AU2004267506A1 - Anti-cancer vaccines - Google Patents

Anti-cancer vaccines Download PDF

Info

Publication number
AU2004267506A1
AU2004267506A1 AU2004267506A AU2004267506A AU2004267506A1 AU 2004267506 A1 AU2004267506 A1 AU 2004267506A1 AU 2004267506 A AU2004267506 A AU 2004267506A AU 2004267506 A AU2004267506 A AU 2004267506A AU 2004267506 A1 AU2004267506 A1 AU 2004267506A1
Authority
AU
Australia
Prior art keywords
ctl
cells
peptide
hla
pr1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
AU2004267506A
Inventor
A. John Barrett
Jeffrey Molldrem
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
US Department of Health and Human Services (HHS)
University of Texas System
Original Assignee
US Department of Health and Human Services (HHS)
University of Texas System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US49823803P priority Critical
Priority to US60/498,238 priority
Application filed by US Department of Health and Human Services (HHS), University of Texas System filed Critical US Department of Health and Human Services (HHS)
Priority to PCT/US2004/027790 priority patent/WO2005019435A2/en
Publication of AU2004267506A1 publication Critical patent/AU2004267506A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4748Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE

Description

WO 2005/019435 PCT/US2004/027790 DESCRIPTION ANTI-CANCER VACCINES 5 BACKGROUND OF THE INVENTION This application claims benefit of priority to U.S. Provisional Application Serial No. 60/489,238, filed August 26, 2003, the entire contents of which are hereby incorporated by reference. 10 The government owns rights in the present invention pursuant to grant numbers RO1 CA81247-02 and RO1 CA49639-11 from the National Institutes of Health. 1. Field of the Invention The present invention relates generally to the fields of cancer and immunotherapy. More 15 particularly, it concerns the identification of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of cancer. 2. Description of Related Art The immune system has long been implicated in the control of cancer, however, evidence 20 for specific and efficacious immune responses in human cancer have been lacking. In chronic myelogenous leukemia (CML), either allogeneic bone marrow transplant (BMT) or interferon a2b (IFN-a2b) therapy have resulted in complete remission, but the mechanism for disease control is unknown and may involve immune antileukemic responses. Based on evidence in the art, it is thought that lymphocytes play a role in meditating an 25 antileukemia effect. Studies have demonstrated that allogeneic donor lymphocyte infusions (DLI) have been used to treat relapse of myeloid leukemia after allogeneic BMT (Giralt and Kolb, 1996; Kolb and Holler, 1997; Kolb et al., 1995; Kolb et al., 1996; Antin, 1993). Lymphocyte transfusion from the original bone marrow (BM) donor induces both hematological and cytogenetic responses in approximately 70% to 80% of patients with chronic myelocytic 30 leukemia (CML) in chronic phase (CP) (Kolb et al., 1996, Holler, 1997). Remissions after DLI for AML are generally not as durable as those obtained in chronic phase CML, which may reflect the rapid kinetics of tumor growth outpacing the kinetics of the developing immune response. Additionally, most patients with myeloid forms of leukemia will die from the disease unless they can be treated with allogeneic bone marrow transplant, where the associated graft 1 WO 2005/019435 PCT/US2004/027790 versus leukemia (GVL) effect cures patients. However, graft-versus-host disease (GVHD) and transplant-related toxicity limit this treatment. It is believed that GVL may be separable from GHVD, and that targeting the immune response toward leukemia-associated antigens will allow for the transfer of GVL to patients without GVHD. 5 Thus, if more antigens (i.e., leukemia antigens or antigens aganist other cancers) could be determined, and if large numbers of the most potent antigen-specific cytotoxic T lymphocytes (CTLs) could be obtained, it would allow for development of leukemia-specific therapies, breast cancer specific therapies, etc. using the antigens as a targets for vaccines or for generating specific T cells for use in adoptive immunotherapy. 10 Various methods have been used in the art to determine the nature of the target antigens, such as leukemia-specific antigens, of the GVL effect. For instance, tissue-restricted minor histocompatibility antigens (mHA) that are derived from proteins expressed only in recipient hematopoietic tissue have been shown to be the targets of alloreactive donor T cells. Heterologous T cell clones that demonstrate alloreactivity toward different mHA have been 15 established from patients with severe GVHD following BMT with an HLA-matched donor (Faber et al., 1995a; Faber et al., 1995b; Faber et al., 1996; van der Harst et al., 1994; Molldrem et al., 2000; Gao et al., 2000; den Haan et al., 1998; Clark et al., 2001). Some of these mHA specific CTL clones react only with hematopoietic-derived cells, suggesting tissue specificity (Faber et al., 1996; den Haan et al., 1998), and therefore potentially shared antigens on leukemia. 20 Expression of two human miHAs, identified as HA-1 and HA-2, is confined to hematopoictic tissues. HA-2 was identified as a peptide derived from the non-filament-forming class I myosin family by using mHA-reactive CTL clones to screen peptide fractions eluted from MHC class I molecules (den Haan et al., 1995; Faber et al., 1995a). Thus, while various methodologies has successfully defined some CTL alloantigens, it is 25 extremely labor intensive and it is unclear whether CTL specific for any minor antigens identified thus far convey leukemia-specific immunity without concomitant GVHD. In one study, GVHD correlated closely with differences in the minor antigen HA-1 in HLA identical sibling transplants (Goulmy et al., 1996; Dolstra et al., 1997). Furthermore, a practical limit of any immunotherapy approach targeting these mHAs is that only 10% of individuals would be 30 expected to have the relevant HA-1 alternate allele, and < 1% would have the HA-2 alternate allele, which makes donor availability quite limiting. An alternative immunological or deductive method to determine leukemia-specific CTL epitopes has been applied to determine whether BCR-ABL fusion region peptides could elicit CML-specific T cell responses. Peptides are synthesized based upon an "educated guess" of 2 WO 2005/019435 PCT/US2004/027790 which proteins are potential target antigens for a selective anti-leukemia CTL response. The proteins are then examined for short peptides that fit the binding motif of the most common HLA alleles based on the amino acid sequence. Using this method, these peptides are then synthesized, tested for binding to the HLA allele, and used to elicit peptide-specific CTL 5 responses in vitro. Since BCR-ABL is present in nearly all (92%) Philadelphia chromosome positive CML patients, it is thought to represent a potentially unique leukemia antigen. The ABL coding sequences upstream (5 ') of exon II on chromosome 9 are translocated to chromosome 22 and fused inframe with the BCR gene downstream (3') of exon III, resulting in a chimeric mRNA (b3a2) (the most common transcript) which is translated into a chimeric protein 10 (p21OBCR-ABL). Translation of b3a2 mRNA results in the coding of a unique amino acid (lysine) within the fusion region. Some HLA-B8-restricted overlapping peptides inclusive of this lysine could bind to HLA-B8 and could be used to elicit T cell proliferative responses when the peptide was either pulsed onto HLA-matched normal antigen presenting cells or onto HLA B8 positive CML cells (Dermime et al., 1995; Bocchia et al., 1995; Bocchia et al., 1996; Faber 15 et al., 1995b; Faber et al., 1996; van der Harst et al., 1994). However, when the b3a2 peptides were used to elicit b3a2-specific T lymphocyte lines in vitro, the resulting T cells could not specifically lyse fresh CML cells which had not previously been pulsed with the peptide (Bocchia et al., 1996; van der Harst et aL, 1994). This could be due to a low affinity of the peptide-specific CTL or the peptide may not be processed or presented on CML cells. More 20 recently, b3a2-specific CTL were identified in the peripheral blood of CML patients using soluble b3a2 peptide/MHC tetramers (Clark et al., 2001). Although the tetramer-positive CTL from the patients were not tested to determine whether they could kill CML target cells, b3a2 specific CTL elicited in vitro from healthy donors were able to kill CML cells (den Haan et al., 1995). This suggests that bcr-abl fusion peptides may be targets of GVL reactions. Although 25 peptides derived from the b3a2 fusion region given as a vaccine to CML patients elicited CTL immunity in 3 of 12 patients, no clinical benefit was noted (Pinilla-Ibarz et al., 2000). In tumors other than leukemia, such as melanoma and breast cancer, many peptide antigens have been identified as targets of tumor-specific CTL. What is clear from these studies is that nearly all of the tumor antigens identified are derived from normal tissue proteins (Nanda 30 and Sercarz, 1995; Boon et al., 1997). It is now accepted that many self-antigenic determinants have not induced self-tolerance and that these peptide determinants supply target structures for autoimmune attack (Nanda and Sercarz, 1995; Rosenberg and White, 1996; Goulmy et al., 1996; Dermime et al., 1995). Since these proteins are often aberrantly expressed or overexpressed in the tumor, there is relative tumor specificity by CTL that recognize these epitopes (Pardoll, 3 WO 2005/019435 PCT/US2004/027790 2002; Pardoll, 1994; Bocchia et al., 1996; Pinilla-Ibarz et al., 2000). Similarly in leukemia, CTL immunity to the Wilm's tumor antigen WT-1, which is aberrantly expressed in various forms of leukemia, has been demonstrated to kill CML CD34+ progenitor cells (Gao et al., 2000). Melanoma peptide antigens that are delved from MAGE-3 proteins, for example, are 5 presented to melanoma-specific CTLs by HLA-A1 and HLA-A2 (Nanda and Sercarz, 1995; Boon et al., 1997; Rosenberg and White, 1996). This protein belongs to a family of proteins which are expressed in melanoma cells and in normal testis. A MAGE-3 derived peptide was determined to be immunogenic by separate groups using different techniques, one using an immunological method (Pardoll, 2002) and the other a genetic method that uses tumor antigen 10 deficient mutants (Nanda and Sercarz, 1995). Recently, a phase I clinical trial using MAGE-3 to vaccinate melanoma patients resulted in some clinical responses (Pardoll, 1994). In addition, tyrosinase, gp100, and Melan-A-MART-1 are also normal self-proteins specific to the melanocyte lineage and T-cells specific for determinants on each of these antigens can be found in a large majority of melanoma patients (Sturrock et aL, 1992; Chen et aL, 1994). Two recent 15 phase II vaccine trials demonstrated clinical efficacy of active immunotherapy using these target antigens as a peptide vaccine or as a antigen-pulsed dendritic cell vaccine. PRI, an HLAA2. 1-restricted nonamer derived from proteinase 3 (P3), was identified as a leukemia-associated antigen (Molldrem et al., 2000; Molldrem et aL, 1996; Molldrem et al., 1997; Molldrem et al., 1999; Molldrem et al., 2003 each incorporated herein by reference in 20 their entirety). The finding that PR1 is a leukemia-associated antigen has been independently confirmed by Burchert et al. (2002) and Scheibenbogen et al. (2002). These studies have thus established PR1 as a human leukemia-associated antigen and have established that PR1- specific CTL contribute to the elimination of CML. Although some tumor specific antigens have been identified as putative 25 immunotherapeutic targets, there still is a great need in the art to identify more antigens and develop immunotherapeutic methods that target different cancers. New approaches for treatment of cancers are therefore needed. Insight into the occurring problem of why immune therapy often fails will help to modify or overcome tolerance and improve immunotherapies for leukemia and potentially other cancers as well. 30 SUMMARY OF THE INVENTION The present invention provides a vaccine comprising a first tumor associated HLA restricted peptide. The HLA-restricted peptide may be an HLA-A2 restricted peptide, such as a proteinase-3 peptide other than PRI. Such peptides include a proteinase-3 peptide is selected Ai WO 2005/019435 PCT/US2004/027790 from the group consisting of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO:11) or a fragment thereof. The proteinase-3 peptide may be a modified peptide selected from the group consisting of 5 VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof. The vaccine may further comprise an adjuvant, such as complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette-Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21. The vaccine may 10 also further comprise an immunostimulant. The vaccine may comprise more than one peptide, and the multiple peptides may depend on the tumor to be treated, and/or the HLA type of the patient. The vaccine may further comprise an antigen presenting cell, such as a dendritic cell, and more particularly a dendritic cell pulsed or loaded with the peptide and used as a cellular vaccine to stimulate T cell immunity 15 against the peptide, and thereby against the tumor. The vaccine may further comprise a second tumor-associated HLA-restricted peptide. The vaccine may further comprise a third, fourth or fifth tumor-associated HLA-restricted peptide. The second, third, fourth or fifth tumor-associated HLA-restricted peptide may be an HLA-A2, HLA-A3, HLA-A11, HLA-B7, HLA-B27 or HLA-B35 restricted peptide. 20 In another embodiment, there is provided a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising a proteinase-3 peptide other than PR1. The vaccine may be administered more than once. The therapeutically effective amount may be in the range of 0.20 mg to 5.0 mg, or in the range of 0.025 mg to 1.0 mg, or in the range of 2.0 mg to 5.0 mg of the peptide. 25 The cancer cell may be a leukemic cell, such as a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia. cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell.

WO 2005/019435 PCT/US2004/027790 The cancer cell may be a solid tumor cell, such as a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphaiic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft 5 tissue cancer cell. The method may use vaccine administered systemically, intravenously, intra-arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermally, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration. The vaccine may be administered locally, by direct intratumoral injection, by injection into tumor vasculature or by 10 an antigen-presenting cell pulsed or loaded with the peptide, wherein the antigen presenting cell may be a dendritic cell. The antigen-presenting cell may comprise one or more distinct peptides. The method may utilize a cellular vaccine. The method may further comprise treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a 15 therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent. The second anticancer agent may be administered simultaneously with the vaccine, or administered at a different time than the vaccine. The immunotherapeutic agent may be GM-CSF, CD40 ligand,.anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-1BB (CD137) mAbs, and an oligonucleotide. The chemotherapeutic agent may be doxorubicin, daunorubicin, 20 dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, semustine, streptozocin, dacarbazine, adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, hydrogen peroxide, nitrosurea, plicomycin, tamoxifen, taxol, 25 transplatinum, vincristin, vinblastin, a TRAIL RI and R2 receptor antibody or agonist, dolastatin-10, bryostatin, annamycin, mylotarg, sodium phenylacetate, sodium butyrate, methotrexate, dacitabine, imatinab mesylate (Gleevec), interferon-a, bevacizumab, cetuximab, thalidomide, bortezomib, gefitinib, erlotinib, azacytidine, 5-AZA-2'deoxycytidine, Revlimid, 2C4, an anti-angiogenic factor, a signal transducer-targeting agent, interferon-y, IL-2 and IL-12. 30 In yet another embodiment, there is provided a method for treating or preventing cancer in a patient comprising (a) contacting CTLs of the patient with a proteinase 3 peptide other than PR1; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient. The method may further comprise expanding the CTL's by ex vivo or in vivo methods prior to administration. Contacting may comprise providing an antigen presenting cell loaded WO 2005/019435 PCT/US2004/027790 with the peptide or that expresses the peptide from an expression construct. The method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide. The therapeutically effective amount of CTL cells required to provide therapeutic benefit may be from about 0.1 x 10 5 to about 5 x 10 7 cells per kilogram weight of the subject. 5 In still yet another embodiment, there is provided a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a proteinase-3 peptide other than PR1. The expression construct may be a non-viral expression construct or a viral expression construct. The expression construct may also encode a second tumor associated peptide. 10 As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one. As used herein "another" may mean at least a second or more. Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed 15 description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. BRIEF DESCRIPTION OF THE DRAWINGS 20 The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. 25 FIG. 1. Peptide-specific cytotoxicity of CTL against peptide-loaded T2 cells. Effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1. CTL raised against T2 cells pulsed with PR-I or PR-2 were tested for specific lysis against the same respective target cell/target peptide combination. Six replicate wells were used for each dilution of effector cells. Data were pooled from 3 separate experiments using 3 separate CTL 30 lines and displayed as mean specific lysis + standard deviation. FIGS. 2A-2B. PRI specific CTL preferentially lyse fresh myeloid leukemia cells. CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1. Six replicate wells were used for each dilution of effector cells. Data were pooled WO 2005/019435 PCT/US2004/027790 from 3 separate experiments using 3 separate CTL lines and displayed as mean specific lysis + standard deviation. FIG. 2A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 5 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls). FIG. 2B - CTL specific for PR-1 demonstrate high specific lysis against marrow cells from patients with chronic myelogenous leukemia in chronic phase (CML-CP), accelerated phase (CML-AP), blast crisis (CML-BC), acute myelogenous leukemia (M4 subtype), and only background lysis toward marrow cells from a healthy marrow donor (D2) for patient P3. 10 FIG. 3. HMY-A2.1+ cells transfected with Pr3 gene express cytoplasmic protein. HMy2.CIR-A2 cells were transfected with the Pr3-containing vector pRTZ.2 and grown in culture in the presence of Zeocin. Cells were then grown in limiting dilution using increasingly higher concentrations of Zeocin. Two resulting cell lines, Clone 2.2 and Clone 1.4, and the non transfected parent cell line HMy2.CIR-A2, were then analyzed for cytoplasmic Pr3 expression 15 by flow cytometry using indirect staining with a FITC-labeled secondary antibody. Histograms of cell number versus the median channel of fluorescence (MCF) intensity of staining for cytoplasmic Pr3 are shown. FIG. 4. PR1 specific CTL lyse Pr3-transfected HIMY-A2.1+ cells. CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratio of 25:1. Six replicate wells 20 were used, and data is displayed as mean specific lysis ± standard deviation. CTL specific for PR-1 demonstrate 36% specific lysis of HMy2.CIR-A2 cells transfected with Pr3 (Clone 1.4), and 73% specific lysis of marrow cells from a patient with chronic myelogenous leukemia in blast crisis (CML-BC), (positive control). There was only background lysis of HL-60 cells (low proteinase 3 expression, HLA-A2.1 negative), non-Pr3 transfected HMy2.CIR-A2 cells, CAT 25 transfected HMy2.CIR cells, and marrow cells from a normal donor (negative controls). FIGS. 5A-5C. PRI-specific CTL can be identified by a PR1-tetramer. FIG. 5A - A day 17 CTL line elicited against PR1 was labeled for 30 min with anti-CD8-FITC, washed three times with PBS, and then labeled for 30 min with the PRI-tetramer-PE. Cells were then washed three more times with PBS and analyzed by flow cytometry. 2.4% of the CTL line was specific 30 for PRI. FIG. 5B - An HLA-A2 tetramer specific for a new shock peptide stained 0.2% of the PR1-specific CTL. FIG. 5C - A day 17 CTL line elicited against influenza nucleoprotein was also labeled with anti-CD8-FITC and the PRI-tetramer-PE and is shown as a negative control. FIG. 6. The PR-tetramer can be used to sort CTL with PRI-specificity. A day 32 CTL line elicited against PRI was stained for 2 hr with anti-CD8-FITC, washed 3 times with PBS, 8 WO 2005/019435 PCT/US2004/027790 then labeled for 2 hr on ice with the PR1-tetramer-PE conjugate. Cells were then labeled a third time with anti-CD4 and PI, washed 3 times with PBS, and sorted for dual-staining CD8 + PR1 tetramer positive cells. FL1-H is CD8-FITC and FL2-H is PR1-tetramer-PE. The CTL line following sorting is shown. 5 FIG. 7. CTL sorted for PR1-specificity show higher specific lysis of leukemia targets than non-sorted bulk culture CTL, with less background lysis. Day 32 bulk culture PRI-pulsed CTL were compared to PRI-tetramer-sorted CTL as effector cells plated with marrow cells from an HLA-A2.1+ patient with CML in accelerated phase (CML BM) or marrow cells from an HLA identical normal donor (Normal BM). CTL were derived from an unrelated normal donor 10 matched only for HLA-A2. FIG. 8. SSCP analysis of the 5 PR3 exons. Shown here are the best results obtained for each exon (Ex 1 to 5) in 10 pairs of donor-recipient (D-R) pairs. Arrowheads indicated bands present in the recipient but not in the donor. FIG. 9. Pr3 exon 3 containing polymorphism codes for peptides that bind to HLA-A2.1. 15 Surface HLA-A2.1 expression after 18 hr of incubation of T2 cells with 100 microgram of either PR71, PR7V, or control influenza peptide. Isotype control is shown at far left. FIG. 10. Tissue Expression of Proteinase 3. FIGS. 11A-11D. HLA-A*0201 Expression on T2. Lower doses of PR1 peptide induce CTLs with higher intensity PR1/HLA-A2 tetramer staining that correlates with TCR avidity and 20 inversely with effector function threshold. FIG. 11A - PBMCs collected from healthy HLA A2.1* donors were stimulated weekly with PR1 peptide-pulsed T2 cells at the peptide concentrations indicated above each FACS plot. After 4 weeks, resulting cultures were stained with CD8 (FITC) Ab and PRl/HLA-A2 tetramer, and the percentage of CD8* cells that stain with tetramer are noted within each FACS plot. FIG. I1B - Surface HLA-A2 expression on T2 25 cells increases linearly with increasing concentration of PRI peptide from 2 yM and 200 yM. T2 cells were incubated with PR1 peptide at the concentrations shown and surface HLA-A2 expression was measured by flow cytometry. FIG. 11C - CTLs elicited with PRI at 0.2 [M (open circles) or 20 AM (filled squares) PRI were incubated for 4 hr at 37'C with PR1 peptide pulsed T2 cells at the indicated peptide concentrations at an effector/target (E/T) ratio of 10:1 30 (adjusted based on the number of tetramer-positive CTLs), and percentage of specific lysis was determined. FIG. 11D - Tetramer decay (tm/ 2 ) was determined to be 58 min and 19 min by plotting normalized antigen-specific fluorescence at the indicated time points for 28-day-old PR1/HLA-A2 tetramer-stained CTLs elicited with 0.2 FM (open circles) or 20 /M PR1 (filled squares), respectively. Dissociation kinetics of PR1/ILA-A2 tetramer staining were determined a WO 2005/019435 PCT/US2004/027790 at 4'C in the presence of saturating concentrations of BB7.2 Ab to prevent rebinding of tetramer and in the presence of PI (1 pg/ml) to eliminate dead cells from the FACS gate. FIGS. 12A-12B. Spectratyppe from high and low avidity PR1-specific CTL cultures. Vp2 and VP 11 at day 0 and day 26 are shown. FIG. 12A - 0.2 pM PRI. FIG. 12B - 20 PRL. 5 FIGS. 13A-13B. High-avidity PRI-specific CTLs cause more specific lysis of CML BM cells than low-avidity PR1-specific CTLs. After 4 weeks in culture, PR1- stimulated CTLs were coincubated in a 4-hr microcytotoxicity assay with bone marrow cells, and specific lysis was determined. Six replicate wells were used for each dilution of effector cells. Specific lysis is plotted versus E/T ratio, and effector number was normalized for the number of PRl/HLA-A2 10 tetramer-staining cells in the bulk culture. FIG. 13A - High-avidity PR1-specific CTLs from a healthy donor showed greater specific lysis of CML target cells than low-avidity PR1-specific CTLs. FIG. 13B - PRI-specific CTL line from a CML patient 3 months after IFN treatment preferentially lyse autologous BM target cells taken at time of diagnosis over healthy HLA-A2* BM cells from a third party, and the amount of CML target cell lysis is similar to that produced 15 by healthy donor-derived low-avidity PR1 -specific CTLs. FIGS. 14A-14C. Only low-avidity PR1 -specific CTLs are elicited from peripheral blood of CML patients. PBMCs from three different HLA-A2* CML patients were stimulated weekly with PRI-pulsed T2 cells with PRI ranging from 0.002 yM to 200 IM. After 4 weeks, resultant cultures were stained with CD8 Ab and PR1/HLA-A2 tetramer and analyzed by FACS. The 20 percentage of CD8+ cells that stain with relevant tetramer is indicated within each FACS plot. FIG. 14A - Cultures elicited with 0.2 yM, 0.02 p.M, and 0.002 p.M PRI resulted in CTLs with lower-intensity tetramer staining than CTLs from healthy donors elicited with similar doses of PR1. FIG. 14B - PBMCs from an untreated chronic phase CML patient (CML no. 4) were studied weekly prior to restimulation with PR1-pulsed T2 cells with PR1/HLA-A2 tetramer. 25 Only PRI-specific CTLs with low-intensity tetramer staining emerge over the 4 weeks, and no relatively high tetramer intensity CTLs are present. FIG. 14C - PBMCs from CML no. 2 stimulated weekly with 0.2 p.M pp65 peptide elicited CTLs with high-intensity pp65/HLA-A2 tetramer staining after 4 weeks in culture. FIGS. 15A-15C. High-avidity PR1-specific CTLs are identified in the peripheral blood 30 of IFN sensitive CML patients (FIG. 15A) in cytogenetic remission, but not in (FIG. 15B) IFN resistant or in (FIG. 15C) untreated newly diagnosed CML patients. PBMCs were stained with CD8, dump (CD14 + CD19), and PR1-HLA-A2 tetramer. Patients 5-8 were treated for a minimum of 9 months with IFN. The percentage of Ph+ chromosomes in a simultaneous BM 1 A WO 2005/019435 PCT/US2004/027790 specimen is indicated above each FACS plot, and the percentage of CD8* cells with high-avidity PR1 -specific CTLs is indicated within each FACS plot. FIGS. 16A-16B. High-avidity PR1-specific CTLs undergo apoptosis 18 hr after stimulation with high-concentration PR1 peptide. PBMCs from a healthy donor 28 days after 5 weekly restimulation with either 0.2 yM or 20 pM PRI-pulsed T2 cells established relatively high- and low-avidity PRI-CTL, respectively (far left panels). The resulting PRI-CTLs were washed and combined in a 1:1 ratio, based on the number of tetramer-positive cells, with T2 cells pulsed with either 0.2 yM or 20 yM PRI peptide. After 16 to 18 hr, cells were stained with Annexin V Ab, and live cells were analyzed based on PI staining. The percentage of CD8+ cells 10 that are tetramer-positive is shown in the far left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels. FIG. 16A - Annexin V expression increased on high-avidity PR1-CTLs exposed to high-concentration (20 sM) PRI, but not after exposure to low (0.2 gM) concentration PR1. Annexin V upregulation was blocked by pretreating peptide-pulsed T2 cells with anti-HLA-A2 (BB7.2) prior to coculture with PR1-CTL. 15 FIG. 16B - Annexin V was not upregulated 18 hr after coculture of low-avidity PRI-CTLs with either low-concentration (0.2 AM) or high concentration (20 pM) PRI. peptide. FIGS. 17A-17D. High-avidity PRl-CTLs undergo apoptosis 18 hr after coincubation with HLA-A2* CML cells that overexpress proteinase 3. High- and low-avidity PR1 -CTLs were combined in a 1:1 ratio, based upon the number of tetramer-positive cells, with CML BM cells 20 from untreated HLA-A2+ and HLA-A2- patients. Annexin V staining was measured on live cells, based on PI staining, 18 hr after coincubation. The percentage of CD8+ cells that are tetramer positive is shown in the left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels. FIG. 17A - Annexin V was upregulated in the high-avidity PR1-CTLs after coincubation with HLA-A2* cells, but not after coincubation with 25 HLA-A2- cells. Remaining low-avidity PR1-CTLs in the culture did not upregulate annexin V. FIG. 17B - In contrast, low-avidity PRI-CTLs did not upregulate annexin V after coincubation with either HLA-A2* or HLA-A2- CML BM cells. FIG. 17C - Overall MHC-I expression and proteinase 3 expression was similar in both CML BM target cells, as measured by surface staining with pan-HLA-AB,C Ab. FIG. 17D - Proteinase 3 expression was 2.8- and 3.3-fold 30 higher in the HLA-A2+ and the HLA-A2- patient BM, respectively, compared with healthy donor BM cells. FIG. 18. High avidity PR1-CTL in IFN-sensitive CML patients off therapy. FIG. 19. PR1-CTL phenotype in CML patients in CCR off interferon: High avidity PR1 CTL have an effector memory phenotype. 1 1 WO 2005/019435 PCT/US2004/027790 FIG. 20. PRI vaccine elicits PRI-CTL immunity at injection site. FIG. 21. PRI vaccine induces immune responses and clinical responses. FIG. 22. PR1 vaccine induces PR1-CTL immunity and molecular remission in UPN4 with AML. The fraction of functional PRI-CTL vs pp65-CTL is similar in CMV* patients with 5 an immune response to the PRI vaccine. FIG. 23. PR1 vaccine elicits functional PR1-CTL immunity that persiste beyond 6 months. UPN9: PBMC analyzed six months after 3 rd injection of PR1 (1.0 mg) for tetramer+ and CD69/IFN* PR1-CTL. FIGS. 24A-24B. In UPN4 patient with AML t(15;17) long term molecular remission 10 after vaccine-induced expansion of PR1-CTL was test (FIG. 24A) and vaccine-induced PR1 CTL was shown to preferentially kill leukemia cells (FIG. 24B). FIG. 25. PR1 vaccine induces molecular remission in UPNI 5 patient with inv(16) AML. FIG. 26. Clinical response correlates with immune response and higher T Cell Receptor avidity of PRI-CTL. The data shows 5 clinical responses in 8 patients with immune response 15 versus 0 clinical responses in 7 patients without immune response. p = 0.02. FIGS. 27A-27D. High avidity PR1-CTL are preferentially lost after vaccination and remaining low avidity PR1-CTL specifically, kill autologous leukemia cells in UPN6 patient. FIG. 27A - Using sample from patient 6 (UPN 6) percent antigens specific CTL was assessed. FIG. 27B - Pre and Post-vaccine. FIG. 27C - PR1/A2 Tetramer-Sorted CTL Are Peptide 20 Specific. FIG. 27D - Tetramer-Sorted PR1-CTL Preferentially Kill CML. FIG. 28. High affinity PRl-CTL are absent in UPN 6 after vaccination. UPN6 (CML) and UPN4 (AML) patient samples are compared 30 days post-PR1 at 200 ptM and 0.2 pM. High PR1-CTL avidity was found to be expanded in UPN4 but not UPN6I patient. FIGS. 29A-29B. PR1-CTL immunity at day 60 correlates with remission at 1 year after 25 NST for AML. FIG. 30. Efficiency of various APC populations to elicit CTL. Cell count comparison of CTL cultures elicited with PR1 -pulsed T2 DC/IGM or DC/4GM antigen presenting cells. FIGS. 31A-31B. Cytotoxicity comparison of PRl-CTL elicited with various APCs. Percent specific lysis for T2 alone versus T2 + PRI in DC/IGM (FIG. 31A) or DC/4GM (FIG. 30 31B) antigen presenting cells is shown. FIG. 32. Comparison of DC growth conditions on CTL stimulation. Cell proliferation of PRi -CTL lines stimulated with autologous DC/IGM under various culture conditions is shown. FIGS. 33A-33C. IFN-Induced P3 expression correlates with PR1-CTL response and CCR to IFN. 17 WO 2005/019435 PCT/US2004/027790 FIG. 34. Five MPO-Deduced Peptides Bind to HLA-A2.1. FIG. 35. MY2-Specific CTL Kill Leukemia Cells and Also Healthy Donor Marrow Cells. FIG. 36. MY4-Sepcific CTL Preferentially Kill AML Bone Marrow Cells And Not 5 Healthy Bone Marrow Cells. FIG. 37. MY4-Specific CTL Lysis of MY4-Pulsed T2 Cells is HLA-A2-Restricted. FIG. 38. MY4-CTL Inhibit Leukemia Progenitors. FIG. 39. MPO Protein is Present in CD34 Leukemia Cells, but not Normal CD34+ Cells. 10 FIG. 40. Tissue Expression of Myeloperoxidase. FIG. 41. Multiple Peptide/HLA-A2-Tetramers Can Be Used To Simultaneously Stain Single Patient Samples. FIG. 42. PR1-, MY2- & MY4-CTL Are Not Present In Healthy Donors Or NST Recipients With Lymphoid Malignancies. 15 FIG. 43. PR1-CTL & MY4-CTL, But No MY2-CTL, Are Detectable In Nonmyeloablative Stem Cell Transplant (NST) Recipients In Complete Remission. FIG.44. Percentage of PR1-TL, MY4-CTL & HAl-CTL All Correlate with Remission Status. FIG. 45. PR1 -CTL Kill Leukemia but not Normal Marrow. 20 FIG. 46. PR1-CTL Lysis of Targets is HLA-A2-Restricted. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS I. The Present Invention The present invention serves to overcome the deficiencies in the art by providing HLA 25 restricted peptides, derived from myeloid self-proteins, that can be used to elicit peptide-reactive CTL that preferentially target mycloid leukemia. These peptides and the peptide-reactive CTL will be used in vaccines or as adoptive cellular immunotherapy, to treat patients with myeloid leukemia. The findings of the present invention suggest that the PR1 peptide is an important tumor 30 antigen for CTL immune responses against this forn of leukemia, and provide the first direct evidence that an antigen-specific T cell response contributes to its control. PRl-specific CTL are found in the majority of patients that achieve remission with IFN-ca2b therapy or with allogeneic BMT, therapies thought to potentially work through an immune mechanism. The inventors have shown that normal healthy donors have existent CTL immunity to PRI and that CML patients 1'2 WO 2005/019435 PCT/US2004/027790 who have a cytogenetic remission after treatment with interferon also have effective PRI specific CTL immunity toward their leukemia cells, while patients without cytogenetic responses do not, thus establishing PR1 as the first leukemia-associated tumor antigen. The present invention also seeks to determine whether vaccination with PRI peptide can enhance immunity 5 toward leukemia, whether the responding T lymphocytes are memory or naYve, and whether the PRI -specific CTL exhibit T cell receptors (TCRs) with higher or lower affinity for PR1/HLA-A2 compared to healthy individuals. In other aspects of the present invention the in vivo relevance of MY2 and MY4 as leukemia antigens is examined since the peptides were identified using in vitro techniques. Pre 10 existing MY2 and MY4 reactivity by CTL in leukemia patients and their HLA-matched marrow donors will also be examined. The present invention will determine whether MY2- and MY4 specific CTL can be elicited in vitro from leukemia patients using the established methods for eliciting similar responses in normal donors. In the present invention, there is also provided a phase I clinical trial to adoptively transfer MY4-specific CTL to acute myeloid leukemia patients 15 following NST as a way to enhance GVL while abrogating GVHD. Ways to enhance MY4 responses in vitro will also be assessed, and the remainder of the HLA-A2.1 -restricted, HLA-A3 restricted, and HLA-B7-restricted peptides from MPO with predicted high MHC binding will be examined for their capacity to elicit myeloid leukemia-reactive CTL responses similar to MY4 and PRI. 20 I. Definitions The phrases "isolated" or "biologically pure" refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state. Thus, isolated peptides in accordance with the invention preferably do not contain 25 materials normally associated with the peptides in their in situ environment. "Major histocompatibility complex" or "MHC" is a cluster of genes that plays a role in control of the cellular interactions responsible for physiologic immune responses. In humans, the MHC complex is also known as the HLA complex. For a detailed description of the MHC and HLA complexes (see Paul, 1993). 30 "Human leukocyte antigen" or "HLA" is a human class I or class II major histocompatibility complex (MHC) protein (see, e.g., Stites, 1994). An "HLA supertype or family", as used herein, describes sets of HLA molecules grouped on the basis of shared peptide-binding specificities. HLA class I molecules that share somewhat similar binding affinity for peptides bearing certain amino acid motifs are grouped into HLA 1I WO 2005/019435 PCT/US2004/027790 supertypes. The terms HLA superfamily, HLA supertype family, HLA family, and HLA xx-like supertype molecules (where xx denotes a particular HLA type), are synonyms. The tenn "motif' refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to 5 about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule. Peptide motifs are typically different for each protein encoded by each human HLA allele and differ in the pattern of the primary and secondary anchor residues. A "supermotif' is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Thus, a preferably is recognized with high or intermediate affinity (as 10 defined herein) by two or more HLA antigens. "Cross-reactive binding" indicates that a peptide is bound by more than one HLA molecule; a synonym is degenerate binding. A "protective immune response" refers to a CTL and/or an HTL response to an antigen derived from an infectious agent or a tumor antigen, which prevents or at least partially arrests 15 disease symptoms or progression. The immune response may also include an antibody response which has been facilitated by the stimulation of helper T cells. 11. HLA-Restricted Peptides The present provides a vaccine comprising a tumor associated HLA restricted peptide. 20 "Human leukocyte antigen" or "HLA" is a human class I or class II major histocompatibility complex (MHC) protein (see, e.g., Stites, 1994). An "HLA supertype or family", as used herein, describes sets of HLA molecules grouped on the basis of shared peptide-binding specificities. HLA class I molecules that share somewhat similar binding affinity for peptides bearing certain amino acid motifs are grouped into HLA supertypes. The terms HLA superfamily, HLA 25 supertype family, HLA family, and HLA xx-like supertype molecules (where xx denotes a particular HLA type), are synonyms. HLA-restricted molecules of the present invention may include HLA-A2, HLA-A3, HLA-A1 1, HLA-B7, HLA-B27, or HLA-B35; but are not limited to such. HLA-restricted antigens/peptides include, but are not limited to: 707 alanine proline 30 (707-AP); alpha (a)-fetoprotein (AFP); adenocarcinoma antigen recognized by T cells 4 (ART 4); B antigen (BAGE); p-catenin/n, p-catenin/mutated; breakpoint cluster region-Abelson (Bcr abl); CTL-recognized antigen on melanoma (CAMEL); carcinoembryonic antigen peptide - 1 (CAP-i); caspase-8 (CASP-8); cell-division-cycle 27 mutated (CDC2 7m); cycline-dependent kinase 4 mutated (CDK4/m); carcinoembryonic antigen (CEA); cancer/testis (antigen) (CT); WO 2005/019435 PCT/US2004/027790 cyclophilin B (Cyp-B); differentiation antigen melanoma (the epitopes of DAM-6 and DAM-10 are equivalent, but the gene sequences are different. DAM-6 is also called MAGE-B2 and DAM 10 is also called MAGE-B1) (DAM); elongation factor 2 mutated (ELF2M); Ets variant gene 6/acute myeloid leukemia 1 gene ETS (ETV6-AM1); glycoprotein 250 (G250); G antigen 5 (GAGE); N-acetylglucosaminyltransferase V (GnT-V); glycoprotein 100 Kd (Gp1OO); helicose antigen (HAGE); human epidermal receptor-2/neurological (HER-2/neu); arginine (R) to isoleucine (I) exchange at residue 170 of the a-helix of the a2-domain in the HLA-A2 gene (HLA-A *0201-R1 701); human papilloma virus E7 (HPV-E7); heat shock protein 70 - 2 mutated (HSP70-2M); human signet ring tumor - 2 (HST-2); human telomerase reverse transcriptase 10 (hTERT or hTRT); intestinal carboxyl esterase (iCE); name of the gene as it appears in databases (KIAA0205); L antigen (LAGE); low density lipid receptor/GDP-L-fucose (LDLR/FUT); p-D galactosidase 2-a-L-fucosyltransferase; melanoma antigen (MAGE); melanoma antigen recognized by T cells-i/Melanoma antigen A (MART-1/Melan-A); melanocortin 1 receptor (MC1R); myosin mutated (Myosin/nz); mucin 1 (MUC1); melanoma (MUM-1, -2, -3); ubiquitous 15 mutated 1, 2, 3; NA cDNA clone of patient M88 (NA88-A); New York - esophageous 1 (NY ESO-1); protein 15 (P15); protein of 190 (p190 minor bcr-abl); KD bcr-abl; promyelocytic leukaemia/retinoic acid receptor a (Pml/RARa); preferentially expressed antigen of melanoma (PRAME); prostate-specific antigen (PSA); prostate-specific membrane antigen (PSM); renal antigen (RAGE); renal ubiquitous 1 or 2 (RU1 or RU2); sarcoma antigen (SAGE); squamous 20 antigen rejecting tumor 1 or 3 (SART-1 or SART-3); translocation Ets-family leukemia/acute myeloid leukemia 1 (TEL/AML1); triosephosphate isomerase mutated (TPI/m); tyrosinase related protein 1, or gp75 (TRP-1); tyrosinase related protein 2 (TRP-2); TRP-2/intron 2 (TRP-2/INT2); Wilms' tumor gene (WT1) or any such HLA-restricted antigen or peptide known to one of ordinary in the art. 25 In particular embodiments, the present invention contemplates the use of HLA-restricted peptide for treating cancers. IV. Myeloid-Restricted Antigens To adapt what has been learned about immunity against melanoma antigens to the study 30 of myeloid leukemia antigens, myeloid-restricted normal proteins that are highly expressed in the leukemia are studied. Myeloid leukemias express a number of differentiation antigens associated with granule formation. These antigens may include proteinease-3 (Pr3 or P3), neutrophil elastase, myeloperoxidase, cylcin El, cyclin D, or a cyclin E2; but are not limited to such.

WO 2005/019435 PCT/US2004/027790 Particular examples of myeloid-restricted peptides, such as Pr3 and myeloperoxidase, are provided herein. P3 and two other azurophil granule proteins, neutrophil elastase and azurocidin, are coordinately regulated and the transcription factors PU. 1 and C/EBPt, which are responsible for 5 normal myeloid differentiation from stem cells to monocytes or granulocytes, are important in mediating their expression (Lewin et al., 2002). These transcription factors have been implicated in leukemogenesis (Behre et al., 1999), and P3 itself may also be important in maintaining a leukemia phenotype since P3 antisense oligonucleotides halt cell division and induce maturation of the HL-60 promyelocytic leukemia cell line (Bories et aL., 1989). Critical 10 to identifying T cell antigens in these proteins is the observation that P3 is the target of autoimmune attack in Wegener's granulomatosis (Franssen et al., 1994). A. Proteinase3 Peptides and Vaccines Pr3 is a 26 kDa neutral seine protease that is stored in primary azurophil granules and is 15 maximally expressed at the promyelocyte stage of myeloid differentiation (Sturrock et al., 1992; Chen et al., 1994; Muller-Berat et al., 1994; Lewin et al., 2002; Behre et al., 1999). The human gene contains 5 exons, is localized on chromosome 19p and has been cloned (Sturrock et al., 1992). Pr3 is overexpressed in a variety of mycloid leukemia cells including 75% of CML patients, approximately 50% of acute myeloid leukemia patients, and approximately 30% of the 20 cases of myelodysplastic syndrome patients (Dengler et al., 1995). Pr3 also has several characteristics that make it an appealing target for vaccine and T cell directed therapy. It is overexpressed in human myeloid leukemia and is generally homogeneous throughout the leukemia. An immune response generated against the antigen could result in complete eradication of the leukemia. Since Pr3 may be important for maintenance of the 25 leukemia phenotype, any selective pressure resulting in Pr3-loss mutants following immunotherapy may not result in "tumor escape." As a protein that is targeted to the endoplasmic reticulum by means of a pre-propeptide leader sequence, any TAP-deficient tumor mutants might remain susceptible to an anti-leukemia immune response since the protein would still be available to the MHC class I antigen processing pathway. Additionally, the use of a 30 synthetic peptide derived from Pr3 as the immunizing antigen in a leukemia vaccine offers practical advantages: relatively easy construction and production, chemical stability, and a lack of infectious or oncogenic potential. It has been shown that a small peptide called PR1, a portion of the larger molecule of proteinase 3 (P3) found in myeloid leukemia cells, can be used to generate immune cells, 117 WO 2005/019435 PCT/US2004/027790 particularly, cytotoxic T lymphocytes (CTL). PRI is a 9 aa peptide comprising amino acid 169 177, that binds to HLA-A2.1, thereby eliciting CTL from an HLA-A2.1+ normal donor in vitro. These PR1-specific CTL show preferential cytotoxicity toward allogeneic HLA-A2.1+ myeloid leukemia cells over HLA-identical normal donor marrow (Molldrem et al., 1996). PRI -specific 5 CTL also inhibit colony-forming unit granulocyte-macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA-matched donors (Molldrem et al., 1997). These CTL, generated from normal healthy donors, preferentially kill leukemia cells while leaving normal bone marrow cells unharmed. More recently, it was found that CML patients who enter remission after treatment with either BMT or interferon have highly increased 10 numbers of very effective PRI-specific CTL that kill their leukemia cells. PR1 is therefore the first peptide antigen identified that can elicit specific CTL lysis of fresh human myeloid leukemia cells. B. Myeloperoxidase (MPO) Peptides and Vaccines 15 The invention also provides peptides of myeloperoxidase (MPO), another myeloid-, restricted protein, which is a heme protein synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains (Franssen et al., 20 1996). This enzyme produces hypohalous acids central to the microbicidal activity of netrophils. Importantly, MPO (like Pr3) is overexpressed in a variety of myeloid leukemia cells including 75% of CML patients, approximately 50% of. acute myeloid leukemia patients, and approximately 30% of the cases of myelodysplastic syndrome patients (Williams et al., 1994). While Pr3 is the target of autoimmune attack in Wegener's granulomatosis MPO is the target 25 antigen in small vessel vasculitis (Franssen et al., 1996; Brouwer et al., 1994; Molldrem et al., 1996) respectively, with evidence for both T-cell and antibody immunity in patients with these diseases. Wegener's granulomatosis is associated with production of cytoplasmic antineutrophil cytoplasmic antibodies (cANCA) with specificity for Pr3 (Molldrem et al., 1997), while microscopic polyangiitis and Churg-Strauss syndrome are associated with perinuclear ANCA 30 (pANCA) with specificity for MPO (Molldrem et al., 1999; Savage et al., 1999). T-cells taken from such leukemia patients proliferate in response to crude extracts from neutrophil granules and to the purified proteins (Brouwer et al., 1994; Yee et al., 1999). These findings (summarized in Table 1) indicate that T cell responses against these proteins might be relatively easy to elicit. 1 2 WO 2005/019435 PCT/US2004/027790 Table 1: T cell Responses Myeloperoxidase (MPO) - Granule protein of 80kD, gene on chromosome 17q - Target antigen of the pANCA antibody in small vessel - Vasculitis, Churg-Strauss syndrome, and crescentic Glomerulonephritis - Expressed in very early myeloid progenitors - Most abundant protein in myeloid cells - Aberrantly expressed in CD34+ myeloid leukemia cells (MDS, AML & CML) V. Tumor-Associated HLA-Restricted Peptides and Vaccines In certain embodiments, the present invention concerns tumor-associated HLA-restricted 5 peptide or antigen compositions comprising at least one HLA-restricted peptide, such as proteinase3 (P3 or Pr3) or myeloperoxidase (MYO) for use as a vaccine in treating cancers. As used herein, an "antigenic composition" may comprise an antigen (e.g., a peptide or polypepide), a nucleic acid encoding an antigen (e.g., an antigen expression vector), or a cell expressing or presenting an antigen. For an antigenic composition, such as a tumor-associated 10 HLA-restricted peptide or antigen of the present invention, to be useful as a vaccine, the antigenic composition must induce an immune response to the antigen in a cell, tissue or animal (e.g., a human). In particular embodiments, the antigenic composition comprises or encodes all or part of the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, 15 SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ 20 ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, or an immunologically functional equivalent thereof 25 As used herein, an "amino acid molecule" or "amino acid residue" refers to any naturally occurring amino acid, any amino acid derivative or any amino acid mimic known in the art, including modified or unusual amino acids. In certain embodiments, the residues of the protein or peptide are sequential, without any non-amino acid interrupting the sequence of amino acid 10 WO 2005/019435 PCT/US2004/027790 residues. In other embodiments, the sequence may comprise one or more non-amino acid moieties. In particular embodiments, the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties. In specific aspects, the composition of the present invention employs a peptide of from about 5 to about 100 amino acids or greater in 5 length. Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides. The nucleotide and protein, polypeptide and peptide sequences 10 corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's Genbank and GenPept databases located at the National Institutes of Health website. The coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be know to those of ordinary 15 skill in the art. Alternatively, various commercial preparations of proteins, polypeptides and peptides are known to those of skill in the art. The term "peptide" is used interchangeably with "oligopeptide" in the present specification to designate a series of residues, typically L-amino acids, connected one to the other, typically by peptide bonds between the a-amino and carboxyl groups of adjacent amino 20 acids. The preferred CTL-inducing oligopeptides of the invention are 13 residues or less in length and usually consist of between about 8 and about 11 residues, preferably 9 or 10 residues. The preferred HTL-inducing oligopeptides are less than about 50 residues in length and usually consist of between about 6 and about 30 residues, more usually between about 12 and 25, and often between about 15 and 20 residues. 25 In certain embodiments the size of the at least one peptide molecule may comprise, but is not limited to, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 30 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 60, or greater amino molecule residues, and any range derivable therein. An "immunogenic peptide" or "peptide epitope" is a peptide which comprises an allele specific motif or supermotif such that the peptide will bind an HLA molecule and induce a CTL and/or HTL response. Thus, immunogenic peptides of the invention are capable of binding to an 20 WO 2005/019435 PCT/US2004/027790 appropriate HLA molecule and thereafter inducing a cytotoxic T cell response, or a helper T cell response, to the antigen from which the immunogenic peptide is derived. Accordingly, the term "proteinaceous composition" encompasses amino molecule sequences comprising at least one of the 20 common amino acids in naturally synthesized 5 proteins, or at least one modified or unusual amino acid, including but not limited to those shown on Table 2 below. Table 2: Modified and Unusual Amino Acids Abbr. Amino Acid Abbr. Amino Acid Aad 2-Aminoadipic acid EtAsn N-Ethylasparagine Baad 3- Aminoadipic acid Hyl Hydroxylysine Bala 2-alanine, -Amino-propionic acid Ahyl Allo-Hydroxylysine Abu 2-Aminobutyric acid 3Hyp 3-Hydroxyproline 4Abu 4- Aminobutyric acid, piperidinic acid 4fyp 4-Hydroxyproline Acp 6-Aminocaproic acid Ide Isodesmosine Ahe 2-Aminoheptanoic acid Aile Allo-Isoleucine Aib 2-Aminoisobutyric acid MeGly N-Methylglycine, sarcosine Baib 3-Aminoisobutyric acid Mele N-Methylisoleucine Apm 2-Aminopimelic acid MeLys 6-N-Methyllysine Dbu 2,4-Diaminobutyric acid MeVal N-Methylvaline Des Desmosine Nva Norvaline Dpm 2,2'-Diaminopimelic acid Nle Norleucine Dpr 2,3-Diaminopropionic acid OM Omnithine EtGly N-Ethylglycine In certain embodiments the proteinaceous composition comprises at least one protein, 10 polypeptide or peptide. In further embodiments the proteinaceous composition comprises a biocompatible protein, polypeptide or peptide. As used herein, the term "biocompatible" refers to a substance which produces no significant untoward effects when applied to, or administered to, a given organism according to the methods and amounts described herein. Such untoward or undesirable effects are those such as significant toxicity or adverse immunological reactions. In 15 preferred embodiments, biocompatible protein, polypeptide or peptide containing compositions 21 WO 2005/019435 PCT/US2004/027790 will generally be mammalian proteins or peptides or synthetic proteins or peptides each essentially free from toxins, pathogens and harmful immunogens. In certain embodiments a proteinaceous compound may be purified. Generally, "purified" will refer to a specific or protein, polypeptide, or peptide composition that has been 5 subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as would be known to one of ordinary skill in the art for the specific or desired protein, polypeptide or peptide. In certain embodiments, the proteinaceous composition may comprise at least one 10 antibody, for example, an antibody against PR1 or myeloperoxidase. As used herein, the tenn "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. 15 The tenn "antibody" is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab') 2 , single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (See, e.g., Harlow et al., 20 1988; incorporated herein by reference). It is contemplated that virtually any protein, polypeptide or peptide containing component may be used in the compositions and methods disclosed herein. However, it is preferred that the proteinaceous material is biocompatible. In certain embodiments, it is envisioned that the formation of a more viscous composition will be advantageous in that will 25 allow the composition to be more precisely or easily applied to the tissue and to be maintained in contact with the tissue throughout the procedure. In such cases, the use of a peptide composition, or more preferably, a polypeptide or protein composition, is contemplated. Ranges of viscosity include, but are not limited to, about 40 to about 100 poise. In certain aspects, a viscosity of about 80 to about 100 poise is preferred. 30 A. Fusion Proteins of HLA-Restiricted Peptides A specialized kind of insertional variant is the fusion protein. This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide. For example, fusions typically employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host. Another

?I)

WO 2005/019435 PCT/US2004/027790 useful fusion includes the addition of an immunologically active domain, such as an antibody epitope, to facilitate purification of the fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification. Other useful fusions include linking of functional domains, such as active sites from enzymes such as a 5 hydrolase, glycosylation domains, cellular targeting signals or transmembrane regions. B. Variants of HLA-Restiricted Peptides It is contemplated that peptides of the present invention may further employ amino acid sequence variants such as substitutional, insertional or deletion variants. Deletion variants lack one or more residues of the native protein. Insertional mutants typically involve the addition of 10 material at a non-terminal point in the polypeptide. Substitutions are changes to an existing amino acid. These sequence variants may generate truncations, point mutations, and frameshift mutations. As is known to one skilled in the art, synthetic peptides can be generated by these mutations. It also will be understood that amino acids sequence variants may include additional 15 residues, such as additional N- or C-terminal amino acids, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological activity. The following is a discussion based upon changing the amino acids of a protein, such as a HLA-restricted peptide or protein of the invention, to create a mutated, truncated, or modified 20 protein. For example, certain amino acids may be substituted for other amino acids in the tumor associated HLA-restricted peptide or protein such as a Pr3 or MYO protein, resulting in a greater CTL immune response in cells such as a myeloid cell. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying nucleic acid coding 25 sequence, thereby producing a mutated, truncated or modified protein. In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring interactive biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the 30 resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like. It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Patent 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the

?I

WO 2005/019435 PCT/US2004/027790 hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Patent 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ± 1), glutamate (+3.0 + 1), asparagine (+0.2), and glutamine (+0.2); 5 hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline ( 0.5 + 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3). 10 It is understood that an amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ± 2 is preferred, those that are within ± 1 are particularly preferred, and those within + 0.5 are even more particularly preferred. 15 As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, 20 leucine and isoleucine. The present invention may also employ the use of peptide mimetics for the preparation of polypeptides (see e.g., Johnson, 1993) having many of the natural properties of a tumor associated HLA-restricted peptide such as Pr3 or MYO protein, but with altered and/or improved characteristics. The underlying rationale behind the use of peptide mimetics is that the peptide 25 backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen. These principles may be used, in conjunction with the principles outline above, to engineer second generation molecules having many of the natural properties of a tumor-associated HLA-restricted peptide but with altered and even improved characteristics. 30 C. Tumor-Associated HLA-Restricted Peptide Purification In certain embodiments the protein(s) of the present invention may be purified. It may be desirable to purify the tumor-associated HLA-restricted peptides, polypeptides or proteins or variants thereof. The term "purified protein or peptide" as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any

')A

WO 2005/019435 PCT/US2004/027790 degree relative to its naturally-obtainable state. A purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur. Generally, "purified" will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition 5 substantially retains its expressed biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. Protein purification techniques are well known to those of skill in the art. These 10 techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation of a pure peptide are ion-exchange 15 chromatography, exclusion chromatography; polyacrylamide gel electrophoresis; isoelectric focusing. Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques. 20 In purifying a tumor-associated HLA-restricted peptide of the present invention, it may be desirable to express the polypeptide in a prokaryotic or eukaryotic expression system and extract the protein using denaturing conditions. The polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. Although this preparation will be purified in an inactive form, the denatured 25 material will still be capable of transducing cells. Once inside of the target cell or tissue, it is generally accepted that the polypeptide will regain full biological activity. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide. 30 Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. Another method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific WO 2005/019435 PCT/US2004/027790 activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed protein or peptide exhibits a detectable activity. 5 It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al., 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary. VI. HLA-Restricted Antigenic Sequences 10 It is also contemplated in the present invention that peptides corresponding to one or more antigenic determinants of the tumor-associated HLA-restricted peptides or polypeptides may be prepared so that an immune response against the tumor-associated HLA-restricted peptides, polypeptides or proteins, such as Pr3 or MYO is raised. Thus, it is contemplated that vaccination with a tumor-associated HLA-restricted peptides, or polypeptides, may generate an 15 autoimmune response in an immunized animal such that autoantibodies that specifically recognize the animal's endogenous tumor-associated HLA-restricted protein. This vaccination technology is shown in U.S. Patents 6,027,727; 5,785,970, and 5,609,870, which are hereby incorporated by reference. Such peptides should generally be at least five or six amino acid residues in length and 20 will preferably be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or about 30 amino acid residues in length, and may contain up to about 35-50 residues. For example, these peptides may comprise a amino acid sequence, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, and 50 or more contiguous amino acids from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ 25 ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, 30 SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61. Synthetic peptides will generally be about 35 residues long, which is the approximate upper length limit of automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA). Longer peptides also may be prepared, e.g., by recombinant means.

WO 2005/019435 PCT/US2004/027790 U.S. Patent 4,554,101, incorporated herein by reference, teaches the identification and preparation of epitopes from Primary amino acid sequences on the basis of hydrophilicity. Through the methods disclosed in Hopp, one of skill in the art would be able to identify epitopes from within an amino acid sequence such as the tumor-associated HLA-restricted peptides 5 sequences disclosed herein in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:42, SEQ ID NO:43, SEQ ID 10 NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61. Numerous scientific publications have also been devoted to the prediction of secondary structure, and to the identification of epitopes, from analyses of amino acid sequences (Chou and 15 Fasman, 1974a, b; 1978a, b; 1979). Any of these may be used, if desired, to supplement the teachings of Hopp in U.S. Patent 4,554,101. Moreover, computer programs are currently available to assist with predicting antigenic portions and epitopic core regions of proteins. Examples include those programs based upon the Jameson-Wolf analysis (Jameson and Wolf, 1988; Wolf et al., 1988), the program PepPlot@ 20 (Brutlag et al., 1990; Weinberger et al., 1985), and other new programs for protein tertiary structure prediction (Fetrow and Bryant, 1993). Another commercially available software program capable of carrying out such analyses is MacVector (IBI, New Haven, CT). In further embodiments, major antigenic determinants of a tumor-associated HLA restricted peptide may be identified by an empirical approach in which portions of the gene 25 encoding the tumor-associated LILA-restricted peptides are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response. For example, PCRTM can be used to prepare a range of peptides lacking successively longer fragments of the C terminus of the protein. The immunoactivity of each of these peptides is determined to identify those fragments or domains of the polypeptide that are immunodominant. Further studies in 30 which only a small number of amino acids are removed at each iteration then allows the location of the antigenic determinants of the polypeptide to be more precisely determined. Another method for determining the major antigenic determinants of a polypeptide is the SPOTs system (Genosys Biotechnologies, Inc., The Woodlands, TX). In this method, overlapping peptides are synthesized on a cellulose membrane, which following synthesis and WO 2005/019435 PCT/US2004/027790 deprotection, is screened using a polyclonal or monoclonal antibody. The antigenic determinants of the peptides which are initially identified can be further localized by performing subsequent syntheses of smaller peptides with larger overlaps, and by eventually replacing individual amino acids at each position along the immunoreactive peptide. 5 Once one or more such analyses are completed, polypeptides are prepared that contain at least the essential features of one or more antigenic determinants. The peptides are then employed in the generation of antisera against the polypeptide. Minigenes or gene fusions encoding these determinants also can be constructed and inserted into expression vectors by standard methods, for example, using PCRTM cloning methodology. 10 The use of such small peptides for antibody generation or vaccination typically requires conjugation of the peptide to an immunogenic carrier protein, such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin, or other adjuvants discussed above (adjuvenated peptide). Alum is an adjuvant that has proven sufficiently non-toxic for use in humans. Methods for performing this conjugation are well known in the art. Other 15 immunopotentiating compounds are also contemplated for use with the compositions of the invention such as polysaccharides, including chitosan, which is described in U.S. Patent 5,980,912, hereby incorporated by reference. Multiple (more than one) tumor-associated HLA restricted epitopes may be crosslinked to one another (e.g., polymerized). Alternatively, a nucleic acid sequence encoding a tumor-associated HLA-restricted peptides, or polypeptides 20 may be combined with a nucleic acid sequence that heightens the immune response. Such fusion proteins may comprise part or all of a foreign (non-self) protein such as bacterial sequences, for example. Antibody titers effective to achieve a response against endogenous tumor-associated HLA-restricted peptides, or polypeptides will vary with the species of the vaccinated animal, as 25 well as with the sequence of the administered peptide. However, effective titers may be readily determined, for example, by testing a panel of animals with varying doses of the specific antigen and measuring the induced titers of autoantibodies (or anti-self antibodies) by known techniques, such as ELISA assays, and then correlating the titers with a related cancer characteristics, e.g., tumor growth or size. 30 One of ordinary skill would know various assays to determine whether an immune response against a tumor-associated HLA-restricted peptide was generated. The phrase "immune response" includes both cellular and humoral immune responses. Various B lymphocyte and T lymphocyte assays are well known, such as ELISAs, cytotoxic T lymphocyte (CTL) assays, such as chromium release assays, proliferation assays using peripheral blood lymphocytes (PBL), WO 2005/019435 PCT/US2004/027790 tetramer assays, and cytokine production assays. See Benjamini et al. (1991), hereby incorporated by reference. VIL Vaccine Components In other embodiments of the invention, the antigenic composition, such a tumor 5 assoicated HLA-restricted peptide or antigen, may comprises an additional immunostimulatory agent or nucleic acids encoding such an agent. Immunostimulatory agents include but are not limited to an additional antigen, an immunomodulator, an antigen presenting cell or an adjuvant. In other embodiments, one or more of the additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination. In certain embodiments, the antigenic 10 composition is conjugated to or comprises an HLA anchor motif amino acids. A. Adjuvants As also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, 15 known as adjuvants. .Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Patent 4,877,611). Immunization protocols have used adjuvants to stimulate responses for many years, and as such adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are 20 precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation. For many cancers, there is compelling evidence that the immune system participates in host defense against the tumor cells, but only a fraction of the likely total number of tumor-specific antigens are believed to have been identified to date. The use of the tumor associated HLA-restricted antigens of the present invention with the inclusion of a suitable 25 adjuvant will likely increase the anti-tumor response of the antigens. S uitable molecule adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions. Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete 30 Freund's adjuvants and aluminum hydroxide adjuvant. Other adjuvants that may also be used include IL-1, IL-2, IL-4, IL-7, IL-12, - interferon, GMCSP, BCG, aluminum hydroxide, MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL). RIBI, which contains three components extracted from bacteria, MPL, trehalose ,a WO 2005/019435 PCT/US2004/027790 dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion also is contemplated. MHC antigens may even be used. In one aspect, an adjuvant effect is achieved by use of an agent, such as alum, used in about 0.05 to about 0.1% solution in phosphate buffered saline. Alternatively, the antigen is 5 made as an admixture with synthetic polymers of sugars (Carbopol@) used as an about 0.25% solution. Adjuvant effect may also be made my aggregation of the antigen in the vaccine by heat treatment with temperatures ranging between about 70 to about 101 0 C for a 30 second to 2 minute period, respectively. Aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, mixture with bacterial cell(s) such as C. parvun, an endotoxin or a lipopolysaccharide 10 component of Gram-negative bacteria, emulsion in physiologically acceptable oil vehicles, such as mannide mono-oleate (Aracel A), or emulsion with a 20% solution of a perfluorocarbon (Fluosol-DA@) used as a block substitute, also may be employed. Some adjuvants, for example, certain organic molecules obtained from bacteria, act on the host rather than on the antigen. An example is muramyl dipeptide (N-acetylmuramyl 15 L-alanyl-D-isoglutamine [MDP]), a bacterial peptidoglycan. The effects of MDP, as with most adjuvants, are not fully understood. MDP stimulates macrophages but also appears to stimulate B cells directly. The effects of adjuvants, therefore, are not antigen-specific. If they are administered together with a purified antigen, however, they can be used to selectively promote the response to the antigen. 20 In certain embodiments, hemocyanins and hemoerythrins may also be used in the invention. The use of hemocyanin from keyhole limpet (KLH) is preferred in certain embodiments, although other molluscan and arthropod hemocyanins and hemoerythrins may be employed. Various polysaccharide adjuvants may also be used. For example, the use of various 25 pneumococcal polysaccharide adjuvants on the antibody responses of mice has been described (Yin et al., 1989). The doses that produce optimal responses, or that otherwise do not produce suppression, should be employed as indicated (Yin et al, 1989). Polyamine varieties of polysaccharides are particularly preferred, such as chitin and chitosan, including deacetylated chitin. 30 Another group of adjuvants are the muramyl dipeptide (MDP, N-acetylmuramyl L-alanyl-D-isoglutamine) group of bacterial peptidoglycans. Derivatives of muramyl dipeptide, such as the amino acid derivative threonyl-MDP, and the fatty acid derivative MTPPE, are also contemplated.

WO 2005/019435 PCT/US2004/027790 U.S. Patent 4,950,645 describes a lipophilic disaccharide-tripeptide derivative of muramyl dipeptide which is described for use in artificial liposomes formed from phosphatidyl choline and phosphatidyl glycerol. It is the to be effective in activating human monocytes and destroying tumor cells, but is non-toxic in generally high doses. The compounds of U.S. Patent 5 4,950,645 and PCT Patent Application WO 91/16347, are contemplated for use with cellular carriers and other embodiments of the present invention. BCG (bacillus Calmette-Guerin, an attenuated strain of Mycobacterium) and BCG-cell wall skeleton (CWS) may also be used as adjuvants, with or without trehalose dimycolate. Trehalose dimycolate may be used itself. Trehalose dimycolate administration has been shown 10 to correlate with augmented resistance to influenza virus infection in mice (Azuma et al., 1988). Trehalose dimycolate may be prepared as described in U.S. Patent 4,579,945. BCG is an important clinical tool because of its immunostimulatory properties. BCG acts to stimulate the reticulo-endothelial system, activates natural killer cells and increases proliferation of hematopoietic stem cells. Cell wall extracts of BCG have proven to have excellent immune 15 adjuvant activity. Molecular genetic tools and methods for mycobacteria have provided the means to introduce foreign genes into BCG (Jacobs et al., 1987; Snapper et al., 1988; Husson et al., 1990; Martin et al., 1990). Live BCG is an effective and safe vaccine used worldwide to prevent tuberculosis. BCG and other mycobacteria are highly effective adjuvants, and the immune response to mycobacteria has been studied extensively. With nearly 2 billion 20 immunizations, BCG has a long record of safe use in man (Luelmo, 1982; Lotte et al., 1984). It is one of the few vaccines that can be given at birth, it engenders long-lived immune responses with only a single dose, and there is a worldwide distribution network with experience in BCG vaccination. An exemplary BCG vaccine is sold as TICE BCG (Organon Inc., West Orange, NJ). 25 Amphipathic and surface active agents, e.g., saponin and derivatives such as QS21 (Cambridge Biotech), form yet another group of adjuvants for use with the immunogens of the present invention. Nonionic block copolymer surfactants (Rabinovich et al., 1994) may also be employed. Oligonucleotides are another useful group of adjuvants (Yamamoto et al., 1988). Quil A and lentinen are other adjuvants that may be used in certain embodiments of the present 30 invention. Another group of adjuvants are the detoxified endotoxins, such as the refined detoxified endotoxin of U.S. Patent 4,866,034. These refined detoxified endotoxins are effective in producing adjuvant responses in mammals. Of course, the detoxified endotoxins may be combined with other adjuvants to prepare multi-adjuvant-incorporated cells. For example, WO 2005/019435 PCT/US2004/027790 combination of detoxified endotoxins with trehalose dimycolate is particularly contemplated, as described in U.S. Patent 4,435,386. Combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids is also contemplated (U.S. Patent 4,505,899), as is combination of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose 5 dimycolate, as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900. Combinations of just CWS and trehalose dimycolate, without detoxified endotoxins, is also envisioned to be useful, as described in U.S. Patent 4,520,019. Those of skill in the art will know the different kinds of adjuvants that can be conjugated to cellular vaccines in accordance with this invention and these include alkyl lysophosphilipids 10 (ALP); BCG; and biotin (including biotinylated derivatives) among others. Certain adjuvants particularly contemplated for use are the teichoic acids from Grain-cells. These include the lipoteichoic acids (LTA), ribitol teichoic acids (RTA) and glycerol teichoic acid (GTA). Active forms of their, synthetic counterparts may also be employed in connection with the invention (Takada et al., 1995). 15 Various adjuvants, even those that are not commonly used in humans, may still be employed in animals, where, for example, one desires to raise antibodies or to subsequently obtain activated T cells. The toxicity or other adverse effects that may result from either the adjuvant or the cells, e.g., as may occur using non-irradiated tumor cells, is irrelevant in such circumstances. 20 Adjuvants may be encoded by a nucleic acid (e.g., DNA or RNA). It is contemplated that such adjuvants may be also be encoded in a nucleic acid (e.g., an expression vector) encoding the antigen, or in a separate vector or other construct. Nucleic acids encoding the adjuvants can be delivered directly, such as for example with lipids or liposomes. 25 B. Biological Response Modifiers In addition to adjuvants, it may be desirable to coadminister biologic response modifiers (BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, Cimetidine (CIM; 1200 mg/d) (Smith/Kline, PA); low-dose Cyclophosphamide (CYP; 300 mg/m2) (Johnson/ Mead, NJ), 30 cytokines such as -interferon, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.

WO 2005/019435 PCT/US2004/027790 C. Chemokines Chemokines, nucleic acids that encode for chemokines, and/or cells that express such also may be used as vaccine components. Chemokines generally act as chemoattractants to recruit immune effector cells to the site of chemokine expression. It may be advantageous to 5 express a particular chemokine coding sequence in combination with, for example, a cytokine coding sequence, to enhance the recruitment of other immune system components to the site of treatment. Such chemokines include, for example, RANTES, MCAF, MIP1-alpha, MIP1-Beta, IP-10 and combinations thereof. The skilled artisan will recognize that certain cytokines are also known to have chemoattractant effects and could also be classified under the term chemokines. 10 D. Immunogenic Carrier Proteins In certain embodiments, an antigenic composition may be chemically coupled to a carrier or recombinantly expressed with a immunogenic carrier peptide or polypetide (e.g., a antigen carrier fusion peptide or polypeptide) to enhance an immune reaction. Exemplary and preferred 15 immunogenic carrier amino acid sequences include hepatitis B surface antigen, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as immunogenic carrier proteins. Means for conjugating a polypeptide or peptide to a immunogenic carrier protein are well known in the art and include, for example, glutaraldehyde, m-maleimidobenzoyl-N-hydroxysnccinimide 20 ester, carbodiimide and bis-biazotized benzidine. VIU. Antibodies and Antibody Generation Another embodiment of the present invention are antibodies, in some cases, a human monoclonal antibody immunoreactive with the polypeptide sequence of a tumor-associated 25 HLA-restricted peptide of the invention comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID 30 NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61. It is also understood that this antibody is useful for screening samples from human patients for the purpose of detecting a particular tumor-associated HLA-restricted 2'2 WO 2005/019435 PCT/US2004/027790 peptide present in the samples. The antibody also may be useful in the screening of expressed DNA segments or peptides and proteins for the discovery of related antigenic sequences. In addition, the antibody may be useful in passive immunotherapy for cancer. All such uses of the antibodies and any antigens or epitopic sequences so discovered fall within the scope of the 5 present invention. Examples of other antibodies that may be employed in the present invention may include antibodies that react with T cells such as CD1, CD2, CD3, CD5, CD7 CD4, CD6, CD8 and CD27. Antibodies that react with myeloid cells may also be employed and include CD11b, CDllc, CD13, CD14, CD15, CD16, CD33, CD48, CD63, CD74, CD65, CD66, CD67 and 10 CD68. Antibodies that react with undifferentiated cells may include HLA-DR, CD34 and CD38. It should be appreciated that multiple combinations of antibodies selected from the ones mentioned above are possible. Accordingly, it will be apparent to one skilled in the art that one can vary the antibody combinations In certain embodiments, the present invention involves antibodies. For example, all or 15 part of a monoclonal, single chain, or humanized antibody may function as a vaccine for cancer. Other aspects of the invention involve administering antibodies as a fonn of treatment or as a diagnostic to identify or quantify a particular polypeptide, such as tumor-associated HLA restricted polypeptide, for example Pr3 or MYO polypeptide. As detailed above, in addition to antibodies generated against full length proteins, antibodies also may be generated in response to 20 smaller constructs comprising epitopic core regions, including wild-type and mutant epitopes. As used herein, the term "antibody" is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. 25 The term "antibody" is may also be used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody-based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (See, Harlow 30 and Lane, 1988; incorporated herein by reference). Monoclonal antibodies (niAbs) are recognized to have certain advantages, e.g., reproducibility and large-scale production, and their use is generally preferred. The invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin.

IA

WO 2005/019435 PCT/US2004/027790 The methods for generating monoclonal antibodies (mAbs) generally begin along the same lines as those for preparing polyclonal antibodies. Briefly, a polyclonal antibody may be prepared by immunizing an animal with an immunogenic polypeptide composition in accordance with the present invention and collecting antisera from that immunized animal. Alternatively, in 5 some embodiments of the present invention, serum is collected from persons who may have been exposed to a particular antigen. Exposure to a particular antigen may occur a work environment, such that those persons have been occupationally exposed to a particular antigen and have developed polyclonal antibodies to a peptide, polypeptide, or protein. In some embodiments of the invention polyclonal serum from occupationally exposed persons is used to identify antigenic 10 regions in the gelonin toxin through the use of immunodetection methods. A wide range of animal species can be used for the production of antisera. Typically the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies. 15 As is well known in the art, a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier. Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as carriers. Means 20 for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis biazotized benzidine. The amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature of the immunogen as well as the animal used for immunization. A variety 25 of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal). The production of polyclonal antibodies may be monitored by sampling blood of the immunized animal at various points following immunization. A second, booster injection also may be given. The process of boosting and titering is repeated until a suitable titer is achieved. When a desired level of immunogenicity is obtained, 30 the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate mAbs. mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference. Typically, this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a WO 2005/019435 PCT/US2004/027790 purified or partially purified polypeptide, peptide or domain, be it a wild-type or mutant composition. The immunizing composition is administered in a manner effective to stimulate antibody producing cells. mAbs may be further purified, if desired, using filtration, centrifugation and various 5 chromatographic methods such as HPLC or affinity chromatography. Fragments of the monoclonal antibodies of the invention can be obtained from the monoclonal antibodies so produced by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction. Alternatively, monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide 10 synthesizer. It also is contemplated that a molecular cloning approach may be used to generate mAbs. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this 15 approach over conventional hybridoma techniques are that approximately 104 times as many antibodies can be produced and screened 'in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies. Humanized monoclonal antibodies are antibodies of animal origin that have been 20 modified using genetic engineering techniques to replace constant region and/or variable region framework sequences with human sequences, while retaining the original antigen specificity. Such antibodies are commonly derived from rodent antibodies with specificity against human antigens. Such antibodies are generally useful for in vivo therapeutic applications. This strategy reduces the host response to the foreign antibody and allows selection of the human effector 25 functions. "Humanized" antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof. The techniques for producing humanized immunoglobulins are well known to those of skill in the art. For example 30 U.S. Patent 5,693,762 discloses methods for producing, and compositions of, humanized immunoglobulins having one or more complementarity determining regions (CDR's). When combined into an intact antibody, the humanized immunoglobulins are substantially non immunogenic in humans and retain substantially the same affinity as the donor immunoglobulin to the antigen, such as a protein or other compound containing an epitope. Examples of other WO 2005/019435 PCT/US2004/027790 teachings in this area include U.S. Patents 6,054,297; 5,861,155; and 6,020,192, all specifically incorporated by reference. Methods for the development of antibodies that are "custom-tailored" to the patient's disease are likewise known and such custom-tailored antibodies are also contemplated. 5 IX. Nucleic Acids Encoding HLA-Restricted Protein, Peptides and Polypeptides It is contemplated in the present invention, that the tumor-associated HLA-restricted peptides, or polypeptides may be encoded by a nucleic acid sequence. A nucleic acid may be derived from genomic DNA, complementary DNA (cDNA) or synthetic DNA. Where incorporation into an expression vector is desired, the nucleic acid may also comprise a natural 10 intron or an intron derived from another gene. As used herein, the term "cDNA" is intended to refer to DNA prepared using messenger RNA (mRNA) as template. The advantage of using a cDNA, as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences of the corresponding protein. There may be times when the 15 full or partial genomic sequence is preferred, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy. A tumor-associated HLA-restricted peptide or polypeptide cDNA, such as a Pr3 or MYO cDNA, for use in the present invention, may be derived from human cDNA but are not limited such. 20 As used herein, the term "nucleic acid segment" refers to a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a nucleic acid segment encoding a polypeptide refers to a nucleic acid segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term "nucleic acid 25 segment" are a polypeptide or polypeptides, DNA segments smaller than a polypeptide, and recombinant vectors, such as, plasmids and other non-viral vectors. The term "recombinant" may be used in conjunction with a polypeptide or the name of a specific polypeptide, and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule. 30 Recombinant vectors and isolated nucleic acid segments may variously include the PRI or myeloperoxidase -coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include PR1 or myeloperoxidase -coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.

WO 2005/019435 PCT/US2004/027790 A "nucleic acid" as used herein includes single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogs. It is contemplated that a nucleic acid within the scope of the present invention may be of about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 5 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, 10 about 975, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 1750, about 2000, about 2250, about 2500 or greater nucleotide residues in length. Those of skill will recognize that in cases where the nucleic acid region encodes a tumor-associated HLA restricted peptide, or polypeptide, the nucleic acid region can be quite long, depending upon the number of amino acids in the fusion protein. 15 It is contemplated that the tumor-associated HLA-restricted peptide, or polypeptide may be encoded by any nucleic acid sequence that encodes the appropriate amino acid sequence. The design and production of nucleic acids encoding a desired amino acid sequence is well known to those of skill in the art, using standardized codon tables (Table 3). In preferred embodiments, the codons selected for encoding each amino acid may be modified to optimize expression of the 20 nucleic acid in the host cell of interest. The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or seine, and also refers to codons that encode biologically equivalent amino acids. Codon preferences for various species of host cell are well known in the art. Codons preferred for use in humans, are well known to those of skill in the art (Wada et.al., 1990). Codon preferences for other 25 organisms also are well known to those of skill in the art (Wada et al., 1990, included herein in its entirety by reference) WO 2005/019435 PCT/US2004/027790 Table 3: Codon Table Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU Histidine His H1 CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU Proline Pro P CCA CCC CCG CCU Glutanine Gin Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine Tbr T ACA ACC ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU Prokaryote- and/or eukaryote-based systems can be used to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. The present invention 5 contemplates the use of such an expression system to produce the tumor-associated HLA restricted peptide, or polypeptide. More specifically, the present invention employs the use of the insect cell/baculovirus system. The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Patents 5,871,986, 4,879,236, both herein incorporated by reference, and which can be bought, for 10 example, under the name MAxBAC) 2.0 from INVITROGEN@ and BACPAcKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH@. In addition to the expression system disclosed in the invention, numerous expression systems exists which are commercially and widely available. One example of such a system is the STRATAGENE@'s COMPLETE CONTROL Inducible Mammalian Expression System, which 15 involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli

IQ

WO 2005/019435 PCT/US2004/027790 expression system. Another example of an inducible expression system is available from INVITROGEN@, which carries the T-REXTM (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter. INVITROGEN@ also provides a yeast expression system called the Pichia methanolica Expression System, which 5 is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide. A. Viral Vectors There are a number of ways in which expression vectors may be introduced into cells. In 10 certain embodiments of the invention, the expression vector comprises a virus or engineered vector derived from a viral genome. The ability of certain viruses to enter cells via receptor mediated endocytosis, to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign genes into manmalian cells (Ridgeway, 1988; Nicolas and Rubenstein, 1988; Baichwal and Sugden, 1986; 15 Temin, 1986). The first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986). 1. Adenoviral Vectors 20 A particular method for delivery of the nucleic acid involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to 25 ultimately express a tissue or cell-specific construct that has been cloned therein. Knowledge of the genetic organization or adenovirus, a 36 kb, linear, double-stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kb (Grunhaus and Horwitz, 1992). 30 2. AAV Vectors The nucleic acid may be introduced into the cell using adenovirus assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al., 1992; Curiel, 1994). Adeno-associated virus (AAV) is an attractive vector system for use in the vaccines of the present invention (Muzyczka,

AA

WO 2005/019435 PCT/US2004/027790 1992). AAV has a broad host range for infectivity (Tratschin et al., 1984; Laughlin et al., 1986; Lebkowski et al., 1988; McLaughlin et al., 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patents 5,139,941 and 4,797,368, each incorporated herein by reference. 5 3. Retroviral Vectors Retroviruses have promise as gene delivery vectors in vaccines due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special 10 cell-lines (Miller, 1992). In order to construct a retroviral vector, a nucleic acid (e.g., one encoding an antigen of interest) is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed 15 (Mann et al., 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into a special cell line (e.g., by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The media containing 20 the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al., 1975). Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. Lentiviral vectors 25 are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al., 1997; Blomer et al., 1997; U.S. Patents 6,013,516 and 5,994,136). Some examples of lentivirus include the Human Immunodeficiency Viruses: HIV-1, HIV-2 and the Simian Immunodeficiency Virus: SIV. Lentiviral vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif vpr, vpu and nef are deleted making the vector biologically safe. 30 Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by A 1 WO 2005/019435 PCT/US2004/027790 reference. One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type. By inserting a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now 5 target-specific. 4. Other Viral Vectors Other viral vectors may be employed as vaccine constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 10 1986; Coupar et al., 1988), sindbis virus, cytomegalovirus and herpes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al., 1988; Horwich et al., 1990). 5. Delivery Using Modified Viruses 15 A nucleic acid to be delivered may be housed within an infective virus that has been engineered to express a specific binding ligand. The virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell. A novel approach designed to allow specific targeting of retrovirus vectors was developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. 20 This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors. Another approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used. The antibodies were coupled via the biotin components by using streptavidin 25 (Roux et al., 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al., 1989). B. Nucleic Acid Delivery Suitable methods for nucleic acid delivery to effect expression of compositions of the 30 present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S. Patents 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and

A')

WO 2005/019435 PCT/US2004/027790 5,580,859, each incorporated herein by reference), including microinjection (Harlan and Weintraub, 1985; U.S. Patent 5,789,215, incorporated herein by reference); by electroporation (U.S. Patent 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE 5 dextran followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Patents 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated 10 herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Patents 5,302,523 and 5,464,765, each incorporated herein by reference); or by PEG-mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Patents 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), 15 tissue(s) or organism(s) may be stably or transiently transformed. X. Pharmaceutical Vaccine Compositions, Delivery, and Treatment Regimens In an embodiment of the present invention, a method of treatment and prevention of cancers such as leukemia by the delivery of a tumor-associated HLA-restricted peptide, or polypeptide or expression construct is contemplated. Examples of cancers contemplated for 20 treatment include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases that may be treated or prevented by a tumor-associated HLA-restricted peptides, or polypeptides of the present invention. 25 An effective amount of the pharmaceutical vaccine composition, generally, is defined as that amount sufficient to detectably and repeatedly to ameliorate, reduce, minimize or limit the extent of the disease or condition or symptoms thereof. More rigorous definitions may apply, including elimination, eradication or cure of disease. Preferably, patients will have adequate bone marrow function (defined as a peripheral 30 absolute granulocyte count of > 2,000 / mm3 and a platelet count of 100,000 / mm ), adequate liver function (bilirubin < 1.5 mg / dl) and adequate renal function (creatinine < 1.5 mg / dl).

WO 2005/019435 PCT/US2004/027790 A. HLA-Restricted Vaccine Administration To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size and otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one would generally contact a cancer cell with the 5 therapeutic compound such as a polypeptide or an expression construct encoding a polypeptide. The routes of administration will vary, naturally, with the location and nature of the lesion, and include, e.g., intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration and formulation. Any of the formulations and routes of 10 administration discussed with respect to the treatment or diagnosis of cancer may also be employed with respect to neoplastic diseases and conditions. Intratumoral injection, or injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration also may be appropriate. For tumors of >4 cm, the volume to be administered will be about 4-10 ml 15 (preferably 10 ml), while for tumors of <4 cm, a volume of about 1-3 ml will be used (preferably 3 ml). Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes. The viral particles may advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals. In the case of surgical intervention, the present invention may be used preoperatively, to 20 render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a tumor-associated HLA restricted peptide or construct encoding therefor. The perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery. 25 Periodic post-surgical treatment also is envisioned. Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is preferred. Such continuous perfusion may take place for a period from about 1-2 hr, to about 2-6 hr, to about 6-12 hr, to about 12-24 hr, to about 1-2 30 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs. It is further contemplated that limb perfusion may be used to administer therapeutic compositions of the present invention, particularly in the treatment of melanomas and sarcomas. A A WO 2005/019435 PCT/US2004/027790 Treatment regimens may vary as well, and often depend on tumor type, tumor location, disease progression, and health and age of the patient. Obviously, certain types of tumor will require more aggressive treatment, while at the same time, certain patients cannot tolerate more taxing protocols. The clinician will be best suited to make such decisions based on the known 5 efficacy and toxicity (if any) of the therapeutic formulations. In certain embodiments, the tumor being treated may not, at least initially, be resectable. Treatments with therapeutic viral constructs may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection will serve 10 to eliminate microscopic residual disease at the tumor site. A typical course of treatment, for a primary tumor or a post-excision tumor bed, will involve multiple doses. Typical primary tumor treatment involves a 6 dose application over a two-week period. The two-week regimen may be repeated one, two, three, four, five, six or more times. During a course of treatment, the need to complete the planned dosings may be re 15 evaluated. The treatments may include various "unit doses." Unit dose is defined as containing a predetermined-quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set 20 period of time. Unit dose of the present invention may conveniently be described in terms of 3 4 5 6 7 plaque forming units (pfu) for a viral construct. Unit doses range from 10 , 10 , 10 , 10 , 10 8 9 10 11 12 13 10 , 10 , 10 , 10 , 10 , 10 pfu and higher. Alternatively, depending on the kind of virus and 4 5 the titer attainable, one will deliver 1 to 100, 10 to 50, 100-1000, or up to about 1 x 10 , 1 x 10 , 6 7 8 9 10 11 12 13 14 15 1x 10 , 1x 10 , 1 x 10 , x 10 , 1x 10 , xl 10 , x 10 , x 10 ,1 x 10 ,or 1 x 10 or 25 higher infectious viral particles (vp) to the patient or to the patient's cells. B. Injectable Compositions and Formulations One method for the delivery of a pharmaceutical according to the present invention is systemically. However, the pharmaceutical compositions disclosed herein may alternatively be 30 administered parenterally, intravenously, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Patent 5,543,158; U.S. Patent 5,641,515 and U.S. Patent 5,399,363 (each specifically incorporated herein by reference in its entirety). Injection of pharmaceuticals may be by syringe or any other method used for injection of a solution, as long as the agent can pass through the particular gauge of needle required for WO 2005/019435 PCT/US2004/027790 injection. A novel needleless injection system has been described (U.S. Patent 5,846,233) having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery. A syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of 5 a solution precisely at any depth (U.S. Patent 5,846,225). Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a 10 preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile. and must be fluid to the extent that easy syringability exists. It must be stable under the 15 conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the 20 maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by 25 the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, 30 intramuscular, subcutaneous, intratumoral and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermolysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035- WO 2005/019435 PCT/US2004/027790 1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity 5 standards as required by FDA Office of Biologics standards. Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the 10 basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. 15 The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases 20 such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like. 25 As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic 30 compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. The phrase "pharmaceutically-acceptable" or "pharmacologically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a A 7 WO 2005/019435 PCT/US2004/027790 protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared. XI. Combination Treatments 5 The compounds and methods of the present invention may be used in the context of neoplastic diseases/conditions including cancer. Types of diseases/conditions contemplated to be treated with the peptides of the present invention include, but are not limited to leukemias such as, AML, MDS and CML. Other types of cancers may include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular 10 cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases. In order to increase the effectiveness of a treatment with the tumor-associated HLA-restricted compositions of the present invention, such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor, it may be desirable to combine these compositions with other agents effective in 15 the treatment of those diseases and conditions. For example, the treatment of a cancer may be implemented with therapeutic compounds of the present invention and other anti-cancer therapies, such as anti-cancer agents or surgery. Various combinations may be employed; for example, the tumor-associated HLA restricted peptide is "A" and the secondary anti-cancer is "B": 20 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A 25 Administration of the therapeutic agents of the present invention to a patient will follow general protocols for the administration of that particular secondary therapy, taking into account the toxicity, if any, of the tumor-associated HLA-restricted peptide treatment. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the 30 described cancer cell. A. Adjunct Anti-Cancer Therapy An "anti-cancer" agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer A52 WO 2005/019435 PCT/US2004/027790 cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. Anti-cancer agents include biological agents (biotherapy), 5 chemotherapy agents, and radiotherapy agents. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with the expression construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell 10 with two distinct compositions or formulations, at the same time, wherein one composition includes the expression construct and the other includes the second agent(s). Tumor cell resistance to chemotherapy and radiotherapy agents represents a major problem in clinical oncology. One goal of current cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy. For example, the herpes 15 simplex-thymidine kinase (HS-tK) gene, when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver et aL, 1992). In the context of the present invention, it is contemplated that tumor-associated HLA restricted peptide therapy could be used similarly in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic or other biological intervention, in addition to other pro 20 apoptotic or cell cycle regulating agents. Alternatively, the gene therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks. In embodiments where the other agent and expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and expression 25 construct would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one may contact the cell with both modalities within about 12 24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective 30 administrations. 1. Chemotherapy Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin,

AO

WO 2005/019435 PCT/US2004/027790 ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine and methotrexate, 5 Temazolomide (an aqueous form of DTIC), or any analog or derivative variant of the foregoing. The combination of chemotherapy with biological therapy is known as biochemotherapy. The present invention contemplates any chemotherapeutic agent that may be employed or kown in the art for treating or preventing cancers. 2. Radiotherapy 10 Other factors that cause DNA damage and have been used extensively include what are commonly known as y-rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and 15 maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells. The terms "contacted" and "exposed," when applied to a cell, are used herein to describe 20 the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing. 3. Immunotherapy 25 Immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, 30 pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of WO 2005/019435 PCT/US2004/027790 therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of Fortilin would provide therapeutic benefit in the treatment of cancer. Immunotherapy could also be used as part of a combined therapy. The general approach for combined therapy is discussed below. In one aspect of immunotherapy, the tumor cell must 5 bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B 10 and p15 5 . An alternative aspect of immunotherapy is to anticancer effects with immune stimulatory effects. Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor such as mda-7 has been shown to enhance 15 anti-tumor effects (Ju et al., 2000). As discussed earlier, examples of immunotherapies currently under investigation or in use are immune adjuvants (e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds) (U.S. Patent 5,801,005; U.S. Patent 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998), cytokine therapy (e.g., interferons, and; 20 IL-1, GM-CSF and TNF) (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998) gene therapy (e.g., TNF, IL-1, IL-2, p53) (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Patent 5,830,880 and U.S. Patent 5,846,945) and monoclonal antibodies (e.g., anti ganglioside GM2, anti-HER-2, anti-p185) (Pietras et al., 1998; Hanibuchi et al., 1998; U.S. Patent 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody 25 that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). Combination therapy of cancer with herceptin and chemotherapy has been shown to be more effective than the individual therapies. Thus, it is contemplated that one or more anti-cancer therapies may be employed with the tumor associated HLA-restricted peptide therapies described herein. 30 i) Adoptive Immunotherapy In adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al., 1988; 1989). To achieve this, one would administer to an animal, or human patient, an immunologically effective amount of RCZ1 WO 2005/019435 PCT/US2004/027790 activated lymphocytes in combination with an adjuvant-incorporated antigenic peptide composition as described herein. The activated lymphocytes will most preferably be the patient's own cells that were earlier isolated from a blood or tumor sample and activated (or "expanded") in vitro. This form of immunotherapy has produced several cases of regression of melanoma and 5 renal carcinoma, but the percentage of responders were few compared to those who did not respond. ii) Passive Immunotherapy A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies 10 coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow. Preferably, human monoclonal antibodies are employed in passive immunotherapy, as they produce few or no side effects in the patient. However, their application is somewhat 15 limited by their scarcity and have so far only been administered intralesionally. Human monoclonal antibodies to ganglioside antigens have been administered intralesionally to patients suffering from cutaneous recurrent melanoma (Irie & Morton, 1986). Regression was observed in six out of ten patients, following, daily or weekly, intralesional injections. In another study, moderate success was achieved from intralesional injections of two human monoclonal 20 antibodies (Irie et al., 1989). It may be favorable to administer more than one monoclonal antibody directed against two different antigens or even antibodies with multiple antigen specificity. Treatment protocols also may include administration of lymphokines or other immune enhancers as described by Bajorin et al. (1988). The development of human monoclonal antibodies is described in further 25 detail elsewhere in the specification. iii) Active Immunotherapy In active immunotherapy, an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine" is administered, generally with a distinct bacterial adjuvant (Ravindranath and Mitchell et al., 1990; Mitchell et al., 1993). In melanoma 30 immunotherapy, those patients who elicit high IgM response often survive better than those who elicit no or low IgM antibodies (Morton et al., 1992). IgM antibodies are often transient antibodies and the exception to the rule appears to be anti-ganglioside or anticarbohydrate antibodies.

WO 2005/019435 PCT/US2004/027790 4. Genes In yet another embodiment, the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the tumor associated HLA-restricted peptide is administered. Delivery of a vector encoding a the tumor 5 associated HLA-restricted peptide in conjunction with a second vector encoding one of the following gene products will have a combined anti-hyperproliferative effect on target tissues. Alternatively, a single vector encoding both genes may be used. A variety of proteins are encompassed within the invention, some of which are described below. Various genes that may be targeted for gene therapy of some form in combination with the present invention are will 10 known to one of ordinary skill in the art and may comprise any gene involved in cancers. i) Inducers of Cellular Proliferation The proteins that induce cellular proliferation further fall into various categories dependent on function. The commonality of all of these proteins is their ability to regulate cellular proliferation. For example, a form of PDGF, the sis oncogene, is a secreted growth 15 factor. Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor. In one embodiment of the present invention, it is contemplated that anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression of the inducer of cellular proliferation. The proteins FMS, ErbA, ErbB and neu are growth factor receptors. Mutations to these 20 receptors result in loss of regulatable function. For example, a point mutation affecting the transmembrane domain of the Neu receptor protein results in the neu oncogene. The erbA oncogene is derived from the intracellular receptor for thyroid hormone. The modified oncogenic ErbA receptor is believed to compete with the endogenous thyroid hormone receptor, causing uncontrolled growth. 25 The largest class of oncogenes includes the signal transducing proteins (e.g., Src, Abl and Ras). The protein Src is a cytoplasmic protein-tyrosine kinase, and its transformation from proto-oncogene to oncogene in some cases, results via mutations at tyrosine residue 527. In contrast, transformation of GTPase protein ras from proto-oncogene to oncogene, in one example, results from a valine to glycine mutation at amino acid 12 in the sequence, reducing ras 30 GTPase activity. The proteins Jun, Fos and Myc are proteins that directly exert their effects on nuclear functions as transcription factors.

WO 2005/019435 PCT/US2004/027790 ii) Inhibitors of Cellular Proliferation The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. The tumor suppressors p53, p16 and C-CAM are described below. 5 In addition to p53, which has been described above, another inhibitor of cellular proliferation is p16. The major transitions of the eukaryotic cell cycle are triggered by cyclin dependent kinases, or CDK's. One CDK, cyclin-dependent kinase 4 (CDK4), regulates progression through the G 1 . The activity of this enzyme may be to phosphorylate Rb at late G 1 . The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory 10 subunit, the p1 6 INK4 has been biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Serrano et al., 1993; Serrano et al., 1995). Since the p1 6 INK4 protein is a CDK4 inhibitor (Serrano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein. p16 also is known to regulate the function of CDK6. 15 pl6INK4 belongs to a newly described class of CDK-inhibitory proteins that also includes p1 6 B, p19, p21WAF1, and p27KIPl. The p16INK4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations of the p16INK4 gene are frequent in human tumor cell lines. This evidence suggests that the p1 6 1NK4 gene is a tumor suppressor gene. This interpretation has been challenged, 20 however, by the observation that the frequency of the p161NK4 gene alterations is much lower in primay uncultured tumors than in cultured cell lines (Caldas et al., 1994; Cheng et al., 1994; Hussussian et al., 1994; Kamb et al., 1994; Kamb et al., 1994; Mori et al., 1994; Okamoto et al., 1994; Nobori et al., 1995; Orlow et al., 1994; Arap et aL, 1995). Restoration of wild-type pI61NK4 function by transfection with a plasmid expression vector reduced colony formation by 25 some human cancer cell lines (Okamoto, 1994; Arap, 1995). Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zac1, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27/pl6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf; erb, fins, trk, ret, gsp, hst, abl, ElA, p300, genes involved in 30 angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.

WO 2005/019435 PCT/US2004/027790 iii) Regulators of Programmed Cell Death Apoptosis, or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al., 1972). The Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be 5 important regulators and effectors of apoptosis in other systems. The Bcl-2 protein, discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related 10 proteins, which can be categorized as death agonists or death antagonists. Subsequent to its discovery, it was shown that Bcl-2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., BclXL, 15 BclW, Belg, Mcl-1, Al, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax, Bak, Bik, Bim, Bid, Bad, Harakiri). 5. Surgery Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is 20 a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part 25 of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue. Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed 30 in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

WO 2005/019435 PCT/US2004/027790 XI. Examples The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the 5 practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. 10 EXAMPLE 1 METHODOLOGY Patients and donors. Donors and patients were treated at the University of Texas M.D. Anderson Cancer Center on protocols approved by the Institutional Review Board. After informed consent, cells from the CML patients and their HLA-matched bone marrow (BM) 15 transplantation donors were obtained. PBMCs from untreated CML patients or from patients receiving IFN were collected and cryopreserved for later analysis. Cells were separated using Ficoll-Hypaque gradient-density (Organon Teknika Corp., Durham, North Carolina, USA) and frozen in RPMI-1640 complete medium (CM) (25 mM HEPES buffer, 2 mM L-glutamine, 100 U/ml penicillin, 100 pg/ml streptomycin; Life Technologies Inc., Gaithersburg, Maryland, USA) 20 supplemented with 20% heat-inactivated pooled human AB serum (AB; Sigma-Aldrich, St. Louis, Missouri, USA) and 10% DMSO, according to standard protocols. Before use, cells were thawed, washed, and suspended in CM plus 10% AB. High-resolution HLA testing was performed by the HLA Laboratory at M.D. Anderson Cancer Center. Peptide synthesis. PRI (aa 169-177) peptide (VLQELNVTV (SEQ ID NO:1)) was 25 synthesized by Bio-Synthesis (Lewisville, Texas, USA), and the HLA-A2-restricted CMV pp65 peptide (NLVPMVATV (SEQ ID NO:2)) was synthesized by the M.D. Anderson Protein and Nucleic Acid Facility, both to a minimum of 95% purity. Cell lines and peptide binding. T2 cells (American Type Culture Collection, Rockville, Maryland, USA) were maintained in culture in CM plus 10% FBS (Atlanta Biologicals Inc., 30 Norcross, Georgia, USA). PR1 peptide was incubated at increasing concentrations for 18 hr at 37'C with 100 pg/ml # 2 m (Sigma-Aldrich) with 106 T2 cells in 1 ml CM. Cells were washed twice with CM, stained with BB7.2 Ab, washed again, and then stained with FITC-labeled secondary Ab (Becton Dickinson Immunocytometry Systems, San Jose, California, USA). HLA-A*0201 expression was measured by FACS.

WO 2005/019435 PCT/US2004/027790 Peptide-specific CTLs were expanded in culture using methods described previously (Molldrem et al., 1996; Molldrem et al., 1997). Briefly, PBMCs from healthy donors or CML patients were stimulated in vitro with PRI, pp65, or flu peptides. T2 cells were washed three times in serum-free CM and incubated with peptide at the indicated peptide concentration for 2 5 hr in CM. The peptide-loaded T2 cells were then irradiated with 7,500 cGy, washed once, and suspended with freshly isolated PBMCs at a 1:1 to a 1:2 ratio in CM supplemented with 10% AB. After 7 days in culture, a second stimulation was performed, and the following day, 60 IU/ml of recombinant human interleukin-2 (rhIL-2) (BioSource International, Camarillo, California, USA) was added. After 14 days in culture, a third stimulation was performed, 10 followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21, followed on day 22 by the addition of rhIL-2. After a total of 27-28 days in culture, the peptide stimulated T cells were obtained and tested for peptide-specific and leukemia-specific cytotoxicity as well as for phenotypic analyses. Tetramer synthesis. Production of MHC/peptide tetramers was described in detail 15 elsewhere (Altman et al., 1996; Molldrem, 2000). Briefly, a 15-amino acid substrate peptide (BSP) for BirA-dependent biotinylation has been engineered onto the COOH terminus of HLA A2. The A2-BSP fusion protein and human fl 2 m were expressed in Escherichia coli and were folded in vitro with the specific peptide ligand. The properly folded MHC-peptide complexes were extensively purified using FPLC and anion exchange and biotinylated on a single lysine 20 within the BSP using the BirA enzyme (Avidity, Denver, Colorado, USA). Tetramers were produced by mixing the biotinylated MHC-peptide complexes with phycoerythrin-conjugated (PE-conjugated) Neutravidin (Molecular Probes Inc., Eugene, Oregon, USA) at a molar ratio of 4:1. PRI tetramers were validated by staining against a CTL line specific for PRI. CMV tetramers were validated by staining PBMCs from a CMV-immune individual. 25 Ab's and flow cytometry. For routine surface-antigen staining, 106 PBMCs were incubated at 4'C with Ab. After washing, cells were incubated with FITC-labeled CD8 (Caltag Laboratories Inc., Burlingame, California, USA) for 30 min on ice. Surface expression of TCR was determined with FITC-labeled TCR-oe (PharMingen, San Diego, California, USA), and annexin V using FITC-labeled Ab (Caltag Laboratories). Proteinase 3 expression was 30 determined with primary mouse Ab (Accurate Chemical & Scientific Corp., Westbury, New York, USA). Mouse monoclonal anti-HLA-A2.1 Ab BB7.2 and anti-HLA-ABC w6/32 were derived from culture supernatants of a hybridoma cell lines (American Tissue Culture Collection). Cells were washed and fixed in 2% paraformaldehyde and analyzed on a FACScan (Becton Dickinson Immunocytometry Systems), and data were analyzed using CELLQuest WO 2005/019435 PCT/US2004/027790 (Becton Dickinson hnmunocytometry Systems) software. The minimum concentration of tetramer necessary to show distinctly different avidities was determined in titration experiments. Each tetramer reagent was titered individually and used at the optimal concentration. The tetramer concentration showing the maximal separation of fluorescence intensity of CTL 5 populations was generally 10-20 pg/ml. Propidium iodide (PI) (Becton Dickinson Immunocytometry Systems) staining (1 pg/ml) was performed to exclude dead cells, according to the manufacturer's instructions. A "dump" channel was used with tetramer staining to eliminate monocytes and B lymphocytes with nonspecific binding to the HLA-A2 heavy chain by staining with PerCP-labeled CD14 and CD19 (both Becton Dickinson Immunocytometry 10 Systems). Detailed methodology for detection of t11 2 of tetramer dissociation was described elsewhere (Savage et al., 1999). Briefly, T cells were stained for 45 min with PR1/HLA-A2 tetramer, washed, and cooled to 4'C. To prevent rebinding of tetramer, cells were incubated in the presence of PI (1 pg/ml) with saturating amounts of BB7.2 Ab, and flow cytometry was used 15 to measure fluorescence decay at 10-min intervals. A constant number of CD8* events was acquired at each time point. Total fluorescence within the tetramer-positive gate was normalized per CD8* cell, and the antigen-specific fluorescence was determined by subtracting the total fluorescence of control healthy donor lymphocytes from the observed total fluorescence of the lymphocyte populations following peptide stimulation. This antigen-specific fluorescence was 20 normalized to the percentage of the total fluorescence at the initial time point and plotted on a logarithmic scale. Tetramer dissociation t11 2 was determined by plotting ln (normalized fluorescence) versus time, and is given by tj 12 = 0.693/k, where k is the slope of the normalized fluorescence decay curve determined by the method of linear least squares. CTL cytotoxicity assay. A semiautomated minicytotoxicity assay was used to 25 determine specific lysis as described previously (Molldrem, 2000; Molldrem et al., 1996). Briefly, effector cells were prepared in doubling dilutions from 6 x 103 to 25 x 103 cells/well and were plated in 40 pl, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, California, USA) with six replicates per dilution. Target cells (T2 cells, marrow-derived leukemic cells, or BM from a healthy donor) at a concentration of 2 x 106 cells/ml were stained with 10 ptg/ml of 30 Calcein-AM (Molecular Probes Inc.) for 60 min at 37 0 C. After washing three times in CM plus 10% AB, target cells were resuspended at 105 cells/ml, and 103 target cells in 10 d medium were added to each well containing effector cells. Wells with target cells alone and medium alone were used for maximum (max) and minimum (min.) fluorescence emission, respectively. After 4 hr incubation at 37*C in 5% CO 2 , 5 pl FluoroQuench (One Lambda Inc., Canoga Park, WO 2005/019435 PCT/US2004/027790 California, USA) was added to each well, and the trays were centrifuged for 1 min at 60 g before measurement of fluorescence using an automated CytoFluor II plate reader (PerSeptive Biosystems, Framingham, Massachusetts, USA). The percentage of lysis was calculated as follows: % lysis = {1 - [(mean experimental mission - mean min.)/(mean max - mean min.)]} x 5 100%. EXAMPLE 2 CLINICAL TRIALS Based upon pre-clinical studies, the toxicity and efficacy of PRI peptide vaccination for 10 patients with refractory or relapsed myeloid leukemias was investigated. This study is being conducted in two phases: a Phase I initial toxicity phase (in order to determine initial vaccine safety), and a Phase II efficacy and toxicity phase. Nine patients will be studied in the Phase I portion, and up to 60 patients will be studied in the Phase II portion. Four patients have been enrolled thus far on Phase I. Details of the protocol are described below. 15 PRI peptide is injected subcutaneously in incomplete Freund's adjuvant every 3 weeks for 3 injections to induce a PRI specific host response against the myeloid leukemia. Both in Phase I and in Phase II, patients will also be evaluated for signs of immune reactivity. Before, during, and at the end of the 9 week period of vaccination, the peripheral blood mononuclear cells (PBMC) from the patients will be tested for the development of PR1 immune reactivity in 20 vitro using cytotoxic T lymphocyte precursor frequency (CTLPf) assays against PR1-loaded target cells and against the patient's own leukemia (a measure of efficacy), PR1/HLA-A2 tetramer staining, 8-color flow cytometry for surface phenotype (memory/naIve, activation), and cytolysis assays of bulk PRI-stimulated PBMC from the patients. The amount of Proteinase 3 expression in the leukemia cells is studied by cytoplasmic flow cytometry analysis. Any clinical 25 responses (defined by standard criteria as hematological and/or cytogenetic responses) will be correlated with the in vitro testing. Vaccination at 3 dose levels of peptide with a fixed amount of IFA will be conducted, and stopping criteria will be guided by established toxicity criteria. Phase I. In Phase I of this study, patients are assigned to three escalating peptide dose levels starting with dose level 1. Patients are followed in dose cohorts of size 3 for signs of dose 30 limiting toxicity. Patients are assigned to the next highest dose level cohort only if no more than 1 of the 3 patients at any time at any dose level has grade 3 non-hematological toxicity or autoimmune phenomena (i.e., dose limiting toxicity). At each dose level, the first patient entered must complete two of the three vaccinations prior to initiation of the second patient in that cohort at that dose level. Before the third patient is enrolled, the first patient in each dose cohort must

ISQ

WO 2005/019435 PCT/US2004/027790 complete all vaccinations and the second patient must complete at least two vaccinations prior to initiation of vaccination in the third patient. Again, if < grade 3 non-hernatological toxicity and no autoimmune phenomena are observed in the first three patients, then the next dose level will accrue patients in a similar manner. If more than 1/3 of the patients enrolled at any time at any 5 dose level have grade III or IV non-hematological toxicity, then maximal tolerated dose (MTD) has been exceeded and this and all higher peptide dose levels will be eliminated from Phase II of the study. Dose escalation to the next dose level will occur only after the third patient has been followed for three weeks after the third vaccination in the series and has no dose limiting toxicity. 10 If an allergic reaction >grade 2 occurs in any patient, no further vaccinations will be given in that patient and they will be taken off study. Allergic reactions will be treated with solumedrol 1 mg/kg IV bolus, benadryl 50 mg IV bolus, and epinephrine 0.5 mg S.C. Phase II. Phase II of the study will be conducted according to a continuous reassessment statistical model. Up to 60 patients will be randomized among three dose levels, with a 15 maximum of 20 patients per dose level. Only those dose levels without dose limiting toxicity as determined in Phase I of this study will be examined in Phase II. Both toxicity and efficacy will be determined as primary endpoints. Patients will be monitored in cohorts of size 4, and all patients in any cohort will be observed for at least 2 weeks from the first dose of the last patient in the group in the absence of grade III or IV non-hematological toxicity before continuing to the 20 next cohort. Toxicity information will be carefully accrued using established. If grade III or IV non-hematological toxicity is observed during the 9 week study period in 2 of the first 4 patients (the first cohort), 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups, then that dose level will be terminated and patients will be treated only on the remaining dose levels. Moving to the next cohort will occur only if dose-limiting toxicity is not reached in 25 the number of patients defined above for each cohort. There will be a two-week observation period before the next vaccination will be given in any patient that experiences grade II non-hematological toxicity < dose limiting toxicity. If the toxicity decreases to grade I or less within those two weeks, the patient will be given the next vaccination. If the grade II toxicity does not decrease to grade I or less within two weeks, the 30 patient will be taken off protocol (removed from study). Any grade toxicity that provides clear evidence of an autoimmune reaction will be considered a dose limiting toxicity. Such a reaction will preclude further administration of peptide under this protocol, and the study will be terminated. If there is evidence that vaccine WO 2005/019435 PCT/US2004/027790 administration has produced a Wegener's-like vasculitis or inflammatory disease, then the study will be terminated. Efficacy, defined as an immune response to PR1 vaccine, will also be determined as a primary endpoint of the study. If none of the first 12 patients have an immune response at a 5 particular dose level, then that dose level will be terminated. Patients will not be retreated in this protocol after the required 3 immunizations, nor will the dose be escalated beyond 1.0 mg of PRI peptide. The maximal tolerated dose (MTD) is defined as the highest peptide dose that does not cause dose-limiting non-hematological toxicity beyond the allowable number of patients stated 10 for each phase at each dose level cohort (dose limiting toxicity). The MTD will be determined in either Phase I or Phase II of this study if: (1) dose-limiting toxicity is reached in more than 1 patient of 3 at each dose level cohort in Phase I, or (2) if dose-limiting non-hematological toxicity is exceeded in 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups in Phase II. 15 EXAMPLE 3 GENERATION OF PR1-CTL AND EX VIVO STUDIES Experimental and clinical evidence indicates that lymphocytes from HLA-matched 20 allogeneic normal donors exert a powerful graft-versus-leukemia (GVL) effect when used to treat patients with myeloid leukemia (Drobyski et al., 1994; Horowitz et al., 1996). Donor lymphocyte infusions (DLI) alone, when administered to patients that have relapsed after allogeneic bone marrow transplantation (BMT) can cure patients with myeloid leukemia (Collins et al., 1997; Kolb and Holler, 1997). However, graft-versus-host disease (GVHD) is an 25 unwanted and sometimes lethal complication of DLI treatment that occurs in nearly 50% of patients. The GVL and GVHD target antigens of these lymphocytes are largely unknown. GVL may be enhanced and GVHD eliminated after DLI if (1) antigens that were the favored targets of GVL are known and (2) an efficient ex vivo process for enrichment of GVL-causing lymphocytes based on antigen specificity is developed. 30 In this study, it was determined whether high and low affinity PR1-specific CTL can be expanded from normal donors ex vivo and then enriched using antigen-coated microbeads for transfer to myeloid leukemia patients, in place of conventional DLI, in order to deliver GVL without GVHD. Methods to more efficiently generate PR1-CTL, enrich high affinity PRl-CTL IK1 WO 2005/019435 PCT/US2004/027790 using microbeads, and expand selected PRI-CTL ex vivo for adoptive imuunotherapy were also investigated. Methodology. PR1 peptide was combined into the binding region of the HLA-A2 heavy chain, and the resulting protein folded with p2-microglobulin and attached the resulting 5 PRI/HLA-A2 monomer onto 50 nm magnetic microbeads (Miltenyi Co.) (Wang et al., 2000). To do this, the technology used was adapted to assemble PRl/HLA-A2 tetramers, where heavy chain monomers are biotinylated at the C terminus and combined in a 4:1 molar ratio with streptavidin, which has in turn been conjugated to phycoerythrin (PE). The PR1 monomer conjugated microbeads can then be passed through a sterile colunm that is surrounded by a 10 magnet that traps microbead-adherent T cells. After the non-adherent cells pass through the column, the column is removed from the magnet and the PRI-specific T cells attached to the microbeads can be collected. This method allows for the selection of PR1-specific T cells, which could be further expanded and given to patients with myeloid leukemia to facilitate GVL without GVHD. 15 Determining the most efficient in vitro method for short-term expansion of PRi antigen-specific T lymphocytes. The results show that PR1-specific cytotoxic T lymphocytes (CTL) are present at frequencies from 1/15,000 to 1/300,000 in normal donors. Therefore, the PR1-specific CTL will first be expanded so enough cells are available for subsequent enrichment by magnetic bead separation. The efficiency of antigen presenting cells (APC) produced by 20 different methods to expand short-term polyclonal PR1-specific CTL will be compared. Peripheral blood mononuclear cells (PBMC), as APC, will be compared to dendritic cells (DC) derived from peripheral blood monocytes after a 2-hr adherence step. One week-old DC will be derived after incubating adherent cells from the same healthy HLA-A2+ donors with either 10 ng/ml IL-4 + 1000 U/ml GM-CSF or 1000 U/ml IFN-a + 1000 U/nl GM-CSF (Verdijk et al., 25 1999; Santini et al., 2000). The resulting APC will be pulsed weekly with PRI at 10 Lg/ml plus IL-2 at 20 U/ml and combined with responder PBMC in ratios from 1:1 to 1:20. These APC will be compared to standard T2 cells, a cell line unable to present endogenous antigens due to TAP 1/2 deficiency and can only present peptides pulsed onto the cell surface (Salter and Cresswell, 1986). Preliminary studies using T2 cells as peptide-pulsed APCs expanded the PR1-specific 30 CTL to between 2% to 8% of the total lymphocyte culture by 28 days (Molldrem et al., 2000). In addition, the APC methodology described above will also be compared to the results obtained from pulsing Drosophila melanogaster S2 cells with PRI peptide (Janetzki et al., 2000). S2 cells have been transfected with the HLA-A2.1 heavy chain, p-2M, ICAM-1, and the co-stimulatory molecule B7.1. By pulsing peptides on the surface of transfected S2, these cells ri;9 WO 2005/019435 PCT/US2004/027790 have demonstrated the ability to act as efficient APC during the critical first round of peptide antigen stimulation of CTL in vitro. The advantages of using S2 cells as an APC population is that they can be propagated at room temperature and subsequently require low maintenance, a critical element for eventual clinical application. 5 After 3 to 4 weeks in culture, the resulting PR1-specific CTL will be quantified and characterized using the PRl/HLA-A2 tetramer in combination with antibodies to CD8, CD69, HLA-DR, CD25, LFA-1, CD54, CD2, intracellular y-interferon, and CD45(RO) conjugated to different fluorochromes (Molldrem et al., 1999; Molldrem et al., 2000). Cells will subsequently be analyzed using a MoFlo cytometer capable of simultaneous 10-color cytofluorometric 10 analysis. Efficiency of the various APC conditions can be directly compared by quantifying PR1-specific CTL using the tetramer and the other markers will allow comparison of activation state, functional state and memory phenotype. To determine whether high and low affinity antigen-specific cytotoxic T lymphocytes can be separated and enriched using PR1/HLA-A2 monomer-coated 15 microbeads. From the preliminary studies, it has been shown that by using low doses of tetramer reagent a discrimination can be made between CTL with high and low affinity T cell receptor (TCR) based on high and low tetramer staining as assessed by FACS (Molldrem et al., 1998). The T 12 of tetramer binding has been shown to correlate with staining intensity, and specific lysis of CML target cells correlates with TCR affinity. High affinity PRI-CTL were 20 elicited from normal donors in the presence of low-dose PR1 (2 pg/ml) and low affinity PR1 CTL were elicited using high-dose PR1 (200 ptg/ml) (Molldrem et al., 1998). To preferentially select PR1 antigen-specific T-cells, streptavidin-coated microbeads (from 'Miltenyi, Inc.) will be used. Beads will be conjugated with PR1 plus HLA-A2 through the biotin-labeled C-terminus of the heavy chain (Wang et al., 2000). PRI-pulsed short-term CTL 25 lines will be incubated for 30 min with PR1/HLA-A2 coated microbeads and selected using the MACSTM magnetic column. Bead-selected and non-selected CTL will be quantified by flow cytometry using the PR1/HLA-A2 tetramer and compared to the starting polyclonal CTL lines. It is estimated that yields will range from 85% to 100% and PRI-specific CTL purity will range from 11% to 21% after the selection process (i.e. a 3- to 5-fold increase in purity of antigen 30 specific CTL), based on preliminary studies using PRI-pulsed T2 cells to elicit PRI-specific CTL (Molldrem et al., 1999; Wang et al., 2000). The selected PRl-specific CTL will be tested for functional activity. Specific lysis of PRI-coated T2 cells, CML and AML marrow cells, and normal HLA-A2 marrow will be assessed using the PR1-specific CTL and compared to lysis by the non-selected CTL. The WO 2005/019435 PCT/US2004/027790 method to select the highest affinity PRI -specific CTL will be optimized using different ratios of PR1/HLA-A2 monomers, microbeads, and starting cell populations to achieve the highest yield and greatest purity of high affinity PR1 -specific CTL. To determine whether lymphocytes, separated using PR1/HLA-A2 monomer-coated 5 microbeads, can be expanded to a sufficient number for use in adoptive immunotherapy of myeloid leukemia. It is estimated that from 1 to 5 x 106 CTL may be needed to treat patients with relapsed leukemia after BMT (Mackinnon et al., 1995). By optimizing a CTL expansion technique in combination with the bead enrichment, the requirement of a leukapheresis product may be reduced to as little as 100 ml of peripheral blood. To achieve this goal, it will be 10 determined whether the bead-enriched PRI-specific CTL can be further expanded in short term culture. Two methods will be directly compared: the optimized technique, as determined previously, will be used to expand PRl-CTL by weekly restimulation with PR1-coated APCs, versus a non-specific method. Anti-CD3 + anti-CD28 coated Dynal beads will be coincubated with the bead-enriched PRl-specific CTL in culture media containing varying doses of IL-2 15 (Garlie et al., 1999; Levine et al., 1998). In controlled experiments, other cytokines such as IL 12 and interferon will be supplemented in order to optimize the number of PRl-CTL (Fallarino et al., 1996). PR1-specificity will be confirmed at the end of culture using PR1/HLA-A2 tetramers and CTL functional activity will be ascertained using standard cytotoxicity experiments against PR1 -coated T2 cells and HLA-A2+ leukemia cell targets. 20 If non-specific expansion of CTL (with anti-CD3 and anti-CD28) is found to be efficient and can maintain PR1-specific CTLs, then this method will also be tested PRlor to bead selection and compared to the PR1-specific expansion method described above. This may eliminate the requirement for further CTL expansion after bead enrichment. These methods, once optimized, can be easily transferred to the clinical setting to treat 25 patients with myeloid leukemia using a Miltenyi MACSTM magnetic bead system to select CD34* progenitor cells from marrow donors for clinical use. Furthermore, these methods may be used to select CTL with different specificities for other tumor antigens, minor antigens, and viral antigens. Such CTL may be elicited and selected in a single step and adoptively transferred using the methods described herein. 30 Based on the techniques described herein efficient clinical scale-up procedures will be determined for adoptive transfer of antigen-specific T lymphocytes.

WO 2005/019435 PCT/US2004/027790 EXAMPLE 4 PRELIMINARY STUDIES 5 Peptide selection and binding assays. In the first step to generating T cells which could be used for adoptive immunotherapy of myeloid leukemias, several peptides derived from the published sequence of Pr3 which were predicted to bind to HLA-A*0201 using a published algorithm (Parker et al., 1994) were identified. This allele was chosen because its high frequency in the US population (49% of individuals) would maximize the therapeutic relevance 10 of any eventual immunotherapeutic strategy. Of the 9 peptides predicted to have sufficiently high binding affinities based on the known HLA-A2.1 binding motif, the two with the highest predicted binding were subsequently synthesized (designated PRI and PR2) (Table 4). The peptides were synthesized by Biosynthesis (Lewisville, TX) to a minimum of 95% purity Table 4: Predicted Binding-Half Life of HLA-A*0201-Restricted Pr3 Peptides 15 Peptide Peptide Sequence SEQ ID NO: Predicted Abbreviation Binding Half-life (minutes) PR1 VLQELNVTV 1 304 PR2 RLFPDFFTRV 3 1169 PR3 VLQELNVTVV 4 215 PR4 NLSASVTSV 5 160 PR5 IIQGIDSFV 6 83 PR6 VLLALLLISGA 7 66 PR71 KLNDILLIQL 8 221 PR7V KLNDVLLIQL 9 220 PR8 QLPQQDQPV 10 66 PR9 FLNNYDAENKL 11 53 Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAPI and TAP2 genes and 20 therefore cannot present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with (p2-microglobulin and increased HLA-A2.1 surface expression, which could be measured using flow cytometry. An HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CalTag Laboratories, Burlingame, CA) was used to measure surface expression of 25 HLA-A2.1. fA;5 WO 2005/019435 PCT/US2004/027790 In the second assay, the dissociation rate of 1 1 25 -labeled (p2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and p2-microglobulin was measured, which allowed calculation of binding half-life (T1/2). The labeled heterotrimer complex was separated from unincorporated (p2-microglobulin by high-performance liquid 5 chromatography gel filtration, and the half-time of dissociation of p2-microglobulin was determined by subjecting aliquots of the complex to a second round of gel filtration. Both PRI and PR2 showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide, as the background for HLA-A2.1 expression, (Table 5). The control influenza peptide is an Influenza B nucleoprotein (aa 85-94; Flu), and Tax is an HTLV-1 peptide 10 (aa 11-19), both with known high binding affinity to HLA-A2.1. The long measured Tv 2 as measured using (p2-microglobulin dissociation confirmed the binding of PRI and PR2 to HLA A2.1. Table 5: Measured Binding of PR1 and PR2 to HLA-A2.1 Peptide Median Channel of T 1 /2(minutes) Fluorescence of HLA-A2 Expression on T2 PRI 294 1460 PR2 273 140 HTLV-1 Tax 8,000 Influenza nucleoprotein 194 Background HLA-A2 22 15 Induction of Primary CTL responses to peptides. These peptides were next used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HL-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL. 20 Briefly, T2 cells (which co-express the costimulatory molecule B7.1) were washed 3 times in serum-free RPMI culture media supplemented with penicillin/streptomycin and glutamine (CM) and incubated with peptide at 20 pg/mL for 2 hr in CM. The peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO). After 7 days in 25 culture, a second stimulation was performed and the following day, 60 IU/mL of recombinant human interleukin-2 (rhIL2) (Biosource International, Camarillo, CA) was added. After 14 days WO 2005/019435 PCT/US2004/027790 in culture a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21 followed on day 22 by the addition of rhIL2. After a total of 27 days in culture, the peptide-stimulated T cells were harvested and tested for peptide specific cytotoxicity toward Calcein AM-labeled T2 cells, leukemia cell lines, and fresh human 5 leukemia cells. FIG. 1 shows the peptide-specific lysis of the CTL lines against T2 cells loaded with either 1.0 tg/mL of PRl or PR-2, or T2 cells without added peptide, at varying effector to target (E:T) ratios. The CTL line generated against the PR1 peptide demonstrated high specific lysis against PRl-loaded target cells, whereas the CTL line generated against PR-2 did not demonstrate any 10 significant cytotoxicity (Molldrem et al., 1996). Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLA-A2.1, was also measured (data not shown) and resulted in < 20% specific lysis at E:T ratios of 50:1 by CTL specific for either PR1 or PR-2. CTL response toward PR1 was shown to be specific for target cells expressing the HLA 15 A2.1 molecule. This and the cytotoxicity observed was HLA-A2.1-restricted. PR1 specific CTL preferentially lyse human myeloid leukemia cells. It was next determined whether the PRI-specific CTL line was capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals. Table 6 lists the HLA type and leukemia type of target cells used. As controls, two cell lines expressing low levels of Pr3 were used: 20 HLA-A2.1 transfected K562 cells and U937 cell line which lack HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2. 1-restricted manner. Cryopreserved bone marrow cells from patients P1 -P4, and marrow cells from a healthy normal volunteer (D2, a bone marrow donor for an allogeneic bone marrow transplant performed on patient P3) were thawed and used as targets for the PR1 -specific CTL line. 25 FIG. 2 shows the combined results of three separate experiments from three PR1-specific CTL lines. In FIG. 2A, the specific lysis by PRl-specific CTL, at various E:T ratios, of either U937 cells, HLA-A2.1-transfected K562 cells, or T2 cells with or without exogenously added PR1 peptide at 1.0 gg/mL is shown. The specific lysis of U937 and HLA-A2.1-positive K562 cells by PRl-specific CTL was lower than the background lysis observed against T2 cells 30 without added peptide (Molldrem et al, 1996). FIG. 2B demonstrates the cytotoxicity of the CTL line against HLA-A2. 1-positive human myeloid leukemia cells. Marrow cells from three patients with CML (P 1, P2, and P3) as well as one patient with AML M4 (P4) were readily lysed, with 53% specific lysis against P1 (a patient with CML in chronic phase) at an E:T ratio of only 6:1 (Molldrem et WO 2005/019435 PCT/US2004/027790 al., 1996). Marrow cells taken from a normal healthy donor (D2) demonstrate only background lysis (< 20% lysis), similar to that of the control T2 cells without added PRI peptide. Table 6: Patient and Donor Cell HLA Types Used For Cytotoxicity 5 Experiments Patient/Donor Cell Description HLA-A HLA-B HLA-DR D1 Normal PBMC 1,2 8,27 3,16 D2 Normal Marrow 2, 26 13, 58 7, 7 U937 Cell Line 3, 3 18,51 14,16 P1 CML-CP 2,28 35,51 9,14 P2 CML-AP 1, 2 63, 63 8, 13 P3 CML-BC 2, 26 13, 58 7, 7 P4 AML 2,3 35, 52 4,13 P5 MDS (RAEB) 2, 24 27, 62 1, 13 Abbreviations: PBMC = peripheral blood monouclear cells; CML-CP = chronic myelogenous leukemia, chronic phase; CML-AP = chronic myelogenous leukemia, accelerated phase; CML-BC = chronic myelogenous leukemia, blast crisis; 10 MDS (RAEB - myelodysplastic syndrome, refractory anemia with excess of blasts. In previous studies, Pr1 specific CTL was found to preferentially inhibit colony forming units in leukemia patient samples, but not in normal donor samples (Molldrem et al., 19997). Cell contact was found to be required for inhibition of CFU-GM, and inhibitory factors elaborated into the supernatant by CTL1 effector cells were not responsible for colony inhibition 15 (Molldrem et al., 1997). Inhibition of CML CFU-GM correlates with Pr3 overexpression in target cells. Target cells were examined for cytoplasmic Pr3 expression by flow cytometry. After permeabilizing the cell membrane, indirect staining was performed using an antibody to Pr3 and a second FITC-labeled antibody, followed by flow cytometry. Table 7 lists the 20 perentage of cells in the sample population that stain positive for Pr3 and the median fluorescence intensity of intracellular Pr3 staining. Median fluorescence intensity of leukemia samples was nearly five times the median fluorescence intensity of normal samples (1399 vs 298, p = 0.009).

WO 2005/019435 PCT/US2004/027790 Table 7: Proteinase 3 Expression in Normal (D1-D5) and Leukemia (P1-P5) Marrow Target Cells Used in Colony Inhibition Studies Patient/Donor % Positive Cells Median Channel Fluorescence CTL1 0 0 CTL2 0 0 Dl 73.4 288 D2 80.8 267 D3 77.6 337 D4 84.5 301 D5 64.6 247 P1 89 1011 P2 98.6 1866 P3 66.2 1437 P4 94.7 1281 P5 87.6 1641 5 Pr3 is highly expressed in leukemia but not in normal CD34 cells. To confirm that Pr3 was expressed in early CD34 positive CML cells, marrow was collected from patients. Marrow was obtained from a patient with CML in BC (P3), and normal CD34 cells for comparison were obtained from G-CSF mobilized peripheral blood mononuclear cells from a 10 normal donor (D3). Cells were first labeled with PE conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA), followed by cytoplasmic indirect staining for Pr3. The inventors have shown that CML blasts that were CD34 positive and highly expressed Pr3 as compared to CD34 negative blasts and normal CD34 positive cells. This shows that very early progenitor cells overexpress Pr3 whereas there is very little Pr3 expression in a small number of normal 15 progenitor cells. Expression of proteinase 3 following transfection into and HMy2.CIR and HMy2.CIR-A2 cells. To provide further evidence that the PRI peptide was processed and presented on the surface of a cell, a human B cell line (that does not express Pr3) was transfected with Pr3 and tested whether PRI specific CTL could lyse the transfected cells. The parental 20 HMy2.CIR cell line, which has lost expression of HLA-A and -B, and the HLA-A2.1-transfected HMy2.CIR cells (named HMy2.CIR-A2), were both transfected with Pr3 as described below.

WO 2005/019435 PCT/US2004/027790 The previously published DNA sequence encoding Pr3 was used to design primers for cloning the cDNA from a normal bone marrow sample (Sturrick et al., 1992). RNA was extracted from normal donor bone marrow cells using the RNA STAT solution (Teltest). One microgram of RNA was reversed transcribed into cDNA using a RT PCR kit (Perkin-Elmer, 5 Norwalk, CT). Half of the iotal cDNA was then amplified using the primers Pr3C-F 5' CTGGACCCCACCATGGCTCA-3' (SEQ ID NO:12) which included the ATG start codon, and Pr3C-R 5'-CGCCACAGTGTTCGGGGAAG-3' (SEQ ID NO:13) and a high-fidelity polymerase (Takara, Madison, WI) according to the manufacturer instructions. The PCR product was cloned into the pCR2 vector using the TA cloning kit (Invitrogen, Carlsbad, CA) and then subcloned 10 into the mammalian expression vector pCDNA3.1 (Invitrogen) containing the CMV promoter and the Zeocin resistance marker. The resulting plasmid DNA was named pRTZ.2. Ten million HMy2.CIR (ATCC, Rockville, MD), or 10 million HMy2.CIR-A2 cells were each washed in phosphate buffered saline (PBS) and re-suspended in 0.8 mL of ice-cold PBS and put into an electroporation cuvette with 20 pig of circular plasmid DNA. The mixture was 15 exposed to an electric pulse of 320 volts at 960 microF and incubated on ice for 10 min. Cells were then added to 10 mL of pre-warmed CM. The following day, the CM was replaced. On day 2, cells were grown under selection conditions using 200 tg/mL Zeocin. Following one week of selection, the cells were subcloned by limiting dilution under Zeocin selection, and 6 clones were isolated. 20 The human B cell line HMy2.CIR-A2 transfected either with the Pr3-containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT, was tested for intracellular Pr3 expression by flow cytometry analysis of as previously described. Two clones with the highest expression are shown in FIG. 3. HMy.2.CIR-A2 cells transfected with Pr3 are susceptible to lysis by PR1 specific 25 CTL. It was next determined whether the transfected HMy2.CIR-A2 cells could be lysed by PR1 specific CTL. The PRI specific CTL were elicited in the manner previously described, and after 22 days in culture were combined at a 25:1 E:T ratio with HMy2.CIR-A2 transfected either with the Pr3-containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT. PRI specific CTL were also combined with control marrow cells from a CML patient in blast 30 crisis (P3), HL-60 cells (which express Pr3, but lack HLA-A2.1), and marrow cells from a normal donor (D3). PRI specific CTL demonstrated 36% specific lysis of the Pr3-transfected cells (clone 1.4), but only background lysis of normal marrow cells, HL-60 cells, HMy2.CIR cells transfected with the empty vector (CAT), and the non-transfected parent B cell line HMy2.CIR (HMY A2; FIG. 4). These results suggest that the PR1 peptide is processed and ,7M WO 2005/019435 PCT/US2004/027790 presented on the surface of the Pr3 transfected HMy2.CIR cells. Although the level of Pr3 expression was lower than that found in leukemia cells, the B cell line may be more efficient at processing and presentation, thus compensating for the lower level of Pr3 expression. PR1-specific CTL identified in PBMC from normal donors by limiting dilution 5 analysis and by using a PR1-HLA-A2 heavy chain tetramer. In order to determine the frequency of PRI-specific CTL in the PBMC of 2 HLA-A2+ normal donors (donors 2 and 3) and one patient with chronic phase CML (donor 1), a modified limiting dilution assay (LDA) designed for detecting low frequency lymphocyte precursors (CTLP) using a limited amount of patient material was used. This assay was used to determine the CTLP frequency (CTLPf) on 10 day 0 and again after 20 days of PR1-stimulated expansion in bulk culture. The details of this assay are described herein. These results were compared to the results of a separate assay, using a reagent where CTL with PRI -specificity can be analyzed by flow cytometry. In this assay, the HLA-A2.1 heavy chain (modified to contain a biotin binding site near the C-terminal end of the A2 heavy chain) plus (p2-microglobulin is combined with the PR1 peptide, which is then 15 combined with streptavidin conjugated to phycoerythrin (PE) (Altman et al., 1996). This "PR1 tetramer" was therefore used to directly label CTL with TCR specific for HLA-A2. 1-bound PRI. FIG. 5 shows that the PR1-tetramer can be used to identify a distinct population of CTL with specificity for HLA-A2. 1-bound PRI amongst a 17 day-old bulk culture of PRi-stimulated PBMC. 20 Selection of a purified population of PR1-specific CTL from bulk culture is possible using a PR1-HLA-A2 heavy chain tetramer. In order to determine whether a purified population of PR1 -specific CTL could be obtained from bulk culture CTL stimulated with PR1, the PRI-tetramer to FACS sort for CTL that expressed PR1-specific TCR was used. In this way, an enriched population of CTL might quickly be obtained without the usual requirement of 25 cloning by limiting dilution followed by expansion, a process that may take several weeks to months. A 32 day-old PRi-stimulated CTL culture was obtained from a starting population of PBMC from an HLA-A2.1+ normal donor using the methods previously described. When the cells were dual-labeled with anti-CD8 and the PR1-tetramer, 4.3% of the bulk culture CTL were 30 double-positive. An aliquot of 5 x 106 CTL was washed three times with PBS and labeled with anti-CD8 conjugated to FITC (Caltag Laboratories, Burlingame, CA) for 2 hr at 4'C. The cells were then washed three times with PBS and labeled with the PE-conjugated PRI-tetramer for 2 hr at 4'C. This was followed by a third labeling with both anti-CD4 and PI which was used as a dump during sorting. The cells were then sorted for dual-staining running CellQuest and '71 WO 2005/019435 PCT/US2004/027790 CloneCyt software. 1.1 x 10 5 CTL were recovered with >95% viability (a yield of 2.2% of the total population, or 55% of the PR1-specific population) and the sorted population is shown in FIG. 6. The sorted CTL were then placed back into culture at 1 x 106 cells/mL of CM 5 supplemented with 10% human serum (Sigma) and 100 IU/mL IL-2 (Biosource International). After 24 hr, the cells were collected and tested for the ability to lyse fresh leukemia target cells. The PR1-sorted CTL were then compared to the non-sorted bulk culture CTL in a 4-hr cytotoxicity assay. Effector cells were washed three times with PBS and co-incubated at E:T ratios of 20:1 to 2.5:1 with target bone marrow cells from an HLA 10 A2.1+ patient with accelerated phase CML and with bone marrow cells from an HLA matched normal donor for 4 hr. Target cells (1000 cells/well) were labeled with Calcein AM for 90 min prior to co-incubation, as in previous experiments. FIG. 7 shows that the PRI-sorted CTL produced significantly greater specific lysis of CML marrow than non-sorted CTL at all E:T ratios, and that background lysis of normal 15 marrow was reduced to near zero. The CTL population depleted of PR1-specific CTL after FACS sorting was also examined for specific lysis of the CML marrow and no specific lysis was found at any E:T ratio. These results demonstrate that the PR1-tetramer can be used to select a homogeneous CTL population with a higher degree of specificity toward leukemia than bulk culture PRl-stimulated CTL. Other investigators studying melanoma antigens have obtained 20 similar results. Using a MelanA/MIART-1-tetramer to sort a polyclonal CTL line, Dunbar et al. (1998) found greater lysis of peptide-coated T2 cells and no background killing compared to non-sorted CTL. Using the PRl-tetramer, a homogeneous population of PRI-sorted CTL could be obtained for use in adoptive immunotherapy to treat patients with leukemia. DNA polymorphism is found within exon 3 of Pr3. Since allogeneic CTL responses 25 directed against leukemia also involve differences in minor antigens (mH) between donor and recipient, the Pr3 coding region was searched for potential polymorphisms. Twenty-eight HLA identical donor-recipient pairs undergoing BMT were studied. DNA was prepared from frozen samples using the Wizard Genomic DNA Preparation Kit (Promega). Each of the 5 exons of Pr3 was amplified using specific primers (Table 8) and analyzed by PCR-SSCP (sequence specific 30 conformational polymorphism). The PCR mixture was then analyzed with only 0.5 mCi of [ 32 p] dATP per reaction. The amplifications were carried out according to the "touchdown" protocol under the conditions summarized in Table 8. PCR products were reamplified with the same primers to which were added an M13 sequencing primer tail (M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO:14) for the 'M7, WO 2005/019435 PCT/US2004/027790 forward primer and M13 Reverse 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO:15) for the reverse primer). The new PCR product was directly sequenced using the ABI Dye primer Cycle Sequencing Kit with the M13-21 and Reverse sequencing primers. Several independent sequences of each of the selected individuals were aligned and compared. 5 Table 8: Oligonucleotide Primers and PCRTM conditions used for the amplification of the PR3 exons Name Amplified Sequence 5'- 3 SEQ Location Size No. of Annealing exon ID (base#)a (bp) Cycles temp (*C) NO: P1-F ACT CAA CTC CGT CTG GCA TT 16 348 15 70-55 P1-R 1 TGA TGA CCT CGT GGT GGA TA 17 548 201 20 55 P2-F GCT CCC TGA CGC CTG GAC TC 18 2801 5 70-65 P2-R 2 ACG GGG CTT AGC TGG GTC CT 19 3097 297 25 65 P3-F CCG GGG AGG ACC CAG CTA AG 20 3072 10 65-55 P3-R 3 GGT CGT GGC CCG GTA TAC AG 21 3496 425 25 55 P4-F TTT GAG GTG GTG GGT GTG GT 22 5137 5 70-65 P4-R 4 AGG CAC AGC ATG AAG CCA CA 23 5561 425 25 65 P5-F TCA GGT GGC CCT GAT GGG TG 24 6577 5 70-65 P5-R 5 TCG AGG GTT TGG AGC CAG GC 25 6840 264 30 65 aAccording to (Sturrock, et al) Genotype of donors and recipients was detennined using Sequence Specific primer (SSP) 10 PCR. The PCRTM products were run in 2% agarose gel stained with Ethidium Bromide. Different patterns between individuals were noted in exons 1 through 4, but only exons 1 through 3 showed differences between donors and recipients of the same pair, as shown in FIG. 8. Since the amplified DNA product also contained portions of the flanking intronic regions and since all of the base differences in the coding region may not result in amino acid differences, the 15 amplified products from donor-recipient pairs showing donor specific bands were sequenced. These results show that the Pr3 gene is polymorphic for the following reasons: (1) The sequences as determined from the intronic regions conflicted several times with the published genomic sequence; (2) two different polymorphic sites were found in exons 1, 2, and 3 that explained the multiple patterns observed on autoradiography; (3) only one DNA polymorphism, in exon 3, was 20 found to encode for an amino acid polymorphism in the deduced amino acid sequence (Table 9). This polymorphism encodes for either an isoleucine (ATT) or a valine (GTT) at position 119 of the amino acid sequence.

WO 2005/019435 PCT/US2004/027790 Table 9 - Polymorphisms in the Pr3 gene as determined by direct gene sequencing Position Base change aa Change Remarks 1 390 CorT No Outside coding Region (5' UT) 2 506 CorT No Outside coding Region (Intron I) 3 | 2827 A or C No Outside coding Region (Intron I) 4 3059 A or G No Outside coding Region (Intron II) 5 3393 AorG Val or Ile 119 Exon 3 6 3456 A or C No Outside codign Region (Intron III) 7 5179 A or G No Outside coding Region (I(ntron III) Found only in one donor Sequencings of the first 4 exons have been submited to Genbank (accession numbers: AF015446; AF015447; AF015448 and AF015449). Aa: amino acid; lie; isoleucine; Val: valine; UT: untranslated. 5 Peptides that span the Pr3 polymorphic site bind to HLA-A2.1. Next, it was determined whether the polymorphism, as discussed above, could lead to the expression of different peptides that could bind to HLA molecules. Anchor motifs contained in the peptides spanning the polymorphic region of exon 3 were then looked for that could bind to several HLA 10 class I molecules including HLA-A1, -A*0201, -A*0205, -A3, -Al1, and -A24. There are two 10 amino acid peptides (KLNDILLIQL (SEQ ID NO:8)) or KLNDVLLIQL (SEQ ID NO:9)), named PR7I and PR7V, respectively) spanning the polymorphic site, at amino acid 115-124 which possess anchor motifs capable of binding to HLA-A2. Both peptides have the same predicted binding half-lives of 705 mn 'and 126 mn for HLA-A*0201 and - A*0205, 15 respectively. The ability of these peptides to bind to HLA-A*0201 was then tested in T2 cells by measuring surface HLA expression. Peptides PR7I and PR7V, together with control influenza peptide, were each pulsed onto T2 cells for 18 hr and the subsequent HLA-A2.1 expression was measured by flow cytometry. T2 cells pulsed with either PR7I or PR7V demonstrated strong 20 peptide binding with fluorescence intensities greater than that of the positive control peptide (Influenza B Nuclear Protein; FIG. 9). Low background MHC class I expression was demonstrated by the low fluorescent intensity of the cells without added peptide. It was previously shown that the PRI self peptide from Pr3 is immunogenic, and these data suggested that T cell responses may be elicited against polymorphic differences in Pr3 as 25 well. These differences may be used as a basis for designing leukemia-specific adoptive T cell therapy of myeloid leukemia. '7A WO 2005/019435 PCT/US2004/027790 EXAMPLE 5 PRI IS DERIVED FROM PROTEINASE 3 AND NEUTROPHIL ELASTASE PROTEINS The leukemia-associated antigen PRI is derived from both proteinase 3 and 5 neutrophil elastase proteins. The inventors have shown that killing of leukemia cells by PR1 specific CTL correlates with P3 overexpression. However, the PRI sequence is also contained within neutrophil elastase (NE), which is also aberrantly expressed in leukemia cells. To determine whether PR1 is processed and presented from either protein, P3- and NE-transfected B cells were used as target cells in a proliferation assay with PR1-specific T cells. Full-length P3 10 and NE cDNA was cloned from the promyelocytic HL-60 cell line based on published sequences. The sequences were subeloned into an EGFP-containing vector (pCMS-EGFP) with a CMV promoter to drive constitutive expression. The B cell line, HMy-CIR, previously stably transfected with the HLA-A*0201 gene, was transfected with P3-pCMS-EGFP and NE-pCMS EGFP by electroporation for 24 hr. GFP-expressing cells (P3-HMy.CIR-A2 and NE-HMy.CIR 15 A2, respectively) were selected by FACSorting and high transfection levels were confirmed by fluorescence microscopy. Quantitative real time-PCR showed mRNA transcripts from one of two selected P3-transfected clones were only 2.6-fold less than HL-60 cells (p = 0.07), and only 1.5-fold less in a second clone (p = 0.3). By contrast, NE transcript numbers from a transfected clone were 7-fold less than in HL-60 cells. Western blotting confirmed protein expression in the 20 NE-HMy.CIR-A2-transfected cells, although expression was similarly less than in HL-60 cells. PR1-specific CTL lines elicited from two healthy donors showed stimulation indices (SI) of 1.3 and 2.4 when co-incubated with P3-HMy.CIR-A2 target cells during BrDU incorporation, confirming that PRI-CTL recognize PR1 peptide processed and presented from P3. Interestingly, PR1-CTL also recognized NE-transfected cells, with SI's of 1.5 and 2.1. No 25 recognition of non-transfectants or parent HMy.CIR (A2-) was observed. These results demonstrated that, in addition to P3, PR1 is also processed and presented by NE, which may result in enhanced immunogenicity of the peptide compared to peptides derived from a single protein. Redundancy of proteins may also lessen the impact of tumor-loss variants after PR1 based immunotherapy.

WO 2005/019435 PCT/US2004/027790 EXAMPLE 6 BMT PATIENTS WITH MYELOID LEUKEMIA TESTED FOR CTL IMMUNITY TO PRI The data in this study support that PR1 could be used as a target antigen to stimulate both 5 active and passive leukemia-specific immunity. In this study, PRI will be given as a vaccine with incomplete adjuvant to boost leukemia immunity, and in additional clinical trials PRI specific CTL will be selected and expanded ex vivo with the PRI antigen for the production of leukemia-reactive CTL. PRI-specific CTL will be used alone or combined with existing treatments, such as allogeneic BMT, to produce a GVL effect. PR-specific donor-derived CTL 10 added to a previously CD3 T cell-depleted graft, for instance, may allow selective GVL reactivity without GVHD. In this study, it has been shown that normal donors have existent CTL immunity to PR1, an HLA-A2-restricted 9 amino acid peptide (aa 169-177) derived from proteinase 3 (Pr3). Pr3 is a protein contained within the azurophil granules of myeloid lineage cells and is overexpressed in many patients with myeloid leukemia. 15 CTL responses to PR1 will be examined by determining CTL precursor (CTLP) frequency using microtiter limiting dilution analysis. As a first step to determining the clinical significance of CTL responses to PR1, blood and bone marrow samples will be examined from patients and their marrow donors prior to transplant, and at three, six, and nine months after transplant. Recently, it has been found that some patients with CML that have had 20 a molecular relapse after allogeneic BMT have both Ph+ and Ph- populations of host-derived hematopoietic progenitors present, and that after DLI alone were given to patients the host derived Ph- progenitors reconstituted normal hematopoiesis. This suggests that the allogeneic DLI that produced the remission might target CML independent of minor antigen differences between the donor and the recipient. If a CTL response to PRI is contained within the GVL 25 response, it is expected that CTLPf would be low in the donor, lower still in the recipient, but that it would increase following BMT. Alternatively, a high CTLPf against PR1 present in the recipient prior to BMT might indicate leukemia immune escape, which could be addressed separately as detailed below. Because of the limited availability of patient material, especially bone marrow, it is important to use the microtiter techniques described herein to determine 30 CTLPf by limiting dilution analysis (LDA) using Terasaki trays. PBMC and BM from HLA-A2.1+ patient samples will be used to test for existing T cell reactivity toward PRl by using a limiting dilution CTLPf assay (Hensel et al., 1999). PBMC and bone marrow mononuclear cells (BMC) will be obtained by Ficoll Hypaque separation and WO 2005/019435 PCT/US2004/027790 either used fresh, or frozen in liquid nitrogen for future use. Samples from HLA-A2.1 positive patients with CML, AML, and MDS will be collected. PBMC and BM from the HLA-matched normal BMT donors to those patients will also be collected, cryopreserved, and assayed as well. The previously frozen samples will be thawed and washed three times in serum-free CM and 5 counted. A total of 19.5 million cells will be prepared for the assay (7.5 million stimulator cells, and 12 million responder cells). One million additional PBMC will be used to generate phytohemagglutinin (PHA-P; Sigma Chemical, St. Louis, MO) stimulated blasts to be used as target cells on day 10 of the assay. One million unrelated HLA-disparate PBMC (third party) will also be used as a positive control, with half of the total number used as stimulator cells and 10 the other half as responder cells. PHA blasts will be generated by placing 106 cells in 1.0 mL of CM supplemented with 10% fetal bovine serum (FBS; Sigma Chemical) in a 25 cm 2 flask. Five tL/mL of PHA-P will be added, and the cells will be cultured in 5% CO 2 at 37'C. On day 4, 6, and 8 of the culture, additional CM + 10% FBS with 5 iL/mL PHA-P and 500 IU/mL rhIL-2 will be added. Cells 15 will be counted and cultures will be maintained at 106 cells/mL. These cells will be used as target cells on day 10 of the CTLPf assay. PBMC responder cells (from patient samples) will be plated into high profile Terasaki Trays (Robbins Scientific, Sunnyvale, CA) at 6 dilutions (from 5 x 10 4 to 5 x 105 PBMC/well) using 24 replicates at each dilution in CM + 10% human AB serum (AB; Sigma Chemical). 20 Third party responders (from normal donors) will be plated at a single dilution (5 x 104 PBMC/well). Patient PBMC stimulator cells will either be pulsed with peptide (PR1 or FLU, the influenza nuclear protein described previously, as a positive control peptide) at 20 pig/mL or no peptide for 90 min at 37'C, washed once with serum-free CM, then irradiated with 2500 cGy. These cells will then be plated into the wells containing the responder cells, as well as 24 25 additional wells of stimulators alone. On days 3 and 7, 60 IIJ/mL of IL-2 will be added to each well. On day 10 the previously prepared PHA blasts from the same patient (as target cells) will either be pulsed with PRI at 20 mg/mL or no peptide for 90 min at 37'C, washed once with serum-free CM, and then labeled with Calcein AM (Molecular Probes, Eugene, OR) as described in the cytotoxicity experiments above. One thousand target cells per well will be plated, lightly 30 centrifuged at 800 rpm for 1 min, and then cultured in 5% CO 2 at 37'C for 4 hr. Five microliter of Fluoroquench EB Stain-Quench Reagent (One Lambda, Canoga Park, CA) will be added to each well, and the plates will be analyzed for fluorescence emission using an automated Lambda Scan (One Lambda, Canoga Park, CA).

WO 2005/019435 PCT/US2004/027790 The mean plus 3 standard deviations of the 24 wells containing the stimulators alone will be determined as the cut-off value for background fluorescence. Any experimental well less than the cut-off value will be considered positive for lysis, and from the fraction of negative wells at the various responder cell dilutions, the frequency of CTLP will be calculated using the 5 maximum likelihood method based on Poisson probabilities. The calculated CTLP frequencies will then be analyzed with respect to the amount of Pr3 expression in the patient's blast populations, since the amount of specific lysis of PR1-specific CTL in normal donors correlated with the amount of Pr3 overexpression in the target leukemia cells in the previous studies (Molldrem et al., 1996). 10 Determining the percent of PBMC and BM specific for the PRI peptide. CTL responses to PRI will be examined determining the percent of peripheral blood mononuclear cells (PBMC) and bone marrow cells (BM) that are specific for the HLA-A2.1-bound PR1 peptide by FACS analysis using a specific PR1-HLA-A2 tetramer (PR1-tetramer) linked to phycoerythrin (PE). The PRl-tetramer will be used to identify the fraction of CTL that recognize 15 HLA-A2-bound PRI in patient and donor PBMC and BM before transplant and again 6 months after transplant. This will be easier to study using patients that receive peripheral blood grafts since more patient material is available for the larger number of lymphocytes needed for flow cytometry determination of the percent of PRl-specific CTL. PR1 -specific CTL, determined using the combination of PR1-tetramer plus CD8, will be 20 analyzed by using three and four color FACS analysis to simultaneously determine the phenotype of the PRl-specific CTL. The cells will be analyzed for state of activation using CD28, CD69, and CD25. Memory CTL will be evaluated using CD45RO antibody. It is important to determine whether any PR1-specific CTL that are found in the leukemia patients are memory cells in an inactivated state which would suggest either that the leukemia is not a potent 25 immunogen or perhaps the CTL are incapable of responding. By also determining Pr3 expression and surface phenotype of the leukemia cells (including MHC I and II, - CD40, CD54, CD80 and CD86), immunogenic potential can be better assessed. Since the precursor frequency of PRI -specific CTL is quite low even in the normal donors previously examined, PRI -specific CTL may not be detectable by FACS analysis because of the 30 low total number of cells available in the patient samples. In addition, patient lymphocytes may be incapable of responding to PRI peptide due to tolerance or anergy. By expanding PR1 specific CTL lines in vitro using T2 cells pulsed with PRI peptide this possibility will be investigated. Starting with cryopreserved patient PBMC and BM, 10 million mononuclear cells will be thawed and washed 3 times with PBS. These cells will be placed into culture with 5 to '7R WO 2005/019435 PCT/US2004/027790 10 million T2 cells (previously pulsed with 10 pg/mL of PRI for 90 min at 37C) in CM + 10% HS at 37'C and 5% C02 for one week and then re-stimulated with PRI -pulsed T2 cells on day 7. On day 8, IL-2 at 20 IU/mL will be added to the cultures and this process will be repeated at two and three weeks of cell culture. The cells at the end of three weeks in culture will be collected 5 and used in micro-cytotoxicity assays using Calcein AM-labeled T2 cells as targets. T2 target cells will be pulsed with 10 pg/mL of PR1, control Flu peptide, or no peptide for the cytotoxicity assays. A CTL line established from an HLA-matched normal donor using the same methods will be used as a positive control in the cytotoxicity assay, since this is an established method. CTL responses to PRI will be examined determining the frequency of cells secreting 10 cytokines in response to PRI peptide recognition using the ELISPOT assay. Cytokine secreting cells will be measured in response to PRI -coated targets by using the ELISPOT assay. Recent clinical trials have used methods such as precursor frequency analysis by limiting dilution based on cytotoxicity ( 51 Cr), lymphocyte proliferation (3H thymidine uptake), as well as cytokine responses by measuring single cell interferon-y or TNF-a secretion (using the 15 commercially available ELISpot assay, Mabtech, Nacka, Sweden). Each of these methods measure different lymphocyte functional responses, and clinical response to tumor vaccines does not always correlate with these in vitro measurements (Nelson et al., 166; Rosenberg et al., 1998). Lalvani et al. (1997) have determined, using the enzyme-linked immunospot (ELISPOT) 20 assay, that memory CD8+ T lymphocytes are capable of rapid effector function (i.e. 24 hr) when triggered with exposure to cognate peptide in the absence of cytokines. The frequency of CTL as measured by ELISPOT has been shown to correlate closely with the number of CTL that stain with peptide-specific tetramers in FACS assays (Dunbar et al., 1998), although limiting dilution assays (LDA) often yield lower frequencies by comparison. Others have found that 14-day 25 expansions of PBMC against peptide-coated target cells results in a better correlation of LDA with the ELISPOT assay (Scheibenbogen et al., 1997). These results suggest that LDA, which is highly dependent on culture conditions and relies on the presence of proliferating cells, may underestimate the actual number of peptide-specific CTL present. ELISPOT assays will be performed in 96-well polyvinylidene difluoride backed plates 30 (MAIP S 45; Millipore, Bedford, MA). These wells will be coated with 15 pg/mL of anti-IFN-y mAb 1-DIK (Mabtech, Stockholm, Sweden) overnight at 4'C. Plates will be washed 6 times with CM and blocked with CM + 10% HS for 1 hr. PBMCs will be thawed and washed 3 times with PBS and suspended in CM + 10% HS. PBMCs will be added in 100 jtL CM + 10% HS per '70 WO 2005/019435 PCT/US2004/027790 well to the precoated plates at 5 x 10 5 /well, in duplicate wells. For assays performed in parallel with CTLPf by LDA, duplicate wells with 5 x 10 5 and 2.5 x 10s PBMCs/well will be used. Detection of peptide-specific T cells from freshly isolated PBMCs will be performed using autologous PBMCs themselves to present PR1 peptide. This will avoid responses been 5 elicited from T cells of other specificities if heterologous B cell lines (such as EBV-transformed lymphocytes) were used as target cells for peptide presentation. Peptides will be added at 10 [tg/mL. T2 cells will be used in some assays as target cells and compared to the autologous PBMCs. In this case, T2 cells will be pulsed with 10 ptg/mL of PR1 peptide for 90 min and washed 3 times prior to plating with responder PBMCs. 10 The plates will then be incubated for 6 hr at 37'C, 5% C0 2 and then arrested by shaking off the contents and washing 6 times with PBS 0.05% Tween 20 (Sigma Chemical, St. Louis, MO). Next, 100 ptL of 1 tg/mL of the biotinylated anti-IFN-y mAb 7-B6-1 biotin (Mabtech, Stockholm, Sweden) will be added. After 3 hr of incubation, plates will be washed six times more and a 1:1000 dilution of streptavidin alkaline phosphatase conjugate (Mabtech) will be 15 added to the wells and the plates then incubated at room temperature for a further 2 hr. Next, the wells will again be washed 6 times and 100 tL of chromogenic alkaline phosphatase substrate (Bio Rad Labs, Hercules, CA), diluted 1:25 with deionized water, will be added. After 30 min, the colorimetric reaction will be terminated by washing with tap water and the plates will be air dried. 20 Enumeration of the IFN-y-producing spot-forming cells (SFCs) will be performed using a stereomicroscope under magnification of 20. Only large spots with fuzzy borders will be scored as SFCs as per convention (Klinman, 1994). Responses will be considered significant if a minimum of five SFCs are present per well, and additionally, this number is at least twice that in negative control wells (without added peptide). Counting SFCs allows the added advantage of 25 estimating the frequency of responding CTL. If no SFCs are seen, then the time of exposure to peptide will be increased in a time course experiment up to 48 hr. If no SFCs are yet produced, this could be an indication that a secondary response could not be produced and a primary response will be investigated. In this case, PBMCs will be pulsed with PR1 peptide and exposed as stimulators to autologous PBMCs at a 30 1:1 responder: stimulator ratio on two occasions over 7 to 10 days with low-dose IL-2 added to each well at 60 IU/mL before the ELISPOT assay is performed. In addition, since others have demonstrated that TNF-ca is sometimes produced by greater numbers of peptide-specific CTL than y-IFN, the ELISPOT technique will also used to quantify the number of SFC in a TNF-a assay under similar conditions (Herr et al., 1996). By making use Qn WO 2005/019435 PCT/US2004/027790 of the Perseptive Biosystems Cytofluor 4000 plate reader requested in the budget of this proposal, the CTLP frequency by LDA, cytotoxicity experiments, and ELISPOT assays can all be performed using this same instrument (Herr et al., 1997). Evaluation of Pr3 expression and surface phenotype of myeloid leukemia target 5 cells. Cytoplasmic Pr3 expression will be determined in BMC from each of these patient samples, based on cytoplasmic staining and subsequent analysis using flow cytometry using the method previously described (Molldrem et al., 1996). Cells will also be surface-labeled with anti-CD33, CD34, and CD14 monoclonal antibodies (Becton-Dickinson, San Jose, CA) in order to correlate the. developmental stage of the blast population with Pr3 expression. In addition, 10 cells will be labeled for MHC class I and II, CD80 (B7.1) (ImmunoTech S.A., Marceilles Cedex, France), CD86 (B7.2) (ImmunoTech), and CD54 (ICAM-1) (Becton Dickinson) to evaluate the potential of the blasts as suitable CTL targets. Three color staining will allow for cell subset analysis. One million cells will be studied for each combination of antibodies. The cells will be washed in serum-free CM, permeabilized using Ortho PermeaFix for 30 min at room 15 temperature, washed twice in serum-free CM, and then indirectly stained with an antibody to Pr3 (Accurate Chemicals, Westbury, NY) and a secondary FITC-conjugated antibody. This will be followed by an additional wash with serum-free CM and surface labeling of the other markers using direct staining with PE- or APC-conjugated antibodies at 4CC. As previously discussed, a high CTLPf in the recipient pre-BMT may indicate leukemia 20 immune escape. This may be due to decreased expression of MHC 1 (Dermime et al., 1997, decreased co-stimulatory molecules (Matulonis et al., 1995; Boussiotis et al., 1995), decreased Pr3 expression in the leukemia (Molldrem et al., 1996), or possibly a TCR signaling defect in the CTL (Boussiotis et al., 1996). In addition, a failure to increase CTLPf after BMT may also be due to any of these mechanisms. By examining expression of these molecules and correlating 25 CTLPf with the number of PRI-specific CTL present by PRI-tetramer labeling, insight into possible failure of a CTL immune response to PRI will gained. For instance, a low CTLPf but a high percent of PRI-specific CTL by flow cytometry may indicate a defect in CTL target recognition, which may be further investigated by examining TCR ~ chain tyrosine phosphorylation by Western blot analysis. 30 Humoral immune responses to Pr3 will be examined by measuring antineurophil cytoplasmic antibody (ANCA) titers. In Wegener's granulomatosis, the ANCA IgG titer correlates closely with disease activity. Since T lymphocytes taken from biopsy sites of active vasculitis in these patients show proliferation in response to Pr3, and since T cell help is required Q1 WO 2005/019435 PCT/US2004/027790 for IgG production, it is possible that measuring ANCA titers may be an indirect measure of Pr3 directed activity of T lymphocytes. ANCA titer has not been formally examined in patients with myeloid leukemia. An inexpensive and reliable assay is commercially available and used in clinical laboratories to 5 evaluate ANCA titers. ANCA titers will be determined in all myeloid leukemia patients enrolled on phase I/II clinical vaccine trials as well as the transplant patients and their donors will be investigated using the above assays to measure cellular immunity. Patients of all HLA types will be evaluated for ANCA positivity. EXAMPLE 7 10 DETERMINING WHETHER PRI CAN ELICIT SPECIFIC ANTILEUKEMIA IMMUNITY IN PATIENTS WITH MYELOID LEUKEMIA It was next determined whether PR1 can be used to elicit specific antileukemia immunity in patients with myeloid leukemia. Leukemia offers several advantages as a model disease for 15 vaccine development and evaluation. First, since the leukemia cells circulate in the peripheral blood the tumor cells are readily available for study without the need for repeated invasive biopsies which allows for close monitoring of any changes in the tumor phenotype. In addition, the lymphocytes under study also reside in the peripheral blood in constant contact with the malignant cells. These are obvious advantages to the study of immune responses in the 20 treatment of solid tumors. Enhancing CTL reactivity by PRL. A phase I/II clinical protocol using the PR1 peptide in combination with incomplete Freund's adjuvant (IFA) will be employed to vaccinate patients with myeloid leukemia to determine whether CTL reactivity to PRI peptide can be enhanced by subcutaneous vaccination with the PR1 peptide combined with incomplete Freund's adjuvant 25 (IFA) every 3 weeks for 3 injections. CTLP frequency will be measured in PBMC and BM before and after vaccination using microtiter limiting dilution analysis. IFA has been used in one successful clinical trial using gp100 to vaccinate patients with melanoma (Rosenberg et al., 1998). Up to 60 HLA-A2+ patients (as confirmed with BB7.2 antibody labeling) with CML, 30 AML, and MDS will receive a deep subcutaneous injection every 3 weeks for 9 weeks. Patients will be randomized to three dose levels of the PR1 peptide (0.25 mg, 0.5 mg, and 1.0 mg) with a fixed amount of IFA, and then followed in cohorts of 4 for toxicity and evidence of an immune response to PR1 as measured in vitro using the CTLPf assay by LDA. Patients will be randomized to three different doses of vaccine, since it is not clear that increased dose will result O11 WO 2005/019435 PCT/US2004/027790 in a greater anti-tumor response. In fact, if toxicity of a vaccine is related to the augmentation of the immune response, that augmentation may be elicited by repeated immunization rather than increasing the dose of the immunizing antigen. The "dose escalation" of a vaccine may not lie in the quantity of peptide delivered, but rather in the number of exposures to antigen, i.e. the 5 number of immunizations. In fact, in a study of immunization with TCR derived peptides for the treatment of multiple sclerosis there was an indication that the peptide-specific T cell immune response was suppressed when the amount of peptide injected was greater than 1000 Ig (Bourdette et al., 1994). In addition, immune responses will be investigated using the PR1-tetramer. A one log 10 increase (compared to study entry) in CTLPf, or any increase in the percent of PR1 -specific CTL by FACS analysis measured at any time over the 9 weeks will be considered evidence of an immune response to PR1. These assays will be performed using samples of bone marrow and peripheral blood from patients enrolled on this protocol. Standard criteria for complete and partial remissions will be used to judge clinical responses. 15 Using the methods described, the CTLPf (by LDA) and the percent PR1-specific CTL measured using the PR1-tetramer will be used to assay immune responses in the patients. Approximately 20 million PBMC will be used in both assays derived from 100 ml peripheral blood samples before and 3 weeks after th.e last vaccination. Further experiments will be performed to evaluate any non-responsiveness found using both these assays. 20 An important aspect in the design of any phase I/II cancer vaccine trial targeting a self tumor antigen is the selection of the patients to be immunized. Toxicity such as vasculitis is possible and therefore patients with advanced stage leukemia will be eligible for this initial study. However, determination of safety requires that an immune response be mounted, and far advanced patients often lack a competent immune response. Therefore, patients with all types of 25 mycloid leukemia at various stages of disease including patients with chronic phase CML who will have a stable low-leukemia burden and normal lymphocyte counts will be examined. It is anticipated that the chronic phase CML patients will be those without the option of of allogeneic BMT, who may be failing other forms of therapy such as interferon with or without chemotherapy, and who are therefore terminally ill. Patients with CML offer the further 30 advantage over solid tumor patients that molecular studies of the amount of Ph chromosome can be used to judge responses in the chronic phase patients with low tumor burden. PCR analysis, which is performed routinely on all CML patients to follow the disease course, will be performed at 3-week intervals during the course of the study, and again one month after the last vaccine.

WO 2005/019435 PCT/US2004/027790 In order to increase the likelihood of producing an immune response against the leukemia, a subcutaneous injection of 75 ptg of GM-CSF will be administered into each vaccine injection site to enhance the adjuvant effect. GM-CSF as an adjuvant has produced greater immune responses in animal models of other hematological malignancies (Kwak et al., 1996). 5 Phase I trials using bcr-abl junction region peptides to vaccinate patients with CML are being conducted by other investigators. These investigators are using a combination of 5 HLA A3 and HLA-All-restricted peptides from the b3a2 translocation region with the adjuvant QS-21 in a dose-escalation trial design starting with 10 ptg of peptide. Thus far, 5 patients treated with 10 pig and 5 patients treated with 30 pg (the next dose level) have not had any clinical response 10 to the vaccine. By using the conventional 51 Cr-release cytotoxicity assay, these investigators have not found in vitro evidence of an immune responses to the peptides thus far. Thus, as provided in the present invention, the PR1 peptide vaccine has greater potential to elicit immunity compared to bcr-abl junction region peptides for several reasons. First, the pre-clinical data regarding ber-abl junction region peptides indicates that CTL elicited in vitro 15 against these peptides do not demonstrate cytotoxicity against fresh leukemia target cells, but only to leukemia cells that have been pre-pulsed with the target peptides. In contrast, PR1 specific CTL show cytotoxicity and leukemia progenitor inhibition of fresh leukemia cells with no prior peptide labeling of the target cells (FIG. 2). Second, clinical trials showing responses to melanoma peptide vaccines have used 10-fold higher peptide doses to vaccinate patients than 20 what is used in the b3a2 peptide vaccine trial. The PR1 vaccine trial will use peptide doses similar to those used in the melanoma vaccine trials. Third, the 5Cr-release CTLPf by LDA that was used to evaluate an immune response to the b3a2 peptides is less sensitive than the mirco titer CalceinAM-based assay of the present invention. Lastly, the PRI vaccine trial will include patients with all types of myeloid leukemia, thereby broadening the opportunity to find immune 25 responses. Potential non-responsiveness to PR1 will be evaluated by generation of PRi-specific T cells in myeloid leukemia patients. In this phase I/II study, whether PR1-specific CTL responses can be elicited in patients by using the peptide vaccine will be determined. In those patients where no immune response is elicited, or in those patients that develop an immune 30 response but do not have a clinical response to the vaccine, it will be important to know whether PRl-specific CTL from those patients can recognize and/or kill autologous leukemia cells. These patients will be investigated further to determine whether a PR1-specific CTL can be elicited from PBMC in vitro using methods described herein. In these patients it is expected that

QA

WO 2005/019435 PCT/US2004/027790 a PR1-specific CTL will not be elicited in vitro, or any CTL that could be expanded might not be able to recognize or kill the leukemia. PBMC from amongst patients with CML, AML, and MDS that do not develop an immune response to the vaccine will be selected in order to identify any differences based on 5 disease. Fifty million T2 cells will be washed in serum-free CM three times and suspended at 10 x 106 cells/mL in 50 mL conical tubes. PRI peptide, synthesized to >95% purity (Biosynthesis, Lewisville, TX), will be added to the T2 cells at 10 tg/mL and the T2 cells will be placed in a humidified incubator at 37'C for 90 min. The PR1-pulsed T2 cells will be irradiated with 7500 cGy, washed twice with serum-free CM, and combined at a 1:1 ratio with patient PBMC in 50 10 mL of CM + 10% human AB serum (10% AB) and placed in a 75 cm 2 tissue culture flask. Media will be replaced as necessary, and at day 7 the PBMC will be washed with CM + 10% AB and recombined at a 1:1 ratio with fresh T2 cells (similarly pulsed with PRI, irradiated, and washed). On day 8, 20 IU/mL of recombinant human interleukin-2 (rhIL-2) (Biosource International, Camarillo, CA) will be added to the culture. After 14 days in culture a third 15 stimulation will be performed with PR1 -pulsed T2 cells, followed on day 15 by addition of rhIL 2. A fourth stimulation will be performed on day 21 followed on day 22 by the addition of 20 1U/mL rhIL-2. After a total of 25 to 27 days in culture, the PRI-stimulated T cells will be tested for peptide-specific cytotoxicity toward T2 cells and leukemia cells from autologous and allogeneic BMC. 20 A semi-automated mircotiter cytotoxicity assay, identical to that used in the previously published studies, will be used to determine specific lysis. Effector cells grown in the presence of PR1-pulsed T2 cells will be prepared in doubling from 6 x 10 3 to 25 x 103 cells/well and will be plated in 40 gL, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, CA) with six replicates per dilution. Target cells (T2 cells + PRI, autologous marrow-derived leukemia 25 cells, or marrow derived from normal donors) will be thawed and washed three times in serum-free CM then suspended at a concentration of 2 x 106 cells/mL and stained with 10 mg/mL of Calcein-AM (CAM; Molecular Probes Inc, Eugene, OR) for 60 min at 37'C. After washing three times in CM + 10% AB, target cells will be resuspended at 105 cells/mL. Wells with target cells alone and medium alone will be used for maximum (max) and 30 minimum (min) fluorescence emission, respectively. After 4 hr incubation at 37'C in 5% C0 2 , 5 pL FluoroQuench EB Stain-Quench Reagent (One Lambda, Inc, Canoga Park, CA) will be added to each well and the trays will be centrifuged for 1 min at 60g before measurement of fluorescence using an automated Lambda Fluoroscan (One Lambda, Inc). A decrease in the fluorescence emission is proportional to the degree of lysis of target cells, R ZZ WO 2005/019435 PCT/US2004/027790 once the hemoglobin contained in the FluoroQuench reagent quenches the released dye. The mean and standard deviation fluorescence from the 6 wells at each E:T ratio will be calculated, and the percent lysis will be calculated. PR1 specificity will be confirmed by using Flu peptide-coated T2 cells as a negative 5 control target cell population in the cytotoxicity assay. Autologous BMC and HLA-A2+ BMC from a normal donor will be prepared similarly and also used as target cells to test for leukemia-reactivity. In addition, patient PBMC will be used in parallel to generate Flu specific CTL lines which will be similarly tested for lysis of Flu peptide-coated T2 cells. In the case where CTL immunity is preserved against the Flu peptide, but can not be elicited 10 against PRI, then comparison to any existent pre-vaccine PRI immunity (as measured by CTLPf, PR1-tetramer positive CTL, or PRl-specific CLT by ELISPOT) would assess the development of tolerance toward PR1. To confirm HLA-A2.1 specificity in these experiments, 100 pL/mL of the HLA-A2 specific blocking antibody BB7.2 (ATCC; Rockville, MD) will be co-incubated with 1 x 106 15 PR1-coated T2 cells for 30 min at 37'C prior to coincubation with effector cells. Starting PBMC and resultant T cell populations will be phenotyped for T cell subsets using the PR1 tetramer, anti-CD3, CD4 + CD8, CD3 + CD16 + 56, and anti-TCR-ap (Becton Dickinson). In order to elicit autologous PR1-specific cytotoxicity in vitro, an alternative approach that may be used will employ PR1-pulsed dendritic cells (DC) derived from 20 adherent PBMC populations and grown for 7 to 10 days in IL-4 and GM-CSF in place of T2 cells to stimulate responder CTLs using PBMC from these patients (Nestle et al., 1998). In patients where a loss of immune response to PRI is found, 100 p1 of blood will be collected and PBMC isolated over a Ficoll-Hypaque density gradient as previously described. PBMC will be allowedto adhere to a plastic 75-cm 2 flask for 2 hr at 37 0 C. Non-adherent cells will 25 be removed, and the adherent cells will be cultured for 7 days with GM-CSF (800 U/mL; Sandoz, Germany) and IL-4 (500 U/mL; PharMingen, Hamburg, Germany). Phenotypic changes will be monitored by light microscopy and flow cytometry will be performed to confirm the DC phenotype. Cells will be evaluated for high levels of HLA class I, HLA class II, and costimulatory molecules (CD80 and CD86) as previously described. PRI will 30 be used to pulse dendritic cells (DC) derived from the peripheral blood of normal donors, and these PRI-pulsed DC will be used like T2 cells in previous experiments to elicit PR1 specific CTL. PRI-specific lysis will be evaluated using these DC-generated CTL using assays discussed previously and compared with T2-generated CTL.

QK

WO 2005/019435 PCT/US2004/027790 In additional experiments Pr3 expression in patient BMC will be evaluated after the addition of interferon-y, interferon-oc, and GM-CSF. These cytokines are known to increase T cell MHC molecules and co-stimulatory molecules (Tsukada et al., 1997) and also increase Pr3 expression (Mayet et al., 1997; Sibelius et al., 1998). Thus, cytokine co-administration 5 might lead to more effective anti-PR1 immunity (Dermime et al., 1997). To determine whether a FACS-sorted population of PR1-specific CTL from HLA A2 donors can produce enhanced lysis of autologous and allogeneic leukemia cells. As indicated in FIG. 17, the PRI-tetramer may be used to FACS sort for a homogeneous population of PRI-selected CTL that show high specific lysis of leukemia with no 10 background lysis of normal marrow cells. Therefore, the PRI-tetramer will be used in the present invention to FACS sort homogeneous population of CTL from bulk culture CTL lines established at 2 to 3 wk of culture. These CTL lines will be generated using PBMC from HLA-A2. 1+ patients with CML and AML as well as normal donors using PR1-pulsed T2 cells as antigen presenting cells. Using the PR1-tetramer, these cells will be FACS sorted 15 and their state of activation and phenotype will be compared (by measuring CD28, CD69, CD25, and CD45RO) and their ability to lyse PR1-coated T2 and fresh autologous and allogeneic leukemia cells. The results of these cytotoxicity experiments will be compared to the results obtained with bulk culture CTL as well as the population of CTL left behind after the sort procedure. 20 PR1-sorted CTL that demonstrate cytotoxicity toward the leukemia cells, will also be evaluated for their ability to inhibit leukemia CFU-GM and normal HLA-A2.1+ CFU-GM using normal donor bone marrow cells and the methods previously described. The PR1-sorted CTL, as shown in FIG. 16, contain some CD8+ cells that do not have apparent specificity for PR1. However, a much more homogeneous population of PR1-specific 25 CTL are obtained using the PR1-tetramer, which will allow for more efficient cloning of these cells. Cells will be cloned by limiting dilution according the Poisson distribution where 0.3 cells/well will be plated into 96 well plates containing 1 x 105 allogeneic PBMC (previously radiated with 7,500 cGy) in 300 pL CM + 10% HS and 60 IU/mL IL-2. These wells will be placed at 37'C and 5% CO 2 for 7 to 10 days. Media will be replaced after 7 to 10 days and wells 30 that contain growing cells will be expanded and subsequently studied for specific lysis of PR1 coated T2 cells as previously described. These clones will also be evaluated for phenotype using the above antibodies. R'7 WO 2005/019435 PCT/US2004/027790 Clones obtained using these methods will be used to investigate the Hmy2.CIR-A2 transfectants and other cells transfected with the Pr3 gene as discussed elsewhere in this application. Similar to that demonstrated in previous studies (Molldrem et al., 1999), CTL from a 5 patient with CML that demonstrate high specific lysis of PRi-pulsed T2 target cells was not elicited. Therefore, to overcome the apparent non-reactivity to this self-peptide in patients with leukemia FACS-sorted populations of PRl-specific CTL from normal donors will be investigated. Normal donor-derived allogeneic PRI-specific CTL that are FACS sorted using the PR1 10 tetramer may be used for the safe adoptive transfer into leukemia patients selected only for the HLA-A2.1 allele as demonstrated using CTL specific for adenovirus-associated tumors in mice (Toes et al., 1996). This type of allogeneic therapy might allow for selective killing of host leukemia without the requirement of a traditional bone marrow transplant and without the re quirement of a fully HLA-matched donor. 15 EXAMPLE 8 IDENTIFYING POTENTIAL HLA-A2.1-RESTRICTED PEPTIDE EPITOPES IN PR3 TO ELICIT LEUKEMIA-REACTIVE HUMAN CTL USING IMMUNOLOGICAL METHODS To determine whether CTL reactivity can be elicited against the remaining self 20 peptides contained within Pr3 that are predicted to bind to HLA-A2.1. The development of effective peptide vaccines for leukemia will likely involve the identification of several peptide epitopes, since a single peptide might not be immunogenic in all individuals. It is likely that other peptides within Pr3 will also elicit CTL immunity, and using the same methods to find the PR1 peptide, seven additional peptides within Pr3 have been identified that contain the HLA 25 A2.1 binding motif (Table 4, PR3-PR9). These peptides have been identified to 95% purity (Biosynthesis Co.) and tested for HLA-A2.1 binding by performing flow cytometry for HLA A2.1 expression on peptide-coated T2 cells using methods previously described. These peptides will be used to elicit CTL where peptide-coated T2 cells are radiated, pulsed with peptide, and used to stimulate PBMC from normal donors. These resultant CTL lines will be tested first for 30 peptide-specific recognition of peptide-coated T2 cells (compared to non-coated T2), and then for lysis of fresh HLA-A2.1+ BMC from leukemia patients (compared to BMC from normal HLA-A2.1+ donors). Blocking studies with antibody to HLA-A2.1 (BB7.2) and irrelevant Flu peptide-coated T2 cell targets will be used to confirm the allele-specificity in cytotoxicity assays. Q2 WO 2005/019435 PCT/US2004/027790 The relative binding affinities to HLA-A2.1 of these peptides compared to PR1 will be determined by incubating serial dilutions of PR1 plus each peptide with T2 cells and analyzing for surface HLA-A2.1 expression by flow cytometry. In this way, an IC 50 value will be determined for each peptide. 5 Since the peptides predicted to bind to HLA-A2.1 in Table 4 might be subdominant epitopes, CTL immunity toward peptide-pulsed T2 cells might be easily elicited but subsequent immunity toward HLA-A2.1+ leukemia targets might be lacking. In this circumstance, autologous dendritic cells will be substituted as antigen presenting cells for the T2 cell line and the resulting CTL will be examined for cytotoxicity toward HLA-A2. 1+ leukemia targets. 10 For the peptides PR5-6 and PR8-9 that have relatively lower predicted binding affinities to HLA-A2.1, if only weak immunity toward peptide-pulsed T2 cells is elicited, substitutions will be made in the HLA-A2.1 anchor positions. At positions 2 and 9 of the peptide, leucine and methionine or valine and leucine will be substituted for the existing amino acids and these peptides will be used to elicit CTL immunity again using T2 cells. These amino acids are 15 known to be relevant for high affinity binding to the HLA-A2.1 allele (Rammensee et al., 1995), and substitution of anchor amino acids has been shown to increase CTL lysis of the peptide-coated target cell (Parkhurst et al., 1996), presumably because of more stable binding of the peptide to the MHC class I heavy chain (Sette et al., 1994). Peptides that do not elicit any immunity will be considered not to be within the TCR repertoire of the donor PBMC. 20 To determine whether CTL reactivity to the PR1 peptide can be enhanced by single amino acid substitutions in the HLA-A2.1 anchor motif positions. As previously stated, it is known that certain amino acid substitutions in a peptide may enhance binding of the peptide to HLA-A2.1, which may subsequently enhance target recognition by CTL (Rosenberg et al., 1998). Thus, homologous PR1 peptides that contain single or double amino acid substitutions 25 at the HLA-A2.1 anchor residues will be used to coat T2 cells and test for specific lysis. These peptides (Table 10) are predicted to have higher binding affinities to HLA-A2.1 based on the same algorithm used to predict the PR1 and PR2 peptides (Parker et al., 1994). These peptides will be synthesized (Biosynthesis Co.), tested for HLA-A2.1 binding using T2 cells, and tested in the mini-cytotoxicity assay where specific lysis will be compared to native PRl-coated T2 30 cells using TCL that are PR1-specific. The PR1-specific bulk culture CTL will be generated using the methods described herein. If any additional HLA-A2. 1-binding peptide from Table 10 is found that can be used to generate CTL responses, then combinations of PRI with this peptide will be used to coat T2 target cells to test for specific lysis. Using CTL specific for this peptide, T2 cells will be 2o WO 2005/019435 PCT/US2004/027790 coated with a fixed concentration of the peptide at 10 pg/mL, plus serial dilutions of PRi (0.1 to 50 pig/mL) to test for potential interference with TCR recognition, as measured by reduced specific lysis at fixed E:T ratios. The results of these experiments plus the IC 50 of each of the peptides will be used to make comparisons of which are the possible dominant and 5 subdominant peptides. This will be used to develop vaccines using combinations of peptides to stimulate CTL immunity (Nestle et al., 1998). If peptides used to coat T2 cells from Table 10 do not result in greater cytotoxicity over PRl-coated T2 cell targets, then PR1 -specific CTL that are obtained after PR1-tetramer sorting will be studied for their ability to recognize and lyse the PRl-variant peptide-coated T2 cells. 10 Because these cells are a much more homogeneous population of CTL, they are expected be a more sensitive indicator of improved CTL immunity. Table 10: Synthetic PR1-Like Peptides with Amino Acid Substitutions Peptide Name Amino Acid Sequence SEQ ID NO: Predicted Binding Half-Life (minutes) PRI VLQELNVTV 1 304 PRlV6 VLQELWTV 26 1115 PRIK8 VLQELNVKV 27 485 PRlV6K8 VLQELWKV 28 1115 PR1M2V6 VMQELWTV 29 805 15 To determine whether the HLA-A2.1-restricted peptides spanning the known single amino acid polymorphism in Pr3 can be used to elicit CTL immunity from the PBMC of donors that possess the opposite polymorphism. Based on previous studies, a polymorphism in the third exon of Pr3 was found that encodes for a single amino acid difference in peptides that can bind with high affinity to HLA-A2.1. The amino acid difference does not involve 20 HLA-A2.1 the anchor regions, but it likely involves the region of the peptide recognized by the TCR. This polymorphism may therefore represent a new minor antigen that is restricted to hematopoietic tissue, and provide an ideal target for allogeneic adoptive immunotherapy strategies. Therefore, these two peptides (PR7I and PR7V) will be synthesized and used to coat T2 25 cells for in vitro immunization of PBMC derived from the donors already known to have the opposite polymorphism using the methods to generate PRI reactivity. The resulting CTL lines will be tested for specific lysis of T2 cells pulsed with either the original or the polymorphic peptide. These peptides will also be evaluated for lysis of leukemia cells from patients that have previously been determined to contain the opposite polymorphism. HLA-A2.1 on WO 2005/019435 PCT/US2004/027790 blocking studies will confirm A2.1-restriction, and irrelevant Flu peptide will confirm peptide specificity. Lysis of these leukemia target cells without lysis of autologous marrow progenitors, will demonstrate PR7I and PR7V as the first potential new minor antigens found in humans. 5 In order to adequately estimate the ability of PR7I and PR7V to elicit CTL immunity, several PBMC donors will need to be studied since not all individuals would be expected to have T cells capable of recognizing the peptide. Furthermore, controls where CTL are elicited against the autologous PR7 peptide from the donors that contain that polymorphic peptide will need to be compared to CTL elicited from the donors that do not carry the 10 polymorphism. If no reactivity can be found using any of these combinations using PBMC from three to four donors, then it is unlikely that either of these peptides can be recognized by CTL. Studies involving vaccination with autologous dendritic cells pulsed with Pr3 peptides, or liposomes containing the PR1 peptide or other Pr3-derived peptides are also 15 contemplated in the present invention. In addition, the use of the HLA-A2,1-transgenic mouse model for the investigation into mechanisms of tolerance toward PR1, (Toes et al., 1996b; Toes et al., 1996c) are also contemplated. In addition, the PRI-tetramer could be used to select for a homogeneous population of leukemia-reactive CTL and may allow for the first time the adoptive transfer of CTL against MHC barriers to treat leukemia(Toes et al., 1996a). 20 EXAMPLE 9 ANTIGEN PRESENTING CELLS (APC) ELICIT IMMUNITY DIRECTED AGAINST CML To study whether autologous antigen presenting cells (APC) derived from CML cells could elicit immunity directed against CML several approaches were investigated. First, it was 25 determined whether autologous PRI-specific CTL could be elicited in vitro using autologous dendritic cells (DC) that were expanded from peripheral blood monocytes. Second, it was determined whether the elicited PR1-CTL demonstrate peptide-specific cytotoxicity. Third, it was determined whether PR1-CTL, that were elicited with autologous PRI-pulsed DC, could be further purified from bulk CTL cultures through the use of PRl/HLA-A2 coated microbeads and 30 high speed flow cytometry. FIG. 10 shows that P3 transcripts were detectable only in bone marrow at 1 OOX concentration (corresponding to approximately 100 pg of cDNA). Importantly, there is no P3 expression in tissue outside of the bone marrow, and in particular there is no 01 WO 2005/019435 PCT/US2004/027790 thymic P3 expression, which suggests that -peripheral tolerance may play an important role in controlling T cell immunity to PR1. Analysis of PRI-specific immunity in myeloid leukemia patients after treatment with BMT or IFN, and deletional tolerance of PRI-specific T cells. In order to evaluate the 5 relevance of PRI as a leukemia antigen, it was determined whether PRI-specific CTL could be found in PBMC from HLA-A2.1+ CML patients undergoing different treatments using the PRI/HLA-A2 tetramer. PBMC from 38 HLA-A2.1+ CML patients at different stages of disease and 5 healthy volunteer donors were obtained and and cryopreserved. Diagnosis of CML was defined by 100% Ph+ cells in bone marrow aspirates from all patients prior to treatment. Ten 10 patients received chemotherapy alone, including hydroxyurea, cytarabine, cyclophosphamide, and topotecan. Nineteen patients received IFN-c2b-based therapies, which consisted of IFN alone (6 patients) or combined with the chemotherapeutic drugs cytarabine and homoharingtonine (13 patients). Nine patients received an HLA-identical allogeneic BMT from a related donor. To assess the treatment response, metaphase cells from bone marrow aspirates 15 were examined for the percentage of Ph+ cells. PBMC were simultaneously examined for PRl/HLA-A2 tetramer staining. Clinical responses were categorized as complete (CR, Ph, 0%), partial (PR, Ph, 1% - 34%), or minor (MR, Ph, 35% - 90%) (Faderl et al., 1999). Tetramer synthesis and validation was performed as previously described (Molldrem et al., 1999; Altman et al., 1996). The specificity of the PR1/HLA-A2 tetramer was demonstrated by its ability to 20 stain a PR1 -specific T cell line at 4'C that was derived from a healthy HLA-A2. 1+ donor, but not from a CMV-specific line derived from the same donor (data not shown). None of the 10 patients that received chemotherapy alone without IFN and none of 5 HLA-A2.1+ healthy volunteer donor control samples had detectable PRI-specific CTL. Although one patient treated with chemotherapy alone had a response, no PR1-specific CTL 25 were detectable (Table 11) by tetramer staining. Similarly, there were no detectable PR1 specific CTL in HLA-A2.1+ PBMC from three patients with multiple myeloma and two patients with newly diagnosed breast cancer that had received IFN.

WO 2005/019435 PCT/US2004/027790 Table 11: Patient Characteristics Patient Time from IFN Ph+ Cells by bcr-abl+ by PCR withdrawal (months) Cytogenet UPN1 18 0% + 26 0% UPN2 12 0% + 18 0% + 24 0% + UPN3 15 0% + 21 0% + 26 35% + 32 0% + UPN4 45 0% UPN5 76 0% PRI-specific CTL with high and low TCR avidity can be elicited from healthy donors. To determine whether high and low avidity PR1-CTL are present in healthy donors, a 5 modified tetramer staining technique (Savage et al., 1999) using limiting tetramer concentration to visualize high and low fluorescence intensity tetramer+ cells, which correlates with high and low TCR avidity was utilized. Sufficient PR1-CTL was elicited by stimulating PBMC with increasing peptide concentrations for 28 days. PBMC from an HLA-A2.1+ healthy donor stimulated weekly for 28 days with 0.2 p.M PR1 elicited 1.3% high intensity PRl/HLA-A2 10 tetramer-staining CTL with a median channel of fluorescence (MCF) of 293 (high avidity PR1 CTL), while stimulation with 20 pM PRI produced 3.1% low avidity (MCF = 93) PR1-specific CTL (FIG. 11A). PBMC stimulated with 2 p.M PRi elicited PR1-CTL with intermediate TCR avidity (MCF = 211). Total TCR-ab expression was comparable for cells elicited with 0.2, 2.0, or 20 p.M PR1, suggesting that differences in tetramer staining were not due to differences in 15 TCR expression level. Cultures stimulated with 2 p.M PR1 produced fewer PRI-specific CTL with mixed TCR avidities, while stimulation with < 0.02 pM PR1 induced < 0.1% PRl-CTL. The PR1-CTL elicited with low (0.2 pM) PR1 (open circles) showed higher specific lysis of PRI -pulsed T2 target cells than PRl-CTL elicited with high (20 p.M) PR1 concentration (closed circles), when both were normalized at an E:T of 10:1 based on the total number of PR1/HLA 20 A2 tetramer+ events in the CTL cultures (FIG. 11 C). To further verify that tetramer staining intensity correlates with TCR avidity, the kinetics of tetramer staining decay was determined n'2 WO 2005/019435 PCT/US2004/027790 using previously described techniques (Savage et al., 1999). PR1-CTL elicited with either low (0.2. iM) or high (20 gM) PRI concentrations for 4 weeks were incubated with PR1/HLA-A2 tetramer and saturating concentration of BB7.2 anti-HLA-A2 monoclonal antibody to prevent rebinding. Normalized total fluorescence was measured at 4'C at the appropriate time points and 5 linear tetramer staining decay plots were obtained, indicating tetramer staining half-lives (tv/ 2 ) should be proportional to the ti, 2 of the respective TCR peptide/HLA-A2 complexes (FIG. I1D). PRl-CTL elicited with low (0.2 pM) PRI showed a 3-fold longer tu, 2 than PRl-CTL elicited with high (20 jM) PR1 (58 vs 19 min), which correlates with overall high and low tetramer fluorescence (FIG. 11A), respectively, and validates the use of overall tetramer fluorescence 10 intensity to indicate relative TCR avidity. Spectratype from high and low avidity PRI-specific CTL cultures supports unique clonal derivation. To determine whether short-term PR1-CTL lines with high and low TCR avidities might be derived from distinct clonal populations, the TCR-Vp CDR3 spectratype of 4 week old CTL from the same donor were analyzed. High avidity PR1-CTL elicited with 0.2 pM 15 PRi showed the most striking dominant clone to be present within TCR-Vp family VP 11, low avidity PRl-CTL elicited from the same donor with 20 ptM PR1 showed a dominant clone in Vs2 (FIG. 12). A Gaussian pattern was preserved in the majority of Vs families in each of the PRl-CTL lines, with the exception of Vp3, Vp5.1 and Vp14, which showed similarly skewed repertoires in the two different CTL lines. Similarly skewed spectratypes were obtained repeated 20 experiments, suggesting unique clonal origin bf high and low avidity PR1-CTL. CML target cell killing by PR1-specific CTL correlates with TCR avidity. To evaluate whether CTL lines with different TCR avidities showed differences in effector function, 4-week old PRI-CTL lines derived from a healthy donor or from patients with CML were tested for the ability to kill HLA-A2+ CML target cells from a patient with blast crisis CML, 25 autologous chronic phase CML cells from patient CML #3 at time of diagnosis, or cells from healthy donors. PRl-CTL derived from the healthy donor with high or low avidity were each combined with either bone marrow (BM) from the patient with CML or BM from the patient's healthy HLA matched sibling in a 4-hr cytotoxicity assay. High avidity PR1-CTL elicited with 0.2 jiM PR1 showed nearly 2-fold greater lysis of the same CML BM cells on a per cell basis 30 than did the low avidity PRl-CTL elicited with 20 jM PR1 (FIG. .13A). The specific lysis of autologous BM cells by a PR1-CTL line derived from a CML patient (CML #3) using 0.2 pfM PR1 was similar to the amount of lysis of CML BM cells by the low avidity PR1-CTL line derived from the healthy donor (FIG. 13B). Similarly, CTL from patients CML #1 and CML #2

OA

WO 2005/019435 PCT/US2004/027790 elicited with 0.2 ptM PRI showed lysis of CML #3 BM cells of 24% ± 5% and 33% ± 6%, respectively, at an E:T ratio of 20:1. High avidity PRI-specific CTL are present only in interferon sensitive CML patients in cytogenetic remission. It was previously shown that detection of functional PRI 5 CTL in CML patients correlates with a cytogenetic response to interferon-a (Molldrem et al., 2000). This suggested that high avidity PR1-CTL would only be present in IFN-sensitive patients. To address this possibility PBMCs from untreated HLA-A2* patients with either blast crisis (CML # 1) or chronic phase CML (CML # 2) or a patient with chronic phase treated with IFN-a for 3 months (CML # 3) were stimulated weekly with PR1. Only low-avidity PRl-CTLs 10 could be elicited from any of the three patients (FIG. 14A). There were no detectable PRI-CTLs by tetramer staining in PBMCs prior to repeated peptide stimulation. Low-avidity PRI-CTLs were elicited with as little as 0.02 AM PRI in patient 2 and 0.002 gM PRI in patient 3, whereas PRi-CTLs from patient 1 could not be elicited below 0.2 AM PRI, and overall fewer CTLs were obtained. Patients 1 and 2 had 100% Philadelphia chromosome positive (Ph*) cells in the BM by 15 karyotype, but patient 3 had developed a cytogenetic response to IFN-a and had 80% Ph+ cells. Because of the possibility that high-avidity CTLs may have arisen earlier during restimulation, cultures from a fourth untreated CML patient in chronic phase (CML no. 4) were studied weekly prior to restimulation with T2 cells pulsed with 0.2 pM PR1 for the emergence of tetramer positive CTLs, and no high-avidity PR1-CTLs emerged during culture (FIG. 14B). Failure to 20 elicit high-avidity CTLs was restricted to PR1, since high-avidity p65-specific CTLs from the CMV seropositive patient CML 2 was elicited using 0.2 pM pp65 peptide-pulsed T2 cells (FIG. 14C). To further address the possibility that high avidity PR1-CTL would only be present in IFN-sensitive patients, two CML patients in a cytogenetic remission after 9 months of interferon 25 treatment (CML #5 and CML #6 with 0% and 85% Ph+ cells, respectively), interferon resistant patients with no cytogenetic remission (CML #7 and CML #8), and one untreated newly diagnosed patient (CML #9) for the presence of PR1-CTL with high or low avidity TCR were studied. High avidity PRI-CTL were identified in both patients in a cytogenetic remission but in none of the interferon resistant or untreated patients (FIG. 15). However, low avidity PR1-CTL 30 could be identified in the interferon resistant patients, but totaled less than 0.1% of CD8+ cells. Furthermore, PBMC from untreated HLA-A2+ patients with either blast crisis (CML #1) or chronic phase CML (CML #2) or a patient with chronic phase treated with interferon-a for three months (CML #3) were stimulated weekly with PR1. Only low avidity PR1-CTL could be elicited from any of the three patients. This suggests that low numbers of high avidity PRI-CTL 0 WO 2005/019435 PCT/US2004/027790 may be sufficient to contribute to cytogenetic remission in interferon sensitive patients, but leaves unanswered whether high numbers of low avidity PRI -CTL may contribute to remission. High PRI concentration and proteinase 3-overexpressing CML cells induce apoptosis of high avidity PRI-specific CTL. Previous studies showing that high affinity virus 5 specific T cells are eliminated by target cells infected with a high viral load (Alexander-Miller et al., 1998; Alexander-Miller et al., 1996a), and that CML cells frequently overexpressed proteinase 3 ((Molldrem et al., 1996; Molldrem et al., 1997), suggested that high avidity PRI CTL might be undetectable in untreated CML patients due to selective elimination by CML cells that overexpress the target antigen. To demonstrate this, an equal number of PRI-CTL from a 10 healthy donor were challenged with T2 cells pulsed with either high or low doses of PRI and studied for evidence of apoptosis by Annexin V staining 16 to 18 hr later. High avidity PR1 CTL underwent apoptosis when challenged with high dose (20 piM) PR1 peptide, but not when challenged with low dose (0.2 piM) PR1 (FIG. 16). All high avidity PR1-CTL exposed to high dose PR1 were dead after 36 to 48 hr of co-culture. Apoptosis was abrogated in the presence of 15 the BB7.2 blocking antibody to HLA-A2.1, and no apoptosis was observed when 20 piM of the irrelevant peptide Flu was used instead of PRI. In contrast, low avidity PR1-CTL did not undergo apoptosis when challenged with either high or low concentrations of PR1. To determine whether CML cells similarly induced apoptosis of high avidity PR1-CTL, co-incubation studies were performed with HLA matched BM cells from CML patients followed 20 by staining for Annexin V, for 16 to 18 hr after co-incubation. High avidity PRl-CTL underwent apoptosis by 18 hr after co-culture with BM from an HLA-matched patient with CML in chronic phase with 100% Ph+ cells (FIG. 17A). No apoptosis was induced by co-incubation with BM cells from an HLA-A2 negative CML patient with 100% Ph+ cells, or by co-incubation with BM cells from an HLA-A2+ healthy donor. In contrast, less than 1% of the low avidity 25 PR1-CTL underwent apoptosis when challenged with either the HLA-A2+ or HLA-A2- CML cells (FIG. 17B). Similar overexpression of cytoplasmic proteinase 3 was observed in BM cells from each of the CML patients (2.8-fold higher in the HLA-A2+ cells and 3.3-fold higher in the HLA-A2- cells compared to healthy donor BM cells), and MHC I expression was similar in the two patient samples (FIG. 17C). Therefore, differences in apoptosis were likely due to 30 differences in the amount of PR1 peptide presented on the CML cells. High avidity PR1-CTL persist in IFN-sensitive CML patients off of all therapy. Since it has been shown that IFN-sensitive patients have high avidity PRl-CTL in peripheral blood that can kill CML, it was determined whether PR1-CTL maintain remission in patients in CR off therapy. Three patients in complete cytogenetic remission after discontinued IFN were 0 r.

WO 2005/019435 PCT/US2004/027790 studied. The patients had CML from 5 to 9 years, and were off IFN from 18 to 26 months prior to study (Table 11 and Table 12). All patients continued to have ber-abl transcripts by RT-PCR. Both high and low affinity PR1-CTL were identified in all patients, although only 25% to 30% of all PR1-CTL were of high affinity (FIG. 18). Importantly, all of the high affinity PRl-CTL 5 were functionally active since stimulation with either PR1 peptide or SEB induced y-IFN production by CFC and upregulated CD69, whereas the low affinity PR1-CTL did not produce y IFN, but did upregulate CD69 (not shown). Notably, the high affinity PR1- CTL from UPN3 upregulated CD69 but did not produce y-IFN when tested at 21 months, indicating a loss of anti leukemia immune function 5 months prior to cytogenetic relapse and the simultaneous 10 disappearance of PR1-CTL. Table 12: PR1-CTL in IFN-Sensitive CML Patients off Therapy Patient (age, sex) Length of Time off IFN %PR1-CTL %Ph Cells Disease (yrs) (months) (bone marrow UPN1 (61, female) 6 26 0.74% 0% UPN2 (42, female) 5 12 0.96% 0% 18 1.17% 0% UPN3 (45, male) 9 15 0.53% 0% 21 0.19% 0% 26 0% 35% The only high affinity PRl-CTL were CD45RA+/CD28+/CCR7+/CCR5-, indicating an 15 effector memory or possibly a naive phenotype. In addition, the high affinity PR1-CTL had significantly higher expression of CD28 (p = 0.03) and lower expression of CCR5 (p = 0.01) than low affinity PR1-CTL (FIG. 19), which suggested that low affinity PR1-CTL are terminally differentiated memory cells with little anti-leukemia activity. These results indicated that IFN treatment induces a long-lasting renewing population of high affinity PRl-CTL that continue to 20 maintain lasting cytogenetic remissions in some patients after discontinuing IFN therapy. Loss of functional activity amongst high affinity PR1-CTL or the presence of only low affinity PRI CTL suggests acquired tolerance, leading to eventual relapse. This early nonresponsiveness may reflect an anergic state, but loss of the PR1 -CTL at the time of relapse may be due to deletion. PRI peptide vaccine can elicit PR1-CTL immunity in patients with myeloid 25 leukemia. Preliminary data suggesed that in myeloid leukemia patients in whom a PRI-specific 07 WO 2005/019435 PCT/US2004/027790 CTL immune response could be elicited or increased, PR1-CTL would convey an anti-leukemia immune response and contribute to remission. To test this in refractory leukemia patients, a phase I/II vaccine study was initiated. HLA-A2* patients with CML (interferon-resistant or relapsed after BMT), AML (smoldering relapse or 2nd CR) or MDS (RAEB or RAEBt) with 5 no detectable antibodies to proteinase 3 (no detectable cANCA) were eligible. Patients that relapsed after BMT or those ineligible for BMT were also eligible for study. Pregnant patients, HIV+ patients, and those with known vasculitis were excluded. Patients were required to have immunosuppression (i.e. cyclosporine, steroids) discontinued 4 weeks prior to study entry. Primary endpoints were (1) toxicity assessment including the induction of autoimimunity 10 resembling Wegener's granulomatosis, the systemic vasculitis associated with cANCA antibodies; and (2) induction of an immune response assessed by cytokine flow cytometry (CFC) of y-IFN and PR1/HLA-A2 tetramer staining of PBMC before and 3 weeks after the last vaccination. Secondarily, clinical responses were assessed by standard criteria with bone marrow biopsy, cytogenetic studies (standard chromosome banding) and molecular studies (PCR 15 for bcr-abl or other known abnormalities such as t(15;17), invl6, etc.) 3 weeks after the last vaccination. Patients were seen and evaluated in clinic every 3 weeks during the study period. Both vialed PRI peptide (NSC698102) and the adjuvant (Montanide ISA-51, NSC675756) were used in this study. The overall study was divided into two parts: Phase I consisted of nine patients treated in 20 cohorts of three at 1 of 3 dose levels of 0.25 mg, 0.5 mg, or 1.0 mg of PR1 peptide given subcutaneously in incomplete Freund's adjuvant (Montanide ISA-51) and GM-CSF 75 mg subcutaneously every 3 weeks for 3 injections. The Phase II part of the study enrolled patients in cohorts of 4 randomized to one of the same three PR1 peptide doses since none of the doses were eliminated on the basis of toxicity during the Phase I part of the study. A continuous 25 reassessment model was used in the statistical design to assess best dose level using criteria of immune response (> 2-fold increase in the number of PR1 -specific CTL during the vaccine study period) and grade 3 or 4 organ toxicity. If any patient developed vasculitis and/or cANCA, the trial would be stopped, and if any individual patient developed grade 3 or 4 organ toxicity the vaccine would be withheld for that patient. Any dose level would be discontinued if the number 30 of patients with grade 3 or 4 toxicity, divided by the number of patients evaluated for toxicity, is greater than or equal to 3/4, 4/8, 5/12 or 6/16. Any dose level would be terminated if none of the first 12 patients in that dose level have an immune response. If an immune response was noted, patients would continue to be entered onto that dose level, by continued randomization, to a maximum of 20 patients per dose level. If any clinical response was noted during the study o2 WO 2005/019435 PCT/US2004/027790 period either with or without a measurable immune response, this would be considered an efficacy endpoint and patients would be entered onto that dose level to a maximum of 20 patients per dose level. Patients were monitored every 3 weeks with chest xrays, ANCA titers and physical examinations and for immune responses using PR1/HLA-A2 tetramers. Bone marrow 5 cells (BMC) were obtained before the first vaccination and 3 weeks after the last vaccination to assess disease status. To date, 16 patients have been enrolled on the combined phase II study, and 15 patients are fully evaluable for toxicity, immune response and clinical response, as shown in FIG. 20. Two patients that had progressed on imatinib were kept on the same dose of imatinib to control 10 blood counts and were treated with vaccine. One patient with AML was in hematological remission prior to study. None developed vasculitis or cANCA conversion (FIG. 20). A grade 2 cutaneous injection reaction was noted in one patient (UPN13, FIG. 20) at dose level 3 by two weeks after the first injection, which resolved after 1 week, and mild fatigue was noted in 4 patients. Skin biopsy from UNP13 showed a perivascular lymphocytic infiltrate and PRI/HLA 15 A2 tetramer staining confirmed that 65% of CD8+ lymphocytes were PR1-specific, demonstrating a localized immune response (FIG. 20). Immune response, defined as a > 2-fold increase in the percentage of tetramer+ PR1-CTL, was noted in 8 of the 15 patients (FIG. 21). FIGS. 23 and 24 show that the elicited PR1-CTL were functional by CFC after incubation with 10 pM PR1 and that of the tetramer+ fraction, approximately half were able to secrete cytokine. 20 Five of these eight patients were induced into CR during the study period, including 1 patient with overt acute leukemia. Although a secondary endpoint, clinical responses were also noted on this study (FIG. 21). Three patients (UPN4, UPN7 and UPN15) with relapsed AML prior to vaccination obtained cytogenetic remission (CR) after the second or third injection at dose levels 2, 3 and 1, respectively. They remained in CR at 20 months, 9 months and 4 months, 25 respectively, with 0.58%, 0.2% and 1% circulating PR1-specific CTL (based on CD8 lymphocytes), respectively. Of the 6 patients with CML, only 2 had fewer than 100% Ph+ cells prior to study and one of these patients (UPN12), who had also progressed on imatinib, obtained cytogenetic remission (CR) on dose level 1 (0.25 mg). Because clinical responses were seen at all of the three dose levels, trial design obligates 20 patients on each dose level of the Phase II 30 part of the study. 0o WO 2005/019435 PCT/US2004/027790 Table 13: PRI Vaccine Causes Minimal Toxicity o No induction of cANCA o No vasculitis or Wegener's-like autoimmunity o No maximum tolerated dose or dose limiting toxicity has been reached Toxicity Grade N Fever 1 3 Local injection site reaction 1 13 2 1 Injection site granuloma 2 5 Vaccine-induced PR1-CTL contribute to cytogenetic remission. To show that PR1 CTL induced remission, cells were examined from UPN4, a 27-year-old man with APL in 4th relapse previously treated with allogeneic BMT and 3 escalating doses of DLI who separately consented to have PBMC collected by leukapheresis (LP) one month after the last vaccination. 10 Donor-derived PR1-CTL increased from 0.1% to 0.54% after the 3rd vaccination, and were enriched for effector memory CD45RA+/ CD28+/CD57- donor-derived CTL (by PCR microsatellite analysis), which correlated with loss of t(15;17) transcripts by RT-PCR 6 weeks after the first vaccination(FIG. 24A). PR1-CTL persist at 0.2% 22 months after completing the vaccinations. Tetramer sort-purified PR1-CTL obtained after vaccination showed PRI 15 specificity against peptide-pulsed T2 cells, and 44% lysis of the BMC collected at time of relapse versus only 14% lysis of BMC taken at time of remission, at E:T 10:1 (FIG. 24B). In another patient with inv16 AML (UPN15), PR1-CTL immunity was elicited at the time of 2nd relapse. This 32-year-old man received an autologous transplant while in 2nd remission and had no evidence of AML by FISH using probes for invl6. Two months later, his platelet count fell 20 to 24,000 and he had invl6 by FISH (FIG. 25). By 3 weeks after the last injections of 0.25 mg (dose level 1) of the PR1 vaccine, his platelet count returned to normal and there was no inv16 by FISH or by RT-PCR. Taken together, data from this trial demonstrate for the first time direct evidence that peptide vaccination of leukemia patients can elicit highly active specific immunity against leukemia cells that induces cytogenetic remission. An immune response was necessary 25 but not sufficient for a clinical response, although clinical responses correlated with the induction of an immune response (p = 0.02). Thus, it was suggested that PR1-CTL would have higher TCR avidity in patients in CR since these CTL kill leukemia better than lower avidity PR1-CTL and would therefore show clinically effective antileukemia immunity. FIG. 26 shows that by using low doses of tetramer to identify high and low avidity PR1-CTL, it was found that 1An WO 2005/019435 PCT/US2004/027790 the average TCR avidity of PR1-CTLs was 1.5-fold higher in the clinical responders compared to post-vaccination PR1-CTL in the non-responders that had pre-existing tetramer+ CTL (p = 0.02). T cell tolerance from loss of high avidity PRI-CTL and downregulation of P3 5 antigen correlates with progression of CML after vaccination. UPN6, a non-responder, was found to have both high and low avidity PRl-CTL prior to vaccination with 0.5 mg of PRI, but only low avidity PR1-CTL 3 weeks after the last injection (FIG. 27). Furthermore, the overall number of PR1-CTL decreased from 3.2% to 0.5% during the study and the number of Ph+ metaphase chromosomes increased from 90% to 95% (FIG. 27). Interestingly, PRI/ HLA-A2 10 tetramer-sorted CTL showed peptide-specific lysis of T2 cells pulsed with 20 ptM PR1 that was similar to PR1-CTL from UPN4 that produced nearly equivalent lysis (on a per cell basis) of T2 cells pulsed with only 2 pLM PRl. Although UPN6 received the same peptide dose as the responder UPN4 during vaccination, this dose was sufficient to eliminate the high avidity PRI CTL and allow outgrowth of CML. Since high avidity PR1-CTL were not detectable in 15 peripheral blood PBMC in UPN6, PR1-pulsed T2 cells were used to determine whether they could be expanded. PBMC from LP products from both UPN4 and UPN6 were stimulated weekly with varying doses of PR1 (0.2 jM to 200 pM) coated T2 cells. However, as shown in FIG. 28, high avidity PRl-CTL could only be expanded from UPN4, but not from UPN6. This experiment supported the expectation that high avidity PRl-CTL were deleted in this non 20 responder. However, high avidity PR1-CTL may still be present in UPN6 but cannot be expanded, perhaps due to poor proliferative potential, poor cytokine production, or a more generalized antigen nonresponsiveness. Since it has been well described that defective antigen processing (Restifo et al., 1993; Maeurer et al., 1996), target antigen mutation or downregulation of MHC (Lehmann et al., 1995) 25 or target antigen (Marincola et al., 1996) can lead to immune escape and tumor outgrowth, studies were conducted to investigate these possibilities by comparing P3 expression before and after vaccination in both UPN4 and UPN6. It was found that P3 decreased by 60% in UPN6 after vaccination, compared with no change in P3 expression in UPN4. Interestingly, P3 expression shifted to a more immature CD34+ progenitor cell, which have lower MHC 30 expression (Bernhard et al., 1995) and may be less able to process and present antigen to T cells than more mature myeloid cells in the marrow. Together, these studies show preferential loss of high avidity PRl-CTL with a simultaneous decrease in P3 target antigen expression in the leukemia cells in UPN6, a clinical non-responder, compared to an expansion of high avidity PRl-CTL and preserved overall P3 expression after vaccination in UPN4, a clinical responder. 1 A1 WO 2005/019435 PCT/US2004/027790 Overall MHC-I, CD80 (B7.1) and CD54 (ICAM-1) expression remained unchanged in both patients before and after vaccination. Therefore, at least two or more mechanisms appear to be operative in UPN6 leading to eventual escape from anti-leukemia immunity. Monocyte-derived dendritic cells (DC) can expand autologous PRI-specific CTL 5 and PR1/HLA-A2 monomers can be used to select PR1-CTL for adoptive immunotherapy. Another central aspect of this invention is that CTL that contribute to GVL and those that cause GVHD after allogeneic bone marrow transplantation (BMT) target unique antigens. Previously, the inventors identified the HLA-A2-restricted peptide PRI, derived from P3, that can elicit CTL that preferentially kill CML over normal bone marrow. Furthermore, PR1-specific CTL could 10 be identified in the peripheral blood of BMT recipients that were in cytogenetic remission using soluble peptide/MHC tetramers to stain peripheral blood mononuclear cells. More recently, the inventors have studied the peripheral blood of AML patients that received of nonmyeloablative stem cell transplant (NST) regimens for evidence of PRl-CTL. Patients were studied around day 60 post-NST using HLA-A2 tetramers folded with different peptide epitopes to detennine 15 whether immunity directed against minor histocompatibility antigens such as HA-1 coexisted with immunity against self peptides such as PR1. Using combinations of the fluorocbromes PE(Cy7) and PE, tetramers were constructed that can be used to simultaneously stain small aliquots of peripheral blood for different peptide-specific T cells using multiple tetramers, which produces results that are similar to single tetramer-stained blood samples (FIG. 29A). It was 20 found that around day 60 a higher percentage of CD8+ T cells specific for PR1 correlated with remission at one year post-NST (p = 0.03, FIG. 29B). By combining tetramers for PR1, HA-1 and WT-1, a dominance hierarchy can be defined, and the relative contribution of immune responses against each antigen toward GVL and GVHD determined. Furthermore, it was reasoned that these reagents might also be used to select for peptide antigen-specific CTL 25 amongst polyclonal T cells that could be used in adoptive immunotherapy. Since the precursor frequencies of these T cells is very low, especially for self-antigens, selection with tetramer staining would need to follow the preferential expansion of the antigen-specific T cells in bulk culture. A clinically practical method of expanding peptide-specific CTL ex vivo for use in adoptive transfer to patients after BMT was sought. Peptide-pulsed T2 cells (a highly reliable 30 but unsuitable clinical method for eliciting peptide-specific CTL) were compared with peptide pulsed dendritic cells (DC). Because it is desirable to use reagents that are already approved for clinical use, DC expanded from peripheral blood monocytes were employed using both interferon-a2b (IFN) and GM-CSF, as these cells would be useful as peptide-pulsed APC to expand antigen-specific T cells (Santini et al., 2000). DC expanded for 7 days were compared 1 (Y) WO 2005/019435 PCT/US2004/027790 using IFN (1,000 U/ml) and GM-CSF (500 ng/ml) versus DC expanded for 7 days with IL-4 and GM-CSF. The yields of PR1-specific CTL from autologous PBMC were compared using each of these APCs from 7 healthy HLA-A2+ donors (FIG. 30). PBMC from each of the patients were stimulated weekly with PR1 peptide-pulsed T2, IFN + GM-CSF-treated DC (DC/IGM) or 5 IL-4 + GM-CSF-treated DC (DC/4GM). As shown in FIG. 30, the yields of peptide-specific CTL at the end of 21 days in culture were similar amongst all three groups. Cytotoxicity experiments also confirmed peptide specificity and a comparable amount of specific lysis of PRI-pulsed T2 cells as targets amongst all three groups (FIG. 31). DC/IGM are been pursued as reliable sources of APC that can be used to elicit PRI-specific CTL for the adoptive transfer 10 studies. In addition, the experiments shown in FIGS. 24B and 27 demonstrated the feasibility of using tetramers which can be used to select PR1-specific T cells by high-speed flow cytometry, if the PR1-CTL are present at sufficiently high frequency. Importantly, the PRl-CTL retained their cytotoxic potential against leukemia after sorting. EXAMPLE 10 15 SPECIFIC IMMUNITY INDUCED AFTER PR1 PEPTIDE VACCINATION CORRELATES WITH CYTOGENETIC REMISSION The inventors have shown that patients with CML that have a cytogenetic response to IFN-y or that are in remission after allogeneic BMT have circulating cytotoxic T lymphocytes 20 (CTL) with specificity for the HLA-A2 restricted peptide PR1. The PR1-CTL show peptide specific lysis of leukemia and are long-lived in some patients. Although this shows that PR1 CTL may be important in clearing the malignant cells, it is not clear whether PRl-CTL developed in response to the malignancy and are sufficient for the elimination of it. In a phase I study evaluating escalating doses of PR1 peptide administered subcutaneously combined with 25 incomplete Freund's adjuvant and GM-CSF, the results were reported from two patients that received 3 injections of 0.5 mg PR1 every 3 weeks: a 38-year-old woman with late chronic phase CML relapsed after allogeneic BMT (UPN6) and a 27 year old man with refractory APML after allogeneic BMT and DLI x 3 (UPN4). PR1/HLA-A2 tetramers were used to identify PR1-CTL and to FACsort them to > 99% purity from leukapheresis products obtained at the end of the trial 30 period for functional analysis. Chimerism of the total T-cell population and of FACsorted PR1 CTL was performed by DNA microsatellite analysis. Until 1 month prior to the vaccine, UPN6 received IFN-y and had 1.9% PR1-CTL, which declined to 0.83% 1 month after the 3 rd vaccination. Although there was only 15% overall donor T-cell chimerism, the PR1-CTL were 100% donor-derived. This patient had no clinical response with persistence of 95% Ph cells. In 1 Al WO 2005/019435 PCT/US2004/027790 contrast, UPN4 had < 0.1% PRI-CTL prior to vaccine, which increased to 1.5% after the 3 rd vaccination and remained 100% donor T-cell chimeric throughout. At the same time, detectable t(15;17) transcripts by RT-PCR prior to vaccination were no longer detectable 1 month after vaccination. Interestingly, UPN6 developed limited oral and ocular chronic GvHD 1 month after 5 receiving the PRI vaccine. The functional capacity of FACsorted PRl-CTL to CD8+ PR1/HLA A2 tetramer negative cells was then compared in a standard 4-hr cytotoxicity assay. PR1-CTL from both patients showed PR1 peptide specificity using PRi-pulsed T2 cells as target cells at E:T ratios from 10:1 to 1:1. PR1-CTL from UPN4 showed 49% specific lysis of CML bone marrow (BM) cells obtained prior to BMT compared to only 27% specific lysis by the tetramer 10 CTL at E:T 10:1. Likewise, PR1-CTL from UPN4 showed 44% lysis of BM at time of relapse versus only 14% lysis of BM taken at time of remission. By contrast, the CD8+ PR1/HLA-A2 tetramer negative cells showed only 25% and 6% lysis of relapse and remission BM, respectively, at E:T 10:1. This study demonstrated for the first time direct evidence that peptide vaccination of a leukemia patient can induce highly active specific immunity against the 15 leukemia cells. Further studies are been conducted to investigate both the PR1-CTL and remaining target cells from each of the patients to determine why vaccination in UPN6 lead to a decline in the number of functional PR1-CTL. It is possible that APML is more susceptible vaccine target since expression of proteinase 3, the protein from which PR1 is derived, is more abundantly expressed compared to CML cells. 20 To determine an optimal method to expand PR1-specific cytotoxic T lymphocytes (CTL) with high avidity T cell receptors ex vivo. In this study, whether a combination of IFN and GM-CSF can produce DC that can be used to elicit PR1-CTL for adoptive immunotherapy was tested. Based on previous observations that PR1-CTL preferentially kill leukemia over normal BM due to P3 overexpression, and because P3 is only expressed in hematopoietic tissue, 25 it was indicated that adoptively transferred PR1-CTL will produce GVL without GVHD. It has also been shown that high avidity PR1-CTL are more efficient killers of leukemia cells, although they may also undergo apoptosis when incubated with highly P3-expressing leukemia cells. This further suggested that if large numbers of high avidity PR1-CTL were adoptively transferred to myeloid leukemia patients with minimal disease after allogeneic bone marrow transplant, a 30 sufficient GVL effect would be produced before significant leukemia-induced loss of the PR1 CTL resulted, which would facilitate remission without significant GVHD. Two general expansion methods to elicit PR1-CTL in vitro will be compared as previously described. In brief, DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon-u2b plus 500 U/ml GM-CSF (termed 1014 WO 2005/019435 PCT/US2004/027790 DC/IGM). Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines. T2 cells were maintained in RPMI + 10% I4S prior to co-culture with donor PBMC. At the end of 7 days, DC were pulsed with 20 pLg/ml PRi peptide, 5 irradiated and combined with fresh PBMC from the same donor at a 1:2 ratio. On day 7, the culture was restimulated with PRI-pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PR1-CTL cultures were tested for their ability to lyse PRI-coated target cells or CML cells. The PR1-CTL was evaluated for surface phenotype with the PRl/HLA-A2 tetramer and anti 10 CD8. In general, both DC/IGM and T2 cells elicited PR1-CTL. However, T2 were nearly twice as efficient, typically yielding 3% to 6% PR1-CTL (of the bulk culture, determined by tetramer staining) by 4 weeks and DC/ IGM yielding only 1.5% to 4% PR1-CTL. Because of the regulatory concerns using T2 cells in the clinical setting, alternative sources of stimulators will be studied. 15 To further improve the efficiency of CTL expansion, artificial antigen presenting cells (AAPC) were constructed as a substitute for DC. The advantage of this approach is that it is more readily available and there is potentially more consistency in the final synthetic product. In preliminary experiments using the PRI peptide, HLA-A*0201 heavy chain and p2 microglobulin were each produced in E. coli and the expressed protein was folded in vitro in the 20 presence of PRI. Folded monomeric complexes were purified by gel filtration and ion exchange. The PR1/HLA-A2 monomers were then mixed with dioleolyl phosphatidylcholine (DOPC) (Avanti Polar Lipids), at molar ratios of 1:100, 1:500 or 1:1000, frozen in dry ice/acetone bath, and lyophilized overnight to remove organic solvent. The lyophilized product was stored at -20'C and then hydrated in PBS buffer and vortexed vigorously before use. T2 25 cells were incubated with PRl/HLA-A2 AAPC (1:100, 1:500, and 1:100 molar ratio) for 3 hr and 24 hrs. After incubation, the cells were surface stained with murine anti-HLA-A*0201 monoclonal antibody BB7.2 and secondarily stained with FITC-labeled goat anti-mouse antibody, and observed under the confocal fluorescent microscope to determine proper insertion of PRl/HLA-A2 into the artificial membrane. After this was confirmed, the efficiency of 30 liposome-encapsulated T2 cells were compared to DC for eliciting PR1-CTL after 4 weeks in culture with weekly stimulation. CTLs elicited with PRI/HLA-A2 AAPC for 3 to 5 weeks efficiently lysed T2 target cells pulsed with PRI peptide and was equivalent to lysis by DC generated PR1-CTL lines. The number of PR1-CTL produced with either method was equivalent in the initial experiment, but in two additional experiments the AAPC appeared to be 1 (fl WO 2005/019435 PCT/US2004/027790 similar to T2 cells, which generally are more efficient than DCs at eliciting peptide-specific CTL, in their ability to expand PR1-CTL. In preliminary experiments, it was noted that antigen expression could be increased at higher molar ratios of peptide/A2 monomer to DOPC, which may improve the efficiency further. 5 However, apoptosis of high avidity PRI-CTL may occur as a consequence, and it is likely that a "therapeutic window" of antigen concentration will be optimal. The DC/IGM will be directly compared to DC grown using IL-4, GM-CSF and TNF-a, and to both AAPC and peptide-pulsed T2 cells. As discussed above, in preliminary experiments using PRI it was shown that AAPC are equivalent to T2 cells, which are in turn more efficient than DC/IGM. Typical yields of 10 antigen-specific tetramer+ cell numbers are 3% to 5% PR1-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to HA-1 and other putative target antigens of GVL (WT-1), but all of the comparative experiments will be repeated using these peptides. In addition, serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. In 15 preliminary experiments, pooled human AB serum was nearly equivalent to FBS as a supplement to media used to expand DC/ IGM that could then be used as peptide-pulsed APC to expand PRI- CTL (FIG. 32). Once these methods have been confirmed, scaleup procedures will be carried out in both flasks and closed bag systems to demonstrate the feasibility for clinical use. A particular aspect of this study is to first determine the conditions that produce the highest 20 numbers of functional high avidity PRl-CTL in the shortest period of time. Once conditions are optimized and the scale-up experiments show feasibility, an adoptive immunotherapy study will begin using PR1-CTL generated ex vivo. Weekly tetramer staining during bulk culture restimulations will be used to compare yields and avidity of PR1-CTL, and CFC and cytotoxicity experiments will be used to compare the effector function of the cells. 25 Secondly, two methods to select antigen-specific CTL from bulk culture will be compared. Although it is suggested that the bulk culture conditions described above will yield CTL that, when adoptively transferred to patients, will not produce significant GVHD, it is possible that GVHD may occur due to the non-specific CTL remaining in the bulk cultures. Since CTL cloning at the end bulk culture is time-consuming and would therefore need to be 30 performed prophylactically in each patient, and because the transfer of CTL clones is not likely to yield long-lived CTL in vivo (Riddell et al., 1997), separation of the peptide-specific fraction from the bulk culture will improve the purity of PRl-CTL and thereby reduce GVHD. Initial cell transfer will involve escalating doses of bulk cultures of peptide-expanded CTL carried out in previous experiments. If there is no GVHD, then the dose of non-selected bulk culture PR1 1 AK WO 2005/019435 PCT/US2004/027790 ... ..... --.. .......... .. CTL will be escalated. If patients develop > grade II GVHD, then PR1-CTL will be selected from the bulk cultures using methods described below. In the first approach to select the antigen-specific CTL, the use of high-speed flow cytometry will verify separate antigen-specific CTLs using soluble peptide/MHC tetramers. By staining leukeapheresis products with anti-CD8 5 and PR1/HLA-A2 tetramers, PR1-CTL can be separated from the remainder of CD8+ lymphocytes, and these sorted cells can efficiently kill leukemia cells (FIGS. 24B and 27). Preliminary experiments were designed to obtain 1 x 106 PR1-CTL for the cytotoxicity experiments, however, this could be scaled up to obtain sufficient cells for adoptive immunotherapy from a cell product that contained as few as 0.4% PR1-CTL (based on CD8+ 10 lymphocytes). For instance, 1010 total cells collected from leukapheresis would be expected to yield 2 x 109 cells at the end of a typical 4-week expansion. Based on minimum assumptions about the yield of cells at the end of the 4-week expansion, including cells where 40% are lymphocytes with only 20% of those as CD8 lymphocytes and a tetramer frequency of only 0.4% PR1-CTL, a dose of 0.9 x 106 PR1-CTL/kg could be adoptively transferred to the average 70 kg 15 recipient. The cell purity was > 90% and the efficiency was > 95%. In the second approach, the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen-specific CTL. In preliminary experiments using the PR1 peptide, the feasibility of using PR1 peptide/HLA-A2 monomers linked to streptavidin-coated microbeads (Miltenyi Inc, Germany) to separate antigen-specific 20 CTL from bulk cultures of mixed lymphocytes was demonstrated(Wang et al., 2000). Short term polyclonal CTL lines were elicited by pulsing 70 x 106 PBMC from 6 different healthy HLA-A2.1+ donors weekly with PR1-coated T2 cells plus interleukin-2. After 21 days in culture, these PR1-pulsed CTL, quantified with a PR1-HLA-A2 tetramer conjugated to phycoerythrin (PE), comprised 2% to 8% of the culture. To preferentially select PR1 antigen 25 specific T-cells, a method using streptavidin-coated microbeads (Miltenyi, Inc.) was developed and optimized. Beads were conjugated with HLA-A2.1 heavy chain plus PR1 myeloid leukemia peptide via a biotin-labeled C-terminus of the heavy chain. PR1-pulsed short-term CTL lines were incubated for 30 min with PRl/HLA-A2 coated microbeads and were selected using the magnetic MACS column. Bead-selected and non-selected CTL were quantified by FACS 30 analysis using the PR1-HLAA2 tetramer and compared to the initial polyclonal CTL lines. Yields ranged from 85% to 100%, and PRI-specific CTL purity ranged from 11% to 21% after selection (3- to 5-fold increase in purity of antigen-specific CTL). Specific lysis of both PRI coated T2 cells and CML marrow cells increased in all 6 cultures and background lysis of normal HLA-A2.1 normal marrow was eliminated compared to non-selected PR1-specific CTL. 1 f)7 WO 2005/019435 PCT/US2004/027790 Both the flow cytometry method and monomer-coated microbead method will be compared to the cytokine capture microbead technology developed by Miltenyi Inc., which relies on the ability of antigen-specific CTL to secrete IFN after antigen challenge. PRI-CTL obtained after 4 weeks of weekly restimulation will be incubated with PR1 antigen and the bi-specific antibody 5 with anti-CD45 and anti-IFN binding will be co-incubated with the cells. A secondary antibody with anti-IFN antibody that is directly linked to microbeads (supplied by Miltenyi, Inc) will then be used to select out IFN-secreting CTL from bulk culture. Although it is reasonable to expect that the commercial cytokine-capture technology will produce sufficient purity of CTL, the device does not capture all CTL with the potential to 10 recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen specific CTL might be required to maintain a more functional fraction in vivo, or whether the non-secreting CTL later develop the potential to express effector function, and may be selecting too few CTL using the commercial product. Similarly, monomer-coated beads have the potential to be more easily scalable on a molar ratio basis so that high avidity PR1-CTL can be selectively 15 purified. To determine whether adoptively transferred proteinase 3 peptide-specific CTL contribute to the graft-versus-leukemia (GVL) effect. Another aspect of the invention is to enhance GVL and reduce GVHD by using a preparative regimen to achieve engraftment of transplanted allogeneic blood stem cell or bone marrow, which can then be used as a platform to 20 deliver antigen-specific CTL therapy. It was postulated that GVHD could be eliminated and GVL enhanced by adoptively transferring antigen-specific T cells with preferential GVL activity. Therefore, whether adoptive transfer of high avidity PRI-CTL induces GVL without increasing GVHD will be tested, the clinical trial will determine the maximal dose of PRI specific CTL that will provide GVL while preventing the development of acute GVHD (the 25 baseline rate of grade 3 and 4 acute GVHD < 15%). T cells have been shown to cause GVHD (Drobyski et al., 1994; Mavroudis et al., 1996; Gaschet et al., 1996; Debergie et al., 1997; van Lochem et al., 1992; Barrett et al., 1998), facilitate engraftment (Reich-Zeliger et al., 2000) and are required to prevent rejection with established nonablative preparative regimens developed at M. D. Anderson Cancer Center (Houston, Texas) and elsewhere. Leukapheresis samples from 30 healthy HLA-matched donors will be used to expand PR1-CTL ex vivo, using the expansion methods outlined herein. The expansion methods developed in this invention will also be used for the production of cellular products for clinical use. Patients with advanced disease, who are eligible for the transplant studies, will receive allogeneic BMT and imatinib mesylate after transplant and will be monitored by PCR for evidence of persistent or increasing disease. If 1 (2 WO 2005/019435 PCT/US2004/027790 patients that are HLA-A2+ remain PCR+ for ber-abl at day 60, then patients will receive PRI CTL expanded ex vivo in escalating doses. By skewing the ex vivo culture conditions with low doses of PRI as shown in the preliminary results, high avidity PR1-CTL will preferentially be expanded from the donors. These cells will be infused into PCR+ donors after 4 weeks of 5 expansion at escalating doses starting at 1 x 107 , 5 x 107 and 1 x 108 bulk CTL/kg of recipient weight. At 4 weeks of culture, the bulk PR1-CTL cultures contain from 1.5% to 4% PR1 specific CTL, as observed, by tetramer staining and functional analyses, and based on expansions perviously performed. Two leukapheresis products (LP) will be required to (1) elicit sufficient DC/IGM as APC (from cryopreserved aliquots of LP), which will be pulsed with PR1 10 peptide at 0.2 mM to (2) elicit PR1-CTL bulk cultures. Clinical-scale expansions will be performed before the adoptive cellular therapy trial with PRl -CTL is begun. Quantitative PCR for ber-abl/abl transcript ratios will be performed monthly to determine whether there is disease progression. If the ratio is increased by 2-fold and if the patient has GVHD of 2, then the next higher dose of bulk PR1-CTL will be infused. If there continues to be progression, an 15 unmanipulated DLI from the original donor will be infused at a dose of 1 x 108 CD3 T cells/kg. However, if there is a decrease in the bcr abl/abl, patients will be monitored monthly until there is no increase for 2 consecutive months. In this way, dose escalations within each patient and amongst cohorts of 3 patients each will be carried out. If patients develop > grade 2 GVHD after the first PRI-CTL infusion, then a selected PR1-CTL infusion will be given in escalating doses 20 starting at 1 x 105 5 x 105 and 1 x 106 PRI -CTL/kg of recipient weight. The exact number of PR1-CTL will be determined by tetramer staining, and the PR1-CTL will be selected based on the optimal method determined above. In preliminary experiments, it was shown that peptide/tetramer-coated microbeads, in addition to PR1/HLA-A2 tetramer-based high speed cell sorting using the MoFlo cytometer can be used to enrich for a highly purified PR1-CTL 25 population. Since patients that receive PR1-CTL might have an initial rise in tetramer+ cells and a simultaneous clinical response, it is possible they could lose immunity and suffer a relapse. This has been shown for a number of adoptive immunotherapy trials using T cells. Therefore, since in the present invention it has been shown that the PRI peptide vaccine can elicit PR1-CTL in 30 patients with leukemia, it would be prudent to administer the PR1 vaccine to patients after adoptive transfer while there is a minimal residual disease state (< 10% Ph+ cells, or PCR+ only) and before the tumor burden becomes too large. A large tumor burden may tip the scale in favor of the leukemia due to PRl-CTL apoptosis induced by the leukemia cells. Therefore, the protocol of the clinical trial will contain a provision for patients to receive the PR1 vaccine at a 1 Mo WO 2005/019435 PCT/US2004/027790 dose of 0.25 mg SQ every 3 weeks for 3 injections, the dose and schedule that has elicited long lasting PR1-CTL after vaccination. Statistical considerations, including sample size determination and the proper sequencing of within- and amongst-patient dose escalations will be performed once the clinical scale up is confirmed since PRI-CTL cell dose depends upon the 5 efficiency of the scale up methods. It is also indicated that high avidity PR1-CTL will preferentially cause a GVL response and contribute to molecular remission without increasing GVHD. Therefore, a randomized control group of patients will receive unmanipulated DLI following a standard treatment approach. All patients will have blood collected at weekly intervals up to 4 weeks beyond the 10 last infusion of PRI-CTL or DLI, then monthly thereafter until one year or removal from study. Bone marrow biopsies will be performed on day 30, day 60, then monthly until 6 months, then again at 1 year or until removal from study. The overall percentage of functional PR1-CTL in the recipients will be determined by tetramer staining and standard CFC assays. In addition, the number of pp65-CTL in CMV immune patients will provide an internal control to determine 15 whether the number of PR1-CTL is increased after infusion and whether those cells are long lived. Likewise, the restorative immunity of unanipulated DLI will be compared with that of patients receiving adoptively transferred PR1-CTL by determining TREC numbers, CD4 and CD8 counts, and the percentage of CFC+ cells. Based on the findings in the PRI vaccine trial, the quality of the PRI-CTL response, measured by both TCR avidity and function, is perhaps 20 more important to produce a remission than the more simple measurement of the quantity of PR1-CTL. Therefore, the avidity of the PR1-CTL that exist will be compared in (1) the donor product, (2) the recipient prior to transplant and prior to CTL infusion, and (3) the recipient at time points after infusion using limiting doses of tetramer to stain PBMC. This method will be compared to tetramer dissociation half times to confirm the validity of the measurements. In 25 addition, an aliquot of the PRI -CTL product will be used to study whether the high avidity PRI CTL preferentially kill the patient's CML by using BM target cells cyropreserved prior to BMT, prior to CTL infusion and BM cells taken at time of molecular remission in a standard cytotoxicity assay. In addition, peptide dose-response CFC assays will be performed, as shown in FIG. 11 C for the patients that do not have sufficient cells that can be used as targets in a 30 standard cytotoxicity assay. Although it has been shown that the adoptive transfer of antigen specific CTL clones does not result in long-lived immunity (Riddell et al., 1992), vaccination with the PR1 peptide does result in long-lived PR1-CTL for up to two years. This apparently contradictory result may be because the PR1 -specific response is not confined to a single clone. 1 10 WO 2005/019435 PCT/US2004/027790 Thus, the adoptive transfer protocol of the clinical trial will involve a broader oligo-clonal PR1 CTL repertoire expanded ex vivo. Based on the preliminary data, it is suggested that high avidity PR1-CTL will contribute to complete remission after adoptive transfer without increasing GVHD. Thus, these 5 experiments will allow for the direct comparison of patients who do and those who do not achieve CR, to those who achieve CR but who experience worsening GVHD. In the later patients, PR1/HLA-A2 tetramer staining of PBMC and BM will be compared to cells from GVHD site tissue biopsies to determine whether there are more PRI- CTL at the sites of active GVHD. It is indicated that there would be fewer or no PR1-CTL at these GVHD sites since 10 there is no P3 expression in peripheral tissues such as skin. However, if PR1-CTL are present, this will also be compared to the TCR avidity with those of circulating PR1-CTL. A recent murine model has shown that while GVHD effector cells may be allo-antigen-independent, host APC are instrumental and may be required to initiate GVHD (Teshima et al., 2002; Shlomchik et al., 1999). Although PR1 is a self-antigen, it is suggested that PR1-CTL at sites of GVHD 15 would have lower avidity TCR than circulating PR1-CTL, which would potentially allow more cross-reactivity with other peptide ligands and less specificity for the PR1 ligand. Such an observation would give the appearance that the CTL have little peptide specificity and would be consistent with the observations in the murine systems. In humans, the data is less clear. Dickinson, et al. (2002) have shown that although 20 minor histocompatibility antigen-specific CTL are present at sites of active GVHD in humans (with specificity for both hematopoietic-restricted HA-2 and the ubiquitously expressed H-Y antigens), only CTL with specificity for the H-Y antigen produce cytokines at GVHD sites. Dickinson, et al. (2002) concluded that ubiquitously expressed minor antigens were the targets of GVHD, although they did not measure or compare TCR avidity in the HA-2-specific CTL. 25 Therefore, the frequency and avidity of HA-Y-specific CTL in the skin and blood of recipients of sex-mismatched transplants will be determined and compared to the PR1-CTL. It will be determined whether deletional tolerance of the high avidity PRI-CTL occurs after adoptive transfer and compare this to clinical outcome. It is expected that the selective loss of high avidity PR1-CTL will result from the persistence of CML cells with high P3 expression relative 30 to the P3 expression in BM cells from patients that retain high avidity PR1-CTL and who may be in clinical remission. Deletional tolerance will be determined by comparing the relative disappearance of relatively high and low avidity PR1-CTL after transfer and comparing any disproportionate disappearance of the high avidity PR1-CTL to the rate of disappearance of high avidity pp65-CTL in CMV-immune patients. As shown, CML escape from PRl-CTL immunity 111 WO 2005/019435 PCT/US2004/027790 may be due to additional mechanisms such as decreased expression of the P3 antigen. Therefore, the amount of P3 expression in the recipient BM and PBMC will be determined by real-time PCRTM and by flow cytometry and compared to the healthy donors. Data regarding general immune status in each of the patients, will serve as a baseline for comparing the specific high 5 avidity PRl-CTL within and amongst patients. In addition, the phenotype data will allow for the comparison of the differentiation state of the PRl-CTL, since an altered maturation phenotype to a terminally differentiated state would be expected to result in ineffective anti-CML immunity. To determine whether PR1-CTL identified by tetramer staining post-infusion are derived from the adoptively transferred product, TCR-Vp spectratyping followed by repetitive 10 sequencing of restricted TCR-V3 families will be performed in selected patients. In the preliminary data it was shown that this technique can be used to determine the breadth of the PRI-CTL response, and was previously used to follow clonal T cell progression in MDS patients (Kochenderfer et al., 2002). The families and the sequences can be compared from PRI/ HLA-A2 tetramer-sorted CTL from each of the products and each of the time points to 15 follow the outcome of individual clones. This technique has also recently been used to demonstrate clonal persistence of melanoma-specific CTL following adoptive transfer (Dudley et al., 2002). Spectratype analysis of the HSV Tk-transduced lymphocytes will also be performed to determine TCR repertoire of the transduced lymphocytes during ex vivo expansion. Clones within the transduced cells with similar CDR3 region sequences to PRl-CTL clones 20 would suggest overlapping antigen specificity. Finally, it has recently been found that 2 4 p3 (the human homologue is NGAL) is secreted by CML cells and inhibits diploid cell proliferation. This factor may also contribute to a loss of proliferative capacity of CML-specific T cells. Serum samples from patients will be collected at each of the indicated time points so that quantitative measurements of NGAL can be determined. 25 If NGAL is expressed at high levels, then cell proliferation by MTT will be determined after exposure of PR1-CTL to NGAL in vitro. To determine whether PRI peptide vaccine can be used to elicit PR1-CTL immunity in patients with minimal residual disease after autologous bone marrow transplant or after imatinib mesylate (Gleevec) and interferon. The preliminary results have shown no 30 development of Wegener's granulomatosis or other vasculitis thus far, with only grade 2 toxicity seen in one patient. None of the 3 doses tested were eliminated due to toxicity, and the combined data shows evidence for both immune responses and clinical responses. In addition, it has been shown that the potential for leukemia-induced apoptosis and selective deletion of the most potent antileukemia high avidity PR1-CTL. Data from other laboratories has suggested 111) WO 2005/019435 PCT/US2004/027790 that vaccination after high dose chemotherapy (such as autologous transplant) may be more effective, however, than vaccination without prior chemotherapy since T cell immunity may be "reset" allowing naYve T cells to expand, possibly including high avidity T cells, if exposed to antigen during the proliferative phase of immune reconstitution after transplant (Borrello et al., 5 2000). Alternatively, a sufficient expansion of low avidity anti-CML T cells may also be effective in eliminating the leukemia, and this expansion would also be enhanced following transplant (Morgan et al., 1998). It will be determined whether the PRi peptide vaccine can elicit PRl-CTL in recipients of autologous BMT for refractory CML. The hypothesis underlying this trial is that PR1 peptide 10 vaccination after autologous BMT will allow re-expansion of high avidity PRI-CTL that were previously eliminated by CML cells. In the absence of any potential autoimmune toxicity, it would be expected that the resulting high avidity PRl-CTL contribute to molecular remission. The efficiency of this expansion of T cells can be measured as an increase in the total number of high avidity cells, an average increase in overall avidity of the induced PR1 -CTL, or more rapid 15 expansion kinetics of the high avidity PRI-CTL pool compared to vaccination done without prior transplant. Lastly, the breadth of the PR1-specific TCR repertoire may increase as well after vaccination, which may reflect a more robust and sustainable immune reaction to the peptide and therefore against the leukemia. The post-transplant PR1 vaccine will be given to recipients of autologous transplantation for CML who have progressive disease and are without a 20 suitable allogeneic donor. The, clinical trial will also determine whether PR1 vaccination will induce high avidity PR1-CTL and increase leukemia-free survival in HLA-A2+ patients compared to those without the HLA-A2 allele not given the vaccination (a biological randomization). Based on previous studies, it is expected that no impact of the HLA-A2 allele on outcome in chronic myeloid leukemias will be observed (Cortes et al., 1998). Patients with 25 HLA-A2 will be randomized to receive one of three dose levels of PRI peptide (0.25 mg, 0.50 mg, and 1.0 mg) given as three injections every 3 weeks. The PRI peptide will be dissolved in water and mixed with a fixed dose of incomplete Freund's adjuvant (Montanide ISA-51). GM CSF 75 mg will be administered as a second injection into the same site as the vaccine. Current PR1 vaccine trial, treating patients with AML and MDS with the same vaccination schedule, has 30 not enrolled enough patients to determine whether there is a clear dose effect on the potential to expand high avidity PR1-CTL. However, the most striking example that peptide vaccine alone can induce molecular remission is patient UPN15 who received autologous BMT 2 months prior to vaccination for 2nd relapse of AML and who received the lowest dose (0.25 mg) of the PR1 peptide (FIG. 25). 1 1 WO 2005/019435 PCT/US2004/027790 Bone marrow, and peripheral blood will be collected prior to and again 3 weeks after the last of the 3 vaccine injections, and peripheral blood will be collected every 3 weeks while patients are in the trial. Using these samples, the number of PR1-CTL will be quantify before and after vaccination using tetramers, and by LDA in patients without a detectable response by 5 tetramer staining. PR1-CTL TCR avidity will be determined by using limiting dilutions of MHC-I tetramers, and a titer that produces maximal fluorescence intensity separation of a "high" and "low" intensity population, as discussed previously, will be established for each batch of reagent. TCR-V3 spectratype will be performed on selected patients in whom the number of PR1-CTL has either increased or decreased by 2-fold or greater to learn whether the breadth of 10 the peptide-specific TCR repertoire has changed. Preliminary experiments were performed on post-vaccination CTL from UPN4 (responder) by comparing the spectratype of total CD8+ lymphocytes, high and low avidity PR1-CTL and the tetramer-negative CD8+ lymphocytes by separating the cells using tetramer labeling and high speed flow cytometry with the MoFlo. It was found that merely two dominant clones in the TCR-VP3 family are found within the high 15 avidity PR1-CTL, while multiple clones are dominant in the low avidity PR1-CTL in at least 4 different TCR-VP families. Currently the CDR3 regions of the clones are been cloned and sequenced (Kochenderfer et al., 2002) to confirm these initial observations by determining the sequence similarity of the isolated clones. These will be compared to pp65-specific CTL that were also isolated from the patient (a CMV-specific HLA-A2-restricted epitope) since the TCR 20 repertoire should not be influenced by the PRI vaccine. Preliminary experiments on PBMC samples obtained from UPN4 suggest that the induced high avidity PR1-CTL are derived from a very limited number of clones, which might negatively influence the longevity of these cells. However, it was noted that the patient continues to have 0.58% PRI-CTL in the peripheral circulation 20 months after the last vaccination. It will be important, therefore, to compare the 25 CDR3 sequences of the clones over time in both the responders and the non-responders. This will help us to understand whether there is clonal stability in the PR1-CTL compartment over time or whether clones are gradually replaced over time with a subsequent fine-tuning of the resulting TCR avidity, as has been shown in T cell transgenic mouse models using antigen specific T cells (Savage et al., 1999). 30 Because it was observed that TCR avidity correlates with immune response, and because lower doses of PRI elicit higher avidity PR1-CTL in vitro, it is at first reasonable to believe that lower doses of the PR1 peptide vaccine would produce higher avidity PRl-CTL. However, because of the requirement for cellular uptake and presentation of the injected peptide to elicit PRl-CTL response, a clear dose-response effect may not be established given the heterogeneity 11At WO 2005/019435 PCT/US2004/027790 of the patients, the different types of leukemia and the different disease stages, number of prior treatments, number of circulating lymphocytes, amongst other variables. Instead, the responses and the resulting avidity of the PR1-CTL will be monitored before and after the trial at each peptide dose and the clinical responders and non-responders groups compared, and the effect of 5 peptide dose on those observations analyzed. The empiric dose range of 0.25 mg to 1.0 mg of PRI may be outside the range of a more appropriate dose that would have a biologically measurable effect on TCR avidity. Since no other tumor vaccine trial has monitored for these effects, however, these effects will be observed. Furthermore, high numbers of low avidity PRI CTL, if expanded with the vaccine, may be sufficient to eliminate CML (Molldrem et al., 2002a; 10 Morgan et al., 1998; Molldrem et al., 2002b). As noted, most patients in the current vaccine trial had circulating PR1-CTL detected prior to vaccination. The differences in TCR avidity on all patients will be measured. In addition, CFC analysis for y-IFN secretion after PR1 peptide stimulation of fresh PBMC samples will be compared at each follow up visit. Peptide doses ranging from 0.2 gM to 200 gM will be used to compare the activation threshold of the CTL and 15 this will be compared to TCR avidity measured with tetramer. For patients that are seropositive for CMV, the HLA-A2-restricted pp65 peptide antigen will be used to compare activation threshold and TCR avidity of the respective peptide-specific CTL. That PRI peptide elicits high avidity PR1-CTL in recipients of autologous BMT predicts that pp65-specific CTL will not change the overall avidity after PRI vaccination. If the avidity 20 is noted to increase, however, it may reflect more general changes in the TCR repertoire in those patients that receive transplant. Therefore, the avidity to CTL from patients that have not received transplant will be compared. An alternative is that the PRI peptide may fail to elicit any PRl-CTL responses due to nonresponsiveness or anergy. This will be evaluated by measuring surface expression of CD80, CD86, CD28, CTLA-4, and HLA-A2 and HLA-DR 25 expression on BM cells and PR1-CTL. In addition, P3 expression in the BM before and after vaccination will be compared. In addition; whether overexpression of P3 in leukemia cells leads to susceptibility to PR1-CTL-mediated lysis of the leukemia cells, and also preferentially induces apoptosis of high avidity PR1-CTL over low avidity PR1-CTL will be tested. The later will lead to outgrowth of the leukemia. Clinical response to the PRI vaccine will be compared, as will the 30 P3 expression and the resulting change in the TCR avidity of the induced PRl-CTL in all patients on the vaccine trial. In addition to studying the vaccine patients, samples of blood and marrow are collected on all patients that undergo allogeneic BMT and patients that receive DLI. These samples will be used to examine P3 expression in BM cells and the PR1-CTL avidity of PBMC in HLA-A2+ patients with CML that have relapsed after BMT and subsequently received 1 1 Ir WO 2005/019435 PCT/US2004/027790 DLI. Pretransplant, remission and relapse samples will be compared. Currently there are 12 such patients with sufficient samples and cell numbers to be examined. Based on the data, it is predicted that P3 expression would be high (relative to normal BM) pre-BMT, low at time of remission, high again during relapse, but low after successful 5 BMT or immunotherapy in patients that have a preserved high avidity PR1-CTL response after BMT. In patients that have a high avidity PRI-CTL population at time of remission after BMT and who subsequently lose the high avidity cells after BMT, it is predicted that the BM cells would either have a higher average P3 expression over time than the former group of patients, or that the P3 expression is maintained relatively "high" during remission after BMT, which either 10 increases or do not change substantially after subsequent immunotherapy. In these patients, it is further predicted that there will be no clinical response to immunotherapy with concomitant loss of high avidity PR1-CTL. Other parameters will likely influence the outcome, as shown in patients UPN4 and UPN6 treated with the PRI vaccine. Therefore, P3 distribution will also be measured in early 15 versus more committed BM progenitors using flow cytometry, surface expression of CD80, CD86, ICAM-1 (CD54), overall MHC and HLA-A2 expression, and the activation thresholds of the PRl-CTL will be examined using the y-IFN CFC assay and correlate with TCR avidity measured with tetramer staining. BM and PBMC will also be examined to compare any differences in TCR avidity and P3 expression between the two compartments since BM is the 20 site of a larger number of leukemia cells and high avidity PRl-CTL may be absent in the marrow but still be present in PBMC. Although cause and effect are more difficult to establish in patients compared to animal models where parameters can be more easily manipulated to establish that P3 overexpression in leukemia induces selective loss of high avidity leukemia specific T cells, it is expected that these experiments are likely to yield important insights into 25 the nature of tolerance since the antigen is well-defined, the tools are established and the patient samples necessary to conduct the experiments are avaiable. The inventors and others (Burchert et al., 2002) have also found that IFN induces P3 expression in myeloid cells. This increased expression may alter susceptibility to PR1-CTL mediated killing, but it may also cause apoptosis of the PR1 -CTL. In preliminary experiments, it 30 has been shown that IFN preferentially upregulates P3 only in the patients that achieve cytogenetic remission after treatment with IFN, and in whom a high avidity PRl-CTL immune response is noted by tetramer staining (FIG. 33). This may be interpreted to mean that P3 overexpression does not lead to selective loss of high avidity PR1-CTL. However, other effects of IFN on the PR1-CTL may influence the survival of the high avidity cells since type I 11r WO 2005/019435 PCT/US2004/027790 interferons are known to suppress apoptosis in activated antigen-specific T lymphocytes (Stark et al., 1998; Tanaka et al., 1998; Nakamoto et al., 1997). Therefore, using cryopreserved BM and PBMC from CML patients, will incubate high and low avidity PR1-CTL with CML cells as was done previously, but with and without INF- ae and IFN-y and with or without antibody to IFN-a 5 or IFN-y to detennine whether either IFN prevents PRl-CTL apoptosis (in addition to increasing P3 expression). If true, this may also help to explain the usefulness of IFN in the treatment of other solid tumors that are also targeted by tumor-specific CTL, such as melanoma and renal cell carcinoma. Lastly, the murine model of IFN-transduced mesenchymal stem cells (MSC) to treat CML may also give clues related to tolerance. For instance, increased expression of P3 after 10 induction of IFN expression may increase susceptibility to immune attack by P3-specific T cells, while at the same time leading to their ultimate extinction by apoptosis. In the clinical trial whether the PRI vaccine, administered as 3 injections every 3 weeks as previously described, will induce a PRl-CTL response and whether the vaccine induces cytogenetic and molecular responses in CML patients that are refractory to imatinib mesylate 15 (Gleevec) will be determined. It is expected that the PRI vaccine will induce PR1-CTL in patients that are refractory to imatinib and improve cytogenetic remissions in those patients. It is also expected that potential downregulation of P3 by treatment with imatinib may facilitate expansion of high avidity PR1-CTL induced by the vaccine. Patients will be randomized on the basis of HLA-A2 expression to receive IFN alone versus PR1 peptide with or without IFN in 20 patients with 10% to 90% Ph+ disease after 9 months of imatinib therapy. P3 in BM samples cryopreserved at the time of diagnosis (when available) will be quantified and compared to the time of study entry, and again 3 weeks following the vaccine. The P3 expression in vaccine recipients will be compared to patients that receive IFN alone or IFN plus PRl. Because imatinib down-regulates P3 while IFN upregulates P3 expression, it is not possible to predict 25 which mechanism might prevail to alter P3 expression. Concomitant to examining BM samples from the clinical study, however, the effect of both agents on P3 expression on BM cells from healthy donors and newly diagnosed CML patients in vitro will be examined. Epigenetic changes, such as methylation of the P3 gene, lead to altered expression of P3 (Lubbert et al., 1999), which may be independent of the effects of either imatinib or IFN and this will be 30 investigated in patient samples. In addition, because it was found that high avidity PR1-CTL undergo apoptosis when exposed to high doses of PR1, it is expected that very low expression of P3 in imatinib-treated patients may facilitate the reemergence of previously depleted high avidity PR1-CTL. Whether the high avidity PR1- CTL are present prior to vaccination, and the relative influence of the vaccine, compared to IFN on their possible reemergence will be determined. 117 WO 2005/019435 PCT/US2004/027790 CFC studies will be performed as previously described, to determine whether there are differences in functional activity in either the low or the high avidity PR1-CTL. Phenotypic data will be used to compare the maturation state of the CTL, which may relate to generalized T cell non-responsiveness. 5 EXAMPLE 11 MYELOPEROXIDASE (MPO) More recently, the inventors have studied another myeloid-restricted protein, 10 Myeloperoxidase (MPO), a heme protein synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. It was found that MY4 (RLFEQVMRI (SEQ ID NO:30)), a 9 aa peptide derived from MPO that binds to HLA-A2.1, can be used to elicit CTL from HLA-A2.l+ normal donors in vitro (Braunschweig et al., 2000). These MY4-specific CTL show preferential cytotoxicity 15 toward allogeneic HLA-A2. 1+ myeloid leukemia cells over HLA-identical normal donor marrow (Braunschweig et al., 2000). MY4-specific CTL also inhibit colony forming unit granulocyte macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA matched donors. Like PRI, MY4 is therefore a peptide antigen that can elicit specific CTL lysis of fresh human myeloid leukemia cells. Other peptides from MPO are predicted to bind to HLA 20 A2.1, but not all of these have been tested for their potential to stimulate immunity. Some previous studies have established PRI to be an important leukemia-associated antigen (LAA), and because of the many striking similarities of the nature of the immunity directed against Pr3 and MPO, it is likely that similar methods applied to the study of MPO specific immunity will establish MY4 and potentially other MPG peptides as important LAA as 25 well (Kochenderfer and Molldrem, 2001). EXAMPLE 12 PEPTIDE SELECTION AND BINDING ASSAYS In the first step to generating T cells which could be used for adoptive immunotherapy of myeloid leukemias, several peptides derived from the published sequence of MPO have been 30 identified which were predicted to bind to HLA-A*0201 using a published algorithm (Molldrem et al., 1996; Parker et al., 1994). This allele was chosen because its high frequency in the US population (49% of individuals) would maximize the therapeutic relevance of any eventual immunotherapeutic strategy. Of 10 peptides predicted to have sufficiently high binding affinities 118 WO 2005/019435 PCT/US2004/027790 based on the known HLAA2.1 binding motif, the five with the highest predicted binding were subsequently synthesized (designated MY1 through MY5) (Table 14). The peptides were synthesized by Biosynthesis (Lewisville, TX) or by the M. D. Anderson Protein CORE Facility (Houston, TX) to a minimum of 95% purity as measured by high-performance liquid 5 chromatography (HPLC). Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and 2 genes and cannot therefore present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with p2-microglobulin and increased 10 HLA-A2.1 surface expression, which could be measured using flow cytometry. An HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CALTAG) was used to measure surface expression of HLA-A2.1. In the second assay, the dissociation rate of I 125 -labeled p2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and 2-microglobulin was measured, which 15 allowed calculation of binding half-life (tm, 2 ). The labeled heterotrimer complex was separated from unincorporated p2-microglobulin by high-performance liquid Table 14: Peptide Start Amino Acid (aa) Subsequence Residue Half-Time Position Disassociation Peptide Start (aa) Subsequence SEQ ID NO: Residue Half-Time Residue Position Disassociation MYl 132 SLWRRPFNV 31 3348.233 MY2 28 KLLLALAGL 32 636.279 MY3 98 LLSYFKQPV 33 449.306 MY4 571 RLFEQVMRI 30 364.011 MY5 504 LIQPFMFRL 34 253.129 MY6 529 RVFFASWRV 35 168.881 MY7 53 VLGEVDTSL 36 148.896 MY8 418 LLLREHNRL 37 134.369 MY9 143 VLTPAQLNV 38 118.238 MY10 118 YLHVALDLL 39 110.747 20 MPO peptides predicted to bind HLA-A2.1 chromatography gel filtration, and the halftime of disassociation of P2-microglobulin were determined by subjecting aliquots of the 11Q WO 2005/019435 PCT/US2004/027790 complex to a second round of gel filtration. Five peptides showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide (background HLA-A2.1 expression; (FIG. 34; Braunschweig et al., 2000). The control peptides are the PRI peptide and an Influenza B nucleoprotein (aa 85-94; Flu), both with known high binding affinity to HLA-A2.1. The long 5 measured t 112 as measured using p2-microglobulin disassociation confined the binding of MY1 through MY5 to HLAA2.1 (Molldrem et al., 1996). EXAMPLE 13 INDUCTION OF PRIMARY CTL RESPONSES TO PEPTIDES 10 The five MPO peptides discussed above, were used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL. Briefly, T2 cells (which co-express the costimulatory molecule B7.1) were washed 3 times in serum-free RPMI culture media 15 supplemented with penicillin/streptomycin and glutamine (CM) and incubated with peptide at concentrations ranging from 0.2 to 200 gg/mL for 2 hr in CM. The peptide loaded T2 cells were then irradiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO). After 7 days in culture, a second stimulation was performed and the following day, 60 IU/mL of recombinant 20 human interleukin-2 (rhIL-2) (Biosource International, Camarillo, CA) was added. After 14 days in culture a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21 followed on day 22 by the addition of rhIL-2. After a total of 27 days in culture, the peptide-stimulated T cells were harvested and tested for peptide specific cytotoxicity toward CalceinAM labeled T2 cells, leukemia cell lines, and fresh human 25 leukemia cells. FIGS 35 and 36 show the peptide specific lysis of the CTL lines against T2 cells loaded with either 2.0 ptg/mL of MY2 or MY4, or T2 cells without added peptide, at varying effector to target (E:T) ratios. No peptide specific CTL lines could be elicited using MY1, MY3 or MY5 peptides, despite testing using different donors and differing peptide concentrations. The CTL line generated against the MY2 peptide demonstrated high specific lysis against MY2 30 loaded target cells, whereas the CTL line generated against MY4 did not demonstrate any significant cytotoxicity against MY2-loaded targets (Molldrem et al., 1996). The converse experiment, using CTL generated against MY4, tested similarly. Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLAA2.1, was also measured and resulted in < 20% specific lysis at E:T ratios of 50:1 by CTL 1 %)l WO 2005/019435 PCT/US2004/027790 specific for either MY2 or MY4. CTL stimulated weekly with either higher or lower peptide concentrations of MY2 or MY4 did not produce a short-term CTL line by 4 to 6 wk, as measured by specific lysis of peptide-coated T2 targets at the end of culture. Only CTL stimulated with 2.0 pg/ml of peptide produced effective short-term CTL lines. This observation was 5 reproducible across 10 healthy HLA-A2.1+ donor PBMCs that were used in the studies to elicit the CTL. This phenomenon was noted previously for CTL elicited against other self-peptides. EXAMPLE 14 HLA-A2.1 RESTRICTED CTL RESPONSES 10 To further demonstrate that the CTL response toward MY2 or MY4 are specific for target cells expressing the HLA-A2.1 molecule, T2 cells loaded or not loaded with 2.0 ptg/mL MY2 or MY4 were prepared. The CTL line generated against the respective peptides were also used to test for specific lysis. Mouse monoclonal antibody against HLA-A2.1 (BB7.2) was used to block HLA-A2.1-restricted recognition by the CTL line. T2 cells without peptide, but with 15 antibody present, were used to control for any potential non-specific antibody-mediated cytotoxicity. FIG. 37 demonstrates that with the addition of antibody to HLA-A2.1, specific lysis was blocked. Further, there was only background lysis of T2 cells in the presence of antibody alone. The data shown in FIG. 37 is the combined results from three separate experiments using three 20 separately generated CTL lines. This demonstrated that the observed cytotoxicity was HLA A2. 1-restricted. EXAMPLE 15 PR1 SPECIFIC CTL PREFERENTIALLY LYSE HUMAN MYELOID LEUKEMIA CELLS 25 It was next determined whether the MY2 and MY4-specific CTL lines were capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals. The targets were BM cells from pre-transplant HLA-A2.1-positive AML patients. As controls, BM cells from HLA-A2.l1-negative AML patients, BM from HLA-A2.1-positive healthy donors and two cell lines expressing low levels of MPO were used: HLA-A2.1 transfected K562 cells and 30 the U937 cell line which lacks HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2. 1-restricted manner. 1 )1 WO 2005/019435 PCT/US2004/027790 FIG. 35 shows the combined results of three separate experiments from three MY4 specific CTL lines. The specific lysis by MY4-specific CTL, at various E:T ratios, of either BM from healthy HLA-A2. 1-positive donors, HLA-A2.1-positive AML patients, HLA-A2.1 negative AML patients, or T2 cells with or without exogenously added MY4 peptide at 2.0 5 ptg/mL is shown. The specific lysis of U937 and HLA-A2.1-positive K562 cells by MY4 specific CTL was lower than the background lysis observed against T2 cells without added peptide. The results show that CTL elicited with the MY4 peptide result in short-term CTL lines with both MY4 -and HLA-A2.1 specificity that killed AML cells, but not normal cells. In contrast, FIG. 36 demonstrates typical cytotoxicity results from three experiments with 10 three different MY2-specific CTL lines. Marrow cells from patients with HLA-A2. 1-positive AML were readily lysed, at an E:T ratio of only 5:1. However, marrow cells taken from an HLA-A2.1-positive normal healthy donor also demonstrated significant lysis (43% lysis at E:T of 20: 1), similar to that of the HLA-A2.1-positive AML cells. EXAMPLE 16 15 MY2- AND MY4-SPECIFIC CTL LYSIS OF LEUKEMIA CELLS IS ASSOCIATED WITH ABERRANT MPO EXPRESSION All target cells were assayed for the presence of cytoplasmic MPO. After permeabilizing the cell membrane with Ortho PermeaFix (Ortho Diagnostics, Raritan, NJ), staining was performed using a FITC-labeled antibody to MPO (Accurate Chemicals, Westbury, NY) and a 20 PE-labeled antibody to CD34 (Becton-Dickinson, San Jose, CA) followed by flow cytometry. Table 15 lists the percentage of cells in the sample population that stain positive for MPO, as well as the median fluorescence intensity of intracellular MPO staining. The percentage of cells expressing surface MHC class I and CD80 (the costimulatory molecule B7.1) was also evaluated in the same target cell populations by staining with FITC labeled antibodies. 25 These experiments demonstrate that it is possible to elicit CTL specific for the MY2 and MY4 self-peptides from normal HLA-A2.1-positive donors that exhibit in vitro cytotoxicity against myeloid leukemia cells. Furthermore, the degree of cytotoxicity was associated with aberrant MPO expression. However, the MY2-specific CTL also showed specific lysis of normal donor marrow cells, which suggests that immunity elicited against this peptide in vivo might result in 30 autoimmunity that would be incapable of distinguishing leukemic cells from normal marrow progenitor cells. Lastly, since the CTL were tested against whole marrow from leukemia patients in short-term assays, it was possible that leukemia progenitor cells, which might not aberrantly express MPO, could escape CTL recognition. Therefore, whether leukemia 1'? WO 2005/019435 PCT/US2004/027790 progenitor cells could be eliminated by MY4-specific CTL in an AML colony-forming assay was investigated. The MPO expression in both leukemia and normal CD34+ cells was also determined. 5 Table 15: Cytoplasmic MPO Expression and Surface Phenotype of Target Cells Used in Cytotoxicity Experiments Patient/Donor Target Cell* % Cells MFI of NPO % Cells % Cells Expressing Expression Expressing Expressing MPO MHC I CD 80 AML #1 For MY2-CTL 98 982 88 46 AML #2 For MY2-CTL 77 841 92 38 AML #3 For MY4-CTL 89 966 98 58 AML #4 For MY4-CTL 84 859 83 41 Donor #1 For MY2-CTL 14 254 99 80 Donor #2 For MY4-CTL 18 217 96 56 U937 For both CTL 90 212 100 23 K562 For both CTL 21 181 28 32 *Target for specified cytotoxicity experiment; MPO = myeloperoxidase; MFI median fluorescence intensity. 10 EXAMPLE 17 MY4-SPECIFIC CTL PREFERENTIALLY INHIBIT AML COLONY-FORMING UNITS 15 PBMC from two normal healthy donors heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells using the method previously described. FIG. 38 shows the results of colony inhibition assays using CTL derived from a 13 day MY4 peptide-pulsed culture (CTL1). CFU-GM from patient P1 (M2-AML) and P2 (M4-AML) showed 63% (p = 0.006) and 34% (p = 0.007) inhibition, respectively. In contrast there was no inhibition of CFUGM from 20 normal marrow, Dl and D2, the corresponding HLA identical marrow donors for P1 and P2. Control CTL1 plated alone in methylcellulose under identical experimental conditions at 5 x 105 cells/ml showed no CFU-GM by day 16. 1'TN WO 2005/019435 PCT/US2004/027790 EXAMPLE 18 MPO IS EXPRESSED IN LEUKEMIC CD34+ CELLS - EXPRESSION IS LIMITED TO HEMATOPOIETIC CELLS Next it was confirmed that MPO was expressed in early CD34 positive CML cells. 5 Marrow was obtained from a patient with CML in CP, a patient with AML, and normal CD34 cells from G-CSF mobilized peripheral blood mononuclear cells from a normal donor for comparison. Cells were first labeled with PE conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA), followed by cytoplasmic staining for MPO. FIG. 39 shows that 19% of the CML cells were CD34 positive and 16% of those cells 10 highly expressed Pr3. In addition, CD34-negative cells also expressed MPO. In contrast, none of the normal CD34 positive cells expressed MPO. In cells from another patient with AML, 57% of AML cells were CD34- positive and 5% of those cells highly expressed MPO. This shows that very early progenitor cells overexpress MPO whereas there is no MPO expression normal progenitor cells. 15 To confirm that MPO expression was limited to hematopoietic cells, a panel of human tissues for MPO RNA expression was analyzed using RT-PCR. Following isolation and reverse transcription of RNA from each of the tissue samples, cDNA was amplified with 30 cycles of PCR. Primers amplifying a region spanning the 3rd and 4 't coding regions (conjunction position 613, 5' primer 588-610 (CATCTGCTTCGGAGACTCAGGTG (SEQ ID NO:40)), 3' primer 20 689-672 (TCAGGGAAAAGGCGGGTG (SEQ ID NO:41)) were selected and used to generate PCR products that were then separated on a 2% agarose gel. The gel was imaged on a BioRad analyzer and GelDoc software was used to quantify the products. FIG. 40 shows that expression of MPO is limited to bone marrow. EXAMPLE 19 25 MY4-SPECIFIC CTL IDENTIFIED IN PERIPHERAL BLOOD OF RECIPIENTS OF NONMYELOABLATIVE STEM CELL TRANSPLANTS USING PEPTIDE-HLA-A2 TETRAMERS Because CTL lines against both MY2 and MY4 could be elicited from normal donors and 30 that killed AML, it was next assessed whether it was possible to detect these CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2 specific CTL caused lysis of both leukemic and healthy bone marrow cells, which suggested that it would be unlikely to find *high circulating numbers of MY2-specific CTL since these might 11A WO 2005/019435 PCT/US2004/027790 mediate autoimunuity in addition to anti-leukemia immunity. Previous successful methodology using peptide/HLAA2 tetramers to identify the similarly deduced peptide PR1 as an HLA-A2. 1 restricted leukemia associated antigen (LAA) (Molldrem et al., 2000) argued strongly that this same methodology could be used to determine whether MY2 and MY4 were also potential 5 LAAs. Production of peptide/MHC tetramers has been described by in detail elsewhere (Molldrem et al., 2000). Briefly, a 15 amino acid substrate peptide (BSP) for BirA dependent biotinylation has been engineered onto the COOH terminus of HLA A2. The A2 BSP fusion protein and human P2 microglobulin (p 2 M) were expressed in E. coli, and were folded in vitro 10 with the specific peptide ligand. The properly folded MHC peptide complexes were extensively purified using FPLC and anion exchange, and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, CO). Tetramers were produced by mixing the biotinylated MHC peptide complexes with phycoerythrin (PE) conjugated Neutravidin (Molecular Probes), or PE(Cy7)-conjugated Neutravidin at a molar ratio of 4:1. MY2 and MY4 15 tetramers were validated by staining against a CTL line specific for each peptide. CMV tetramers were validated by staining with PBMC from a CMV immune individual. Specificity was demonstrated by the lack of staining of irrelevant CTL. By titrating positive CTLs into PBMCs from normal controls, the limit of detection was established to be as low as 0.01% of CD8+ cells. Each tetramer reagent was titered individually and used at the optimum 20 concentration, generally 20 pg/ml - 50 ptg/ml. Nine HLA-A2.1- positive AML patients in relapse prior to allogeneic NST, and then again at day 60 post-transplant were examined using peptide/MHC tetramers. All of the patients were CMV immune prior to transplant, and therefore pp65/HLA-A2.1 tetramers served as positive controls for evidence of antigen specific immunity. Because of the limited amount of 25 sample that was available, staining method was modified to use 2 or more different tetramers simultaneously to stain PBMC samples. In contrast to MY2-CTL, which showed 45% specific lysis of HLA-A2+ normal BMC in addition to killing leukemia, MY4-CTL showed no lysis of normal BMC and only killed leukemia cells, which suggested that MY4 may be a more biologically relevant leukemia 30 antigen. It was predicted that high numbers of circulating MY2-CTL would not be found, but that MY4-CTL may be detectable in leukemia patients. CTL from blood samples obtained 60 days after NST in 9 HLA-A2 AML patients were studied using combinations of 6 HLA-A2 tetramers and multiparameter flow cytometry using a MoFlo cytometer (Cytomation, Fort Collins, CO). A2 tetramers were constructed with the following peptides: PRI, MY2, MY4, the 1 r WO 2005/019435 PCT/US2004/027790 CMV pp6 5 peptide, and the minor antigens HA-1R (a negative control) (den Haan et al., 1998) and HA-1H (the allele against which CTL responses have been shown) (den Haan et al., 1995; den Haan et al., 1998; Marijt et al., 1995). All patients showed evidence of donor chimerism by DNA microsatellite analysis at the time of study, and all were CMV seropositive. 5 FIG. 41 shows that multiple-tetramer staining is associated with a 0.1% loss of sensitivity; however, ratios of antigen specific CTL were preserved when compared to single tetramer staining. As shown in FIG. 42, staining PBMC from HLA-A2.1-positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and chronic lymphocytic leukemia) showed there was no detectable CTL immunity against mycloid-specific 10 antigens. However, as shown in FIG. 43, both PR1-CTL and MY4-CTL are detected in the peripheral blood of these patients, but MY2-CTL is not detected (the limit of sensitivity is 0.01% in cell titration experiments). This figure shows a representative patient sample of peripheral blood that was obtained on day 60 post-NST and stained using the multiple tetramer methodology and CD8 and then analyzed using CellQuest software. 15 Next, a total of 9 HLA-A2+ NST recipients were examined on day 60 post-transplant for immunity against each of the 6 peptides. By comparing relapse rates, as summarized in FIG. 44, a greater percentage of PR1-CTL were present in patients in continuous remission at 1 year (median of 2.45%) versus those patients that went on to relapse (median of 1.55%), p = 0.03. Although there was a trend toward a higher percentage of both MY4- and HA-1H-CTL in 20 patients in remission, it did not reach statistical significance. No MY2-CTL were identified in any of the patients studied. The development of either > grade II acute GvHD or chronic GvHD did not correlate with the percentage of any of the peptide-specific CTL studied, although there was a trend toward a higher number of HA-1-CTL in patients that developed significant GvHD. Importantly, these preliminary experiments (1) extended the importance of PR1-specific CTL 25 immunity to NST recipients, (2) highlighted the probable relevance of MY4-specific CTL immunity in NST recipients, and (3) lessened the likelihood of biological relevance of MY2 specific CTL immunity as part of the anti-leukemia response. This is the first study to combine simultaneous multi-tetramer analysis with other surface phenotypic markers to determine the relative importance of leukemia-associated antigens in the 30 GVL effect. These results indicate that although CTL with MY2 specificity are below the detection limit using tetramer staining, MY4-CTL and HA-1H-CTL are increased in NST recipients and may therefore be important in the GVL effect after NST for AML. These results also extend the previous results and suggest that PR1-CTL may also contribute to the elimination of AML after NST. 1 'M WO 2005/019435 PCT/US2004/027790 EXAMPLE 20 SORTED ANTIGEN-SPECIFIC CTL SPECIFICALLY KILL LEUKEMIA CELLS To show that tetramer-sorted antigen-specific CTL are functional, PRl/HLA-A2 tetramer+ CTL from a donor lymphocyte (DLI) product obtained from leukapheresis were 5 stained, sorted and tested for lysis of both donor and recipient (which contained > 90% blasts) cryopreserved BM. The recipient was in remission by 6 months after allogeneic BMT, but relapsed with chronic phase CML by 12 months with 100% Ph+ BM cells. The patient was then treated with a total of 7 x 10 DLI per kilogram body weight from months 12 to 13 with no other therapy, and was in remission with 0% Ph+ BM cells by month 18 when PBMC were available 10 for testing. After staining with the PRl/HLA-A2 tetramer and sorting on the MoFlo cytometer, the yield of sorted PR1/HLA-A2 tetramer+ cells was 81%, with 90% purity, and the sorted tetramer negative population contained no detectable PR1/HLA-A2 tetramer+ CTL. As shown in FIG. 45, the sorted PRl/HLA-A2 tetramer positive CTL showed greater lysis of recipient marrow 15 taken from time of relapse than the non-sorted PBMC. Although the sorted PRl/HLA-A2 tetramer negative CTL showed less lysis of recipient BM than non-sorted PBMC, it was above background lysis against donor BM. This likely reflects non-PR1-specific CTL with activity against other leukemia antigens. Minimal or no lysis of donor BM was seen with either the sorted PRl/HLA-A2 tetramer positive CTL or non-sorted PBMC. This is strong evidence that 20 PR1-specific CTL actively lyse CML cells and contributed to remission in this patient (Molldrem et al., 2000). To confirm leukemia specificity of the PRI -specific CTL, PBMC from the recipient were again sorted using the PR1/HLA-A2 tetramer and tested for lysis of HLA mismatched target cells. As shown in FIG. 46, PR1/HLA-A2 tetramer sorted PBMC showed lysis of HLA-A2.1+ 25 CML cells from 2 unrelated patients, but no lysis of either HLA-A2.1- CML cells or HLA-A2.1+ normal donor marrow cells at E:T ratio of 5:1. To show that CTL with specificity for peptides such as MY4, which are identified using a deductive strategy, can successfully be translated to the clinic, a phase I clinical trial using the PR1 peptide as a vaccine with incomplete Freund's adjuvant and GM-CSF was initiated. This 30 further demonstrates that highly useful LAA can be identified using these methods. Patients eligible for the vaccine included HLA-A2+ CML and AML patients that had failed conventional therapy or AML patients that were in 2nd CR (i.e. at high risk of relapse). When PR1 was administered subcutaneously at 0.25, 0.5 or 1.0 mg every 3 weeks for 3 injections, PRI -specific CTL immunity was elicited in 6 of 9 patients (by tetramer staining) and 177 WO 2005/019435 PCT/US2004/027790 complete remissions were obtained in 2 patients (1 AML and 1 CML patient). The patient with AML was positive for the t(15;17) translocation and subsequently became PCR negative after vaccination. Importantly, the expanded PR1-specific CTL from peripheral blood of that patient were isolated by tetramer staining and relapsed BM cells were killed, but not BM cells taken 5 during remission. This technique may be applied to the treatment of other forms of leukemia, to other HLA types and potentially to other tumors as well. Thus, to develop effective leukemia-specific immunotherapies, Pr3 and MPO were investigated as tissue-restricted proteins and it was found that the HLA-A2. 1-restricted self peptides, PRI and MY4, derived from Pr3 and MPO, respectively, can be used to elicit peptide 10 specific CTL that preferentially attack myeloid leukemia based on aberrant expression of the parent proteins in the target cells. By using tetramers to study post-transplant and postinterferon treated patients for peptide-specific immunity, PRI was established as a leukemia-associated antigen. The data suggest that PR1 and MY4 could be used as target antigens to stimulate both 15 active and passive leukemia-specific immunity. MY4-specific CTL will be given in an adoptive immunotherapy study with nonmyeloablative stem cell transplant, and in a clinical phase I trial other peptide antigens that are identified will be added to this approach. MY4-specific CTL will be selected and expanded ex vivo with the MY4 antigen for the production of leukemia-reactive CTL to produce a GVL effect and minimize GVHD. 20 A deductive strategy to identify peptide antigens from myeloperoxidase that are restricted to common HLA alleles that can be used to elicit leukemia-specific CTL responses in vitro. It has been shown, as previously discussed, in 9 HLA-A2+ AML patients who received NST that, in addition to PR1, MY4 is another new potential LAA. However, only 48% of the U.S. population has the HLA-A2 allele. Therefore, to extend any resulting 25 immunotherapy strategies based on newly identified peptide antigens, whether each of the peptides predicted to have high binding (dissociation half-time >10) to the HLA-A3 and the HLA-B7 alleles can also elicit peptide-specific CTL will be addressed. It will be determined whether it is possible to elicit CTL immunity against the remaining five peptides in Table 14 that are predicted to bind to HLA-A2.1. In addition, whether CTL 30 against the predicted HLA-A3-, and HLA-B7-restricted epitopes from MPO can be elicited will be determined. Using the same method used to deduce HLA-A2-restricted peptides, several more peptides that are predicted to bind with high affinity to their respective HLA alleles have been identified. These peptides are shown in Table 16 and Table 17. As shown previously, peptides with predicted disassociation half-times of > 10 are the most likely to bind to the 1 95Z WO 2005/019435 PCT/US2004/027790 relevant HLA alleles (Molldrem et al., 1996). Therefore, all 20 of the A3- and B7-restricted peptides will be synthesized and examined. All peptides will be synthesized to a minimum of 95% purity. The peptides will be dissolved in a minimum of DMSO and solubility characteristics will be noted. Binding of each 5 of the HLA-A2.1 -restricted peptides will be performed using wild type T2 cells using the method of determining HLA-A2 stabilization by indirect fluorescence and flow cytometry. Relative fluorescence will be obtained using the BB7.2 hybridoma (ATCC) and compared to peptides with known binding characteristics, PRI and pp65. 10 Table 16: MPO peptides predicted to bind HLA-A3 HLA-A3 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation Peptide Starting Sequence SEQ ID NO Predicted Binding Number Amino Acid Half-Time Position Dissociation 1 466 VLGPTAIRK 42 60.000 2 595 GLPGYNAWR 43 54.000 3 503 TLIQPFMFR 44 54.000 4 571 RLFEQVMRI 30 27.000 5 62 VLSSMEEAK 45 20.000 6 508 FMFRLDNRY 46 20.000 7 471 AMRKYLPTY 47 18.000 8 452 AMVQIITYR 48 13.500 9 663 CIIGTQFRK 49 13.500 10 361 GLLAVNQRF 50 13.500 To determine whether the remaining peptides from Tables 16 and 17 will also bind to HLA, the HLA-A3 and HLA-B7 alleles from EBV-transformed B cells derived from HLA-A3+ 15 and HLA-B7+ normal donors were first cloned. These genes were inserted into the BirA containing cassette that was used to construct the HLA-A2.1 tetramers and were then used to fold HLA-A3 and HLA-B7 tetramers using peptides with known high binding affinity to the respective alleles. Tetramers folded with the newly identified peptides will be used as reagents to test whether patients have evidence of circulating peptide-specific CTL. 20 The peptide-specific CTL lines generated in vitro from healthy donors that show peptide specific lysis will be used as "reagents" to confirm the specificity of the tetramers. The A3 and 110 WO 2005/019435 PCT/US2004/027790 B7 alleles have also been cloned into a mammalian vector containing the CMV promoter (Clonetech). Electroporation will be used to transduce T2 cells with these vectors. The transduced T2 cells will then be expanded for up to 1 month and sort-purified using the MoFlo high-speed cell sorter based on increased A3 or B7 surface expression after the addition of 5 stabilizing A3- and B7-binding peptides. The resulting T2 cells can then be used to determine whether the predicted peptides from Tables 16 and 17 bind to A3 and B7 by using A3- and B7-specific monoclonal antibodies (Immunotech and Pharmingen), and measuring surface expression. These binding results will be compared to peptides with known binding affinities to A3 and B7, such as influenza matrix and 10 CMV pp65-derived peptides. The relative binding affinities of these peptides to the HLA allele, will be determined by serial dilutions of each peptide and comparing them to PR1 after analyzing for surface HLA expression by flow cytometry. In this way, an IC 50 value will be determined for each peptide. Using the methods described for PR1 and the first 5 MPO peptides examined, the 15 resulting peptide-elicited CTL lines will be characterized for their ability to kill peptide-coated T2 cells, fresh leukemia cells and established leukemia cell lines such as U937 and K562. HLA restriction will be confirmed using targets without the relevant allele and by blocking experiments with antibodies specific for the relevant alleles. The amount of target cell killing will be determined using a standard 4-hr assay (Molldrem et al., 1996; Hensel et aL, 1999) and 20 will be correlated with target antigen expression and surface phenotype of the leukemia cells and healthy donor BM cells. Table 17: MPO peptides predicted to bind HLA-B7HLA-B7 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation Peptide Starting Amino Sequence SEQ ID NO Predicted Half-Time Number Acid Position Dissociation 1 434 NPRWDGERL 51 800.000 2 234 IVRFPTDQL 52 300.000 3 468 GPTAMRKYL 53 120.000 4 136 RPFNVTDVL 54 80.000 5 575 QVMRIGLDL 55 60.000 6 522 NPRVPLSRV 56 60.000 7 588 MQRSRDHGL 57 40.000 8 191 SNRAFVRWL 58 40.000 1 W) WO 2005/019435 PCT/US2004/027790 Peptide Starting Amino Sequence SEQ ID NO Predicted Half-Time Number Acid Position Dissociation 9 325 TIRNQINAL 59 40.000 10 352 NLRNMSNQL 60 40.000 MPO intracellular protein expression will be detennined using direct intracellular FACS staining for the MPO protein with a FITC-labeled murine monoclonal antibody. This intracellular stain will be combined with surfaced antibodies for myeloid differentiation markers 5 such as CD34, CD33, CD13, CD14, CD16 and HLA-DR to determine which stage of differentiation might be more susceptible to CTL killing. The MoFlo cytometer is capable of simultaneous 10-color analysis, which will greatly facilitate the analysis of progenitor stage of development. Both BM and PBMC will be examined similarly for MPO expression and surface phenotype and compared to determine whether there are differences in target susceptibility based l'0 on location (marrow vs. peripheral blood). To determine whether CTL with specificity for myeloperoxidase-derived peptides can be detected in vivo in patients at diagnosis, before and after NST and after treatment with chemotherapy. Because CTL lines against both MY2 and MY4 could be elicited from normal donors and kill AML cells, it was next determined whether it was possible to detect these 15 CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2-specific CTL caused lysis of both leukemic and healthy bone marrow cells, which suggested it would be unlikely to find high circulating numbers of MY2-specific CTL since these might mediate autoinimunity in addition to anti-leukemia immunity. Previous studies using peptide/HLA-A2 tetramers to identify the similarly deduced peptide PR1 as an HLAA2.1 20 restricted leukemia associated antigen (LAA) (Molldrem et al., 2000) argued strongly that the same methodology could be used to determine whether MY2 and MY4 were also potential LAAs. Thus, paired samples from 90 AML patients treated using nonmyeloablative transplant regimens (up to 30 per year for the first 3 years) will be examined. Patients will be studied for immunity to the 6 peptides discussed, in addition to any peptide antigens that are found to elicit 25 anti-leukemia immunity. This will include peptides with HLA-A3 and HLA-B7 restrictions. Patient peripheral blood samples will be obtained prior to transplant and then weekly after transplant, beginning on day 10 and continuing until day 100. Patient samples will then be examined at each follow-up in the BMT clinic, which will be monthly until 1 year post transplant. PBMC samples will also be obtained from the donor pre-transplant. BM cells will be 30 obtained from the donor if BM is used as the graft, and from the recipient prior to transplant and 1 T WO 2005/019435 PCT/US2004/027790 again on days 30, 100 and day 365 post-transplant. The PBMC and BM samples will be cryopreserved. PBMC samples will be used for later evaluation as more peptides are identified as potential LAAs (as discussed herein). The lymphocytes for surface expression of several markers, will be examined including CD3, CD4, CD8, CD16 + 56, CD45RA, CD45RO, CD57, 5 CD28, CD27 as well as tetramer staining. The maximum number of tetramer + cells during the time course of study will be determined. Prior experience with viral antigen-specific CTL, with HA-i-specific CTL and with PR1-specific CTL suggest that the peak number of tetramer+ cells occurs over a 3 to 4 week period and often coincides (or may lag by a week or two) with the time of documented 10 remission. Furthermore, the peak for other peptide- specific CTL is usually in the range of 1% to 10%. Significant increases over baseline of tetramer+ cells occurring during the study period will be verified. The study size will provide 85% power to establish a mean absolute increase of 1 percentage point (SD=3.5% based on previous data, type I error=0.05) at peak. In addition, the proportion of patients who show tetramer positivity, defined as at least 1% of cells positive at 15 peak (SD+/-10% under assumed rate of 50% positivity) will be estimated. BM cells will be studied for MPO expression using intracytoplasmic staining combined with surface phenotypic makers that will allow the determination of the point of maturation of the BM cells. Expression of CD1 la, CD13, CD14, CD16, CD33, CD34, CD80, CD86, HLA-ABC and HLA-DR will be examined. Because MY4 and the other peptides in this study are self-antigens, it is possible that 20 AML patients treated with chemotherapy alone may have circulating numbers of MY4/MHC tetramer+ cells based on a previous study of CML patients using the PR1/HLA-A2 tetramer, however, this would seem unlikely. If these peptides are detected in AML patients that are in remission it may indicate that post-chemotherapy recovery of immunity is important for obtaining remission and the length of remission duration. Blood samples will be obtained from 25 10 consecutive AML patients receiving chemotherapy as alternative to NST, with samples obtained at the same time points after start of therapy as for the NST group. Thus, whether the proportion of patients showing tetramer positivity differs between the chemotherapy and NST groups will be addressed. It is anticipated that less than 5% of chemotherapy patients will show positivity compared to about 50% of NST patients. A chi-square test comparing the two 30 proportions will have 92% power to detect the difference of interest (type I error=0.05), comparing the 10 chemotherapy patients to 90 NST patients. To determine the significance of circulating tetramer+ cells, it will also be assessed whether the presence of MY4 tetramer+ lymphocytes is associated with duration of disease response. All or nearly all of the 90 patients who start NST will be in complete remission or achieve it following NST therapy. From 30 to 1 31 WO 2005/019435 PCT/US2004/027790 40 relapses will have occurred at the time of data analysis, one year after the last patient is treated. Patients will be classified into two groups based on whether or not the patients have detectable tetramer+ cells. The association of response duration to tetramer positivity status will be modeled assuming proportional hazards. The study is powered to detect a tripling in risk of 5 relapse associated with failure to detect tetramer+ lymphocytes. In addition, separate assessments of the association of tetramer positivity with duration of response determined by molecular and cytogenetic methods, will be made. It will also be important to determine whether the MY4-CTL are functional. Various methods of assessing function have been described, including cytokine secretion, CD69 upregulation, cell proliferation, and cytotoxicity. Tetramer 10 staining and cytokine flow cytometry (CFC) will simultaneously be determined on all patients since the MoFlo will greatly facilitate these experiments. PE-labeled antibody to gamma interferon and PECy7- labeled tetramers will be used to in these studies. Cells will first be labeled for 10 min at 37'C with tetramer and FITC-labeled CD8 and then stimulated with MY4 peptide at 2 pig/ml. Brefeldin A will be added during culture to inhibit secretion of cytokines, 15 and after 6 hr cells will be permeabilized and stained for interferon. This technique has been successfully used to monitor PRl-CTL responses after vaccination and it was found that CFC positivity correlates with cytotoxicity. In select patients with sufficient numbers of available PBMC and tetramer+ cells, the tetramer+ population will be purified by high-speed sorting using the MoFlo cytometer. Both the tetramer+ and tetramer-cells will be tested for cytotoxicity 20 against cryopreserved leukemia targets prior to NST or chemotherapy. Because the MoFlo is capable of 4-way simultaneous sorting, the killing of peptide-coated target cells of the MY4 CTL will be compared to other peptide-specific CTL (i.e. pp65 in serpositive patients) to directly compare lytic potential. To determine the optimal method to select and expand peptide-specific CTL from 25 healthy donors that can be used for adoptive cellular immunotherapy of NST recipients. Because CTL with mycloid self-antigen specificity are present at very low precursor frequencies (Molldrem et al., 1999), these CTL will need to be expanded before they could be used as part of an adoptive transfer immunotherapy strategy. While there are currently some commercially available methods for the separation of antigen-specific CTL based on cytokine secretion, they 30 are presently not licensed for use in patients, and the best method to separate antigen-specific CTL has not been defined. Similarly, the optimal method to expand CTL in short-term culture conditions is not yet defined, and expansions on large scale without the use of fetal calf serum remain a major obstacle to cellular immunotherapy. Two general expansion methods to elicit MY4-CTL in vitro will be compared.

WO 2005/019435 PCT/US2004/027790 In the first approach, peptide-pulsed dendritic cells (DCs) will be used to stimulate responder PBMC weekly for 4 to 6 wk. Although there are many potential sources for precursors to mature DC, including CD34+ cell-derived hematopoietic precursors, monocyte derived DC have been chosen because they are more readily available in large numbers from 5 donor leukapheresis products. For practical reasons, this methodology is most likely to yield the greatest potential number of DC, which will be needed to grow low precursor frequency self antigen specific CTL. For similar practical reasons, the use of interferon (IFN) and GM-CSF to grow DC, with or without TNF-a added to mature the cells during the last 48 to 72 hr of culture have been studied. The advantage is that both IFN and GMCSF are commercially available and 10 have been used extensively in humans. In brief, DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon-a2b plus 500 U/ml GM-CSF (termed DC/IGM). Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10% human serum (HS) with the addition of the above cytokines. T2 cells were maintained in 15 RPMI + 10% HS prior to co-culture with donor PBMC. At the end of 7 days, DC were pulsed with 20 pg/ml PR1 peptide, irradiated and combined with fresh PBMC from the same donor at a 1:2 ratio. On day 7, the culture was restimulated with PR1-pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PR1-CTL cultures were tested for their ability to lyse PR1-coated 20 target cells or CML cells. The PRl-CTL were also evaluated for surface phenotype with the PR1/HLA-A2 tetramer and anti-CD8. In general, both DC/IGM and T2 cells elicited PR1-CTL. However, T2 were nearly twice as efficient, typically yielding 3% to 6% PRI-CTL (of the bulk culture, determined by tetramer staining) by 4 wk and DC/IGM yielding only 0.5% to 2% PR1 CTL. Since T2 cells may be difficult to use clinically for regulatory reasons, alternative sources 25 of stimulators must be studied. This procedure is discussed in detail herein and in Molldrem et al. (2003); (2002); (1999); (1998); (1997); each incorporated herein in their entirety by reference). Typical yields of antigen-specific tetramer+ cell numbers were 3% to 5% PRl-CTL using AAPC or T2 cells, but only 0.3% to 2% when DC/IGM are used. These observations are likely to apply to MY4, but all 30 of the comparative experiments will be repeated using this peptide. hi addition, serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. This will detennine the optimal conditions that produce the highest numbers of functional MY4-CTL in the shortest period of time. Weekly tetramer 1VA WO 2005/019435 PCT/US2004/027790 staining during bulk culture restimulations will be used to compare numbers of MY4-CTL, and CFC and cytotoxicity experiments will be used to compare the effector function of the cells. Additionally, two methods to select antigen-specific CTL from bulk culture will be compared. Although it is predicted that the bulk culture conditions described above will yield 5 CTL that, when adoptively transferred to patients, will not produce significant GVHD, it is possible that GVHD occurs due to the non-specific CTL remaining in the bulk cultures. Since CTL cloning at the end bulk culture is time-consuming and would therefore need to be performed prophylactically in each patient, and because the transfer of CTL clones is not likely to yield long-lived CTL in vivo (Riddell and greenberg, 1994; riddell and Greenberg, 1995a; 10 Riddell and Greenberg, 1995b), it is suggested that separation of the peptide-specific fraction from the bulk culture may improve the purity and thereby reduce GVHD. In the first approach to select the antigen-specific CTL, cytokine capture microbead technology developed by Miltenyi Inc., which relies on the ability of antigen-specific CTL to secrete IFN after antigen challenge will be used. These reagents are commercially available, although they are not yet 15 approved for clinical use. MY4-CTL obtained after 4 wk of weekly restimulation will be incubated with MY4 antigen and the bi-specific antibody with anti- CD45 and anti-IFN binding will be co-incubated with the cells. A secondary antibody with anti- IFN antibody that is directly linked to microbeads (supplied by Miltenyi, Inc., Germany) will then be used to select out IFN secreting CTL from bulk culture. In the second approach, the IFN capture method will be 20 compared to a modified peptide/MHC-conjugated bead method developed to select antigen specific CTL. In previous studies using the PR1 peptide, the feasibility of using PRi peptide/HLA-A2 monomers linked to streptavidin-coated microbeads (Miltenyi Inc, Germany) to separate antigen-specific CTL from bulk cultures of mixed lymphocytes was demonstrated as described herein (see also Molldrem et al. (2003); (2002); (1999); (1998); (1997), each 25 incorporated by reference herein in their entirety). These studies will be repeated using MY4/HLA-A2 monomers to determine whether similar yields of antigen-specific CTL can be obtained. This methodology will be compared to the standard IFN-capture methodology developed by Miltenyi. Although it is reasonable to expect that the commercial technology will produce sufficient purity of CTL, the device may not capture all CTL with the potential to 30 recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen specific CTL might be required to maintain the more functional fraction in vivo, or whether the non-secreting CTL later become able to express effector function, too few CTL may be selected using the commercial product. Monomer coated beads are likely to capture all of the available antigen-specific CTL from the bulk culture, as shown in previous studies. 1 ' WO 2005/019435 PCT/US2004/027790 To determine whether peptide antigen-specific CTL can be adoptively transferred to myeloid leukemia patients after T cell-depleted NST to facilitate engraftment, boost GVL and reduce GVHD. The overall treatment strategy to enhance GVL and reduce GVHD is to use a nonablative preparative regimen to achieve engraftment of allogeneic blood stem cell or 5 bone marrow transplant and to be the platform to deliver antigen-specific CTL therapy. The goal is to determine the maximal dose of MY4-specific CTL that will provide engraftment in > 80% of patients while preventing development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD <15%) and mediating a GVL effect. T-cells have been shown to facilitate engraftment and are required to prevent rejection with the established nonablative preparative 10 regimens. Recently, the use of a nonablative preparative regimen, including fludarabine and melphalan, was demostrated that successfully allowed engraftment of an allogeneic blood stem cell or bone marrow transplant from HLA identical siblings or matched unrelated donors in patients with AML and other hematologic malignancies. This approach allows allogeneic transplantation for patients who were elderly or had co-morbidities, which would make them 15 ineligible for high dose myeloablative regimens. Acute GVHD is a major cause of morbidity and mortality and treatment for GVHD remains unsatisfactory, particularly in older and infirm patients. Thus, this study extends this therapeutic strategy, with manipulation of donor cells to reduce alloreactive cells by enriching for MY4-CTL (and other antigen-specific CTL determined previously). This will be accomplished by selecting and adoptively transferring the MY4-CTL. 20 These cells thus, would not be expected to react against the recipient tissues, but would still be able to mediate anti-leukemia effects. Patients with AML who have an HLA compatible related or unrelated donor who failed to respond to initial chemotherapy or after relapse will be used. Lymphocytes will be collected from the donor by apheresis with a goal of collecting 2 x 108 CD3+ T-cells/kg. Donor type peripheral-blood mononuclear cells are plated in 75-mm flasks at 25 2 x 106 cells/ml and stimulated with 2 x 106 irradiated donor-derived DC from the patient's donor. If other methods, as discussed above, produce superior results, the procedure will be modified to incorporate those methods. CTL bulk cultures will be restimulated weekly, as described herein. After 28 days of co-culture, the cells will be harvested and live cells will be 30 isolated on Ficoll gradient. The cultures are treated with IL-2 20 U/mL final concentration on day 8 and weekly thereafter. All the responders and stimulators are suspended into RPMI-1640 medium with 2 mM L-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 25 mM Hepes, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 5 x 105 M 2-mercaptoethanol. Autologous serum at 10% will be supplemented. This will be modified if the results show that 1 i WO 2005/019435 PCT/US2004/027790 albumin or serum-free conditions can be substituted. Stem cells will be collected from the donor's blood after G-CSF administration according to standard procedures. If there is a medical contraindication to G-CSF administration, stem cells will be collected by bone marrow harvest. Apheresis will occur daily for up to a total of four procedures in order to collect > 5 x 106 5 CD34+ cells/kg recipient weight after positive selection of CD34+ cells. The minimal acceptable number is 2 x 106 CD34+ cells/kg recipient weight. Cells will undergo CD34 selection using the Isolex or Miltenyi device with the final composition including > 2 x 106 CD34+ cells and < 1 x 105 T-cells/kg. The apheresis product from each day will be cryopreserved according to standard procedures. For the preparative regimen, patients will 10 receive fludarabine 25 mg/m 2 intravenously daily at the same time over 30 min on days 6, 5, 4, 3, 2 and melphalan 70 mg/m 2 on day 3 and 2 administered following completion of the fludarabine. The allogeneic hematopoietic cell infusion consisting of > 2 x 106 CD34+ cells plus MY4-CTL is administered on day 0. MY4-CTL will be administered in a phase I study to define the maximal dose that can be administered without producing GVHD. Tetramer staining will be 15 performed at the end of bulk culture. Dose levels will be 1: 5 x 107 CD8+ cells/kg; 2: 1 x 108 CD8+ cells/kg and 3: 5 x 108 CD8+ cells/kg. Patients will not receive post transplant immunosuppressive therapy or growth factors, but will receive standard supportive care for prevention of infection. It is predicted, based upon previous results, that current expansion techniques will yield sufficient MY4-CTL 20 from the collection of 2 x 108 CD3+ T-cells/kg. Patients will be assessed for engraftnent and chimerism on days 28, 56, 90, 180, 365 and yearly post transplant. Chimerism will be assessed by microsatellite STR (short tandem repeat) markers and analyzed using GeneScan software on peripheral blood, assaying both T-cells and myeloid cells separately. Engraftment is defined as documentation of> 50% donor derived T-cells on day 90. Disease remission will be assessed by 25 bone marrow evaluation on day 28, 90 and 180 and as indicated thereafter. Acute and chronic GVHD will be assessed by standard criteria. Peripheral blood will be collected weekly for tetramer staining and for surface phenotyping, as performed above. Evaluation for Donor Leukocyte Infusion. If no GVHD is observed, and if antigen specific CTL are no longer detectable, patients will be evaluated at day 45 for infusion of antigen 30 specific T cells. Patients in remission and with evidence of T cell chimerism (> 5% recipient) will be eligible for donor cell infusion. The same cell dose will be transferred. Primary endpoints are the achievement of durable engraftment defined as the durable presence of > 50% donor T-cells and myeloid cells (in the absence of leukemia relapse) and development of grade 3 acute GVHD using standard criteria. Secondary endpoints include relapse of AML, non-relapse 1'17 WO 2005/019435 PCT/US2004/027790 mortality and survival. The non-alloreactive CTL are intended to augment engraftment without inducing GVHD in the absence of leukemia relapse. Patients will be treated in cohorts of 6 patients. The starting dose level is level one. If graft failure occurs in 2 of a given group without GVHD, the dose will be considered too low to ensure engraftment and subsequent patients will 5 be entered at the next higher dose level. If grade 3 acute GVHD does not occur in a given group, subsequent patients will receive the next higher dose level. If grade 3 acute GVHD occurs in one patient, 6 additional patients will be treated at a given level. If grade 3 acute GVHD occurs in 2 patients (out of a maximum of 12) at a given level, the rate of GVHD will be considered excessive and that level will be terminated. The MTD is the level, which allows engraftment in 10 at least 5 of 6 patients without excessive GVHD. Ten additional patients will be treated at the MTD. Early stopping criteria will be established to close the study in the event of excess death or relapse. A phase I trial will be conducted in which a maximum of 60 patients will be assigned among the three levels of cell doses. Outcomes to be monitored are immune response and occurrence of GVHD, both defined over a 100-day period from receipt of transplant. Within 15 each dose group, the goals are to achieve a rate of at least 20% of patients with immune response while maintaining at most a 20% rate of GVHD. Patient outcomes will be monitored and compared to stopping boundaries computed using a Bayesian method. Priors will be based on results of the PR1 peptide vaccine trial of active immunotherapy, and doses are assumed independent. The vaccine trial has shown a peak tetramer response of 2% of all CD8+ T-cells, 20 which will provide a good starting estimate for the design of a passive adoptive transfer cell therapy protocol. Stopping boundaries will be computed using available software. This is intented to terminate a dose level if the computed probability of achieving at least a 20% immune response rate based on accumulated data is less than 10%, or the probability of 20% GVHD rate is at least 90%. Among dose levels not terminated early, the dose level having the 25 highest observed immune response rate will be declared optimal, unless there are major differences in GVHD rates. It is expect, based on previous data, that therapy based on peptides derived from self hematopoictic proteins will lead to advances in the treatment of mycloid leukemia. Peptide specific adoptive T-cell immunotherapy, combined with CTL specific for other MPO epitopes 30 may enhance the efficacy of such an approach. If the clinical study fails to convey an anti leukemia immune response with adoptive transfer of MY4-CTL, studies involving adoptive transfer of CTL other MPO- or Pr3-derived peptides may be conducted. In addition, the use of the HLA-A2.1- transgenic mouse model may allow for investigation into mechanisms of tolerance toward MPO peptides such as, but not limited to, MY4. In addition, the possibility that 1 11R WO 2005/019435 PCT/US2004/027790 the MY4/HLA-A2 tetramer could be used to select for a homogeneous population of leukemia reactive CTL might allow for the first time the adoptive transfer of CTL across MHC barriers to treat leukemia (Toes et al., 1996). The results as disclosed herein, show the development of tolerance toward MY4. 5 EXAMPLE 21 CYCLIN El To search for other potential tumor-associated antigens, the cyclin E family of proteins were investigated, because it is well known that cyclin E is constitutively expressed in some 10 tumor cells in dependent of the cell cycle, and aberrantly expressing cyclin E contributes to tumorigenesis as a result of chromosomal instability. Cyclin E2 is a homologue of cyclin El and both proteins have restricted tissue distribution. To investigate whether cyclin El and E2. are over-expressed in hematological malignancy, cyclin El and cyclin E2 mRNA expression were first analyzed in 21 patients with hematological malignancy (11 CML (CP), 5 CML (BC), 2 15 AML, 2 ALL, 1 NHL) and 12 normal donors by RT-PCR. PBMCs from 15 patients and 5 normal donors expressed cyclin El mRNA. The relative expression level of cyclin El mRNA standardized to p-actin was higher in patients than in normal donors (p = 0.0149). Cyclin E2 mRNA was highly over-expressed in PBMCs of patients (10/21) as compared to normal donor PBMCs (0/12; p = 0.0109). Next cyclin El protein expression was analyzed in 18 of 21 patients 20 with hematological malignancy and 3 of 12 normal donors by western blotting. Although none of PBMCs from normal donor expressed cyclin El protein, except one CML (CP) patient, almost all of PBMCs from patients expressed cyclin El protein even if they did not express mRNA at the same time point. Nonameric peptides derived from cyclin El and cyclin E2 and predicted to bind to the 25 HLA-A2 allele have similar amino acid sequences, differing only at position 7. Thus, the binding of CCNE1144-152 (cyclin El derived) and CCNE2 14 4 152 (cyclin E2 derived) was compared to that of PRI by a peptide-binding assay. The ability of CCNE 14 4 152 and CCNE2 144 152 to stabilize HLA-A2 on the surface of T2 cells was almost the same as that of PR1 (FI CCNE1 14415 2 /FI PR1=1.008, Fl CCNE2 14 4 152 /FI PR1=1.189). To determine whether 30 CCNE1 1441 5 2 and CCNE2 14 4 15 2 specific CTLs could be elicited in vitro, PBMCs from 7 HLA A2 positive normal donors were stimulated with peptide-pulsed T2 cells. In 3 of 7 donors, CCNE1 144 15 2 -stimulated CTL lines killed both CCNE1 1 1 5 2 and CCNE 2, 1 52 -pulsed T2 cells but not non-peptide-pulsed T2 cells and irrelevant peptide-pulsed T2 cells. In 4 of 7 same 110 WO 2005/019435 PCT/US2004/027790 donors, CCNE2 1 -stimulated CTL lines killed both CCNE2144s2 and CCNE1 144 15 -pulsed T2 cells but not non-peptide-pulsed T2 cells and irrelevant peptide-pulsed T2 cells. Thus, each peptide-specific CTLs can recognize both peptides with HLA-A2, but the immunogenicity of each peptide is different between individuals. Moreover, one of 4 CCNE1 1 44 5 152stimulated CTL lines which killed CCNEl 144 1 ,-pulsed T2 cell killed HLA-A2 transfected K562 leukemic cell line which is over-expressing cyclin El protein, but not non-transfected K562 leukemic cell line. Thus, CCNEl 14 4 152 -specific CTL can distinguish leukemic cell lines from normal PBMCs. From the data, it was concluded that cyclin El/E2 derived peptides are potential tumor- antigens, because 1) cyclin E1/E2 are highly over-expressed in hematological 10 malignancy, 2) cyclin E1/E2 peptides can sufficiently bind to HLA-A2 to stimulate CTL and 3) CCLE1 14 4 15 2 specific CTL preferentially kills leukemic cell lines HLA-A2 restrictively. * * * * * * * * * * * * * * * * * * 15 All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described 20 herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended 25 claims. 1AO WO 2005/019435 PCT/US2004/027790 XIII. References The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. U.S. Patent 4,196,265 U.S. Patent 4,435,386 U.S. Patent 4,436,727 U.S. Patent 4,436,728 U.S. Patent 4,505,899 U.S. Patent 4,505,900 U.S. Patent 4,520,019 U.S. Patent 4,554,101 U.S. Patent 4,579,945 U.S. Patent 4,684,611 U.S. Patent 4,797,368 U.S. Patent 4,866,034 U.S. Patent 4,877,611 U.S. Patent 4,879,236 U.S. Patent 4,950,645 U.S. Patent 4,952,500 U.S. Patent 5,139,941 U.S. Patent 5,302,523 U.S. Patent 5,322,783 U.S. Patent 5,384,253 U.S. Patent 5,399,363 U.S. Patent 5,464,765 U.S. Patent 5,466,468 U.S. Patent 5,538,877 U.S. Patent 5,538,880 U.S. Patent 5,543,158 U.S. Patent 5,550,318 U.S. Patent 5,563,055 U.S. Patent 5,580,859 U.S. Patent 5,589,466 1A1 WO 2005/019435 PCT/US2004/027790 U.S. Patent 5,609,870 U.S. Patent 5,610,042 U.S. Patent 5,641,515 U.S. Patent 5,656,610 U.S. Patent 5,693,762 U.S. Patent 5,702,932 U.S. Patent 5,736,524 U.S. Patent 5,739,169 U.S. Patent 5,780,448 U.S. Patent 5,785,970 U.S. Patent 5,789,215 U.S. Patent 5,801,005 U.S. Patent 5,824,311 U.S. Patent 5,830,880 U.S. Patent 5,846,225 U.S. Patent 5,846,233 U.S. Patent 5,846,945 U.S. Patent 5,861,155 U.S. Patent 5,871,986 U.S. Patent 5,945,100 U.S. Patent 5,980,912 U.S. Patent 5,981,274 U.S. Patent 5,994,136 U.S. Patent 5,994,624 U.S. Patent 6,013,516 U.S. Patent 6,020,192 U.S. Patent 6,027,727 U.S. Patent 6,054,297 Aichele et al., J. Exp. Med., 182:261-266, 1995. Alam et al., Nature, 381:616-620, 1996. Alexander-Miller et al., J. Exp. Med., 184:485-492, 1996. Alexander-Miller et al., J. Exp. Med., 188:1391-1399, 1998. Alexander-Miller et al., Proc. NatL. Acad. Sci. USA, 93:4102-4107, 1996. Altman et al., Science, 274:94-96, 1996. 1 A2 WO 2005/019435 PCT/US2004/027790 Anderton et al., J Exp. Med., 193:1-11, 2001. Antin, Blood, 82:2273-2277, 1993. Arap et al., Cancer Res., 55(6):1351-1354, 1995. Austin-Ward and Villaseca, Rev. Med. Child , 126(7):838-45, 1998. Azumaetal., Cell Immunol., 116(1):123-134, 1988. Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 117-148, 1986. Bajorin et al., J. Clin. Oncol., 6(5):786-92, 1988. Bakhshi et al., Cell, 41(3):899-906, 1985. Ballieux et al., Clin. Exp. Immunol., 100:186-193, 1995. Barrett et al., Blood, 95:3323-3327, 2000. Barrett et al., Bone Marrow Transplant., 21:543-551, 1998. Behre et al., Methods, 17:231-237, 1999. Benjamini et al., Adv. Exp. Med. Biol., 303:71-77, 1991. Bernhard et al., Cancer Res., 55:1099-1104, 1995. Blomer et al., J. Virol., 71(9):6641-6649, 1997. Bocchia et al., Blood, 85:2680-2684, 1995. Bocchia et al., Blood, 87:3587-3592, 1996. Boon et al., Immunol Today, 18:267-268, 1997. Boon et al., Important Adv. Oncol., 53-69, 1994. Bories et al., Cell, 59:959, 1989. Borregaard and Cowland, Blood, 89:3503-3521, 1997. Borrello et al., Blood, 95:3011-3019, 2000. Bourdette et al., J. Immunol., 152:2510-2519, 1994. Boussiotis et al., J. Exp. Med., 184:365-376, 1996. Boussiotis et al., Res. Immunol., 146:140-149, 1995. Braunschweig et al., Blood, 96:3291, 2000. Brouwer et al., Clin. Exp. Immunol., 98:448-453, 1994. Brutlag et al., Comput. Apple. Biosci., 6(3):237-245, 1990. Bukowski et al., Clin. Cancer Res., 4(10):2337-47, 1998. Burchert et al., Blood, 02:659, 2002. Caldas et al., Nat. Genet., 8(1):27-32, 1994. Campanelli et al., J Exp. Med., 172:1709-1715, 1990. Capaldi et al., Biochem. Biophys. Res. Comm., 74(2):425-433, 1977. Celis et al., Proc. Natl. Acad. Sci. USA, 91:2105-2109, 1994. 1 A WO 2005/019435 PCT/US2004/027790 Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987. Chen et al., Biochem. Biophys. Res. Commun., 200:1130-1135, 1994. Cheng et al., Cancer Res., 54(21):5547-5551, 1994a. Chou and Fasman, Adv. Enzymol., 47:45-148, 1978b. Chou and Fasman, Annu. Rev. Biochem., 47:251-276, 1978a. Chou and Fasman, Biochemistry, 13(2):211-222, 1974b. Chou and Fasman, Biophys. J., 26(3):385-399, 1979. Christodoulides et al., Microbiology, 144(Pt 11):3027-37, 1998. Clark et al., Blood, 98:2887-2893, 2001. Cleary and Sklar, Proc. Natl. Acad. Sci. USA, (21):7439-7443, 1985. Cleary et al., J. Exp. Med., 164(1):315-320, 1986. Collins, Jr. et al., J. Clin. Oncol., 15:433-444, 1997. Cortes et al., Leukemia, 12:455-462, 1998. Cotten et al., Proc. Natl. Acad. Sci. USA, 89(13):6094-6098, 1992. Coupar et al., Gene, 68:1-10, 1988. Culver et al., Science, 256(5063):1550-1552, 1992. Curiel, Nat. -nmun., 13(2-3):141-164, 1994. Davidson et al., J. Immunother., 21(5):389-98, 1998. den Haan et al., Science, 268:1476-1480, 1995. den Haan et al., Science, 279:1054-1057, 1998. Dengler et al., Br. J. Haematol., 89:250-257, 1995. Dermime et al., Blood, 86, 1995. Dermime et al., Bone Marrow Transplant., 19:989-999, 1997. Devergie et al., Bone Marrow Transplant., 20:11-9, 1997. Dickinson et al., Nat. Med., 8:410-414, 2002. Dillnan, Cancer Biother. Radiopharm., 14(1):5-10, 1999. Dolstra et al., J. Immunol., 158:560-565, 1997. Drobyski et al., Blood, 83:1980-1987, 1994. Dudley et al., Science, 298:850-854, 2002. Dunbar et al., Curr. Biol., 8:413-416, 1998. Faber et al., Biol. Blood Marrow Transplant., 2:31-36, 1996. Faber et al., Blood, 86:2821-2828, 1995. Faber et al., J. Clin. Invest., 96:877-883, 1995. Faderl et al., Ann. Intern. Med., 131:207-219, 1999. 1 AA WO 2005/019435 PCT/US2004/027790 Fechheimer et al.; Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987. Fetrow and Bryant, Biotechnology, 11(4):479-484, 1993. Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. Franssen et al., Kidney Int., 57:2195-1206, 2000. Franssen et al., Lancet., 347:116, 1996. Friedmann, Science, 244:1275-1281, 1989. Gale et al., Ann. Intern. Med., 120:646-652, 1994. Gallimore et al., J. Exp. Med., 187:1383-1393, 1998. Gao et al., Blood, 95:2198-2203, 2000. Garlie et al., J. Immunother., 22:336-345, 1999. Gaschet et al., J. Clin. Invest., 98:100-107, 1996. Gaugler et al., J. Exp. Med., 179:921-930, 1994. Giralt and Kolb, Curr. Opin. Oncol., 8:96-102, 1996. Gopal, Mol. Cell Biol., 5:1188-1190, 1985. Goulmy et al., N. Engl. J Med., 334:281-285, 1996. Graham and Van Der Eb, Virology, 52:456-467, 1973. Grossman and Paul, Proc. Natl. Acad. Sci. USA, 89:10365-10369, 1992. Grunhaus and Horwitz, Seminar in Virology, 3:237-252, 1992. Hanibuchi et al., Int. J. Cancer, 78(4):480-485, 1998. Harlan and Weintraub, J Cell Biol., 101:1094-1099, 1985. Harlow and Lane, Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring harbor, NY, 553-612, 1988. Hellstrand et al., Acta Oncol., 37(4):347-353, 1998. Hensel et al., Bone Marrow Transplant., 23:71-78, 1999. Hermonat and Muzycska, Proc. Natl. Acad. Sci. USA, 81:6466-6470, 1984. Herr et al., J. Immunol. Methods, 191:131-142, 1996. Herr et al., J. Immunol. Methods, 203:141-152, 1997. Horowitz et al., Bone Marrow Transplant., 17(Suppl 3):S5-6, 1996. Horwich et al. J. Virol., 64:642-650, 1990. Hui and Hashimoto, Infect. Immun., 66(11):5329-36, 1998. Husson et al., J. Bacteriol., 172(2):519-524, 1990. Hussussian et al., Nat. Genet., 8(1):15-21, 1994. Irie and Morton, Proc. Natl. Acad. Sci. USA, 83(22):8694-8698, 1986. Irie et al., Lancet., 1(8641):786-787, 1989. 1 Al WO 2005/019435 PCT/US2004/027790 Jacobs et al., Nature, 327(6122):532-535, 1987. Jameson and Wolf, Comput. Apple. Biosci., 4(l):181-186, 1988. Janetzki et al., J. Immunol. Methods, 234:1-12, 2000. Jennette et al., Semin. Diagn. Pathol., 18:3-13, 2001. Johnson et al., In: Biotechnology And Pharmacy, Pezzuto et al. (Eds.), Chapman and Hall, NY, 1993. Ju et al., J. Neuropathol. Exp. Neurol., 59(3):241-50, 2000. Kaeppler et al., Plant Cell Reports, 9:415-418, 1990. Kamb et al., Nat. Genet., 8(1):23-2, 1994. Kamb et al., Science, 2674:436-440, 1994. Kaneda et al., Science, 243:375-378, 1989. Kato et al, J. Biol. Chem., 266:3361-3364, 1991. Kelleher and Vos, Biotechniques, 17(6):1110-7, 1994. Kerr et al., Br. J. Cancer, 26(4):239-257, 1972. Klinman, Curr. Prot. Immunol., 6.19:18, 1994. Kochenderfer and Molldrem, Curr. Oncol. Rep. 3:193-200, 2001. Kochenderfer et al., Blood, 100:3639-3645, 2002. Kolb and Holler, Curr. Opin. Oncol., 9:139-145, 1997. Kolb et al., Blood, 86:2041-2050, 1995. Kolb et al., Bone Marrow Transplant, 17:449-452, 1996. Kwak et al., Proc. Natl. Acad. Sci. USA, 93:10972-10977, 1996. Kyte and Doolittle, J. Mol. Biol., 57(1):105-32, 1982. Lalvani et al., J Exp. Med., 186:859-865, 1997. Laughlin et al., J. Virol., 60(2):515-524, 1986. Lebkowski et al., Mol. Cell. Biol., 8(10):3988-3996, 1988. Lee et al., Nat. Med., 5:677-685, 1999. Lehmann et al., Eur. J. Imnimunol., 25:340-347, 1995. Levine et al., J. Hematother., 7:437-448, 1998. Lewin et al., Blood, 100:2235-2242, 2002. Lotte et al., Adv. Tuberc. Res., 21:107-93; 194-245, 1984. Lubbert et al., Leukemia, 13:1420-1427, 1999. Luelmo, Am. Rev. Respir. Dis., 125(3 Pt 2):70-72, 1982. Mackinnon et al., Bone Marrow Transplant., 15:591-594, 1995. Maeurer et al., J. Clin. Invest., 98:1633-1641, 1996. 1 A6 WO 2005/019435 PCT/US2004/027790 Mann et al., Cell, 33:153-159, 1983. Marchand et al., Int. J Cancer, 63:883-885, 1995. Marijt et al., Blood 82:3778-3785, 1995. Marincola et al., J. Immunother. Emphasis Tumor Immnunol., 19:192-205, 1996. Martin et al., Nature, 345(6277):739-743, 1990. Matulonis et al., Blood, 85:2507-2515, 1995. Mavroudis et al., Bone Marrow Transplant., 17:793-799, 1996. Mayet et al., Eur. J. Clin. Invest., 27:893-899, 1997. McLaughlin et al., J. Virol., 62(6):1963-1973, 1988. Miller et al., Am. J. Clin. Oncol., 15(3):216-221, 1992. Mitchell et al., Ann. NYAcad. Sci., 690:153-166, 1993. Mitchell et al., J. Clin. Oncol., 8(5):856-869, 1990. Molldrem et al., Blood, 88:2450-2457, 1996. Molldrem et al., Blood, 90:1858, 1998. Molldrem et al., Blood, 90:2529-2534, 1997. Molldrern et al., Br. J. Haematol., 102:1314-1322, 1998. Molldrem et al., Cancer Res., 59:2675-2681, 1999. Molldrem et al., Curr. Opin. Hematol., 9:503-508, 2002. Molldrem et al., J. Clin. Invest., 111:639-647, 2003. Molldrem et al., Nat. Med., 6:1018-1023, 2000. Molldrem et al., Oncogene, 21:8668-8673, 2002. Morgan et al., J. Immunol., 160:643-651, 1998. Mori et al., Cancer Res., 54(13):3396-3397, 1994. Morton et al., Arch. Surg., 127:392-399, 1992. Muller-Berat et al., Clin. Immunol. Immunopathol., 70:51-59, 1994. Muzyczka, Curr. Topics Microbiol. Immunol., 158:97-129, 1992. Nakamoto et al., J. Immunol., 158:5692-5697, 1997. Naldini et al., Science, 272(5259):263-267, 1996. Nanda and Sercarz, Cell, 82:13-17, 1995. Nelson et al., Blood, 88:580-589, 1996. Nestle et al., Nature Med., 4:328-332, 1998. Nicolas and Rubinstein, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 494-513, 1988. Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982. 1 ,7 WO 2005/019435 PCT/US2004/027790 Nicolau et al., Methods Enzymol., 149:157-176, 1987. Nobri et al., Nature (London), 368:753-756, 1995. Okamoto et al., Proc. Natd. Acad. Sci. USA, 1(23):11045-11049, 1994. Omirulleh et al., Plant Mol. Biol., 21(3):415-28, 1993. Orlow et al., Cancer Res, 54(11):2848-2851, 1994. Papadopoulos et al., Blood, 90:4938-4946, 1997. Pardoll, Current Opin. ImmunoL.,.14:619- 6 2 3 , 1992. Pardoll, Nature Rev. Immunol., 2:227-23 8, 2002. Pardoll, Nature, 369:357, 1994. Parker et al., J. Immunol., 152:163, 1994. Parkhurst et al., J. Immunol., 157:2539-2548, 1996. Paskind et al., Virology, 67:242-248, 1975. PCT Appln, WO 91/16347 PCT Appln. WO 94/09699 PCT Appln. WO 95/06128 Pietras et al., Oncogene, 17(17):2235-49, 1998. Pinilla-Ibarz et al., Blood, 95:1781-1787, 2000. Potrykus et al., Mol. Gen. Genet., 199:183-188, 1985. Qin et al., Proc. Nat?. Acad. Sci. USA, 95(24):14411-14416, 1998. Rabinovich et al., Science, 265(5177):1401-1404, 1994. Rammensee et al., Immunogenetics, 41:178-228, 1995. Ravindranath and Morton, Intern. Rev. Immunol., 7: 303-329, 1991. Rees et al., Proc. Natl. Acad. Sci. USA, 96:9781-9786, 1999. Reich-Zeliger et al., Immunity, 13:507-515, 2000. Remington's Pharmaceutical Sciences, 15 th ed., pages 1035-1038 and 1570-1580, Mack Publishing Company, Easton, PA, 1980. Restifo et al., J. Exp. Med., 177:265-272, 1993. Riddell and Greenberg, Annu. Rev. Immunol., 13:545-586, 1995. Riddell and Greenberg, Cancer Treat Res., 76:337-369, 1995. Riddell and Greenberg, Curr. Top Microbiol. ImmunoL., 189:9-34, 1994. Riddell et al., Science, 257:238-241, 1992. Ridgeway, In: Vectors: A survey of molecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham:Butterworth, 467-492, 1988. Rippe et al., Mol. Cell Biol., 10:689-695, 1990. 1 A2 WO 2005/019435 PCT/US2004/027790 Rosenberg and White, J. Immunother. Emphasis. Tumor Immunol., 19:81-84, 1996. Rosenberg et al., Ann. Surg. 210(4):474-548, 1989. Rosenberg et al., Nature Med., 4:321-327, 1998. Rosenberg et al., N. Engl. J. Med., 319:1676, 1988. Salter and Cresswell, Embo. J., 5:943-949, 1986. Santiniet al., J. Exp. Med., 191:1777-1788, 2000. Savage et al., Immunity, 10:485-492, 1999. Savige et al., Am. J. Clin. Pathol., 111:507-513, 1999. Scheibenbogen et al., Blood, 100:2132-2137, 2002. Scheibenbogen et al., Int. J. Cancer, 71:932-936, 1997. Serrano et al., Nature, 366:704-707, 1993. Serrano et al., Science, 267(5195):249-252, 1995. Sette et al., I Immunol., 153:5586-5592,1994. Shlomchik et al., Science, 285:412-415, 1999. Sibelius et al., J Exp. Med., 187:497-503, 1998. Snapper et al., Proc. Natl. Acad. Sci. USA, 85(18):6987-6991, 1988. Stark, G.R., Kerr, I.M., Williams, B.R., Silverman, R.H. & Schreiber, R.D. How cells respond to interferons. Annu Rev Biochem 67, 227-64 (1998). Sturrock et al., J Biol. Chem., 267:21193, 1992. Takada et al., J. Clin. Microbiol., 33(3):658-660, 1995. Tanaka et al., Cancer Res., 57:4465-4468, 1997. Tanaka et al., Genes Cells, 3:29-37, 1998. Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum Press, 149-188, 1986. Teshima et al., Nat. Med., 8:575-581, 2002. Toes et al., Int. J. Cancer, 66:686-691, 1996. Toes et al., J. Immunol., 156:3911-3918, 1996. Toes et al., Proc. Natl. Acad. Sci. USA, 93:7855-7860, 1996. Tratschin et al., Mol. Cell. Biol., 4:2072-2081, 1984. Tsujimoto and Croce, Proc. Natl. Acad. Sci. USA, 83(14):5214-5218, 1986. Tsujimoto et al., Science, 228(4706):1440-1443, 1985. Tsukada et al., J. Exp. Clin. Cancer Res., 16:171-176, 1997. van der Bruggen et al., Eur. J. Immunol., 124:3038-3043, 1994. van der Harst et al., Blood, 83:1060-1066, 1994. van Lochem et al., Bone Marrow Transplant., 10:181-183, 1992. 1A0 WO 2005/019435 PCT/US2004/027790 van Rhee et al., Blood, 83, 1994. Verdijk et al., J lninunol., 163:57-61, 1999. Wada et al., Nucleic Acids Res. 18:2367-2411, 1990. Wang et al., Biol. Blood Marrow Transplant., 6:118, 2000. Weinberger et al., Science, 228:740-742, 1985. Williams et al., J Immunol., 152:4722-4732, 1994. Wolf et al., Comput. Appl. Biosci., 4(1):187-191, 1988. Wong et al., Gene, 10:87-94, 1980. Yamamoto et al., Jpn. J~ Cancer Res., 79:866-873, 1988. Yee et al., J. Immunol., 162:2227-2234, 1999. Yin et al., J. Biol. Resp. Modif, 8:190-205, 1989. Zarour et al., J. Invest. Dermatol., 107:63-67, 1996. Zeh et al., J. Immunol., 162:989-994, 1999. Zufferey et al., Nat. Biotechnol., 15(9):871-875, 1997. 1 lio

Claims (46)

1. A vaccine comprising a proteinase-3 peptide other than PRI.
2. The vaccine of claim 1, wherein the proteinase-3 peptide is selected from the group consisting of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO:10) and FLNNYDAENKL (SEQ ID NO:11) or a fragment thereof.
3. The vaccine of claim 1, wherein the proteinase-3 peptide is a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof.
4. The vaccine of claim 1, further comprising an adjuvant.
5. The vaccine of claim 4, wherein said adjuvant is selected from the group consisting of complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21.
6. The vaccine of claim 1, further comprising an immunostimulant.
7. The vaccine of claim 1, comprising more than one peptide.
8. The vaccine of claim 7, wherein the peptides depend on the tumor to be treated.
9. The vaccine of claim 7, wherein the peptides depend on the HLA type of the patient
10. The vaccine of claim 1, further comprising an antigen presenting cell.
11. The vaccine of claim 10, wherein the antigen presenting cell is a dendritic cell. 1 51 WO 2005/019435 PCT/US2004/027790
12. The vaccine of claim 11, wherein the dendritic cell is pulsed or loaded with the peptide and used as a cellular vaccine to stimulate T cell immunity against the peptide, and thereby against the tumor.
13. The vaccine of claim 1, further comprising a second tumor-associated HLA-restricted peptide.
14. The vaccine of claim 13, wherein the second tumor-associated HLA-restricted peptide is an HLA-A2, HLA-A3, HLA-A1 1, HLA-B7, HLA-B27 or HLA-B35 restricted peptide.
15. A method for treating or preventing a cancer in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising a proteinase-3 peptide other than PR1.
16. The method of claim 15, wherein the method comprises administering the vaccine more than once.
17. The method of claim 15, wherein the therapeutically effective amount is in the range of 0.20 mg to 5.0 mg.
18. The method of claim 15, wherein the therapeutically effective amount is in the range of 0.025 mg to 1.0 mg.
19. The method of claim 15, wherein the therapeutically effective amount is in the range of 2.0 mg to 5.0 mg.
20. The method of claim 15, wherein the cancer cell is a leukemic cell.
21. The method of claim 20, wherein said leukemic cell is a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell. 1 IZ) WO 2005/019435 PCT/US2004/027790
22. The method of claim 15, wherein said cancer cell is a solid tumor cell.
23. The method of claim 22, wherein said solid tumor cell is a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphatic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft tissue cancer cell.
24. The method of claim 15, wherein the vaccine is administered systemically.
25. The method of claim 24, wherein the vaccine is administered intravenously, intra arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermally, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration.
26. The method of claim 15, wherein the vaccine is administered locally.
27. The method of claim 26, wherein the vaccine is administered by direct intratumoral injection.
28. The method of claim 26, wherein the vaccine is administered by injection into tumor vasculature.
29. The method of claim 26, wherein the vaccine is administered by an antigen-presenting cell pulsed or loaded with the peptide.
30. The method of claim 29, wherein the antigen presenting cell is a dendritic cell.
31. The method of claim 29, wherein the vaccine is a cellular vaccine.
32. The method of claim 29, wherein the antigen-presenting cell contains one or more peptide. 153 WO 2005/019435 PCT/US2004/027790
33. The method of claim 15, further comprising treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent.
34. The method of claim 33, wherein the second anticancer agent is administered simultaneously with the vaccine.
35. The method of claim 33, wherein the second anticancer agent is administered at a different time than the vaccine.
36. The method of claim 33, wherein said chemotherapeutic agent is from a group consisting of doxorubicin, daunorubicin, dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, senustine, streptozocin, dacarbazine, adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, hydrogen peroxide, nitrosurea, plicomycin, tamoxifen, taxol, transplatinum, vincristin, vinblastin, a TRAIL RI and R2 receptor antibody or agonist, dolastatin-10, bryostatin, annamycin, mylotarg, sodium phenylacetate, sodium butyrate, methotrexate, dacitabine, imatinab mesylate (Gleevec), interferon-ct bevacizumab, cetuximab, thalidomide, bortezomib, gefitinib, erlotinib, azacytidine, 5-AZA-2'deoxycytidine, Revlimid, 2C4, an anti angiogenic factor, a signal transducer-targeting agent, interferon-y, IL-2 and IL-12.
37. The method of claim 33, wherein said immunotherapeutic agent is selected from a group consisting of GM-CSF, CD40 ligand, anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-1BB (CD137) mAbs, and an oligonucleotide.
38. A method for treating or preventing cancer in a patient comprising: (a) contacting CTLs of said patient with a proteinase 3 peptide other than PR1; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient. 154 WO 2005/019435 PCT/US2004/027790
39. The method of claim 38, further comprising expanding said CTL's by ex vivo or in vivo methods prior to administration.
40. The method of claim 38, wherein contacting comprises providing an antigen presenting cell loaded with said peptide or that expresses said peptide from an expression construct.
41. The method of claim 38, further comprising providing CTLs transfected with a T cell receptor specific for the peptide.
42. The method of claim 38, wherein the therapeutically effective amount of CTL cells required to provide therapeutic benefit is from about 0.1 x 10 5 to about 5 x 10 7 cells per kilogram weight of the subject.
43. A method for treating or preventing a cancer in a patient comprising administering to said patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a proteinase-3 peptide other than PRL.
44. The method of claim 43, wherein said expression construct is a non-viral expression construct.
45. The method of claim 43, wherein said expression construct is a viral expression construct.
46. The method of claim 43, wherein said expression construct encodes a second tumor associated peptide.
AU2004267506A 2003-08-26 2004-08-26 Anti-cancer vaccines Abandoned AU2004267506A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US49823803P true 2003-08-26 2003-08-26
US60/498,238 2003-08-26
PCT/US2004/027790 WO2005019435A2 (en) 2003-08-26 2004-08-26 Anti-cancer vaccines

Publications (1)

Publication Number Publication Date
AU2004267506A1 true AU2004267506A1 (en) 2005-03-03

Family

ID=34216164

Family Applications (1)

Application Number Title Priority Date Filing Date
AU2004267506A Abandoned AU2004267506A1 (en) 2003-08-26 2004-08-26 Anti-cancer vaccines

Country Status (5)

Country Link
EP (2) EP1660636A4 (en)
JP (1) JP2007504149A (en)
AU (1) AU2004267506A1 (en)
CA (1) CA2536654A1 (en)
WO (2) WO2005035714A2 (en)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7976852B2 (en) * 2005-04-26 2011-07-12 Eisai R&D Management Co., Ltd. Compositions and methods for cancer immunotherapy
CA2523032A1 (en) * 2005-10-07 2007-04-07 Immunovaccine Technologies Inc. Vaccines for cancer therapy
ES2588705T3 (en) 2007-09-27 2016-11-04 Immunovaccine Technologies Inc. Use of liposomes in a carrier comprising a continuous hydrophobic phase for delivery of polynucleotides in vivo
WO2009102909A2 (en) * 2008-02-15 2009-08-20 Board Of Regents, The University Of Texas System Anti-cancer vaccines
GB201009222D0 (en) * 2010-06-02 2010-07-21 Immatics Biotechnologies Gmbh Improved cancer therapy based on tumour associated antigens derived from cyclin D1
WO2012079075A1 (en) 2010-12-10 2012-06-14 Concert Pharmaceuticals, Inc. Deuterated phthalimide derivatives
JP6240077B2 (en) 2011-10-06 2017-11-29 イムノバクシーン・テクノロジーズ・インコーポレイテッドImmunovaccine Technologies Inc. Tlr2 or activate, or liposomes compositions and the use thereof comprising an adjuvant to increase its activity
WO2013130849A1 (en) 2012-02-29 2013-09-06 Concert Pharmaceuticals, Inc. Substituted dioxopiperidinyl phthalimide derivatives
WO2013159026A1 (en) 2012-04-20 2013-10-24 Concert Pharmaceuticals, Inc. Deuterated rigosertib
JP2015534989A (en) 2012-10-22 2015-12-07 コンサート ファーマシューティカルズ インコーポレイテッド {S-3- (4-amino-1-oxo - isoindolin-2-yl) (piperidin -3,4,4,5,5-d5) -2,6- dione} solid form of
WO2014110322A2 (en) 2013-01-11 2014-07-17 Concert Pharmaceuticals, Inc. Substituted dioxopiperidinyl phthalimide derivatives
CA2840974A1 (en) * 2013-02-05 2014-08-05 Nitto Denko Corporation Vaccine composition for mucosal administration
CA2840937A1 (en) * 2013-02-05 2014-08-05 Nitto Denko Corporation Vaccine composition for transdermal administration

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2410903A1 (en) * 2000-06-02 2001-12-06 University Of Connecticut Health Center Complexes of alpha (2) macroglobulin and antigenic molecules for immunotherapy

Also Published As

Publication number Publication date
WO2005035714A2 (en) 2005-04-21
CA2536654A1 (en) 2005-03-03
WO2005019435A3 (en) 2006-06-29
EP1670899A2 (en) 2006-06-21
WO2005019435A8 (en) 2006-04-27
EP1660636A4 (en) 2009-07-01
WO2005019435A2 (en) 2005-03-03
JP2007504149A (en) 2007-03-01
EP1660636A2 (en) 2006-05-31
WO2005035714A3 (en) 2009-04-16

Similar Documents

Publication Publication Date Title
CN100486995C (en) Compositions and methods for WT1 specific immunotherapy
JP5182770B2 (en) Tumor-associated peptides binding the Mhc molecule
US20050221440A1 (en) Epitope sequences
US6759046B1 (en) Peptides
US20080107668A1 (en) Cytotoxic t-lymphocyte-inducing immunogens for prevention, treatment, and diagnosis of cancer
CN100376290C (en) Antigenic peptides derived from telomerase
EP0529023B1 (en) Therapeutically useful peptides and peptides fragments
JP5948319B2 (en) Compositions and methods for identifying tumor-specific neo-antigens
US7378087B2 (en) Method of enhancing an immune response
Manjili et al. Immunotherapy of cancer using heat shock proteins
JP5502823B2 (en) Bcl-2 family - use of the proteins and fragments thereof, as well as in cancer patients belonging to the
CA2706907C (en) Cancer vaccine composition
US20070071722A1 (en) Nucleotide vaccine composition
EP1432441B1 (en) Use of hmgb1 for the activation of dendritic cells
JP6444336B2 (en) Polypeptide
EP1482963A2 (en) Controlled modulation of amino acid side chain length of peptide antigens
CN102302788B (en) wt1 1101-restricted peptide and a pharmaceutical composition thereof
JP2003521245A (en) Using the peptides and nucleic acid compositions, induction of cellular immune response to prostate cancer antigen
CA2478930A1 (en) Epitope constructs comprising antigen presenting cell targeting mechanisms
JP2012144563A (en) Chemo-immunotherapy method
EP1951281B1 (en) Wt1 hla class ii-binding peptides and compositions and methods comprising same
CA2393730A1 (en) Hla class i a2 tumor associated antigen peptides and vaccine compositions
JP2011200231A (en) Immunogenic t helper epitope from human tumor antigen, and method of immunotherapy by using the epitope
EP2089423B1 (en) Antigen specific multi epitope vaccines
Manjili et al. Cancer immunotherapy: stress proteins and hyperthermia

Legal Events

Date Code Title Description
MK4 Application lapsed section 142(2)(d) - no continuation fee paid for the application