55, SEQ ED NO:56, SEQ JD NO:57, SEQ ID NO:58, SEQ JD NO:59, SEQ JD NO:60, SEQ JD NO:61, SEQ JD NO:62, SEQ ED NO:63. Numerous scientific publications have also been devoted to the prediction of secondary structure, and to the identification of epitopes, from analyses of amino acid sequences (Chou and Fasman, 1974a,b; 1978a,b; 1979). Any of these may be used, if desired, to supplement the teachings of Hopp inU.S. Patent 4,554,101. Moreover, computer programs are currently available to assist with predicting antigenic portions and epitopic core regions of proteins. Examples include those programs based upon the Jameson- Wolf analysis (Jameson and Wolf, 1988; Wolf et al, 1988), the program PepPlot® (Brutlag et al, 1990; Weinberger et al, 1985), and other new programs for protein tertiary structure prediction (Fetrow and Bryant, 1993). Another commercially available software program capable of carrying out such analyses is Mac Vector (EBI, New Haven, CT). In further embodiments, major antigenic determinants of a tumor-associated HLA- restricted peptide may be identified by an empirical approach in which portions of the gene encoding the tumor-associated HLA-restricted peptides are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response. For example, PCR™ can be used to prepare a range of peptides lacking successively longer fragments of the C- terminus of the protein. The immunoactivity of each of these peptides is determined to identify those fragments or domains of the polypeptide that are immunodominant. Further studies in which only a small number of amino acids are removed at each iteration then allows the location of the antigenic determinants of the polypeptide to be more precisely determined. Another method for determining the major antigenic determinants of a polypeptide is the SPOTs system (Genosys Biotechnologies, Inc., The Woodlands, TX). In this method, overlapping peptides are synthesized on a cellulose membrane, which following synthesis and deprotection, is screened using a polyclonal or monoclonal antibody. The antigenic determinants of the peptides which are initially identified can be further localized by perfonning subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive peptide. Once one or more such analyses are completed, polypeptides are prepared that contain at least the essential features of one or more antigenic determinants. The peptides are then employed in the generation of antisera against the polypeptide. Minigenes or gene fusions encoding these determinants also can be constructed and inserted into expression vectors by standard methods, for example, using PCR™ cloning methodology. The use of such small peptides for antibody generation or vaccination typically requires conjugation of the peptide to an immunogenic carrier protein, such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin, or other adjuvants discussed above (adjuvenated peptide). Alum is an adjuvant that has proven sufficiently non-toxic for use in humans. Methods for performing this conjugation are well known in the art. Other immunopotentiating compounds are also contemplated for use with the compositions of the invention such as polysaccharides, including chitosan, which is described in U.S. Patent 5,980,912, hereby incorporated by reference. Multiple (more than one) tumor-associated HLA- restricted epitopes may be crosslinked to one another (e.g., polymerized). Alternatively, a nucleic acid sequence encoding a tumor-associated HLA-restricted peptides, or polypeptides may be combined with a nucleic acid sequence that heightens the immune response. Such fusion proteins may comprise part or all of a foreign (non-self) protein such as bacterial sequences, for example. Antibody titers effective to achieve a response against endogenous tumor-associated HLA-restricted peptides, or polypeptides will vary with the species of the vaccinated animal, as well as with the sequence of the administered peptide. However, effective titers may be readily determined, for example, by testing a panel of animals with varying doses of the specific antigen and measuring the induced titers of autoantibodies (or anti-self antibodies) by known techniques, such as ELISA assays, and then correlating the titers with a related cancer characteristics, e.g., tumor growth or size. One of ordinary skill would know various assays to determine whether an immune response against a tumor-associated HLA-restricted peptide was generated. The phrase "immune response" includes both cellular and humoral immune responses. Various B lymphocyte and T lymphocyte assays are well known, such as ELIS As, cytotoxic T lymphocyte (CTL) assays, such as chromium release assays, proliferation assays using peripheral blood lymphocytes (PBL), tetramer assays, and cytokine production assays. See Benjamini et al. (1991), hereby incorporated by reference.
VII. Vaccine Components In other embodiments of the invention, the antigenic composition, such a tumor- assoicated HLA-restricted peptide or antigen, may comprises an additional immunostimulatory agent or nucleic acids encoding such an agent. Immunostimulatory agents include but are not limited to an additional antigen, an immunomodulator, an antigen presenting cell or an adjuvant. In other embodiments, one or more of the additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination, hi certain embodiments, the antigenic composition is conjugated to or comprises an HLA anchor motif amino acids.
A. Adjuvants As also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Patent 4,877,611). Immunization protocols have used adjuvants to stimulate responses for many years, and as such adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation. For many cancers, there is compelling evidence that the immune system participates in host defense against the tumor cells, but only a fraction of the likely total number of tumor-specific antigens are believed to have been identified to date. The use of the tumor- associated HLA-restricted antigens of the present invention with the inclusion of a suitable adjuvant will likely increase the anti-tumor response of the antigens. S uitable molecule adjuvants mclude all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions. Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant. Other adjuvants that may also be used include IL-1, IL-2, IL-4, JL-7, IL-12, interferon, GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL). REBI, which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion also is contemplated. MHC antigens may even be used. In one aspect, an adjuvant effect is achieved by use of an agent, such as alum, used in about 0.05 to about 0.1% solution in phosphate buffered saline. Alternatively, the antigen is made as an admixture with synthetic polymers of sugars (Carbopol®) used as an about 0.25 % solution. Adjuvant effect may also be made my aggregation of the antigen in the vaccine by heat treatment with temperatures ranging between about 70° to about 101°C for a 30 second to 2- inute period, respectively. Aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, mixture with bacterial cell(s) such as C. parvum, an endotoxin or a lipopolysaccharide component of Gram-negative bacteria, emulsion in physiologically acceptable oil vehicles, such as mamiide mono-oleate (Aracel A), or emulsion with a 20% solution of a perfluorocarbon (Fluosol-DA®) used as a block substitute, also maybe employed. Some adjuvants, for example, certain organic molecules obtained from bacteria, act on the host rather than on the antigen. An example is muramyl dipeptide (N-acetylmuramyl- L-alanyl-D-iso glutamine [MDP]), a bacterial peptidoglycan. The effects of MDP, as with most adjuvants, are not fully understood. MDP stimulates macrophages but also appears to stimulate B cells directly. The effects of adjuvants, therefore, are not antigen-specific. If they are administered together with a purified antigen, however, they can be used to selectively promote the response to the antigen. In certain embodiments, hemocyanins and hemoerythrins may also be used in the invention. The use of hemocyanin from keyhole limpet (KLH) is preferred in certain embodiments, although other molluscan and arthropod hemocyanins and hemoerythrins may be employed. Various polysaccharide adjuvants may also be used. For example, the use of various pneumococcal polysaccharide adjuvants on the antibody responses of mice has been described (Yin et al, 1989). The doses that produce optimal responses, or that otherwise do not produce suppression, should be employed as indicated (Yin et al, 1989). Polyamine varieties of polysaccharides are particularly preferred, such as chitin and chitosan, including deacetylated chitin. Another group of adjuvants are the muramyl dipeptide (MDP, N-acetylmuramyl- L-alanyl-D-isoglutamine) group of bacterial peptidoglycans. Derivatives of muramyl dipeptide, such as the amino acid derivative threonyl-MDP, and the fatty acid derivative MTPPE, are also contemplated. U.S. Patent 4,950,645 describes a lipophilic disaccharide-tripeptide derivative of muramyl dipeptide which is described for use in artificial liposomes formed from phosphatidyl choline and phosphatidyl glycerol. It is the to be effective in activating human π onocytes and destroying tumor cells, but is non-toxic in generally high doses. The compounds of U.S. Patent 4,950,645 and PCT Patent Application WO 91/16347, are contemplated for use with cellular carriers and other embodiments of the present invention. BCG (bacillus Cahnette-Guerin, an attenuated strain of Mycobacterium) and BCG-cell wall skeleton (CWS) may also be used as adjuvants, with or without trehalose dimycolate. Trehalose dimycolate may be used itself. Trehalose dimycolate administration has been shown to correlate with augmented resistance to influenza virus infection in mice (Azuma et al, 1988). Trehalose dimycolate may be prepared as described in U.S. Patent 4,579,945. BCG is an important clinical tool because of its immunostimulatory properties. BCG acts to stimulate the reticulo-endothelial system, activates natural killer cells and increases proliferation of hematopoietic stem cells. Cell wall extracts of BCG have proven to have excellent immune adjuvant activity. Molecular genetic tools and methods for mycobacteria have provided the means to introduce foreign genes into BCG (Jacobs et al, 1987; Snapper et al, 1988; Husson et α/., 1990; Martin et al, 1990). Live BCG is an effective and safe vaccine used worldwide to prevent tuberculosis. BCG and other mycobacteria are highly effective adjuvants, and the immune response to mycobacteria has been studied extensively. With nearly 2 billion immunizations, BCG has a long record of safe use in man (Luelmo, 1982; Lotte et al, 1984). It is one of the few vaccines that can be given at birth, it engenders long-lived immune responses with only a single dose, and there is a worldwide distribution network with experience in BCG vaccination. An exemplary BCG vaccine is sold as TICE BCG (Organon Inc., West Orange, NJ). Amphipathic and surface active agents, e.g., saponin and derivatives such as QS21 (Cambridge Biotech), form yet another group of adjuvants for use with the immunogens of the present invention. Nonionic block copolymer surfactants (Rabinovich et al, 1994) may also be employed. Oligonucleotides are another useful group of adjuvants (Yamamoto et al, 1988). Quil A and lentinen are other adjuvants that may be used in certain embodiments of the present invention. Another group of adjuvants are the detoxified endotoxins, such as the refined detoxified endotoxin of U.S. Patent 4,866,034. These refined detoxified endotoxins are effective in producing adjuvant responses in mammals. Of course, the detoxified endotoxins may be combined with other adjuvants to prepare multi-adjuvant-incorporated cells. For example, combination of detoxified endotoxins with trehalose dimycolate is particularly contemplated, as described in U.S. Patent 4,435,386. Combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids is also contemplated (U.S. Patent 4,505,899), as is combination of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose dimycolate, as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900. Combinations of just CWS and trehalose dimycolate, without detoxified endotoxins, is also envisioned to be useful, as described in U.S. Patent 4,520,019. Those of skill in the art will know the different kinds of adjuvants that can be conjugated to cellular vaccines in accordance with this invention and these include alkyl lysophosphilipids (ALP); BCG; and biotin (including biotinylated derivatives) among others. Certain adjuvants particularly contemplated for use are the teichoic acids from Gram-cells. These include the lipoteichoic acids (LT ), ribitol teichoic acids (R ) and glycerol teichoic acid (GTA). Active forms of their synthetic counterparts may also be employed in connection with the invention (Takada et Ω/., 1995). Various adjuvants, even those that are not commonly used in humans, may still be employed in animals, where, for example, one desires to raise antibodies or to subsequently obtain activated T cells. The toxicity or other adverse effects that may result from either the adjuvant or the cells, e.g., as may occur using non-irradiated tumor cells, is irrelevant in such circumstances. Adjuvants may be encoded by a nucleic acid (e.g., DNA or RNA). It is contemplated that such adjuvants may be also be encoded in a nucleic acid (e.g., an expression vector) encoding the antigen, or in a separate vector or other construct. Nucleic acids encoding the adjuvants can be delivered directly, such as for example with lipids or liposomes.
B. Biological Response Modifiers In addition to adjuvants, it may be desirable to coadminister biologic response modifiers (BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, Cimetidine (CM; 1200 mg/d) (Smith Kline, PA); low-dose Cyclophosphamide (CYP; 300 mg/m2) (Johnson/ Mead, NJ), cytokines such as interferons, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7. C. Chemokines Chemokines, nucleic acids that encode for chemokines, and/or cells that express such also may be used as vaccine components. Chemokines generally act as chemoattractants to recruit immune effector cells to the site of chemokine expression. It may be advantageous to express a particular chemokine coding sequence in combination with, for example, a cytokine coding sequence, to enhance the recruitment of other immune system components to the site of treatment. Such chemokines include, for example, RANTES, MCAF, MIP1 -alpha, MIPl-Beta, IP- 10 and combinations thereof. The skilled artisan will recognize that certain cytokines are also known to have chemoattractant effects and could also be classified under the term chemokines. D. Immunogenic Carrier Proteins h certain embodiments, an antigenic composition may be chemically coupled to a carrier or recombinantly expressed with a immunogenic carrier peptide or polypetide (e.g., a antigen- carrier fusion peptide or polypeptide) to enhance an immune reaction. Exemplary and preferred immunogenic carrier amino acid sequences include hepatitis B surface antigen, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as immunogenic carrier proteins. Means for conjugating a polypeptide or peptide to a immunogenic carrier protein are well known in the art and include, for example, glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis-biazotized benzidine.
VIII. Antibodies and Antibody Generation Another embodiment of the present invention are antibodies, in some cases, a human monoclonal antibody immunoreactive with the polypeptide sequence of a tumor-associated HLA-restricted peptide of the invention comprising SEQ ED NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ JD NO:5, SEQ JD NO:6, SEQ JD NO:7, SEQ JD NO:8, SEQ JD NO:9, SEQ ED NO:10, SEQ ID NO.ll, SEQ ID NO-.26, SEQ ID NO:27, SEQ ID NO:28, SEQ ED NO:29, SEQ ED NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ JD NO:35, SEQ ID NO:36, SEQ JD NO:37, SEQ JD NO:38, SEQ JD NO:39, SEQ ID NO:42, SEQ JD NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ JD NO:46, SEQ JD NO:47, SEQ ED NO:48, SEQ ED NO:50, SEQ ED NO:51, SEQ ED NO:52, SEQ ED NO:53, SEQ ED NO:54, SEQ ED NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ED NO:59, SEQ ED NO:60, SEQ ID NO:61, SEQ ED NO:62, SEQ ED NO:63 or fragments thereof. It is also understood that this antibody is useful for screening samples from human patients for the purpose of detecting a particular tumor-associated HLA-restricted peptide present in the samples. The antibody also may be useful in the screening of expressed DNA segments or peptides and proteins for the discovery of related antigenic sequences. In addition, the antibody maybe useful in passive immunotherapy for cancer, autoimmune diseases, transplant rejection, post-transplant antitumor immunity, vasculitis and infection. All such uses of the antibodies and any antigens or epitopic sequences so discovered fall within the scope of the present invention. Examples of other antibodies that may be employed in the present invention may include antibodies that react with T cells such as CD1, CD2, CD3, CD5, CD7 CD4, CD6, CD8 and CD27. Antibodies that react with myeloid cells may also be employed and include CD1 lb, CDllc, CD13, CD14, CD15, CD16, CD33, CD48, CD63, CD74, CD65, CD66, CD67 and CD68. Antibodies that react with undifferentiated cells may include HLA-DR, CD34 and CD38. It should be appreciated that multiple combinations of antibodies selected from the ones mentioned above are possible. Accordingly, it will be apparent to one skilled in the art that one can vary the antibody combinations In certain embodiments, the present invention involves antibodies. For example, all or part of a monoclonal, single chain, or humanized antibody may function as a vaccine for cancer. Other aspects of the invention involve administering antibodies as a form of treatment or as a diagnostic to identify or quantify a particular polypeptide, such as tumor-associated HLA- restricted polypeptide, for example Pr3 or MYO polypeptide. As detailed above, in addition to antibodies generated against full length proteins, antibodies also may be generated in response to smaller constructs comprising epitopic core regions, including wild-type and mutant epitopes. As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. The term "antibody" is may also be used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (See, Harlow and Lane, 1988; incorporated herein by reference). Monoclonal antibodies (mAbs) are recognized to have certain advantages, e.g., reproducibility and large-scale production, and their use is generally preferred. The invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin. The methods for generating monoclonal antibodies (mAbs) generally begin along the same lines as those for preparing polyclonal antibodies. Briefly, a polyclonal antibody may be prepared by immunizing an animal with an immunogenic polypeptide composition in accordance with the present invention and collecting antisera from that immunized animal. Alternatively, in some embodiments of the present invention, serum is collected from persons who may have been exposed to a particular antigen. Exposure to a particular antigen may occur a work environment, such that those persons have been occupationally exposed to a particular antigen and have developed polyclonal antibodies to a peptide, polypeptide, or protein. In some embodiments of the invention polyclonal serum from occupationally exposed persons is used to identify antigenic regions in the gelonin toxin through the use of immunodetection methods. A wide range of animal species can be used for the production of antisera. Typically the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies. As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as carriers. Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis- biazotized benzidine. The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate mAbs. mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified polypeptide, peptide or domain, be it a wild-type or mutant composition. The immunizing composition is administered in a manner effective to stimulate antibody producing cells. mAbs may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography. Fragments of the monoclonal antibodies of the invention can be obtained from the monoclonal antibodies so produced by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer. It also is contemplated that a molecular cloning approach may be used to generate mAbs. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this 4 approach over conventional hybridoma techniques are that approximately 10 times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies. Humanized monoclonal antibodies are antibodies of animal origin that have been modified using genetic engineering techniques to replace constant region and/or variable region framework sequences with human sequences, while retaining the original antigen specificity.
Such antibodies are commonly derived from rodent antibodies with specificity against human antigens. Such antibodies are generally useful for in vivo therapeutic applications. This strategy reduces the host response to the foreign antibody and allows selection of the human effector functions. "Humanized" antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof. The techniques for producing humanized immunoglobulins are well known to those of skill in the art. For example U.S. Patent 5,693,762 discloses methods for producing, and compositions of, humanized immunoglobulins having one or more complementarity determining regions (CDR's). When combined into an intact antibody, the humanized immunoglobulins are substantially non- immunogenic in humans and retain substantially the same affinity as the donor immunoglobulin to the antigen, such as a protein or other compound containing an epitope. Examples of other teachings in this area include U.S. Patents 6,054,297; 5,861,155; and 6,020,192, all specifically incorporated by reference. Methods for the development of antibodies that are "custom-tailored" to the patient's disease are likewise known and such custom-tailored antibodies are also contemplated.
IX. Nucleic Acids Encoding HLA-Restricted Protein, Peptides and Polypeptides It is contemplated in the present invention, that the tumor-associated HLA-restricted peptides, or polypeptides may be encoded by a nucleic acid sequence. A nucleic acid may be derived from genomic DNA, complementary DNA (cDNA) or synthetic DNA. Where incorporation into an expression vector is desired, the nucleic acid may also comprise a natural intron or an intron derived from another gene. As used herein, the term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy. A tumor-associated HLA-restricted peptide or polypeptide cDNA, such as a Pr3 or MYO cDNA, for use in the present invention, may be derived from human cDNA but are not limited such. As used herein, the term "nucleic acid segment" refers to a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a nucleic acid segment encoding a polypeptide refers to a nucleic acid segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term "nucleic acid segment" are a polypeptide or polypeptides, DNA segments smaller than a polypeptide, and recombinant vectors, such as, plasmids and other non-viral vectors. The term "recombinant" may be used in conjunction with a polypeptide or the name of a specific polypeptide, and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule. Recombinant vectors and isolated nucleic acid segments may variously include the PRl or myeloperoxidase-coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include PRl or myeloperoxidase-coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences. A "nucleic acid" as used herein includes single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogs. It is contemplated that a nucleic acid within the scope of the present invention may be of about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about 975, about 1000, about U00, about 1200, about 1300, about 1400, about 1500, about 1750, about 2000, about 2250, about 2500 or greater nucleotide residues in length. Those of skill will recognize that in cases where the nucleic acid region encodes a tumor-associated HLA- restricted peptide, or polypeptide, the nucleic acid region can be quite long, depending upon the number of amino acids in the fusion protein. It is contemplated that the tumor-associated HLA-restricted peptide, or polypeptide may be encoded by any nucleic acid sequence that encodes the appropriate amino acid sequence. The design and production of nucleic acids encoding a desired amino acid sequence is well known to those of skill in the art, using standardized codon tables (Table 3). hi preferred embodiments, the codons selected for encoding each amino acid may be modified to optimize expression of the nucleic acid in the host cell of interest. The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids. Codon preferences for various species of host cell are well known in the art. Codons preferred for use in humans, are well known to those of skill in the art (Wada et.a , 1990). Codon preferences for other organisms also are well known to those of skill in the art (Wada et al, 1990, included herein in its entirety by reference). Table 3: Codon Table
Amino Acids Codons
Alanine Ala A GCA GCC GCG GCU
Cysteine Cys C UGC UGU
Aspartic acid Asp D GAC GAU
Glutamic acid Glu E GAA GAG
Phenylalanine Phe F UUC uuu
Glycine Gly G GGA GGC GGG GGU
Histidine His H CAC CAU
Isoleucine He I AUA AUC AUU
Lysine Lys K AAA AAG
Leucine Leu L UUA UUG CUA CUC CUG CUU
Methionine Met M AUG
Asparagine Asn N AAC AAU
Proline Pro P CCA CCC CCG CCU
Glutamine Gin Q CAA CAG
Arginine Arg R AGA AGG CGA CGC CGG CGU
Serine Ser S AGC AGU UCA UCC UCG UCU
Threonine Thr T ACA ACC ACG ACU
Valine Val V GUA GUC GUG GUU
Tryptophan Trp w UGG
Tyrosine Tyr Y UAC UAU
Prokaryote- and or eukaryote-based systems can be used to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. The present invention contemplates the use of such an expression system to produce the tumor-associated HLA- restricted peptide, or polypeptide. More specifically, the present invention employs the use of the insect cell baculovirus system. The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patents 5,871,986, 4,879,236, both herein incorporated by reference, and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACK™ BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH®. In addition to the expression system disclosed in the invention, numerous expression systems exists which are commercially and widely available. One example of such a system is the STRATAGENE®'S COMPLETE CONTROL Inducible Mammalian Expression System, which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN®, which carries the T-REX™ (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter. INVITROGEN® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.
A. Viral Vectors There are a number of ways in which expression vectors may be introduced into cells. In certain embodiments of the invention, the expression vector comprises a virus or engineered vector derived from a viral genome. The ability of certain viruses to enter cells via receptor- mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into mammalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). 1. Adenoviral Vectors A particular method for delivery of the nucleic acid involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue or cell-specific construct that has been cloned therein. Knowledge of the genetic organization or adenovirus, a 36 kb, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kb (Grunhaus and Horwitz, 1992).
2. AAV Vectors The nucleic acid may be introduced into the cell using adenovirus assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten t α , 1992; Curiel, 1994). Adeno-associated virus (AAV) is an attractive vector system for use in the vaccines of the present invention (Muzyczka, 1992). AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin et al, 1986; Lebkowski et al, 1988; McLaughlin et al, 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patents 5,139,941 and 4,797,368, each incorporated herein by reference.
3. Retro viral Vectors Retroviruses have promise as gene delivery vectors in vaccines due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992). In order to construct a retro viral vector, a nucleic acid (e.g., one encoding an antigen of interest) is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et al, 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into a special cell line (e.g., by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al, 1983). The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975). Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. Lentiviral vectors are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al, 1991; Blomer et al, 1997; U.S. Patents 6,013,516 and 5,994,136). Some examples of lentivirus include the Human Immunodeficiency Viruses: HIV-1, HEV-2 and the Simian Immunodeficiency Virus: S . Lentiviral vectors have been generated by multiply attenuating the HIN virulence genes, for example, the genes env, vifi vpr, vpu and nefaxe deleted making the vector biologically safe. Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference. One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type. By inserting a sequence (including a regulatory region) of interest into the viral vector, along with another gene 5 which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific.
4. Other Viral Vectors Other viral vectors may be employed as vaccine constructs in the present invention.0 Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et α ., 1988), sindbis virus, cytomegalovirus and herpes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988; Horwich et al, 1990). 5 5. Delivery Using Modified Viruses A nucleic acid to be delivered may be housed within an infective virus that has been engineered to express a specific binding ligand. The virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell. A novel approach designed to allow specific targeting of retrovirus vectors was developed based on the chemical0 modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors. Another approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor5 were used. The antibodies were coupled via the biotin components by using streptavidin (Roux et al, 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al, 1989).
B. Nucleic Acid Delivery O Suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Patents 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990); by using DEAE- dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al, 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987; Wong et al, 1980; Kaneda et al, 1989; Kato et al, 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Patents 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al, 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al, 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al, 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.
X. Pharmaceutical Vaccine Compositions, Delivery, and Treatment Regimens In an embodiment of the present invention, a method of treatment and prevention of cancers such as leukemia. Examples of cancers contemplated for treatment include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases that may be treated or prevented by a tumor-associated HLA-restricted peptides, or polypeptides of the present invention. In another embodiment of the present invention, a method of treatment and prevention of autoimmune diseases or conditions; transplant rejection; or vasculitis, by the delivery of an HLA-restricted peptide, or polypeptide or expression construct is contemplated. Autoimmune diseases/conditions that may be treated or prevented include but are not limited to asculitis, Wegner's granulomatoses Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic purpura (FTP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's disease, ulcerative colitis, sarcoidosis, scleroderma, graft versus host disease (acute and chronic), aplastic anemia, myelodysplastic syndrome, cyclic neutropenia, T-LGL (T-large granular lymphocytic) leukemia. An effective amount of the pharmaceutical vaccine composition, generally, is defined as that amount sufficient to detectably and repeatedly to ameliorate, reduce, minimize or limit the extent of the disease or condition or symptoms thereof. More rigorous definitions may apply, including elimination, eradication or cure of disease. Preferably, patients will have adequate bone marrow function (defined as a peripheral 3 3 absolute granulocyte count of > 2,000 / mm and a platelet count of 100,000 / mm ), adequate liver function (bilirubin < 1.5 mg / dl) and adequate renal function (creatinine < 1.5 mg / dl).
A. HLA-Restricted Vaccine Administration To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size and otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one would generally contact a cancer cell with the therapeutic compound such as a polypeptide or an expression construct encoding a polypeptide. The routes of administration will vary, naturally, with the location and nature of the lesion, and include, e.g., intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration and formulation. Any of the formulations and routes of administration discussed with respect to the treatment or diagnosis of cancer may also be employed with respect to neoplastic diseases and conditions. Intratumoral injection, or injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration also may be appropriate. For tumors of >4 cm, the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml). Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes. The viral particles may advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals. In the case of surgical intervention, the present invention may be used preoperatively, to render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a tumor-associated HLA restricted peptide or construct encoding therefor. The perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned. Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is preferred. Such continuous perfusion may take place for a period from about 1-2 hr, to about 2-6 hr, to about 6-12 hr, to about 12-24 hr, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs. It is further contemplated that limb perfusion may be used to administer therapeutic compositions of the present invention, particularly in the treatment of melanomas and sarcomas. Treatment regimens may vary as well, and often depend on tumor type, tumor location, disease progression, and health and age of the patient. Obviously, certain types of tumor will require more aggressive treatment, while at the same time, certain patients cannot tolerate more taxing protocols. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations. In certain embodiments, the tumor being treated may not, at least initially, be resectable. Treatments with therapeutic viral constructs may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection will serve to eliminate microscopic residual disease at the tumor site. A typical course of treatment, for a primary tumor or a post-excision tumor bed, will involve multiple doses. Typical primary tumor treatment involves a 6 dose application over a two-week period. The two-week regimen may be repeated one, two, three, four, five, six or more times. During a course of treatment, the need to complete the planned dosings may be re- evaluated. The treatments may include various "unit doses." Unit dose is defined as containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Unit dose of the present invention may conveniently be described in terms of 3 4 5 δ 7 plaque forming units (pfu) for a viral construct. Unit doses range from 10 , 10 , 10 , 10 , 10 , O Q i -\ 1 1 ι o ι
10 , 10 , 10 , 10 , 10 , 10 pfu and higher. Alternatively, depending on the kind of virus and the titer attainable, one will deliver 1 to 100, 10 to 50, 100-1000, or up to about 1 x 10 , 1 x 105, 6 7 8 9 10 11 12 13 14 15
1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , 1 x 10 , or 1 x 10 or higher infectious viral particles (vp) to the patient or to the patient's cells.
B. Injectable Compositions and Formulations One method for the delivery of a pharmaceutical according to the present invention is systemically. However, the pharmaceutical compositions disclosed herein may alternatively be administered parenterally, intravenously, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Patent 5,543,158; U.S. Patent 5,641,515 and U.S. Patent 5,399,363 (each specifically incorporated herein by reference in its entirety). Injection of pharmaceuticals may be by syringe or any other method used for injection of a solution, as long as the agent can pass through the particular gauge of needle required for injection. A novel needleless injection system has been described (U.S. Patent 5,846,233) having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225). Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like, hi many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermolysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" or "pharmacologically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
XI. Combination Treatments The compounds and methods of the present invention may be used in the context of neoplastic diseases/conditions including cancer. Types of diseases/conditions contemplated to be treated with the peptides of the present invention include, but are not limited to leukemias such as, AML, MDS and CML. Other types of cancers may include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases. In order to increase the effectiveness of a treatment with the tumor-associated HLA-restricted compositions of the present invention, such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor, it may be desirable to combine these compositions with other agents effective in the treatment of those diseases and conditions. For example, the treatment of a cancer may be implemented with therapeutic compounds of the present invention and other anti-cancer therapies, such as anti-cancer agents or surgery. In addition, the compounds and methods of the present invention may be used in the context of autoimmune diseases/conditions. In order to increase the effectiveness of a treatment with the HLA-restricted compositions of the present invention, such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor, it may be desirable to combine these compositions with other agents effective in the treatment of those diseases and conditions. For example, the treatment of autoimmune diseases or infections with therapeutic compounds of the present invention may be enhanced by combination with and other therapies. Various combinations may be employed; for example, the tumor-associated HLA- restricted peptide is "A" and the secondary therapy is "B":
A B/A B/AB B B/A A A B A/B/B B/A/A A/B/B/B B/A B/B B/B/B/A B/B/A/B A A/B/B A/B/A/B A B/B/A B B/A A B/A B/A B/A/A/B A/A/A/B B/A A/A A/B/A/A A/A/B/A Administration of the therapeutic agents of the present invention to a patient will follow general protocols for the administration of that particular secondary therapy, taking into account the toxicity, if any, of the tumor-associated HLA-restricted peptide treatment. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described cancer cell.
A. Adjunct Anti-Cancer Therapy An "anti-cancer" agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. Anti-cancer agents include biological agents (biotherapy), chemotherapy agents, and radiotherapy agents. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with the expression construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the expression construct and the other includes the second agent(s). Tumor cell resistance to chemotherapy and radiotherapy agents represents a major problem in clinical oncology. One goal of current cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy. For example, the heφes si plex-thymidine kinase (HS-tK) gene, when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver et al, 1992). In the context of the present invention, it is contemplated that tumor-associated HLA- restricted peptide therapy could be used similarly in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic or other biological intervention, in addition to other pro- apoptotic or cell cycle regulating agents. Alternatively, the gene therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks, hi embodiments where the other agent and expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and expression construct would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one may contact the cell with both modalities within about 12- 24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations. 1. Chemotherapy Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine and methotrexate, Temazolomide (an aqueous form of DTIC), or any analog or derivative variant of the foregoing. The combination of chemotherapy with biological therapy is known as biochemotherapy. The present invention contemplates any chemotherapeutic agent that may be employed or kown in the art for treating or preventing cancers.
2. Radiotherapy Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV- irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. The terms "contacted" and "exposed," when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
3. Immunotherapy I munotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of Fortilin would provide therapeutic benefit in the treatment of cancer. Immunotherapy could also be used as part of a combined therapy. The general approach for combined therapy is discussed below. In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gρ68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pi 55. An alternative aspect of immunotherapy is to anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-JFN, chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as mda-7 has been shown to enhance anti-tumor effects (Ju et al, 2000). As discussed earlier, examples of immunoiherapies currently under investigation or in use are immune adjuvants (e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds) (U.S. Patent 5,801,005; U.S. Patent 5,739,169; JHui and Hashimoto, 1998; Christodoulides et al, 1998), cytokine therapy (e.g., interferons, and; IL-1, GM-CSF and TNF) (Bukowski et al, 1998; Davidson et al, 1998; Hellstrand et al, 1998) gene therapy (e.g., TNF, IL-1, IL-2, p53) (Qin et al, 1998; Austin-Ward and Villaseca, 1998; U.S. Patent 5,830,880 and U.S. Patent 5,846,945) and monoclonal antibodies (e.g., anti- ganglioside GM2, anti-HER-2, anti-ρl85) (Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). Combination therapy of cancer with tierceptin and chemotherapy has been shown to be more effective than the individual therapies. Thus, it is contemplated that one or more anti-cancer therapies may be employed with the tumor- associated HLA-restricted peptide therapies described herein. i) Adoptive Immunotherapy In adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al, 1988; 1989). To achieve this, one would administer to an animal, or human patient, an immunologically effective amount of activated lymphocytes in combination with an adjuvant-incoφorated antigenic peptide composition as described herein. The activated lymphocytes will most preferably be the patient's o"wn cells that were earlier isolated from a blood or tumor sample and activated (or "expanded") in vitro. This form of immunotherapy has produced several cases of regression of melanoma and renal carcinoma, but the percentage of responders were few compared to those who did not respond. ii) Passive Immunotherapy A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow. Preferably, human monoclonal antibodies are employed in passive immunotherapy, as they produce few or no side effects in the patient. However, their application is somewhat limited by their scarcity and have so far only been administered intralesionally. Human monoclonal antibodies to ganglioside antigens have been administered intralesionally to patients suffering from cutaneous recurrent melanoma (hie & Morton, 1986). Regression was observed in six out of ten patients, following, daily or weekly, intralesional injections. In another study, moderate success was achieved from intralesional injections of two human monoclonal antibodies (Erie et αl, 1989). It may be favorable to administer more than one monoclonal antibody directed against two different antigens or even antibodies with multiple antigen specificity. Treatment protocols also may include administration of lymphokines or other immune enhancers as described by Bajorin et αl. (1988). The development of human monoclonal antibodies is described in further detail elsewhere in the specification. iii) Active Immunotherapy In active immunotherapy, an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine" is administered, generally with a distinct bacterial adjuvant (Ravindranath and Mitchell et αl, 1990; Mitchell et αl, 1993). In melanoma immunotherapy, those patients who elicit high IgM response often survive better than those who elicit no or low IgM antibodies (Morton et αl, 1992). IgM antibodies are often transient antibodies and the exception to the rule appears to be anti-ganglioside or anticarbohydrate antibodies.
4. Genes In yet another embodiment, the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the tumor- associated HLA-restricted peptide is administered. Delivery of a vector encoding a the tumor- associated HLA-restricted peptide in conjunction with a second vector encoding one of the following gene products will have a combined anti-hypeφroliferative effect on target tissues. Alternatively, a single vector encoding both genes may be used. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention are will known to one of ordinary skill in the art and may comprise any gene involved in cancers. i) Inducers of Cellular Proliferation The proteins that induce cellular proliferation further fall into various categories dependent on function. The commonality of all of these proteins is their ability to regulate cellular proliferation. For example, a form of PDGF, the sis oncogene, is a secreted growth factor. Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor. In one embodiment of the present invention, it is contemplated that anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression of the inducer of cellular proliferation. The proteins FMS, ErbA, ErbB and neu are growth factor receptors. Mutations to these receptors result in loss of regulatable function. For example, a point mutation affecting the transmembrane domain of the Neu receptor protem results in the neu oncogene. The erbA oncogene is derived from the intracellular receptor for thyroid hormone. The modified oncogenic ErbA receptor is believed to compete with the endogenous thyroid hormone receptor, causing uncontrolled growth. The largest class of oncogenes includes the signal transducing proteins (e.g., Src, Abl and Ras). The protein Src is a cytoplasmic protein-tyrosine kinase, and its transformation from proto-oncogene to oncogene in some cases, results via mutations at tyrosine residue 527. In contrast, transformation of GTPase protein ras from proto-oncogene to oncogene, in one example, results from a valine to glycine mutation at amino acid 12 in the sequence, reducing ras GTPase activity. The proteins Jun, Fos and Myc are proteins that directly exert their effects on nuclear functions as transcription factors. ii) Inhibitors of Cellular Proliferation The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors p53, pi 6 and C-CAM are described below. In addition to p53, which has been described above, another inhibitor of cellular proliferation is pi 6. The major transitions of the eukaryotic cell cycle are triggered by cyclin- dependent kinases, or CDK's. One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the G\. The activity of this enzyme maybe to phosphorylate Rb at late G\. The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the plό^NK^ has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al, 1993; Serrano et al, 1995). Since the plό11^4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hypeφhosphorylation of the Rb protein, pi 6 also is known to regulate the function of CDK6. pX6ΪNK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6B, pl9, p21WAF1, and p27KIP1. The pl *NK4 gene maps to 9p2i5 a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the pl6lNK4 gene are frequent in human tumor cell lines. This evidence suggests that the ρl6^K4 gene 1S a tumor suppressor gene. This inteφretation has been challenged, however, by the observation that the frequency of the pl6^N gene alterations is much lower in primay uncultured tumors than in cultured cell lines (Caldas et al, 1994; Cheng et al, 1994; Hussussian et al, 1994; Kamb et al, 1994; Kamb et al, 1994; Mori et al, 1994; Okamoio et al, 1994; Nobori et al, 1995; Orlow et al, 1994; Arap et al, 1995). Restoration of wild-type pl6ΪNK4 function by transfection with a plasmid expression vector reduced colony formation by some human cancer cell lines (Okamoto, 1994; Arap, 1995). Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, ρ27, p27/ρl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS,
Dp, E2F, ras, myc, neu, raf, erb, fins, trk, ret, gsp, hst, abl, EIA, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC. iii) Regulators of Programmed Cell Death Apoptosis, or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al, 1972). The Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be important regulators and effectors of apoptosis in other systems. The Bcl-2 protein, discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al, 1985; Cleary and Sklar, 1985; Cleary et al, 1986; Tsujimoto et al, 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists. Subsequent to its discovery, it was shown that Bcl-2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., BclχL,
Bclyy, B^S' Mcl-1, Al, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax,
Bak, Bik, Bim, Bid, Bad, Harakiri). 5. Surgery Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue. Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well. B. Adjunct Autoimmune Therapy Typical treatments for autoimmune diseases include various anti-inflammatories. For example, aminosalicylates, drugs that contain 5-aminosalicyclic acid (5-ASA), help control inflammation. Other 5-ASA agents such as olsalazine, mesalamine, and balsalazide, have a different carrier, offer fewer side effects, and may be used by people who cannot take sulfasalazine. Other non-steroidal anti-inflammatories include COX-selective and COX- preferential inhibitors. Corticosteroids - such as prednisone and hydrocortisone - also reduce inflammation. They may be used by people who have moderate to severe ulcerative colitis or who do not respond to 5-ASA drugs. Corticosteroids, also known as steroids, can be given orally, intravenously, through an enema, or in a suppository, depending on the location of the inflammation. These drugs can cause side effects such as weight gain, acne, facial hair, hypertension, mood swings, and an increased risk of infection. For this reason, they are not recommended for long-term use. Immunomodulators - such as azathioprine and 6-mercapto-purine (6-MP) - reduce inflammation by affecting the immune system. They are used for patients who have not responded to 5-ASAs or corticosteroids or who are dependent on corticosteroids. However, immunomodulators are slow-acting and may take up to 6 months before the full benefit is seen. Patients taking these drugs are monitored for complications including pancreatitis and hepatitis, a reduced white blood cell count, and an increased risk of infection. Cyclosporine A may be used with 6-MP or azathioprine to treat active, severe ulcerative colitis in people who do not respond to intravenous corticosteroids.
C. Adjunct Therapy for Infections A varient of a biologicals are available to treat infectious diseases and include antibacterial (antibiotics, antiseptics), anti-virals, and anti-parastic agents. Any of these agents may be used in combinantion with the present invention.
XII. EXAMPLES The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a lilce or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1 METHODOLOGY Patients and donors. Donors and patients were treated at the University of Texas M.D.
Anderson Cancer Center on protocols approved by the Institutional Review Board. After informed consent, cells from the CML patients and their HLA-matched bone marrow (BM) transplantation donors were obtained. PBMCs from untreated CML patients or from patients receiving IFN were collected and cryopreserved for later analysis. Cells were separated using Ficoll-Hypaque gradient-density (Organon Teknika Coφ., Durham, North Carolina, USA) and frozen in RPMI-1640 complete medium (CM) (25 mM HEPES buffer, 2 mM L-glutamine, 100 U/ml penicillin, 100 g/ml streptomycin; Life Technologies Inc., Gaithersburg, Maryland, USA) supplemented with 20% heat-inactivated pooled human AB serum (AB; Sigma-Aldrich, St. Louis, Missouri, USA) and 10% DMSO, according to standard protocols. Before use, cells were thawed, washed, and suspended in CM plus 10% AB. High-resolution HLA testing was performed by the HLA Laboratory at M.D. Anderson Cancer Center. Peptide synthesis. PRl (aa 169-177) peptide (VLQELNVTV (SEQ ID NO:l)) was synthesized by Bio-Synthesis (Lewisville, Texas, USA), and the HLA-A2-restricted CMV pp65 peptide (NLVPMVATV (SEQ ID NO:2)) was synthesized by the M.D. Anderson Protein and Nucleic Acid Facility, both to a minimum of 95% purity. Cell lines and peptide binding. T2 cells (American Type Culture Collection, Rockville,
Maryland, USA) were maintained in culture in CM plus 10% FBS (Atlanta Biologicals Inc., Norcross, Georgia, USA). PRl peptide was incubated at increasing concentrations for 18 hr at 37°C with 100 μg/ml β2m (Sigma-Aldrich) with 106 T2 cells in 1 ml CM. Cells were washed twice with CM, stained with BB7.2 Ab, washed again, and then stained with FITC-labeled secondary Ab (Becton Dickinson Jmmunocytometry Systems, San Jose, California, USA). HLA-A*0201 expression was measured by FACS. Peptide-specific CTLs were expanded in culture using methods described previously (Molldrem et al, 1996; Molldrem et al, 1997). Briefly, PBMCs from healthy donors or CML patients were stimulated in vitro with PRl, pp65, or flu peptides. T2 cells were washed tliree times in serum-free CM and incubated with peptide at the indicated peptide concentration for 2 hr in CM. The peptide-loaded T2 cells were then irradiated with 7,500 cGy, washed once, and suspended with freshly isolated PBMCs at a 1:1 to a 1:2 ratio in CM supplemented with 10% AB. After 7 days in culture, a second stimulation was performed, and the following day, 60 IU/ml of recombinant human interleukin-2 (rhIL-2) (BioSource International, Camarillo, California, USA) was added. After 14 days in culture, a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21, followed on day 22 by the addition of rhIL-2. After a total of 27-28 days in culture, the peptide- stimulated T cells were obtained and tested for peptide-specific and leukemia-specific cytotoxicity as well as for phenotypic analyses. Tetramer synthesis. Production of MHC/peptide tetramers was described in detail elsewhere (Altman et al, 1996; Molldrem, 2000). Briefly, a 15-amino acid substrate peptide (BSP) for BirA-dependent biotinylation has been engineered onto the COOH terminus of HLA- A2. The A2-BSP fusion protein and human /3 m were expressed in Escherichia coli and were folded in vitro with the specific peptide ligand. The properly folded MHC-peptide complexes were extensively purified using FPLC and anion exchange and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, Colorado, USA). Tetramers were produced by mixing the biotinylated MHC-peptide complexes with phycoerythrin-conjugated (PE-conjugated) Neutravidin (Molecular Probes Inc., Eugene, Oregon, USA) at a molar ratio of 4:1. PRl tetramers were validated by staining against a CTL line specific for PRl. CMV tetramers were validated by staining PBMCs from a CMV-immune individual. Ab's and flow cytometry. For routine surface-antigen staining, 106 PBMCs were incubated at 4°C with Ab. After washing, cells were incubated with FITC-labeled CD8 (Caltag Laboratories Inc., Burlingame, California, USA) for 30 min on ice. Surface expression of TCR was determined with FITC-labeled TCR-aβ (PharMingen, San Diego, California, USA), and annexin V using FITC-labeled Ab (Caltag Laboratories). Proteinase 3 expression was determined with primary mouse Ab (Accurate Chemical & Scientific Coφ., Westbury, New York, USA). Mouse monoclonal anti-HLA-A2.1 Ab BB7.2 and anti-HLA-ABC w6/32 were derived from culture supematants of a hybridoma cell lines (American Tissue Culture Collection). Cells were washed and fixed in 2% paraformaldehyde and analyzed on a FACScan (Becton Dickinson hnmunocytometry Systems), and data were analyzed using CELLQuest (Becton Dickinson Immunocytometry Systems) software. The minimum concentration of tetramer necessary to show distinctly different avidities was determined in titration experiments. Each tetramer reagent was titered individually and used at the optimal concentration. The tetramer concentration showing the maximal separation of fluorescence intensity of CTL populations was generally 10-20 μg/ml. Propidium iodide (PI) (Becton Dickinson hnmi nocytometry Systems) staining (1 μg/ml) was performed to exclude dead cells, according to the manufacturer's instructions. A "dump" channel was used with tetramer staining to eliminate monocytes and B lymphocytes with nonspecific binding to the HLA-A2 heavy chain by staining with PerCP-labeled CD14 and CD19 (both Becton Dickinson Immunocytometry Systems). Detailed methodology for detection of t\n of tetramer dissociation was described elsewhere (Savage et al, 1999). Briefly, T cells were stained for 45 min with PR1 HLA-A2 tetramer, washed, and cooled to 4°C. To prevent rebinding of tetramer, cells were incubated in the presence of PI (1 μg/ml) with saturating amounts of BB7.2 Ab, and flow cytometry was used to measure fluorescence decay at 10-min intervals. A constant number of CD8+ events was acquired at each time point. Total fluorescence within the tetramer-positive gate was normalized per CD8+ cell, and the antigen-specific fluorescence was determined by subtracting the total fluorescence of control healthy donor lymphocytes from the observed total fluorescence of the lymphocyte populations following peptide stimulation. This antigen-specific fluorescence was normalized to the percentage of the total fluorescence at the initial time point and plotted on a logarithmic scale. Tetramer dissociation tι/2 was determined by plotting ln (normalized fluorescence) versus time, and is given by 0.693/&, where k is the slope of the normalized fluorescence decay curve determined by the method of linear least squares. CTL cytotoxicity assay. A semiauto ated minicytotoxicity assay was used to determine specific lysis as described previously (Molldrem, 2000; Molldrem et al, 1996). Briefly, effector cells were prepared in doubling dilutions from 6 103 to 25 x 103 cells/well and were plated in 40 μl, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, California, USA) with six replicates per dilution. Target cells (T2 cells, marrow-derived leukemic cells, or BM from a healthy donor) at a concentration of 2 x 106 cells/ml were stained with 10 μg/ml of Calcein-AM (Molecular Probes Inc.) for 60 min at 37°C. After washing three times in CM plus 10°/ό AB, target cells were resuspended at 105 cells/ml, and 103 target cells in 10 μl medium were added to each well containing effector cells. Wells with target cells alone and medium alone were used for maximum (max) and minimum (min.) fluorescence emission, respectively. After 4 hr incubation at 37°C in 5% CO2, 5 μl FluoroQuench (One Lambda Inc., Canoga Park, California, USA) was added to each well, and the trays were centrifuged for 1 min at 60 g before measurement of fluorescence using an automated CytoFluor II plate reader (PerSeptive Biosystems, Framingham, Massachusetts, USA). The percentage of lysis was calculated as folloΛvs: % lysis = {1 — [(mean experimental mission — mean min.)/(mean max - mean min.)]} 100%. EXAMPLE 2 CLINICAL TRIALS
Based upon pre-clinical studies, the toxicity and efficacy of PRl peptide vaccination for patients with refractory or relapsed myeloid leukemias was investigated. This study is being conducted in two phases: a Phase I initial toxicity phase (in order to determine initial vaccine safety), and a Phase II efficacy and toxicity phase. Nine patients will be studied in the Phase I portion, and up to 60 patients will be studied in the Phase II portion. Four patients have been enrolled thus far on Phase I. Details of the protocol are described below. PRl peptide is injected subcutaneously in incomplete Freund's adjuvant every 3 weeks for 3 injections to induce a PRl specific host response against the myeloid leukemia. Both in Phase I and in Phase II, patients will also be evaluated for signs of immune reactivity. Before, during, and at the end of the 9 week period of vaccination, the peripheral blood mononuclear cells (PBMC) from the patients will be tested for the development of PRl immune reactivity in vitro using cytotoxic T lymphocyte precursor frequency (CTLPf) assays against PRl -loaded target cells and against the patient's own leukemia (a measure of efficacy), PR1/HLA-A2 tetramer staining, 8-color flow cytometry for surface phenotype (memory/naϊve, activation), and cytolysis assays of bulk PRl -stimulated PBMC from the patients. The amount of Proteinase 3 expression in the leukemia cells is studied by cytoplasmic flow cytometry analysis. Any clinical responses (defined by standard criteria as hematological and/or cytogenetic responses) will be correlated with the in vitro testing. Vaccination at 3 dose levels of peptide with a fixed amount of IF A will be conducted, and stopping criteria will be guided by established toxicity criteria. Phase I. In Phase I of this study, patients are assigned to three escalating peptide dose levels starting with dose level 1. Patients are followed in dose cohorts of size 3 for signs of dose limiting toxicity. Patients are assigned to the next highest dose level cohort only if no more than 1 of the 3 patients at any time at any dose level has > grade 3 non-hematological toxicity or autoimmune phenomena (i.e., dose limiting toxicity). At each dose level, the first patient entered must complete two of the three vaccinations prior to initiation of the second patient in that cohort at that dose level. Before the third patient is enrolled, the first patient in each dose cohort must complete all vaccinations and the second patient must complete at least two vaccinations prior to initiation of vaccination in the third patient. Again, if < grade 3 non-hematological toxicity and no autoimmune phenomena are observed in the first three patients, then the next dose level will accrue patients in a similar manner. If more than 1/3 of the patients enrolled at any time at any dose level have grade III or IV non-hematological toxicity, then maximal tolerated dose (MTD) has been exceeded and this and all higher peptide dose levels will be eliminated from Phase II of the study. Dose escalation to the next dose level will occur only after the third patient has been followed for three weeks after the third vaccination in the series and has no dose limiting toxicity. If an allergic reaction > grade 2 occurs in any patient, no further vaccinations will be given in that patient and they will be taken off study. Allergic reactions will be treated with solumedrol 1 mg/kg IN bolus, benadryl 50 mg IV bolus, and epinephrine 0.5 mg S.C. Phase II. Phase π of the study will be conducted according to a continuous reassessment statistical model. Up to 60 patients will, be randomized among three dose levels, with a maximum of 20 patients per dose level. Only those dose levels without dose limiting toxicity as determined in Phase I of this study will be examined in Phase II. Both toxicity and efficacy will be determined as primary endpoints. Patients will be monitored in cohorts of size 4, and all patients in any cohort will be observed for at least 2 weeks from the first dose of the last patient in the group in the absence of grade III or EV non-hematological toxicity before continuing to the next cohort. Toxicity information will be carefully accrued using established. If grade III or IN non-hematological toxicity is observed during the 9 week study period in 2 of the first 4 patients (the first cohort), 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups, then that dose level will be terminated and patients will be treated only on the remaining dose levels. Moving to the next cohort will occur only if dose-limiting toxicity is not reached in the number of patients defined above for each cohort. There will be a two-week observation period before the next vaccination will be given in any patient that experiences grade II non-hematological toxicity < dose limiting toxicity. If the toxicity decreases to grade I or less within those two weeks, the patient will be given the next vaccination. If the grade II toxicity does not decrease to grade I or less within two weeks, the patient will be taken off protocol (removed from study). Any grade toxicity that provides clear evidence of an autoimmune reaction will be considered a dose limiting toxicity. Such a reaction will preclude further administration of peptide under this protocol, and the study will be terminated. If there is evidence that vaccine administration has produced a Wegener's-like vasculitis or inflammatory disease, then the study will be terminated. Efficacy, defined as an immune response to PRl vaccine, will also be determined as a primary endpoint of the study. If none of the first 12 patients have an immune response at a particular dose level, then that dose level will be terminated. Patients will not be retreated in this protocol after the required 3 immunizations, nor will the dose be escalated beyond 1.0 mg of PRl peptide. The maximal tolerated dose (MTD) is defined as the highest peptide dose that does not cause dose-limiting non-hematological toxicity beyond the allowable number of patients stated for each phase at each dose level cohort (dose limiting toxicity). The MTD will be determined in either Phase I or Phase II of this study if: (1) dose-limiting toxicity is reached in more than 1 patient of 3 at each dose level cohort in Phase I, or (2) if dose-limiting non-hematological toxicity is exceeded in 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups in Phase II.
EXAMPLE 3 GENERATION OF PR1-CTL AND EX VIVO STUDBES
Experimental and clinical evidence indicates that lymphocytes from HLA-matched allogeneic normal donors exert a powerful graft-versus-leukemia (GVL) effect when used to treat patients with myeloid leukemia (Drobyski et al, 1994; Horowitz et al, 1996). Donor lymphocyte infusions (DLI) alone, when administered to patients that have relapsed after allogeneic bone marrow transplantation (BMT) can cure patients with myeloid leukemia (Collins et al, 1997; Kolb and Holler, 1997). However, graft-versus-host disease (GVHD) is an unwanted and sometimes lethal complication of DLI treatment that occurs in nearly 50% of patients. The GVL and GVHD target antigens of these lymphocytes are largely unknown. GVL may be enhanced and GVHD eliminated after DLI if (1) antigens that were the favored targets of GVL are known and (2) an efficient ex vivo process for enrichment of GVL-causing lymphocytes based on antigen specificity is developed. In this study, it was determined whether high and low affinity PRl-specific CTL can be expanded from normal donors ex vivo and then enriched using antigen-coated microbeads for transfer to myeloid leukemia patients, in place of conventional DLI, in order to deliver GVL without GVHD. Methods to more efficiently generate PR1-CTL, enrich high affinity PR1-CTL using microbeads, and expand selected PRl -CTL ex vivo for adoptive immunotherapy were also investigated. Methodology. PRl peptide was combined into the binding region of the HLA-A2 heavy chain, and the resulting protein folded with β2-microglobulin and attached the resulting PRl /HLA- A2 monomer onto 50 nm magnetic microbeads (Miltenyi Co.) (Wang et al, 2000). To do this, the technology used was adapted to assemble PR1/HLA-A2 tetramers, where heavy chain monomers are biotinylated at the C terminus and combined in a 4:1 molar ratio with streptavidin, which has in turn been conjugated to phycoerythrin (PE). The PRl monomer- conjugated microbeads can then be passed through a sterile column that is surrounded by a magnet that traps microbead-adherent T cells. After the non-adherent cells pass through the column, the column is removed from the magnet and the PRl-specific T cells attached to the microbeads can be collected. This method allows for the selection of PRl-specific T cells, which could be further expanded and given to patients with myeloid leukemia to facilitate GVL without GVHD. Determining the most efficient in vitro method for short-term expansion of PRl antigen-specific T lymphocytes. The results show that PRl-specific cytotoxic T lymphocytes (CTL) are present at frequencies from 1/15,000 to 1/300,000 in normal donors. Therefore, the PRl-specific CTL will first be expanded so enough cells are available for subsequent enrichment by magnetic bead separation. The efficiency of antigen presenting cells (APC) produced by different methods to expand short-term polyclonal PRl-specific CTL will be compared. Peripheral blood mononuclear cells (PBMC), as APC, will be compared to dendritic cells (DC) derived from peripheral blood monocytes after a 2-hr adherence step. One week-old DC will be derived after incubating adherent cells from the same healthy HLA-A2+ donors with either 10 ng/ml IL-4 + 1000 U/ml GM-CSF or 1000 U/ml IFN-α + 1000 U/ml GM-CSF (Verdijk et al, 1999; Santini et al, 2000). The resulting APC will be pulsed weekly with PRl at 10 μg/ml plus IL-2 at 20 U/ml and combined with responder PBMC in ratios from 1 : 1 to 1 :20. These APC will be compared to standard T2 cells, a cell line unable to present endogenous antigens due to TAP 1/2 deficiency and can only present peptides pulsed onto the cell surface (Salter and Cresswell, 1986). Preliminary studies using T2 cells as peptide-pulsed APCs expanded the PRl-specific CTL to between 2% to 8% of the total lymphocyte culture by 28 days (Molldrem et al, 2000). En addition, the APC methodology described above will also be compared to the results obtained from pulsing Drosophila melanogaster S2 cells with PRl peptide (Janetzki et al, 2000). S2 cells have been transfected with the HLA-A2.1 heavy chain, β-2M, ICAM-1, and the co-stimulatory molecule B7.1. By pulsing peptides on the surface of transfected S2, these cells have demonstrated the ability to act as efficient APC during the critical first round of peptide antigen stimulation of CTL in vitro. The advantages of using S2 cells as an APC population is that they can be propagated at room temperature and subsequently require low maintenance, a critical element for eventual clinical application. After 3 to 4 weeks in culture, the resulting PRl-specific CTL will be quantified and characterized using the PR1/HLA-A2 tetramer in combination with antibodies to CD8, CD69, HLA-DR, CD25, LFA-1, CD54, CD2, intracellular γ-interferon, and CD45(RO) conjugated to different fluorochromes (Molldrem et al, 1999; Molldrem et al, 2000). Cells will subsequently be analyzed using a MoFlo cytometer capable of simultaneous 10-color cytofluorometric analysis. Efficiency of the various APC conditions can be directly compared by quantifying PRl-specific CTL using the tetramer and the other markers will allow comparison of activation state, functional state and memory phenotype. To determine whether high and low affinity antigen-specific cytotoxic T lymphocytes can be separated and enriched using PR1/HLA-A2 monomer-coated microbeads. From the preliminary studies, it has been shown that by using low doses of tetramer reagent a discrimination can be made between CTL with high and low affinity T cell receptor (TCR) based on high and low tetramer staining as assessed by FACS (Molldrem et al, 1998). The Υ 2 of tetramer binding has been shown to correlate with staining intensity, and specific lysis of CML target cells correlates with TCR affinity. High affinity PRl -CTL were elicited from normal donors in the presence of low-dose PRl (2 μg/ml) and low affinity PR1- CTL were elicited using high-dose PRl (200 μg/ml) (Molldrem et al, 1998). To preferentially select PRl antigen-specific T-cells, streptavidin-coated microbeads (from Miltenyi, Inc.) will be used. Beads will be conjugated with PRl plus HLA-A2 through the biotin-labeled C-terminus of the heavy chain (Wang et al, 2000). PRl -pulsed short-tenn CTL lines will be incubated for 30 min with PR1/HLA-A2 coated microbeads and selected using the MACS™ magnetic column. Bead-selected and non-selected CTL will be quantified by flow cytometry using the PRl /HLA- A2 tetramer and compared to the starting polyclonal CTL lines. It is estimated that yields will range from 85% to 100% and PRl-specific CTL purity will range from 11% to 21% after the selection process (i.e. a 3- to 5-fold increase in purity of antigen- specific CTL), based on preliminary studies using PRl -pulsed T2 cells to elicit PRl-specific CTL (Molldrem et al, 1999; Wang et al, 2000). The selected PRl-specific CTL will be tested for functional activity. Specific lysis of PRl -coated T2 cells, CML and AML marrow cells, and normal HLA-A2 marrow will be assessed using the PRl-specific CTL and compared to lysis by the non-selected CTL. The method to select the highest affinity PRl-specific CTL will be optimized using different ratios of PRl /HLA- A2 monomers, microbeads, and starting cell populations to achieve the highest yield and greatest purity of high affinity PRl-specific CTL. To determine whether lymphocytes, separated using PR1/HLA-A2 monomer-coated microbeads, can be expanded to a sufficient number for use in adoptive immunotherapy of myeloid leukemia. It is estimated that from 1 to 5 x 106 CTL may be needed to treat patients with relapsed leukemia after BMT (Mackinnon et al, 1995). By optimizing a CTL expansion technique in combination with the bead enrichment, the requirement of a leukapheresis product may be reduced to as little as 100 ml of peripheral blood. To achieve this goal, it will be determined whether the bead-enriched PRl-specific CTL can be further expanded in short term culture. Two methods will be directly compared: the optimized technique, as determined previously, will be used to expand PRl -CTL by weekly restimulation with PRl -coated APCs, versus a non-specific .method. Anti-CD3 + anti-CD28 coated Dynal beads will be coincubated with the bead-enriched PRl-specific CTL in culture media containing varying doses of IL-2 (Garlie et al, 1999; Levine et al, 1998). In controlled experiments, other cytokines such as IL- 12 and interferon will be supplemented in order to optimize the number of PR1-CTL (Fallarino et al, 1996). PRl -specificity will be confirmed at the end of culture using PR1/HLA-A2 tetramers and CTL functional activity will be ascertained using standard cytotoxicity experiments against PRl -coated T2 cells and HLA-A2+ leukemia cell targets. If non-specific expansion of CTL (with anti-CD3 and anti-CD28) is found to be efficient and can maintain PRl-specific CTLs, then this method will also be tested PRl or to bead selection and compared to the PRl-specific expansion method described above. This may eliminate the requirement for further CTL expansion after bead enrichment. These methods, once optimized, can be easily transferred to the clinical setting to treat patients with myeloid leukemia using a Miltenyi MACS™ magnetic bead system to select CD34+ progenitor cells from marrow donors for clinical use. Furthermore, these methods may be used to select CTL with different specificities for other tumor antigens, minor antigens, and viral antigens. Such CTL may be elicited and selected in a single step and adoptively transferred using the methods described herein. Based on the techniques described herein efficient clinical scale-up procedures will be determined for adoptive transfer of antigen-specific T lymphocytes.
EXAMPLE 4 PRELIMINARY STUDIES
Peptide selection and binding assays. In the first step to generating T cells which could be used for adoptive immunotherapy of myeloid leukemias, several peptides derived from the published sequence of Pr3 which were predicted to bind to HLA-A*0201 using a published algorithm (Parker et al, 1994) were identified. This allele was chosen because its high frequency in the US population (49% of individuals) would maximize the therapeutic relevance of any eventual immunotherapeutic strategy. Of the 9 peptides predicted to have sufficiently high binding affinities based on the known HLA-A2.1 binding motif, the two with the highest predicted binding were subsequently synthesized (designated PRl and PR2) (Table 4). The peptides were synthesized by Biosynthesis (Lewisville, TX) to a minimum of 95% purity
Table 4: Predicted Binding-Half Life of HLA-A*0201-Restricted Pr3 Peptides
Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and TAP2 genes and therefore cannot present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with (β2-microglobulin and increased HLA-A2.1 surface expression, which could be measured using flow cytometry. An HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CalTag Laboratories, Burlingame, CA) was used to measure surface expression of HLA-A2.1. hi the second assay, the dissociation rate of I125-labeled (β2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and β2-microglobulin was measured, which allowed calculation of binding half-life (T ). The labeled heterotrimer complex was separated from unincoφorated (β2-microglobulin by high-performance liquid chromatography gel filtration, and the half-time of dissociation of β2-microglobulin was determined by subjecting aliquots of the complex to a second round of gel filtration. Both PRl and PR2 showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide, as the background for HLA-A2.1 expression, (Table 5). The control influenza peptide is an Influenza B nucleoprotein (aa 85-94; Flu), and Tax is an HTLV-1 peptide (aa 11-19), both with known high binding affinity to HLA-A2.1. The long measured Tι/2 as measured using (β2-microglobulin dissociation confirmed the binding of PRl and PR2 to HLA- A2.1.
Table 5: Measured Binding of PRl and PR2 to HLA-A2.1
Peptide Median Channel of ι# (minutes) Fluorescence of HLA-A2 Expression on T2
__ _ __
PR2 273 140 HTLV-1 Tax _ 8,000 Influenza nucleoprotein 194 Background HLA-A2 22 __ Induction of Primary CTL responses to peptides. These peptides were next used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HL-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL. Briefly, T2 cells (which co-express the costimulatory molecule B7.1) were washed 3 times in serum-free RPMI culture media supplemented with penicillin/streptomycin and glutamine (CM) and incubated with peptide at 20 μg/mL for 2 hr in CM. The peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO). After 7 days in culture, a second stimulation was performed and the following day, 60 IU/mL of recombinant human interleukin-2 (rhIL2) (Biosource International, Camarillo, CA) was added. After 14 days in culture a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21 followed on day 22 by the addition of rhIL2. After a total of 27 days in culture, the peptide-stimulated T cells were harvested and tested for peptide- specific cytotoxicity toward Calcein AM-labeled T2 cells, leukemia cell lines, and fresh human leukemia cells. FIG. 1 shows the peptide-specific lysis of the CTL lines against T2 cells loaded with either
1.0 μg/mL of PRl or PR-2, or T2 cells without added peptide, at varying effector to target (E:T) ratios. The CTL line generated against the PRl peptide demonstrated high specific lysis against PRl -loaded target cells, whereas the CTL line generated against PR-2 did not demonstrate any significant cytotoxicity (Molldrem et al, 1996). Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLA-A2.1, was also measured (data not shown) and resulted in < 20% specific lysis at E:T ratios of 50:1 by CTL specific for either PRl or PR-2. CTL response toward PRl was shown to be specific for target cells expressing the HLA- A2.1 molecule. This and the cytotoxicity observed was HLA-A2.1 -restricted. PRl specific CTL preferentially lyse human myeloid leukemia cells. It was next determined whether the PRl-specific CTL line was capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals. Table 6 lists the HLA type and leukemia type of target cells used. As controls, two cell lines expressing low levels of Pr3 were used: HLA-A2.1 transfected K562 cells and U937 cell line which lack HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2.1 -restricted manner. Cryopreserved bone marrow cells from patients P1-P4, and marrow cells from a healthy normal volunteer (D2, a bone marrow donor for an allogeneic bone marrow transplant performed on patient P3) were thawed and used as targets for the PRl-specific CTL line. FIG. 2 shows the combined results of tliree separate experiments from three PRl-specific CTL lines. In FIG. 2A, the specific lysis by PRl-specific CTL, at various E:T ratios, of either U937 cells, HLA-A2.1 -transfected K562 cells, or T2 cells with or without exogenously added PRl peptide at 1.0 μg/mL is shown. The specific lysis of U937 and HLA-A2.1-positive K562 cells by PRl-specific CTL was lower than the background lysis observed against T2 cells without added peptide (Molldrem et al, 1996). FIG. 2B demonstrates the cytotoxicity of the CTL line against HLA-A2.1 -positive human myeloid leukemia cells. Marrow cells from three patients with CML (P 1, P2, and P3) as well as one patient with AML M4 (P4) were readily lysed, with 53% specific lysis against PI (a patient with CML in chronic phase) at an E:T ratio of only 6:1 (Molldrem et al, 1996). Marrow cells taken from a normal healthy donor (D2) demonstrate only background lysis (< 20% lysis), similar to that of the control T2 cells without added PRl peptide.
Table 6: Patient and Donor Cell HLA Types Used For Cytotoxicity Experiments
Patient/Donor Cell Description HLA-A HLA-B HLA-DR Dl Normal PBMC 1, 2 8, 27 3, 16 D2 Normal Marrow 2, 26 13, 58 7, 7 U937 Cell Line 3, 3 18, 51 14, 16 PI CML-CP 2, 28 35, 51 9, 14 P2 CML-AP 1, 2 63, 63 8, 13 P3 CML-BC 2, 26 13, 58 7, 7 P4 AML 2, 3 35, 52 4, 13 P5 MDS (RAEB) 2, 24 27, 62 1, 13 Abbreviations: PBMC = peripheral blood monouclear cells; CML-CP = chronic myelogenous leukemia, chronic phase; CML-AP = chronic myelogenous leukemia, accelerated phase; CML-BC = chronic myelogenous leukemia, blast crisis; MDS (RAEB - myelodysplastic syndrome, refractory anemia with excess of blasts. In previous studies, Prl specific CTL was found to preferentially inhibit colony forming units in leukemia patient samples, but not in normal donor samples (Molldrem et al, 19997). Cell contact was found to be required for inhibition of CFU-GM, and inhibitory factors elaborated into the supernatant by CTL1 effector cells were not responsible for colony inhibition (Molldrem et al, 1997). Inhibition of CML CFU-GM correlates with Pr3 overexpression in target cells. Target cells were examined for cytoplasmic Pr3 expression by flow cytometry. After permeabilizing the cell membrane, indirect staining was performed using an antibody to Pr3 and a second FITC-labeled antibody, followed by flow cytometry. Table 7 lists the perentage of cells in the sample population that stain positive for Pr3 and the median fluorescence intensity of intracellular Pr3 staining. Median fluorescence intensity of leukemia samples was nearly five times the median fluorescence intensity of normal samples (1399 vs 298, p = 0.009).
Table 7: Proteinase 3 Expression in Normal (D1-D5) and Leukemia (P1-P5) Marrow Target Cells Used in Colony Inhibition Studies
Patient/Donor % Positive Cells Median Channel Fluorescence CTL1 0 0 CTL2 0 0 Dl 73.4 288 D2 80.8 267 D3 77.6 337 D4 84.5 301 D5 64.6 247 PI 89 1011 P2 98.6 1866 P3 66.2 1437 P4 94.7 1281 P5 87.6 1641
Pr3 is highly expressed in leukemia but not in normal CD34 cells. To confirm that Pr3 was expressed in early CD34 positive CML cells, marrow was collected from patients. Marrow was obtained from a patient with CML in BC (P3), and normal CD34 cells for comparison were obtained from G-CSF mobilized peripheral blood mononuclear cells from a normal donor (D3). Cells were first labeled with PE conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA), followed by cytoplasmic indirect staining for Pr3. The inventors have shown that CML blasts that were CD34 positive and highly expressed Pr3 as compared to CD34 negative blasts and normal CD34 positive cells. This shows that very early progenitor cells overexpress Pr3 whereas there is very little Pr3 expression in a small number of normal progenitor cells. Expression of proteinase 3 following transfection into and HMy2.CIR and
HMy2.CIR-A2 cells. To provide further evidence that the PRl peptide was processed and presented on the surface of a cell, a human B cell line (that does not express Pr3) was transfected with Pr3 and tested whether PRl specific CTL could lyse the transfected cells. The parental HMy2.CIR cell line, which has lost expression of HLA-A and -B, and the HLA-A2.1 -transfected HMy2.CIR cells (named HMy2.CIR-A2), were both transfected with Pr3 as described below. The previously published DNA sequence encoding Pr3 was used to design primers for cloning the cDNA from a normal bone marrow sample (Sturrick et al, 1992). RNA was extracted from normal donor bone marrow cells using the RNA ST AT solution (Teltest). One microgram of RNA was reversed transcribed into cDNA using a RT PCR kit (Perkin-Elmer, Norwalk, CT). Half of the iotal cDNA was then amplified using the primers Pr3C-F 5'- CTGGACCCCACCATGGCTCA-3' (SEQ JD NO: 12) which included the ATG start codon, and Pr3C-R 5'-CGCCACAGTGTTCGGGGAAG-3' (SEQ ED NO:13) and a high-fidelity polymerase (Takara, Madison, WI) according to the manufacturer instructions. The PCR product was cloned into the pCR2 vector using the TA cloning kit (Invitrogen, Carlsbad, CA) and then subcloned into the mammalian expression vector pCDNA3.1 (Invitrogen) containing the CMV promoter and the Zeocin resistance marker. The resulting plasmid DNA was named pRTZ.2. Ten million HMy2.CIR (ATCC, Rockville, MD), or 10 million HMy2.CIR-A2 cells were each washed in phosphate buffered saline (PBS) and re-suspended in 0.8 L of ice-cold PBS and put into an electroporation cuvette with 20 μg of circular plasmid DNA. The mixture was exposed to an electric pulse of 320 volts at 960 microF and incubated on ice for 10 min. Cells were then added to 10 mL of pre-warmed CM. The following day, the CM was replaced. On day 2, cells were grown under selection conditions using 200 μg/mL Zeocin. Following one week of selection, the cells were subcloned by limiting dilution under Zeocin selection, and 6 clones were isolated. The human B cell line HMy2.CIR-A2 transfected either with the Pr3 -containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT, was tested for intracellular Pr3 expression by flow cytometry analysis of as previously described. Two clones with the highest expression are shown in FIG. 3. HMy.2.CIR-A2 cells transfected with Pr3 are susceptible to lysis by PRl specific
CTL. It was next determined whether the transfected HMy2.CTR-A2 cells could be lysed by PRl specific CTL. The PRl specific CTL were elicited in the manner previously described, and after 22 days in culture were combined at a 25:1 E:T ratio with HMy2.CIR-A2 transfected either with the Pr3-containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT. PRl specific CTL were also combined with control marrow cells from a CML patient in blast crisis (P3), HL-60 cells (which express Pr3, but lack HLA-A2.1), and marrow cells from a normal donor (D3). PRl specific CTL demonstrated 36% specific lysis of the Pr3 -transfected cells (clone 1.4), but only background lysis of normal marrow cells, HL-60 cells, HMy2.CIR cells transfected with the empty vector (CAT), and the non-transfected parent B cell line HMy2.CIR (HMY A2; FIG. 4). These results suggest that the PRl peptide is processed and presented on the surface of the Pr3 transfected HMy2.CER cells. Although the level of Pr3 expression was lower than that found in leukemia cells, the B cell line may be more efficient at processing and presentation, thus compensating for the lower level of Pr3 expression. PRl-specific CTL identified in PBMC from normal donors by limiting dilution analysis and by using a PR1-HLA-A2 heavy chain tetramer. In order to determine the frequency of PRl-specific CTL in the PBMC of 2 HLA-A2+ normal donors (donors 2 and 3) and one patient with chronic phase CML (donor 1), a modified limiting dilution assay (LDA) designed for detecting low frequency lymphocyte precursors (CTLP) using a limited amount of patient material was used. This assay was used to determine the CTLP frequency (CTLPf) on day 0 and again after 20 days of PRl-stimulated expansion in bulk culture. The details of this assay are described herein. These results were compared to the results of a separate assay, using a reagent where CTL with PRl -specificity can be analyzed by flow cytometry. In this assay, the HLA-A2.1 heavy chain (modified to contain a biotin binding site near the C-terminal end of the A2 heavy chain) plus (β2-microglobulin is combined with the PRl peptide, which is then combined with streptavidin conjugated to phycoerythrin (PE) (Airman et al, 1996). This "PRl- tetramer" was therefore used to directly label CTL with TCR specific for HLA- A2.1 -bound PRl . FIG. 5 shows that the PRl-tetramer can be used to identify a distinct population of CTL with specificity for HLA-A2.1 -bound PRl amongst a 17 day-old bulk culture of PRl-stimulated PBMC. Selection of a purified population of PRl-specific CTL from bulk culture is possible using a PR1-HLA-A2 heavy chain tetramer. In order to determine whether a purified population of PRl-specific CTL could be obtained from bulk culture CTL stimulated with PRl , the PRl-tetramer to FACS sort for CTL that expressed PRl-specific TCR was used. In this way, an enriched population of CTL might quickly be obtained without the usual requirement of cloning by limiting dilution followed by expansion, a process that may take several weeks to months. A 32 day-old PRl-stimulated CTL culture was obtained from a starting population of PBMC from an HLA-A2.1+ normal donor using the methods previously described. When the cells were dual-labeled with anti-CD8 and the PRl-tetramer, 4.3% of the bulk culture CTL were double-positive. An aliquot of 5 x 106 CTL was washed three times with PBS and labeled with anti-CD8 conjugated to FITC (Caltag Laboratories, Burlingame, CA) for 2 hr at 4°C. The cells were then washed three times with PBS and labeled with the PE-conjugated PRl-tetramer for 2 hr at 4°C. This was followed by a third labeling with both anti-CD4 and PI which was used as a dump during sorting. The cells were then sorted for dual-staining running CellQuest and CloneCyt software. 1.1 x 105 CTL were recovered with >95% vwbility (a yield of 2.2% of the total population, or 55% of the PRl-specific population) and the sorted population is shown in FIG. 6. The sorted CTL were then placed back into culture at 1 x 10 cells/mL of CM supplemented with 10% human serum (Sigma) and 100 IU/mL IL-2 (Biosource International). After 24 hr, the cells were collected and tested for the ability to lyse fresh leukemia target cells. The PRl -sorted CTL were then compared to the non-sorted bulk culture CTL in a 4-hr cytotoxicity assay. Effector cells were washed three times with PBS and co-incnbated at E:T ratios of 20:1 to 2.5:1 with target bone marrow cells from an HLA- A2.1+ patient with accelerated phase CML and with bone marrow cells from an HLA- matched normal donor for 4 hr. Target cells (1000 cells/well) were labeled with Calcein AM for 90 min prior to co -incubation, as in previous experiments. FIG. 7 shows that the PRl -sorted CTL produced significantly greater specific lysis of CML marrow than non-sorted CTL at all E:T ratios, and that background lysis of normal marrow was reduced to near zero. The CTL population depleted of PRl-specific CTL after FACS sorting was also examined for specific lysis of the CML marrow and no specific lysis was found at any E:T ratio. These results demonstrate that the PRl-tetramer can be used to select a homogeneous CTL population with a higher degree of specificity toward leukemia than bulk culture PRl -stimulated CTL. Other investigators studying melanoma antigens have obtained similar results. Using a MelanA/MART-1 -tetramer to sort a polyclonal CTL line, Dunbar et al. (1998) found greater lysis of peptide-coated T2 cells and no background killing compared to non-sorted CTL. Using the PRl-tetramer, a homogeneous population of PRl-sorted CTL could be obtained for use in adoptive immunotherapy to treat patients with leukemia. DNA polymorphism is found within exon 3 of Pr3. Since allogeneic CTL responses directed against leukemia also involve differences in minor antigens (mH) between donor and recipient, the Pr3 coding region was searched for potential polymoφhisms. Twenty-eight HLA- identical donor-recipient pairs undergoing BMT were studied. DNA was prepared from frozen samples using the Wizard Genomic DNA Preparation Kit (Promega). Each of the 5 exons of Pr3 was amplified using specific primers (Table 8) and analyzed by PCR-SSCP (sequence specific coiiformational polymoφhism). The PCR mixture was then analyzed with only 0.5 mCi of [32P] dATP per reaction. The amplifications were carried out according to the "touchdown" protocol under the conditions summarized in Table 8. PCR products were reamplified with the same primers to which were added an Ml 3 sequencing primer tail (M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 14) for the forward primer and M13 Reverse 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 15) for the reverse primer). The new PCR product was directly sequenced using the ABI Dye primer Cycle Sequencing Kit with the M13-21 and Reverse sequencing primers. Several independent sequences of each of the selected individuals were aligned and compared.
Table 8: Oligonucleotide Primers and PCR™ conditions used for the amplification of the PR3 exons
Genotype of donors and recipients was determined using Sequence Specific primer (SSP) PCR. The PCR™ products were run in 2% agarose gel stained with Ethidium Bromide. Different patterns between individuals were noted in exons 1 through 4, but only exons 1 through 3 showed differences between donors and recipients of the same pair, as shown in FIG. 8. Since the amplified DNA product also contained portions of the flanking intronic regions and since all of the base differences in the coding region may not result in amino acid differences, the amplified products from donor-recipient pairs showing donor specific bands were sequenced. These results show that the Pr3 gene is polymoφhic for the following reasons: (1) The sequences as determined from the intronic regions conflicted several times with the published genomic sequence; (2) two different polymoφhic sites were found in exons 1, 2, and 3 that explained the multiple patterns observed on autoradiography; (3) only one DNA polymoφhism, in exon 3, was found to encode for an amino acid polymoφhism in the deduced amino acid sequence (Table 9). This polymoφhism encodes for either an isoleucine (ATT) or a valine (GTT) at position 119 of the amino acid sequence.
Table 9 - Polymorphisms in the Pr3 gene as determined by direct gene sequencing
Sequencings of the first 4 exons have been submited to Genbank (accession numbers: .AF015446; AF015447; AF015448 and AF015449). Aa: amino acid; He; isoleucine; Val: valine; UT: untranslated.
Peptides that span the Pr3 polymorphic site bind to HLA-A2.1. Next, it was determined whether the polymoφhism, as discussed above, could lead to the expression of different peptides that could bind to HLA molecules. Anchor motifs contained in the peptides spanning the polymoφhic region of exon 3 were then looked for that could bind to several HLA class I molecules including HLA-A1, -A*0201, -A*0205, -A3, -Al l, and -A24. There are two 10 amino acid peptides (KLNDILLIQL (SEQ ID NO:8)) or KLNDVLLIQL (SEQ ID NO:9)), named PR7I and PR7V, respectively) spanning the polymoφhic site, at amino acid 115-124 which possess anchor motifs capable of binding to HLA-A2. Both peptides have the same predicted binding half-lives of 705 mn and 126 mn for HLA-A*O201 and - A*0205, respectively. The ability of these peptides to bind to HLA-A*0201 was then tested in T2 cells by measuring surface HLA expression. Peptides PR7I and PR7V, together with control influenza peptide, were each pulsed onto T2 cells for 18 hr and the subsequent HLA-A2.1 expression was measured by flow cytometry. T2 cells pulsed with either PR7I or PR7N demonstrated strong peptide binding with fluorescence intensities greater than that of the positive control peptide (Influenza B Nuclear Protein; FIG. 9). Low background MHC class I expression was demonstrated by the low fluorescent intensity of the cells without added peptide. It was previously shown that the PRl self peptide from Pr3 is irnrnunogenic, and these data suggested that T cell responses may be elicited against polymoφhic differences in Pr3 as well. These differences may be used as a basis for designing leukemia-specific adoptive T cell therapy of myeloid leukemia. EXAMPLE 5 PRl IS DERIVED FROM PROTEINASE 3 AND NEUTROPHIL ELASTASE PROTEINS
The leukemia-associated antigen PRl is derived from both proteinase 3 and neutrophil elastase proteins. The inventors have shown that killing of leukemia cells by PRl- specific CTL correlates with P3 overexpression. However, the PRl sequence is also contained within neutrophil elastase (NE), which is also aberrantly expressed in leukemia cells. To determine whether PRl is processed and presented from either protein, P3- and NE-transfected B cells were used as target cells in a proliferation assay with PRl-specific T cells. Full-length P3 and NE cDNA was cloned from the promyelocytic HL-60 cell line based on published sequences. The sequences were subcloned into an EGFP-containing vector (pCMS-EGFP) with a CMV promoter to drive constitutive expression. The B cell line, HMy-CIR, previously stably transfected with the HLA-A*0201 gene, was transfected with P3-pCMS-EGFP and NE-pCMS- . EGFP by electroporation for 24 hr. GFP-expressing cells (P3-HMy.CIR-A2 and NE-HMy.CIR- A2, respectively) were selected by FACSorting and high transfection levels were confirmed by fluorescence microscopy. Quantitative real time-PCR showed mRNA transcripts from one of two selected P3-transfected clones were only 2.6-fold less than HL-60 cells (p = 0.07), and only 1.5-fold less in a second clone (p = 0.3). By contrast, NE transcript numbers from a transfected clone were 7-fold less than in HL-60 cells. Western blotting confirmed protein expression in the NE-HMy.CIR-A2-transfected cells, although expression was similarly less than in HL-60 cells. PRl-specific CTL lines elicited from two healthy donors showed stimulation indices (SI) of 1.3 and 2.4 when co-incubated with P3-HMy.CIR-A2 target cells during BrDU incoφoration, confirming that PRl -CTL recognize PRl peptide processed and presented from P3. Interestingly, PRl -CTL also recognized NE-transfected cells, with Si's of 1.5 and 2.1. No recognition of non-transfectants or parent HMy.CIR (A2-) was observed. These results demonstrated that, in addition to P3, PRl is also processed and presented by NE, which may result in enhanced immunogenicity of the peptide compared to peptides derived from a single protein. Redundancy of proteins may also lessen the impact of tumor-loss variants after PR1- based immunotherapy. EXAMPLE 6 BMT PATIENTS WITH MYELOID LEUKEMIA TESTED FOR CTL IMMUNITY TO PRl
The data in this study support that PRl could be used as a target antigen to stimulate both active and passive leukemia-specific immunity. In this study, PRl will be given as a vaccine with incomplete adjuvant to boost leukemia immunity, and in additional clinical trials PRl- specific CTL will be selected and expanded ex vivo with the PRl antigen for the production of leukemia-reactive CTL. PRl-specific CTL will be used alone or combined xvith existing treatments, such as allogeneic BMT, to produce a GVL effect. PRl-specific donor-derived CTL added to a previously CD3 T cell-depleted graft, for instance, may allow selective GVL reactivity without GVHD. In this study, it has been shown that normal donors liave existent CTL immunity to PRl, an HLA- A2 -restricted 9 amino acid peptide (aa 169-177) derived from proteinase 3 (Pr3). Pr3 is a protein contained within the azurophil granules of myeloid lineage cells and is overexpressed in many patients with myeloid leukemia. CTL responses to PRl will be examined by determining CTL precur-sor (CTLP) frequency using microtiter limiting dilution analysis. As a first step to determining the clinical significance of CTL responses to PRl, blood and bone anow samples will be examined from patients and their marrow donors prior to transplant, and at three, six, and nine months after transplant. Recently, it has been found that some patients with CML that have had a molecular relapse after allogeneic BMT have both Ph+ and Ph- populations of host-derived hematopoietic progenitors present, and that after DLI alone were given to patients the host- derived Ph- progenitors reconstituted normal hematopoiesis. This suggests that trie allogeneic DLI that produced the remission might target CML independent of minor antigen differences between the donor and the recipient. If a CTL response to PRl is contained within the GVL response, it is expected that CTLPf would be low in the donor, lower still in the recipient, but that it would increase following BMT. Alternatively, a high CTLPf against PRl present in the recipient prior to BMT might indicate leukemia immune escape, which could h e addressed separately as detailed below. Because of the limited availability of patient material, especially bone marrow, it is important to use the microtiter techniques described herein to determine CTLPf by limiting dilution analysis (LDA) using Terasaki trays. PBMC and BM from HLA-A2.1+ patient samples will be used to test for existing T cell reactivity toward PRl by using a limiting dilution CTLPf assay (Hensel et al, 1999). PBMC and bone marrow mononuclear cells (BMC) will be obtained by Ficoll Hypaque separation and either used fresh, or frozen in liquid nitrogen for future use. Samples from HLA-A 2.1 positive patients with CML, AML, and MDS will be collected. PBMC and BM from the HLA-matched normal BMT donors to those patients will also be collected, cryopreserved, and assayed as well. The previously frozen samples will be thawed and washed three times in serum-free CM and counted. A total of 19.5 million cells will be prepared for the assay (7.5 million stimulator cells, and 12 million responder cells). One million additional PBMC will be used to generate phytohemagglutinin (PHA-P; Sigma Chemical, St. Louis, MO) stimulated blasts to be used as target cells on day 10 of the assay. One million unrelated HLA-disparate PBMC (third party) will also be used as a positive control, with half of the total number used as stimulator cells and the other half as responder cells. PHA blasts will be generated by placing 106 cells in 1.0 mL of CM supplemented with
10% fetal bovine serum (FBS; Sigma Chemical) in a 25 cm2 flask. Five μL/mL of PHA-P will be added, and the cells will be cultured in 5% CO at 37°C. On day 4, 6, and 8 of the culture, additional CM + 10% FBS with 5 μL/mL PHA-P and 500 lU/mL rhIL-2 will be added. Cells will be counted and cultures will be maintained at 106 cells/mL. These cells will be used as target cells on day 10 of the CTLPf assay. PBMC responder cells (from patient samples) will be plated into high profile Terasaki Trays (Robbins Scientific, Sunnyvale, CA) at 6 dilutions (from 5 x 104 to 5 x 105 PBMC/well) using 24 replicates at each dilution in CM + 10% human AB serum (AB; Sigma Chemical). Third party responders (from normal donors) will be plated at a single dilution (5 x 104 PBMC/well). Patient PBMC stimulator cells will either be pulsed with peptide (PRl or FLU, the influenza nuclear protein described previously, as a positive control peptide) at 20 μg/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, then irradiated with 2500 cGy. These cells will then be plated into the wells containing the responder cells, as well as 24 additional wells of stimulators alone. On days 3 and 7, 60 IU/mL of IL-2 will be added to each well. On day 10 the previously prepared PHA blasts from the same patient (as target cells) will either be pulsed with PRl at 20 mg/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, and then labeled with Calcein AM (Molecular Probes, Eugene, OR) as described in the cytotoxicity experiments above. One thousand target cells per well will be plated, lightly centrifuged at 800 φm for 1 min, and then cultured in 5% CO at 37°C for 4 hr. Five microtiter of Fluoroquench EB Stain-Quench Reagent (One Lambda, Canoga Park, CA) will be added to each well, and the plates will be analyzed for fluorescence emission using an automated Lambda Scan (One Lambda, Canoga Park, CA). The mean plus 3 standard deviations of the 24 wells containing the stimulators alone will be determined as the cut-off value for background fluorescence. Any experimental well less than the cut-off value will be considered positive for lysis, and from the fraction of negative wells at the various responder cell dilutions, the frequency of CTLP will be calculated using the maximum likelihood method based on Poisson probabilities. The calculated CTLP ±requencies will then be analyzed with respect to the amount of Pr3 expression in the patient's blast populations, since the amount of specific lysis of PRl-specific CTL in normal donors correlated with the amount of Pr3 overexpression in the target leukemia cells in the previous studies (Molldrem et al, 1996). Determining the percent of PBMC and BM specific for the PRl peptide. CTL responses to PRl will be examined determining the percent of peripheral blood mononuclear cells (PBMC) and bone marrow cells (BM) that are specific for the HLA-A2.1 -bound PRl peptide by FACS analysis using a specific PRl -HLA- A2 tetramer (PRl-tetramer) linked to phycoerythrin (PE). The PRl-tetramer will be used to identify the fraction of CTL that recognize HLA-A2-bound PRl in patient and donor PBMC and BM before transplant and again 6 months after transplant. This will be easier to study using patients that receive peripheral blood grafts since more patient material is available for the larger number of lymphocytes needed for flow cytometry determination of the percent of PRl-specific CTL. PRl-specific CTL, determined using the combination of PRl-tetramer plus CD8, will be analyzed by using three and four color FACS analysis to simultaneously determine the phenotype of the PRl-specific CTL. The cells will be analyzed for state of activation using CD28, CD69, and CD25. Memory CTL will be evaluated using CD45RO antibody. It is important to determine whether any PRl-specific CTL that are found in the leukemia patients are memory cells in an inactivated state which would suggest either that the leukemia is not a potent immunogen or perhaps the CTL are incapable of responding. By also deterrnining Pr3 expression and surface phenotype of the leukemia cells (including MHC I and II, - CD 40, CD54, CD80 and CD86), immunogenic potential can be better assessed. Since the precursor frequency of PRl-specific CTL is quite low even in the normal donors previously examined, PRl-specific CTL may not be detectable by FACS analysis because of the low total number of cells available in the patient samples. In addition, patient lymphocytes may be incapable of responding to PRl peptide due to tolerance or anergy. By expanding PRl- specific CTL lines in vitro using T2 cells pulsed with PRl peptide this possibility will be investigated. Starting with cryopreserved patient PBMC and BM, 10 million mononvxclear cells will be thawed and washed 3 times with PBS. These cells will be placed into culture with 5 to 10 million T2 cells (previously pulsed with 10 μg/mL of PRl for 90 min at 37°C) in CM + 10% HS at 37°C and 5% C02 for one week and then re-stimulated with PRl-pulsed T2 cells on day 7. On day 8, IL-2 at 20 IU/mL will be added to the cultures and this process will be repeated at two and three weeks of cell culture. The cells at the end of three weeks in culture will be collected and used in micro-cytotoxicity assays using Calcein AM-labeled T2 cells as targets. T2 target cells will be pulsed with 10 μg/mL of PRl, control Flu peptide, or no peptide for the cytotoxicity assays. A CTL line established from an HLA-matched normal donor using the saαne methods will be used as a positive control in the cytotoxicity assay, since this is an established method. CTL responses to PRl will be examined determining the frequency of cells secreting cytokines in response to PRl peptide recognition using the ELISPOT assay. Cytokine- secreting cells will be measured in response to PRl -coated targets by using the ELISPOT assay. Recent clinical trials have used methods such as precursor frequency analysis by limiting dilution based on cytotoxicity (51Cr), lymphocyte proliferation (3H thymidine uptake), as well as cytokine responses by measuring single cell interferon-γ or TNF-α secretion (using the commercially available ELISpot assay, Mabtech, Nacka, Sweden). Each of these methods measure different lymphocyte functional responses, and clinical response to tumor va cines does not always correlate with these in vitro measurements (Nelson et al, 166; Rosenberg et al, 1998). Lalvani et al (1997) have determined, using the enzyme-linked immunospot (ELISPOT) assay, that memory CD8+ T lymphocytes are capable of rapid effector function (i.e. 24 hr) when triggered with exposure to cognate peptide in the absence of cytokines. The frequency of CTL as measured by ELISPOT has been shown to correlate closely with the number of CTX that stain with peptide-specific tetramers in FACS assays (Dunbar et al, 1998), although limitLng dilution assays (LDA) often yield lower frequencies by comparison. Others have found that 14-day expansions of PBMC against peptide-coated target cells results in a better correlation of LDA with the ELISPOT assay (Scheibenbogen et al, 1997). These results suggest that LDA, which is highly dependent on culture conditions and relies on the presence of proliferating cells, may underestimate the actual number of peptide-specific CTL present. ELISPOT assays will be performed in 96-well polyvinylidene difluoride backed plates (MAIP S 45; Millipore, Bedford, MA). These wells will be coated with 15 μg/mL of anti-IFN-γ mAb 1-DIK (Mabtech, Stockholm, Sweden) overnight at 4°C. Plates will be washed 6 times with CM and blocked with CM + 10% HS for 1 hr. PBMCs will be thawed and washed 3 times with PBS and suspended in CM + 10% HS. PBMCs will be added in 100 μL CM + lO% HS per well to the precoated plates at 5 x 105/well, in duplicate wells. For assays performed in parallel with CTLPf by LDA, duplicate wells with 5 x 105 and 2.5 x 105 PBMCs/well will be used. Detection of peptide-specific T cells from freshly isolated PBMCs will be performed using autologous PBMCs themselves to present PRl peptide. This will avoid responses been elicited from T cells of other specificities if heterologous B cell lines (such as EBN-transformed lymphocytes) were used as target cells for peptide presentation. Peptides will be added at 10 μg/mL. T2 cells will be used in some assays as target cells and compared to the autologous PBMCs. In this case, T2 cells will be pulsed with 10 μg/mL of PRl peptide for 90 min and washed 3 times prior to plating with responder PBMCs. The plates will then be incubated for 6 hr at 37°C, 5% C02 and then arrested by shaking off the contents and washing 6 times with PBS 0.05% Tween 20 (Sigma Chemical, St. Louis, MO). Next, 100 μL of 1 μg/mL of the biotinylated anti-IFN-γ mAb 7-B6-1 biotin (Mabtech, Stockholm, Sweden) will be added. After 3 hr of incubation, plates will be washed, six times more and a 1:1000 dilution of streptavidin alkaline phosphatase conjugate (Mabtech) will be added to the wells and the plates then incubated at room temperature for a further 2 hr. Next, the wells will again be washed 6 times and 100 μL of chromogenic alkaline phosphatase substrate (Bio Rad Labs, Hercules, CA), diluted 1:25 with deionized water, will be added. After 30 min, the colorimetric reaction will be terminated by washing with tap water and the plates will be air dried. Enumeration of the IFN-γ-producing spot-forming cells (SFCs) will be performed using a stereomicroscope under magnification of 20. Only large spots with fuzzy borders will be scored as SFCs as per convention (Klinman, 1994). Responses will be considered significant if a minimum of five SFCs are present per well, and additionally, this number is at least twice that in negative control wells (without added peptide). Counting SFCs allows the added advantage of estimating the frequency of responding CTL. If no SFCs are seen, then the time of exposure to peptide will be increased in a time course experiment up to 48 hr. If no SFCs are yet produced, this could be an indication that a secondary response could not be produced and a primary response will be investigated. In this case, PBMCs will be pulsed with PRl peptide and exposed as stimulators to autologous PBMCs at a 1:1 responder: stimulator ratio on two occasions over 7 to 10 days with low-dose IL-2 added to each well at 60 IU/mL before the ELISPOT assay is performed. In addition, since others have demonstrated that TNF- is sometimes produced by greater numbers of peptide-specific CTL than γ-IFN, the ELISPOT technique will also used to quantify the number of SFC in a TNF-a assay under similar conditions (Herr et al, 1996). By making use of the Perseptive Biosystems Cytofluor 4000 plate reader requested in the budget of this proposal, the CTLP frequency by LDA, cytotoxicity experiments, and ELISPOT assays can -all be performed using this same instrument (Herr et al, 1997). Evaluation of Pr3 expression and surface phenotype of myeloid leukemia target cells. Cytoplasmic Pr3 expression will be detennined in BMC from each of these patient samples, based on cytoplasmic staining and subsequent analysis using flow cytometry using the method previously described (Molldrem et al, 1996). Cells will also be surface-labeled with anti-CD33, CD34, and CD14 monoclonal antibodies (Becton-Dickinson, San Jose, CA) in order to correlate the developmental stage of the blast population with Pr3 expression. In addition, cells will be labeled for MHC class I and II, CD80 (B7.1) (ImmunoTech S.A., Marceilles Cedex, France), CD86 (B7.2) (ImmunoTech), and CD54 (ICAM-1) (Becton Dickinson) to evaluate the potential of the blasts as suitable CTL targets. Three color staining will allow for cell subset analysis. One million cells will be studied for each combination of antibodies. The cells will "be washed in serum-free CM, permeabilized using Ortho PermeaFix for 30 min at room temperature, washed twice in serum-free CM, and then indirectly stained with an antibody to Pr3 (Accurate Chemicals, Westbury, NY) and a secondary FITC-conjugated antibody. This will he followed by an additional wash with serum-free CM and surface labeling of the other markers using direct staining with PE- or APC-conjugated antibodies at 4°C. As previously discussed, a high CTLPf in the recipient pre-BMT may indicate leukemia immune escape. This may be due to decreased expression of MHC 1 (Dermime et al, 1997, decreased co-stimulatory molecules (Matulonis et al, 1995; Boussiotis et al, 1995), decreased Pr3 expression in the leukemia (Molldrem et al, 1996), or possibly a TCR signaling defect in the CTL (Boussiotis et al, 1996). In addition, a failure to increase CTLPf after BMT may also "be due to any of these mechanisms. By examining expression of these molecules and correlating CTLPf with the number of PRl-specific CTL present by PRl-tetramer labeling, insight into possible failure of a CTL immune response to PRl will gained. For instance, a low CTLPf but a high percent of PRl-specific CTL by flow cytometry may indicate a defect in CTL target recognition, which may be further investigated by examining TCR ~ chain tyrosine phosphorylation by Western blot analysis. Humoral immune responses to Pr3 will be examined by measuring antineuroptiil cytoplasmic antibody (ANCA) titers. In Wegener's granulomatosis, the ANCA IgG titer correlates closely with disease activity. Since T lymphocytes taken from biopsy sites of active vasculitis in these patients show proliferation in response to Pr3, and since T cell help is required for IgG production, it is possible that measuring ANCA titers may be an indirect measure of Redirected activity of T lymphocytes. ANCA titer has not been formally examined in patients with myeloid leukemia. An inexpensive and reliable assay is commercially available and used in clinical laboratories to evaluate ANCA titers. ANCA titers will be determined in all myeloid leukemia patients enrolled on phase I/II clinical vaccine trials as well as the transplant patients and their donors will be investigated using the above assays to measure cellular immunity. Patients of all HLA types will be evaluated for ANCA positivity.
EXAMPLE 7 DETERMINING WHETHER PRl CAN ELICIT SPECIFIC ANTILEUKEMIA IMMUNITY IN PATIENTS WITH MYELOID LEUKEMIA
It was next determined whether PRl can be used to elicit specific antileukemia immunity in patients with myeloid leukemia. Leukemia offers several advantages as a model disease for vaccine development and evaluation. First, since the leukemia cells circulate in the peripheral blood the tumor cells are readily available for study without the need for repeated invasive biopsies which allows for close monitoring of any changes in the tumor phenotype. In addition, the lymphocytes under study also reside in the peripheral blood in constant contact with the malignant cells. These are obvious advantages to the study of immune responses in the treatment of solid tumors. Enhancing CTL reactivity by PRl. A phase I/II clinical protocol using the PRl peptide in combination with incomplete Freund's adjuvant (IF A) will be employed to vaccinate patients with myeloid leukemia to determine whether CTL reactivity to PRl peptide can be enhanced by subcutaneous vaccination with the PRl peptide combined with incomplete Freund's adjuvant (IF A) every 3 weeks for 3 injections. CTLP frequency will be measured in PBMC and BM before and after vaccination using microtiter limiting dilution analysis. IFA has been used in one successful clinical trial using gplOO to vaccinate patients with melanoma (Rosenberg et al, 1998). Up to 60 HLA-A2+ patients (as confirmed with BB7.2 antibody labeling) with CML, AML, and MDS will receive a deep subcutaneous injection every 3 weeks for 9 weeks. Patients will be randomized to three dose levels of the PRl peptide (0.25 mg, 0.5 mg, and 1.0 mg) with a fixed amount of IFA, and then followed in cohorts of 4 for toxicity and evidence of an immune response to PRl as measured in vitro using the CTLPf assay by LDA. Patients will be randomized to three different doses of vaccine, since it is not clear that increased dose will result in a greater anti-tumor response, hi fact, if toxicity of a vaccine is related to the augmentation of the immune response, that augmentation may be elicited by repeated immunization rather than increasing the dose of the immunizing antigen. The "dose escalation" of a vaccine may not lie in the quantity of peptide delivered, but rather in the number of exposures to antigen, i.e. the number of immunizations. In fact, in a study of immunization with TCR derived peptides for the treatment of multiple sclerosis there was an indication that the peptide-specific T cell immune response was suppressed when the amount of peptide injected was greater than 1000 μg (Bourdette et al, 1994). hi addition, immune responses will be investigated using the PRl-tetramer. A one log increase (compared to study entry) in CTLPf, or any increase in the percent of PRl-specific CTL by FACS analysis measured at any time over the 9 weeks will be considered evidence of an immune response to PRl . These assays will be performed using samples of bone marrow and peripheral blood from patients enrolled on this protocol. Standard criteria for complete and partial remissions will be used to judge clinical responses. Using the methods described, the CTLPf (by LDA) and the percent PRl-specific CTL measured using the PRl-tetramer will be used to assay immune responses in the patients. Approximately 20 million PBMC will be used in both assays derived from 100 ml peripheral blood samples before and 3 weeks after the last vaccination. Further experiments will be performed to evaluate any non-responsiveness found using both these assays. An important aspect in the design of any phase I/II cancer vaccine trial targeting a self tumor antigen is the selection of the patients to be immunized. Toxicity such as vasculitis is possible and therefore patients with advanced stage leukemia will be eligible for this initial study. However, determination of safety requires that an immune response be mounted, and far advanced patients often lack a competent immune response. Therefore, patients with all types of myeloid leukemia at various stages of disease including patients with chronic phase CML who will have a stable low-leukemia burden and normal lymphocyte counts will be examined. It is anticipated that the chronic phase CML patients will be those without the option of of allogeneic BMT, who may be failing other forms of therapy such as interferon with or without chemotherapy, and who are therefore terminally ill. Patients with CML offer the further advantage over solid tumor patients that molecular studies of the amount of Ph chromosome can be used to judge responses in the chronic phase patients with low tumor burden. PCR analysis, which is performed routinely on all CML patients to follow the disease course, will be performed at 3-week intervals during the course of the study, and again one month after the last vaccine. In order to increase the likelihood of producing an immune response against the leukemia, a subcutaneous injection of 75 μg of GM-CSF will be administered into each vaccine injection site to enhance the adjuvant effect. GM-CSF as an adjuvant has produced greater immune responses in animal models of other hematological malignancies (Kwak et al, 1996). Phase I trials using bcr-abl junction region peptides to vaccinate patients with CML are being conducted by other investigators. These investigators are using a combination of 5 HLA- A3 and HLA- All-restricted peptides from the b3a2 translocation region with the adjuvant QS-21 in a dose-escalation trial design starting with 10 μg of peptide. Thus far, 5 patients treated with 10 μg and 5 patients treated with 30 μg (the next dose level) have not had any clinical response to the vaccine. By using the conventional 51 Cr-release cytotoxicity assay, these investigators have not found in vitro evidence of an immune responses to the peptides thus far. Thus, as provided in the present invention, the PRl peptide vaccine has greater potential to elicit immunity compared to bcr-abl junction region peptides for several reasons. First, the pre-clinical data regarding bcr-abl junction region peptides indicates that CTL elicited in vitro against these peptides do not demonstrate cytotoxicity against fresh leukemia target cells, but only to leukemia cells that have been pre-pulsed with the target peptides. In contrast, PRl- specific CTL show cytotoxicity and leukemia progenitor inhibition of fresh leukemia cells with no prior peptide labeling of the target cells (FIG. 2). Second, clinical trials showing responses to melanoma peptide vaccines have used 10-fold higher peptide doses to vaccinate patients than what is used in the b3a2 peptide vaccine trial. The PRl vaccine trial will use peptide doses similar to those used in the melanoma vaccine trials. Third, the 51Cr-release CTLPf by LDA that was used to evaluate an immune response to the b3a2 peptides is less sensitive than the mirco- titer CalceinAM-based assay of the present invention. Lastly, the PRl vaccine trial will include patients with all types of myeloid leukemia, thereby broadening the opportunity to find immune responses. Potential non-responsiveness to PRl will be evaluated by generation of PRl-specific T cells in myeloid leukemia patients. In this phase I/II study, whether PRl-specific CTL responses can be elicited in patients by using the peptide vaccine will be determined. In those patients where no immune response is elicited, or in those patients that develop an immune response but do not have a clinical response to the vaccine, it will be important to know whether PRl-specific CTL from those patients can recognize and/or kill autologous leukemia cells. These patients will be investigated further to determine whether a PRl-specific CTL can be elicited from PBMC in vitro using methods described herein. In these patients it is expected that a PRl -specific CTL will not be elicited in vitro, or any CTL that could be expanded might not be able to recognize or kill the leukemia. PBMC from amongst patients with CML, AML, and MDS that do not develop an immune response to the vaccine will be selected in order to identify any differences based on disease. Fifty million T2 cells will be washed in serum-free CM three times and suspended at 10 x 106 cells/mL in 50 mL conical tubes. PRl peptide, synthesized to >95% purity (Biosynthesis, Lewisville, TX), will be added to the T2 cells at 10 μg/mL and the T2 cells will be placed in a humidified incubator at 37°C for 90 min. The PRl -pulsed T2 cells will be irradiated with 7500 cGy, washed twice with serum-free CM, and combined at a 1:1 ratio with patient PBMC in 50 mL of CM + 10% human AB serum (10% AB) and placed in a 75 cm2 tissue culture flask. Media will be replaced as necessary, and at day 7 the PBMC will be washed with CM + 10% AB and recombined at a 1:1 ratio with fresh T2 cells (similarly pulsed with PRl, irradiated, and washed). On day 8, 20 IU/mL of recombinant human interleukin-2 (rhIL-2) (Biosource International, Camarillo, CA) will be added to the culture. After 14 days in culture a third stimulation will be performed with PRl -pulsed T2 cells, followed on day 15 by addition of rhlL- 2. A fourth stimulation will be performed on day 21 followed on day 22 by the addition of 20 IU/mL rhIL-2. After a total of 25 to 27 days in culture, the PRl-stimulated T cells will be tested for peptide-specific cytotoxicity toward T2 cells and leukemia cells from autologous and allogeneic BMC. A semi-automated mircotiter cytotoxicity assay, identical to that used in the previously published studies, will be used to determine specific lysis. Effector cells grown in the presence of PRl -pulsed T2 cells will be prepared in doubling from 6 x 103 to 25 x 103 cells/well and will be plated in 40 μL, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, CA) with six replicates per dilution. Target cells (T2 cells ± PRl, autologous marrow-derived leukemia cells, or marrow derived from normal donors) will be thawed and washed three times in serum-free CM then suspended at a concentration of 2 x 10 cells/mL and stained with 10 mg/mL of Calcein-AM (CAM; Molecular Probes Inc, Eugene, OR) for 60 min at 37°C. After washing three times in CM + 10% AB, target cells will be resuspended at 105 cells/mL. Wells with target cells alone and medium alone will be used for maximum (max) and minimum (min) fluorescence emission, respectively. After 4 hr incubation at 37°C in 5% CO2, 5 μL FluoroQuench EB Stain-Quench Reagent (One Lambda, Inc, Canoga Park, CA) will be added to each well and the trays will be centrifuged for 1 min at 60g before measurement of fluorescence using an automated Lambda Fluoroscan (One Lambda, Inc). A decrease in the fluorescence emission is proportional to the degree of lysis of target cells, once the hemoglobin contained in the FluoroQuench reagent quenches the released dye. The mean and standard deviation fluorescence from the 6 wells at each E:T ratio will be calculated, and the percent lysis will be calculated. PRl specificity will be confirmed by using Flu peptide-coated T2 cells as a negative control target cell population in the cytotoxicity assay. Autologous BMC and HLA-A2+ BMC from a normal donor will be prepared similarly and also used as target cells to test for leukemia-reactivity. In addition, patient PBMC will be used in parallel to generate Flu- specific CTL lines which will be similarly tested for lysis of Flu peptide-coated T2 cells. In the case where CTL immunity is preserved against the Flu peptide, but can not be elicited against PRl, then comparison to any existent pre- vaccine PRl immunity (as measured by CTLPf, PRl-tetramer positive CTL, or PRl-specific CLT by ELISPOT) would assess the development of tolerance toward PRl. To confirm HLA-A2.1 specificity in these experiments, 100 μL/mL of the HLA-A2- specific blocking antibody BB7.2 (ATCC; Rockville, MD) will be co-incubated with 1 x 106 PRl -coated T2 cells for 30 min at 37°C prior to coincubation with effector cells. Starting PBMC and resultant T cell populations will be phenotyped for T cell subsets using the PRl- tetramer, anti-CD3, CD4 + CD8, CD3 + CD16 + 56, and anti-TCR-αβ (Becton Dickinson). In order to elicit autologous PRl-specific cytotoxicity in vitro, an alternative approach that may be used will employ PRl -pulsed dendritic cells (DC) derived from adherent PBMC populations and grown for 7 to 10 days in IL-4 and GM-CSF in place of T2 cells to stimulate responder CTLs using PBMC from these patients (Nestle et al, 1998). In patients where a loss of immune response to PRl is found, 100 μL of blood will be collected and PBMC isolated over a Ficoll-Hypaque density gradient as previously described. PBMC will be allowed to adhere to a plastic 75-cm2 flask for 2 hr at 37°C. Non-adherent cells will be removed, and the adherent cells will be cultured for 7 days with GM-CSF (800 U/mL; Sandoz, Germany) and IL-4 (500 U/mL; PharMingen, Hamburg, Germany). Phenotypic changes will be monitored by light microscopy and flow cytometry will be performed to confirm the DC phenotype. Cells will be evaluated for high levels of HLA class I, HLA class II, and costimulatory molecules (CD80 and CD86) as previously described. PRl will be used to pulse dendritic cells (DC) derived from the peripheral blood of normal donors, and these PRl -pulsed DC will be used like T2 cells in previous experiments to elicit PRl- specific CTL. PRl-specific lysis will be evaluated using these DC-generated CTL using assays discussed previously and compared with T2-generated CTL. In additional experiments Pr3 expression in patient BMC will be evaluated after the addition of interferon-γ, interferon-α, and GM-CSF. These cytokines are known to increase
T cell MHC molecules and co-stimulatory molecules (Tsukada et al, 1997) and also increase
Pr3 expression (Mayet et al, 1997; Sibelius et al, 1998). Thus, cytokine co-administration might lead to more effective anti-PRl immunity (Dermime et al, 1997). To determine whether a FACS-sorted population of PRl-specific CTL from HLA- A2 donors can produce enhanced lysis of autologous and allogeneic leukemia cells. As indicated in FIG. 17, the PRl-tetramer may be used to FACS sort for a homogeneous population of PRl -selected CTL that show high specific lysis of leukemia with no background lysis of normal marrow cells. Therefore, the PRl-tetramer will be used in the present invention to FACS sort homogeneous population of CTL from bulk culture CTL lines established at 2 to 3 wk of culture. These CTL lines will be generated using PBMC from HLA-A2.1+ patients with CML and AML as well as normal donors using PRl -pulsed T2 cells as antigen presenting cells. Using the PRl-tetramer, these cells will be FACS sorted and their state of activation and phenotype will be compared (by measuring CD28, CD69, CD25, and CD45RO) and their ability to lyse PRl-coated T2 and fresh autologous and allogeneic leukemia cells. The results of these cytotoxicity experiments will be compared to the results obtained with bulk culture CTL as well as the population of CTL left behind after the sort procedure. PRl -sorted CTL that demonstrate cytotoxicity toward the leukemia cells, will also be evaluated for their ability to inhibit leukemia CFU-GM and normal HLA-A2.1+ CFU-GM using normal donor bone marrow cells and the methods previously described. The PRl -sorted CTL, as shown in FIG. 16, contain some CD8+ cells that do not have apparent specificity for PRl. However, a much more homogeneous population of PRl-specific CTL are obtained using the PRl-tetramer, which will allow for more efficient cloning of these cells. Cells will be cloned by limiting dilution according the Poisson distribution where 0.3 cells/well will be plated into 96 well plates containing 1 x 105 allogeneic PBMC (previously radiated with 7,500 cGy) in 300 μL CM + 10% HS and 60 IU/mL IL-2. These wells will be placed at 37°C and 5% CO2 for 7 to 10 days. Media will be replaced after 7 to 10 days and wells that contain growing cells will be expanded and subsequently studied for specific lysis of PRl- coated T2 cells as previously described. These clones will also be evaluated for phenotype using the above antibodies. Clones obtained using these methods will be used to investigate the Hmy2.CIR-A2 transfectants and other cells transfected with the Pr3 gene as discussed elsewhere in this application. Similar to that demonstrated in previous studies (Molldrem et al, 1999), CTL from a patient with CML that demonstrate high specific lysis of PRl -pulsed T2 target cells was not elicited. Therefore, to overcome the apparent non-reactivity to this self-peptide in patients with leukemia FACS-sorted populations of PRl-specific CTL from normal donors will be investigated. Normal donor-derived allogeneic PRl-specific CTL that are FACS sorted using the PR1- tetramer may be used for the safe adoptive transfer into leukemia patients selected only for the HLA-A2.1 allele as demonstrated using CTL specific for adenovirus-associated tumors in mice (Toes et al, 1996). This type of allogeneic therapy might allow for selective killing of host leukemia without the requirement of a traditional bone marrow transplant and without the requirement of a fully HLA-matched donor. EXAMPLE 8 IDENTIFYING POTENTIAL HLA-A2.1-RESTRICTED PEPTIDE EPITOPES IN PR3 TO ELICIT LEUKEMIA-REACTIVE HUMAN CTL USING IMMUNOLOGICAL METHODS
To determine whether CTL reactivity can be elicited against the remaining self peptides contained within Pr3 that are predicted to bind to HLA-A2.1. The development of effective peptide vaccines for leukemia will likely involve the identification of several peptide epitopes, since a single peptide might not be immunogenic in all individuals. It is likely that other peptides within Pr3 will also elicit CTL immunity, and using the same methods to find the
PRl peptide, seven additional peptides within Pr3 have been identified that contain the HLA- A2.1 binding motif (Table 4, PR3-PR9). These peptides have been identified to 95% purity
(Biosynthesis Co.) and tested for HLA-A2.1 binding by performing flow cytometry for HLA-
A2.1 expression on peptide-coated T2 cells using methods previously described. These peptides will be used to elicit CTL where peptide-coated T2 cells are radiated, pulsed with peptide, and used to stimulate PBMC from normal donors. These resultant CTL lines will be tested first for peptide-specific recognition of peptide-coated T2 cells (compared to non-coated T2), and then for lysis of fresh HLA-A2.1+ BMC from leukemia patients (compared to BMC from normal
HLA-A2.1+ donors). Blocking studies with antibody to HLA-A2.1 (BB7.2) and irrelevant Flu peptide-coated T2 cell targets will be used to confirm the allele-specificity in cytotoxicity assays. The relative binding affinities to HLA-A2.1 of these peptides compared to PRl will be determined by incubating serial dilutions of PRl plus each peptide with T2 cells and analyzing for surface HLA-A2.1 expression by flow cytometry. In this way, an IC 0 value will be determined for each peptide. Since the peptides predicted to bind to HLA-A2.1 in Table 4 might be subdominant epitopes, CTL immunity toward peptide-pulsed T2 cells might be easily elicited but subsequent immunity toward HLA-A2.1+ leukemia targets might be lacking. In this circumstance, autologous dendritic cells will be substituted as antigen presenting cells for the T2 cell line and the resulting CTL will be examined for cytotoxicity toward HLA-A2.1+ leukemia targets. For the peptides PR5-6 and PR8-9 that have relatively lower predicted binding affinities to HLA-A2.1, if only weak immunity toward peptide-pulsed T2 cells is elicited, substitutions will be made in the HLA-A2.1 anchor positions. At positions 2 and 9 of the peptide, leucine and methionine or valine and leucine will be substituted for the existing amino acids and these peptides will be used to elicit CTL immunity again using T2 cells. These amino acids are known to be relevant for high affinity binding to the HLA-A2.1 allele (Rammensee et al, 1995), and substitution of anchor amino acids has been shown to increase CTL lysis of the peptide-coated target cell (Parkhurst et al, 1996), presumably because of more stable binding of the peptide to the MHC class I heavy chain (Sette et al, 1994). Peptides that do not elicit any immunity will be considered not to be within the TCR repertoire of the donor PBMC. To determine whether CTL reactivity to the PRl peptide can be enhanced by single amino acid substitutions in the HLA-A2.1 anchor motif positions. As previously stated, it is known that certain amino acid substitutions in a peptide may enhance binding of the peptide to HLA-A2.1, which may subsequently enhance target recognition by CTL (Rosenberg et al, 1998). Thus, homologous PRl peptides that contain single or double amino acid substitutions at the HLA-A2.1 anchor residues will be used to coat T2 cells and test for specific lysis. These peptides (Table 10) are predicted to have higher binding affinities to HLA-A2.1 based on the same algorithm used to predict the PRl and PR2 peptides (Parker et al, 1994). These peptides will be synthesized (Biosynthesis Co.), tested for HLA-A2.1 binding using T2 cells, and tested in the mini-cytotoxicity assay where specific lysis will be compared to native PRl-coated T2 cells using TCL that are PRl-specific. The PRl-specific bulk culture CTL will be generated using the methods described herein. If any additional HLA-A2.1 -binding peptide from Table 10 is found that can be used to generate CTL responses, then combinations of PRl with this peptide will be used to coat T2 target cells to test for specific lysis. Using CTL specific for this peptide, T2 cells will be coated with a fixed concentration of the peptide at 10 μg/mL, plus serial dilutions of PRl (0.1 to 50 μg/mL) to test for potential interference with TCR recognition, as measured by reduced specific lysis at fixed E:T ratios. The results of these experiments plus the IC50 of each of the peptides will be used to make comparisons of which are the possible dominant and subdominant peptides. This will be used to develop vaccines using combinations of peptides to stimulate CTL immunity (Nestle et al, 1998). If peptides used to coat T2 cells from Table 10 do not result in greater cytotoxicity over PRl-coated T2 cell targets, then PRl-specific CTL that are obtained after PRl-tetramer sorting will be studied for their ability to recognize and lyse the PRl -variant peptide-coated T2 cells. Because these cells are a much more homogeneous population of CTL, they are expected be a more sensitive indicator of improved CTL immunity.
Table 10: Synthetic PRl-Like Peptides with Amino Acid Substitutions
To determine whether the HLA-A2.1-restricted peptides spanning the known single amino acid polymorphism in Pr3 can be used to elicit CTL immunity from the PBMC of donors that possess the opposite polymorphism. Based on previous studies, a polymoφhism in the third exon of Pr3 was found that encodes for a single amino acid difference in peptides that can bind with high affinity to HLA-A2.1. The amino acid difference does not involve HLA-A2.1 the anchor regions, but it likely involves the region of the peptide recognized by the TCR. This polymoφhism may therefore represent a new minor antigen that is restricted to hematopoietic tissue, and provide an ideal target for allogeneic adoptive immunotherapy strategies. Therefore, these two peptides (PR7I and PR7V) will be synthesized and used to coat T2 cells for in vitro immunization of PBMC derived from the donors already known to have the opposite polymoφhism using the methods to generate PRl reactivity. The resulting CTL lines will be tested for specific lysis of T2 cells pulsed with either the original or the polymoφhic peptide. These peptides will also be evaluated for lysis of leukemia cells from patients that have previously been determined to contain the opposite polymoφhism. HLA-A2.1 blocking studies will confirm A2.1 -restriction, and irrelevant Flu peptide will confirm peptide specificity. Lysis of these leukemia target cells without lysis of autologous marrow progenitors, will demonstrate PR7I and PR7V as the first potential new minor antigens found in humans. In order to adequately estimate the ability of PR7I and PR7 V to elicit CTL immunity, several PBMC donors will need to be studied since not all individuals would be expected to have T cells capable of recognizing the peptide. Furthermore, controls where CTL are elicited against the autologous PR7 peptide from the donors that contain that polymoφhic peptide will need to be compared to CTL elicited from the donors that do not carry the polymoφhism. If no reactivity can be found using any of these combinations using PBMC from three to four donors, then it is unlikely that either of these peptides can be recognized by CTL. Studies involving vaccination with autologous dendritic cells pulsed with Pr3 peptides, or liposomes containing the PRl peptide or other Pr3 -derived peptides are also contemplated in the present invention. In addition, the use of the HLA-A2,1 -transgenic mouse model for the investigation into mechanisms of tolerance toward PRl, (Toes et al, 1996b; Toes et al, 1996c) are also contemplated. In addition, the PRl-tetramer could be used to select for a homogeneous population of leukemia-reactive CTL and may allow for the first time the adoptive transfer of CTL against MHC barriers to treat leukemia(Toes et al, 1996a). EXAMPLE 9 ANTIGEN PRESENTING CELLS (APC) ELICIT IMMUNITY DIRECTED AGAINST CML
To study whether autologous antigen presenting cells (APC) derived from CML cells could elicit immunity directed against CML several approaches were investigated. First, it was determined whether autologous PRl-specific CTL could be elicited in vitro using autologous dendritic cells (DC) that were expanded from peripheral blood monocytes. Second, it was determined whether the elicited PRl -CTL demonstrate peptide-specific cytotoxicity. Third, it was determined whether PRl -CTL, that were elicited with autologous PRl -pulsed DC, could be further purified from bulk CTL cultures through the use of PR1/HLA-A2 coated microbeads and high speed flow cytometry. FIG. 10 shows that P3 transcripts were detectable only in bone marrow at 100X concentration (corresponding to approximately 100 pg of cDNA). Importantly, there is no P3 expression in tissue outside of the bone marrow, and in particular there is no thymic P3 expression, which suggests that peripheral tolerance may play an important role in controlling T cell immunity to PRl . Analysis of PRl-specific immunity in myeloid leukemia patients after treatment with BMT or IFN, and deletional tolerance of PRl-specific T cells. In order to evaluate the relevance of PRl as a leukemia antigen, it was determined whether PRl-specific CTL could be found in PBMC from HLA-A2.1+ CML patients undergoing different treatments using the PR1/HLA-A2 tetramer. PBMC from 38 HLA-A2.1+ CML patients at different stages of disease and 5 healthy volunteer donors were obtained and and cryopreserved. Diagnosis of CML was defined by 100% Ph+ cells in bone marrow aspirates from all patients prior to treatment. Ten patients received chemotherapy alone, including hydroxyurea, cytarabine, cyclophosphamide, and topotecan. Nineteen patients received IFN-α2b-based therapies, which consisted of IFN alone (6 patients) or combined with the chemotherapeutic drugs cytarabine and homoharingtonine (13 patients). Nine patients received an HLA-identical allogeneic BMT from a related donor. To assess the treatment response, metaphase cells from bone marrow aspirates were examined for the percentage of Ph+ cells. PBMC were simultaneously examined for PR1/HLA-A2 tetramer staining. Clinical responses were categorized as complete (CR, Ph, 0%), partial (PR, Ph, 1% - 34%), or minor (MR, Ph, 35% - 90%) (Faderl et al, 1999). : Tetramer synthesis and validation was performed as previously described (Molldrem et al, 1999; Airman et al, 1996). The specificity of the PR1/HLA-A2 tetramer was demonstrated by its ability to stain a PRl-specific T cell line at 4°C that was derived from a healthy HLA-A2.1+ donor, but not from a CMV-specific line derived from the same donor (data not shown). None of the 10 patients that received chemotherapy alone without IFN and none of 5 HLA-A2.1+ healthy volunteer donor control samples had detectable PRl-specific CTL. Although one patient treated with chemotherapy alone had a response, no PRl-specific CTL were detectable (Table 11) by tetramer staining. Similarly, there were no detectable PRl- specific CTL in HLA-A2.1+ PBMC from three patients with multiple myeloma and two patients with newly diagnosed breast cancer that had received IFN. Table 11: Patient Characteristics
PRl-specific CTL with high and low TCR avidity can be elicited from healthy donors. To determine whether high and low avidity PRl -CTL are present in healthy donors, a modified tetramer staining technique (Savage et al, 1999) using limiting tetramer concentration to visualize high and low fluorescence intensity tetramer+ cells, which correlates with high and low TCR avidity was utilized. Sufficient PRl -CTL was elicited by stimulating PBMC with increasing peptide concentrations for 28 days. PBMC from an HLA-A2.1+ healthy donor stimulated weekly for 28 days with 0.2 μM PRl elicited 1.3% high intensity PR1/HLA-A2 tetramer-staining CTL with a median channel of fluorescence (MCF) of 293 (high avidity PR1- CTL), while stimulation with 20 μM PRl produced 3.1% low avidity (MCF = 93) PRl-specific CTL (FIG. 11 A). PBMC stimulated with 2 μM PRl elicited PR1-CTL with intermediate TCR avidity (MCF = 211). Total TCR-ab expression was comparable for cells elicited with 0.2, 2.0, or 20 μM PRl, suggesting that differences in tetramer staining were not due to differences in TCR expression level. Cultures stimulated with 2 μM PRl produced fewer PRl-specific CTL with mixed TCR avidities, while stimulation with < 0.02 μM PRl induced < 0.1% PRl -CTL. The PRl -CTL elicited with low (0.2 μM) PRl (open circles) showed higher specific lysis of PRl -pulsed T2 target cells than PRl -CTL elicited with high (20 μM) PRl concentration (closed circles), when both were normalized at an E:T of 10:1 based on the total number of PR1/HLA- A2 tetramer+ events in the CTL cultures (FIG. 11C). To further verify that tetramer staining intensity correlates with TCR avidity, the kinetics of tetramer staining decay was determined using previously described techniques (Savage et al, 1999). PRl -CTL elicited with either low (0.2 μM) or high (20 μM) PRl concentrations for 4 weeks were incubated with PR1/HLA-A2 tetramer and saturating concentration of BB7.2 anti-HLA-A2 monoclonal antibody to prevent rebinding. Normalized total fluorescence was measured at 4°C at the appropriate time points and linear tetramer staining decay plots were obtained, indicating tetramer staining half-lives (t 2) should be proportional to the t of the respective TCR peptide/HLA-A2 complexes (FIG. 1 ID). PR1-CTL elicited with low (0.2 μM) PRl showed a 3-fold longer t1/2 than PR1-CTL elicited with high (20 μM) PRl (58 vs 19 min), which correlates with overall high and low tetramer fluorescence (FIG. 11 A), respectively, and validates the use of overall tetramer fluorescence intensity to indicate relative TCR avidity. Spectratype from high and low avidity PRl-specific CTL cultures supports unique clonal derivation. To determine whether short-term PRl -CTL lines with high and low TCR avidities might be derived from distinct clonal populations, the TCR-Vβ CDR3 spectratype of 4- week old CTL from the same donor were analyzed. High avidity PRl -CTL elicited with 0.2 μM PRl showed the most striking dominant clone to be present within TCR-Vβ family Vβl l, low avidity PRl -CTL elicited from the same donor with 20 μM PRl showed a dominant clone in Vβ2 (FIG. 12). A Gaussian pattern was preserved in the majority of Vβ families in each of the PR1-CTL lines, with the exception of Vβ3, Vβ5.1 and Vβl4, which showed similarly skewed repertoires in the two different CTL lines. Similarly skewed spectratypes were obtained repeated experiments, suggesting unique clonal origin of high and low avidity PRl -CTL. CML target cell killing by PRl-specific CTL correlates with TCR avidity. To evaluate whether CTL lines with different TCR avidities showed differences in effector function, 4-week old PRl -CTL lines derived from a healthy donor or from patients with CML were tested for the ability to kill HLA-A2+ CML target cells from a patient with blast crisis CML, autologous chronic phase CML cells from patient CML #3 at time of diagnosis, or cells from healthy donors. PRl -CTL derived from the healthy donor with high or low avidity were each combined with either bone marrow (BM) from the patient with CML or BM from the patient's healthy HLA matched sibling in a 4-hr cytotoxicity assay. High avidity PRl -CTL elicited with 0.2 μM PRl showed nearly 2-fold greater lysis of the same CML BM cells on a per cell basis than did the low avidity PRl -CTL elicited with 20 μM PRl (FIG. 13 A). The specific lysis of autologous BM cells by a PR1-CTL line derived from a CML patient (CML #3) using 0.2 μM PRl was similar to the amount of lysis of CML BM cells by the low avidity PRl -CTL line derived from the healthy donor (FIG. 13B). Similarly, CTL from patients CML #1 and CML #2 elicited with 0.2 μM PRl showed lysis of CML #3 BM cells of 24% ± 5% and 33% ± 6%, respectively, at an E:T ratio of 20:1. High avidity PRl-specific CTL are present only in interferon sensitive CML patients in cytogenetic remission. It was previously shown that detection of functional PR1- CTL in CML patients correlates with a cytogenetic response to interferon-α (Molldrem et al, 2000). This suggested that high avidity PR1-CTL would only be present in IFN-sensitive patients. To address this possibility PBMCs from untreated HLA-A2+ patients with either blast crisis (CML # 1) or chronic phase CML (CML # 2) or a patient with chronic phase treated with IFN-G! for 3 months (CML # 3) were stimulated weekly with PRl. Only low-avidity PRl-CTLs could be elicited from any of the three patients (FIG. 14A). There were no detectable PRl-CTLs by tetramer staining in PBMCs prior to repeated peptide stimulation. Low-avidity PRl-CTLs were elicited with as little as 0.02 μM PRl in patient 2 and 0.002 μM. PRl in patient 3, whereas PRl-CTLs from patient 1 could not be elicited below 0.2 μM PRl, and overall fewer CTLs were obtained. Patients 1 and 2 had 100% Philadelphia chromosome positive (Ph+) cells in the BM by karyotype, but patient 3 had developed a cytogenetic response to IFN-o; and had 80% Ph+ cells. Because of the possibility that high-avidity CTLs may have arisen earlier during restimulation, cultures from a fourth untreated CML patient in chronic phase (CML no. 4) were studied weekly prior to restimulation with T2 cells pulsed with 0.2 μM PRl for the emergence of tetramer- positive CTLs, and no high-avidity PRl-CTLs emerged during culture (FIG. 14B). Failure to elicit high-avidity CTLs was restricted to PRl, since high-avidity p65-specific CTLs from the CMV seropositive patient CML 2 was elicited using 0.2 μM pp65 peptide-pulsed T2 cells (FIG. 14C). To further address the possibility that high avidity PRl -CTL would only be present in IFN-sensitive patients, two CML patients in a cytogenetic remission after 9 months of interferon treatment (CML #5 and CML #6 with 0% and 85% Ph+ cells, respectively), interferon resistant patients with no cytogenetic remission (CML #7 and CML #8), and one untreated newly diagnosed patient (CML #9) for the presence of PRl -CTL with high or low avidity TCR were studied. High avidity PRl -CTL were identified in both patients in a cytogenetic remission but in none of the interferon resistant or untreated patients (FIG. 15). However, low avidity PRl -CTL could be identified in the interferon resistant patients, but totaled less than 0.1% of CD8+ cells. Furthermore, PBMC from untreated HLA-A2+ patients with either blast crisis (CML #1) or chronic phase CML (CML #2) or a patient with chronic phase treated with interferon-α for three months (CML #3) were stimulated weekly with PRl. Only low avidity PRl -CTL could be elicited from any of the three patients. This suggests that low numbers of high avidity PR1-CTL may be sufficient to contribute to cytogenetic remission in interferon sensitive patients, but leaves unanswered whether high numbers of low avidity PRl -CTL may contribute to remission. High PRl concentration and proteinase 3-overexpressing CML cells induce apoptosis of high avidity PRl-specific CTL. Previous studies showing that high affinity virus- specific T cells are eliminated by target cells infected with a high viral load (Alexander-Miller et al, 1998; Alexander-Miller et al, 1996a), and that CML cells frequently overexpressed proteinase 3 ((Molldrem et al, 1996; Molldrem et al, 1997), suggested that high avidity PR1- CTL might be undetectable in untreated CML patients due to selective elimination by CML cells that overexpress the target antigen. To demonstrate this, an equal number of PRl -CTL from a healthy donor were challenged with T2 cells pulsed with either high or low doses of PRl and studied for evidence of apoptosis by Annexin N staining 16 to 18 hr later. High avidity PRl- CTL underwent apoptosis when challenged with high dose (20 μM) PRl peptide, but not when challenged with low dose (0.2 μM) PRl (FIG. 16). All high avidity PRl -CTL exposed to high dose PRl were dead after 36 to 48 hr of co-culture. Apoptosis was abrogated in the presence of the BB7.2 blocking antibody to HLA-A2.1, and no apoptosis was observed when 20 μM of the irrelevant peptide Flu was used instead of PRl. In contrast, low avidity PRl -CTL did not undergo apoptosis when challenged with either high or low concentrations of PRl. To determine whether CML cells similarly induced apoptosis of high avidity PRl -CTL, co-incubation studies were performed with HLA matched BM cells from CML patients followed by staining for Annexin N, for 16 to 18 hr after co-incubation. High avidity PRl -CTL underwent apoptosis by 18 hr after co-culture with BM from an HLA-matched patient with CML in chronic phase with 100% Ph+ cells (FIG. 17A). No apoptosis was induced by co-incubation with BM cells from an HLA-A2 negative CML patient with 100% Ph+ cells, or by co-incubation with BM cells from an HLA-A2+ healthy donor. In contrast, less than 1% of the low avidity PRl -CTL underwent apoptosis when challenged with either the HLA-A2+ or HLA-A2- CML cells (FIG. 17B). Similar overexpression of cytoplasmic proteinase 3 was observed in BM cells from each of the CML patients (2.8-fold higher in the HLA-A2+ cells and 3.3-fold higher in the HLA-A2- cells compared to healthy donor BM cells), and MHC I expression was similar in the two patient samples (FIG. 17C). Therefore, differences in apoptosis were likely due to differences in the amount of PRl peptide presented on the CML cells. High avidity PRl -CTL persist in IFN-sensitive CML patients off of all therapy. Since it has been shown that IFN-sensitive patients have high avidity PRl -CTL in peripheral blood that can kill CML, it was determined whether PRl -CTL maintain remission in patients in CR off therapy. Three patients in complete cytogenetic remission after discontinued IFN were studied. The patients had CML from 5 to 9 years, and were off IFN from 18 to 26 months prior to study (Table 11 and Table 12). All patients continued to have bcr-abl transcripts by RT-PCR. Both high and low affinity PR1-CTL were identified in all patients, although only 25% to 30% of all PR1-CTL were of high affinity (FIG. 18). Importantly, all of the high affinity PR1-CTL were functionally active since stimulation with either PRl peptide or SEB induced γ-IFN production by CFC and upregulated CD69, whereas the low affinity PRl -CTL did not produce γ- IFN, but did upregulate CD69 (not shown). Notably, the high affinity PRl- CTL from UPN3 upregulated CD69 but did not produce γ-IFN when tested at 21 months, indicating a loss of anti- leukemia immune function 5 months prior to cytogenetic relapse and the simultaneous disappearance of PRl -CTL.
Table 12: PR1-CTL in IFN-Sensitive CML Patients off Therapy
Patient (age, sex) Length of Time off IFN %PR1-CTL %Ph Cells Disease (yrs) (months) (bone marrow UPN1 (61, female) 6 26 0.74% 0% UPN2 (42, female) 5 12 0.96% 0% 18 1.17% 0% UPN3 (45, male) 9 15 0.53% 0% 21 0.19% 0% 26 0% 35%
The only high affinity PRl -CTL were CD45RA+/CD28+/CCR7+/CCR5-, indicating an effector memory or possibly a naive phenotype. In addition, the high affinity PRl -CTL had significantly higher expression of CD28 (p = 0.03) and lower expression of CCR5 (p = 0.01) than low affinity PRl -CTL (FIG. 19), which suggested that low affinity PRl -CTL are terminally differentiated memory cells with little anti-leukemia activity. These results indicated that IFN treatment induces a long-lasting renewing population of high affinity PRl -CTL that continue to maintain lasting cytogenetic remissions in some patients after discontinuing IFN therapy. Loss of functional activity amongst high affinity PRl -CTL or the presence of only low affinity PR1- CTL suggests acquired tolerance, leading to eventual relapse. This early nonresponsiveness may reflect an anergic state, but loss of the PRl -CTL at the time of relapse may be due to deletion. PRl peptide vaccine can elicit PR1-CTL immunity in patients with myeloid leukemia. Preliminary data suggesed that in myeloid leukemia patients in whom a PRl-specific CTL immune response could be elicited or increased, PRl -CTL would convey an anti-leukemia immune response and contribute to remission. To test this in refractory leukemia patients, a phase I/II vaccine study was initiated. HLA-A2+ patients with CML (interferon-resistant or relapsed after BMT), AML (smoldering relapse or > 2nd CR) or MDS (RAEB or RAEBt) with no detectable antibodies to proteinase 3 (no detectable cANCA) were eligible. Patients that relapsed after BMT or those ineligible for BMT were also eligible for study. Pregnant patients, HIV+ patients, and those with known vasculitis were excluded. Patients were required to have irnmunosuppression (i.e. cyclosporine, steroids) discontinued 4 weeks prior to study entry. Primary endpoints were (1) toxicity assessment including the induction of autoimmunity resembling Wegener's granulomatosis, the systemic vasculitis associated with cANCA antibodies; and (2) induction of an immune response assessed by cytokine flow cytometry (CFC) of γ-JFN and PR1/HLA-A2 tetramer staining of PBMC before and 3 weeks after the last vaccination. Secondarily, clinical responses were assessed by standard criteria with bone marrow biopsy, cytogenetic studies (standard chromosome banding) and molecular studies (PCR for bcr-abl or other known abnormalities such as t(15;17), invlδ, etc.) 3 weeks after the last vaccination. Patients were seen and evaluated in clinic every 3 weeks during the study period. Both vialed PRl peptide (NSC698102) and the adjuvant (Montanide ISA-51, NSC675756) were used in this study. The overall study was divided into two parts: Phase I consisted of nine patients treated in cohorts of three at 1 of 3 dose levels of 0.25 mg, 0.5 mg, or 1.0 mg of PRl peptide given subcutaneously in incomplete Freund's adjuvant (Montanide ISA-51) and GM-CSF 75 mg subcutaneously every 3 weeks for 3 injections. The Phase II part of the study enrolled patients in cohorts of 4 randomized to one of the same three PRl peptide doses since none of the doses were eliminated on the basis of toxicity during the Phase I part of the study. A continuous reassessment model was used in the statistical design to assess best dose level using criteria of immune response (> 2-fold increase in the number of PRl-specific CTL during the vaccine study period) and grade 3 or 4 organ toxicity. If any patient developed vasculitis and/or cANCA, the trial would be stopped, and if any individual patient developed grade 3 or 4 organ toxicity the vaccine would be withheld for that patient. Any dose level would be discontinued if the number of patients with grade 3 or 4 toxicity, divided by the number of patients evaluated for toxicity, is greater than or equal to 3/4, 4/8, 5/12 or 6/16. Any dose level would be terminated if none of the first 12 patients in that dose level have an immune response. If an immune response was noted, patients would continue to be entered onto that dose level, by continued randomization, to a maximum of 20 patients per dose level. If any clinical response was noted during the study period either with or without a measurable immune response, this would be considered an efficacy endpoint and patients would be entered onto that dose level to a maximum of 20 patients per dose level. Patients were monitored every 3 weeks with chest xrays, ANCA titers and physical examinations and for immune responses using PR1/HLA-A2 tetramers. Bone marrow cells (BMC) were obtained before the first vaccination and 3 weeks after the last vaccination to assess disease status. To date, 16 patients have been enrolled on the combined phase I/II study, and 15 patients are fully evaluable for toxicity, immune response and clinical response, as shown in FIG. 20. Two patients that had progressed on imatinib were kept on the same dose of imatinib to control blood counts and were treated with vaccine. One patient with AML was in hematological remission prior to study. None developed vasculitis or cANCA conversion (FIG. 20). A grade 2 cutaneous injection reaction was noted in one patient (UPN13, FIG. 20) at dose level 3 by two weeks after the first injection, which resolved after 1 week, and mild fatigue was noted in 4 patients. Skin biopsy from UNP13 showed a perivascular lymphocytic infiltrate and PR1/HLA- A2 tetramer staining confirmed that 65% of CD8+ lymphocytes were PRl-specific, demonstrating a localized immune response (FIG. 20). Immune response, defined as a > 2-fold increase in the percentage of tetramer+ PRl -CTL, was noted in 8 of the 15 patients (FIG. 21). FIGS. 23 and 24 show that the elicited PRl -CTL were functional by CFC after incubation with 10 μM PRl and that of the tetramer+ fraction, approximately half were able to secrete cytokine. Five of these eight patients were induced into CR during the study period, including 1 patient with overt acute leukemia. Although a secondary endpoint, clinical responses were also noted on this study (FIG. 21). Three patients (UPN4, UPN7 and UPN15) with relapsed AML prior to vaccination obtained cytogenetic remission (CR) after the second or third injection at dose levels 2, 3 and 1, respectively. They remained in CR at 20 months, 9 months and 4 months, respectively, with 0.58%, 0.2% and 1% circulating PRl-specific CTL (based on CD8 lymphocytes), respectively. Of the 6 patients with CML, only 2 had fewer than 100% Ph+ cells prior to study and one of these patients (UPN12), who had also progressed on imatinib, obtained cytogenetic remission (CR) on dose level 1 (0.25 mg). Because clinical responses were seen at all of the three dose levels, trial design obligates 20 patients on each dose level of the Phase II part of the study. Table 13: PRl Vaccine Causes Minimal Toxicity α No induction of cANCA α No vasculitis or Wegener's-like autoimmunity α No maximum tolerated dose or dose limiting toxicity has been reached Toxicity Grade N Fever 1 3 Local injection site reaction 1 13 2 1 Injection site granuloma 2
Vaccine-induced PR1-CTL contribute to cytogenetic remission. To show that PR1- CTL induced remission, cells were examined from UPN4, a 27-year-old man with APL in 4th relapse previously treated with allogeneic BMT and 3 escalating doses of DLI who separately consented to have PBMC collected by leukapheresis (LP) one month after the last vaccination. Donor-derived PR1-CTL increased from 0.1% to 0.54% after the 3rd vaccination, and were enriched for effector memory CD45RA+/ CD28+/CD57- donor-derived CTL (by PCR microsatellite analysis), which correlated with loss of t(15;17) transcripts by RT-PCR 6 weeks after the first vaccination(FIG. 24A). PRl -CTL persist at 0.2% 22 months after completing the vaccinations. Tetramer sort-purified PRl -CTL obtained after vaccination showed PRl specificity against peptide-pulsed T2 cells, and 44% lysis of the BMC collected at time of relapse versus only 14% lysis of BMC taken at time of remission, at E:T 10:1 (FIG. 24B). In another patient with invlό AML (UPN15), PRl -CTL immunity was elicited at the time of 2nd relapse. This 32-year-old man received an autologous transplant while in 2nd remission and had no evidence of AML by FISH using probes for invlό. Two months later, his platelet count fell to 24,000 and he had invl6 by FISH (FIG. 25). By 3 weeks after the last injections of 0.25 mg (dose level 1) of the PRl vaccine, his platelet count returned to normal and there was no invlό by FISH or by RT-PCR. Taken together, data from this trial demonstrate for the first time direct evidence that peptide vaccination of leukemia patients can elicit highly active specific immunity against leukemia cells that induces cytogenetic remission. An immune response was necessary but not sufficient for a clinical response, although clinical responses correlated with the induction of an immune response (p = 0.02). Thus, it was suggested that PRl -CTL would have higher TCR avidity in patients in CR since these CTL kill leukemia better than lower avidity PRl -CTL and would therefore show clinically effective antileukemia immunity. FIG. 26 shows that by using low doses of tetramer to identify high and low avidity PRl -CTL, it was found that the average TCR avidity of PRl-CTLs was 1.5-fold higher in the clinical responders compared to post- vaccination PRl -CTL in the non-responders that had pre-existing tetramer+ CTL (p = 0.02). T cell tolerance from loss of high avidity PR1-CTL and downregulation of P3 antigen correlates with progression of CML after vaccination. UPNό, a non-responder, was found to have both high and low avidity PRl -CTL prior to vaccination with 0.5 mg of PRl, but only low avidity PRl -CTL 3 weeks after the last injection (FIG. 27). Furthermore, the overall number of PR1-CTL decreased from 3.2% to 0.5% during the study and the number of Ph+ metaphase chromosomes increased from 90% to 95% (FIG. 27). Interestingly, PRl/ HLA-A2 tetramer-sorted CTL showed peptide-specific lysis of T2 cells pulsed with 20 μM PRl that was similar to PRl -CTL from UPN4 that produced nearly equivalent lysis (on a per cell basis) of T2 cells pulsed with only 2 μM PRl. Although UPN6 received the same peptide dose as the responder UPN4 during vaccination, this dose was sufficient to eliminate the high avidity PR1- CTL and allow outgrowth of CML. Since high avidity PRl -CTL were not detectable in peripheral blood PBMC in UPNό, PRl -pulsed T2 cells were used to determine whether they could be expanded. PBMC from LP products from both UPN4 and UPN6 were stimulated weekly with varying doses of PRl (0.2 μM to 200 μM) coated T2 cells. However, as shown in FIG. 28, high avidity PRl -CTL could only be expanded from UPN4, but not from UPNό. This experiment supported the expectation that high avidity PRl -CTL were deleted in this non- responder. However, high avidity PRl -CTL may still be present in UPN6 but cannot be expanded, perhaps due to poor proliferative potential, poor cytokine production, or a more generalized antigen nonresponsiveness. Since it has been well described that defective antigen processing (Restifo et al, 1993; Maeurer et al, 1996), target antigen mutation or downregulation of MHC (Lehmann et al, 1995) or target antigen (Marincola et al, 1996) can lead to immune escape and tumor outgrowth, studies were conducted to investigate these possibilities by comparing P3 expression before and after vaccination in both UPN4 and UPN6. It was found that P3 decreased by 60% in UPN6 after vaccination, compared with no change in P3 expression in UPN4. Interestingly, P3 expression shifted to a more immature CD34+ progenitor cell, which have lower MHC expression (Bernhard et al, 1995) and may be less able to process and present antigen to T cells than more mature myeloid cells in the marrow. Together, these studies show preferential loss of high avidity PRl -CTL with a simultaneous decrease in P3 target antigen expression in the leukemia cells in UPNό, a clinical non-responder, compared to an expansion of high avidity PRl -CTL and preserved overall P3 expression after vaccination in UPN4, a clinical responder. Overall MHC-I, CD80 (B7.1) and CD54 (ICAM-1) expression remained unchanged in both patients before and after vaccination. Therefore, at least two or more mechanisms appear to be operative in UPN6 leading to eventual escape from anti-leukemia immunity. Monocyte-derived dendritic cells (DC) can expand autologous PRl-specific CTL and PR1/HLA-A2 monomers can be used to select PR1-CTL for adoptive immunotherapy. Another central aspect of this invention is that CTL that contribute to GVL and those that cause GVHD after allogeneic bone marrow transplantation (BMT) target unique antigens. Previously, the inventors identified the HLA- A2 -restricted peptide PRl, derived from P3, that can elicit CTL that preferentially kill CML over normal bone marrow. Furthermore, PRl-specific CTL could be identified in the peripheral blood of BMT recipients that were in cytogenetic remission using soluble peptide/MHC tetramers to stain peripheral blood mononuclear cells. More recently, the inventors have studied the peripheral blood of AML patients that received of nonmyeloablative stem cell transplant (NST) regimens for evidence of PRl -CTL. Patients were studied around day 60 post-NST using HLA-A2 tetramers folded with different peptide epitopes to determine whether immunity directed against minor histocompatibility antigens such as HA-1 coexisted with immunity against self peptides such as PRl. Using combinations of the fluorochromes PE(Cy7) and PE, tetramers were constructed that can be used to simultaneously stain small aliquots of peripheral blood for different peptide-specific T cells using multiple tetramers, which produces results that are similar to single tetramer-stained blood samples (FIG. 29 A). It was found that around day 60 a higher percentage of CD8+ T cells specific for PRl correlated with remission at one year post-NST (p = 0.03, FIG. 29B). By combining tetramers for PRl, HA-1 and WT-1, a dominance hierarchy can be defined, and the relative contribution of immune responses against each antigen toward GVL and GVHD determined. Furthermore, it was reasoned that these reagents might also be used to select for peptide antigen-specific CTL amongst polyclonal T cells that could be used in adoptive immunotherapy. Since the precursor frequencies of these T cells is very low, especially for self-antigens, selection with tetramer staining would need to follow the preferential expansion of the antigen-specific T cells in bulk culture. A clinically practical method of expanding peptide-specific CTL ex vivo for use in adoptive transfer to patients after BMT was sought. Peptide-pulsed T2 cells (a highly reliable but unsuitable clinical method for eliciting peptide-specific CTL) were compared with peptide- pulsed dendritic cells (DC). Because it is desirable to use reagents that are already approved for clinical use, DC expanded from peripheral blood monocytes were employed using both interferon-α2b (IFN) and GM-CSF, as these cells would be useful as peptide-pulsed APC to expand antigen-specific T cells (Santini et al, 2000). DC expanded for 7 days were compared using IFN (1,000 U/ml) and GM-CSF (500 ng/ml) versus DC expanded for 7 days with IL-4 and GM-CSF. The yields of PRl-specific CTL from autologous PBMC were compared using each of these APCs from 7 healthy HLA-A2+ donors (FIG. 30). PBMC from each of the patients were stimulated weekly with PRl peptide-pulsed T2, IFN + GM-CSF-treated DC (DC/IGM) or IL-4 + GM-CSF-treated DC (DC/4GM). As shown in FIG. 30, the yields of peptide-specific CTL at the end of 21 days in culture were similar amongst all three groups. Cytotoxicity experiments also confirmed peptide specificity and a comparable amount of specific lysis of PRl-pulsed T2 cells as targets amongst all three groups (FIG. 31). DC/IGM are been pursued as reliable sources of APC that can be used to elicit PRl-specific CTL for the adoptive transfer studies. In addition, the experiments shown in FIGS. 24B and 27 demonstrated the feasibility of using tetramers which can be used to select PRl-specific T cells by high-speed flow cytometry, if the PRl -CTL are present at sufficiently high frequency. Importantly, the PRl -CTL retained their cytotoxic potential against leukemia after sorting.
EXAMPLE 10 SPECIFIC IMMUNITY INDUCED AFTER PRl PEPTIDE VACCINATION CORRELATES WITH CYTOGENETIC REMISSION
The inventors have shown that patients with CML that have a cytogenetic response to IFN-γ or that are in remission after allogeneic BMT have circulating cytotoxic T lymphocytes (CTL) with specificity for the HLA-A2 restricted peptide PRl. The PRl -CTL show peptide- specific lysis of leukemia and are long-lived in some patients. Although this shows that PR1- CTL may be important in clearing the malignant cells, it is not clear whether PRl -CTL developed in response to the malignancy and are sufficient for the elimination of it. In a phase I study evaluating escalating doses of PRl peptide administered subcutaneously combined with incomplete Freund's adjuvant and GM-CSF, the results were reported from two patients that received 3 injections of 0.5 mg PRl every 3 weeks: a 38-year-old woman with late chronic phase CML relapsed after allogeneic BMT (UPN6) and a 27 year old man with refractory APML after allogeneic BMT and DLI x 3 (UPN4). PR1/HLA-A2 tetramers were used to identify PR1-CTL and to FACsort them to > 99% purity from leukapheresis products obtained at the end of the trial period for functional analysis. Chimerism of the total T-cell population and of FACsorted PR1- CTL was performed by DNA microsatellite analysis. Until 1 month prior to the vaccine, UPNό received JFN-γ and had 1.9% PR1-CTL, which declined to 0.83% 1 month after the 3rd vaccination. Although there was only 15% overall donor T-cell chimerism, the PRl -CTL were 100% donor-derived. This patient had no clinical response with persistence of 95% Ph+ cells. In contrast, UPN4 had < 0.1% PR1-CTL prior to vaccine, which increased to 1.5% after the 3rd vaccination and remained 100% donor T-cell chimeric throughout. At the same time, detectable t(15;17) transcripts by RT-PCR prior to vaccination were no longer detectable 1 month after vaccination. Interestingly, UPNό developed limited oral and ocular chronic GvHD 1 month after receiving the PRl vaccine. The functional capacity of FACsorted PRl -CTL to CD8+ PR1/HLA- A2 tetramer negative cells was then compared in a standard 4-hr cytotoxicity assay. PRl -CTL from both patients showed PRl peptide specificity using PRl -pulsed T2 cells as target cells at E:T ratios from 10:1 to 1:1. PR1-CTL from UPN4 showed 49% specific lysis of CML bone marrow (BM) cells obtained prior to BMT compared to only 27% specific lysis by the tetramer- CTL at E:T 10:1. Likewise, PRl -CTL from UPN4 showed 44% lysis of BM at time of relapse versus only 14% lysis of BM taken at time of remission. By contrast, the CD8+ PRl /HLA- A2 tetramer negative cells showed only 25% and 6% lysis of relapse and remission BM, respectively, at E:T 10:1. This study demonstrated for the first time direct evidence that peptide vaccination of a leukemia patient can induce highly active specific immunity against the leukemia cells. Further studies are been conducted to investigate both the PRl -CTL and remaining target cells from each of the patients to determine why vaccination in UPN6 lead to a decline in the number of functional PRl -CTL. It is possible that APML is more susceptible vaccine target since expression of proteinase 3, the protein from which PRl is derived, is more abundantly expressed compared to CML cells. To determine an optimal method to expand PRl-specific cytotoxic T lymphocytes
(CTL) with high avidity T cell receptors ex vivo. In this study, whether a combination of IFN and GM-CSF can produce DC that can be used to elicit PRl -CTL for adoptive immunotherapy was tested. Based on previous observations that PRl -CTL preferentially kill leukemia over normal BM due to P3 overexpression, and because P3 is only expressed in hematopoietic tissue, it was indicated that adoptively transferred PR1-CTL will produce GVL without GVHD. It has also been shown that high avidity PRl -CTL are more efficient killers of leukemia cells, although they may also undergo apoptosis when incubated with highly P3-expressing leukemia cells. This further suggested that if large numbers of high avidity PR1-CTL were adoptively transferred to myeloid leukemia patients with minimal disease after allogeneic bone marrow transplant, a sufficient GVL effect would be produced before significant leukemia-induced loss of the PR1- CTL resulted, which would facilitate remission without significant GVHD. Two general expansion methods to elicit PRl -CTL in vitro will be compared as previously described. In brief, DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon-α2b plus 500 U/ml GM-CSF (termed DC/IGM). Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines. T2 cells were maintained in RPMI + 10% HS prior to co-culture with donor PBMC. At the end of 7 days, DC were pulsed with 20 μg/ml PRl peptide, irradiated and combined with fresh PBMC from the same donor at a 1 :2 ratio. On day 7, the culture was restimulated with PRl -pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PRl -CTL cultures were tested for their ability to lyse PRl-coated target cells or CML cells. The PRl -CTL was evaluated for surface phenotype with the PR1/HLA-A2 tetramer and anti- CD8. In general, both DC/IGM and T2 cells elicited PRl -CTL. However, T2 were nearly twice as efficient, typically yielding 3% to 6% PR1-CTL (of the bulk culture, determined by tetramer staining) by 4 weeks and DC/ IGM yielding only 1.5% to 4% PR1-CTL. Because of the regulatory concerns using T2 cells in the clinical setting, alternative sources of stimulators will be studied. To further improve the efficiency of CTL expansion, artificial antigen presenting cells
(AAPC) were constructed as a substitute for DC. The advantage of this approach is that it is more readily available and there is potentially more consistency in the final synthetic product. In preliminary experiments using the PRl peptide, HLA-A*0201 heavy chain and β2- microglobulin were each produced in E. coli and the expressed protein was folded in vitro in the presence of PRl. Folded monomeric complexes were purified by gel filtration and ion exchange. The PR1/HLA-A2 monomers were then mixed with dioleolyl phosphatidylcholine (DOPC) (Avanti Polar Lipids), at molar ratios of 1:100, 1:500 or 1:1000, frozen in dry ice/acetone bath, and lyophilized overnight to remove organic solvent. The lyophilized product was stored at — 20°C and then hydrated in PBS buffer and vortexed vigorously before use. T2 cells were incubated with PR1 HLA-A2 AAPC (1:100, 1:500, and 1:100 molar ratio) for 3 hr and 24 hrs. After incubation, the cells were surface stained with murine anti-HLA-A*0201 monoclonal antibody BB7.2 and secondarily stained with FITC-labeled goat anti-mouse antibody, and observed under the confocal fluorescent microscope to determine proper insertion of PRl /HLA- A2 into the artificial membrane. After this was confirmed, the efficiency of liposome-encapsulated T2 cells were compared to DC for eliciting PRl -CTL after 4 weeks in culture with weekly stimulation. CTLs elicited with PR1/HLA-A2 AAPC for 3 to 5 weeks efficiently lysed T2 target cells pulsed with PRl peptide and was equivalent to lysis by DC- generated PRl -CTL lines. The number of PRl -CTL produced with either method was equivalent in the initial experiment, but in two additional experiments the AAPC appeared to be similar to T2 cells, which generally are more efficient than DCs at eliciting peptide-specific CTL, in their ability to expand PRl -CTL. In preliminary experiments, it was noted that antigen expression could be increased at higher molar ratios of peptide/A2 monomer to DOPC, which may improve the efficiency further. However, apoptosis of high avidity PRl -CTL may occur as a consequence, and it is likely that a "therapeutic window" of antigen concentration will be optimal. The DC/IGM will be directly compared to DC grown using IL-4, GM-CSF and TNF-α, and to both AAPC and peptide-pulsed T2 cells. As discussed above, in preliminary experiments using PRl it was shown that AAPC are equivalent to T2 cells, which are in turn more efficient than DC/IGM. Typical yields of antigen-specific tetramer+ cell numbers are 3% to 5% PR1-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to HA-1 and other putative target antigens of GVL (WT-1), but all of the comparative experiments will be repeated using these peptides. hi addition, serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. In preliminary experiments, pooled human AB serum was nearly equivalent to FBS as a supplement to media used to expand DC/ IGM that could then be used as peptide-pulsed APC to expand PRl- CTL (FIG. 32). Once these methods have been confirmed, scaleup procedures will be carried out in both flasks and closed bag systems to demonstrate the feasibility for clinical use. A particular aspect of this study is to first determine the conditions that produce the highest numbers of functional high avidity PRl -CTL in the shortest period of time. Once conditions are optimized and the scale-up experiments show feasibility, an adoptive immunotherapy study will begin using PRl -CTL generated ex vivo. Weekly tetramer staining during bulk culture restimulations will be used to compare yields and avidity of PRl -CTL, and CFC and cytotoxicity experiments will be used to compare the effector function of the cells. Secondly, two methods to select antigen-specific CTL from bulk culture will be compared. Although it is suggested that the bulk culture conditions described above will yield CTL that, when adoptively transferred to patients, will not produce significant GVHD, it is possible that GVHD may occur due to the non-specific CTL remaining in the bulk cultures. Since CTL cloning at the end bulk culture is time-consuming and would therefore need to be performed prophylactically in each patient, and because the transfer of CTL clones is not likely to yield long-lived CTL in vivo (Riddell et al, 1997), separation of the peptide-specific fraction from the bulk culture will improve the purity of PRl -CTL and thereby reduce GVHD. Initial cell transfer will involve escalating doses of bulk cultures of peptide-expanded CTL carried out in previous experiments. If there is no GVHD, then the dose of non-selected bulk culture PR1- CTL will be escalated. If patients develop > grade II GVHD, then PRl -CTL will be selected from the bulk cultures using methods described below. In the first approach to select the antigen-specific CTL, the use of high-speed flow cytometry will verify separate antigen-specific CTLs using soluble peptide/MHC tetramers. By staining leukeapheresis products with anti-CD8 5 and PRl /HLA- A2 tetramers, PRl -CTL can be separated from the remainder of CD8+ lymphocytes, and these sorted cells can efficiently kill leukemia cells (FIGS. 24B and 27). Preliminary experiments were designed to obtain 1 x 106 PRl -CTL for the cytotoxicity experiments, however, this could be scaled up to obtain sufficient cells for adoptive immunotherapy from a cell product that contained as few as 0.4% PRl -CTL (based on CD8+0 lymphocytes). For instance, 101 total cells collected from leukapheresis would be expected to yield 2 x 109 cells at the end of a typical 4- week expansion. Based on minimum assumptions about the yield of cells at the end of the 4-week expansion, including cells where 40% are lymphocytes with only 20% of those as CD8 lymphocytes and a tetramer frequency of only 0.4% PR1-CTL, a dose of 0.9 x 106 PRl-CTL/kg could be adoptively transferred to the average 70 kg 5 recipient. The cell purity was > 90% and the efficiency was > 95%. In the second approach, the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen-specific CTL. In preliminary experiments using the PRl peptide, the feasibility of using PRl peptide/HLA-A2 monomers linked to streptavidin-coated microbeads (Miltenyi Inc, Germany) to separate antigen-specificO CTL from bulk cultures of mixed lymphocytes was demonstrated(Wang et al, 2000). Short- term polyclonal CTL lines were elicited by pulsing 70 x 106 PBMC from 6 different healthy HLA-A2.1+ donors weekly with PRl-coated T2 cells plus interleukin-2. After 21 days in culture, these PRl -pulsed CTL, quantified with a PRl -HLA- A2 tetramer conjugated to phycoerythrin (PE), comprised 2% to 8% of the culture. To preferentially select PRl antigen-5 specific T-cells, a method using streptavidin-coated microbeads (Miltenyi, Inc.) was developed and optimized. Beads were conjugated with HLA-A2.1 heavy chain plus PRl myeloid leukemia peptide via a biotin-labeled C-terminus of the heavy chain. PRl -pulsed short-term CTL lines were incubated for 30 min with PR1/HLA-A2 coated microbeads and were selected using the magnetic MACS column. Bead-selected and non-selected CTL were quantified by FACSO analysis using the PR1-HLAA2 tetramer and compared to the initial polyclonal CTL lines. Yields ranged from 85% to 100%, and PRl-specific CTL purity ranged from 11% to 21% after selection (3- to 5-fold increase in purity of antigen-specific CTL). Specific lysis of both PRl- coated T2 cells and CML marrow cells increased in all 6 cultures and background lysis of normal HLA-A2.1 normal marrow was eliminated compared to non-selected PRl-specific CTL. Both the flow cytometry method and monomer-coated microbead method will be compared to the cytokine capture microbead technology developed by Miltenyi Inc., which relies on the ability of antigen-specific CTL to secrete IFN after antigen challenge. PRl -CTL obtained after 4 weeks of weekly restimulation will be incubated with PRl antigen and the bi-specifϊc antibody with anti-CD45 and anti-IFN binding will be co-incubated with the cells. A secondary antibody with anti-IFN antibody that is directly linked to microbeads (supplied by Miltenyi, Inc) will then be used to select out IFN-secreting CTL from bulk culture. Although it is reasonable to expect that the commercial cytokine-capture technology will produce sufficient purity of CTL, the device does not capture all CTL with the potential to recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen- specific CTL might be required to maintain a more functional fraction in vivo, or whether the non-secreting CTL later develop the potential to express effector function, and may be selecting too few CTL using the commercial product. Similarly, monomer-coated beads have the potential to be more easily scalable on a molar ratio basis so that high avidity PRl -CTL can be selectively purified. To determine whether adoptively transferred proteinase 3 peptide-specific CTL contribute to the graft-versus-leukemia (GVL) effect. Another aspect of the invention is to enhance GVL and reduce GVHD by using a preparative regimen to achieve engraftment of transplanted allogeneic blood stem cell or bone marrow, which can then be used as a platform to deliver antigen-specific CTL therapy. It was postulated that GVHD could be eliminated and GVL enhanced by adoptively transferring antigen-specific T cells with preferential GVL activity. Therefore, whether adoptive transfer of high avidity PRl -CTL induces GVL without increasing GVHD will be tested, the clinical trial will determine the maximal dose of PRl- specific CTL that will provide GVL while preventing the development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD < 15%). T cells have been shown to cause GVHD (Drobyski et al, 1994; Mavroudis et al, 1996; Gaschet et al, 1996; Debergie et al, 1997; van Lochem et al, 1992; Barrett et al, 1998), facilitate engraftment (Reich-Zeliger et al, 2000) and are required to prevent rejection with established nonablative preparative regimens developed at M. D. Anderson Cancer Center (Houston, Texas) and elsewhere. Leukapheresis samples from healthy HLA-matched donors will be used to expand PRl -CTL ex vivo, using the expansion methods outlined herein. The expansion methods developed in this invention will also be used for the production of cellular products for clinical use. Patients with advanced disease, who are eligible for the transplant studies, will receive allogeneic BMT and imatinib mesylate after transplant and will be monitored by PCR for evidence of persistent or increasing disease. If patients that are HLA-A2+ remain PCR+ for bcr-abl at day 60, then patients will receive PR1- CTL expanded ex vivo in escalating doses. By skewing the ex vivo culture conditions with low doses of PRl as shown in the preliminary results, high avidity PRl -CTL will preferentially be expanded from the donors. These cells will be infused into PCR+ donors after 4 weeks of expansion at escalating doses starting at l x l0 , 5 x l0 and 1 x 10 bulk CTL/kg of recipient weight. At 4 weeks of culture, the bulk PRl -CTL cultures contain from 1.5% to 4% PRl- specific CTL, as observed, by tetramer staining and functional analyses, and based on expansions perviously performed. Two leukapheresis products (LP) will be required to (1) elicit sufficient DC/IGM as APC (from cryopreserved aliquots of LP), which will be pulsed with PRl peptide at 0.2 mM to (2) elicit PRl -CTL bulk cultures. Clinical-scale expansions will be performed before the adoptive cellular therapy trial with PRl -CTL is begun. Quantitative PCR for bcr-abl/abl transcript ratios will be performed monthly to determine whether there is disease progression. If the ratio is increased by > 2-fold and if the patient has GVHD of < 2, then the next higher dose of bulk PRl -CTL will be infused. If there continues to be progression, an unmanipulated DLI from the original donor will be infused at a dose of 1 x 10 CD3 T cells/kg. However, if there is a decrease in the bcr abl/abl, patients will be monitored monthly until there is no increase for 2 consecutive months. In this way, dose escalations within each patient and amongst cohorts of 3 patients each will be carried out. If patients develop > grade 2 GVHD after the first PRl -CTL infusion, then a selected PRl -CTL infusion will be given in escalating doses starting at 1 x 105, 5 x 105 and 1 x 106 PRl -CTL/kg of recipient weight. The exact number of PR1-CTL will be determined by tetramer staining, and the PR1-CTL will be selected based on the optimal method determined above, h preliminary experiments, it was shown that peptide/tetramer-coated microbeads, in addition to PR1/HLA-A2 tetramer-based high speed cell sorting using the MoFlo cytometer can be used to enrich for a highly purified PRl -CTL population. Since patients that receive PRl -CTL might have an initial rise in tetramer cells and a simultaneous clinical response, it is possible they could lose immunity and suffer a relapse. This has been shown for a number of adoptive immunotherapy trials using T cells. Therefore, since in the present invention it has been shown that the PRl peptide vaccine can elicit PRl -CTL in patients with leukemia, it would be prudent to administer the PRl vaccine to patients after adoptive transfer while there is a minimal residual disease state (< 10% Ph+ cells, or PCR+ only) and before the tumor burden becomes too large. A large tumor burden may tip the scale in favor of the leukemia due to PRl -CTL apoptosis induced by the leukemia cells. Therefore, the protocol of the clinical trial will contain a provision for patients to receive the PRl vaccine at a dose of 0.25 mg SQ every 3 weeks for 3 injections, the dose and schedule that has elicited long- lasting PRl-CTL after vaccination. Statistical considerations, including sample size determination and the proper sequencing of within and amongst patient dose escalations will be performed once the clinical scale up is confirmed since PRl-CTL cell dose depends upon the efficiency of the scale up methods. It is also indicated that high avidity PRl-CTL will preferentially cause a GVL response and contribute to molecular remission without increasing GVHD. Therefore, a randomized control group of patients will receive unmanipulated DLI following a standard treatment approach. All patients will have blood collected at weekly intervals up to 4 weeks beyond the last infusion of PRl-CTL or DLI, then monthly thereafter until one year or removal from study. Bone marrow biopsies will be performed on day 30, day 60, then monthly until 6 months, then again at 1 year or until removal from study. The overall percentage of functional PRl-CTL in the recipients will be determined by tetramer staining and standard CFC assays. In addition, the number of pp65-CTL in CMV immune patients will provide an internal control to determine whether the number of PRl-CTL is increased after infusion and whether those cells are long- lived. Likewise, the restorative immunity of unmanipulated DLI will be compared with that of patients receiving adoptively transferred PRl-CTL by determining TREC numbers, CD4 and CD8 counts, and the percentage of CFC+ cells. Based on the findings in the PRl vaccine trial, the quality of the PRl-CTL response, measured by both TCR avidity and function, is perhaps more important to produce a remission than the more simple measurement of the quantity of PRl-CTL. Therefore, the avidity of the PRl-CTL that exist will be compared in (1) the donor product, (2) the recipient prior to transplant and prior to CTL infusion, and (3) the recipient at time points after infusion using limiting doses of tetramer to stain PBMC. This method will be compared to tetramer dissociation half times to confirm the validity of the measurements, hi addition, an aliquot of the PRl-CTL product will be used to study whether the high avidity PRl- CTL preferentially kill the patient's CML by using BM target cells cyropreserved prior to BMT, prior to CTL infusion and BM cells taken at time of molecular remission in a standard cytotoxicity assay. In addition, peptide dose-response CFC assays will be performed, as shown in FIG. 11C for the patients that do not have sufficient cells that can be used as targets in a standard cytotoxicity assay. Although it has been shown that the adoptive transfer of antigen- specific CTL clones does not result in long-lived immunity (Riddell et al, 1992), vaccination with the PRl peptide does result in long-lived PRl-CTL for up to two years. This apparently contradictory result may be because the PRl-specific response is not confined to a single clone. Thus, the adoptive transfer protocol of the clinical trial will involve a broader oligo-clonal PRl- CTL repertoire expanded ex vivo. Based on the preliminary data, it is suggested that high avidity PRl-CTL will contribute to complete remission after adoptive transfer without increasing GVHD. Thus, these experiments will allow for the direct comparison of patients who do and those who do not achieve CR, to those who achieve CR but who experience worsening GVHD. In the later patients, PR1/HLA-A2 tetramer staining of PBMC and BM will be compared to cells from GVHD site tissue biopsies to determine whether there are more PRl- CTL at the sites of active GVHD. It is indicated that there would be fewer or no PRl-CTL at these GVHD sites since there is no P3 expression in peripheral tissues such as skin. However, if PRl-CTL are present, this will also be compared to the TCR avidity with those of circulating PRl-CTL. A recent murine model has shown that while GVHD effector cells may be allo-antigen-independent, host APC are instrumental and maybe required to initiate GVHD (Teshima et al, 2002; Shlomchik et al, 1999). Although PRl is a self-antigen, it is suggested that PRl-CTL at sites of GVHD would have lower avidity TCR than circulating PRl-CTL, which would potentially allow more cross-reactivity with other peptide ligands and less specificity for the PRl ligand. Such an observation would give the appearance that the CTL have little peptide specificity and would be consistent with the observations in the murine systems. In humans, the data is less clear. Dickinson, et al. (2002) have shown that although minor histocompatibility antigen-specific CTL are present at sites of active GVHD in humans (with specificity for both hematopoietic-restricted HA-2 and the ubiquitously expressed H-Y antigens), only CTL with specificity for the H-Y antigen produce cytokines at GVHD sites. Dickinson, et al. (2002) concluded that ubiquitously expressed minor antigens were the targets of GVHD, although they did not measure or compare TCR avidity in the HA-2-specific CTL. Therefore, the frequency and avidity of HA-Y-specific CTL in the skin and blood of recipients of sex-mismatched transplants will be determined and compared to the PRl-CTL. It will be determined whether deletional tolerance of the high avidity PRl-CTL occurs after adoptive transfer and compare this to clinical outcome. It is expected that the selective loss of high avidity PRl-CTL will result from the persistence of CML cells with high P3 expression relative to the P3 expression in BM cells from patients that retain high avidity PRl-CTL and who may be in clinical remission. Deletional tolerance will be determined by comparing the relative disappearance of relatively high and low avidity PRl-CTL after transfer and comparing any disproportionate disappearance of the high avidity PRl-CTL to the rate of disappearance of high avidity pp65-CTL in CMV-immune patients. As shown, CML escape from PRl-CTL immunity may be due to additional mechanisms such as decreased expression of the P3 antigen. Therefore, the amount of P3 expression in the recipient BM and PBMC will be determined by real-time PCR™ and by flow cytometry and compared to the healthy donors. Data regarding general immune status in each of the patients, will serve as a baseline for comparing the specific high avidity PRl-CTL within and amongst patients. In addition, the phenotype data will allow for the comparison of the differentiation state of the PRl-CTL, since an altered maturation phenotype to a terminally differentiated state would be expected to result in ineffective anti-CML immunity. To determine whether PRl-CTL identified by tetramer staining post-infusion are derived from the adoptively transferred product, TCR-Vβ spectratyping followed by repetitive sequencing of restricted TCR-Vβ families will be performed in selected patients. In the preliminary data it was shown that this technique can be used to determine the breadth of the PRl-CTL response, and was previously used to follow clonal T cell progression in MDS patients (Kochenderfer et al, 2002), The families and the sequences can be compared from PRl/ HLA-A2 tetramer-sorted CTL from each of the products and each of the time points to follow the outcome of individual clones. This technique has also recently been used to demonstrate clonal persistence of melanoma-specific CTL following adoptive transfer (Dudley et al, 2002). Spectratype analysis of the HSV Tk-transduced lymphocytes will also be performed to determine TCR repertoire of the transduced lymphocytes during ex vivo expansion. Clones within the transduced cells with similar CDR3 region sequences to PRl-CTL clones would suggest overlapping antigen specificity. Finally, it has recently been found that 24p3 (the human homologue is NGAL) is secreted by CML cells and inhibits diploid cell proliferation. This factor may also contribute to a loss of proliferative capacity of CML-specific T cells. Serum samples from patients will be collected at each of the indicated time points so that quantitative measurements of NGAL can be determined. If NGAL is expressed at high levels, then cell proliferation by MTT will be determined after exposure of PRl-CTL to NGAL in vitro. To determine whether PRl peptide vaccine can be used to elicit PRl-CTL immunity in patients with minimal residual disease after autologous bone marrow transplant or after imatinib mesylate (Gleevec) and interferon. The preliminary results have shown no development of Wegener's granulomatosis or other vasculitis thus far, with only grade 2 toxicity seen in one patient. None of the 3 doses tested were eliminated due to toxicity, and the combined data shows evidence for both immune responses and clinical responses. In addition, it has been shown that the potential for leukemia-induced apoptosis and selective deletion of the most potent antileukemia high avidity PRl-CTL. Data from other laboratories has suggested that vaccination after high dose chemotherapy (such as autologous transplant) may be more effective, however, than vaccination without prior chemotherapy since T cell immunity may be "reset" allowing naϊve T cells to expand, possibly including high avidity T cells, if exposed to antigen during the proliferative phase of immune reconstitution after transplant (Borrello et al, 2000). Alternatively, a sufficient expansion of low avidity anti-CML T cells may also be effective in eliminating the leukemia, and this expansion would also be enhanced following transplant (Morgan et al, 1998). It will be determined whether the PRl peptide vaccine can elicit PRl-CTL in recipients of autologous BMT for refractory CML. The hypothesis underlying this trial is that PRl peptide vaccination after autologous BMT will allow re-expansion of high avidity PRl-CTL that were previously eliminated by CML cells. In the absence of any potential autoimmune toxicity, it would be expected that the resulting high avidity PRl-CTL contribute to molecular remission. The efficiency of this expansion of T cells can be measured as an increase in the total number of high avidity cells, an average increase in overall avidity of the induced PRl-CTL, or more rapid expansion kinetics of the high avidity PRl-CTL pool compared to vaccination done without prior transplant. Lastly, the breadth of the PRl-specific TCR repertoire may increase as well after vaccination, which may reflect a more robust and sustainable immune reaction to the peptide and therefore against the leukemia. The post-transplant PRl vaccine will be given to recipients of autologous transplantation for CML who have progressive disease and are without a suitable allogeneic donor. The clinical trial will also determine whether PRl vaccination will induce high avidity PRl-CTL and increase leukemia-free survival in HLA-A2+ patients compared to those without the HLA-A2 allele not given the vaccination (a biological randomization). Based on previous studies, it is expected that no impact of the HLA-A2 allele on outcome in chronic myeloid leukemias will be observed (Cortes et al, 1998). Patients with HLA-A2 will be randomized to receive one of three dose levels of PRl peptide (0.25 mg, 0.50 mg, and 1.0 mg) given as three injections every 3 weeks. The PRl peptide will be dissolved in water and mixed with a fixed dose of incomplete Freund's adjuvant (Montanide ISA-51). GM- CSF 75 mg will be administered as a second injection into the same site as the vaccine. Current PRl vaccine trial, treating patients with AML and MDS with the same vaccination schedule, has not enrolled enough patients to determine whether there is a clear dose effect on the potential to expand high avidity PRl-CTL. However, the most striking example that peptide vaccine alone can induce molecular remission is patient UPN15 who received autologous BMT 2 months prior to vaccination for 2nd relapse of AML and who received the lowest dose (0.25 mg) of the PRl peptide (FIG. 25). Bone marrow, and peripheral blood will be collected prior to and again 3 weeks after the last of the 3 vaccine injections, and peripheral blood will be collected every 3 weeks while patients are in the trial. Using these samples, the number of PRl-CTL will be quantify before and after vaccination using tetramers, and by LDA in patients without a detectable response by tetramer staining. PRl-CTL TCR avidity will be determined by using limiting dilutions of MHC-I tetramers, and a titer that produces maximal fluorescence intensity separation of a "high" and "low" intensity population, as discussed previously, will be established for each batch of reagent. TCR-Vβ spectratype will be performed on selected patients in whom the number of PRl-CTL has either increased or decreased by 2-fold or greater to learn whether the breadth of the peptide-specific TCR repertoire has changed. Preliminary experiments were performed on post-vaccination CTL from UPN4 (responder) by comparing the spectratype of total CD8+ lymphocytes, high and low avidity PRl-CTL and the tetramer-negative CD8+ lymphocytes by separating the cells using tetramer labeling and high speed flow cytometry with the MoFlo. It was found that merely two dominant clones in the TCR-Vβ3 family are found within the high avidity PRl-CTL, while multiple clones are dominant in the low avidity PRl-CTL in at least 4 different TCR-Vβ families. Currently the CDR3 regions of the clones are been cloned and sequenced (Kochenderfer et al, 2002) to confirm these initial observations by determining the sequence similarity of the isolated clones. These will be compared to pp65-specific CTL that were also isolated from the patient (a CMV-specific HLA-A2-restricted epitope) since the TCR repertoire should not be influenced by the PRl vaccine. Preliminary experiments on PBMC samples obtained from UPN4 suggest that the induced high avidity PRl-CTL are derived from a very limited number of clones, which might negatively influence the longevity of these cells. However, it was noted that the patient continues to have 0.58% PRl-CTL in the peripheral circulation 20 months after the last vaccination. It will be important, therefore, to compare the CDR3 sequences of the clones over time in both the responders and the non-responders. This will help us to understand whether there is clonal stability in the PRl-CTL compartment over time or whether clones are gradually replaced over time with a subsequent fine-tuning of the resulting TCR avidity, as has been shown in T cell transgenic mouse models using antigen- specific T cells (Savage et al, 1999). Because it was observed that TCR avidity correlates with immune response, and because lower doses of PRl elicit higher avidity PRl-CTL in vitro, it is at first reasonable to believe that lower doses of the PRl peptide vaccine would produce higher avidity PRl-CTL. However, because of the requirement for cellular uptake and presentation of the injected peptide to elicit PRl-CTL response, a clear dose-response effect may not be established given the heterogeneity of the patients, the different types of leukemia and the different disease stages, number of prior treatments, number of circulating lymphocytes, amongst other variables. Instead, the responses and the resulting avidity of the PRl-CTL will be monitored before and after the trial at each peptide dose and the clinical responders and non-responders groups compared, and the effect of peptide dose on those observations analyzed. The empiric dose range of 0.25 mg to 1.0 mg of PRl may be outside the range of a more appropriate dose that would have a biologically measurable effect on TCR avidity. Since no other tumor vaccine trial has monitored for these effects, however, these effects will be observed. Furthermore, high numbers of low avidity PRl- CTL, if expanded with the vaccine, may be sufficient to eliminate CML (Molldrem et al, 2002a; Morgan et al, 1998; Molldrem et al, 2002b). As noted, most patients in the current vaccine trial had circulating PRl-CTL detected prior to vaccination. The differences in TCR avidity on all patients will be measured. In addition, CFC analysis for γ-IFN secretion after PRl peptide stimulation of fresh PBMC samples will be compared at each follow up visit. Peptide doses ranging from 0.2 μM to 200 μM will be used to compare the activation threshold of the CTL and this will be compared to TCR avidity measured with tetramer. For patients that are seropositive for CMV, the HLA-A2 -restricted pp65 peptide antigen will be used to compare activation threshold and TCR avidity of the respective peptide-specific CTL. That PRl peptide elicits high avidity PRl-CTL in recipients of autologous BMT predicts that pp65-specific CTL will not change the overall avidity after PRl vaccination. If the avidity is noted to increase, however, it may reflect more general changes in the TCR repertoire in those patients that receive transplant. Therefore, the avidity to CTL from patients that have not received transplant will be compared. An alternative is that the PRl peptide may fail to elicit any PRl-CTL responses due to nonresponsiveness or anergy. This will be evaluated by measuring surface expression of CD80, CD86, CD28, CTLA-4, and HLA-A2 and HLA-DR expression on BM cells and PRl-CTL. hi addition, P3 expression in the BM before and after vaccination will be compared. In addition; whether overexpression of P3 in leukemia cells leads to susceptibility to PRl-CTL-mediated lysis of the leukemia cells, and also preferentially induces apoptosis of high avidity PRl-CTL over low avidity PRl-CTL will be tested. The later will lead to outgrowth of the leukemia. Clinical response to the PRl vaccine will be compared, as will the P3 expression and the resulting change in the TCR avidity of the induced PRl-CTL in all patients on the vaccine trial. In addition to studying the vaccine patients, samples of blood and marrow are collected on all patients that undergo allogeneic BMT and patients that receive DLI. These samples will be used to examine P3 expression in BM cells and the PRl-CTL avidity of PBMC in HLA-A2+ patients with CML that have relapsed after BMT and subsequently received DLL Pretransplant, remission and relapse samples will be compared. Currently there are 12 such patients with sufficient samples and cell numbers to be examined. Based on the data, it is predicted that P3 expression would be high (relative to normal BM) pre-BMT, low at time of remission, high again during relapse, but low after successful BMT or immunotherapy in patients that have a preserved high avidity PRl-CTL response after BMT. In patients that have a high avidity PRl-CTL population at time of remission after BMT and who subsequently lose the high avidity cells after BMT, it is predicted that the BM cells would either have a higher average P3 expression over time than the former group of patients, or that the P3 expression is maintained relatively "high" during remission after BMT, which either increases or do not change substantially after subsequent immunotherapy. In these patients, it is further predicted that there will be no clinical response to immunotherapy with concomitant loss of high avidity PRl-CTL. Other parameters will likely influence the outcome, as shown in patients UPN4 and UPNό treated with the PRl vaccine. Therefore, P3 distribution will also be measured in early versus more committed BM progenitors using flow cytometry, surface expression of CD80, CD86, ICAM-1 (CD54), overall MHC and HLA-A2 expression, and the activation thresholds of the PRl-CTL will be examined using the γ-IFN CFC assay and correlate with TCR avidity measured with tetramer staining. BM and PBMC will also be examined to compare any differences in TCR avidity and P3 expression between the two compartments since BM is the site of a larger number of leukemia cells and high avidity PRl-CTL may be absent in the marrow but still be present in PBMC. Although cause and effect are more difficult to establish in patients compared to animal models where parameters can be more easily manipulated to establish that P3 overexpression in leukemia induces selective loss of high avidity leukemia- specific T cells, it is expected that these experiments are likely to yield important insights into the nature of tolerance since the antigen is well-defined, the tools are established and the patient samples necessary to conduct the experiments are avaiable. The inventors and others (Burchert et al, 2002) have also found that JFN induces P3 expression in myeloid cells. This increased expression may alter susceptibility to PRl-CTL- mediated killing, but it may also cause apoptosis of the PRl-CTL. In preliminary experiments, it has been shown that IFN preferentially upregulates P3 only in the patients that achieve cytogenetic remission after treatment with IFN, and in whom a high avidity PRl-CTL immune response is noted by tetramer staining (FIG. 33). This may be inteφreted to mean that P3 overexpression does not lead to selective loss of high avidity PRl-CTL. However, other effects of IFN on the PRl-CTL may influence the survival of the high avidity cells since type I interferons are known to suppress apoptosis in activated antigen-specific T lymphocytes (Stark et al, 1998; Tanaka et al, 1998; Nakamoto et al, 1997). Therefore, using cryopreserved BM and PBMC from CML patients, will incubate high and low avidity PRl-CTL with CML cells as was done previously, but with and without INF- a and IFN-γ and with or without antibody to IFN-α or JJFN-γ to determine whether either IFN prevents PRl-CTL apoptosis (in addition to increasing P3 expression). If true, this may also help to explain the usefulness of IFN in the treatment of other solid tumors that are also targeted by tumor-specific CTL, such as melanoma and renal cell carcinoma. Lastly, the murine model of IFN-transduced mesenchymal stem cells (MSC) to treat CML may also give clues related to tolerance. For instance, increased expression of P3 after induction of IFN expression may increase susceptibility to immune attack by P3-specific T cells, while at the same time leading to their ultimate extinction by apoptosis. In the clinical trial whether the PRl vaccine, administered as 3 injections every 3 weeks as previously described, will induce a PRl-CTL response and whether the vaccine induces cytogenetic and molecular responses in CML patients that are refractory to imatinib mesylate (Gleevec) will be determined. It is expected that the PRl vaccine will induce PRl-CTL in patients that are refractory to imatinib and improve cytogenetic remissions in those patients. It is also expected that potential downregulation of P3 by treatment with imatinib may facilitate expansion of high avidity PRl-CTL induced by the vaccine. Patients will be randomized on the basis of HLA-A2 expression to receive IFN alone versus PRl peptide with or without IFN in patients with 10% to 90% Ph+ disease after 9 months of imatinib therapy. P3 in BM samples cryopreserved at the time of diagnosis (when available) will be quantified and compared to the time of study entry, and again 3 weeks following the vaccine. The P3 expression in vaccine recipients will be compared to patients that receive IFN alone or IFN plus PRl. Because imatinib down-regulates P3 while IFN upregulates P3 expression, it is not possible to predict which mechanism might prevail to alter P3 expression. Concomitant to examining BM samples from the clinical study, however, the effect of both agents on P3 expression on BM cells from healthy donors and newly diagnosed CML patients in vitro will be examined. Epigenetic changes, such as methylation of the P3 gene, lead to altered expression of P3 (Lubbert et al, 1999), which may be independent of the effects of either imatinib or IFN and this will be investigated in patient samples. In addition, because it was found that high avidity PRl-CTL undergo apoptosis when exposed to high doses of PRl, it is expected that very low expression of P3 in imatinib-treated patients may facilitate the reemergence of previously depleted high avidity PRl-CTL. Whether the high avidity PRl- CTL are present prior to vaccination, and the relative influence of the vaccine, compared to IFN on their possible reemergence will be determined. CFC studies will be performed as previously described, to determine whether there are differences in functional activity in either the low or the high avidity PRl-CTL. Phenotypic data will be used to compare the maturation state of the CTL, which may relate to generalized T cell non-responsiveness .
EXAMPLE 11 MYELOPEROXIDASE (MPO
More recently, the inventors have studied another myeloid-restricted protein, Myeloperoxidase (MPO), a heme protein synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. It was found that MY4 (RLFEQVMRI (SEQ JD NO:30)), a 9 aa peptide derived from MPO that binds to HLA-A2.1, can be used to elicit CTL from HLA-A2.1+ normal donors in vitro (Braunschweig et al, 2000). These MY4-specifϊc CTL show preferential cytotoxicity toward allogeneic HLA-A2.1+ myeloid leukemia cells over HLA-identical normal donor marrow (Braunschweig et al, 2000). MY4-specific CTL also inhibit colony forming unit granulocyte- macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA- matched donors. Like PRl, MY4 is therefore a peptide antigen that can elicit specific CTL lysis of fresh human myeloid leukemia cells. Other peptides from MPO are predicted to bind to HLA- A2.1, but not all of these have been tested for their potential to stimulate immunity. Some previous studies have established PRl to be an important leukemia-associated antigen (LAA), and because of the many striking similarities of the nature of the immunity directed against Pr3 and MPO, it is likely that similar methods applied to the study of MPO- specific immunity will establish MY4 and potentially other MPO peptides as important LAA as well (Kochenderfer and Molldrem, 2001).
EXAMPLE 12 PEPTIDE SELECTION AND BINDING ASSAYS
In the first step to generating T cells which could be used for adoptive immunotherapy of myeloid leukemias, several peptides derived from the published sequence of MPO have been identified which were predicted to bind to HLA-A*0201 using a published algorithm (Molldrem et al, 1996; Parker et al, 1994). This allele was chosen because its high frequency in the US population (49% of individuals) would maximize the therapeutic relevance of any eventual immunotherapeutic strategy. Of 10 peptides predicted to have sufficiently high binding affinities based on the known HLAA2.1 binding motif, the five with the highest predicted binding were subsequently synthesized (designated MY1 through MY5) (Table 14). The peptides were synthesized by Biosynthesis (LewisviUe, TX) or by the M. D. Anderson Protein CORE Facility (Houston, TX) to a minimum of 95% purity as measured by high-performance liquid chromatography (HPLC). Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and 2 genes and cannot therefore present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with β2-microglobulin and increased HLA-A2.1 surface expression, which could be measured using flow cytometry. An HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CALTAG) was used to measure surface expression of HLA-A2.1. hi the second assay, the dissociation rate of I125-labeled β2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and β2-microglobulin was measured, which allowed calculation of binding half-life (tι/2). The labeled heterotrimer complex was separated from unincoφorated β2-microglobulin by high-performance liquid
Table 14: Peptide Start Amino Acid (aa) Subsequence Residue Half-Time Position Disassociation
MPO peptides predicted to bind HLA-A2.1 chromatography gel filtration, and the halftime of disassociation of β2-microglobulin were determined by subjecting aliquots of the complex to a second round of gel filtration. Five peptides showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide (background HLA-A2.1 expression; (FIG. 34; Braunschweig et al, 2000). The control peptides are the PRl peptide and an Influenza B nucleoprotein (aa 85-94; Flu), both with known high binding affinity to HLA-A2.1. The long measured ty2 as measured using β2-microglobulin disassociation confirmed the binding of MY1 through MY5 to HLAA2.1 (Molldrem et al, 1996).
EXAMPLE 13 INDUCTION OF PRIMARY CTL RESPONSES TO PEPTIDES The five MPO peptides discussed above, were used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL. Briefly, T2 cells (which co-express the costimulatory molecule B7.1) were washed 3 times in serum-free RPMI culture media supplemented with penicillin/streptomycin and glutamine (CM) and incubated with peptide at concentrations ranging from 0.2 to 200 μg/mL for 2 hr in CM. The peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO). After 7 days in culture, a second stimulation was performed and the following day, 60 IU/mL of recombinant human interleukin-2 (rhIL-2) (Biosource International, Camarillo, CA) was added. After 14 days in culture a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21 followed on day 22 by the addition of rhIL-2. After a total of 27 days in culture, the peptide-stimulated T cells were harvested and tested for peptide specific cytotoxicity toward CalceinAM labeled T2 cells, leukemia cell lines, and fresh human leukemia cells. FIGS 35 and 36 show the peptide specific lysis of the CTL lines against T2 cells loaded with either 2.0 μg/mL of MY2 or MY4, or T2 cells without added peptide, at varying effector to target (E:T) ratios. No peptide specific CTL lines could be elicited using MY1, MY3 or MY5 peptides, despite testing using different donors and differing peptide concentrations. The CTL line generated against the MY2 peptide demonstrated high specific lysis against MY2- loaded target cells, whereas the CTL line generated against MY4 did not demonstrate any significant cytotoxicity against MY2-loaded targets (Molldrem et al, 1996). The converse experiment, using CTL generated against MY4, tested similarly. Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLAA2.1, was also measured and resulted in < 20% specific lysis at E:T ratios of 50:1 by CTL specific for either MY2 or MY4. CTL stimulated weekly with either higher or lower peptide concentrations of MY2 or MY4 did not produce a short-term CTL line by 4 to 6 wk, as measured by specific lysis of peptide-coated T2 targets at the end of culture. Only CTL stimulated with 2.0 μg/ml of peptide produced effective short-term CTL lines. This observation was reproducible across 10 healthy HLA-A2.1+ donor PBMCs that were used in the studies to elicit the CTL. This phenomenon was noted previously for CTL elicited against other self-peptides.
EXAMPLE 14 HLA-A2.1 RESTRICTED CTL RESPONSES
To further demonstrate that the CTL response toward MY2 or MY4 are specific for target cells expressing the HLA-A2.1 molecule, T2 cells loaded or not loaded with 2.0 μg/mL MY2 or MY4 were prepared. The CTL line generated against the respective peptides were also used to test for specific lysis. Mouse monoclonal antibody against HLA-A2.1 (BB7.2) was used to hlock HLA-A2.1 -restricted recognition by the CTL line. T2 cells without peptide, but with antibody present, were used to control for any potential non-specific antibody-mediated cytotoxicity. FIG. 37 demonstrates that with the addition of antibody to HLA-A2.1, specific lysis was hlocked. Further, there was only background lysis of T2 cells in the presence of antibody alone.
The data shown in FIG. 37 is the combined results from three separate experiments using three separately generated CTL lines. This demonstrated that the observed cytotoxicity was HLA- A2.1 -restricted.
EXAMPLE 15 PRl SPECIFIC CTL PREFERENTIALLY LYSE HUMAN MYELOID LEUKEMIA CELLS
It was next determined whether the MY2 and MY4-specific CTL lines were capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals. The targets were BM cells from pre-transplant HLA-A2.1 -positive AML patients. As controls, BM cells from HLA-A2.1 -negative AML patients, BM from HLA-A2.1 -positive healthy donors and two cell lines expressing low levels of MPO were used: HLA-A2.1 transfected K562 cells and the U937 cell line which lacks HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2.1 -restricted manner. FIG. 35 shows the combined results of three separate experiments from tliree MY4- specific CTL lines. The specific lysis by MY4-specific CTL, at various E:T ratios, of either BM from healthy HLA-A2.1 -positive donors, HLA-A2.1 -positive AML patients, HLA-A2.1- negatiVe AML patients, or T2 cells with or without exogenously added MY4 peptide at 2.0 μg/mL is shown. The specific lysis of U937 and HLA-A2.1 -positive K562 cells by MY4- specific CTL was lower than the background lysis observed against T2 cells without added peptide. The results show that CTL elicited with the MY4 peptide result in short-term CTL lines with both MY4 and HLA-A2.1 specificity that killed AML cells, but not normal cells. In contrast, FIG. 36 demonstrates typical cytotoxicity results from three experiments with three different MY2-specific CTL lines. Marrow cells from patients with HLA-A2.1 -positive
AML were readily lysed, at an E:T ratio of only 5:1. However, marrow cells taken from an HLA-A 2.1 -positive normal healthy donor also demonstrated significant lysis (43 % lysis at E:T of 20: 1), similar to that of the HLA-A2.1 -positive AML cells.
EXAMPLE 16 MY2- AND MY4-SPECIFIC CTL LYSIS OF LEUKEMIA CELLS IS ASSOCIATED WITH ABERRANT MPO EXPRESSION Λll target cells were assayed for the presence of cytoplasmic MPO. After permeabilizing the cell membrane with Ortho PermeaFix (Ortho Diagnostics, Raritan, NJ), staining was performed using a FITC-labeled antibody to MPO (Accurate Chemicals, Westbury, NY) and a PE-labeled antibody to CD34 (Becton-Dickinson, San Jose, CA) followed by flow cytometry. Table 15 lists the percentage of cells in the sample population that stain positive for MPO, as well as the median fluorescence intensity of intracellular MPO staining. The percentage of cells expressing surface MHC class I and CD80 (the costimulatory molecule B7.1) was also evaluated in the same target cell populations by staining with FITC labeled antibodies. These experiments demonstrate that it is possible to elicit CTL specific for the MY2 and MY4 self-peptides from normal HLA-A2.1 -positive donors that exhibit in vitro cytotoxicity against myeloid leukemia cells. Furthermore, the degree of cytotoxicity was associated with aberrant MPO expression. However, the MY2-specific CTL also showed specific lysis of normal donor marrow cells, which suggests that immunity elicited against this peptide in vivo might result in autoimmxinity that would be incapable of distinguishing leukemic cells from normal marrow progenitor cells. Lastly, since the CTL were tested against whole marrow from leukemia patients in short-term assays, it was possible that leukemia progenitor cells, which might not aberrantly express MPO, could escape CTL recognition. Therefore, whether leukemia progenitor cells could be eliminated by MY4-specific CTL in an AML colony-forming assay was investigated. The MPO expression in both leukemia and normal CD34+ cells was also determined.
Table 15: Cytoplasmic MPO Expression and Surface Phenotype of Target Cells Used in Cytotoxicity Experiments
Patient/Donor Target Cell* % Cells MFI ofMPO % Cells % Cells Expressing Expression Expressing Expressing MPO MHC I CD 80
AML #1 For MY2-CTL 98 982 88 46
AML #2 ForMY2-CTL 77 841 92 38
AML #3 ForMY4-CTL 89 966 98 58
AML #4 For MY4-CTL 84 859 83 41
Donor #1 For MY2-CTL 14 254 99 80
Donor #2 ForMY4-CTL 18 217 96 56
U937 For both CTL 90 212 100 23
K562 For both CTL 21 181 28 32
Target for specified cytotoxicity experiment; MPO = myeloperoxidase; MFI = median fluorescence intensity.
EXAMPLE 17 MY4-SPECIFIC CTL PREFERENTIALLY INHIBIT AML COLONY-FORMING UNITS
PBMC from two normal healthy donors heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells using the method previously described. FIG. 38 shows the results of colony inhibition assays using CTL derived from a 13 day MY4 peptide-pulsed culture (CTLl). CFU-GM from patient PI (M2-AML) and P2 (M4-AML) showed 63% (p = 0.006) and 34% (p = 0.007) inhibition, respectively. In contrast there was no inhibition of CFUGM from normal marrow, Dl and D2, the corresponding HLA identical marrow donors for PI and P2. Control CTLl plated alone in methylcellulose under identical experimental conditions at 5 x 105 cells/ml showed no CFU-GM by day 16. EXAMPLE 18 MPO IS EXPRESSED IN LEUKEMIC CD34+ CELLS - EXPRESSION IS LIMITED TO HEMATOPOIETIC CELLS
Next it was confirmed that MPO was expressed in early CD34 positive CML cells. Marrow was obtained from a patient with CML in CP, a patient with AML, and normal CD34 cells from G-CSF mobilized peripheral blood mononuclear cells from a normal donor for comparison. Cells were first labeled with PE conjugated anti-CD34 antibody (Becton
Dickinson, San Jose, CA), followed by cytoplasmic staining for MPO. FIG. 39 shows that 19% of the CML cells were CD34 positive and 16% of those cells highly expressed Pr3. In addition, CD34-negative cells also expressed MPO. In contrast, none of the normal CD34 positive cells expressed MPO. In cells from another patient with AML, 57% of AML cells were CD34- positive and 5% of those cells highly expressed MPO. This shows that very early progenitor cells overexpress MPO whereas there is no MPO expression normal progenitor cells. To confirm that MPO expression was limited to hematopoietic cells, a panel of human tissues for MPO RNA expression was analyzed using RT-PCR. Following isolation and reverse transcription of RNA from each of the tissue samples, cDNA was amplified with 30 cycles of PCR. Primers amplifying a region spanning the 3rd and 4th coding regions (conjunction position 613, 5' primer 588-610 (CATCTGCTTCGGAGACTCAGGTG (SEQ ID NO:40)), 3' primer 689-672 (TCAGGGAAAAGGCGGGTG (SEQ JD NO:41)) were selected and used to generate PCR products that were then separated on a 2% agarose gel. The gel was imaged on a BioRad analyzer and GelDoc software was used to quantify the products. FIG. 40 shows that expression of MPO is limited to bone marrow.
EXAMPLE 19 MY4-SPECIFIC CTL IDENTIFIED IN PERIPHERAL BLOOD OF RECIPIENTS OF NONMYELOABLATIVE STEM CELL TRANSPLANTS USING PEPTIDE-HLA-A2 TETRAMERS
Because CTL lines against both MY2 and MY4 could be elicited from normal donors and that killed AML, it was next assessed whether it was possible to detect these CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2- specific CTL caused lysis of both leukemic and healthy bone marrow cells, which suggested that it would be unlikely to find high circulating numbers of MY2-specific CTL since these might mediate autoimmunity in addition to anti-leukemia immunity. Previous successful methodology using peptide/HLAA2 tetramers to identify the similarly deduced peptide PRl as an HLA-A2.1- restricted leukemia associated antigen (LAA) (Molldrem et al. , 2000) argued strongly that this same methodology could be used to determine whether MY2 and MY4 were also potential LAAs. Production of peptide/MHC tetramers has been described by in detail elsewhere (Molldrem et al, 2000). Briefly, a 15 amino acid substrate peptide (BSP) for BirA dependent biotinylation has been engineered onto the COOH terminus of HLA A2. The A2 BSP fusion protein and human β2 microglobulin (β2M) were expressed in E. coli, and were folded in vitro with the specific peptide ligand. The properly folded MHC peptide complexes were extensively purified using FPLC and anion exchange, and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, CO). Tetramers were produced by mixing the biotinylated MHC peptide complexes with phycoerythrin (PΕ) conjugated Neutravidin (Molecular Probes), or PΕ(Cy7)-conjugated Neutravidin at a molar ratio of 4:1. MY2 and MY4 tetramers were validated by staining against a CTL line specific for each peptide. CMV tetramers were validated by staining with PBMC from a CMV immune individual. Specificity was demonstrated by the lack of staining of irrelevant CTL. By titrating positive CTLs into PBMCs from normal controls, the limit of detection was established to be as low as 0.01% of CD 8+ cells. Each tetramer reagent was titered individually and used at the optimum concentration, generally 20 μg/ml - 50 μg/ml. Nine HLA-A2.1- positive AML patients in relapse prior to allogeneic NST, and then again at day 60 post-transplant were examined using peptide/MHC tetramers. All of the patients were CMV immune prior to transplant, and therefore pp65/HLA-A2.1 tetramers served as positive controls for evidence of antigen specific immunity. Because of the limited amount of sample that Λvas available, staining method was modified to use 2 or more different tetramers simultaneously to stain PBMC samples. In contrast to MY2-CTL, which showed 45% specific lysis of HLA-A2+ normal BMC in addition to killing leukemia, MY4-CTL showed no lysis of normal BMC and only killed leukemia cells, which suggested that MY4 may be a more biologically relevant leukemia antigen. It was predicted that high numbers of circulating MY2-CTL would not be found, but that MY4-CTL may be detectable in leukemia patients. CTL from blood samples obtained 60 days after NST in 9 HLA-A2 AML patients were studied using combinations of 6 HLA-A2 tetramers and multiparameter flow cytometry using a MoFlo cytometer (Cytomation, Fort Collins, CO). A2 tetramers were constructed with the following peptides: PRl, MY2, MY4, the CMV pρ65 peptide, and the minor antigens HA-1R (a negative control) (den Haan et al, 1998) and HA-1H (the allele against which CTL responses have been shown) (den Haan et al, 1995; den Haan et al, 1998; Marijt et al, 1995). All patients showed evidence of donor chimerism by DNA microsatellite analysis at the time of study, and all were CMV seropositive. FIG. 41 shows that multiple-tetramer staining is associated with a 0.1% loss of sensitivity; however, ratios of antigen specific CTL were preserved when compared to single tetramer staining. As shown in FIG. 42, staining PBMC from HLA-A2.1 -positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and chronic lymphocytic leukemia) showed there was no detectable CTL immunity against myeloid-specific antigens. However, as shown in FIG. 43, both PRl-CTL and MY4-CTL are detected in the peripheral blood of these patients, but MY2-CTL is not detected (the limit of sensitivity is 0.01% in cell titration experiments). This figure shows a representative patient sample of peripheral blood that was obtained on day 60 post-NST and stained using the multiple tetramer methodology and CD8 and then analyzed using CellQuest software. Next, a total of 9 HLA-A2+ NST recipients were examined on day 60 post-transplant for immunity against each of the 6 peptides. By comparing relapse rates, as summarized in FIG. 44, a greater percentage of PRl-CTL were present in patients in continuous remission at 1 year (median of 2.45%) versus those patients that went on to relapse (median of 1.55%), p = 0.03. Although there was a trend toward a higher percentage of both MY4- and HA-1H-CTL in patients in remission, it did not reach statistical significance. No MY2-CTL were identified in any of the patients studied. The development of either > grade II acute GvHD or chronic GvHD did not correlate with the percentage of any of the peptide-specific CTL studied, although there was a trend toward a higher number of HA-1 -CTL in patients that developed significant GvHD. Importantly, these preliminary experiments (1) extended the importance of PRl-specific CTL immunity to JSTST recipients, (2) highlighted the probable relevance of MY4-specific CTL immunity in NST recipients, and (3) lessened the likelihood of biological relevance of MY2- specific CTL immunity as part of the anti-leukemia response. This is the first study to combine simultaneous multi-tetramer analysis with other surface phenotypic markers to determine the relative importance of leukemia-associated antigens in the GVL effect. These results indicate that although CTL with MY2 specificity are below the detection limit using tetramer staining, MY4-CTL and HA-1H-CTL are increased in NST recipients and may therefore be important in the GVL effect after NST for AML. These results also extend the previous results and suggest that PRl-CTL may also contribute to the elimination of AML after NST. EXAMPLE 20 SORTED ANTIGEN-SPECIFIC CTL SPECIFICALLY KILL LEUKEMIA CELLS
To show that tetramer-sorted antigen-specific CTL are functional, PR1/HLA-A2 tetramer+ CTL from a donor lymphocyte (DLI) product obtained from leukapheresis were stained, sorted and tested for lysis of both donor and recipient (which contained > 90% blasts) cryopreserved BM. The recipient was in remission by 6 months after allogeneic BMT, but relapsed with chronic phase CML by 12 months with 100% Ph+ BM cells. The patient was then treated with a total of 7 x 107 DLI per kilogram body weight from months 12 to 13 with no other therapy, and was in remission with 0% Ph+ BM cells by month 18 when PBMC were available for testing. After staining with the PRl /HLA- A2 tetramer and sorting on the MoFlo cytometer, the yield of sorted PRl /HLA- A2 tetramer+ cells was 81%, with 90% purity, and the sorted tetramer- negative population contained no detectable PR1 HLA-A2 tetramer+ CTL. As shown in FIG. 45, the sorted PRl HLA- A2 tetramer positive CTL showed greater lysis of recipient marrow taken from time of relapse than the non-sorted PBMC. Although the sorted PR1/HLA-A2 tetramer negative CTL showed less lysis of recipient BM than non-sorted PBMC, it was above background lysis against donor BM. This likely reflects non-PRl -specific CTL with activity against other leukemia antigens. Minimal or no lysis of donor BM was seen with either the sorted PR1/HLA-A2 tetramer positive CTL or non-sorted PBMC. This is strong evidence that PRl-specific CTL actively lyse CML cells and contributed to remission in this patient (Molldre et al., 2000). To confirm leukemia specificity of the PRl-specific CTL, PBMC from the recipient were again sorted using the PR1/HLA-A2 tetramer and tested for lysis of HLA mismatched target cells. As shown in FIG. 46, PR1/HLA-A2 tetramer sorted PBMC showed lysis of HLA-A2.1+ CML cells from 2 umelated patients, but no lysis of either HLA-A2.1- CML cells or HLA-A2.1+ nomial donor marrow cells at E:T ratio of 5 : 1. To show that CTL with specificity for peptides such as MY4, which are identified using a deductive strategy, can successfully be translated to the clinic, a phase I clinical trial using the PRl peptide as a vaccine with incomplete Freund's adjuvant and GM-CSF was initiated. This further demonstrates that highly useful LAA can be identified using these methods. Patients eligible for the vaccine included HLA-A2+ CML and AML patients that had failed conventional therapy or AML patients that were in 2nd CR (i.e. at high risk of relapse). When PRl was administered subcutaneously at 0.25, 0.5 or 1.0 mg every 3 weeks for 3 injections, PRl-specific CTL immunity was elicited in 6 of 9 patients (by tetramer staining) and complete remissions were obtained in 2 patients (1 AML and 1 CML patient). The patient with AML was positive for the t(15;17) translocation and subsequently became PCR negative after vaccination. Importantly, the expanded PRl-specific CTL from peripheral blood of that patient were isolated by tetramer staining and relapsed BM cells were killed, but not BM cells taken during remission. This technique may be applied to the treatment of other forms of leukemia, to other HLA types and potentially to other tumors as well. Thus, to develop effective leukemia-specific immunotherapies, Pr3 and MPO were investigated as tissue-restricted proteins and it was found that the HL A- A2.1 -restricted self- peptides, PR.1 and MY4, derived from Pr3 and MPO, respectively, can be used to elicit peptide- specific CTL that preferentially attack myeloid leukemia based on aberrant expression of the parent proteins in the target cells. By using tetramers to study post-transplant and postinterferon treated patients for peptide-specific immunity, PRl was established as a leukemia-associated antigen. The data suggest that PRl and MY4 could be used as target antigens to stimulate both active and passive leukemia-specific immunity. MY4-specific CTL will be given in an adoptive immunotherapy study with nonmyeloablative stem cell transplant, and in a clinical phase I trial other peptide antigens that are identified will be added to this approach. MY4-specific CTL will be selected and expanded ex vivo with the MY4 antigen for the production of leukemia-reactive CTL to produce a GVL effect and minimize GVHD. A deductive strategy to identify peptide antigens from myeloperoxidase that are restricted to common HLA alleles that can be used to elicit leukemia-specific CTL responses in vitro. It has been shown, as previously discussed, in 9 HLA-A2+ AML patients who received NST that, in addition to PRl, MY4 is another new potential LAA. However, only 48% of the U.S. population has the HLA-A2 allele. Therefore, to extend any resulting immunotherapy strategies based on newly identified peptide antigens, whether each of the peptides predicted to have high binding (dissociation half-time >10) to the HLA- A3 and the HLA-B7 alleles can also elicit peptide-specific CTL will be addressed. It will be determined whether it is possible to elicit CTL immunity against the remaining five peptides in Table 14 that are predicted to bind to HLA-A2.1. In addition, whether CTL against the predicted HLA-A3-, and HLA-B7-restricted epitopes from MPO can be elicited will be determined. Using the same method used to deduce HLA-A2-restricted peptides, several more peptides that are predicted to bind with high affinity to their respective HLA alleles have been identified. These peptides are shown in Table 16 and Table 17. As shown previously, peptides with predicted disassociation half-times of > 10 are the most likely to bind to the relevant HLA alleles' (Molldrem et al, 1996). Therefore, all 20 of the A3- and B7-restricted peptides will be synthesized and examined. All peptides will be synthesized to a minimum of 95% purity. The peptides will be dissolved in a minimum of DMSO and solubility characteristics will be noted. Binding of each of the HLA-A2.1 -restricted peptides will be performed using wild type T2 cells using the method of determining HLA-A2 stabilization by indirect fluorescence and flow cytometry. Relative fluorescence will be obtained using the BB7.2 hybridoma (ATCC) and compared to peptides with known binding characteristics, PRl and pp65.
Table 16: MPO peptides predicted to bind HLA- A3 HLA- A3 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
Peptide Starting Sequence SEQ ID NO Predicted Binding Number Amino Acid Half-Time Position Dissociation 1 466 VLGPTAMRK 42 60.000 2 595 GLPGYNAWR 43 54.000 3 503 TLIQPFMFR 44 54.000 4 571 RLFEQVMRI 30 27.000 5 62 VLSSMEEAK 45 20.000 6 508 FMFRLDNRY 46 20.000 7 471 AMRKYLPTY 47 18.000 8 452 AMVQIITYR 48 13.500 9 663 CHGTQFRK 49 13.500 10 361 GLLAVNQRF 50 13.500
To determine whether the remaining peptides from Tables 16 and 17 will also bind to »
HLA, the HLA-A3 and HLA-B7 alleles from EBV-transformed B cells derived from HLA-A3+ and HLA-B7+ normal donors were first cloned. These genes were inserted into the BirA- containing cassette that was used to construct the HLA-A2.1 tetramers and were then used to fold HLA-A3 and HLA-B7 tetramers using peptides with known high binding affinity to the respective alleles. Tetramers folded with the newly identified peptides will be used as reagents to test whether patients have evidence of circulating peptide-specific CTL. The peptide-specific CTL lines generated in vitro from healthy donors that show peptide- specific lysis will be used as "reagents" to confirm the specificity of the tetramers. The A3 and B7 alleles have also been cloned into a mammalian vector containing the CMV promoter (Clonetech). Electroporation will be used to transduce T2 cells with these vectors. The transduced T2 cells will then be expanded for up to 1 month and sort-purified using the MoFlo high-speed cell sorter based on increased A3 or B7 surface expression after the addition of stabilizing A3- and B7-binding peptides. The resulting T2 cells can then be used to determine whether the predicted peptides from Tables 16 and 17 bind to A3 and B7 by using A3- and B7-specific monoclonal antibodies (Immunotech and Pharmingen), and measuring surface expression. These binding results will be compared to peptides with known binding affinities to A3 and B7, such as influenza matrix and CMV pp65-derived peptides. The relative binding affinities of these peptides to the HLA allele will be determined by serial dilutions of each peptide and comparing them to PRl after analyzing for surface HLA expression by flow cytometry. In this way, an IC50 value will be determined for each peptide. Using the methods described for PRl and the first 5 MPO peptides examined, the resulting peptide-elicited CTL lines will be characterized for their ability to kill peptide-coated T2 cells, fresh leukemia cells and established leukemia cell lines such as U937 and K562. HLA restriction will be confirmed using targets without the relevant allele and by blocking experiments with antibodies specific for the relevant alleles. The amount of target cell killing will be determined using a standard 4-hr assay (Molldrem et al, 1996; Hensel et al, 1999) and will be correlated with target antigen expression and surface phenotype of the leukemia cells and healthy donor BM cells.
Table 17: MPO peptides predicted to bind HLA-B7HLA-B7 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
MPO intracellular protein expression will be determined using direct intracellular FACS staining for the MPO protein with a FITC-labeled murine monoclonal antibody. This intracellular stain will be combined with surfaced antibodies for myeloid differentiation markers such as CD34, CD33, CD13, CD14, CD16 and HLA-DR to determine which stage of differentiation might be more susceptible to CTL killing. The MoFlo cytometer is capable of simultaneous 10-color analysis, which will greatly facilitate the analysis of progenitor stage of development. Both BM and PBMC will be examined similarly for MPO expression and surface phenotype and compared to determine whether there are differences in target susceptibility based on location (marrow vs. peripheral blood). To determine whether CTL with specificity for myeloperoxidase-derived peptides can be detected in vivo in patients at diagnosis, before and after NST and after treatment with chemotherapy. Because CTL lines against both MY2 and MY4 could be elicited from normal donors and kill AML cells, it was next determined whether it was possible to detect these CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2-specific CTL caused lysis of both leukemic and healthy bone marrow cells, which suggested it would be unlikely to find high circulating numbers of MY2-specifϊc CTL since these might mediate autoimmunity in addition to anti-leukemia immunity. Previous studies using peptide/HLA-A2 tetramers to identify the similarly deduced peptide PRl as an HLAA2.1- restricted leukemia associated antigen (LAA) (Molldrem et al, 2000) argued strongly that the same methodology could be used to determine whether MY2 and MY4 were also potential LAAs. Thus, paired samples from 90 AML patients treated using nonmyeloablative transplant regimens (up to 30 per year for the first 3 years) will be examined. Patients will be studied for immunity to the 6 peptides discussed, in addition to any peptide antigens that are found to elicit anti-leukemia immunity. This will include peptides with HLA-A3 and HLA-B7 restrictions. Patient peripheral blood samples will be obtained prior to transplant and then weekly after transplant, beginning on day 10 and continuing until day 100. Patient samples will then be examined at each follow-up in the BMT clinic, which will be monthly until 1 year post- transplant. PBMC samples will also be obtained from the donor pre-transplant. BM cells will be obtained from the donor if BM is used as the graft, and from the recipient prior to transplant and again on days 30, 100 and day 365 post-transplant. The PBMC and BM samples will be cryopreserved. PBMC samples will be used for later evaluation as more peptides are identified as potential LAAs (as discussed herein). The lymphocytes for surface expression of several markers, will be examined including CD3, CD4, CD8, CD16 + 56, CD45RA, CD45RO, CD57, CD28, CD27 as well as tetramer staining. The maximum number of tetramer + cells during the time course of study will be determined. Prior experience with -viral antigen-specific CTL, with HA-1 -specific CTL and with PRl-specific CTL suggest that the peak number of tetramer+ cells occurs over a 3 to 4 week period and often coincides (or may lag by a week or two) with the time of documented remission. Furthermore, the peak for other peptide- specific CTL is usually in the range of 1% to 10%. Significant increases over baseline of tetramer+ cells occurring during the study period will be verified. The study size will provide 85% power to establish a mean absolute increase of 1 percentage point (SD=3.5% based on previous data, type I error=0.05) at peak. In addition, the proportion of patients who show tetramer positivity, defined as at least 1% of cells positive at peak (SD+/-10% under assumed rate of 50% positivity) will be estimated. BM cells will be studied for MPO expression using intracytoplasmic staining combined with surface phenotypic makers that will allow the determination of the point of maturation of the BM cells. Expression of CDlla, CD13, CD14, CD16, CD33, CD34, CD80, CD86, HLA-ABC and HLA-DR will be examined. Because MY4 and the other peptides in this study are self-antigens, it is possible that AML patients treated with chemotherapy alone may have circulating numbers of MY4/MHC tetramer+ cells based on a previous study of CML patients using the PR1/HLA-A2 tetramer, however, this would seem unlikely. If these peptides are detected in AML patients that are in remission it may indicate that post-chemotherapy recovery of immunity is important for obtaining remission and the length of remission duration. Blood samples will be obtained from 10 consecutive AML patients receiving chemotherapy as alternative to NST, with samples obtained at the same time points after start of therapy as for the NST group. Thus, whether the proportion of patients showing tetramer positivity differs between the chemotherapy and NST groups will be addressed. It is anticipated that less than 5% of chemotherapy patients will show positivity compared to about 50% of NST patients. A chi-square test comparing the two proportions will have 92% power to detect the difference of interest (type I error=0.05), comparing the 10 chemotherapy patients to 90 NST patients. To determine the significance of circulating tetramer+ cells, it will also be assessed whether the presence of MY4 tetramer+ lymphocytes is associated with duration of disease response. All or nearly all of the 90 patients who start NST will be in complete remission or achieve it following NST therapy. From 30 to 40 relapses will have occurred at the time of data analysis, one year after the last patient is treated. Patients will be classified into two groups based on whether or not the patients have detectable tetramer+ cells. The association of response duration to tetramer positivity status will be modeled assuming proportional hazards. The study is powered to detect a tripling in risk of relapse associated with failure to detect tetramer lymphocytes. In addition, separate assessments of the association of tetramer positivity with duration of response determined by molecular and cytogenetic methods, will be made. It will also be important to determine whether the MY4-CTL are functional. Various methods of assessing function have been described, including cytokine secretion, CD69 upregulation, cell proliferation, and cytotoxicity. Tetramer staining and cytokine flow cytometry (CFC) will simultaneously be determined on all patients since the MoFlo will greatly facilitate these experiments. PE-labeled antibody to gamma- interferon and PECy7- labeled tetramers will be used to in these studies. Cells will first be labeled for 10 min at 37°C with tetramer and FITC-labeled CD8 and then stimulated with MY4 peptide at 2 μg/ml. Brefeldin A will be added during culture to inhibit secretion of cytokines, and after 6 hr cells will be permeabilized and stained for interferon. This technique has been successfully used to monitor PRl-CTL responses after vaccination and it was found that CFC positivity correlates with cytotoxicity. In select patients with sufficient numbers of available PBMC and tetramer+ cells, the tetramer+ population will be purified by high-speed sorting using the MoFlo cytometer. Both the tetramer+ and tetramer-cells will be tested for cytotoxicity against cryopreserved leukemia targets prior to NST or chemotherapy. Because the MoFlo is capable of 4-way simultaneous sorting, the killing of peptide-coated target cells of the MY4- CTL will be compared to other peptide-specific CTL (i.e. pp65 in seφositive patients) to directly compare lytic potential. To determine the optimal method to select and expand peptide-specific CTL from healthy donors that can be used for adoptive cellular immunotherapy of NST recipients.
Because CTL with myeloid self-antigen specificity are present at very low precursor frequencies (Molldrem et al, 1999), these CTL will need to be expanded before they could be used as part of an adoptive transfer immunotherapy strategy. While there are currently some commercially available methods for the separation of antigen-specific CTL based on cytokine secretion, they are presently not licensed for use in patients, and the best method to separate antigen-specific CTL has not been defined. Similarly, trie optimal method to expand CTL in short-term culture conditions is not yet defined, and expansions on large scale without the use of fetal calf serum remain a major obstacle to cellular immunotherapy. Two general expansion methods to elicit MY4-CTL in vitro will be compared. In the first approach, peptide-pulsed dendritic cells (DCs) will be used to stimulate responder PBMC weekly for 4 to 6 wk. Although there are many potential sources for precursors to mature DC, including CD 34+ cell-derived hematopoietic precursors, monocyte- derived DC have been chosen because they are more readily available in large numbers from donor leukapheresis products. For practical reasons, this methodology is most likely to yield the greatest potential number of DC, which will be needed to grow low precursor frequency self- antigen specific CTL. For similar practical reasons, the use of interferon (IFN) and GM-CSF to grow DC, with or without TNF-α added to mature the cells during the last 48 to 72 hr of culture have been studied. The advantage is that both IFN and GMCSF are commercially available and have been used extensively in humans. In brief, DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon- 2b plus 500 U/ml GM-CSF (termed DC/IGM). Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines. T2 cells were maintained in RPMI + 10% HS prior to co-culture with donor PBMC. At the end of 7 days, DC were pulsed with 20 μg/ml PRl peptide, irradiated and combined with fresh PBMC from the same donor at a 1 :2 ratio. On day 7, the culture was restimulated with PRl -pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PRl-CTL cultures were tested for their ability to lyse PRl-coated target cells or CML cells. The PRl-CTL were also evaluated for surface phenotype with the PR1 HLA-A2 tetramer and anti-CD8. In general, both DC/IGM and T2 cells elicited PRl-CTL. However, T2 were nearly twice as efficient, typically yielding 3% to 6% PRl-CTL (of the bulk culture, determined by tetramer staining) by 4 wk and DC/IGM yielding only 0.5% to 2% PR1- CTL. Since T2 cells may be difficult to use clinically for regulatory reasons, alternative sources of stimulators must be studied. This procedure is discussed in detail herein and in Molldrem et al (2003); (2002); (1999); (1998); (1997); each incoφorated herein in their entirety by reference). Typical yields of antigen-specific tetramer+ cell numbers were 3% to 5% PRl-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to MY4, but all of the comparative experiments will be repeated using this peptide. hi addition, serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. This will determine the optimal conditions that produce the highest numbers of functional MY4-CTL in the shortest period of time. Weekly tetramer staining during bulk culture restimulations will be used to compare numbers of MY4-CTL, and CFC and cytotoxicity experiments will be used to compare the effector function of the cells. Additionally, two methods to select antigen-specific CTL from bulk culture will be compared. Although it is predicted that the bulk culture conditions described above will yield CTL that, when adoptively transferred to patients, will not produce significant GVHD, it is possible that GVHD occurs due to the non-specific CTL remaining in the bulk cultures. Since CTL cloning at the end bulk culture is time-consuming and would therefore need to be performed prophylactically in each patient, and because the transfer of CTL clones is not likely to yield long-lived CTL in vivo (Riddell and greenberg, 1994; riddell and Greenberg, 1995a; Riddell and Greenberg, 1995b), it is suggested that separation of the peptide-specific fraction from the bulk culture may improve the purity and thereby reduce GVHD. hi the first approach to select the antigen-specific CTL, cytokine capture microbead technology developed by Miltenyi Inc., which relies on the ability of antigen-specific CTL to secrete IFN after antigen challenge will be used. These reagents are commercially available, although they are not yet approved for clinical use. MY4-CTL obtained after 4 wk of weekly restimulation will be incubated with MY4 antigen and the bi-specific antibody with anti- CD45 and anti-IFN binding will be co-incubated with the cells. A secondary antibody with anti- IFN antibody that is directly linked to microbeads (supplied by Miltenyi, Inc., Germany) will then be used to select out JFN- secreting CTL from bulk culture, hi the second approach, the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen- specific CTL. In previous studies using the PRl peptide, the feasibility of using PRl peptide/HLA-A2 monomers linked to streptavidin-coated microbeads (Miltenyi Inc, Germany) to separate antigen-specific CTL from bulk cultures of mixed lymphocytes was demonstrated as described herein (see also Molldrem et al. (2003); (2002); (1999); (1998); (1997), each incoφorated by reference herein in their entirety). These studies will be repeated using MY4/HLA-A2 monomers to determine -whether similar yields of antigen-specific CTL can be obtained. This methodology will be compared to the standard IFN-capture methodology developed by Miltenyi. Although it is reasonable to expect that the commercial technology will produce sufficient purity of CTL, the device may not capture all CTL with the potential to recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen- specific CTL might be required to maintain the more functional fraction in vivo, or whether the non-secreting CTL later become able to express effector function, too few CTL may be selected using the commercial product. Monomer coated beads are likely to capture all of the available antigen-specific CTL from the bulk culture, as shown in previous studies. To determine whether peptide antigen-specific CTL can be adoptively transferred to myeloid leukemia patients after T cell-depleted NST to facilitate engraftment, boost GVL and reduce GVHD. The overall treatment strategy to enhance GVL and reduce GVHD is to use a nonablative preparative regimen to achieve engraftment of allogeneic blood stem cell or bone marrow transplant and to be the platform to deliver antigen-specific CTL therapy. The goal is to determine the maximal dose of MY4-specific CTL that will provide engraftment in > 80% of patients while preventing development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD <15%) and mediating a GVL effect. T-cells have been shown to facilitate engraftment and are required to prevent rejection with the established nonablative preparative regimens. Recently, the use of a nonablative preparative regimen, including fludarabine and melphalan, was demostrated that successfully allowed engraftment of an allogeneic blood stem cell or bone marrow transplant from HLA identical siblings or matched unrelated donors in patients with AML and other hematologic malignancies. This approach allows allogeneic transplantation for patients who were elderly or had co-morbidities, which would make them ineligible for high dose myeloablative regimens. Acute GVHD is a major cause of morbidity and mortality and treatment for GVHD remains unsatisfactory, particularly in older and infirm patients. Thus, this study extends this therapeutic strategy, with manipulation of donor cells to reduce alloreactive cells by enriching for MY4-CTL (and other antigen-specific CTL determined previously). This will be accomplished by selecting and adoptively transferring the MY4-CTL. These cells thus, would not be expected to react against the recipient tissues, but would still be able to mediate anti-leukemia effects. Patients with AML who have an HLA compatible related or unrelated donor who failed to respond to initial chemotherapy or after relapse will be used. Lymphocytes will be collected from the donor by apheresis with a goal of collecting 2 x 10 CD3+ T-cells/kg. Donor type peripheral-blood mononuclear cells are plated in 75-mm flasks at 2 x 106 cells/ml and stimulated with 2 x 106 irradiated donor-derived DC from the patient's donor. If other methods, as discussed above, produce superior results, the procedure will be modified to incoφorate those methods. CTL bulk ultures will be restimulated weekly, as described herein. After 28 days of co-culture, the cells will be harvested and live cells will be isolated on Ficoll gradient. The cultures are treated with IL-2 20 U/mL final concentration on day 8 and weekly thereafter. All the responders and stimulators are suspended into RPMI-1640 medium with 2 mM L-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 25 mM Hepes, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 5 x 105 M 2-mercaptoethanol. Autologous serum at 10% will be supplemented. This will be modified if the results show that albumin or serum-free conditions can be substituted. Stem cells will be collected from the donor's blood after G-CSF administration according to standard procedures. If there is a medical contraindication to G-CSF administration, stem cells will be collected by bone marrow harvest. Apheresis will occur daily for up to a total of four procedures in order to collect > 5 x 10 CD34+ cells/kg recipient weight after positive selection of CD34+ cells. The minimal acceptable number is 2 x 106 CD34+ cells/kg recipient weight. Cells will undergo CD34 selection using the Isolex or Miltenyi device with the final composition including > 2 x 10 CD34+ cells and < 1 x 105 T-cells/kg. The apl eresis product from each day will be cryopreserved according to standard procedures. For the preparative regimen, patients will receive fludarabine 25 mg/m intravenously daily at the same time over 30 min on days 6, 5, 4, 3, 2 and melphalan 70 mg/m2 on day 3 and 2 administered following completion of the fludarabine. The allogeneic hematopoietic cell infusion consisting of > 2 x 106 CD34+ cells plus MY4-CTL is administered on day 0. MY4-CTL will be administered in a phase I study to define the maximal dose that can be administered without producing GVHD. Tetramer staining will be performed at the end of bulk culture. Dose levels will be 1: 5 x 107 CD8+ cells/kg; 2: 1 x 108 CD8+ cells/kg and 3: 5 x 108 CD8+ cells/kg. Patients will not receive post transplant immunosuppressive therapy or growth factors, but will receive standard supportive care for prevention of infection. It is predicted, based upon previous results, that current expansion techniques will yield sufficient MY4-CTL from the collection of 2 x 108 CD3+ T-cells/kg. Patients will be assessed for engraftment and chimerism on days 28, 56, 90, 180, 365 and yearly post transplant. Chimerism will be assessed by microsatellite STR (short tandem repeat) markers and analyzed using GeneScan software on peripheral blood, assaying both T-cells and myeloid cells separately. Engraftment is defined as documentation of > 50% donor derived T-cells on day 90. Disease remission will be assessed by bone marrow evaluation on day 28, 90 and 180 and as indicated thereafter. Acute and chronic GVHD will be assessed by standard criteria. Peripheral blood will be collected weekly for tetramer staining and for surface phenotyping, as performed above. Evaluation for Donor Leukocyte Infusion. If no GVHD is observed, and if antigen- specific CTL are no longer detectable, patients will be evaluated at day 45 for infusion of antigen specific T cells. Patients in remission and with evidence of T cell chimerism (> 5% recipient) will be eligible for donor cell infusion. The same cell dose will be transferred. Primary endpoints are the achievement of durable engraftment defined as the durable presence of > 50% donor T-cells and myeloid cells (in the absence of leukemia relapse) and development of grade 3 acute GVHD using standard criteria. Secondary endpoints include relapse of AML, non-relapse mortality and survival. The non-alloreactive CTL are intended to augment engraftment without inducing GVHD in the absence of leukemia relapse. Patients will be treated in cohorts of 6 patients. The starting dose level is level one. If graft failure occurs in 2 of a given group without GVHD, the dose will be considered too low to ensure engraftment and subsequent patients will be entered at the next higher dose level. If grade 3 acute GVHD does not occur in a given group, subsequent patients will receive the next higher dose level. If grade 3 acute GVHD occurs in one patient, 6 additional patients will be treated at a given level. If grade 3 acute GVHD occurs in 2 patients (out of a maximum of 12) at a given level, the rate of GVHD will be considered excessive and that level will be terminated. The MTD is the level, which allows engraftment in at least 5 of 6 patients without excessive GVHD. Ten additional patients will be treated at the MTD. Early stopping criteria will be established to close the study in the event of excess death or relapse. A phase I trial will be conducted in which a maximum of 60 patients will be assigned among the three levels of cell doses. Outcomes to be monitored are immune response and occurrence of GVHD, both defined over a 100-day period from receipt of transplant. Within each dose group, the goals are to achieve a rate of at least 20% of patients with immune response while maintaining at most a 20% rate of GVHD. Patient outcomes will be monitored and compared to stopping boundaries computed using a Bayesian method. Priors will be based on results of the PRl peptide vaccine trial of active immunotherapy, and doses are assumed independent. The vaccine trial has shown a peak tetramer response of 2% of all CD8+ T-cells, which will provide a good starting estimate for the design of a passive adoptive transfer cell therapy protocol. Stopping boundaries will be computed using available software. This is intented to terminate a dose level if the computed probability of achieving at least a 20% immune response rate based on accumulated data is less than 10%, or the probability of 20% GVHD rate is at least 90%. Among dose levels not terminated early, the dose level having the highest observed immune response rate will be declared optimal, unless there are major differences in GVHD rates. It is expect, based on previous data, that therapy based on peptides derived from self hematopoietic proteins will lead to advances in the treatment of myeloid leukemia. Peptide- specific adoptive T-cell immunotherapy, combined with CTL specific for other MPO epitopes may enhance the efficacy of such an approach. If the clinical study fails to convey an anti- leukemia immune response with adoptive transfer of MY4-CTL, studies involving adoptive transfer of CTL other MPO- or Pr3-derived peptides may be conducted, hi addition, the use of the HLA-A2.1 -transgenic mouse model may allow for investigation into mechanisms of tolerance toward MPO peptides such as, but not limited to, MY4. hi addition, the possibility that the MY4/HLA-A2 tetramer could be used to select for a homogeneous population of leukemia- reactive CTL might allow for the first time the adoptive transfer of CTL across MHC barriers to treat leukemia (Toes et al, 1996). The results as disclosed herein, show the development of tolerance toward MY4.
EXAMPLE 21 CYCLIN El
To search for other potential tumor-associated antigens, the cyclin E family of proteins were investigated, because it is well known that cyclin E is constitutively expressed in some tumor cells in dependent of the cell cycle, and aberrantly expressing cyclin E contributes to tumorigenesis as a result of chromosomal instability. Cyclin E2 is a homologue of cyclin El and both proteins have restricted tissue distribution. To investigate whether cyclin El and E2 are over-expressed in hematological malignancy, cyclin El and cyclin E2 mRNA expression were first analyzed in 21 patients with hematological malignancy (11 CML (CP), 5 CML (BC), 2 AML, 2 ALL, 1 NHL) and 12 normal donors by RT-PCR. PBMCs from 15 patients and 5 normal donors expressed cyclin El mRNA. The relative expression level of cyclin El mRNA standardized to β-actin was higher in patients than in normal donors (p = 0.0149). Cyclin E2 mRNA was highly over-expressed in PBMCs of patients (10/21) as compared to normal donor PBMCs (0/12; p = 0.0109). Next cyclin El protein expression was analyzed in 18 of 21 patients with hematological malignancy and 3 of 12 normal donors by western blotting. Although none of PBMCs from normal donor expressed cyclin El protein, except one CML (CP) patient, almost all of PBMCs from patients expressed cyclin El protein even if they did not express mRNA at the same time point. Nonameric peptides derived from cyclin El and cyclin E2 and predicted to bind to the HLA-A2 allele have similar amino acid sequences, differing only at position 7. Thus, the binding of CCNE1144452 (cyclin El derived) and CCNE2144_152 (cyclin E2 derived) was compared to that of PRl by a peptide-binding assay. The ability of CCNE1144 _χ51 and CCNE2M4 to stabilize HLA-A2 on the surface of T2 cells was almost the same as that of PRl (FI
CCNE1144 152 /FI PR1=1.008, FI CCNE2 _152 /FI PR1=1.189). To determine whether CCNE1144 152 and CCNE2144 152 specific CTLs could be elicited in vitro, PBMCs from 7 HLA-
A2 positive normal donors were stimulated with peptide-pulsed T2 cells. In 3 of 7 donors,
CCNEl144 152-stimulated CTL lines killed both CCNE1144_152 and CCNE 2144_152-ρulsed T2 cells but not non-peptide-pulsed T2 cells and irrelevant peptide-pulsed T2 cells. In 4 of 7 same donors, CCNE2144 152-stimulated CTL lines killed both CCNE2144 152 and CCNEl144_152-pulsed
T2 cells but not non-peptide-pulsed T2 cells and irrelevant peptide-pulsed T2 cells. Thus, each peptide-specific CTLs can recognize both peptides with HLA-A2, but the immunogenicity of each peptide is different between individuals. Moreover, one of 4 CCNE1144_ 152-stimulated CTL lines which killed CC El144_152-pulsed T2 cell killed HLA-A2 transfected
K562 leukemic cell line which is over-expressing cyclin El protein, but not non-transfected K562 leukemic cell line. Thus, CCNEl144 152-specific CTL can distinguish leukemic cell lines from normal PBMCs. From the data, it was concluded that cyclin E1/E2 derived peptides are potential tumor- antigens, because 1) cyclin E1/E2 are highly over-expressed in hematological malignancy, 2) cyclin E1/E2 peptides can sufficiently bind to HLA-A2 to stimulate CTL and 3) CCLE1144 152 specific CTL preferentially kills leukemic cell lines HLA-A2 restrictively.
All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
XIII. REFERENCES The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incoφorated herein by reference. U.S. Patent 4,196,265 U.S. Patent 4,435,386 U.S. Patent 4,436,727 U.S. Patent 4,436,728 U.S. Patent 4,505,899 U.S. Patent 4,505,900 U.S. Patent 4,520,019 U.S. Patent 4,554,101 U.S. Patent 4,579,945 U.S. Patent 4,684,611 U.S. Patent 4,797,368 U.S. Patent 4,866,034 U.S. Patent 4,877,611 U.S. Patent 4,879,236 U.S. Patent 4,950,645 U.S. Patent 4,952,500 U.S. Patent 5,139,941 U.S. Patent 5,302,523 U.S. Patent 5,322,783 U.S. Patent 5,384,253 U.S. Patent 5,399,363 U.S. Patent 5,464,765 U.S. Patent 5,466,468 U.S. Patent 5,538,877 U.S. Patent 5,538,880 U.S. Patent 5,543,158 U.S. Patent 5,550,318 U.S. Patent 5,563,055 U.S. Patent 5,580,859 U.S. Patent 5,589,466 U.S. Patent 5,609,870 U.S. Patent 5,610,042
U.S. Patent 5,641,515
U.S. Patent 5,656,610
U.S. Patent 5,693,762
U.S. Patent 5,702,932
U.S. Patent 5,736,524
U.S. Patent 5,739,169
U.S. Patent 5,780,448
U.S. Patent 5,785,970
U.S. Patent 5,789,215
U.S. Patent 5,801,005
U.S. Patent 5,824,311
U.S. Patent 5,830,880
U.S. Patent 5,846,225
U.S. Patent 5,846,233
U.S. Patent 5,846,945
U.S. Patent 5,861,155
U.S. Patent 5,871,986
U.S. Patent 5,945,100
U.S. Patent 5,980,912
U.S. Patent 5,981,274
U.S. Patent 5,994,136
U.S. Patent 5,994,624
U.S. Patent 6,013,516
U.S. Patent 6,020,192
U.S. Patent 6,027,727
U.S. Patent 6,054,297
Aichele et al, J. Exp. Med., 182:261-266, 1995.
Alam et α/., Nature, 381:616-620, 1996.
Alexander-Miller et al, J. Exp. Med., 184:485-492, 1996.
Alexander-Miller et al, J. Exp. Med, 188:1391-1399, 1998.
Alexander-Miller et al, Proc. Natl. Acad. Sci. USA, 93:4102-4107, 1996.
Airman et al, Science, 274:94-96, 1996.
Anderton et al, J. Exp. Med., 193:1-11, 2001. Antin, Blood, 82:2273-2277, 1993.
Arap et al, Cancer Res., 55(6):1351-1354, 1995.
Austin- Ward and Villaseca, Rev. Med. Chil, 126(7):838-45, 1998.
Azuma et al, Cell Immunol, 116(1): 123-134, 1988.
Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 117-148, 1986.
Bajorin et al., J. Clin. Oncol, 6(5):786-92, 1988.
Bakhshi et al, Cell, 41(3):899-906, 1985.
Ballieux et al, Clin. Exp. Immunol, 100:186-193, 1995.
Barrett et al, Blood, 95:3323-3327, 2000.
Barrett et al, Bone Marrow Transplant, 21:543-551, 1998.
Behre et al, Methods, 17:231-237, 1999.
Benjamini et al, Adv. Exp. Med. Biol, 303:71-77, 1991.
Bernhard et al, Cancer Res., 55:1099-1104, 1995.
Blomer et α/., J Virol, 71(9):6641-6649, 1997.
Bocchia et al, Blood, 85:2680-2684, 1995.
Bocchia et al, Blood, 87:3587-3592, 1996.
Boon et al, Immunol Today, 18:267-268, 1997.
Boon et al, Important Adv. Oncol., 53-69, 1994.
Bories etal, Cell, 59:959, 1989.
Borregaard and Cowland, Blood, 89:3503-3521, 1997.
Borrello et al, Blood, 95:3011-3019, 2000.
Bourdette et al, j. Immunol., 152:2510-2519, 1994.
Boussiotis et al, j. Exp. Med., 184:365-376, 1996.
Boussiotis et al, Res. Immunol., 146:140-149, 1995.
Braunschweig et al, Blood, 96:3291, 2000.
Brouwer et al, Clin. Exp. Immunol, 98:448-453, 1994.
Brutlag et al, Comput. Appl Biosci., 6(3):237~245, 1990.
Bukowski et /., Clin. Cancer Res., 4(10):2337-47, 1998.
Burchert et al, Blood, 02:659, 2002.
Caldas et al, Nat. Genet., 8(l):27-32, 1994.
Campanelli et al, J. Exp. Med., 172:1709-1715, 1990.
Capaldi et al, Biochem. Biophys. Res. Comm., 74(2):425-433, 1977.
Celis et al, Proc. Natl. Acad. Sci. USA, 91:2105-2109, 1994.
Chen and Okayama, Mol. Cell Biol, 7(8):2745-2752, 1987. Chen et al, Biochem. Biophys. Res. Commun., 200:1130-1135, 1994.
Cheng et al, Cancer Res., 54(21):5547-5551, 1994a.
Chou and Fasman, ^<iv. Enzymol, 47:45-148, 1978b.
Chou and Fasman, Annu. Rev. Biochem., 47:251-276, 1978a.
Chou and Fasman, Biochemistry, 13(2):211-222, 1974b.
Chou and Fasman, Biophys. J, 26(3):385-399, 1979.
Christodoulides t α/., zcrøt3to/øgy, 144(Pt l l):3027-37, 1998.
Clark et al, Blood, 98:2887-2893, 2001.
Cleary and Sklar, Proc. Natl Acad. Sci. USA, (21):7439-7443, 1985.
Cleary et al, J. Exp. Med., 164(l):315-320, 1986.
Collins, Jr. et al. . Clin. Oncol, 15:433-444, 1997.
Cortes et al, Leukemia, 12:455-462, 1998.
Cotten et al, Proc. Natl. Acad. Sci. USA, 89(13):6094-6098, 1992.
Coupar etal, Gene, 68:1-10, 1988.
Culver et al, Science, 256(5063):1550-1552, 1992.
CurieL Nαt. Immun., 13(2-3):141-164, 1994.
Davidson et al, J. Immunother., 21(5):389-98, 1998. den Haan et al, Science, 268:1476-1480, 1995. den Haan et al, Science, 279:1054-1057, 1998.
Dengler et al, Br. J. Haematol, 89:250-257, 1995.
Dermime et al, Blood, 86, 1995.
Dermime et al, Bone Marrow Transplant., 19:989-999, 1997.
Devergie et al, Bone Marrow Transplant, 20:11-9, 1997.
Dickinson et al, Nat. Med., 8:410-414, 2002.
Dillman, Cancer Biother. Radiopharm., 14(1):5-10, 1999.
Dolstra et al, J. Immunol, 158:560-565, 1997.
Drobyski et al, Blood, 83:1980-1987, 1994.
Dudley et al, Science, 298:850-854, 2002.
Dunbar et α/., Curr. Biol, 8:413-416, 1998.
Faber et al, Biol. Blood Marrow Transplant, 2:31-36, 1996.
Faber et al, Blood, 86:2821-2828, 1995.
Faber et al, J. Clin. Invest, 96:877-883, 1995.
Faderl et al, Ann. Intern. Med, 131:207-219, 1999.
Fechheimer et al, Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987. Fetrow and Bryant, Biotechnology, 11(4):479~484, 1993.
Fraley et al, Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979.
Franssen et al, Kidney Int., 57:2195-1206, 2000.
Franssen et al, Lancet, 347:116, 1996.
Friedmann, Science, 244:1275-1281, 1989.
Gale et al, Ann. Intern. Med., 120:646-652, 1994.
Gallimore et al, J. Exp. Med, 187:1383-1393, 1998.
Gao et al, Blood, 95:2198-2203, 2000.
Garlie et al, J. Immunother., 22:336-345, 1999.
Gaschet et al, J. Clin. Invest, 98:100-107, 1996.
Gaugler et al, J. Exp. Med., 179:921-930, 1994.
Giralt and Kolb, Curr. Opin. Oncol, 8:96-102, 1996.
Gopal, Mol. Cell Biol, 5:1188-1190, 1985.
Goulmy et al, N. Engl. J. Med, 334:281-285, 1996.
Graham and Van Der Eb, Virology, 52:456-467, 1973.
Grossman and Paul, Proc. Natl Acad. Sci. USA, 89:10365-10369, 1992.
Grunhaus an Horwitz, Seminar in Virology, 3:237-252, 1992.
Hanibuchi et al, Int. J. Cancer, 78(4):480-485, 1998.
Harlan and eintraub, J. Cell Biol, 101:1094-1099, 1985.
Harlow and Lane, Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring harbor, NY, 553-612, 1988. Hellstrand et al, Ada Oncol, 37(4):347-353, 1998. Hensel et al, Bone Marrow Transplant, 23:71-78, 1999. Hermonat and Muzycska, Proc. Natl Acad. Sci. USA, 81:6466-6470, 1984. Herr et al, J. Immuno Methods, 191:131-142, 1996. Herr et al, J. Immunol Methods, 203:141-152, 1997. Horowitz et al, Bone Marrow Transplant., 17(Suppl 3):S5-6, 1996. Horwich et al J. Virol, 64:642-650, 1990. Hui and Hashimoto, Infect. Immun., 66(11):5329-36, 1998. Husson et β/., J Bacteriol, 172(2):519-524, 1990. Hussussian et β/., Nβt. Genet., 8(1):15-21, 1994. hie and Morton, Proc. Natl. Acad. Sci. USA, 83 (22): 8694-8698, 1986. Irie et al, Lancet, l(8641):786-787, 1989. Jacobs et al, Nature, 327(6122):532-535, 1987. Jameson and Wolf, Comput. Appl Biosci, 4(1):181-186, 1988.
Janetzki et al, J. Immunol. Methods, 234:1-12, 2000.
Jennette et al, Semin. Diagn. Pathol, 18:3-13, 2001.
Johnson et al, In: Biotechnology And Pharmacy, Pezzuto et al. (Eds.), Chapman and Hall, NY, 1993. Ju et al, J. Neuropathol Exp. Neurol, 59(3):241-50, 2000. Kaeppler et al, Plant Cell Reports, 9:415-418, 1990. Kamb et al, Nat. Genet, 8(l):23-2, 1994. Kamb et al, Science, 2674:436-440, 1994. Kaneda et al, Science, 243:375-378, 1989. Kato et al, J. Biol. Chem., 266:3361-3364, 1991. Kelleher and Nos, Biotechniques, 17(6):1110-7, 1994. Kerr et al, Br. J. Cancer, 26(4):239-257, 1972. Klinman, Curr. Prot. Immunol, 6.19:18, 1994. Kochenderfer and Molldrem, Curr. Oncol. Rep. 3:193-200, 2001. Kochenderfer et al, Blood, 100:3639-3645, 2002. Kolb and Holler, Curr. Opin. Oncol, 9:139-145, 1997. Kolb et al, Blood, 86:2041-2050, 1995. Kolb et al, Bone Marrow Transplant, 17:449-452, 1996. Kwak et ., Proc. Natl. Acad. Sci. USA, 93:10972-10977, 1996. Kyte and Doolittle, J. Mol. Biol, 57(l):105-32, 1982. Lalvani et al, J. Exp. Med, 186:859-865, 1997. Laughlin et /., J. Virol, 60(2):515-524, 1986. Lebkowski et al, Mol. Cell. Biol, 8(10):3988-3996, 1988. Lee et al, Nat Med., 5:677-685, 1999. Lehmann et al, Eur. J. Immunol, 25:340-347, 1995. Levine et al, J. Hematother., 7:437-448, 1998. Lewin etal, Blood, 100:2235-2242, 2002. Lotte et al, Adv. Tuberc. Res., 21:107-93; 194-245, 1984. ubbert et al, Leukemia, 13:1420-1427, 1999. Luelmo, ^m. Rev. Respir. Dis., 125(3 Pt 2):70-72, 1982. Mackinnon et al, Bone Marrow Transplant, 15:591-594, 1995. Maeurer et al, J. Clin. Invest, 98:1633-1641, 1996. Mann et al, Cell, 33:153-159, 1983. Marchand et al, Int. J. Cancer, 63:883-885, 1995.
Marijt etal, Blood 82:3778-3785, 1995.
Marincola et al, J. Immunother. Emphasis Tumor Immunol, 19:192-205, 1996.
Martin et al, Nature, 345(6277):739-743, 1990.
Matulonis et al, Blood, 85:2507-2515, 1995.
Mavroudis et al., Bone Marrow Transplant, 17:793-799, 1996.
Mayet et al, Eur. J. Clin. Invest, 27:893-899, 1997.
McLaughlin et α/., J. Virol, 62(6):1963-1973, 1988.
Miller et al, Am. J. Clin. Oncol, 15(3):216-221, 1992.
Mitchell et al, Ann. NY Acad. Sci, 690:153-166, 1993.
Mitchell et al, J. Clin. Oncol, 8(5):856-869, 1990.
Molldrem et al, Blood, 88 :2450-2457, 1996. Molldrem et al, Blood, 90 :1858, 1998. Molldrem et al, Blood, 90 :2529-2534, 1997. Molldrem et al, Br. J. Haematol, 102:1314-1322, 1998. Molldrem et al, Cancer Res., 59:2675-2681, 1999. Molldrem et al, Curr. Opin. Hematol, 9:503-508, 2002. Molldrem et al, J. Clin. Invest., 111:639-647, 2003. Molldrem et al, Nat. Med., 6:1018-1023, 2000. Molldrem et al, Oncogene, 21:8668-8673, 2002. Morgan et al, J. Immunol, 160:643-651, 1998. Mori et al, Cancer Res., 54(13):3396-3397, 1994. Morton et al, Arch. Surg, 127:392-399, 1992. Muller-Berat et al, Clin. Immunol. Immunopathol, 70:51-59, 1994. Muzyczka, Curr. Topics Microbiol Immunol, 158:97-129, 1992. Nakamoto et al, J. Immunol, 158:5692-5697, 1997. Naldini et al, Science, 272(5259):263-267, 1996. Nanda and Sercarz, Cell, 82:13-17, 1995. Nelson et al, Blood, 88:580-589, 1996. Nestle et al, Nature Med., 4:328-332, 1998. Nicolas and Rubinstein, hi: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 494-513, 1988. Nicolau and Sene, Biochim. Biophys. Acta, 721 : 185-190, 1982. Nicolau et al, Methods Enzymol, 149:157-176, 1987. Nobri etal, Nature (London), 368:753-756, 1995.
Okamoto et al, Proc. Natl. Acad. Sci. USA, 1(23): 11045-11049, 1994.
Omirulleh et al, Plant Mol Biol, 21(3):415-28, 1993.
Orlow et al, Cancer Res, 54(11):2848-2851, 1994.
Papadopoulos et al, Blood, 90:4938-4946, 1997.
Pardoll, Current Opin. Immunol, .14:619-623, 1992.
Pardoll, Nature Rev. Immunol, 2:227-238, 2002.
Pardoll, Nature, 369:357, 1994.
Parker et al, J. Immunol, 152:163, 1994.
Parkhurst et al, J. Immunol, 157:2539-2548, 1996.
Paskind et al, Virology, 67:242-248, 1975.
PCT Appln, WO 91/16347
PCT Appln. WO 94/09699
PCT Appln. WO 95/06128
Pierras et α/., Oncogene, 17(17):2235-49, 1998.
Pinilla-lbarz et al, Blood, 95:1781-1787, 2000.
Potrykus et al, Mol. Gen. Genet, 199:183-188, 1985.
Qin et al, Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998.
Rabinovich et al, Science, 265(5177):1401-1404, 1994.
Rammensee et al, Immunogenetics, 41:178-228, 1995.
Ravindranath and Morton, Intern. Rev. Immunol, 7: 303-329, 1991.
Rees et al, Proc. Natl. Acad. Sci. USA, 96:9781-9786, 1999.
Reich-Zeliger et al, Immunity, 13:507-515, 2000.
Remington's Pharmaceutical Sciences, 15th ed., pages 1035-1038 and 1570-1580, Mack Publishing Company, Easton, PA, 1980. Restifo et al, J. Exp. Med, 177:265-272, 1993. Riddell and Greenberg, Annu. Rev. Immunol, 13:545-586, 1995. Riddell and Greenberg, Cancer Treat Res., 76:337-369, 1995. Riddell and Greenberg, Curr. Top Microbiol Immunol, 189:9-34, 1994. Riddell et al, Science, 257:238-241, 1992. Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), StoneharmButterworth, 467-492, 1988. Rippe t β ., Mol. Cell Biol, 10:689-695, 1990. Rosenberg and White, J. Imrnunother. Emphasis. Tumor Immunol, 19:81-84, 1996. Rosenberg et al, Ann. Surg. 210(4)474-548, 1989.
Rosenberg et al, Nature Med., 4:321-327, 1998.
Rosenberg et al, N. Engl J. Med, 319:1676, 1988.
Salter and Cresswell, Embo. J., 5:943-949, 1986.
Santiniet al, J. Exp. Med., 191:1777-1788, 2000.
Savage et al, Immunity, 10:485-492, 1999.
Savige et al, Am. J. Clin. Pathol, 111:507-513, 1999.
Scheibenbogen et al, Blood, 100:2132-2137, 2002.
Scheibenbogen et al, Int. J. Cancer, 71:932-936, 1997.
Serrano et al, Nature, 366:704-707, 1993.
Senano et al, Science, 267(5195):249-252, 1995.
Sette et al, J. Immunol, 153:5586-5592,1994.
Shlomchik et al, Science, 285:412-415, 1999.
Sibelius et al, J. Exp. Med, 187:497-503, 1998.
Snapper et al, Proc. Natl. Acad. Sci. USA, 85(18):6987-6991, 1988.
Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H. & Schreiber, R.D. How cells respond to interferons. Annu Rev Biochem 67, 227-64 (1998). Sturrock et al, J. Biol. Chem., 267:21193, 1992. Takada et al, J. Clin. Microbiol, 33(3):658-660, 1995. Tanaka t α/., Cancer Res., 57:4465-4468, 1997. Tanaka et α/., Genes Cells, 3:29-37, 1998.
Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 149-188, 1986. Teshima et al, Nat Med., 8:575-581, 2002. Toes et al, Int. J. Cancer, 66:686-691, 1996. Toes et al, J. Immunol, 156:3911-3918, 1996. Toes et al, Proc. Natl. Acad. Sci. USA, 93:7855-7860, 1996. Tratschin et al, Mol. Cell. Biol, 4:2072-2081, 1984. Tsujimoto and Croce, Proc. Natl Acad. Sci. USA, 83(14):5214-5218, 1986. Tsujimoto et al, Science, 228(4706): 1440-1443, 1985. Tsukada et al, J. Exp. Clin. Cancer Res., 16:171-176, 1997. van der Bruggen et al, Eur. J. Immunol, 124:3038-3043, 1994. van der Harst et al, Blood, 83:1060-1066, 1994. van Lochem et al, Bone Marrow Transplant, 10:181-183, 1992. van Rhee et al, Blood, 83, 1994. Nerdijk et al, J. Immunol, 163:57-61, 1999. Wada et al. , Nucleic Acids Res. 18 :2367-2411, 1990. Wang et al, Biol. Blood Marrow Transplant., 6:118, 2000. Weinberger et al, Science, 228:740-742, 1985. Williams et al, J. Immunol, 152:4722-4732, 1994. Wolf et al, Comput. Appl. Biosci, 4(1):187-191, 1988. Wong et al, Gene, 10:87-94, 1980. Yamamoto et al, Jpn. J. Cancer Res., 79:866-873, 1988. Yee et al, J. Immunol, 162:2227-2234, 1999. Yin et al, J. Biol. Resp. Modifi, 8:190-205, 1989. Zarour et al, J. Invest. Dermatol, 107:63-67, 1996. Zeh et /., J. Immunol, 162:989-994, 1999. Zufferey et al, Nat. Biotechnol, 15(9):871-875, 1997.

Claims

1. A vaccine comprising a peptide selected from the group consisting of a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
2. The vaccine of claim 1, wherein the cyclin D comprises the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof.
3. The vaccine of claim 1, wherein the cyclin El peptide comprises the sequence ILLDWLMEV (SEQ ID NO:62) or a fragment thereof.
4. The vaccine of claim 1, wherein the cyclin E2 peptide comprises the sequence ILLDWLLEV (SEQ JD NO:63) or a fragment thereof.
5. The vaccine of claim 1, further comprising a tumor-associated HLA- A3 restricted peptide.
6. The vaccine of claim 1, further comprising a tumor-associated HLA-A11 restricted peptide.
7. The vaccine of claim 1, further comprising a tumor-associated HLA-B7 restricted peptide.
8. The vaccine of claim 1, further comprising a tumor- associated HLA-B27 restricted peptide.
9. The vaccine of claim 1, further comprising a tumor-associated HLA-B35 restricted peptide.
10. The vaccine of claim 1, further comprising a myeloperoxidase peptide.
11. The vaccine of claim 10, wherein the myeloperoxidase peptide comprises an amino acid sequence of MY4 (SEQ ID NO:30) or MY2 (SEQ ID NO:32) or a fragment thereof.
12. The vaccine of claim 1, further comprising an adjuvant.
13. The vaccine of claim 12, wherein said adjuvant is selected from the group consisting of complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette- Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21.
14. The vaccine of claim 1 , further comprising an immunostimulant.
15. The vaccine of claim 1 , comprising more than one peptide.
16. The vaccine of claim 15, wherein the peptides depend on the tumor to be treated.
17. The vaccine of claim 15, wherein the peptide depend on the HLA type of the patient
18. The vaccine of claim 15, further comprising an antigen presenting cell.
19. The vaccine of claim 18, wherein the antigen presenting cell is a dendritic cell.
20. The vaccine of claim 19, wherein the dendritic cell (a) is pulsed or loaded with the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, and thereby against the tumor, or (b) comprises an expression construct that encodes the peptide and is used as a cellular vaccine to stimulate T cell immunity against the peptide, or and thereby against the tumor.
21. The vaccine of claim 1, further comprising a second tumor-associated HLA-restricted peptide.
22. The vaccine of claim 21, wherein the second tumor-associated HLA-restricted peptide is an HLA-A3, HLA-A11, HLA-B7, HLA-B27 or HLA-B35 restricted peptide.
23. A method for treating or preventing a cancer in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a tumor-associated peptide, wherein the peptide is a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
24. The method of claim 23, wherein the method comprises administering the vaccine more than once.
25. The method of claim 23, wherein the therapeutically effective amount is in the range of 0.20 mg to 5.0 mg.
26. The method of claim 23, wherein the therapeutically effective amount is in the range of 0.025 mg to 1.0 mg.
27. The method of claim 23, wherein the therapeutically effective amount is in the range of 2.0 mg to 5.0 mg.
28. The method of claim 23, wherein the cancer cell is a leukemic cell.
29. The method of claim 28, wherein said leukemic cell is a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell.
30. The method of claim 23, wherein said cancer cell is a solid tumor cell.
31. The method of claim 30, wherein said solid tumor cell is a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphatic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft tissue cancer cell.
32. The method of claim 23, wherein the vaccine is administered systemically.
33. The method of claim 32, wherein the vaccine is administered intravenously, intra- arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermally, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration.
34. The method of claim 23, wherein the vaccine is administered locally.
35. The method of claim 34, wherein the vaccine is administered by direct intratumoral injection.
36. The method of claim 34, wherein the vaccine is administered by injection into tumor vasculature.
37. The method of claim 34, wherein the vaccine is administered by an antigen-presenting cell pulsed or loaded with the peptide.
38. The method of claim 37, wherein the antigen presenting cell is a dendritic cell.
39. The method of claim 37, wherein the vaccine is a cellular vaccine.
40. The method of claim 37, wherein the antigen-presenting cell contains one or more peptide.
41. The method of claim 23, further comprising treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent.
42. The method of claim 41, wherein the second anticancer agent is administered simultaneously with the vaccine.
43. The method of claim 41, wherein the second anticancer agent is administered at a different time than the vaccine.
44. The method of claim 41, wherein said chemotherapeutic agent is from a group consisting of doxorubicin, daunorubicin, dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, semustine, streptozocin, dacarbazme, adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, hydrogen peroxide, nitrosurea, plicomycin, tamoxifen, taxol, transplatinum, vincristin, vinblastin, a TRAIL Rl and R2 receptor antibody or agonist, dolastatin-10, bryostatin, annamycin, mylotarg, sodium phenylacetate, sodium butyrate, methotrexate, dacitabine, imatinab mesylate (Gleevec), interferon-α, bevacizumab, cetuximab, thalidomide, bortezomib, gefitinib, erlotinib, azacytidine, 5-AZA-2'deoxycytidine, Revlimid, 2C4, an anti- angiogenic factor, a signal transducer-targeting agent, interferon-γ, IL-2 and IL-12.
45. The method of claim 41, wherein said immunotherapeutic agent is selected from a group consisting of GM-CSF, CD40 ligand, anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-lBB (CD137) mAbs, and an oligonucleotide.
46. A method for treating or preventing cancer in a patient comprising:
(a) contacting CTLs of said patient with a a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient.
47. The method of claim 46, further comprising expanding said CTL's by ex vivo or in vivo methods prior to administration.
48. The method of claim 46, wherein contacting comprises providing (a) an antigen presenting cell loaded with said peptide, (b) an antigen presenting cell transfected with an expression construct encoding said peptide, or (c) an antigen presenting cell infected with a viral vector that expresses said peptide.
49. The method of claim 46, further comprising providing CTLs transfected with a T cell receptor specific for the peptide.
50. The method of claim 46, wherein the therapeutically effective amount of CTL cells required to provide therapeutic benefit is from about 0.1 x 105 to about 5 x 107 cells per kilogram weight of the subject.
51. A peptide comprising the amino acid sequence of MY4 (SEQ ID NO:30) or MY2 (SEQ ID NO:32) or a fragment thereof.
52. An expression vector comprising a nucleic acid sequence that encodes the MY2 sequence (SEQ ID NO:32) or the MY4 sequence (SEQ ID NO:30) or a fragment thereof.
53. A peptide comprising the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ JD NO:4), NLSASVTSV (SEQ JD NO:5), IIQGIDSFV (SEQ JD NO:6), VLLALLLISGA (SEQ JD NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ JD NO: 11), VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof.
54. An expression vector comprising a nucleic acid that encodes the amino acid sequence of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ JD NO:7), QLPQQDQPV (SEQ JD NO: 10) and FLNNYDAENKL (SEQ JD NO: 11), VLQELWTV (SEQ JD NO:26), VLQELNVKV (SEQ JD NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ JD NO:29) or a fragment thereof.
55. A method for treating or preventing a cancer in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor-associated peptide,wherein the peptide is a neutrophil elastase peptide other than PRl, a cyclin El peptide, cyclin D peptide, or a cyclin E2 peptide.
56. The method of claim 55, wherein said expression construct is a non-viral expression construct.
57. The method of claim 55, wherein said expression construct is a viral expression construct.
58. The method of claim 55, wherein said expression construct encodes a second tumor associated peptide.
59. A method for treating an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2- restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
60. The method of claim 59, wherein the cyclin D comprises the sequence LLGATCMFV (SEQ JD NO:61) or a fragment thereof, or wherein the cyclin El peptide comprises the sequence ILLDWLMEV (SEQ JD NO: 62), or wherein the cyclin E2 peptide comprises the sequence ILLDWLLEV (SEQ ID NO:63) or a fragment thereof, or wherein the myleoperoxidase peptide may comprise the sequence of MY2 (SEQ JD NO:32) or MY4 (SEQ ID NO:30) or a fragment thereof.
61. The method of claim 59, wherein the vaccine further comprises a disease-associated HLA- A3 restricted peptide.
62. The method of claim 59, wherein the vaccine further comprises a disease-associated HLA-A11 restricted peptide.
63. The method of claim 59, wherein the vaccine further comprises a disease-associated HLA-B7 restricted peptide.
64. The method of claim 59, wherein the vaccine further comprises a disease-associated HLA-B27 restricted peptide.
65. The method of claim 59, wherein the vaccine further comprises a disease-associated HLA-B35 restricted peptide.
66. The method of claim 59, wherein the proteinase-3 peptide is selected from the group consisting of VLQELNVTV (SEQ ID NO:l), RFLPDFFTRV (SEQ JD NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ JD NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ JD NO:l 1) or a fragment thereof.
67. The method of claim 59, wherein the proteinase-3 peptide is a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof.
68. The method of claim 59, wherein the autoimmune disease is vasculitis, Wegener's granulomatosis, Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic pmpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's disease, ulcerative colitis, sarcoidosis, scleroderma, graft versus host disease (acute and chronic), aplastic anemia, or cyclic neutropenia.
69. A method of treating or preventing an infectious disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
70. The method of claim 69, wherein the cyclin D comprises the sequence LLGATCMFV (SEQ ID NO:61) or a fragment thereof, or wherein the cyclin El peptide comprises the sequence ILLDWLMEV (SEQ ID NO:62), or wherein the cyclin E2 peptide comprises the sequence ILLDWLLEV (SEQ JD NO:63) or fragment thereof, or wherein the myleoperoxidase peptide is MY2 (SEQ ID NO:32) or MY4 (SEQ ID NO:30) or a fragment thereof.
71. The method of claim 69, further comprising a disease-associated HLA- A3 restricted peptide.
72. The method of claim 69, further comprising a disease-associated HLA-A11 restricted peptide.
73. The method of claim 69, further comprising a disease-associated HLA-B7 restricted peptide.
74. The method of claim 69, further comprising a disease-associated HLA-B27 restricted peptide.
75. The method of claim 69, further comprising a disease-associated HLA-B35 restricted peptide.
76. The method of claim 69, wherein the proteinase-3 peptide is selected from the group consisting of VLQELNVTV (SEQ ID NO:l), RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ JD NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ JD NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ JD NO: 11) or a fragment thereof.
77. The method of claim 69, wherein the proteinase-3 peptide is a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ JD NO:29) or fragment thereof.
78. The method of claim 69, wherein the infectious disease is a viral hepatitis.
79. The method of claim 78, wherein the viral hepatitis is hepatitis B or hepatitis C.
80. A method of generating HLA-restricted peptide specific cytotoxic T-lymphocytes (CTLs) comprising: (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating high affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA-restricted peptide specific CTLs.
81. The method of claim 80, further comprising purifying the concentrated HLA-restricted peptide specific CTLs.
82. The method of claim 80, wherein step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs.
83. The method of claim 81 , wherein purifying comprises high-speed flow cytometry.
84. The method of claim 80, wherein the target peptide depends upon the donor and the peptide epitope.
85. The method of claim 80, wherein concentrating high affinity HLA-restricted peptide specific CTLs comprises using microbeads.
86. The method of claim 80, wherein concentrating high affinity HLA-restricted peptide specific CTLs comprises using high speed sorting.
87. The method of claim 80, further comprising concentrating low affinity HLA-restricted peptide specific CTLs.
88. The method of claim 87, comprising expanding the concentrated low affinity HLA- restricted peptide specific CTLs.
89. The method of claim 80, further comprising adoptive T cell immunotherapy.
90. The method of claim 80, further comprising expansion of adoptively transferred peptide- specific T lymphocytes.
91. The method of claim 90, further comprising vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide-specific T lymphocytes.
92. A method for treating or preventing an autoimmune or infectious disease in a patient comprising:
(a) contacting CTLs of said patient with a HLA- A2 -restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase 3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide; and (b) administering a therapeutically effective amount of said CTLs to the patient.
93. The method of claim 92, further comprising expanding said CTL's by ex vivo or in vivo methods prior to administration.
94. The method of claim 92, wherein contacting comprises providing an antigen presenting cell containing said peptide.
95. The method of claim 92, further comprising providing CTLs transfected with a T cell receptor specific for the peptide/HLA-A2 ligand.
96. The method of claim 92, wherein the autoimmune disease is vasculitis, Wegner's granulomatoses Addison's disease, alopecia, ankylosing spondylitis, antiphospholipid syndrome, Behcet's disease, celiac disease, chronic fatigue syndrome, Crohn's disease, ulcerative colitis, type I diabetes, fibromyalgia, autoimmune gastritis, Goodpasture syndrome, Graves' disease, idiopathic thrombocytopenic pmpura (ITP), lupus, Meniere's multiple sclerosis, myasthenia gravis, pemphigus vulgaris, primary biliary cirrhosis, psoriasis, rheumatoid arthritis, rheumatic fever, sarcoidosis, scleroderma, vitiligo, vasculitis, small vessel vasculitis, hepatitis, primary biliary cirrhosis, rheumatoid arthritis, Chrohn's disease, ulcerative colitis, sarcoidosis, scleroderma, graft versus host disease (acute and chronic), aplastic anemia, myelodysplastic syndrome, cyclic neutropenia, T- LGL (T-large granular lymphocytic) leukemia.
97. The method of claim 92, wherein the infectious disease is a viral hepatitis.
98. The method of claim 97, wherein the viral hepatitis is hepatitis B or hepatitis C.
99. The method of claim 92, wherein the therapeutically effective amount of CTL cells required to provide therapeutic benefit is from about 0.1 x 105 to about 5 x 107 cells per kilogram weight of the subject.
100. A method for treating or preventing an autoimmune disease in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a tumor associated HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
101. The method of claim 100, wherein said expression construct is a non- viral expression construct.
102. The method of claim 100, wherein said expression constract is a viral expression construct.
103. A method for preventing an autoimmune disease in a patient comprising (a) identifying a patient at risk of developing an autoimmune disease, and (b) administering to said patient a therapeutically effective amount of a vaccine comprising a HLA-A2-restricted peptide, wherein the HLA-A2-restricted peptide is a proteinase-3 peptide, a neutrophil elastase peptide, a myeloperoxidase peptide, a cyclin El peptide, cyclin D, or a cyclin E2 peptide.
104. A method of generating HLA-restricted peptide specific cytotoxic T-lymphocytes (CTLs) comprising:
(a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the CTL ex vivo; (b) concentrating low affinity HLA-restricted peptide specific CTLs; and (c) expanding the concentrated HLA-restricted peptide specific CTLs.
105. The method of claim 104, further comprising purifying the concentrated HLA-restricted peptide specific CTLs.
106. The method of claim 104, wherein step (b) may occur prior to, after, or both before and after purifying the concentrated HLA-restricted peptide-specific CTLs.
107. The method of claim 105, wherein purifying comprises high-speed flow cytometry.
108. The method of claim 104, wherein the target peptide depends upon the donor and the peptide epitope.
109. The method of claim 104, wherein concentrating low affinity HLA-restricted peptide specific CTLs comprises using microbeads.
110. The method of claim 104, wherein concentrating low affinity HLA-restricted peptide specific CTLs comprises using high speed sorting.
111. The method of claim 104, further comprising concentrating high affinity HLA-restricted peptide specific CTLs.
112. The method of claim 111, comprising expanding the concentrated high affinity HLA- restricted peptide specific CTLs.
113. The method of claim 104, further comprising adoptive T cell immunotherapy.
114. The method of claim 104, further comprising expansion of adoptively transferred peptide-specific T lymphocytes.
115. The method of claim 114, further comprising vaccinating the recipient with the specific peptide combined with an adjuvant after the transfer of the peptide-specific T lymphocytes.
116. A method of generating HLA-restricted peptide specific regulatory T-cells comprising: (a) obtaining a target peptide pulsed onto antigen-presenting cells to expand the T- cells ex vivo;
(b) concentrating HLA-restricted peptide specific regulatory T-cells; and
(c) expanding the concentrated HLA-restricted peptide specific regulatory T-cells.
EP04809624A 2003-08-26 2004-08-26 Vaccines for cancer, autoimmune disease and infections Withdrawn EP1670899A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US49823803P 2003-08-26 2003-08-26
PCT/US2004/027792 WO2005035714A2 (en) 2003-08-26 2004-08-26 Vaccines for cancer, autoimmune disease and infections

Publications (1)

Publication Number Publication Date
EP1670899A2 true EP1670899A2 (en) 2006-06-21

Family

ID=34216164

Family Applications (2)

Application Number Title Priority Date Filing Date
EP04782297A Withdrawn EP1660636A4 (en) 2003-08-26 2004-08-26 ANTICANCER VACCINES
EP04809624A Withdrawn EP1670899A2 (en) 2003-08-26 2004-08-26 Vaccines for cancer, autoimmune disease and infections

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP04782297A Withdrawn EP1660636A4 (en) 2003-08-26 2004-08-26 ANTICANCER VACCINES

Country Status (5)

Country Link
EP (2) EP1660636A4 (en)
JP (1) JP2007504149A (en)
AU (1) AU2004267506A1 (en)
CA (1) CA2536654A1 (en)
WO (2) WO2005019435A2 (en)

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103285392A (en) * 2005-04-26 2013-09-11 卫材R&D管理株式会社 Compositions for cancer immunotherapy and use thereof
CA2523032A1 (en) 2005-10-07 2007-04-07 Immunovaccine Technologies Inc. Vaccines for cancer therapy
CN106310293A (en) 2007-09-27 2017-01-11 免疫疫苗技术有限公司 Use of liposomes in a carrier comprising a continuous hydrophobic phase for delivery of polynucleotides in vivo
US20110097312A1 (en) * 2008-02-15 2011-04-28 Board Of Regents, The University Of Texas System Anti-cancer vaccines
WO2009146523A1 (en) 2008-06-05 2009-12-10 Immunovaccine Technologies Inc. Compositions comprising liposomes, an antigen, a polynucleotide and a carrier comprising a continuous phase of a hydrophobic substance
GB201009222D0 (en) 2010-06-02 2010-07-21 Immatics Biotechnologies Gmbh Improved cancer therapy based on tumour associated antigens derived from cyclin D1
WO2012079075A1 (en) 2010-12-10 2012-06-14 Concert Pharmaceuticals, Inc. Deuterated phthalimide derivatives
CN113876945A (en) 2011-10-06 2022-01-04 免疫疫苗技术有限公司 Liposome composition comprising adjuvant for activating or increasing TLR2 activity and application thereof
WO2013130849A1 (en) 2012-02-29 2013-09-06 Concert Pharmaceuticals, Inc. Substituted dioxopiperidinyl phthalimide derivatives
US9249093B2 (en) 2012-04-20 2016-02-02 Concert Pharmaceuticals, Inc. Deuterated rigosertib
EP2922838B1 (en) 2012-10-22 2018-03-14 Concert Pharmaceuticals Inc. Solid forms of {s-3-(4-amino-1-oxo-isoindolin-2-yl)(piperidine-3,4,4,5,5-d5)-2,6-dione} .
WO2014110322A2 (en) 2013-01-11 2014-07-17 Concert Pharmaceuticals, Inc. Substituted dioxopiperidinyl phthalimide derivatives
CN103961306A (en) * 2013-02-05 2014-08-06 日东电工株式会社 Vaccine composition for transdermal administration
CN103961697A (en) * 2013-02-05 2014-08-06 日东电工株式会社 Vaccine composition for mucosal administration
GB201519303D0 (en) 2015-11-02 2015-12-16 Imp Innovations Ltd Phagemid vector
GB201706451D0 (en) 2017-04-24 2017-06-07 Imp Innovations Ltd Cancer treatment

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1286693A4 (en) * 2000-06-02 2005-07-13 Univ Connecticut Health Ct COMPLEXES OF ALPHA-2-MACROGLOBULIN AND ANTIGENIC MOLECULES FOR IMMUNOTHERAPY

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005035714A2 *

Also Published As

Publication number Publication date
WO2005019435A8 (en) 2006-04-27
AU2004267506A1 (en) 2005-03-03
EP1660636A2 (en) 2006-05-31
JP2007504149A (en) 2007-03-01
EP1660636A4 (en) 2009-07-01
WO2005035714A2 (en) 2005-04-21
CA2536654A1 (en) 2005-03-03
WO2005035714A3 (en) 2009-04-16
WO2005019435A3 (en) 2006-06-29
WO2005019435A2 (en) 2005-03-03

Similar Documents

Publication Publication Date Title
US20060045881A1 (en) Anti-cancer vaccines
US20230277641A1 (en) Telomerase polypeptide vaccine for treating cancer
US20110097312A1 (en) Anti-cancer vaccines
US10993963B2 (en) Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers
KR101216655B1 (en) PROTEINS BELONGING TO THE Bcl-2 FAMILY AND FRAGMENTS THEREOF, AND THEIR USE IN CANCER PATIENTS
US8043623B2 (en) Immunogenic peptides for the treatment of prostate and breast cancer
US11559550B2 (en) Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers
EP1670899A2 (en) Vaccines for cancer, autoimmune disease and infections
WO2014004385A2 (en) Anti-cancer vaccines
US8258261B2 (en) Induction of tumor immunity by variants of folate binding protein
US10898562B1 (en) Immunotherapy against several tumors of the blood, such as acute myeloid leukemia (AML)
US20060045883A1 (en) Anti-cancer vaccines
Bright et al. SV40 Tag-specific cytotoxic T lymphocytes generated from the peripheral blood of malignant pleural mesothelioma patients
JP2002512202A (en) Vaccine adjuvant for immunotherapy of melanoma
US20060045884A1 (en) Vaccines for autoimmune and infectious disease
CN105163754A (en) Prostate-specific tumor antigen and uses thereof
US9573975B2 (en) Melanoma antigen peptide and uses thereof
JP6918333B2 (en) Peptides recognized by cell-mediated immunity and pharmaceuticals using them
Rivoltini et al. Tumor immunology: Clinical perspectives
Hampton Identification and characterization of tumor-associated antigens

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060302

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

DAX Request for extension of the european patent (deleted)
PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/00 20060101ALI20090424BHEP

Ipc: A61K 38/04 20060101ALI20090424BHEP

Ipc: A61K 38/03 20060101ALI20090424BHEP

Ipc: A61K 38/02 20060101ALI20090424BHEP

Ipc: C07K 14/00 20060101ALI20090424BHEP

Ipc: C07K 7/00 20060101ALI20090424BHEP

Ipc: C07K 4/00 20060101ALI20090424BHEP

Ipc: C07K 2/00 20060101ALI20090424BHEP

Ipc: C07K 1/00 20060101AFI20090424BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20090625