EP1660636A2 - Anti-cancer vaccines - Google Patents
Anti-cancer vaccinesInfo
- Publication number
- EP1660636A2 EP1660636A2 EP04782297A EP04782297A EP1660636A2 EP 1660636 A2 EP1660636 A2 EP 1660636A2 EP 04782297 A EP04782297 A EP 04782297A EP 04782297 A EP04782297 A EP 04782297A EP 1660636 A2 EP1660636 A2 EP 1660636A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- prl
- cells
- peptide
- hla
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
- A61K39/001154—Enzymes
- A61K39/001158—Proteinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/10—Cellular immunotherapy characterised by the cell type used
- A61K40/11—T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/20—Cellular immunotherapy characterised by the effect or the function of the cells
- A61K40/22—Immunosuppressive or immunotolerising
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/418—Antigens related to induction of tolerance to non-self
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K40/00—Cellular immunotherapy
- A61K40/40—Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
- A61K40/41—Vertebrate antigens
- A61K40/42—Cancer antigens
- A61K40/4244—Enzymes
- A61K40/4247—Proteinases
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/02—Antineoplastic agents specific for leukemia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the dose, timing or administration schedule
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K40/00
- A61K2239/46—Indexing codes associated with cellular immunotherapy of group A61K40/00 characterised by the cancer treated
- A61K2239/48—Blood cells, e.g. leukemia or lymphoma
Definitions
- the present invention relates generally to the fields of cancer and immunotherapy. More particularly, it concerns the identification of immunotherapeutic peptides and the development of peptide vaccines for the treatment and prevention of cancer.
- CML clironic myelogenous leukemia
- BMT allogeneic bone marrow transplant
- IFN- ⁇ 2b interferon- ⁇ 2b
- BM lymphocyte infusions have been used to treat relapse of myeloid leukemia after allogeneic BMT (Giralt and Kolb, 1996; Kolb and Holler, 1997; Kolb et al, 1995; Kolb et al, 1996; Antin, 1993).
- Lymphocyte transfusion from the original bone marrow (BM) donor induces both hematological and cytogenetic responses in approximately 70% to 80% of patients with chronic myelocytic leukemia (CML) in chronic phase (CP) (Kolb et al, 1996, Holler, 1997).
- CML chronic myelocytic leukemia
- CP chronic phase
- Remissions after DLI for AML are generally not as durable as those obtained in chronic phase CML, which may reflect the rapid kinetics of tumor growth outpacing the kinetics of the developing immune response. Additionally, most patients with myeloid forms of leukemia will die from the disease unless they can be treated with allogeneic bone marrow transplant, where the associated graft versus leukemia (GVL) effect cures patients. However, graft-versus-host disease (GVHD) and transplant-related toxicity limit this treatment. It is believed that GVL may be separable from GHVD, and that targeting the immune response toward leukemia-associated antigens will allow for the transfer of GVL to patients without GVHD.
- GVL graft-versus-host disease
- antigens i.e., leukemia antigens or antigens aganist other cancers
- CTLs cytotoxic T lymphocytes
- tissue-restricted minor histocompatibility antigens that are derived from proteins expressed only in recipient hematopoietic tissue have been shown to be the targets of alloreactive donor T cells.
- Heterologous T cell clones that demonstrate alloreactivity toward different mHA have been established from patients with severe GVHD following BMT with an HLA-matched donor (Faber et al, 1995a; Faber et al, 1995b; Faber et al, 1996; van der Harst et al, 1994; Molldrem et al, 2000; Gao et al, 2000; den Haan et al, 1998; Clark et al, 2001).
- mHA-specific CTL clones react only with hematopoietic-derived cells, suggesting tissue specificity (Faber et al, 1996; den Haan et al, 1998), and therefore potentially shared antigens on leukemia.
- HA-2 was identified as a peptide derived from the non-filament-forming class I myosin family by using mHA-reactive CTL clones to screen peptide fractions eluted from MHC class I molecules (den Haan et al, 1995; Faber et al, 1995a).
- CTL alloantigens While various methodologies has successfully defined some CTL alloantigens, it is extremely labor intensive and it is unclear whether CTL specific for any minor antigens identified thus far convey leukemia-specific immunity without concomitant GVHD.
- GVHD correlated closely with differences in the minor antigen HA-1 in HLA identical sibling transplants (Goulmy et al, 1996; Dolstra et al, 1997).
- a practical limit of any immunotherapy approach targeting these mHAs is that only 10% of individuals would be expected to have the relevant HA-1 alternate allele, and ⁇ 1% would have the HA-2 alternate allele, which makes donor availability quite limiting.
- BCR-ABL Since BCR-ABL is present in nearly all (92%) Philadelphia chromosome- positive CML patients, it is thought to represent a potentially unique leukemia antigen.
- the ABL coding sequences upstream (5 ') of exon II on chromosome 9 are translocated to chromosome 22 and fused inframe with the BCR gene downstream (3') of exon III, resulting in a chimeric mRNA (b3a2) (the most common transcript) which is translated into a chimeric protein (p210BCR-ABL). Translation of b3a2 mRNA results in the coding of a unique amino acid (lysine) within the fusion region.
- HLA-B8-restricted overlapping peptides inclusive of this lysine could bind to HLA-B8 and could be used to elicit T cell prohferative responses when the peptide was either pulsed onto HLA-matched normal antigen presenting cells or onto HLA- B8 positive CML cells (Dermime et al, 1995; Bocchia et al, 1995; Bocchia et al, 1996; Faber et al, 1995b; Faber et al, 1996; van der Harst et al, 1994).
- the resulting T cells could not specifically lyse fresh CML cells which had not previously been pulsed with the peptide (Bocchia et al, 1996; van der Harst et al, 1994). This could be due to a low affinity of the peptide-specific CTL or the peptide may not be processed or presented on CML cells. More recently, b3a2-specific CTL were identified in the peripheral blood of CML patients using soluble b3a2 peptide/MHC tetramers (Clark et al, 2001).
- CTL immunity to the Wilm's tumor antigen WT-1 which is aberrantly expressed in various forms of leukemia, has been demonstrated to kill CML CD34+ progenitor cells (Gao et al, 2000).
- Melanoma peptide antigens that are derived from MAGE-3 proteins for example, are presented to melanoma-specific CTLs by HLA-A1 and HLA-A2 (Nanda and Sercarz, 1995; Boon et al, 1997; Rosenberg and White, 1996).
- This protein belongs to a family of proteins which are expressed in melanoma cells and in normal testis.
- a MAGE-3 derived peptide was determined to be immunogenic by separate groups using different techniques, one using an immunological method (Pardoll, 2002) and the other a genetic method that uses tumor antigen- deficient mutants (Nanda and Sercarz, 1995). Recently, a phase I clinical trial using MAGE-3 to vaccinate melanoma patients resulted in some clinical responses (Pardoll, 1994).
- tyrosinase, gplOO, and Melan-A-MART-1 are also normal self-proteins specific to the melanocyte lineage and T-cells specific for determinants on each of these antigens can be found in a large majority of melanoma patients (Sturrock et al, 1992; Chen et al, 1994). Two recent phase II vaccine trials demonstrated clinical efficacy of active immunotherapy using these target antigens as a peptide vaccine or as a antigen-pulsed dendritic cell vaccine.
- PRl an HLAA2.1 -restricted nonamer derived from proteinase 3 (P3)
- P3 proteinase 3
- PRl was identified as a leukemia-associated antigen (Molldrem et al, 2000; Molldrem et al, 1996; Molldrem et al, 1997; Molldrem et al, 1999; Molldrem et al, 2003 each incorporated herein by reference in their entirety).
- the finding that PRl is a leukemia-associated antigen has been independently confirmed by Burchert et al. (2002) and Scheibenbogen et al. (2002).
- the present invention provides a vaccine comprising a first tumor associated HLA restricted peptide.
- the HLA-restricted peptide may be an HLA-A2 restricted peptide, such as a proteinase-3 peptide other than PRl .
- Such peptides include a proteinase-3 peptide is selected from the group consisting of RFLPDFFTRV (SEQ ID NO:3), VLQELNVTVV (SEQ ID NO:4), NLSASVTSV (SEQ ID NO:5), IIQGIDSFV (SEQ ID NO:6), VLLALLLISGA (SEQ ID NO:7), QLPQQDQPV (SEQ ID NO: 10) and FLNNYDAENKL (SEQ ID NO: 11) or a fragment thereof.
- the proteinase-3 peptide may be a modified peptide selected from the group consisting of VLQELWTV (SEQ ID NO:26), VLQELNVKV (SEQ ID NO:27), VLQELWKV (SEQ ID NO:28) and VMQELWTV (SEQ ID NO:29) or a fragment thereof.
- the vaccine may further comprise an adjuvant, such as complete Freund's adjuvant, incomplete Freund's adjuvant, alum, Bacillus Calmette-Guerin, agonists and modifiers of adhesion molecules, tetanus toxoid, imiquinod, montanide, MPL, and QS21.
- the vaccine may also further comprise an immunostimulant.
- the vaccine may comprise more than one peptide, and the multiple peptides may depend on the tumor to be treated, and/or the HLA type of the patient.
- the vaccine may further comprise an antigen presenting cell, such as a dendritic cell, and more particularly a dendritic cell pulsed or loaded with the peptide and used as a cellular vaccine to stimulate T cell immurrity against the peptide, and thereby against the tumor.
- the vaccine may further comprise a second tumor-associated HLA-restricted peptide.
- the vaccine may further comprise a third, fourth or fifth tumor-associated HLA-restricted peptide.
- the second, third, fourth or fifth tumor-associated HLA-restricted peptide may be an HLA-A2, HLA-A3, HLA-A11, HLA-B7, HLA-B27 or HLA-B35 restricted peptide.
- a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising a proteinase-3 peptide other than PRl.
- the vaccine may be administered more than once.
- the therapeutically effective amount may be in the range of 0.20 mg to 5.0 mg, or in the range of 0.025 mg to 1.0 mg, or in the range of 2.0 mg to 5.0 mg ofthe peptide.
- the cancer cell may be a leukemic cell, such as a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic leukemia cell, an acute myelogenous leukemic cell, a chronic myelogenous leukemic cell, a lymphoblastic leukemia cell, a hairy cell leukemia cell, myelodysplastic cell, or a T-LGL (T-large granular lymphocytic) leukemia cell.
- a leukemic cell such as a blood cancer cell, a myeloid leukemia cell, a monocytic leukemia cell, a myelocytic leukemia cell, a promyelocytic leukemia cell, a myeloblastic leukemia cell, a lymphocytic
- the cancer cell may be a solid tumor cell, such as a bladder cancer cell, a breast cancer cell, a lung cancer cell, a colon cancer cell, a prostate cancer cell, a liver cancer cell, a pancreatic cancer cell, a stomach cancer cell, a testicular cancer cell, a brain cancer cell, an ovarian cancer cell, a lymphatic cancer cell, a skin cancer cell, a brain cancer cell, a bone cancer cell, a soft tissue cancer cell.
- the method may use vaccine administered systemically, intravenously, mtra-arterially, intra-peritoneally, intramuscularly, intradermally, intratumorally, orally, dermaily, nasally, buccally, rectally, vaginally, by inhalation, or by topical administration.
- the vaccine may be administered locally, by direct intratumoral injection, by injection into tumor vasculature or by an antigen-presenting cell pulsed or loaded with the peptide, wherein the antigen presenting cell may be a dendritic cell.
- the antigen-presenting cell may comprise one or more distinct peptides.
- the method may utilize a cellular vaccine.
- the method may further comprise treating the patient with a second anticancer agent, wherein the second anticancer agent is a therapeutic polypeptide, a nucleic acid encoding a therapeutic polypeptide, a chemotherapeutic agent, an immunotherapeutic agent, or a radiotherapeutic agent.
- the second anticancer agent may be administered simultaneously with the vaccine, or administered at a different time than the vaccine.
- the immunotherapeutic agent may be GM-CSF, CD40 ligand, . anti-CD28 mAbs, anti-CTL-4 mAbs, anti-4-lBB (CD137) niAbs, and an oligonucleotide.
- the chemotherapeutic agent may be doxorubicin, daunorubicin, dactinomycin, mitoxantrone, cisplatin, procarbazine, mitomycin, carboplatin, bleomycin, etoposide, teniposide, mechlroethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil, ifosfamide, melphalan, hexamethylmelamine, thiopeta, busulfan, carmustine, lomustine, semustine, streptozocin, dacarbazine, adriamycin, 5-fluorouracil (5FU), camptothecin, actinomycin-D, hydrogen peroxide, nitrosurea, plicomycin, tamoxifen, taxol, tiansplatinum, vincristin, vinblastin, a TRAIL Rl and R2 receptor antibody or agonist,
- a method for treating or preventing cancer in a patient comprising (a) contacting CTLs ofthe patient with a proteinase 3 peptide other than PRl; and (b) administering a therapeutically effective amount of the CTLs of step (b) to the patient.
- the method may further comprise expanding the CTL's by ex vivo or in vivo methods prior to administration.
- Contacting may comprise providing an antigen presenting cell loaded with the peptide or that expresses the peptide from an expression construct.
- the method may further comprise providing CTLs transfected with a T cell receptor specific for the peptide.
- the therapeutically effective amount of CTL cells required to provide therapeutic benefit may be from about 0.1 x 10 5 to about 5 x 10 7 cells per kilogram weight ofthe subject.
- a method for treating or preventing a cancer in a patient comprising administering to the patient a therapeutically effective amount of a vaccine comprising an expression construct encoding a proteinase-3 peptide other than PRl.
- the expression construct may be a non-viral expression construct or a viral expression construct.
- the expression construct may also encode a second tumor associated peptide.
- "a" or "an” may mean one or more.
- FIG. 1 Peptide-specific cytotoxicity of CTL against peptide-Ioaded T2 cells.
- Effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1.
- CTL raised against T2 cells pulsed with PR-1 or PR-2 were tested for specific lysis against the same respective target cell/target peptide combination.
- Six replicate wells were used for each dilution of effector cells.
- Data were pooled from 3 separate experiments using 3 separate CTL lines and displayed as mean specific lysis ⁇ standard devotion.
- FIGS. 2A-2B PRl specific CTL preferentially lyse fresh myeloid leukemia cells.
- CTL effector cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratios from 50:1 to 6:1.
- FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls).
- FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (low proteinase 3 expression, HLA-A2.1 negative) and T2 cells not loaded with peptide (negative controls).
- FIG. 2 A - CTL specific for PR-1 demonstrating low specific lysis against K562 cells transfected with HLA-A2.1 (low proteinase 3 expression) and T2 cells loaded with PR-1 (positive controls). There was only background lysis against U 937 (
- FIG. 3 HMY-A2.1+ cells transfected with Pr3 gene express cytoplasmic protein.
- HMy2.CrR-A2 cells were transfected with the Pr3 -containing vector pRTZ.2 and grown in culture in the presence of Zeocin. Cells were then grown in limiting dilution using increasingly higher concentrations of Zeocin. Two resulting cell lines, Clone 2.2 and Clone 1.4, and the non- transfected parent cell line HMy2.CIR-A2, were then analyzed for cytoplasmic Pr3 expression by flow cytometry using indirect staining with a FITC-labeled secondary antibody. Histograms of cell number versus the median channel of fluorescence (MCF) intensity of staimng for cytoplasmic Pr3 are shown. '• ⁇ FIG. 4.
- MCF median channel of fluorescence
- CTL lyse Pr3 -transfected HMY-A2.1+ cells were plated with target cells in a 4-hr cytotoxicity assay at E:T ratio of 25:1. Six replicate wells were used, and data is displayed as mean specific lysis ⁇ standard deviation.
- CTL specific for PR-1 demonstrate 36% specific lysis of HMy2.CIR-A2 cells transfected with Pr3 (Clone 1.4), and 73% specific lysis of marrow cells from a patient with chronic myelogenous leukemia in blast crisis (CML-BC), (positive control).
- FIGS. 5A-5C PRl -specific CTL can be identified by a PRl -tetramer.
- FIG. 5A - A day 17 CTL line elicited against PRl was labeled for 30 min with anti-CD8-FITC, washed three times with PBS, and then labeled for 30 min with the PRl-tetramer-PE. Cells were then washed three more times with PBS and analyzed by flow cytometry.
- FIG. 5B An HLA-A2 tetramer specific for a new shock peptide stained 0.2% of the PRl -specific CTL.
- FIG. 5C A day 17 CTL line elicited against influenza nucleoprotein was also labeled with anti-CD8-FITC and the PRl-tetramer-PE and is shown as a negative control.
- FIG. 6. The PR-tetramer can be used to sort CTL with PRl -specificity.
- Pr3 exon 3 containing polymorphism codes for peptides that bind to HLA-A2.1.
- FIG. 10. Tissue Expression of Proteinase 3.
- Lower doses of PRl peptide induce CTLs with higher intensity PR1/HLA-A2 tetramer staining that correlates with TCR avidity and inversely with effector function threshold.
- FIG. 11 A - PBMCs collected from healthy HLA- A2.1 + donors were stimulated weekly with PRl peptide-pulsed T2 cells at the peptide concentrations indicated above each FACS plot. After 4 weeks, resulting cultures were stained with CD8 (FITC) Ab and PR1/HLA-A2 tetramer, and the percentage of CD8 + cells that stain with tetramer are noted within each FACS plot.
- FIG. 11B Surface HLA-A2 expression on T2 cells increases linearly with increasing concentration of PRl peptide from 2 ⁇ M and 200 ⁇ M. T2 cells were incubated with PRl peptide at the concentrations shown and surface HLA-A2 expression was measured by flow cytometry.
- FIG. 11B Surface HLA-A2 expression on T2 cells increases linearly with increasing concentration of PRl peptide from 2 ⁇ M and 200 ⁇ M. T2 cells were incubated with PRl peptide at the concentrations shown and surface HLA-A2 expression was measured by flow cytometry.
- 11D - Tetramer decay (t ) was determined to be 58 min and 19 min by plotting normalized antigen-specific fluorescence at the indicated time points for 28-day-old PR1/HLA-A2 tetramer-stained CTLs elicited with 0.2 ⁇ M (open circles) or 20 ⁇ M PRl (filled squares), respectively.
- Dissociation kinetics of PR1/HLA-A2 tetramer staining were determined at 4°C in the presence of saturating concentrations of BB7.2 Ab to prevent rebinding of tetramer and in the presence of PI (1 ⁇ g/ml) to eliminate dead cells from the FACS gate.
- FIGS. 12A-12B are examples of PR1/HLA-A2 tetramer staining.
- High-avidity PRl-specific CTLs cause more specific lysis of CML BM cells than low-avidity PRl-specific CTLs.
- PRl- stimulated CTLs were coincubated in a 4-hr microcytotoxicity assay with bone marrow cells, and specific lysis was determined. Six replicate wells were used for each dilution of effector cells.
- FIG. 13 A High-avidity PRl-specific CTLs from a healthy donor showed greater specific lysis of CML target cells than low-avidity PRl-specific CTLs.
- FIG. 13B PRl-specific CTL line from a CML patient 3 months after IFN treatment preferentially lyse autologous BM target cells taken at time of diagnosis over healthy HLA-A2 + BM cells from a third party, and the amount of CML target cell lysis is similar to that produced by healthy donor-derived low-avidity PRl -specific CTLs.
- FIG. 14A Cultures elicited with 0.2 ⁇ M, 0.02 ⁇ M, and 0.002 ⁇ M PRl resulted in CTLs with lower-intensity tetramer staining than CTLs from healthy donors elicited with similar doses of PRl.
- FIGS. 15A-15C High-avidity PRl-specific CTLs are identified in the peripheral blood of IFN sensitive CML patients (FIG. 15A) in cytogenetic remission, but not in (FIG. 15B) IFN- resistant or in (FIG. 15C) untreated newly diagnosed CML patients.
- PBMCs were stained with CD8, dump (CD14 + CD19), and PR1-HLA-A2 tetiamer. Patients 5-8 were treated for a minimum of 9 months with IFN.
- FIGS. 16A-16B High-avidity PRl-specific CTLs undergo apoptosis 18 hr after stimulation with high-concentration PRl peptide.
- the resulting PRl -CTLs were washed and combined in a 1 : 1 ratio, based on the number of tetramer-positive cells, with T2 cells pulsed with either 0.2 ⁇ M or 20 ⁇ M PRl peptide. After 16 to 18 hr, cells were stained with Annexin V Ab, and live cells were analyzed based on PI staining. The percentage of CD8 + cells that are tetramer-positive is shown in the far left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels.
- FIGS. 17A-17D show that 16A - Annexin V expression increased on high-avidity PRl -CTLs exposed to high-concentration (20 ⁇ M) PRl, but not after exposure to low (0.2 ⁇ M) concentration PRl .
- Annexin V upregulation was blocked by pretreating peptide-pulsed T2 cells with anti-HLA-A2 (BB7.2) prior to coculture with PRl -CTL.
- FIG. 16B - Annexin V was not upregulated 18 hr after coculture of low-avidity PRl -CTLs with either low-concentration (0.2 ⁇ M) or high concentration (20 ⁇ M) PRl peptide.
- FIGS. 17A-17D show that
- High-avidity PRl-CTLs undergo apoptosis 18 hr after coincubation with HLA-A2 + CML cells that overexpress proteinase 3.
- High- and low-avidity PRl-CTLs were combined in a 1 : 1 ratio, based upon the number of tetramer-positive cells, with CML BM cells from untreated HLA-A2 + and HLA-A2 " patients.
- Annexin V staining was measured on live cells, based on PI staining, 18 hr after coincubation. The percentage of CD8 + cells that are tetramer- positive is shown in the left panels, and the percentage of tetramer-positive cells that stain with annexin V are shown in the remaining panels.
- FIG. 17A Annexin V was upregulated in the high-avidity PRl-CTLs after coincubation with HLA-A2 cells, but not after coincubation with HLA-A2- cells. Remaining low-avidity PRl-CTLs in the culture did not upregulate annexin V.
- FIG. 17B hi contrast, low-avidity PRl-CTLs did not upregulate annexin V after coincubation with either HLA-A2 + or HLA-A2- CML BM cells.
- FIG. 17C Overall MHC-I expression and proteinase 3 expression was similar in both CML BM target cells, as measured by surface staining with pan-HLA-A,B,C Ab.
- FIG. 17A Annexin V was upregulated in the high-avidity PRl-CTLs after coincubation with HLA-A2 cells, but not after coincubation with HLA-A2- cells. Remaining low-avidity PRl-CTLs in the culture did
- FIG. 17D Proteinase 3 expression was 2.8- and 3.3-fold higher in the HLA-A2 + and the HLA-A2- patient BM, respectively, compared with healthy donor BM cells.
- FIG. 18. High avidity PR1-CTL in IFN-sensitive CML patients off therapy.
- FIG. 19. PR1-CTL phenotype in CML patients in CCR off interferon: High avidity PR1- CTL have an effector memory phenotype.
- PRl vaccine elicits PRl -CTL immunity at injection site.
- FIG. 21. PRl vaccine induces immune responses and clinical responses.
- FIG. 22. PRl vaccine induces PRl -CTL immunity and molecular remission in UPN4 with AML.
- FIG. 23 PRl vaccine elicits functional PR1-CTL immunity that persiste beyond 6 months.
- UPN9 PBMC analyzed six months after 3 rd injection of PRl (1.0 mg) for tetramer + and FIGS. 24A-24B.
- FIG. 24 A long term molecular remission after vaccine-induced expansion of PRl -CTL was test (FIG. 24 A) and vaccine-induced PR1- CTL was shown to preferentially kill leukemia cells (FIG. 24B).
- FIG. 25 The fraction of functional PRl -CTL vs pp65-CTL is similar in CMV + patients with an immune response to the PRl vaccine.
- FIG. 23 PRl vaccine elicits functional PR1-CTL immunity that persiste beyond 6 months.
- UPN9 PBMC analyzed six months after 3 rd injection of PRl (1.0 mg) for tetramer + and FIGS. 24A-24B.
- FIG. 24 A long term molecular remission after vaccine-induced expansion
- PRl vaccine induces molecular remission in UPN15 patient with inv(16) AML.
- FIGS. 27A-27D High avidity PRl -CTL are preferentially lost after vaccination and remaining low avidity PRl -CTL specifically- kill autologous leukemia cells in UPN6 patient.
- FIG. 27A - Using sample from patient 6 (UPN 6) percent antigens specific CTL was assessed.
- FIG. 27B Pre and Post-vaccine.
- FIG. 27C PR1/A2 Tetramer-Sorted CTL Are Peptide Specific.
- FIG. 27D Tetramer-Sorted PRl -CTL Preferentially Kill CML.
- FIG. 28 High affinity PRl -CTL are absent in UPN 6 after vaccination.
- UPN6 (CML) and UPN4 (AML) patient samples are compared 30 days post-PRl at 200 ⁇ M and 0.2 ⁇ M. High PRl -CTL avidity was found to be expanded in UPN4 but not UPN6I patient.
- FIGS. 29A-29B PRl -CTL immunity at day 60 correlates with remission at 1 year after NST forAML.
- FIG. 30 PRl -CTL immunity at day 60 correlates with remission at 1 year after NST forAML.
- FIGS. 31A-31B Cytotoxicity comparison of PR1-CTL elicited with various APCs. Percent specific lysis for T2 alone versus T2 + PRl in DC/IGM (FIG. 31A) or DC/4GM (FIG. 31B) antigen presenting cells is shown.
- FIG. 32 Comparison of DC growth conditions on CTL stimulation. Cell proliferation of PRl -CTL lines stimulated with autologous DC/IGM under various culture conditions is shown.
- FIGS. 33A-33C Comparison of DC growth conditions on CTL stimulation.
- FIG. 34 Five MPO-Deduced Peptides Bind to HLA-A2.1.
- FIG. 35 MY2-Specific CTL Kill Leukemia Cells and Also Healthy Donor Marrow Cells.
- FIG. 36 MY4-Sepcific CTL Preferentially Kill AML Bone Marrow Cells And Not Healthy Bone Marrow Cells.
- FIG. 37 MY4-Specific CTL Lysis of MY4-Pulsed T2 Cells is HLA-A2-Restricted.
- FIG. 38 MY4-CTL Inhibit Leukemia Progenitors.
- FIG. 39 MY4-CTL Inhibit Leukemia Progenitors.
- FIG. 40 Tissue Expression of Myeloperoxidase.
- FIG. 41 Multiple Peptide/HLA-A2-Tetramers Can Be Used To Simultaneously Stain Single Patient Samples.
- FIG. 42. PR1-, MY2- & MY4-CTL Are Not Present In Healthy Donors Or NST Recipients With Lymphoid Malignancies.
- FIG. 43. PR1-CTL & MY4-CTL, But No MY2-CTL, Are Detectable In
- FIG.44 Percentage of PR1-TL, MY4-CTL & HA1-CTL All Correlate with Remission Status.
- FIG. 45 PRl -CTL Kill Leukemia but not Normal Marrow.
- FIG. 46 PR1-CTL Lysis of Targets is HLA-A2-Restricted.
- the Present Invention serves to overcome the deficiencies in the art by providing HLA- restricted peptides, derived from myeloid self-proteins, that can be used to elicit peptide-reactive
- PRl peptide is an important tumor antigen for CTL immune responses against this form of leukemia, and provide the first direct evidence that an antigen-specific T cell response contributes to its control.
- PRl-specific CTL are found in the majority of patients that achieve remission with IFN- ⁇ 2b therapy or with allogeneic BMT, therapies thought to potentially work through an immune mechanism.
- the inventors have shown that normal healthy donors have existent CTL immunity to PRl and that CML patients who have a cytogenetic remission after treatment with interferon also have effective PRl- specific CTL immunity toward their leukemia cells, while patients without cytogenetic responses do not, thus establishing PRl as the first leukemia-associated tumor antigen.
- the present invention also seeks to determine whether vaccination with PRl peptide can enhance immunity toward leukemia, whether the responding T lymphocytes are memory or na ⁇ ve, and whether the PRl -specific CTL exhibit T cell receptors (TCRs) with higher or lower affinity for PR1/HLA-A2 compared to healthy individuals.
- TCRs T cell receptors
- the in vivo relevance of MY2 and MY4 as leukemia antigens is examined since the peptides were identified using in vitro techniques.
- Pre-exist MY2 and MY4 reactivity by CTL in leukemia patients and their HLA-matched marrow donors will also be examined.
- the present invention will determine whether MY2- and MY4- specific CTL can be elicited in vitro from leukemia patients using the established methods for eliciting similar responses in normal donors, hi the present invention, there is also provided a phase I clinical trial to adoptively transfer MY4-specific CTL to acute myeloid leukemia patients following NST as a way to enhance GVL while abrogating GVHD.
- HLA- A2.1 -restricted, HLA-A3- restricted, and HLA-B7-restricted peptides from MPO with predicted high MHC binding will be examined for their capacity to elicit myeloid leukemia-reactive CTL responses similar to MY4 and PRl.
- isolated or “biologically pure” refer to material which is substantially or essentially free from components which normally accompany the material as it is found in its native state.
- isolated peptides in accordance with the invention preferably do not contain materials normally associated with the peptides in their in situ environment.
- MHC Major histocompatibility complex
- HLA complex HLA complex
- HLA Human leukocyte antigen
- MHC major histocompatibility complex
- motif refers to the pattern of residues in a peptide of defined length, usually a peptide of from about 8 to about 13 amino acids for a class I HLA motif and from about 6 to about 25 amino acids for a class II HLA motif, which is recognized by a particular HLA molecule.
- Peptide motifs are typically different for each protein encoded by each human HLA allele and differ in the pattern ofthe primary and secondary anchor residues.
- a "supermotif ' is a peptide binding specificity shared by HLA molecules encoded by two or more HLA alleles. Thus, a preferably is recognized with high or intermediate affinity (as defined herein) by two or more HLA antigens.
- Cross-reactive binding indicates that a peptide is bound by more than one HLA molecule; a synonym is degenerate binding.
- a "protective immune response” refers to a CTL and/or an HTL response to an antigen derived from an infectious agent or a tumor antigen, which prevents or at least partially arrests disease symptoms or progression. The immune response may also include an antibody response which has been facilitated by the stimulation of helper T cells.
- HLA-Restricted Peptides The present provides a vaccine comprising a tumor associated HLA restricted peptide.
- Human leukocyte antigen or "HLA” is a human class I or class II major histocompatibility complex (MHC) protein (see, e.g., Stites, 1994).
- MHC major histocompatibility complex
- An "HLA supertype or family”, as used herein, describes sets of HLA molecules grouped on the basis of shared peptide-binding specificities. HLA class I molecules that share somewhat similar binding affinity for peptides bearing certain amino acid motifs are grouped into HLA supertypes.
- HLA-restricted molecules of the present invention may include HLA-A2, HLA-A3, HLA-A11, HLA-B7, HLA-B27, or HLA-B35; but are not limited to such.
- HLA-restricted antigens/peptides include, but are not limited to: 707 alanine proline (707-AP); alpha ( ⁇ )-fetoprotein (AFP); adenocarcinoma antigen recognized by T cells 4 (ART- 4); B antigen (BAGS); ⁇ -catenm/m, ⁇ -catenin/mutated; breakpoint cluster region-Abelson (Bcr- abl); CTL-recognized antigen on melanoma (CAMEL); carcinoembryonic antigen peptide - 1 (CAP-1); caspase-8 (CASP-8); cell-division-cycle 27 mutated (CDC27m); cycline-dependent kinase 4 mutated (CDK4/m); carcinoembryonic antigen (CEA); cancer/testis (antigen) (CT); cyclophilin B (Cyp-B); differentiation antigen melanoma (the epitopes of DAM-6 and DAM-10 are equivalent,
- DAM-6 is also called MAGE-B2 and DAM- 10 is also called MAGE-B1) (DAM); elongation factor 2 mutated (ELF2M); Ets variant gene 6/acute myeloid leukemia 1 gene ETS (ETV6-AM1); glycoprotein 250 (G250); G antigen (GAGE); N-acetylglucosaminyltransferase V (G ⁇ iT-V); glycoprotein 100 Kd (GplOO); helicose antigen (HAGE); human epidermal receptor-2/neurological (HER-2/neu); arginine (R) to isoleucine (I) exchange at residue 170 of the ⁇ -helix of the ⁇ 2-domain in the HLA-A2 gene (HLA-A*0201-R170I); human papilloma virus E7 (HPV-E7); heat shock protein 70 - 2 mutated (HSP70-2M); human signet ring tumor - 2 (HST-2); human
- Myeloid-Restricted Antigens To adapt what has been learned about immunity against melanoma antigens to the study of myeloid leukemia antigens, myeloid-restricted normal proteins that are highly expressed in the leukemia are studied. Myeloid leukemias express a number of differentiation antigens associated with granule formation. These antigens may include proteinease-3 (Pr3 or P3), neutrophil elastase, myeloperoxidase, cylcin El, cyclin D, or a cyclin E2; but are not limited to such. Particular examples of myeloid-restricted peptides, such as Pr3 and myeloperoxidase, are provided herein.
- P3 and two other azurophil granule proteins, neutrophil elastase and azurocidin, are coordinately regulated and the transcription factors PU.l and C/EBP ⁇ , which are responsible for normal myeloid differentiation from stem cells to monocytes or granulocytes, are important in mediating their expression (Lewin et al, 2002). These transcription factors have been implicated in leukemogenesis (Behre et al, 1999), and P3 itself may also be important in maintaining a leukemia phenotype since P3 antisense oligonucleotides halt cell division and induce maturation of the HL-60 promyelocytic leukemia cell line (Bories et al, 1989). Critical to identifying T cell antigens in these proteins is the observation that P3 is the target of autoimmune attack in Wegener's granulomatosis (Franssen et al, 1994).
- Proteinase3 Peptides and Vaccines Pr3 is a 26 kDa neutral serine protease that is stored in primary azurophil granules and is maximally expressed at the promyelocyte stage of myeloid differentiation (Sturrock et al, 1992; Chen et al, 1994; Muller-Berat et al, 1994; Lewin et al, 2002; Behre et al, 1999).
- the human gene contains 5 exons, is localized on chromosome 19p and has been cloned (Sturrock et al, 1992).
- Pr3 is overexpressed in a variety of myeloid leukemia cells including 75% of CML patients, approximately 50% of acute myeloid leukemia patients, and approximately 30% of the cases of myelodysplastic syndrome patients (Dengler et al, 1995). Pr3 also has several characteristics that make it an appealing target for vaccine and T cell directed therapy. It is overexpressed in human myeloid leukemia and is generally homogeneous throughout the leukemia. An immune response generated against the antigen could result in complete eradication of the leukemia.
- Pr3 may be important for maintenance of the leukemia phenotype, any selective pressure resulting in Pr3-loss mutants following immunotherapy may not result in "tumor escape.”
- any TAP-deficient tumor mutants might remain susceptible to an anti-leukemia immune response since the protein would still be available to the MHC class I antigen processing pathway.
- the use of a synthetic peptide derived from Pr3 as the immunizing antigen in a leukemia vaccine offers practical advantages: relatively easy construction and production, chemical stability, and a lack of infectious or oncogenic potential.
- PRl a small peptide that a small peptide called PRl, a portion of the larger molecule of proteinase 3 (P3) found in myeloid leukemia cells, can be used to generate immune cells, particularly, cytotoxic T lymphocytes (CTL).
- CTL cytotoxic T lymphocytes
- PRl is a 9 aa peptide comprising amino acid 169- 177, that binds to HLA-A2.1, thereby eliciting CTL from an HLA-A2.1+ normal donor in vitro.
- CTL cytotoxic T lymphocytes
- PRl-specific CTL also inhibit colony-forming unit granulocyte-macrophage (CFU-GM) from the marrow of CML patients, but not CFU-GM from normal HLA-matched donors (Molldrem et al, 1997). These CTL, generated from normal healthy donors, preferentially kill leukemia cells while leaving normal bone marrow cells unharmed. More recently, it was found that CML patients who enter remission after treatment with either BMT or interferon have highly increased numbers of very effective PRl-specific CTL that kill their leukemia cells. PRl is therefore the first peptide antigen identified that can elicit specific CTL lysis of fresh human myeloid leukemia cells.
- CFU-GM colony-forming unit granulocyte-macrophage
- MPO Myeloperoxidase
- MPO myeloperoxidase
- Another myeloid- restricted protein which is a heme protein synthesized during early myeloid differentiation that constitutes the major component of neutrophil azurophilic granules.
- myeloperoxidase is subsequently cleaved into a light and heavy chain.
- the mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains (Franssen et al, 1996). This enzyme produces hypohalous acids central to the microbicidal activity of netrophils.
- MPO myeloid leukemia cells
- 75%> of CML patients approximately 50% of. acute myeloid leukemia patients
- approximately 30% of the cases of myelodysplastic syndrome patients (Williams et al, 1994).
- Pr3 is the target of autoimmune attack in Wegener's granulomatosis
- MPO is the target antigen in small vessel vasculitis (Franssen et al, 1996; Brouwer et al, 1994; Molldrem et al, 1996) respectively, with evidence for both T-cell and antibody immunity in patients with these diseases.
- Granule protein of 80kD gene on chromosome 17q Target antigen ofthe pANCA antibody in small vessel Vasculitis, Churg-Strauss syndrome, and crescentic Glomerulonephritis Expressed in very early myeloid progenitors Most abundant protein in myeloid cells
- MDS myeloid leukemia cells
- the present invention concerns tumor-associated HLA-restricted peptide or antigen compositions comprising at least one HLA-restricted peptide, such as proteinase3 (P3 or Pr3) or myeloperoxidase (MYO) for use as a vaccine in treating cancers.
- an "antigenic composition” may comprise an antigen (e.g., a peptide or polypepide), a nucleic acid encoding an antigen (e.g., an antigen expression vector), or a cell expressing or presenting an antigen.
- an antigenic composition such as a tumor-associated HLA-restricted peptide or antigen of the present invention
- the antigenic composition must induce an immune response to the antigen in a cell, tissue or animal (e.g., a human).
- the antigenic composition comprises or encodes all or part of the sequences shown in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:ll, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:
- an "amino acid molecule" or “amino acid residue” refers to any naturally occurring amino acid, any amino acid derivative or any amino acid mimic known in the art, including modified or unusual amino acids.
- the residues of the protein or peptide are sequential, without any non-amino acid interrupting the sequence of amino acid residues, hi other embodiments, the sequence may comprise one or more non-amino acid moieties.
- the sequence of residues of the protein or peptide may be interrupted by one or more non-amino acid moieties.
- the composition of the present invention employs a peptide of from about 5 to about 100 amino acids or greater in length.
- Proteins or peptides may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides or peptides through standard molecular biological techniques, the isolation of proteins or peptides from natural sources, or the chemical synthesis of proteins or peptides.
- the nucleotide and protein, polypeptide and peptide sequences corresponding to various genes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art.
- One such database is the National Center for Biotechnology Information's Genbank and GenPept databases located at the National Institutes of Health website.
- the coding regions for known genes may be amplified and/or expressed using the techniques disclosed herein or as would be know to those of ordinary skill in the art.
- peptide is used interchangeably with "oligopeptide” in the present specification to designate a series of residues, typically L-amino acids, connected one to the other, typically by peptide bonds between the -amino and carboxyl groups of adjacent amino acids.
- the preferred CTL-inducing oligopeptides of the invention are 13 residues or less in length and usually consist of between about 8 and about 11 residues, preferably 9 or 10 residues.
- the preferred HTL-inducing oligopeptides are less than about 50 residues in length and usually consist of between about 6 and about 30 residues, more usually between about 12 and 25, and often between about 15 and 20 residues.
- the size ofthe at least one peptide molecule may comprise, but is not limited to, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 60, or greater amino molecule residues, and any range derivable therein.
- immunogenic peptide or “peptide epitope” is a peptide which comprises an allele- specific motif or supermotif such that the peptide will bind an HLA molecule and induce a CTL and/or HTL response.
- immunogenic peptides ofthe invention are capable of binding to an appropriate HLA molecule and thereafter inducing a cytotoxic T cell response, or a helper T cell response, to the antigen from which the immunogenic peptide is derived.
- proteinaceous composition encompasses amino molecule sequences comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid, including but not limited to those shown on Table 2 below.
- the proteinaceous composition comprises at least one protein, polypeptide or peptide.
- the proteinaceous composition comprises a biocompatible protem, polypeptide or peptide.
- biocompatible refers to a substance which produces no significant untoward effects when applied to, or administered to, a given organism according to the methods and amounts described herein. Such untoward or undesirable effects are those such as significant toxicity or adverse immunological reactions.
- biocompatible protein, polypeptide or peptide containing compositions will generally be mammalian proteins or peptides or synthetic proteins or peptides each essentially free from toxins, pathogens and harmful immunogens.
- a proteinaceous compound may be purified. Generally,
- purified will refer to a specific or protein, polypeptide, or peptide composition that has been subjected to fractionation to remove various other proteins, polypeptides, or peptides, and which composition substantially retains its activity, as may be assessed, for example, by the protein assays, as would be known to one of ordinary skill in the art for the specific or desired protein, polypeptide or peptide.
- the proteinaceous composition may comprise at least one antibody, for example, an antibody against PRl or myeloperoxidase. As used herein, the term
- antibody is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA,
- IgD and IgE are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting.
- antibody is used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like.
- DABs single domain antibodies
- Fv single domain antibodies
- scFv single chain Fv
- any protein, polypeptide or peptide containing component may be used in the compositions and methods disclosed herein.
- the proteinaceous material is biocompatible.
- the formation of a more viscous composition will be advantageous in that will allow the composition to be more precisely or easily applied to the tissue and to be maintained in contact with the tissue throughout the procedure.
- the use of a peptide composition, or more preferably, a polypeptide or protein composition is contemplated.
- Ranges of viscosity include, but are not limited to, about 40 to about 100 poise. In certain aspects, a viscosity of about 80 to about 100 poise is preferred. A.
- Fusion Proteins of HLA-Restiricted Peptides A specialized kind of insertional variant is the fusion protein.
- This molecule generally has all or a substantial portion of the native molecule, linked at the N- or C-terminus, to all or a portion of a second polypeptide.
- fusions typically employ leader sequences from other species to permit the recombinant expression of a protein in a heterologous host.
- Another useful fusion includes the addition of an im unologically active domain, such as an antibody epitope, to facilitate purification ofthe fusion protein. Inclusion of a cleavage site at or near the fusion junction will facilitate removal of the extraneous polypeptide after purification.
- Other useful fusions include linking of functional domains, such as active sites from enzymes such as a hydrolase, glycosylation domains, cellular targeting signals or transmembrane regions.
- peptides of the present invention may further employ amino acid sequence variants such as substitutional, insertional or deletion variants.
- Deletion variants lack one or more residues ofthe native protein. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide. Substitutions are changes to an existing amino acid.
- sequence variants may generate truncations, point mutations, and frameshift mutations. As is known to one skilled in the art, synthetic peptides can be generated by these mutations.
- amino acids sequence variants may include additional residues, such as additional N- or C-terminal amino acids, and yet still be essentially as set forth in one of the sequences disclosed herein, so long as the sequence meets the criteria set forth above, including the maintenance of biological activity.
- a protein such as a HLA-restricted peptide or protein of the invention
- certain amino acids may be substituted for other amino acids in the tumor- associated HLA-restricted peptide or protein such as a Pr3 or MYO protein, resulting in a greater CTL immune response in cells such as a myeloid cell.
- Patent 4,554,101 the following hydrophilicity values have been assigned to amino acid residues: basic amino acids: arginine (+3.0), lysine (+3.0), and histidine (-0.5); acidic amino acids: aspartate (+3.0 ⁇ 1), glutamate (+3.0 ⁇ 1), asparagine (+0.2), and glutamine (+0.2); hydrophilic, nonionic amino acids: serine (+0.3), asparagine (+0.2), glutamine (+0.2), and threonine (-0.4), sulfur containing amino acids: cysteine (-1.0) and methionine (-1.3); hydrophobic, nonaromatic amino acids: valine (-1.5), leucine (-1.8), isoleucine (-1.8), proline (- 0.5 ⁇ 1), alanine (-0.5), and glycine (0); hydrophobic, aromatic amino acids: tryptophan (-3.4), phenylalanine (-2.5), and tyrosine (-2.3).
- amino acid can be substituted for another having a similar hydrophilicity and produce a biologically or immunologically modified protein, hi such changes, the substitution of amino acids whose hydrophilicity values are within ⁇ 2 is preferred, those that are within ⁇ 1 are particularly preferred, and those within ⁇ 0.5 are even more particularly preferred.
- amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like.
- substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
- the present invention may also employ the use of peptide mimetics for the preparation of polypeptides (see e.g., Johnson, 1993) having many of the natural properties of a tumor- associated HLA-restricted peptide such as Pr3 or MYO protein, but with altered and/or improved characteristics.
- the peptide backbone of proteins exists chiefly to orient amino acid side chains in such a way as to facilitate molecular interactions, such as those of antibody and antigen.
- These principles may be used, in conjunction with the principles outline above, to engineer second generation molecules having many ofthe natural properties of a tumor-associated HLA-restricted peptide but with altered and even improved characteristics.
- C. Tumor- Associated HLA-Restricted Peptide Purification In certain embodiments the protein(s) ofthe present invention may be purified. It may be desirable to purify the tumor-associated HLA-restricted peptides, polypeptides or proteins or variants thereof.
- purified protein or peptide as used herein, is intended to refer to a composition, isolatable from other components, wherein the protein or peptide is purified to any degree relative to its naturally-obtainable state.
- a purified protein or peptide therefore also refers to a protein or peptide, free from the environment in which it may naturally occur.
- purified will refer to a protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its expressed biological activity.
- substantially purified this designation will refer to a composition in which the protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%o, about 90%), about 95% or more ofthe proteins in the composition.
- Protein purification techniques are well known to those of skill in the art. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions. Having separated the polypeptide from other proteins, the polypeptide of interest may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity). Analytical methods particularly suited to the preparation .
- ion-exchange chromatography exclusion chromatography
- polyacrylamide gel electrophoresis polyacrylamide gel electrophoresis
- isoelectric focusing Other methods for protein purification include, precipitation with ammonium sulfate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; gel filtration, reverse phase, hydroxylapatite and affinity chromatography; and combinations of such and other techniques.
- the polypeptide may be purified from other cellular components using an affinity column, which binds to a tagged portion of the polypeptide. Although this preparation will be purified in an inactive form, the denatured material will still be capable of transducing cells. Once inside of the target cell or tissue, it is generally accepted that the polypeptide will regain full biological activity. As is generally known in the art, it is believed that the order of conducting the various purification steps may be changed, or that certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified protein or peptide. Various methods for quantifying the degree of purification of the protein or peptide will be known to those of skill in the art in light of the present disclosure.
- peptides corresponding to one or more antigenic determinants of the tumor-associated HLA-restricted peptides or polypeptides may be prepared so that an immune response against the tumor-associated HLA-restricted peptides, polypeptides or proteins, such as Pr3 or MYO is raised.
- vaccination with a tumor-associated HLA-restricted peptides, or polypeptides may generate an autoimmune response in an immunized animal such that autoantibodies that specifically recognize the animal's endogenous tumor-associated HLA-restricted protein. This vaccination technology is shown in U.S.
- Patents 6,027,727; 5,785,970, and 5,609,870 which are hereby incorporated by reference.
- Such peptides should generally be at least five or six amino acid residues in length and will preferably be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or about 30 amino acid residues in length, and may contain up to about 35-50 residues.
- these peptides may comprise a amino acid sequence, such as 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, and 50 or more contiguous amino acids from SEQ ID NO:l, SEQ JO NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l 1, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ JD NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45,
- Synthetic peptides will generally be about 35 residues long, which is the approximate upper length limit of automated peptide synthesis machines, such as those available from Applied Biosystems (Foster City, CA). Longer peptides also may be prepared, e.g., by recombinant means.
- U.S. Patent 4,554,101 incorporated herein by reference, teaches the identification and preparation of epitopes from Primary amino acid sequences on the basis of hydrophilicity.
- Examples include those programs based upon the Jameson-Wolf analysis (Jameson and Wolf, 1988; Wolf et al, 1988), the program PepPlot® (Brutlag et al, 1990; Weinberger et al, 1985), and other new programs for protein tertiary structure prediction (Fetrow and Bryant, 1993).
- Another commercially available software program capable of carrying out such analyses is Mac Vector (IB I, New Haven, CT).
- major antigenic determinants of a tumor-associated HLA- restricted peptide may be identified by an empirical approach in which portions of the gene encoding the tumor-associated HLA-restricted peptides are expressed in a recombinant host, and the resulting proteins tested for their ability to elicit an immune response.
- PCRTM can be used to prepare a range of peptides lacking successively longer fragments of the C- terminus of the protein. The immunoactivity of each of these peptides is determined to identify those fragments or domains of the polypeptide that are immunodominant.
- polypeptides are prepared that contain at least the essential features of one or more antigenic determinants.
- the peptides are then employed in the generation of antisera against the polypeptide.
- Minigenes or gene fusions encoding these determinants also can be constructed and inserted into expression vectors by standard methods, for example, using PCRTM cloning methodology.
- the use of such small peptides for antibody generation or vaccination typically requires conjugation ofthe peptide to an immunogenic carrier protein, such as hepatitis B surface antigen, keyhole limpet hemocyanin or bovine serum albumin, or other adjuvants discussed above (adjuvenated peptide).
- Alum is an adjuvant that has proven sufficiently non-toxic for use in humans.
- compositions of the invention such as polysaccharides, including chitosan, which is described in U.S. Patent 5,980,912, hereby incorporated by reference.
- Multiple (more than one) tumor-associated HLA- restricted epitopes may be crosslinked to one another (e.g., polymerized).
- a nucleic acid sequence encoding a tumor-associated HLA-restricted peptides, or polypeptides may be combined with a nucleic acid sequence that heightens the immune response.
- fusion proteins may comprise part or all of a foreign (non-self) protein such as bacterial sequences, for example.
- Antibody titers effective to achieve a response against endogenous tumor-associated HLA-restricted peptides, or polypeptides will vary with the species of the vaccinated animal, as well as with the sequence of the administered peptide. However, effective titers may be readily determined, for example, by testing a panel of animals with varying doses ofthe specific antigen and measuring the induced titers of autoantibodies (or anti-self antibodies) by known techniques, such as ELISA assays, and then correlating the titers with a related cancer characteristics, e.g., tumor growth or size. One of ordinary skill would know various assays to determine whether an immune response against a tumor-associated HLA-restricted peptide was generated.
- immune response includes both cellular and humoral immune responses.
- Various B lymphocyte and T lymphocyte assays are well known, such as ELISAs, cytotoxic T lymphocyte (CTL) assays, such as chromium release assays, proliferation assays using peripheral blood lymphocytes (PBL), tetramer assays, and cytokine production assays.
- CTL cytotoxic T lymphocyte
- PBL peripheral blood lymphocytes
- tetramer assays tetramer assays
- cytokine production assays See Benjamini et al. (1991), hereby incorporated by reference.
- the antigenic composition such a tumor- assoicated HLA-restricted peptide or antigen, may comprises an additional immunostimulatory agent or nucleic acids encoding such an agent.
- Immunostimulatory agents include but are not limited to an additional antigen, an immunomodulator, an antigen presenting cell or an adjuvant.
- one or more ofthe additional agent(s) is covalently bonded to the antigen or an immunostimulatory agent, in any combination, hi certain embodiments, the antigenic composition is conjugated to or comprises an HLA anchor motif amino acids.
- Adjuvants As also well known in the art, the immunogenicity of a particular immunogen composition can be enhanced by the use of non-specific stimulators of the immune response, known as adjuvants. Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Patent 4,877,611). Immunization protocols have used adjuvants to stimulate responses for many years, and as such adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation.
- tumor-associated HLA-restricted antigens of the present invention with the inclusion of a suitable adjuvant will likely increase the anti-tumor response of the antigens.
- molecule adjuvants include all acceptable immunostimulatory compounds, such as cytokines, toxins or synthetic compositions.
- Exemplary, often preferred adjuvants include complete Freund's adjuvant (a non-specific stimulator of the immune response containing killed Mycobacterium tuberculosis), incomplete Freund's adjuvants and aluminum hydroxide adjuvant.
- IL-1 IL-2, IL-4, IL-7, IL-12, - interferon
- GMCSP BCG
- aluminum hydroxide MDP compounds, such as thur-MDP and nor-MDP, CGP (MTP-PE), lipid A, and monophosphoryl lipid A (MPL).
- MDP compounds such as thur-MDP and nor-MDP
- CGP CGP
- MPL monophosphoryl lipid A
- RJJBI which contains three components extracted from bacteria, MPL, trehalose dimycolate (TDM) and cell wall skeleton (CWS) in a 2% squalene/Tween 80 emulsion also is contemplated.
- MHC antigens may even be used.
- an adjuvant effect is achieved by use of an agent, such as alum, used in about 0.05 to about 0.1 % solution in phosphate buffered saline.
- the antigen is made as an admixture with synthetic polymers of sugars (Carbopol®) used as an about 0.25% solution.
- Adjuvant effect may also be made my aggregation ofthe antigen in the vaccine by heat treatment with temperatures ranging between about 70° to about 101°C for a 30 second to 2- minute period, respectively. Aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, mixture with bacterial cell(s) such as C.
- Fab pepsin treated
- an endotoxin or a lipopolysaccharide component of Gram-negative bacteria emulsion in physiologically acceptable oil vehicles, such as mannide mono-oleate (Aracel A), or emulsion with a 20% solution of a perfluorocarbon (Fluosol-DA®) used as a block substitute, also may be employed.
- physiologically acceptable oil vehicles such as mannide mono-oleate (Aracel A)
- Some adjuvants for example, certain organic molecules obtained from bacteria, act on the host rather than on the antigen.
- An example is muramyl dipeptide (N-acetylmuramyl- L-alanyl-D-isoglutamine [MDP]), a bacterial peptidoglycan.
- MDP as with most, adjuvants, are not fully understood. MDP stimulates macrophages but also appears to stimulate B cells directly. The effects of adjuvants, therefore, are not antigen-specific. If they are administered together with a purified antigen, however, they can be used to selectively promote the response to the antigen.
- hemocyanins and hemoerythrins may also be used in the invention.
- KLH keyhole limpet
- Various polysaccharide adjuvants may also be used.
- L-alanyl-D-isoglutamine group of bacterial peptidoglycans.
- Derivatives of muramyl dipeptide such as the amino acid derivative threonyl-MDP, and the fatty acid derivative MTPPE, are also contemplated.
- U.S. Patent 4,950,645 describes a lipophilic disaccharide-tripeptide derivative of muramyl dipeptide which is described for use in artificial liposomes formed from phosphatidyl choline and phosphatidyl glycerol. It is the to be effective in activating human monocytes and destroying tumor cells, but is non-toxic in generally high doses.
- Patent 4,950,645 and PCT Patent Application WO 91/16347 are contemplated for use with cellular carriers and other embodiments ofthe present invention.
- BCG Bacillus Calmette-Guerin, an attenuated strain of Mycobacterium
- CWS BCG-cell wall skeleton
- Trehalose dimycolate may be used itself. Trehalose dimycolate administration has been shown to correlate with augmented resistance to influenza virus infection in mice (Azuma et al, 1988). Trehalose dimycolate may be prepared as described in U.S. Patent 4,579,945.
- BCG is an important clinical tool because of its immunostimulatory properties.
- BCG acts to stimulate the reticulo-endothelial system, activates natural killer cells and increases proliferation of hematopoietic stem cells.
- Cell wall extracts of BCG have proven to have excellent immune adjuvant activity.
- mycobacteria have provided the means to introduce foreign genes into BCG (Jacobs et al, 1987; Snapper et al, 1988; Husson et al, 1990; Martin et al, 1990).
- Live BCG is an effective and safe vaccine used worldwide to prevent tuberculosis.
- BCG and other mycobacteria are highly effective adjuvants, and the immune response to mycobacteria has been studied extensively.
- BCG has a long record of safe use in man (Luelmo, 1982; Lotte et al, 1984). It is one of the few vaccines that can be given at birth, it engenders long-lived immune responses with only a single dose, and there is a worldwide distribution network with experience in BCG vaccination.
- An exemplary BCG vaccine is sold as TICE BCG (Organon Inc., West Orange, NJ). Amphipathic and surface active agents, e.g., saponin and derivatives such as QS21
- Nonionic block copolymer surfactants Roshanovich et al, 1994
- Oligonucleotides are another useful group of adjuvants (Yamamoto et al, 1988).
- Quil A and lentinen are other adjuvants that may be used in certain embodiments of the present invention.
- Another group of adjuvants are the detoxified endotoxins, such as the refined detoxified endotoxin of U.S. Patent 4,866,034. These refined detoxified endotoxins are effective in producing adjuvant responses in mammals.
- the detoxified endotoxins may be combined with other adjuvants to prepare multi-adjuvant-incorporated cells.
- combination of detoxified endotoxins with trehalose dimycolate is particularly contemplated, as described in U.S. Patent 4,435,386.
- Combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids is also contemplated (U.S. Patent 4,505,899), as is combination of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose dimycolate, as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900.
- CWS cell wall skeleton
- CWS cell wall skeleton
- trehalose dimycolate as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900.
- Adjuvants may be encoded by a nucleic acid (e.g., DNA or RNA).
- such adjuvants may be also be encoded in a nucleic acid (e.g., an expression vector) encoding the antigen, or in a separate vector or other construct. Nucleic acids encoding the adjuvants can be delivered directly, such as for example with lipids or liposomes.
- BRM biologic response modifiers
- Such BRMs include, but are not limited to, Cimetidine (CIM; 1200 mg/d) (Smith Kline, PA); low-dose Cyclophosphamide (CYP; 300 mg/m2) (Johnson/ Mead, NJ), cytokines such as -interferon, IL-2, or IL-12 or genes encoding proteins involved in immune helper functions, such as B-7.
- C. Chemokines Chemokines, nucleic acids that encode for chemokines, and/or cells that express such also may be used as vaccine components. Chemokines generally act as chemoattractants to recruit immune effector cells to the site of chemokine expression.
- chemokine coding sequence in combination with, for example, a cytokine coding sequence, to enhance the recruitment of other immune system components to the site of treatment.
- chemokines include, for example, RANTES, MCAF, MJJPl-alpha, MDPl-Beta, JJ?-10 and combinations thereof.
- cytokines are also known to have chemoattractant effects and could also be classified under the term chemokines.
- an antigenic composition may be chemically coupled to a carrier or recombinantly expressed with a immunogenic carrier peptide or polypetide (e.g., a antigen- carrier fusion peptide or polypeptide) to enhance an immune reaction.
- immunogenic carrier amino acid sequences include hepatitis B surface antigen, keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA).
- KLH keyhole limpet hemocyanin
- BSA bovine serum albumin
- Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as immunogenic carrier proteins.
- Means for conjugating a polypeptide or peptide to a immunogenic carrier protein are well known in the art and include, for example, glutaraldehyde, m-maleimidobenzoyl-N-hydroxys ⁇ ccinimide ester, carbodiimide and bis-biazotized benzidine.
- Antibodies and Antibody Generation Another embodiment of the present invention are antibodies, in some cases, a human monoclonal antibody immunoreactive with the polypeptide sequence of a tumor-associated HLA-restricted peptide of the invention comprising SEQ ID NO:l, SEQ ID NO:2, SEQ JD NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ JD NO:6, SEQ JD NO:7, SEQ JD NO:8, SEQ ID NO:9, SEQ JD NO:10, SEQ JD NO:ll, SEQ ID NO:26, SEQ JD NO:27, SEQ JD NO:28, SEQ ID NO:29, SEQ JD NO:30, SEQ JD NO:31, SEQ JD NO:32, SEQ JD NO:33, SEQ ID NO:34, SEQ JD NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ JD NO:39, SEQ JD NO:42, SEQ JD
- this antibody is useful for screening samples from human patients for the purpose of detecting a particular tumor-associated HLA-restricted peptide present in the samples.
- the antibody also may be useful in the screening of expressed DNA segments or peptides and proteins for the discovery of related antigenic sequences.
- the antibody may be useful in passive immunotherapy for cancer. All such uses of the antibodies and any antigens or epitopic sequences so discovered fall within the scope of the present invention.
- Examples of other antibodies that may be employed in the present invention may include antibodies that react with T cells such as CD1, CD2, CD3, CD5, CD7 CD4, CD6, CD8 and CD27.
- Antibodies that react with myeloid cells may also be employed and include CDl lb, CDl lc, CD13, CD14, CD15, CD16, CD33, CD48, CD63, CD74, CD65, CD66, CD67 and CD68.
- Antibodies that react with undifferentiated cells may include HLA-DR, CD34 and CD38. It should be appreciated that multiple combinations of antibodies selected from the ones mentioned above are possible. Accordingly, it will be apparent to one skilled in the art that one can vary the antibody combinations In certain embodiments, the present invention involves antibodies. For example, all or part of a monoclonal, single chain, or humanized antibody may function as a vaccine for cancer.
- antibodies as a form of treatment or as a diagnostic to identify or quantify a particular polypeptide, such as tumor-associated HLA- restricted polypeptide, for example Pr3 or MYO polypeptide.
- a particular polypeptide such as tumor-associated HLA- restricted polypeptide, for example Pr3 or MYO polypeptide.
- antibodies also may be generated in response to smaller constructs comprising epitopic core regions, including wild-type and mutant epitopes.
- the term "antibody” is intended to refer broadly to any immunologic binding agent such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM are preferred because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting.
- antibody is may also be used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like.
- antibody fragments such as Fab', Fab, F(ab')2, single domain antib odies (DABs), Fv, scFv (single chain Fv), and the like.
- DABs single domain antib odies
- Fv single domain antib odies
- scFv single chain Fv
- the invention thus provides monoclonal antibodies of the human, murine, monkey, rat, hamster, rabbit and even chicken origin.
- the methods for generating monoclonal antibodies generally begin along the same lines as those for preparing polyclonal antibodies.
- a polyclonal antibody may be prepared by immunizing an animal with an immunogenic polypeptide composition in accordance with the present invention and collecting antisera from that immunized animal.
- serum is collected from persons who may have been exposed to a particular antigen. Exposure to a particular antigen may occur a work environment, such that those persons have been occupationally exposed to a particular antigen and have developed polyclonal antibodies to a peptide, polypeptide, or protein.
- polyclonal serum from occupationally exposed persons is used to identify antigenic regions in the gelonin toxin through the use of immunodetection methods.
- a wide range of animal species can be used for the production of antisera.
- the animal used for production of antisera is a rabbit, a mouse, a rat, a hamster, a guinea pig or a goat. Because of the relatively large blood volume of rabbits, a rabbit is a preferred choice for production of polyclonal antibodies.
- a given composition may vary in its immunogenicity. It is often necessary therefore to boost the host immune system, as may be achieved by coupling a peptide or polypeptide immunogen to a carrier.
- Exemplary and preferred carriers are keyhole limpet hemocyanin (KLH) and bovine serum albumin (BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as carriers.
- Means for conjugating a polypeptide to a carrier protein are well known in the art and include glutaraldehyde, m-maleimidobenzoyl-N-hydroxysuccinimide ester, carbodiimide and bis- biazotized benzidine.
- the amount of immunogen composition used in the production of polyclonal antibodies varies upon the nature ofthe immunogen as well as the animal used for immunization.
- a variety of routes can be used to administer the immunogen (subcutaneous, intramuscular, intradermal, intravenous and intraperitoneal).
- the production of polyclonal antibodies may be monitored by sampling blood ofthe immunized animal at various points following immunization. A second, booster injection also may be given. The process of boosting and titering is repeated until a suitable titer is achieved.
- the immunized animal can be bled and the serum isolated and stored, and/or the animal can be used to generate mAbs.
- mAbs may be readily prepared through use of well-known techniques, such as those exemplified in U.S. Patent 4,196,265, incorporated herein by reference.
- this technique involves immunizing a suitable animal with a selected immunogen composition, e.g., a purified or partially purified polypeptide, peptide or domain, be it a wild-type or mutant composition.
- a selected immunogen composition e.g., a purified or partially purified polypeptide, peptide or domain
- the immunizing composition is administered in a manner effective to stimulate antibody producing cells.
- mAbs may be further purified, if desired, using filtration, centrifugation and various chromatographic methods such as HPLC or affinity chromatography.
- Fragments of the monoclonal antibodies of the invention can be obtained from the monoclonal antibodies so produced by methods which include digestion with enzymes, such as pepsin or papain, and/or by cleavage of disulfide bonds by chemical reduction.
- monoclonal antibody fragments encompassed by the present invention can be synthesized using an automated peptide synthesizer. It also is contemplated that a molecular cloning approach may be used to generate mAbs. For this, combinatorial immunoglobulin phagemid libraries are prepared from RNA isolated from the spleen of the immunized animal, and phagemids expressing appropriate antibodies are selected by panning using cells expressing the antigen and control cells. The advantages of this 4 approach over conventional hybridoma techniques are that approximately 10 times as many antibodies can be produced and screened in a single round, and that new specificities are generated by H and L chain combination which further increases the chance of finding appropriate antibodies.
- Humanized monoclonal antibodies are antibodies of animal origin that have been modified using genetic engineering techniques to replace constant region and/or variable region framework sequences with human sequences, while retaining the original antigen specificity. Such antibodies are commonly derived from rodent antibodies with specificity against human antigens. Such antibodies are generally useful for in vivo therapeutic applications. This strategy reduces the host response to the foreign antibody and allows selection of the human effector functions. "Humanized” antibodies are also contemplated, as are chimeric antibodies from mouse, rat, or other species, bearing human constant and/or variable region domains, bispecific antibodies, recombinant and engineered antibodies and fragments thereof. The techniques for producing humanized immunoglobulins are well known to those of skill in the art. For example U.S.
- Patent 5,693,762 discloses methods for producing, and compositions of, humanized immunoglobulins having one or more complementarity determining regions (CDR's). When combined into an intact antibody, the humanized immunoglobulins are substantially non- immunogenic in humans and retain substantially the same affinity as the donor immunoglobulin to the antigen, such as a protein or other compound containing an epitope. Examples of other teachings in this area include U.S. Patents 6,054,297; 5,861,155; and 6,020,192, all specifically incorporated by reference. Methods for the development of antibodies that are "custom-tailored" to the patient's disease are likewise known and such custom-tailored antibodies are also contemplated.
- CDR's complementarity determining regions
- nucleic Acids Encoding HLA-Restricted Protein, Peptides and Polypeptides may be encoded by a nucleic acid sequence.
- a nucleic acid may be derived from genomic DNA, complementary DNA (cDNA) or synthetic DNA. Where incorporation into an expression vector is desired, the nucleic acid may also comprise a natural intron or an intron derived from another gene.
- cDNA is intended to refer to DNA prepared using messenger RNA (mRNA) as template.
- a cDNA as opposed to genomic DNA or DNA polymerized from a genomic, non- or partially-processed RNA template, is that the cDNA primarily contains coding sequences ofthe co ⁇ esponding protein. There may be times when the full or partial genomic sequence is prefe ⁇ ed, such as where the non-coding regions are required for optimal expression or where non-coding regions such as introns are to be targeted in an antisense strategy.
- a tumor-associated HLA-restricted peptide or polypeptide cDNA, such as a Pr3 or MYO cDNA, for use in the present invention, may be derived from human cDNA but are not limited such.
- nucleic acid segment refers to a nucleic acid molecule that has been isolated free of total genomic DNA of a particular species. Therefore, a nucleic acid segment encoding a polypeptide refers to a nucleic acid segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, total mammalian or human genomic DNA. Included within the term “nucleic acid segment” are a polypeptide or polypeptides, DNA segments smaller than a polypeptide, and recombinant vectors, such as, plasmids and other non- viral vectors.
- Recombinant may be used in conjunction with a polypeptide or the name of a specific polypeptide, and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule.
- Recombinant vectors and isolated nucleic acid segments may variously include the PRl or myeloperoxidase -coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include PRl or myeloperoxidase -coding regions or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.
- nucleic acid as used herein includes single-stranded and double-stranded molecules, as well as DNA, RNA, chemically modified nucleic acids and nucleic acid analogs. It is contemplated that a nucleic acid within the scope of the present invention may be of about 10, about 20, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 210, about 220, about 230, about 240, about 250, about 275, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 525, about 550, about 575, about 600, about 625, about 650, about 675, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about
- the nucleic acid region encodes a tumor-associated HLA- restricted peptide, or polypeptide
- the nucleic acid region can be quite long, depending upon the number of amino acids in the fusion protein. It is contemplated that the tumor-associated HLA-restricted peptide, or polypeptide may be encoded by any nucleic acid sequence that encodes the appropriate amino acid sequence.
- the design and production of nucleic acids encoding a desired amino acid sequence is well known to those of skill in the art, using standardized codon tables (Table 3). In prefe ⁇ ed embodiments, the codons selected for encoding each amino acid may be modified to optimize expression ofthe nucleic acid in the host cell of interest.
- codons that encode the same amino acid such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids. Codon preferences for various species of host cell are well known in the art. Codons prefe ⁇ ed for use in humans, are well known to those of skill in the art (Wada et.al, 1990). Codon preferences for other organisms also are well known to those of skill in the art (Wada et al, 1990, included herein in its entirety by reference)
- Prokaryote- and/or eukaryote-based systems can be used to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides.
- the present invention contemplates the use of such an expression system to produce the tumor-associated HLA- restricted peptide, or polypeptide. More specifically, the present invention employs the use of the insect cell/baculovirus system.
- the insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S.
- Patents 5,871,986, 4,879,236, both herein incorporated by reference and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH® .
- MAXBAC® 2.0 from INVITROGEN®
- BACPACKTM BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH® BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH®
- numerous expression systems exists which are commercially and widely available.
- STRATAGENE®'S COMPLETE CONTROL Inducible Mammalian Expression System which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system.
- INVITROGEN® which carries the T-REXTM (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter.
- INVITROGEN® also provides a yeast expression system called the Pichia nethanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica.
- a vector such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.
- the expression vector comprises a virus or engineered vector derived from a viral genome.
- the first viruses used as gene vectors were DNA viruses including the papovaviruses (simian virus 40, bovine papilloma virus, and polyoma) (Ridgeway, 1988; Baichwal and Sugden, 1986) and adenoviruses (Ridgeway, 1988; Baichwal and Sugden, 1986).
- papovaviruses simian virus 40, bovine papilloma virus, and polyoma
- adenoviruses Rosgeway, 1988; Baichwal and Sugden, 1986.
- Adenoviral Vectors A particular method for delivery of the nucleic acid involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. "Adenovirus expression vector” is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue or cell-specific construct that has been cloned therein.
- AAV Vectors The nucleic acid may be introduced into the cell using adenovirus assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et al, 1992; Curiel, 1994).
- Adeno-associated virus (AAV) is an attractive vector system for use in the vaccines ofthe present invention (Muzyczka, 1992).
- AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin et al, 1986; Lebkowski et al, 1988; McLaughlin et al, 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patents 5,139,941 and 4,797,368, each incorporated herein by reference.
- Retroviral Vectors have promise as gene delivery vectors in vaccines due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992).
- a nucleic acid e.g., one encoding an antigen of interest
- a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed (Mann et ⁇ /., 1983).
- Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).
- Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. Lentiviral vectors are well known in the art (see, for example, Naldini et al, 1996; Zufferey et al, 1997; Blomer et al., 1997; U.S. Patents 6,013,516 and 5,994,136). Some examples of lentivirus include the Human Immunodeficiency Viruses: HJV-1, HIV-2 and the Simian Immunodeficiency Virus: SIV.
- Lentiviral vectors have been generated by multiply attenuating the HJV virulence genes, for example, the genes env, vifi vpr, vpu and nef xe deleted making the vector biologically safe.
- Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences.
- recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No.
- a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target-specific.
- Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988; Baichwal and Sugden, 1986; Coupar et al, 1988), Sindbis virus, cytomegalovirus and herpes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989;
- a nucleic acid to be delivered may be housed within an infective virus that has been engineered to express a specific binding ligand.
- the virus particle will thus bind specifically to the cognate receptors of the target cell and deliver the contents to the cell.
- a novel approach designed to allow specific targeting of retrovirus vectors was developed based on the chemical modification of a retrovirus by the chemical addition of lactose residues to the viral envelope. This modification can permit the specific infection of hepatocytes via sialoglycoprotein receptors.
- Another approach to targeting of recombinant retroviruses was designed in which biotinylated antibodies against a retroviral envelope protein and against a specific cell receptor were used.
- the antibodies were coupled via the biotin components by using streptavidin (Roux et al, 1989). Using antibodies against major histocompatibility complex class I and class II antigens, they demonstrated the infection of a variety of human cells that bore those surface antigens with an ecotropic virus in vitro (Roux et al, 1989).
- nucleic acid delivery Suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA such as by injection (U.S.
- Patent 5,384,253, incorporated herein by reference by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al, 1990); by using DEAE- dextian followed by polyethylene glycol (Gopal, 1985); by direct sonic loading (Fechheimer et al, 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al, 1979; Nicolau et al, 1987; Wong et al, 1980; Kaneda et al, 1989; Kato et al, 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S.
- a method of treatment and prevention of cancers such as leukemia by the delivery of a tumor-associated HLA-restricted peptide, or polypeptide or expression construct is contemplated.
- cancers contemplated for treatment include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases that may be treated or prevented by a tumor-associated HLA-restricted peptides, or polypeptides ofthe present invention.
- An effective amount of the pharmaceutical vaccine composition is defined as that amount sufficient to detectably and repeatedly to ameliorate, reduce, minimize or limit the extent of the disease or condition or symptoms .thereof. More rigorous definitions may apply, including elimination, eradication or cure of disease.
- patients will have adequate bone ma ⁇ ow function (defined as a peripheral 3 3 absolute granulocyte count of > 2,000 / mm and a platelet count of 100,000 / mm ), adequate liver function (bilirubin ⁇ 1.5 mg / dl) and adequate renal function (creatinine ⁇ 1.5 mg / dl).
- HLA-Restricted Vaccine Administration To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size and otherwise reverse or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one would generally contact a cancer cell with the therapeutic compound such as a polypeptide or an expression construct encoding a polypeptide.
- the routes of administration will vary, naturally, with the location and nature of the lesion, and include, e.g., intradermal, transdermal, parenteral, intravenous, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intratumoral, perfusion, lavage, direct injection, and oral administration and formulation.
- any of the formulations and routes of administration discussed with respect to the treatment or diagnosis of cancer may also be employed with respect to neoplastic diseases and conditions.
- Intratumoral injection, or injection into the tumor vasculature is specifically contemplated for discrete, solid, accessible tumors.
- Local, regional or systemic administration also may be appropriate.
- the volume to be administered will be about 4-10 ml (preferably 10 ml), while for tumors of ⁇ 4 cm, a volume of about 1-3 ml will be used (preferably 3 ml).
- Multiple injections delivered as single dose comprise about 0.1 to about 0.5 ml volumes.
- the viral particles may advantageously be contacted by administering multiple injections to the tumor, spaced at approximately 1 cm intervals.
- the present invention may be used preoperatively, to render an inoperable tumor subject to resection.
- the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease.
- a resected tumor bed may be injected or perfused with a formulation comprising a tumor-associated HLA restricted peptide or construct encoding therefor.
- the perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery.
- Periodic post-surgical treatment also is envisioned.
- Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is prefened.
- Such continuous perfusion may take place for a period from about 1-2 hr, to about 2-6 hr, to about 6-12 hr, to about 12-24 hr, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment.
- the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs.
- limb perfusion may be used to administer therapeutic compositions of the present invention, particularly in the treatment of melanomas and sarcomas. Treatment regimens may vary as well, and often depend on tumor type, tumor location, disease progression, and health and age of the patient.
- the tumor being treated may not, at least initially, be resectable.
- Treatments with therapeutic viral constructs may increase the resectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection will serve to eliminate microscopic residual disease at the tumor site.
- a typical course of treatment, for a primary tumor or a post-excision tumor bed, will involve multiple doses. Typical primary tumor treatment involves a 6 dose application over a two-week period. The two-week regimen may be repeated one, two, three, four, five, six or more times. During a course of treatment, the need to complete the planned dosings may be re- evaluated.
- the treatments may include various "unit doses." Unit dose is defined as containing a predetermined-quantity ofthe therapeutic composition.
- Unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time.
- Unit dose of the present invention may conveniently be described in terms of 3 4 5 6 7 plaque forming units (pfu) for a viral construct. Unit doses range from 10 , 10 , 10 , 10 , 8 9 10 11 12 13
- compositions and Formulations One method for the delivery of a pharmaceutical according to the present invention is systemically.
- the pharmaceutical compositions disclosed herein may alternatively be administered parenterally, intravenously, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Patent 5,543,158; U.S. Patent 5,641,515 and U.S. Patent
- Injection of pharmaceuticals may be by syringe or any other method used for injection of a solution, as long as the agent can pass through the particular gauge of needle required for injection.
- a novel needleless injection system has been described (U.S. Patent 5,846,233) having a nozzle defining an ampule chamber for holding the solution and an energy device for pushing the solution out of the nozzle to the site of delivery.
- a syringe system has also been described for use in gene therapy that permits multiple injections of predetermined quantities of a solution precisely at any depth (U.S. Patent 5,846,225).
- Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
- polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
- Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- the prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like, hi many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.
- the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
- aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral and intraperitoneal administration.
- sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure.
- one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermolysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences” 15th Edition, pages 1035- 1038 and 1570-1580).
- Some variation in dosage will necessarily occur depending on the condition of the subject being treated.
- the person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
- Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
- compositions disclosed herein may be formulated in a neutral or salt form.
- Pharmaceutically-acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
- inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like.
- Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium,
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
- the use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.
- phrases "pharmaceutically-acceptable” or “pharmacologically-acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
- the preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art.
- such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.
- the compounds and methods of the present invention may be used in the context of neoplastic diseases/conditions including cancer.
- Types of diseases/conditions contemplated to be treated with the peptides of the present invention include, but are not limited to leukemias such as, AML, MDS and CML.
- cancers may include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other neoplastic diseases, hi order to increase the effectiveness of a treatment with the tumor-associated HLA-restricted compositions of the present invention, such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor, it may be desirable to combine these compositions with other agents effective in the treatment of those diseases and conditions.
- HLA-restricted compositions of the present invention such as Pr3 or MYO peptide, polypeptide, protein, or expression construct coding therefor
- the treatment of a cancer may be implemented with therapeutic compounds of the present invention and other anti-cancer therapies, such as anti-cancer agents or surgery.
- anti-cancer therapies such as anti-cancer agents or surgery.
- Various combinations may be employed; for example, the tumor-associated HLA- restricted peptide is "A” and the secondary anti-cancer is "B":
- an "anti-cancer” agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer.
- Anti-cancer agents include biological agents (biotherapy), chemotherapy agents, and radiotherapy agents. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell.
- This process may involve contacting the cells with the expression construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the expression construct and the other includes the second agent(s).
- Tumor cell resistance to chemotherapy and radiotherapy agents represents a major problem in clinical oncology.
- One goal of cu ⁇ ent cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy.
- the herpes simplex-thymidine kinase (HS-tK) gene when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver et al, 1992).
- ganciclovir the antiviral agent
- tumor-associated HLA- restricted peptide therapy could be used similarly in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic or other biological intervention, in addition to other pro- apoptotic or cell cycle regulating agents.
- the gene therapy may precede or follow the other agent treatment by intervals ranging from minutes to weeks, hi embodiments where the other agent and expression construct are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and expression construct would still be able to exert an advantageously combined effect on the cell.
- one may contact the cell with both modalities within about 12- 24 h of each other and, more preferably, within about 6-12 h of each other.
- Chemotherapy Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments.
- Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine and methotrexate, Temazolomide (an aqueous form of DTIC), or any analog or derivative variant of the foregoing.
- CDDP
- Radiotherapy Other factors that cause DNA damage and have been used extensively include what are commonly known as ⁇ -rays, X-rays, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV- i ⁇ adiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens.
- Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.
- the terms "contacted” and “exposed,” when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.
- Immunotherapeuti.es generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells.
- the immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell.
- the antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing.
- the antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent.
- the effector may be a lymphocyte ca ⁇ ying a surface molecule that interacts, either directly or indirectly, with a tumor cell target.
- cytotoxic T cells include cytotoxic T cells and NK cells.
- therapeutic modalities i.e., direct cytotoxic activity and inhibition or reduction of Fortilin would provide therapeutic benefit in the treatment of cancer.
- Immunotherapy could also be used as part of a combined therapy. The general approach for combined therapy is discussed below.
- the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention.
- Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and pl55.
- An alternative aspect of immunotherapy is to anticancer effects with immune stimulatory effects.
- Immune stimulating molecules also exist including: cytokines such as IL-2, IL-4, IL-12, GM-CSF, gamma-IFN, chemokines such as MJP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand.
- immune stimulating molecules either as proteins or using gene delivery in combination with a tumor suppressor such as mda-7 has been shown to enhance anti-tumor effects (Ju et al. , 2000).
- immunotherapies currently under investigation or in use are immune adjuvants (e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds) (U.S. Patent 5,801,005; U.S.
- cytokine therapy e.g., interferons, and; IL-1, GM-CSF and TNF
- gene therapy e.g., TNF, IL-1, IL-2, p53
- Patent 5,846,945 and monoclonal antibodies (e.g., anti- ganglioside GM2, anti-HER-2, anti- ⁇ l85) (Pietras et al, 1998; Hanibuchi et al, 1998; U.S. Patent 5,824,311).
- Herceptin trastuzumab
- Herceptin is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor. It possesses anti-tumor activity and has been approved for use in the treatment of malignant tumors (Dillman, 1999). Combination therapy of cancer with herceptin and chemotherapy has been shown to be more effective than the individual therapies.
- one or more anti-cancer therapies may be employed with the tumor- associated HLA-restricted peptide therapies described herein.
- Adoptive Immunotherapy hi adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL-2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al, 1988; 1989). To achieve this, one would administer to an animal, or human patient, an immunologically effective amount of activated lymphocytes in combination with an adjuvant-incorporated antigenic peptide composition as described herein.
- the activated lymphocytes will most preferably be the patient's own cells that were earlier isolated from a blood or tumor sample and activated (or "expanded") in vitro.
- This form of immunotherapy has produced several cases of regression of melanoma and renal carcinoma, but the percentage of responders were few compared to those who did not respond.
- Passive Immunotherapy A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.
- human monoclonal antibodies are employed in passive immunotherapy, as they produce few or no side effects in the patient.
- their application is somewhat limited by their scarcity and have so far only been administered intralesionally.
- Human monoclonal antibodies to ganglioside antigens have been administered intralesionally to patients suffering from cutaneous recurrent melanoma (hie & Morton, 1986). Regression was observed in six out of ten patients, following, daily or weekly, intralesional injections. In another study, moderate success was achieved from intralesional injections of two human monoclonal antibodies (hie et al. , 1989). It may be favorable to administer more than one monoclonal antibody directed against two different antigens or even antibodies with multiple antigen specificity.
- Treatment protocols also may include administration of lymphokines or other immune enhancers as described by Bajorin et al. (1988). The development of human monoclonal antibodies is described in further detail elsewhere in the specification.
- Active Immunotherapy hi active immunotherapy an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine” is administered, generally with a distinct bacterial adjuvant (Ravindranath and Mitchell et al, 1990; Mitchell et al, 1993).
- melanoma immunotherapy those patients who elicit high IgM response often survive better than those who elicit no or low IgM antibodies (Morton et al, 1992).
- the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as the tumor- associated HLA-restricted peptide is administered. Delivery of a vector encoding a the tumor- associated HLA-restricted peptide in conjunction with a second vector encoding one of the following gene products will have a combined anti-hyperproliferative effect on target tissues. Alternatively, a single vector encoding both genes may be used. A variety of proteins are encompassed within the invention, some of which are described below.
- genes that may be targeted for gene therapy of some form in combination with the present invention are will known to one of ordinary skill in the art and may comprise any gene involved in cancers.
- Inducers of Cellular Proliferation The proteins that induce cellular proliferation further fall into various categories dependent on function. The commonality of all of these proteins is their ability to regulate cellular proliferation.
- a form of PDGF the sis oncogene
- Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor.
- anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression ofthe inducer of cellular proliferation.
- the proteins FMS, ErbA, ErbB and neu are growth factor receptors. Mutations to these receptors result in loss of regulatable function. For example, a point mutation affecting the transmembrane domain of the Neu receptor protein results in the neu oncogene.
- the erbA oncogene is derived from the intracellular receptor for thyroid hormone.
- the modified oncogenic ErbA receptor is believed to compete with the endogenous thyroid hormone receptor, causing uncontrolled growth.
- the largest class of oncogenes includes the signal transducing proteins (e.g., Src, Abl and
- the protein Src is a cytoplasmic protein-tyrosine kinase, and its transformation from proto-oncogene to oncogene in some cases, results via mutations at tyrosine residue 527.
- transformation of GTPase protein ras from proto-oncogene to oncogene results from a valine to glycine mutation at amino acid 12 in the sequence, reducing ras GTPase activity.
- the proteins Jun, Fos and Myc are proteins that directly exert their effects on nuclear functions as transcription factors. ii) Inhibitors of Cellular Proliferation The tumor suppressor oncogenes function to inhibit excessive cellular proliferation.
- the inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation.
- the tumor suppressors p53, pi 6 and C-CAM are described below.
- another inhibitor of cellular proliferation is pi 6.
- the major transitions of the eukaryotic cell cycle are triggered by cyclin-dependent kinases, or CDK's.
- CDK cyclin-dependent kinase 4
- the activity of this enzyme may be to phosphorylate Rb at late G .
- CDK4 The activity of CDK4 is controlled by an activating subunit, D-type cyclin, and by an inhibitory subunit, the p 16IN 4 nas ⁇ een biochemically characterized as a protein that specifically binds to and inhibits CDK4, and thus may regulate Rb phosphorylation (Se ⁇ ano et al, 1993; Se ⁇ ano et al, 1995). Since the pl ⁇ 1 ⁇ 4 protein is a CDK4 inhibitor (Se ⁇ ano, 1993), deletion of this gene may increase the activity of CDK4, resulting in hyperphosphorylation of the Rb protein, pi 6 also is known to regulate the function of CDK6.
- pl6fNK4 belongs to a newly described class of CDK-inhibitory proteins that also includes pl6 B , pl9, p21 WAF1 , and p27 KIP1 .
- the pl ⁇ 4 gene maps to 9p21, a chromosome region frequently deleted in many tumor types. Homozygous deletions and mutations ofthe pl ⁇ N ⁇ g ene ⁇ XQ frequent in human tumor cell lines. This evidence suggests that the pl ⁇ 4 g ene 1S a tumor suppressor gene.
- genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1 / PTEN, DBCCR-1, FCC, rsk-3, p27, p27/ ⁇ l6 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, rafi erb, fi ⁇ s, trk, ret, gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.
- angiogenesis e.g., VEGF, FGF, thrombospondin, BA
- Regulators of Programmed Cell Death Apoptosis, or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al, 1972).
- the Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be important regulators and effectors of apoptosis in other systems.
- the Bcl-2 protein plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al, 1985; Cleary and Sklar, 1985; Cleary et al, 1986; Tsujimoto et al, 1985; Tsujimoto and Grace, 1986).
- the evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists. Subsequent to its discovery, it was shown that Bcl-2 acts to suppress cell death triggered by a variety of stimuli.
- Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl-2 (e.g., Bcl ⁇ L, Bcf y, Bclg, Mcl-l, Al, Bfl-1) or counteract Bcl-2 function and promote cell death (e.g., Bax,
- Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies. Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery).
- the present invention may be used in conjunction with removal of superficial cancers, precancers, or incidental amounts of normal tissue.
- a cavity may be formed in the body.
- Treatment may be accomplished by perfusion, direct injection or local application ofthe area with an additional anti-cancer therapy.
- Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months.
- These treatments may be of varying dosages as well.
- PBMCs from untreated CML patients or from patients receiving IFN were collected and cryopreserved for later analysis.
- CM complete medium
- AB heat-inactivated pooled human AB serum
- DMSO heat-inactivated pooled human AB serum
- High-resolution HLA testing was performed by the HLA Laboratory at MD. Anderson Cancer Center. Peptide synthesis.
- PRl (aa 169-177) peptide (VLQELNVTV (SEQ ID NO:l)) was synthesized by Bio-Synthesis (Lewisville, Texas, USA), and the HLA-A2-restricted CMV pp65 peptide (NLVPMVATV (SEQ ID NO:2)) was synthesized by the MD. Anderson Protein and Nucleic Acid Facility, both to a minimum of 95% purity. Cell lines and peptide binding. T2 cells (American Type Culture Collection, Rockville, Maryland, USA) were maintained in culture in CM plus 10% FBS (Atlanta Biologicals Inc., Norcross, Georgia, USA).
- PRl peptide was incubated at increasing concentrations for 18 hr at 37°C with 100 /xg/ml ⁇ 2 m (Sigma-Aldrich) with 10 6 T2 cells in 1 ml CM. Cells were washed twice with CM, stained with BB7.2 Ab, washed again, and then stained with FITC-labeled secondary Ab (Becton Dickinson Immunocytometry Systems, San Jose, California, USA). HLA-A*0201 expression was. measured by FACS. Peptide-specific CTLs were expanded in culture using methods described previously (Molldrem et al, 1996; Molldrem et al, 1997).
- PBMCs from healthy donors or CML patients were stimulated in vitro with PRl, pp65, or flu peptides.
- T2 cells were washed three times in serum-free CM and incubated with peptide at the indicated peptide concentration for 2 hr in CM.
- the peptide-loaded T2 cells were then irradiated with 7,500 cGy, washed once, and suspended with freshly isolated PBMCs at a 1:1 to a 1:2 ratio in CM supplemented with 10% AB.
- rhIL-2 recombinant human interleukin-2
- a third stimulation was performed, followed on day 15 by addition of rhIL-2.
- a fourth stimulation was performed on day 21, followed on day 22 by the addition of rhIL-2.
- the peptide- stimulated T cells were obtained and tested for peptide-specific and leukemia-specific cytotoxicity as well as for phenotypic analyses. Tetramer synthesis. Production of MHC/peptide tetramers was described in detail elsewhere (Altman et al, 1996; Molldrem, 2000). Briefly, a 15-amino acid substrate peptide (BSP) for BirA-dependent biotinylation has been engineered onto the COOH terminus of HLA- A2.
- BSP 15-amino acid substrate peptide
- the A2-BSP fusion protein and human /3 m were expressed in Escherichia coli and were folded in vitro with the specific peptide ligand.
- the properly folded MHC-peptide complexes were extensively purified using FPLC and anion exchange and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, Colorado, USA). Tetramers were produced by mixing the biotinylated MHC-peptide complexes with phycoerythrin-conjugated (PE-conjugated) Neutravidin (Molecular Probes Inc., Eugene, Oregon, USA) at a molar ratio of 4:1.
- PE-conjugated phycoerythrin-conjugated
- Neutravidin Molecular Probes Inc., Eugene, Oregon, USA
- PRl tetramers were validated by staining against a CTL line specific for PRl.
- CMV tetramers were validated by staining PBMCs from a CMV-immune individual. Ab's and flow cytometry. For routine surface-antigen staining, 10 6 PBMCs were incubated at 4°C with Ab. After washing, cells were incubated with FITC-labeled CD8 (Caltag Laboratories hie, Burlingame, California, USA) for 30 min on ice. Surface expression of TCR was determined with FITC-labeled TCR-a ⁇ (PharMingen, San Diego, California, USA), and annexin V using FITC-labeled Ab (Caltag Laboratories).
- Proteinase 3 expression was determined with primary mouse Ab (Accurate Chemical & Scientific Corp., Westbury, New York, USA).
- Mouse monoclonal anti-HLA-A2.1 Ab BB7.2 and anti-HLA-ABC w6/32 were derived from culture supematants of a hybridoma cell lines (American Tissue Culture Collection). Cells were washed and fixed in 2% paraformaldehyde and analyzed on a FACScan (Becton Dickinson Immunocytometry Systems), and data were analyzed using CELLQuest (Becton Dickinson Immunocytometry Systems) software. The minimum concentration of tetramer necessary to show distinctly different avidities was determined in titration experiments.
- tetramer reagent was titered individually and used at the optimal concentration.
- the tetramer concentration showing the maximal separation of fluorescence intensity of CTL populations was generally 10-20 ⁇ g/ml.
- Propidium iodide (PI) (Becton Dickinson Immunocytometry Systems) staining (1 ⁇ g/ml) was performed to exclude dead cells, according to the manufacturer's instructions.
- a "dump" channel was used with tetramer staining to eliminate monocytes and B lymphocytes with nonspecific binding to the HLA-A2 heavy chain by staining with PerCP-labeled CD 14 and CD 19 (both Becton Dickinson Immunocytometry Systems).
- T cells were stained for 45 min with PR1/HLA-A2 tetramer, washed, and cooled to 4°C. To prevent rebinding of tetramer, cells were incubated in the presence of PI (1 ⁇ g/ml) with saturating amounts of BB7.2 Ab, and flow cytometry was used to measure fluorescence decay at 10-min intervals. A constant number of CD8 + events was acquired at each time point.
- a semiautomated minicytotoxicity assay was used to determine specific lysis as described previously (Molldrem, 2000; Molldrem et al, 1996). Briefly, effector cells were prepared in doubling dilutions from 6 x 10 3 to 25 x 10 3 cells/well and were plated in 40 ⁇ l, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, California, USA) with six replicates per dilution.
- Target cells T2 cells, ma ⁇ ow-derived leukemic cells, or BM from a healthy donor
- Calcein-AM Molecular Probes Inc.
- target cells were resuspended at 10 5 cells/ml, and 10 3 target cells in 10 ⁇ l medium were added to each well containing effector cells.
- Wells with target cells alone and medium alone were used for maximum (max) and minimum (min.) fluorescence emission, respectively.
- PBMC peripheral blood mononuclear cells
- CTLf cytotoxic T lymphocyte precursor frequency
- the amount of Proteinase 3 expression in the leukemia cells is studied by cytoplasmic flow cytometry analysis. Any clinical responses (defined by standard criteria as hematological and/or cytogenetic responses) will be co ⁇ elated with the in vitro testing. Vaccination at 3 dose levels of peptide with a fixed amount of IFA will be conducted, and stopping criteria will be guided by established toxicity criteria. Phase I. hi Phase I of this study, patients are assigned to three escalating peptide dose levels starting with dose level 1. Patients are followed in dose cohorts of size 3 for signs of dose limiting toxicity.
- Patients are assigned to the next highest dose level cohort only if no more than 1 of the 3 patients at any time at any dose level has > grade 3 non-hematological toxicity or autoimmune phenomena (i.e., dose limiting toxicity).
- the first patient entered must complete two ofthe three vaccinations prior to initiation ofthe second patient in that cohort at that dose level.
- the first patient in each dose cohort must complete all vaccinations and the second patient must complete at least two vaccinations prior to initiation of vaccination in the third patient.
- the next dose level will accrue patients in a similar manner.
- Phase II ofthe study will be conducted according to a continuous reassessment statistical model. Up to 60 patients will be randomized among three dose levels, with a maximum of 20 patients per dose level. Only those dose levels without dose limiting toxicity as determined in Phase I of this study will be examined in Phase II. Both toxicity and efficacy will be determined as primary endpoints. Patients will be monitored in cohorts of size 4, and all patients in any cohort will be observed for at least 2 weeks from the first dose ofthe last patient in the group in the absence of grade III or IV non-hematological toxicity before continuing to the next cohort. Toxicity information will be carefully accrued using established.
- grade III or TV non-hematological toxicity is observed during the 9 week study period in 2 ofthe first 4 patients (the first cohort), 3 of the first 8, 4 of the first 12, or 5 of the first 16 in any of the three dose groups, then that dose level will be terminated and patients will be treated only on the remaining dose levels. Moving to the next cohort will occur only if dose-limiting toxicity is not reached in the number of patients defined above for each cohort. There will be a two-week observation period before the next vaccination will be given in any patient that experiences grade II non-hematological toxicity ⁇ dose limiting toxicity. If the toxicity decreases to grade I or less within those two weeks, the patient will be given the next vaccination.
- grade II toxicity does not decrease to grade I or less within two weeks, the patient will be taken off protocol (removed from study). Any grade toxicity that provides clear evidence of an autoimmune reaction will be considered a dose limiting toxicity. Such a reaction will preclude further administration of peptide under this protocol, and the study will be terminated. If there is evidence that vaccine administration has produced a Wegener's-like vasculitis or inflammatory disease, then the study will be terminated. Efficacy, defined as an immune response to PRl vaccine, will also be determined as a primary endpoint of the study. If none of the first 12 patients have an immune response at a particular dose level, then that dose level will be terminated. Patients will not be retreated in this protocol after the required 3 immunizations, nor will the dose be escalated beyond 1.0 mg of
- the maximal tolerated dose is defined as the highest peptide dose that does not cause dose-limiting non-hematological toxicity beyond the allowable number of patients stated for each phase at each dose level cohort (dose limiting toxicity).
- the MTD will be determined in either Phase I or Phase II of this study if: (1) dose-limiting toxicity is reached in more than 1 patient of 3 at each dose level cohort in Phase I, or (2) if dose-limiting non-hematological toxicity is exceeded in 3 ofthe first 8, 4 ofthe first 12, or 5 ofthe first 16 in any ofthe three dose groups in Phase II.
- lymphocytes from HLA-matched allogeneic normal donors exert a powerful graft-versus-leukemia (GVL) effect when used to treat patients with myeloid leukemia (Drobyski et al, 1994; Horowitz et al, 1996).
- Donor lymphocyte infusions (DLI) alone when administered to patients that have relapsed after allogeneic bone ma ⁇ ow transplantation (BMT) can cure patients with myeloid leukemia (Collins et al, 1997; Kolb and Holler, 1997).
- graft- versus-host disease GVHD
- the GVL and GVHD target antigens of these lymphocytes are largely unknown.
- GVL may be enhanced and GVHD eliminated after DLI if (1) antigens that were the favored targets of
- GVL are known and (2) an efficient ex vivo process for enrichment of GVL-causing lymphocytes based on antigen specificity is developed.
- high and low affinity PRl-specific CTL can be expanded from normal donors ex vivo and then enriched using antigen-coated microbeads for transfer to myeloid leukemia patients, in place of conventional DLI, in order to deliver GVL without GVHD.
- Methods to more efficiently generate PRl -CTL, enrich high affinity PRl -CTL using microbeads, and expand selected PRl -CTL ex vivo for adoptive immunotherapy were also investigated. Methodology.
- PRl peptide was combined into the binding region ofthe HLA-A2 heavy chain, and the resulting protein folded with ⁇ 2 -microglobulin and attached the resulting PR1/HLA-A2 monomer onto 50 nm magnetic microbeads (Miltenyi Co.) (Wang et al, 2000). To do this, the technology used was adapted to assemble PR1/HLA-A2 tetramers, where heavy chain monomers are biotinylated at the C terminus and combined in a 4:1 molar ratio with streptavidin, which has in turn been conjugated to phycoerythrin (PE).
- PE phycoerythrin
- the PRl monomer- conjugated microbeads can then be passed through a sterile column that is su ⁇ ounded by a magnet that traps microbead-adherent T cells. After the non-adherent cells pass through the column, the column is removed from the magnet and the PRl-specific T cells attached to the microbeads can be collected.
- This method allows for the selection of PRl-specific T cells, which could be further expanded and given to patients with myeloid leukemia to facilitate GVL without GVHD. Determining the most efficient in vitro method for short-term expansion of PRl antigen-specific T lymphocytes. The results show that PRl-specific cytotoxic T lymphocytes (CTL) are present at frequencies from 1/15,000 to 1/300,000 in normal donors.
- CTL cytotoxic T lymphocytes
- the PRl-specific CTL will first be expanded so enough cells are available for subsequent enrichment by magnetic bead separation.
- the efficiency of antigen presenting cells (APC) produced by different methods to expand short-term polyclonal PRl-specific CTL will be compared.
- Peripheral blood mononuclear cells (PBMC) as APC, will be compared to dendritic cells (DC) derived from peripheral blood monocytes after a 2-hr adherence step.
- One week-old DC will be derived after incubating adherent cells from the same healthy HLA-A2+ donors with either 10 ng/ml IL-4 + 1000 U/ml GM-CSF or 1000 U/ml IFN- ⁇ + 1000 U/ml GM-CSF (Verdijk et al, 1999; Santini et al, 2000).
- the resulting APC will be pulsed weekly with PRl at 10 ⁇ g/ml plus IL-2 at 20 U/ml and combined with responder PBMC in ratios from 1:1 to 1:20.
- APC will be compared to standard T2 cells, a cell line unable to present endogenous antigens due to TAP 1/2 deficiency and can only present peptides pulsed onto the cell surface (Salter and Cresswell, 1986).
- Preliminary studies using T2 cells as peptide-pulsed APCs expanded the PRl-specific CTL to between 2% to 8% ofthe total lymphocyte culture by 28 days (Molldrem et al, 2000).
- the APC methodology described above will also be compared to the results obtained from pulsing D ⁇ osoph ⁇ la melanogaster S2 cells with PRl peptide (Janetzki et al, 2000).
- S2 cells have been transfected with the HLA-A2.1 heavy chain, ⁇ -2M, ICAM-1, and the co-stimulatory molecule B7.1. By pulsing peptides on the surface of transfected S2, these cells have demonstrated the ability to act as efficient APC during the critical first round of peptide antigen stimulation of CTL in vitro.
- the advantages of using S2 cells as an APC population is that they can be propagated at room temperature and subsequently require low maintenance, a critical element for eventual clinical application.
- the resulting PRl-specific CTL will be quantified and characterized using the PR1/HLA-A2 tetramer in combination with antibodies to CD8, CD69, HLA-DR, CD25, LFA-1, CD54, CD2, intracellular ⁇ -interferon, and CD45(RO) conjugated to different fluorochromes (Molldrem et al, 1999; Molldrem et al, 2000). Cells will subsequently be analyzed using a MoFlo cytometer capable of simultaneous 10-color cytofluorometric analysis.
- Efficiency of the various APC conditions can be directly compared by quantifying PRl-specific CTL using the tetramer and the other markers will allow comparison of activation state, functional state and memory phenotype.
- TCR T cell receptor
- Beads will be conjugated with PRl plus HLA-A2 through the biotin-labeled C-terminus of the heavy chain (Wang et al, 2000).
- PRl-pulsed short-term CTL lines will be incubated for 30 min with PR1/HLA-A2 coated microbeads and selected using the MACSTM magnetic column.
- Bead-selected and non-selected CTL will be quantified by flow cytometry using the PRl HLA- A2 tetramer and compared to the starting polyclonal CTL lines. It is estimated that yields will range from 85% to 100% and PRl-specific CTL purity will range from 11 ) to 21 ) after the selection process (i.e.
- the method to select the highest affinity PRl-specific CTL will be optimized using different ratios of PR1/HLA-A2 monomers, microbeads, and starting cell populations to achieve the highest yield and greatest purity of high affinity PRl-specific CTL.
- lymphocytes separated using PR1/HLA-A2 monomer-coated microbeads, can be expanded to a sufficient number for use in adoptive immunotherapy of myeloid leukemia. It is estimated that from 1 to 5 x 10 6 CTL may be needed to treat patients with relapsed leukemia after BMT (Mackinnon et al, 1995).
- the requirement of a leukapheresis product may be reduced to as little as 100 ml of peripheral blood.
- it will be determined whether the bead-enriched PRl-specific CTL can be further expanded in short term culture. Two methods will be directly compared: the optimized technique, as determined previously, will be used to expand PRl -CTL by weekly restimulation with PRl -coated APCs, versus a non-specific method.
- Anti-CD3 + anti-CD28 coated Dynal beads will be coincubated with the bead-enriched PRl-specific CTL in culture media containing varying doses of IL-2 (Garlie et al, 1999; Levine et al, 1998). In controlled experiments, other cytokines such as IL- 12 and interferon will be supplemented in order to optimize the number of PRl -CTL (Fallarino et al, 1996). PRl -specificity will be confirmed at the end of culture using PR1/HLA-A2 tetramers and CTL functional activity will be ascertained using standard cytotoxicity experiments against PRl -coated T2 cells and HLA-A2+ leukemia cell targets.
- non-specific expansion of CTL (with anti-CD3 and anti-CD28) is found to be efficient and can maintain PRl-specific CTLs, then this method will also be tested PRl or to bead selection and compared to the PRl-specific expansion method described above. This may eliminate the requirement for further CTL expansion after bead enrichment.
- These methods once optimized, can be easily transfe ⁇ ed to the clinical setting to treat patients with myeloid leukemia using a Miltenyi MACSTM magnetic bead system to select CD34 + progenitor cells from marrow donors for clinical use. Furthermore, these methods may be used to select CTL with different specificities for other tumor antigens, minor antigens, and viral antigens.
- Such CTL may be elicited and selected in a single step and adoptively transferred using the methods described herein. Based on the techniques described herein efficient clinical scale-up procedures will be determined for adoptive transfer of antigen-specific T lymphocytes.
- EXAMPLE 4 PRELIMINARY STUDIES
- HLA-A2.1 Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAPl and TAP2 genes and therefore cannot present endogenous MHC class I restricted antigens. If the peptide effectively bound HLA-A2.1, it stabilized the complex with ( ⁇ 2-microglobulin and increased HLA-A2.1 surface expression, which could be measured using flow cytometry.
- HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CalTag Laboratories, Burlingame, CA) was used to measure surface expression of HLA-A2.1.
- the dissociation rate of I 125 -labeled ( ⁇ 2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and ⁇ 2-microglobulin was measured, which allowed calculation of binding half-life (Tm)-
- the labeled heterotrimer complex was separated from unincorporated ( ⁇ 2-microglobulin by high-performance liquid chromatography gel filtration, and the half-time of dissociation of ⁇ 2-microglobulin was determined by subjecting aliquots ofthe complex to a second round of gel filtration. Both PRl and PR2 showed increased surface HLA-A2.1 expression compared with T2 cells with no added peptide, as the background for HLA-A2.1 expression, (Table 5).
- the control influenza peptide is an Influenza B nucleoprotein (aa 85-94; Flu), and Tax is an HTLV-1 peptide (aa 11-19), both with known high binding affinity to HLA-A2.1.
- T2 cells which co-express the costimulatory molecule B7.1
- CM penicillin/streptomycin and glutamine
- the peptide loaded T2 cells were then i ⁇ adiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1:1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO). After 7 days in culture, a second stimulation was performed and the following day, 60 IU/mL of recombinant human interleukin-2 (rhIL2) (Biosource International, Camarillo, CA) was added. After 14 days in culture a third stimulation was performed, followed on day 15 by addition of rhIL-2. A fourth stimulation was performed on day 21 followed on day 22 by the addition of rhIL2.
- rhIL2 human interleukin-2
- FIG. 1 shows the peptide-specific lysis ofthe CTL lines against T2 cells loaded with either 1.0 ⁇ g/mL of PRl or PR-2, or T2 cells without added peptide, at varying effector to target (E:T) ratios.
- E:T effector to target
- Cytotoxicity toward T2 cells loaded with HTLV-1 tax (aa 11-19), an irrelevant peptide with high binding affinity to HLA-A2.1, was also measured (data not shown) and resulted in ⁇ 20% specific lysis at E:T ratios of 50:1 by CTL specific for either PRl or PR-2.
- CTL response toward PRl was shown to be specific for target cells expressing the HLA- A2.1 molecule. This and the cytotoxicity observed was HLA-A2.1 -restricted.
- PRl specific CTL preferentially lyse human myeloid leukemia cells. It was next determined whether the PRl-specific CTL line was capable of lysing allogeneic human myeloid leukemia cells from HLA-A2.1 positive individuals.
- Table 6 lists the HLA type and leukemia type of target cells used. As controls, two cell lines expressing low levels of Pr3 were used: HLA-A2.1 transfected K562 cells and U937 cell line which lack HLA-A2.1 and would therefore be incapable of presenting peptides in an HLA-A2.1 -restricted manner. Cryopreserved bone marrow cells from patients P1-P4, and ma ⁇ ow cells from a healthy normal volunteer (D2, a bone marrow donor for an allogeneic bone ma ⁇ ow transplant performed on patient P3) were thawed and used as targets for the PRl-specific CTL line. FIG. 2 shows the combined results of three separate experiments from three PRl-specific
- FIG. 2A the specific lysis by PRl-specific CTL, at various E:T ratios, of either U937 cells, HLA-A2.1 -transfected K562 cells, or T2 cells with or without exogenously added PRl peptide at 1.0 ⁇ g/mL is shown.
- the specific lysis of U937 and HLA-A2.1 -positive K562 cells by PRl-specific CTL was lower than the background lysis observed against T2 cells without added peptide (Molldrem et al, 1996).
- FIG. 2B demonstrates the cytotoxicity of the CTL line against HLA-A2.1 -positive human myeloid leukemia cells.
- Marrow cells from three patients with CML (P 1, P2, and P3) as well as one patient with AML M4 (P4) were readily lysed, with 53% specific lysis against PI (a patient with CML in chronic phase) at an E:T ratio of only 6:1 (Molldrem et al, 1996).
- Marrow cells taken from a normal healthy donor (D2) demonstrate only background lysis ( ⁇ 20% lysis), similar to that of the control T2 cells without added PRl peptide.
- PBMC peripheral blood monouclear cells
- CML-CP chronic myelogenous leukemia, chronic phase
- CML-AP chronic myelogenous leukemia, accelerated phase
- CML-BC chronic myelogenous leukemia, blast crisis
- MDS RAEB - myelodysplastic syndrome, refractory anemia with excess of blasts.
- Prl specific CTL was found to preferentially inhibit colony forming units in leukemia patient samples, but not in normal donor samples (Molldrem et al, 19997).
- CFU-GM Cell contact was found to be required for inhibition of CFU-GM, and inhibitory factors elaborated into the supernatant by CTL1 effector cells were not responsible for colony inhibition (Molldrem et al, 1997). Inhibition of CML CFU-GM correlates with Pr3 overexpression in target cells. Target cells were examined for cytoplasmic Pr3 expression by flow cytometry. After permeabilizing the cell membrane, indirect staining was performed using an antibody to Pr3 and a second FITC-labeled antibody, followed by flow cytometry. Table 7 lists the perentage of cells in the sample population that stain positive for Pr3 and the median fluorescence intensity of intracellular Pr3 staining.
- Pr3 is highly expressed in leukemia but not in normal CD34 cells.
- ma ⁇ ow was collected from patients. Ma ⁇ ow was obtained from a patient with CML in BC (P3), and normal CD34 cells for comparison were obtained from G-CSF mobilized peripheral blood mononuclear cells from a normal donor (D3). Cells were first labeled with PE conjugated anti-CD34 antibody (Becton Dickinson, San Jose, CA), followed by cytoplasmic indirect staining for Pr3. The inventors have shown that CML blasts that were CD34 positive and highly expressed Pr3 as compared to CD34 negative blasts and normal CD34 positive cells.
- HMy2.CIR-A2 The parental HMy2.CIR cell line, which has lost expression of HLA-A and -B, and the HLA-A2.1 -transfected HMy2.CIR cells (named HMy2.CIR-A2), were both transfected with Pr3 as described below.
- the previously published DNA sequence encoding Pr3 was used to design primers for cloning the cDNA from a normal bone marrow sample (Sturrick et al, 1992). RNA was extracted from normal donor bone ma ⁇ ow cells using the RNA ST AT solution (Teltest). One microgram of RNA was reversed transcribed into cDNA using a RT PCR kit (Perkin-Elmer, Norwalk, CT).
- telomere sequence was then amplified using the primers Pr3C-F 5'- CTGGACCCCACCATGGCTCA-3' (SEQ JD NO: 12) which included the ATG start codon, and Pr3C-R 5'-CGCCACAGTGTTCGGGGAAG-3' (SEQ JD NO:13) and a high-fidelity polymerase (Takara, Madison, WI) according to the manufacturer instructions.
- the PCR product was cloned into the pCR2 vector using the TA cloning kit (Invitrogen, Carlsbad, CA) and then subcloned into the mammalian expression vector pCDNA3.1 (Invitrogen) containing the CMV promoter and the Zeocin resistance marker.
- the resulting plasmid DNA was named pRTZ.2.
- Ten million HMy2.CIR (ATCC, Rockville, MD), or 10 million HMy2.CIR-A2 cells were each washed in phosphate buffered saline (PBS) and re-suspended in 0.8 mL of ice-cold PBS and put into an electroporation cuvette with 20 ⁇ g of circular plasmid DNA. The mixture was exposed to an electric pulse of 320 volts at 960 microF and incubated on ice for 10 min. Cells were then added to 10 mL of pre-warmed CM. The following day, the CM was replaced. On day 2, cells were grown under selection conditions using 200 ⁇ g/mL Zeocin.
- HMy2.CIR-A2 transfected either with the Pr3 -containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT, was tested for intracellular Pr3 expression by flow cytometry analysis of as previously described. Two clones with the highest expression are shown in FIG. 3. HMy.2.CIR-A2 cells transfected with Pr3 are susceptible to lysis by PRl specific CTL. It was next determined whether the transfected HMy2.CIR-A2 cells could be lysed by PRl specific CTL.
- PRl specific CTL were elicited in the manner previously described, and after 22 days in culture were combined at a 25:1 E:T ratio with HMy2.CIR-A2 transfected either with the Pr3 -containing vector pRTZ.2, or the empty vector containing the reporter gene, CAT.
- PRl specific CTL were also combined with control ma ⁇ ow cells from a CML patient in blast crisis (P3), HL-60 cells (which express Pr3, but lack HLA-A2.1), and marrow cells from a normal donor (D3).
- PRl specific CTL demonstrated 36% specific lysis of the Pr3 -transfected cells (clone 1.4), but only background lysis of normal marrow cells, HL-60 cells, HMy2.CIR cells transfected with the empty vector (CAT), and the non-transfected parent B cell line HMy2.CIR (HMY A2; FIG. 4). These results suggest that the PRl peptide is processed and presented on the surface of the Pr3 transfected HMy2.CIR cells. Although the level of Pr3 expression was lower than that found in leukemia cells, the B cell line may be more efficient at processing and presentation, thus compensating for the lower level of Pr3 expression.
- PRl-specific CTL identified in PBMC from normal donors by limiting dilution analysis and by using a PRl -HLA- A2 heavy chain tetramer.
- a modified limiting dilution assay designed for detecting low frequency lymphocyte precursors (CTLP) using a limited amount of patient material was used.
- CTLPf CTLP frequency
- the PRl -tetramer can be used to identify a distinct population of CTL with specificity for HLA-A2.1-bound PRl amongst a 17 day-old bulk culture of PRl-stimulated PBMC. Selection of a purified population of PRl-specific CTL from bulk culture is possible using a PR1-HLA-A2 heavy chain tetramer. In order to determine whether a purified population of PRl-specific CTL could be obtained from bulk culture CTL stimulated with PRl, the PRl -tetramer to FACS sort for CTL that expressed PRl-specific TCR was used.
- a 32 day-old PRl-stimulated CTL culture was obtained from a starting population of PBMC from an HLA-A2.1+ normal donor using the methods previously described. When the cells were dual-labeled with anti-CD8 and the PRl-tetramer, 4.3% ofthe bulk culture CTL were double-positive. An aliquot of 5 x 10 CTL was washed three times with PBS and labeled with anti-CD8 conjugated to FITC (Caltag Laboratories, Burlingame, CA) for 2 hr at 4°C.
- the cells were then washed three times with PBS and labeled with the PE-conjugated PRl-tetramer for 2 hr at 4°C. This was followed by a third labeling with both anti-CD4 and PI which was used as a dump during sorting.
- the cells were then sorted for dual-staining running CellQuest and CloneCyt software. 1.1 x 10 5 CTL were recovered with >95% viability (a yield of 2.2% of the total population, or 55% of the PRl-specific population) and the sorted population is shown in FIG. 6.
- the sorted CTL were then placed back into culture at 1 x 10 6 cells/mL of CM supplemented with 10% human serum (Sigma) and 100 IU/mL IL-2 (Biosource International). After 24 hr, the cells were collected and tested for the ability to lyse fresh leukemia target cells.
- the PRl -sorted CTL were then compared to the non-sorted bulk culture CTL in a 4-hr cytotoxicity assay. Effector cells were washed three times with PBS and co-incubated at E:T ratios of 20:1 to 2.5:1 with target bone marcow cells from an HLA- A2.1+ patient with accelerated phase CML and with bone marrow cells from an HLA- matched normal donor for 4 hr.
- Target cells 1000 cells/well were labeled with Calcein AM for 90 min prior to co-incubation, as in previous experiments.
- FIG. 7 shows that the PRl -sorted CTL produced significantly greater specific lysis of CML ma ⁇ ow than non-sorted CTL at all E:T ratios, and that background lysis of normal ma ⁇ ow was reduced to near zero.
- the CTL population depleted of PRl-specific CTL after FACS sorting was also examined for specific lysis ofthe CML marrow and no specific lysis was found at any E:T ratio.
- PCR products were reamplified with the same primers to which were added an Ml 3 sequencing primer tail (M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ JD NO:14) for the forward primer and Ml 3 Reverse 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 15) for the reverse primer).
- Ml 3 sequencing primer tail M13 -21 5'-TGTAAAACGACGGCCAGT-3' (SEQ JD NO:14) for the forward primer
- Ml 3 Reverse 5'-CAGGAAACAGCTATGACC-3' SEQ ID NO: 15
- Genotype of donors and recipients was dete ⁇ nined using Sequence Specific primer (SSP) PCR.
- SSP Sequence Specific primer
- the PCRTM products were run in 2% agarose gel stained with Ethidium Bromide. Different patterns between individuals were noted in exons 1 through 4, but only exons 1 through 3 showed differences between donors and recipients of the same pair, as shown in FIG. 8. Since the amplified DNA product also contained portions ofthe flanking intronic regions and since all ofthe base differences in the coding region may not result in amino acid differences, the amplified products from donor-recipient pairs showing donor specific bands were sequenced.
- Pr3 gene is polymorphic for the following reasons: (1) The sequences as determined from the intronic regions conflicted several times with the published genomic sequence; (2) two different polymorphic sites were found in exons 1, 2, and 3 that explained the multiple patterns observed on autoradiography; (3) only one DNA polymorphism, in exon 3, was found to encode for an amino acid polymorphism in the deduced amino acid sequence (Table 9). This polymorphism encodes for either an isoleucine (ATT) or a valine (GTT) at position 119 of the amino acid sequence. Table 9 - Polymorphisms in the Pr3 gene as determined by direct gene sequencing
- Sequencings ofthe first 4 exons have been submited to Genbank (accession numbers: AF015446; AF015447; AF015448 and AF015449).
- Aa amino acid; He; isoleucine; Val: valine; UT: untranslated.
- KLNDILLIQL SEQ ID NO: 8
- KLNDVLLIQL SEQ ID NO: 9
- PR7I PR7V
- the PRl self peptide from Pr3 is immunogenic, and these data suggested that T cell responses may be elicited against polymorphic differences in Pr3 as well. These differences may be used as a basis for designing leukemia-specific adoptive T cell therapy of myeloid leukemia.
- the leukemia-associated antigen PRl is derived from both proteinase 3 and neutrophil elastase proteins. The inventors have shown that killing of leukemia cells by PRl- specific CTL correlates with P3 overexpression. However, the PRl sequence is also contained within neutrophil elastase (NE), which is also abe ⁇ antly expressed in leukemia cells.
- NE neutrophil elastase
- P3- and NE-transfected B cells were used as target cells in a proliferation assay with PRl-specific T cells. Full-length P3 and NE cDNA was cloned from the promyelocytic HL-60 cell line based on published sequences.
- the sequences were subcloned into an EGFP-containing vector (pCMS-EGFP) with a CMV promoter to drive constitutive expression.
- the B cell line, HMy-CIR previously stably transfected with the HLA-A*0201 gene, was transfected with P3-pCMS-EGFP and NE-pCMS- EGFP by electroporation for 24 hr.
- GFP-expressing cells P3 -HMy.CIR- A2 and NE-HMy.CJR- A2, respectively) were selected by FACSorting and high transfection levels were confirmed by fluorescence microscopy.
- Western blotting confirmed protein expression in the NE-HMy.CJR-A2 -transfected cells, although expression was similarly less than in HL-60 cells.
- PRl-specific CTL lines elicited from two healthy donors showed stimulation indices (SI) of 1.3 and 2.4 when co-incubated with P3-HMy.CIR-A2 target cells during BrDU incorporation, confirming that PRl -CTL recognize PRl peptide processed and presented from P3.
- PRl -CTL also recognized NE-transfected cells, with Si's of 1.5 and 2.1. No recognition of non-transfectants or parent HMy.CIR (A2-) was observed.
- PRl could be used as a target antigen to stimulate both active and passive leukemia-specific immunity.
- PRl will be given as a vaccine with incomplete adjuvant to boost leukemia immunity, and in additional clinical trials PRl- specific CTL will be selected and expanded ex vivo with the PRl antigen for the production of leukemia-reactive CTL.
- PRl-specific CTL will be used alone or combined with existing treatments, such as allogeneic BMT, to produce a GVL effect.
- PRl-specific donor-derived CTL added to a previously CD3 T cell-depleted graft, for instance, may allow selective GVL reactivity without GVHD.
- CTL immunity to PRl an HLA-A2-restricted 9 amino acid peptide (aa 169-177) derived from proteinase 3 (Pr3).
- Pr3 is a protein contained within the azurophil granules of myeloid lineage cells and is overexpressed in many patients with myeloid leukemia.
- CTL responses to PRl will be examined by determining CTL precursor (CTLP) frequency using microtiter limiting dilution analysis.
- CTL precursor (CTLP) frequency using microtiter limiting dilution analysis.
- a high CTLPf against PRl present in the recipient prior to BMT might indicate leukemia immune escape, which could be addressed separately as detailed below.
- LDA limiting dilution analysis
- PBMC and BM from HLA-A2.1+ patient samples will be used to test for existing T cell reactivity toward PRl by using a limiting dilution CTLPf assay (Hensel et al, 1999).
- PBMC and bone marrow mononuclear cells (BMC) will be obtained by Ficoll Hypaque separation and either used fresh, or frozen in liquid nitrogen for future use.
- Samples from HLA-A2.1 positive patients with CML, AML, and MDS will be collected.
- PBMC and BM from the HLA-matched normal BMT donors to those patients will also be collected, cryopreserved, and assayed as well.
- the previously frozen samples will be thawed and washed three times in serum-free CM and counted.
- a total of 19.5 million cells will be prepared for the assay (7.5 million stimulator cells, and 12 million responder cells).
- One million additional PBMC will be used to generate phytohemagglutinin (PHA-P; Sigma Chemical, St. Louis, MO) stimulated blasts to be used as target cells on day 10 of the assay.
- PHA-P phytohemagglutinin
- PBMC blood pressure-derived PBMC
- PHA blasts will be generated by placing 10 6 cells in 1.0 mL of CM supplemented with 10% fetal bovine serum (FBS; Sigma Chemical) in a 25 cm 2 flask. Five ⁇ L/mL of PHA-P will be added, and the cells will be cultured in 5% CO 2 at 37°C. On day 4, 6, and 8 of the culture, additional CM + 10% FBS with 5 ⁇ L/mL PHA-P and 500 IU/mL rhIL-2 will be added.
- FBS fetal bovine serum
- PBMC responder cells from patient samples will be plated into high profile Terasaki Trays (Robbins Scientific, Sunnyvale, CA) at 6 dilutions (from 5 x 10 4 to 5 x 10 5 PBMC/well) using 24 replicates at each dilution in CM + 10% human AB serum (AB; Sigma Chemical).
- Third party responders from normal donors will be plated at a single dilution (5 x 10 4 PBMC/well).
- Patient PBMC stimulator cells will either be pulsed with peptide (PRl or FLU, the influenza nuclear protein described previously, as a positive control peptide) at 20 ⁇ g/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, then irradiated with 2500 cGy. These cells will then be plated into the wells containing the responder cells, as well as 24 additional wells of stimulators alone. On days 3 and 7, 60 IU/mL of IL-2 will be added to each well.
- peptide PRl or FLU, the influenza nuclear protein described previously, as a positive control peptide
- the previously prepared PHA blasts from the same patient will either be pulsed with PRl at 20 mg/mL or no peptide for 90 min at 37°C, washed once with serum-free CM, and then labeled with Calcein AM (Molecular Probes, Eugene, OR) as described in the cytotoxicity experiments above.
- PRl at 20 mg/mL or no peptide for 90 min at 37°C
- CM serum-free CM
- Calcein AM Molecular Probes, Eugene, OR
- the calculated CTLP frequencies will then be analyzed with respect to the amount of Pr3 expression in the patient's blast populations, since the amount of specific lysis of PRl-specific CTL in normal donors co ⁇ elated with the amount of Pr3 overexpression in the target leukemia cells in the previous studies (Molldrem et al, 1996). Determining the percent of PBMC and BM specific for the PRl peptide.
- CTL responses to PRl will be examined determining the percent of peripheral blood mononuclear cells (PBMC) and bone marrow cells (BM) that are specific for the HLA-A2.1 -bound PRl peptide by FACS analysis using a specific PRl -HLA- A2 tetramer (PRl-tetramer) linked to phycoerythrin (PE).
- the PRl-tetramer will be used to identify the fraction of CTL that recognize HLA-A2-bound PRl in patient and donor PBMC and BM before transplant and again 6 months after transplant. This will be easier to study using patients that receive peripheral blood grafts since more patient material is available for the larger number of lymphocytes needed for flow cytometry determination ofthe percent of PRl-specific CTL.
- PRl-specific CTL determined using the combination of PRl-tetramer plus CD8, will be analyzed by using three and four color FACS analysis to simultaneously determine the phenotype of the PRl-specific CTL.
- the cells will be analyzed for state of activation using CD28, CD69, and CD25.
- Memory CTL will be evaluated using CD45RO antibody. It is important to determine whether any PRl-specific CTL that are found in the leukemia patients are memory cells in an inactivated state which would suggest either that the leukemia is not a potent immunogen or perhaps the CTL are incapable of responding.
- PBMC and BM 10 million mononuclear cells will be thawed and washed 3 times with PBS. These cells will be placed into culture with 5 to 10 million T2 cells (previously pulsed with 10 ⁇ g/mL of PRl for 90 min at 37°C) in CM + 10% HS at 37°C and 5% C02 for one week and then re-stimulated with PRl-pulsed T2 cells on day 7. On day 8, IL-2 at 20 IU/mL will be added to the cultures and this process will be repeated at two and three weeks of cell culture. The cells at the end of three weeks in culture will be collected and used in micro-cytotoxicity assays using Calcein AM-labeled T2 cells as targets.
- T2 target cells will be pulsed with 10 ⁇ g/mL of PRl, control Flu peptide, or no peptide for the cytotoxicity assays.
- a CTL line established from an HLA-matched normal donor using the same methods will be used as a positive control in the cytotoxicity assay, since this is an established method.
- CTL responses to PRl will be examined determining the frequency of cells secreting cytokines in response to PRl peptide recognition using the ELISPOT assay. Cytokine- secreting cells will be measured in response to PRl -coated targets by using the ELISPOT assay.
- ELISPOT assays will be performed in 96-well polyvinylidene difluoride backed plates (MAIP S 45; Milhpore, Bedford, MA). These wells will be coated with 15 ⁇ g/mL of anti-IFN- ⁇ mAb 1-DIK (Mabtech, Sweden) overnight at 4°C. Plates will be washed 6 times with CM and blocked with CM + 10% HS for 1 hr. PBMCs will be thawed and washed 3 times with PBS and suspended in CM + 10% HS.
- PBMCs will be added in 100 ⁇ L CM + 10% HS per well to the precoated plates at 5 x 10 /well, in duplicate wells.
- duplicate wells with 5 x 10 5 and 2.5 x 10 5 PBMCs/well will be used.
- Detection of peptide-specific T cells from freshly isolated PBMCs will be performed using autologous PBMCs themselves to present PRl peptide. This will avoid responses been elicited from T cells of other specificities if heterologous B cell lines (such as EBV-transformed lymphocytes) were used as target cells for peptide presentation.
- Peptides will be added at 10 ⁇ g/mL.
- T2 cells will be used in some assays as target cells and compared to the autologous PBMCs.
- T2 cells will be pulsed with 10 ⁇ g/mL of PRl peptide for 90 min and washed 3 times prior to plating with responder PBMCs.
- the plates will then be incubated for 6 hr at 37°C, 5% C0 2 and then a ⁇ ested by shaking off the contents and washing 6 times with PBS 0.05% Tween 20 (Sigma Chemical, St. Louis, MO).
- 100 ⁇ L of 1 ⁇ g/mL of the biotinylated anti-IFN- ⁇ mAb 7-B6-1 biotin (Mabtech, Sweden) will be added.
- SFCs JFN- ⁇ -producing spot-forming cells
- PBMCs will be pulsed with PRl peptide and exposed as stimulators to autologous PBMCs at a 1:1 responder: stimulator ratio on two occasions over 7 to 10 days with low-dose IL-2 added to each well at 60 IU/mL before the ELISPOT assay is performed.
- the ELISPOT technique will also used to quantify the number of SFC in a TNF-a assay under similar conditions (Herr et al, 1996).
- Cells will also be surface-labeled with anti-CD33, CD34, and CD14 monoclonal antibodies (Becton-Dickinson, San Jose, CA) in order to correlate the developmental stage of the blast population with Pr3 expression.
- cells will be labeled for MHC class I and II, CD80 (B7.1) (hnmunoTech S.A., Marc Victors Cedex, France), CD86 (B7.2) (hnmunoTech), and CD54 (ICAM-1) (Becton Dickinson) to evaluate the potential of the blasts as suitable CTL targets.
- CD80 B7.1
- CD86 B7.2
- CD54 CD54
- Three color staining will allow for cell subset analysis.
- One million cells will be studied for each combination of antibodies.
- the cells will be washed in serum-free CM, permeabihzed using Ortho PermeaFix for 30 min at room temperature, washed twice in serum-free CM, and then indirectly stained with an antibody to Pr3 (Accurate Chemicals, Westbury, NY) and a secondary FITC-conjugated antibody. This will be followed by an additional wash with serum-free CM and surface labeling of the other markers using direct staining with PE- or APC-conjugated antibodies at 4°C. As previously discussed, a high CTLPf in the recipient pre-BMT may indicate leukemia immune escape.
- a low CTLPf but a high percent of PRl-specific CTL by flow cytometry may indicate a defect in CTL target recognition, which may be further investigated by examining TCR ⁇ chain tyrosine phosphorylation by Western blot analysis.
- Humoral immune responses to Pr3 will be examined by measuring antineurophil cytoplasmic antibody (ANCA) titers. In Wegener's granulomatosis, the ANCA IgG titer co ⁇ elates closely with disease activity.
- ANCA antineurophil cytoplasmic antibody
- ANCA titer Since T lymphocytes taken from biopsy sites of active vasculitis in these patients show proliferation in response to Pr3, and since T cell help is required for IgG production, it is possible that measuring ANCA titers may be an indirect measure of Pr3- directed activity of T lymphocytes.
- ANCA titer has not been formally examined in patients with myeloid leukemia. An inexpensive and reliable assay is commercially available and used in clinical laboratories to evaluate ANCA titers.
- ANCA titers will be determined in all myeloid leukemia patients enrolled on phase I/II clinical vaccine trials as well as the transplant patients and their donors will be investigated using the above assays to measure cellular immunity. Patients of all HLA types will be evaluated for ANCA positivity.
- EXAMPLE 7 DETERMINING WHETHER PRl CAN ELICIT SPECIFIC ANTILEUKEMIA IMMUNITY IN PATIENTS WITH MYELOID LEUKEMIA
- PRl can be used to elicit specific antileukemia immunity in patients with myeloid leukemia.
- Leukemia offers several advantages as a model disease for vaccine development and evaluation. First, since the leukemia cells circulate in the peripheral blood the tumor cells are readily available for study without the need for repeated invasive biopsies which allows for close monitoring of any changes in the tumor phenotype. In addition, the lymphocytes under study also reside in the peripheral blood in constant contact with the malignant cells. These are obvious advantages to the study of immune responses in the treatment of solid rumors. Enhancing CTL reactivity by PRl.
- a phase I/II clinical protocol using the PRl peptide in combination with incomplete Freund's adjuvant (IFA) will be employed to vaccinate patients with myeloid leukemia to determine whether CTL reactivity to PRl peptide can be enhanced by subcutaneous vaccination with the PRl peptide combined with incomplete Freund's adjuvant (IFA) every 3 weeks for 3 injections.
- CTLP frequency will be measured in PBMC and BM before and after vaccination using microtiter limiting dilution analysis.
- IFA has been used in one successful clinical trial using gplOO to vaccinate patients with melanoma (Rosenberg et al, 1998).
- HLA-A2+ patients Up to 60 HLA-A2+ patients (as confirmed with BB7.2 antibody labeling) with CML, AML, and MDS will receive a deep subcutaneous injection every 3 weeks for 9 weeks. Patients will be randomized to three dose levels ofthe PRl peptide (0.25 mg, 0.5 mg, and 1.0 mg) with a fixed amount of JFA, and then followed in cohorts of 4 for toxicity and evidence of an immune response to PRl as measured in vitro using the CTLPf assay by LDA. Patients will be randomized to three different doses of vaccine, since it is not clear that increased dose will result in a greater anti-tumor response.
- toxicity of a vaccine is related to the augmentation of the immune response, that augmentation may be elicited by repeated immunization rather than increasing the dose ofthe immunizing antigen.
- the "dose escalation" of a vaccine may not lie in the quantity of peptide delivered, but rather in the number of exposures to antigen, i.e. the number of immunizations.
- the peptide-specific T cell immune response was suppressed when the amount of peptide injected was greater than 1000 ⁇ g (Bourdette et ⁇ /., 1994).
- PBMC peripheral blood samples before and 3 weeks after the last vaccination. Further experiments will be performed to evaluate any non-responsiveness found using both these assays.
- An important aspect in the design of any phase I/II cancer vaccine trial targeting a self tumor antigen is the selection of the patients to be immunized. Toxicity such as vasculitis is possible and therefore patients with advanced stage leukemia will be eligible for this initial study. However, determination of safety requires that an immune response be mounted, and far advanced patients often lack a competent immune response. Therefore, patients with all types of myeloid leukemia at various stages of disease including patients with chronic phase CML who will have a stable low-leukemia burden and normal lymphocyte counts will be examined.
- the chronic phase CML patients will be those without the option of of allogeneic BMT, who may be failing other forms of therapy such as interferon with or without chemotherapy, and who are therefore terminally ill.
- Patients with CML offer the further advantage over solid tumor patients that molecular studies ofthe amount of Ph chromosome can be used to judge responses in the chronic phase patients with low tumor burden.
- PCR analysis which is performed routinely on all CML patients to follow the disease course, will be performed at 3-week intervals during the course ofthe study, and again one month after the last vaccine.
- a subcutaneous injection of 75 ⁇ g of GM-CSF will be administered into each vaccine injection site to enhance the adjuvant effect.
- GM-CSF as an adjuvant has produced greater immune responses in animal models of other hematological malignancies (Kwak et al, 1996).
- Phase I trials using bcr-abl junction region peptides to vaccinate patients with CML are being conducted by other investigators. These investigators are using a combination of 5 HLA- A3 and HLA- All-restricted peptides from the b3a2 translocation region with the adjuvant QS-21 in a dose-escalation trial design starting with 10 ⁇ g of peptide.
- 5 patients treated with 10 ⁇ g and 5 patients treated with 30 ⁇ g have not had any clinical response to the vaccine.
- the PRl peptide vaccine has greater potential to elicit immunity compared to bcr-abl junction region peptides for several reasons.
- the pre-clinical data regarding bcr-abl junction region peptides indicates that CTL elicited in vitro against these peptides do not demonstrate cytotoxicity against fresh leukemia target cells, but only to leukemia cells that have been pre-pulsed with the target peptides.
- PRl-specific CTL show cytotoxicity and leukemia progenitor inhibition of fresh leukemia cells with no prior peptide labeling ofthe target cells (FIG. 2).
- clinical trials showing responses to melanoma peptide vaccines have used 10-fold higher peptide doses to vaccinate patients than what is used in the b3a2 peptide vaccine trial.
- the PRl vaccine trial will use peptide doses similar to those used in the melanoma vaccine trials.
- the 51 Cr-release CTLPf by LDA that was used to evaluate an immune response to the b3a2 peptides is less sensitive than the mirco- titer CalceinAM-based assay of the present invention.
- the PRl vaccine trial will include patients with all types of myeloid leukemia, thereby broadening the opportunity to find immune responses. Potential non-responsiveness to PRl will be evaluated by generation of PRl-specific T cells in myeloid leukemia patients.
- PRl-specific CTL responses can be elicited in patients by using the peptide vaccine will be determined. In those patients where no immune response is elicited, or in those patients that develop an immune response but do not have a clinical response to the vaccine, it will be important to know whether PRl-specific CTL from those patients can recognize and/or kill autologous leukemia cells.
- PRl peptide synthesized to >95%> purity (Biosynthesis, Lewisville, TX), will be added to the T2 cells at 10 ⁇ g/mL and the T2 cells will be placed in a humidified incubator at 37°C for 90 min.
- the PRl-pulsed T2 cells will be i ⁇ adiated with 7500 cGy, washed twice with serum-free CM, and combined at a 1:1 ratio with patient PBMC in 50 mL of CM + 10%) human AB serum (10% AB) and placed in a 75 cm 2 tissue culture flask.
- PBMC PBMC
- CM + 10% AB CM + 10% AB
- recombined at a 1:1 ratio with fresh T2 cells Similarly pulsed with PRl, i ⁇ adiated, and washed.
- 20 IU/mL of recombinant human interleukin-2 (rhIL-2) Biosource International, Camarillo, CA
- rhIL-2 human interleukin-2
- a third stimulation will be performed with PRl-pulsed T2 cells, followed on day 15 by addition of rhlL- 2.
- a fourth stimulation will be performed on day 21 followed on day 22 by the addition of 20 IU/mL rhIL-2.
- the PRl-stimulated T cells will be tested for peptide-specific cytotoxicity toward T2 cells and leukemia cells from autologous and allogeneic BMC.
- a semi-automated mircotiter cytotoxicity assay identical to that used in the previously published studies, will be used to determine specific lysis. Effector cells grown in the presence of PRl-pulsed T2 cells will be prepared in doubling from 6 x 10 to 25 x 10 cells/well and will be plated in 40 ⁇ L, 60-well Terasaki trays (Robbins Scientific, Sunnyvale, CA) with six replicates per dilution.
- Target cells T2 cells ⁇ PRl, autologous marrow-derived leukemia cells, or ma ⁇ ow derived from normal donors
- CM Calcein-AM
- target cells After washing three times in CM + 10% AB, target cells will be resuspended at 10 5 cells/mL.
- Wells with target cells alone and medium alone will be used for maximum (max) and minimum (min) fluorescence emission, respectively.
- FluoroQuench EB Stain-Quench Reagent (One Lambda, Inc, Canoga Park, CA) will be added to each well and the trays will be centrifuged for 1 min at 60g before measurement of fluorescence using an automated Lambda Fluoroscan (One Lambda, Inc).
- a decrease in the fluorescence emission is proportional to the degree of lysis of target cells, once the hemoglobin contained in the FluoroQuench reagent quenches the released dye.
- the mean and standard deviation fluorescence from the 6 wells at each E:T ratio will be calculated, and the percent lysis will be calculated.
- PRl specificity will be confirmed by using Flu peptide-coated T2 cells as a negative control target cell population in the cytotoxicity assay.
- Autologous BMC and HLA-A2+ BMC from a normal donor will be prepared similarly and also used as target cells to test for leukemia-reactivity.
- patient PBMC will be used in parallel to generate Flu- specific CTL lines which will be similarly tested for lysis of Flu peptide-coated T2 cells.
- PBMC blood will be collected and PBMC isolated over a Ficoll-Hypaque density gradient as previously described. PBMC will be allowed,. to adhere to a plastic 75-cm 2 flask for 2 hr at 37°C. Non-adherent cells will be removed, and the adherent cells will be cultured for 7 days with GM-CSF (800 U/mL; Sandoz, Germany) and IL-4 (500 U/mL; PharMingen, Hamburg, Germany). Phenotypic changes will be monitored by light microscopy and flow cytometry will be performed to confirm the DC phenotype.
- GM-CSF 800 U/mL; Sandoz, Germany
- IL-4 500 U/mL
- PharMingen Hamburg, Germany
- PRl will be used to pulse dendritic cells (DC) derived from the peripheral blood of normal donors, and these PRl-pulsed DC will be used like T2 cells in previous experiments to elicit PRl- specific CTL.
- PRl-specific lysis will be evaluated using these DC-generated CTL using assays discussed previously and compared with T2-generated CTL.
- Pr3 expression in patient BMC will be evaluated after the addition of interferon- ⁇ , interferon- ⁇ , and GM-CSF. These cytokines are known to increase
- T cell MHC molecules and co-stimulatory molecules (Tsukada et al, 1997) and also increase
- Pr3 expression (Mayet et al, 1997; Sibelius et al, 1998). Thus, cytokine co-administration might lead to more effective anti-PRl immunity (Dermime et al, 1997).
- cytokine co-administration might lead to more effective anti-PRl immunity (Dermime et al, 1997).
- the PRl-tetramer may be used to FACS sort for a homogeneous population of PRl -selected CTL that show high specific lysis of leukemia with no background lysis of normal marrow cells.
- the PRl-tetramer will be used in the present invention to FACS sort homogeneous population of CTL from bulk culture CTL lines established at 2 to 3 wk of culture. These CTL lines will be generated using PBMC from HLA-A2.1+ patients with CML and AML as well as normal donors using PRl-pulsed T2 cells as antigen presenting cells 1 . Using the PRl-tetramer, these cells will be FACS sorted and their state of activation and phenotype will be compared (by measuring CD28, CD69, CD25, and CD45RO) and their ability to lyse PRl -coated T2 and fresh autologous and allogeneic leukemia cells.
- PRl -sorted CTL that demonstrate cytotoxicity toward the leukemia cells, will also be evaluated for their ability to inhibit leukemia CFU-GM and normal HLA-A2.1+ CFU-GM using normal donor bone marrow cells and the methods previously described.
- the PRl -sorted CTL as shown in FIG. 16, contain some CD 8+ cells that do not have apparent specificity for PRl. However, a much more homogeneous population of PRl-specific CTL are obtained using the PRl-tetramer, which will allow for more efficient cloning of these cells.
- Cells will be cloned by limiting dilution according the Poisson distribution where 0.3 cells/well will be plated into 96 well plates containing 1 x 10 5 allogeneic PBMC (previously radiated with 7,500 cGy) in 300 ⁇ L CM + 10% HS and 60 IU/mL IL-2. These wells will be placed at 37°C and 5% CO 2 for 7 to 10 days. Media will be replaced after 7 to 10 days and wells that contain growing cells will be expanded and subsequently studied for specific lysis of PR1- coated T2 cells as previously described. These clones will also be evaluated for phenotype using the above antibodies.
- Clones obtained using these methods will be used to investigate the Hmy2.CIR-A2 tiansfectants and other cells transfected with the Pr3 gene as discussed elsewhere in this application. Similar to that demonstrated in previous studies (Molldrem et al, 1999), CTL from a patient with CML that demonstrate high specific lysis of PRl-pulsed T2 target cells was not elicited. Therefore, to overcome the apparent non-reactivity to this self-peptide in patients with leukemia FACS-sorted populations of PRl-specific CTL from normal donors will be investigated.
- Normal donor-derived allogeneic PRl-specific CTL that are FACS sorted using the PR1- tetramer may be used for the safe adoptive transfer into leukemia patients selected only for the HLA-A2.1 allele as demonstrated using CTL specific for adenovirus-associated rumors in mice (Toes et al, 1996).
- This type of allogeneic therapy might allow for selective killing of host leukemia without the requirement of a traditional bone marrow transplant and without the requirement of a fully HLA-matched donor.
- EXAMPLE 8 IDENTIFYING POTENTIAL HLA-A2.1 -RESTRICTED PEPTIDE EPITOPES IN PR3 TO ELICIT LEUKEMIA-REACTIVE HUMAN CTL USING IMMUNOLOGICAL METHODS
- PRl peptide seven additional peptides within Pr3 have been identified that contain the HLA- A2.1 binding motif (Table 4, PR3-PR9). These peptides have been identified to 95% purity
- A2.1 expression on peptide-coated T2 cells using methods previously described. These peptides will be used to elicit CTL where peptide-coated T2 cells are radiated, pulsed with peptide, and used to stimulate PBMC from normal donors. These resultant CTL lines will be tested first for peptide-specific recognition of peptide-coated T2 cells (compared to non-coated T2), and then for lysis of fresh HLA-A2.1+ BMC from leukemia patients (compared to BMC from normal
- HLA-A2.1+ donors Blocking studies with antibody to HLA-A2.1 (BB7.2) and i ⁇ elevant Flu peptide-coated T2 cell targets will be used to confirm the allele-specificity in cytotoxicity assays.
- the relative binding affinities to HLA-A2.1 of these peptides compared to PRl will be determined by incubating serial dilutions of PRl plus each peptide with T2 cells and analyzing for surface HLA-A2.1 expression by flow cytometry. In this way, an IC 50 value will be determined for each peptide.
- leucine and methionine or valine and leucine will be substituted for the existing amino acids and these peptides will be used to elicit CTL immunity again using T2 cells.
- These amino acids are known to be relevant for high affinity binding to the HLA-A2.1 allele (Rammensee et al, 1995), and substitution of anchor amino acids has been shown to increase CTL lysis of the peptide-coated target cell (Parkhurst et al, 1996), presumably because of more stable binding of the peptide to the MHC class I heavy chain (Sette et al, 1994).
- Peptides that do not elicit any immunity will be considered not to be within the TCR repertoire ofthe donor PBMC.
- peptides will be synthesized (Biosynthesis Co.), tested for HLA-A2.1 binding using T2 cells, and tested in the mini-cyto toxicity assay where specific lysis will be compared to native PRl -coated T2 cells using TCL that are PRl-specific.
- the PRl-specific bulk culture CTL will be generated using the methods described herein. If any additional HLA-A2.1 -binding peptide from Table 10 is found that can be used to generate CTL responses, then combinations of PRl with this peptide will be used to coat T2 target cells to test for specific lysis.
- T2 cells Using CTL specific for this peptide, T2 cells will be coated with a fixed concentration of the peptide at 10 ⁇ g/mL, plus serial dilutions of PRl (0.1 to 50 ⁇ g/mL) to test for potential interference with TCR recognition, as measured by reduced specific lysis at fixed E:T ratios.
- PRl 0.1 to 50 ⁇ g/mL
- the results of these experiments plus the IC 50 of each of the peptides will be used to make comparisons of which are the possible dominant and subdominant peptides. This will be used to develop vaccines using combinations of peptides to stimulate CTL immunity (Nestle et al, 1998).
- PRl-specific CTL that are obtained after PRl-tetramer sorting will be studied for their ability to recognize and lyse the PRl -variant peptide-coated T2 cells. Because these cells are a much more homogeneous population of CTL, they are expected be a more sensitive indicator of improved CTL immunity.
- HLA-A2.1 ⁇ restricted peptides spanning the known single amino acid polymorphism in Pr3 can be used to elicit CTL immunity from the PBMC of donors that possess the opposite polymorphism.
- a polymorphism in the third exon of Pr3 was found that encodes for a single amino acid difference in peptides that can bind with high affinity to HLA-A2.1.
- the amino acid difference does not involve HLA-A2.1 the anchor regions, but it likely involves the region ofthe peptide recognized by the TCR.
- This polymorphism may therefore represent a new minor antigen that is restricted to hematopoietic tissue, and provide an ideal target for allogeneic adoptive immunotherapy strategies.
- these two peptides will be synthesized and used to coat T2 cells for in vitro immunization of PBMC derived from the donors already known to have the opposite polymorphism using the methods to generate PRl reactivity.
- the resulting CTL lines will be tested for specific lysis of T2 cells pulsed with either the original or the polymorphic peptide.
- These peptides will also be evaluated for lysis of leukemia cells from patients that have previously been determined to contain the opposite polymorphism.
- HLA-A2.1 blocking studies will confirm A2.1 -restriction, and irrelevant Flu peptide will confirm peptide specificity.
- Lysis of these leukemia target cells without lysis of autologous marrow progenitors will demonstrate PR7I and PR7V as the first potential new minor antigens found in humans.
- PR7I and PR7V the first potential new minor antigens found in humans.
- several PBMC donors will need to be studied since not all individuals would be expected to have T cells capable of recognizing the peptide.
- controls where CTL are elicited against the autologous PR7 peptide from the donors that contain that polymorphic peptide will need to be compared to CTL elicited from the donors that do not carry the polymorphism.
- the PRl-tetramer could be used to select for a homogeneous population of leukemia-reactive CTL and may allow for the first time the adoptive transfer of CTL against MHC barriers to treat leukemia(Toes et al, 1996a).
- EXAMPLE 9 ANTIGEN PRESENTING CELLS (APC)
- APC ANTIGEN PRESENTING CELLS
- PBMC from 38 HLA-A2.1+ CML patients at different stages of disease and 5 healthy volunteer donors were obtained and and cryopreserved. Diagnosis of CML was defined by 100% Ph+ cells in bone marrow aspirates from all patients prior to treatment. Ten patients received chemotherapy alone, including hydroxyurea, cytarabine, cyclophosphamide, and topotecan. Nineteen patients received JFN- ⁇ 2b-based therapies, which consisted of IFN alone (6 patients) or combined with the chemotherapeutic drugs cytarabine and homoharingtonine (13 patients). Nine patients received an HLA-identical allogeneic BMT from a related donor.
- the specificity of the PR1/HLA-A2 tetramer was demonstrated by its ability to stain a PRl-specific T cell line at 4°C that was derived from a healthy HLA-A2.1+ donor, but not from a CMV-specific line derived from the same donor (data not shown). None of the 10 patients that received chemotherapy alone without IFN and none of 5 HLA-A2.1+ healthy volunteer donor control samples had detectable PRl-specific CTL. Although one patient treated with chemotherapy alone had a response, no PRl-specific CTL were detectable (Table 11) by tetramer staining. Similarly, there were no detectable PRl- specific CTL in HLA-A2.1+ PBMC from three patients with multiple myeloma and two patients with newly diagnosed breast cancer that had received IFN. Table 11: Patient Characteristics
- PRl-specific CTL with high and low TCR avidity can be elicited from healthy donors.
- a modified tetramer staining technique (Savage et al, 1999) using limiting tetramer concentration to visualize high and low fluorescence intensity tetramer+ cells, which correlates with high and low TCR avidity was utilized.
- Sufficient PRl -CTL was elicited by stimulating PBMC with increasing peptide concentrations for 28 days.
- MCF median channel of fluorescence
- PBMC stimulated with 2 ⁇ M PRl elicited PR1-CTL with intermediate TCR avidity (MCF 211).
- Total TCR-ab expression was comparable for cells elicited with 0.2, 2.0, or 20 ⁇ M PRl, suggesting that differences in tetramer staining were not due to differences in TCR expression level.
- Cultures stimulated with 2 ⁇ M PRl produced fewer PRl-specific CTL with mixed TCR avidities, while stimulation with ⁇ 0.02 ⁇ M PRl induced ⁇ 0.1% PRl -CTL.
- PRl -CTL elicited with low (0.2 ⁇ M) PRl showed higher specific lysis of PRl-pulsed T2 target cells than PRl -CTL elicited with high (20 ⁇ M) PRl concentration (closed circles), when both were normalized at an E:T of 10:1 based on the total number of PRl/HLA- A2 tetramer+ events in the CTL cultures (FIG. 11C).
- tetramer staining intensity correlates with TCR avidity
- the kinetics of tetramer staining decay was determined using previously described techniques (Savage et al, 1999).
- PRl-CTL elicited with either low (0.2 ⁇ M) or high (20 ⁇ M) PRl concentrations for 4 weeks were incubated with PRl /HLA- A2 tetramer and saturating concentration of BB7.2 anti-HLA-A2 monoclonal antibody to prevent rebinding. Normalized total fluorescence was measured at 4°C at the appropriate time points and linear tetramer staining decay plots were obtained, indicating tetramer staining half-lives (t !/2 ) should be proportional to the t 2 ofthe respective TCR peptide HLA-A2 complexes (FIG. 11D).
- PRl-CTL elicited with low (0.2 ⁇ M) PRl showed a 3-fold longer t 1 2 than PRl-CTL elicited with high (20 ⁇ M) PRl (58 vs 19 min), which co ⁇ elates with overall high and low tetramer fluorescence (FIG. 11 A), respectively, and validates the use of overall tetramer fluorescence intensity to indicate relative TCR avidity.
- Spectratype from high and low avidity PRl-specific CTL cultures supports unique clonal derivation.
- PRl-CTL lines derived from a healthy donor or from patients with CML were tested for the ability to kill HLA-A2+ CML target cells from a patient with blast crisis CML, autologous chronic phase CML cells from patient CML #3 at time of diagnosis, or cells from healthy donors.
- PRl-CTL derived from the healthy donor with high or low avidity were each combined with either bone marrow (BM) from the patient with CML or BM from the patient's healthy HLA matched sibling in a 4-hr cytotoxicity assay.
- High avidity PRl-CTL elicited with 0.2 ⁇ M PRl showed nearly 2-fold greater lysis of the same CML BM cells on a per cell basis than did the low avidity PRl-CTL elicited with 20 ⁇ M PRl (FIG. 13A).
- the specific lysis of autologous BM cells by a PRl-CTL line derived from a CML patient (CML #3) using 0.2 ⁇ M PRl was similar to the amount of lysis of CML BM cells by the low avidity PRl-CTL line derived from the healthy donor (FIG. 13B).
- CTL from patients CML #1 and CML #2 elicited with 0.2 ⁇ M PRl showed lysis of CML #3 BM cells of 24% ⁇ 5% and 33% ⁇ 6%, respectively, at an E:T ratio of 20:1.
- High avidity PRl-specific CTL are present only in interferon sensitive CML patients in cytogenetic remission. It was previously shown that detection of functional PR1- CTL in CML patients co ⁇ elates with a cytogenetic response to interferon- ⁇ (Molldrem et al, 2000). This suggested that high avidity PRl-CTL would only be present in IFN-sensitive patients.
- PBMCs from untreated HLA-A2 + patients with either blast crisis (CML # 1) or chronic phase CML (CML # 2) or a patient with chronic phase treated with JFN-c for 3 months (CML # 3) were stimulated weekly with PRl. Only low-avidity PRl-CTLs could be elicited from any ofthe three patients (FIG. 14A). There were no detectable PRl-CTLs by tetramer staining in PBMCs prior to repeated peptide stimulation.
- low avidity PRl-CTL could be identified in the interferon resistant patients, but totaled less than 0.1% of CD8+ cells.
- PBMC from untreated HLA-A2+ patients with either blast crisis (CML #1) or chronic phase CML (CML #2) or a patient with chronic phase treated with interferon- ⁇ for three months (CML #3) were stimulated weekly with PRl. Only low avidity PRl-CTL could be elicited from any ofthe three patients. This suggests that low numbers of high avidity PRl-CTL may be sufficient to contribute to cytogenetic remission in interferon sensitive patients, but leaves unanswered whether high numbers of low avidity PRl-CTL may contribute to remission.
- High PRl concentration and proteinase 3-overexpressing CML cells induce apoptosis of high avidity PRl-specific CTL.
- Previous studies showing that high affinity virus- specific T cells are eliminated by target cells infected with a high viral load (Alexander-Miller et al, 1998; Alexander-Miller et al, 1996a), and that CML cells frequently overexpressed proteinase 3 ((Molldrem et al, 1996; Molldrem et al, 1997), suggested that high avidity PRl- CTL might be undetectable in untreated CML patients due to selective elimination by CML cells that overexpress the target antigen.
- Apoptosis was abrogated in the presence of the BB7.2 blocking antibody to HLA-A2.1, and no apoptosis was observed when 20 ⁇ M of the irrelevant peptide Flu was used instead of PRl.
- low avidity PRl-CTL did not undergo apoptosis when challenged with either high or low concentrations of PRl.
- co-incubation studies were performed with HLA matched BM cells from CML patients followed by staining for Annexin V, for 16 to 18 hr after co-incubation.
- High avidity PRl-CTL underwent apoptosis by 18 hr after co-culture with BM from an HLA-matched patient with CML in chronic phase with 100% Ph+ cells (FIG. 17A).
- No apoptosis was induced by co-incubation with BM cells from an HLA-A2 negative CML patient with 100% Ph+ cells, or by co-incubation with BM cells from an HLA-A2+ healthy donor.
- less than 1% of the low avidity PRl-CTL underwent apoptosis when challenged with either the HLA-A2+ or HLA-A2- CML cells (FIG. 17B).
- the only high affinity PRl-CTL were CD45RA+/CD28+/CCR7+/CCR5-, indicating an effector memory or possibly a na ⁇ ve phenotype.
- PRl peptide vaccine can elicit PRl-CTL immunity in patients with myeloid leukemia.
- Preliminary data suggesed that in myeloid leukemia patients in whom a PRl-specific CTL immune response could be elicited or increased, PRl-CTL would convey an anti-leukemia immune response and contribute to remission.
- phase I/II vaccine study was initiated.
- HLA-A2 + patients with CML (interferon-resistant or relapsed after BMT), AML (smoldering relapse or > 2nd CR) or MDS (RAEB or RAEBt) with no detectable antibodies to proteinase 3 (no detectable cANCA) were eligible.
- Patients that relapsed after BMT or those ineligible for BMT were also eligible for study.
- Pregnant patients, H1V+ patients, and those with known vasculitis were excluded. Patients were required to have immunosuppression (i.e. cyclosporine, steroids) discontinued 4 weeks prior to study entry.
- Primary endpoints were (1) toxicity assessment including the induction of autoimmunity resembling Wegener's granulomatosis, the systemic vasculitis associated with cANCA antibodies; and (2) induction of an immune response assessed by cytokine flow cytometry (CFC) of ⁇ -IFN and PR1/HLA-A2 tetramer staining of PBMC before and 3 weeks after the last vaccination.
- CFC cytokine flow cytometry
- clinical responses were assessed by standard criteria with bone ma ⁇ ow biopsy, cytogenetic studies (standard chromosome banding) and molecular studies (PCR for bcr-abl or other known abnormalities such as t(15;17), invl6, etc.) 3 weeks after the last vaccination.
- Phase I consisted of nine patients treated in cohorts of three at 1 of 3 dose levels of 0.25 mg, 0.5 mg, or 1.0 mg of PRl peptide given subcutaneously in incomplete Freund's adjuvant (Montanide ISA-51) and GM-CSF 75 mg subcutaneously every 3 weeks for 3 injections.
- the Phase II part ofthe study enrolled patients in cohorts of 4 randomized to one ofthe same three PRl peptide doses since none ofthe doses were eliminated on the basis of toxicity during the Phase I part of the study.
- a continuous reassessment model was used in the statistical design to assess best dose level using criteria of immune response (> 2-fold increase in the number of PRl-specific CTL during the vaccine study period) and grade 3 or 4 organ toxicity. If any patient developed vasculitis and/or cANCA, the trial would be stopped, and if any individual patient developed grade 3 or 4 organ toxicity the vaccine would be withheld for that patient.
- Any dose level would be discontinued if the number of patients with grade 3 or 4 toxicity, divided by the number of patients evaluated for toxicity, is greater than or equal to 3/4, 4/8, 5/12 or 6/16. Any dose level would be terminated if none ofthe first 12 patients in that dose level have an immune response. If an immune response was noted, patients would continue to be entered onto that dose level, by continued randomization, to a maximum of 20 patients per dose level. If any clinical response was noted during the study period either with or without a measurable immune response, this would be considered an efficacy endpoint and patients would be entered onto that dose level to a maximum of 20 patients per dose level.
- a grade 2 cutaneous injection reaction was noted in one patient (UPN13, FIG. 20) at dose level 3 by two weeks after the first injection, which resolved after 1 week, and mild fatigue was noted in 4 patients.
- Skin biopsy from UNP13 showed a perivascular lymphocytic infiltrate and PR1/HLA- A2 tetramer staining confirmed that 65%» of CD8+ lymphocytes were PRl-specific, demonstrating a localized immune response (FIG. 20).
- Immune response defined as a > 2-fold increase in the percentage of tetramer+ PRl-CTL, was noted in 8 of the 15 patients (FIG. 21).
- Vaccine-induced PRl-CTL contribute to cytogenetic remission.
- PRl- CTL induced remission cells were examined from UPN4, a 27-year-old man with APL in 4th relapse previously treated with allogeneic BMT and 3 escalating doses of DLI who separately consented to have PBMC collected by leukapheresis (LP) one month after the last vaccination.
- LP leukapheresis
- Donor-derived PRl-CTL increased from 0.1 %> to 0.54%> after the 3rd vaccination, and were enriched for effector memory CD45RA+/ CD28+/CD57- donor-derived CTL (by PCR microsatellite analysis), which correlated with loss of t(15;17) transcripts by RT-PCR 6 weeks after the first vaccination(FIG. 24A).
- PRl-CTL persist at 0.2% 22 months after completing the vaccinations.
- Tetramer sort-purified PRl-CTL obtained after vaccination showed PRl specificity against peptide-pulsed T2 cells, and 44%o lysis of the BMC collected at time of relapse versus only 14% lysis of BMC taken at time of remission, at E:T 10:1 (FIG.
- PRl-CTL immunity was elicited at the time of 2nd relapse.
- This 32-year-old man received an autologous transplant while in 2nd remission and had no evidence of AML by FISH using probes for invl6.
- his platelet count fell to 24,000 and he had invl6 by FISH (FIG. 25).
- dose level 1 dose level 1
- T cell tolerance from loss of high avidity PRl-CTL and downregulation of P3 antigen correlates with progression of CML after vaccination.
- UPN6 a non-responder, was found to have both high and low avidity PRl-CTL prior to vaccination with 0.5 mg of PRl, but only low avidity PRl-CTL 3 weeks after the last injection (FIG. 27).
- PRl/ HLA-A2 tetramer-sorted CTL showed peptide-specific lysis of T2 cells pulsed with 20 ⁇ M PRl that was similar to PRl-CTL from UPN4 that produced nearly equivalent lysis (on a per cell basis) of T2 cells pulsed with only 2 ⁇ M PRl.
- UPN6 received the same peptide dose as the responder UPN4 during vaccination, this dose was sufficient to eliminate the high avidity PRl- CTL and allow outgrowth of CML.
- Monocyte-derived dendritic cells can expand autologous PRl-specific CTL and PR1/HLA-A2 monomers can be used to select PRl-CTL for adoptive immunotherapy.
- Another central aspect of this invention is that CTL that contribute to GVL and those that cause GVHD after allogeneic bone ma ⁇ ow transplantation (BMT) target unique antigens.
- BMT allogeneic bone ma ⁇ ow transplantation
- PRl-specific CTL could be identified in the peripheral blood of BMT recipients that were in cytogenetic remission using soluble peptide/MHC tetramers to stain peripheral blood mononuclear cells. More recently, the inventors have studied the peripheral blood of AML patients that received of nonmyeloablative stem cell transplant (NST) regimens for evidence of PRl-CTL. Patients were studied around day 60 post-NST using HLA-A2 tetramers folded with different peptide epitopes to determine whether immunity directed against minor histocompatibility antigens such as HA-1 coexisted with immunity against self peptides such as PRl.
- NST nonmyeloablative stem cell transplant
- DC expanded from peripheral blood monocytes were employed using both interferon- ⁇ 2b (IFN) and GM-CSF, as these cells would be useful as peptide-pulsed APC to expand antigen-specific T cells (Santini et al, 2000).
- DC expanded for 7 days were compared using IFN (1,000 U/ml) and GM-CSF (500 ng/ml) versus DC expanded for 7 days with IL-4 and GM-CSF.
- the yields of PRl-specific CTL from autologous PBMC were compared using each of these APCs from 7 healthy HLA-A2+ donors (FIG. 30).
- PBMC from each of the patients were stimulated weekly with PRl peptide-pulsed T2, JFN + GM-CSF-tieated DC (DC/IGM) or IL-4 + GM-CSF-tieated DC (DC/4GM).
- DC/IGM JFN + GM-CSF-tieated DC
- DC/4GM IL-4 + GM-CSF-tieated DC
- the inventors have shown that patients with CML that have a cytogenetic response to JFN- ⁇ or that are in remission after allogeneic BMT have circulating cytotoxic T lymphocytes (CTL) with specificity for the HLA-A2 restricted peptide PRl.
- CTL cytotoxic T lymphocytes
- the PRl-CTL show peptide- specific lysis of leukemia and are long-lived in some patients. Although this shows that PRl- CTL may be important in clearing the malignant cells, it is not clear whether PRl-CTL developed in response to the malignancy and are sufficient for the elimination of it.
- PRl-CTL from UPN4 showed 49% specific lysis of CML bone ma ⁇ ow (BM) cells obtained prior to BMT compared to only 27% specific lysis by the tetramer- CTL at E:T 10:1.
- PRl-CTL from UPN4 showed 44% lysis of BM at time of relapse versus only 14% lysis of BM taken at time of remission.
- the CD8 + PR1/HLA-A2 tetramer negative cells showed only 25%> and 6% lysis of relapse and remission BM, respectively, at E:T 10:1.
- CTL CTL with high avidity T cell receptors ex vivo.
- PRl-CTL preferentially kill leukemia over nonnal BM due to P3 overexpression, and because P3 is only expressed in hematopoietic tissue, it was indicated that adoptively transferred PRl-CTL will produce GVL without GVHD. It has also been shown that high avidity PRl-CTL are more efficient killers of leukemia cells, although they may also undergo apoptosis when incubated with highly P3 -expressing leukemia cells.
- PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10%> human serum (HS) with the addition of the above cytokines.
- T2 cells were maintained in RPMI + 10% HS prior to co-culture with donor PBMC.
- DC were pulsed with 20 ⁇ g/ml PRl peptide, irradiated and combined with fresh PBMC from the same donor at a 1:2 ratio.
- the culture was restimulated with PRl-pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures.
- AAPC AAPC
- HLA-A*0201 heavy chain and ⁇ 2- microglobulin were each produced in E. coli and the expressed protein was folded in vifro in the presence of PRl. Folded monomeric complexes were purified by gel filtration and ion exchange.
- the PR1/HLA-A2 monomers were then mixed with dioleolyl phosphatidylcholine (DOPC) (Avanti Polar Lipids), at molar ratios of 1:100, 1:500 or 1:1000, frozen in dry ice/acetone bath, and lyophilized overnight to remove organic solvent.
- DOPC dioleolyl phosphatidylcholine
- T2 cells were incubated with PR1/HLA-A2 AAPC (1:100, 1:500, and 1:100 molar ratio) for 3 hr and 24 hrs. After incubation, the cells were surface stained with murine anti-HLA-A*0201 monoclonal antibody BB7.2 and secondarily stained with FITC-labeled goat anti-mouse antibody, and observed under the confocal fluorescent microscope to determine proper insertion of PR1/HLA-A2 into the artificial membrane.
- Typical yields of antigen-specific tetramer+ cell numbers are 3% to 5% PRl-CTL using AAPC or T2 cells, but only 0.3%> to 2% when DC/IGM are used. These observations are likely to apply to HA-1 and other putative target antigens of GVL (WT-1), but all of the comparative experiments will be repeated using these peptides.
- serum-free growth conditions will be compared to 10% HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures, hi preliminary experiments, pooled human AB serum was nearly equivalent to FBS as a supplement to media used to expand DC/ IGM that could then be used as peptide-pulsed APC to expand PRl- CTL (FIG. 32).
- scaleup procedures will be carried out in both flasks and closed bag systems to demonstrate the feasibility for clinical use.
- a particular aspect of this study is to first determine the conditions that produce the highest numbers of functional high avidity PRl-CTL in the shortest period of time. Once conditions are optimized and the scale-up experiments show feasibility, an adoptive immunotherapy study will begin using PRl-CTL generated ex vivo. Weekly tetramer staining during bulk culture restimulations will be used to compare yields and avidity of PRl-CTL, and CFC and cytotoxicity experiments will be used to compare the effector function ofthe cells. Secondly, two methods to select antigen-specific CTL from bulk culture will be compared.
- PRl-CTL will be selected from the bulk cultures using methods described below.
- the use of high-speed flow cytometry will verify separate antigen-specific CTLs using soluble peptide/MHC tetramers. By staining leukeapheresis products with anti-CD8 and PR1/HLA-A2 tetramers, PRl-CTL can be separated from the remainder of CD8+ lymphocytes, and these sorted cells can efficiently kill leukemia cells (FIGS. 24B and 27).
- a dose of 0.9 x 10 6 PRl-CTL/kg could be adoptively transferred to the average 70 kg recipient.
- the cell purity was > 90% and the efficiency was > 95%.
- the IFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen-specific CTL.
- PRl-pulsed CTL After 21 days in culture, these PRl-pulsed CTL, quantified with a PRl -HLA- A2 tetramer conjugated to phycoerythrin (PE), comprised 2% to 8%o of the culture.
- PE phycoerythrin
- a method using streptavidin-coated microbeads was developed and optimized. Beads were conjugated with HLA-A2.1 heavy chain plus PRl myeloid leukemia peptide via a biotin-labeled C-terminus of the heavy chain.
- PRl-pulsed short-term CTL lines were incubated for 30 min with PR1/HLA-A2 coated microbeads and were selected using the magnetic MACS column. Bead-selected and non-selected CTL were quantified by FACS analysis using the PR1-HLAA2 tetiamer and compared to the initial polyclonal CTL lines. Yields ranged from 85% to 100%, and PRl-specific CTL purity ranged from 11% to 21% after selection (3- to 5-fold increase in purity of antigen-specific CTL). Specific lysis of both PRl- coated T2 cells and CML marrow cells increased in all 6 cultures and background lysis of normal HLA-A2.1 normal marrow was eliminated compared to non-selected PRl-specific CTL.
- Another aspect of the invention is to enhance GVL and reduce GVHD by using a preparative regimen to achieve engraftment of transplanted allogeneic blood stem cell or bone marrow, which can then be used as a platform to deliver antigen-specific CTL therapy. It was postulated that GVHD could be eliminated and GVL enhanced by adoptively transferring antigen-specific T cells with preferential GVL activity. Therefore, whether adoptive transfer of high avidity PRl-CTL induces GVL without increasing GVHD will be tested, the clinical trial will determine the maximal dose of PRl- specific CTL that will provide GVL while preventing the development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD ⁇ 15%).
- T cells have been shown to cause GVHD (Drobyski et al, 1994; Mavroudis et al, 1996; Gaschet et al, 1996; Debergie et al, 1997; van Lochem et al, 1992; Barrett et al, 1998), facilitate engraftment (Reich-Zeliger et al, 2000) and are required to prevent rejection with established nonablative preparative regimens developed at M. D. Anderson Cancer Center (Houston, Texas) and elsewhere. Leukapheresis samples from healthy HLA-matched donors will be used to expand PRl-CTL ex vivo, using the expansion methods outlined herein. The expansion methods developed in this invention will also be used for the production of cellular products for clinical use.
- the bulk PRl-CTL cultures contain from 1.5% to 4%> PRl- specific CTL, as observed, by tetramer staining and functional analyses, and based on expansions perviously performed.
- Two leukapheresis products (LP) will be required to (1) elicit sufficient DC/IGM as APC (from cryopreserved aliquots of LP), which will be pulsed with PRl peptide at 0.2 mM to (2) elicit PRl-CTL bulk cultures.
- Clinical-scale expansions will be performed before the adoptive cellular therapy trial with PRl-CTL is begun.
- Quantitative PCR for bcr-abl/abl transcript ratios will be performed monthly to determine whether there is disease progression.
- the ratio is increased by > 2-fold and if the patient has GVHD of ⁇ 2, then the next higher dose of bulk PRl-CTL will be infused. If there continues to be progression, an unmanipulated DLI from the original donor will be infused at a dose of 1 x 10 CD3 T cells/kg. However, if there is a decrease in the bcr abl/abl, patients will be monitored monthly until there is no increase for 2 consecutive months. In this way, dose escalations within each patient and amongst cohorts of 3 patients each will be carried out.
- PRl-CTL infusion will be given in escalating doses starting at 1 x 10 5 , 5 x 10 5 and 1 x 10 6 PRl-CTL/kg of recipient weight.
- the exact number of PRl-CTL will be determined by tetramer staining, and the PRl-CTL will be selected based on the optimal method determined above, hi preliminary experiments, it was shown that peptide/tetramer-coated microbeads, in addition to PR1/HLA-A2 tetramer-based high speed cell sorting using the MoFlo cytometer can be used to enrich for a highly purified PRl-CTL population.
- PRl-CTL Since patients that receive PRl-CTL might have an initial rise in tetramert- cells and a simultaneous clinical response, it is possible they could lose immunity and suffer a relapse. This has been shown for a number of adoptive immunotherapy trials using T cells. Therefore, since in the present invention it has been shown that the PRl peptide vaccine can elicit PRl-CTL in patients with leukemia, it would be prudent to administer the PRl vaccine to patients after adoptive transfer while there is a minimal residual disease state ( ⁇ 10% Ph+ cells, or PCR+ only) and before the tumor burden becomes too large. A large tumor burden may tip the scale in favor of the leukemia due to PRl-CTL apoptosis induced by the leukemia cells.
- the protocol of the clinical trial will contain a provision for patients to receive the PRl vaccine at a dose of 0.25 mg SQ every 3 weeks for 3 injections, the dose and schedule that has elicited long- lasting PRl-CTL after vaccination.
- Statistical considerations including sample size determination and the proper sequencing of within- and amongst-patient dose escalations will be performed once the clinical scale up is confirmed since PRl-CTL cell dose depends upon the efficiency ofthe scale up methods. It is also indicated that high avidity PRl-CTL will preferentially cause a GVL response and contribute to molecular remission without increasing GVHD. Therefore, a randomized control group of patients will receive unmanipulated DLI following a standard treatment approach.
- All patients will have blood collected at weekly intervals up to 4 weeks beyond the last infusion of PRl-CTL or DLI, then monthly thereafter until one year or removal from study. Bone ma ⁇ ow biopsies will be performed on day 30, day 60, then monthly until 6 months, then again at 1 year or until removal from study.
- the overall percentage of functional PRl-CTL in the recipients will be determined by tetramer staining and standard CFC assays.
- the number of pp65-CTL in CMV immune patients will provide an internal control to determine whether the number of PRl-CTL is increased after infusion and whether those cells are long- lived.
- the restorative immunity of unmanipulated DLI will be compared with that of patients receiving adoptively transferred PRl-CTL by determining TREC numbers, CD4 and CD8 counts, and the percentage of CFC+ cells.
- the quality of the PRl-CTL response measured by both TCR avidity and function, is perhaps more important to produce a remission than the more simple measurement of the quantity of PRl-CTL. Therefore, the avidity of the PRl-CTL that exist will be compared in (1) the donor product, (2) the recipient prior to transplant and prior to CTL infusion, and (3) the recipient at time points after infusion using limiting doses of tetramer to stain PBMC.
- This method will be compared to tetramer dissociation half times to confirm the validity of the measurements.
- an aliquot ofthe PRl-CTL product will be used to study whether the high avidity PRl- CTL preferentially kill the patient's CML by using BM target cells cyropreserved prior to BMT, prior to CTL infusion and BM cells taken at time of molecular remission in a standard cytotoxicity assay.
- peptide dose-response CFC assays will be performed, as shown in FIG. 11C for the patients that do not have sufficient cells that can be used as targets in a standard cytotoxicity assay.
- deletional tolerance of the high avidity PRl-CTL occurs after adoptive transfer and compare this to clinical outcome. It is expected that the selective loss of high avidity PRl-CTL will result from the persistence of CML cells with high P3 expression relative to the P3 expression in BM cells from patients that retain high avidity PRl-CTL and who may be in clinical remission. Deletional tolerance will be determined by comparing the relative disappearance of relatively high and low avidity PRl-CTL after transfer and comparing any disproportionate disappearance ofthe high avidity PRl-CTL to the rate of disappearance of high avidity pp65-CTL in CMV-immune patients.
- CML escape from PRl-CTL immunity may be due to additional mechanisms such as decreased expression ofthe P3 antigen. Therefore, the amount of P3 expression in the recipient BM and PBMC will be determined by real-time PCRTM and by flow cytometry and compared to the healthy donors. Data regarding general . immune status in each of the patients, will serve as a baseline for comparing the specific high avidity PRl-CTL within and amongst patients. In addition, the phenotype data will allow for the comparison ofthe differentiation state ofthe PRl-CTL, since an altered maturation phenotype to a terminally differentiated state would be expected to result in ineffective anti-CML immunity.
- TCR-V ⁇ spectiatyping followed by repetitive sequencing of restricted TCR-V ⁇ families will be performed in selected patients.
- this technique can be used to determine the breadth of the PRl-CTL response, and was previously used to follow clonal T cell progression in MDS patients (Kochenderfer et al, 2002).
- the families and the sequences can be compared from PRl/ HLA-A2 tetramer-sorted CTL from each of the products and each of the time points to follow the outcome of individual clones.
- Serum samples from patients will be collected at each ofthe indicated time points so that quantitative measurements of NGAL can be determined. If NGAL is expressed at high levels, then cell proliferation by MTT will be determined after exposure of PRl-CTL to NGAL in vitro.
- PRl peptide vaccine can be used to elicit PRl-CTL immunity in patients with minimal residual disease after autologous bone marrow transplant or after imatinib mesylate (Gleevec) and interferon. The preliminary results have shown no development of Wegener's granulomatosis or other vasculitis thus far, with only grade 2 toxicity seen in one patient.
- a sufficient expansion of low avidity anti-CML T cells may also be effective in eliminating the leukemia, and this expansion would also be enhanced following transplant (Morgan et al, 1998). It will be determined whether the PRl peptide vaccine can elicit PRl-CTL in recipients of autologous BMT for refractory CML. The hypothesis underlying this trial is that PRl peptide vaccination after autologous BMT will allow re-expansion of high avidity PRl-CTL that were previously eliminated by CML cells. In the absence of any potential autoimmune toxicity, it would be expected that the resulting high avidity PRl-CTL contribute to molecular remission.
- the efficiency of this expansion of T cells can be measured as an increase in the total number of high avidity cells, an average increase in overall avidity ofthe induced PRl-CTL, or more rapid expansion kinetics of the high avidity PRl-CTL pool compared to vaccination done without prior transplant.
- the breadth of the PRl-specific TCR repertoire may increase as well after vaccination, which may reflect a more robust and sustainable immune reaction to the peptide and therefore against the leukemia.
- the post-transplant PRl vaccine will be given to recipients of autologous tiansplantation for CML who have progressive disease and are without a suitable allogeneic donor. The.
- GM- CSF 75 mg will be administered as a second injection into the same site as the vaccine.
- Current PRl vaccine trial treating patients with AML and MDS with the same vaccination schedule, has not enrolled enough patients to determine whether there is a clear dose effect on the potential to expand high avidity PRl-CTL.
- the most striking example that peptide vaccine alone can induce molecular remission is patient UPN15 who received autologous BMT 2 months prior to vaccination for 2nd relapse of AML and who received the lowest dose (0.25 mg) of the PRl peptide (FIG. 25). Bone marrow, and peripheral blood will be collected prior to and again 3 weeks after the last of the 3 vaccine injections, and peripheral blood will be collected every 3 weeks while patients are in the trial.
- PRl-CTL TCR avidity will be determined by using limiting dilutions of MHC-I tetramers, and a titer that produces maximal fluorescence intensity separation of a "high” and "low” intensity population, as discussed previously, will be established for each batch of reagent.
- TCR-V ⁇ spectratype will be performed on selected patients in whom the number of PRl-CTL has either increased or decreased by 2-fold or greater to learn whether the breadth of the peptide-specific TCR repertoire has changed.
- Peptide doses ranging from 0.2 ⁇ M to 200 ⁇ M will be used to compare the activation threshold ofthe CTL and this will be compared to TCR avidity measured with tetramer.
- the HLA-A2 -restricted pp65 peptide antigen will be used to compare activation threshold and TCR avidity ofthe respective peptide-specific CTL. That PRl peptide elicits high avidity PRl-CTL in recipients of autologous BMT predicts that pp65-specific CTL will not change the overall avidity after PRl vaccination. If the avidity is noted to increase, however, it may reflect more general changes in the TCR repertoire in those patients that receive transplant.
- the avidity to CTL from patients that have not received transplant will be compared.
- An alternative is that the PRl peptide may fail to elicit any PRl-CTL responses due to nonresponsiveness or anergy. This will be evaluated by measuring surface expression of CD80, CD86, CD28, CTLA-4, and HLA-A2 and HLA-DR expression on BM cells and PRl-CTL.
- P3 expression in the BM before and after vaccination will be compared.
- whether overexpression of P3 in leukemia cells leads to susceptibility to PRl-CTL-mediated lysis ofthe leukemia cells, and also preferentially induces apoptosis of high avidity PRl-CTL over low avidity PRl-CTL will be tested.
- BM and PBMC will also be examined to compare any differences in TCR avidity and P3 expression between the two compartments since BM is the site of a larger number of leukemia cells and high avidity PRl -CTL may be absent in the ma ⁇ ow but still be present in PBMC.
- cause and effect are more difficult to establish in patients compared to animal models where parameters can be more easily manipulated to establish that P3 overexpression in leukemia induces selective loss of high avidity leukemia- specific T cells, it is expected that these experiments are likely to yield important insights into the nature of tolerance since the antigen is well-defined, the tools are established and the patient samples necessary to conduct the experiments are avaiable.
- JFN induces P3 expression in myeloid cells. This increased expression may alter susceptibility to PRl-CTL- mediated killing, but it may also cause apoptosis ofthe PRl-CTL.
- IFN preferentially upregulates P3 only in the patients that achieve cytogenetic remission after treatment with JFN, and in whom a high avidity PRl-CTL immune response is noted by tetramer staimng (FIG. 33). This may be interpreted to mean that P3 overexpression does not lead to selective loss of high avidity PRl-CTL.
- IFN-transduced mesenchymal stem cells MSC
- increased expression of P3 after induction of IFN expression may increase susceptibility to immune attack by P3-specific T cells, while at the same time leading to their ultimate extinction by apoptosis.
- the PRl vaccine administered as 3 injections every 3 weeks as previously described, will induce a PRl-CTL response and whether the vaccine induces cytogenetic and molecular responses in CML patients that are refractory to imatinib mesylate (Gleevec) will be determined. It is expected that the PRl vaccine will induce PRl-CTL in patients that are refractory to imatinib and improve cytogenetic remissions in those patients. It is also expected that potential downregulation of P3 by treatment with imatinib may facilitate expansion of high avidity PRl-CTL induced by the vaccine.
- Patients will be randomized on the basis of HLA-A2 expression to receive JFN alone versus PRl peptide with or without JFN in patients with 10% to 90% Ph+ disease after 9 months of imatinib therapy.
- P3 in BM samples cryopreserved at the time of diagnosis (when available) will be quantified and compared to the time of study entry, and again 3 weeks following the vaccine.
- the P3 expression in vaccine recipients will be compared to patients that receive JFN alone or IFN plus PRl. Because imatinib down-regulates P3 while IFN upregulates P3 expression, it is not possible to predict which mechanism might prevail to alter P3 expression.
- MPO Myeloperoxidase
- MY4-specific CTL show preferential cytotoxicity toward allogeneic HLA-A2.1+ myeloid leukemia cells over HLA-identical normal donor marrow (Braunschweig et al, 2000). MY4-specific CTL also inhibit colony forming unit granulocyte- macrophage (CFU-GM) from the ma ⁇ ow of CML patients, but not CFU-GM from normal HLA- matched donors. Like PRl, MY4 is therefore a peptide antigen that can elicit specific CTL lysis of fresh human myeloid leukemia cells. Other peptides from MPO are predicted to bind to HLA- A2.1, but not all of these have been tested for their potential to stimulate immunity.
- CFU-GM colony forming unit granulocyte- macrophage
- LAA leukemia-associated antigen
- the peptides were synthesized by Biosynthesis (Lewisville, TX) or by the M. D. Anderson Protein CORE Facility (Houston, TX) to a minimum of 95% purity as measured by high-performance liquid chromatography (HPLC). Peptide binding to HLA-A2.1 was confirmed using two assays. In the first, indirect flow cytometry was used to measure HLA-A2.1 surface expression on the A2+ T2 cell line coated with the peptide. T2 cells are a human lymphocyte line that lacks TAP1 and 2 genes and cannot therefore present endogenous MHC class I restricted antigens.
- HLA-A2.1 specific monoclonal antibody (BB7.2, ATCC, Rockville, MD) followed by a FITC-labeled secondary antibody (CALTAG) was used to measure surface expression of HLA-A2.1.
- BB7.2 HLA-A2.1 specific monoclonal antibody
- CAG FITC-labeled secondary antibody
- the dissociation rate of I 125 -labeled ⁇ 2-microglobulin from the heterotrimer complex of the HLA-A2.1 heavy chain, peptide, and ⁇ 2-microglobulin was measured, which allowed calculation of binding half-life (t 2 ).
- the labeled heterotrimer complex was separated from unincorporated ⁇ 2-microglobulin by high-performance liquid
- MPO peptides predicted to bind HLA-A2.1 chromatography gel filtration, and the halftime of disassociation of ⁇ 2-microglobulin were determined by subjecting aliquots of the complex to a second round of gel filtration.
- the control peptides are the PRl peptide and an Influenza B nucleoprotein (aa 85-94; Flu), both with known high binding affinity to HLA-A2.1.
- the long measured tm as measured using ⁇ 2-microglobulin disassociation confi ⁇ ned the binding of MY1 through MY5 to HLAA2.1 (Molldrem et al, 1996).
- EXAMPLE 13 INDUCTION OF PRIMARY CTL RESPONSES TO PEPTIDES The five MPO peptides discussed above, were used to stimulate T cells specific for peptide-coated targets. PBMC from a normal healthy donor heterozygous for HLA-A2.1 were stimulated with peptide-pulsed T2 cells. The T2 cell line has been used by others as an antigen presenting cell for the generation of peptide-specific CTL.
- T2 cells which co-express the costimulatory molecule B7.1
- CM penicillin streptomycin and glutamine
- peptide concentrations ranging from 0.2 to 200 ⁇ g/mL for 2 hr in CM.
- the peptide loaded T2 cells were then i ⁇ adiated with 7500 cGy, washed once, and suspended with freshly isolated PBMC at a 1 :1 ratio in CM supplemented with 10% human serum (HS) (Sigma, St. Louis, MO).
- HS human serum
- rhIL-2 human interleukin-2
- Biosource International Camarillo, CA
- FIGS 35 and 36 show the peptide specific lysis ofthe CTL lines against T2 cells loaded with either 2.0 ⁇ g/mL of MY2 or MY4, or T2 cells without added peptide, at varying effector to target (E:T) ratios.
- E:T effector to target
- No peptide specific CTL lines could be elicited using MY1, MY3 or MY5 peptides, despite testing using different donors and differing peptide concentrations.
- the CTL line generated against the MY2 peptide demonstrated high specific lysis against MY2- loaded target cells, whereas the CTL line generated against MY4 did not demonstiate any significant cytotoxicity against MY2-loaded targets (Molldrem et al, 1996).
- EXAMPLE 14 HLA-A2.1 RESTRICTED CTL RESPONSES
- T2 cells loaded or not loaded with 2.0 ⁇ g/mL MY2 or MY4 were prepared.
- the CTL line generated against the respective peptides were also used to test for specific lysis.
- Mouse monoclonal antibody against HLA-A2.1 (BB7.2) was used to block HLA-A2.1 -restricted recognition by the CTL line.
- T2 cells without peptide, but with antibody present, were used to control for any potential non-specific antibody-mediated cytotoxicity.
- FIG. 37 demonstrates that with the addition of antibody to HLA-A2.1, specific lysis was blocked. Further, there was only background lysis of T2 cells in the presence of antibody alone.
- the data shown in FIG. 37 is the combined results from three separate experiments using three separately generated CTL lines. This demonstrated that the observed cytotoxicity was HLA- A2.1 -restricted.
- FIG. 35 shows the combined results of three separate experiments from three MY4- specific CTL lines.
- MY4-specific CTL The specific lysis by MY4-specific CTL, at various E:T ratios, of either BM from healthy HLA-A2.1 -positive donors, HLA-A2.1 -positive AML patients, HLA-A2.1- negative AML patients, or T2 cells with or without exogenously added MY4 peptide at 2.0 ⁇ g/mL is shown.
- the specific lysis of U937 and HLA-A2.1 -positive K562 cells by MY4- specific CTL was lower than the background lysis observed against T2 cells without added peptide.
- the results show that CTL elicited with the MY4 peptide result in short-term CTL lines with both MY4 and HLA-A2.1 specificity that killed AML cells, but not normal cells.
- FIG. 36 demonstrates typical cytotoxicity results from three experiments with three different MY2-specific CTL lines. Ma ⁇ ow cells from patients with HLA-A2.1 -positive
- HLA-A2.1 -positive normal healthy donor also demonstrated significant lysis (43%> lysis at E:T of 20:1), similar to that ofthe HLA-A2.1 -positive AML cells.
- cytoplasmic MPO All target cells were assayed for the presence of cytoplasmic MPO. After permeabilizing the cell membrane with Ortho PermeaFix (Ortho Diagnostics, Raritan, NJ), staining was performed using a FITC-labeled antibody to MPO (Accurate Chemicals, Westbury, NY) and a PE-labeled antibody to CD34 (Becton-Dickinson, San Jose, CA) followed by flow cytometry. Table 15 lists the percentage of cells in the sample population that stain positive for MPO, as well as the median fluorescence intensity of intracellular MPO staining.
- the percentage of cells expressing surface MHC class I and CD80 was also evaluated in the same target cell populations by staining with FITC labeled antibodies.
- the MY2-specific CTL also showed specific lysis of normal donor ma ⁇ ow cells, which suggests that immunity elicited against this peptide in vivo might result in autoimmunity that would be incapable of distinguishing leukemic cells from normal marrow progenitor cells.
- the CTL were tested against whole marrow from leukemia patients in short-term assays, it was possible that leukemia progenitor cells, which might not abe ⁇ antly express MPO, could escape CTL recognition. Therefore, whether leukemia progenitor cells could be eliminated by MY4-specific CTL in an AML colony-forming assay was investigated. The MPO expression in both leukemia and normal CD34+ cells was also determined.
- FIG. 38 shows the results of colony inhibition assays using CTL derived from a 13 day MY4 peptide-pulsed culture (CTL1).
- CTL1 MY4 peptide-pulsed culture
- CFUGM from normal marrow, Dl and D2 the corresponding HLA identical ma ⁇ ow donors for PI and P2.
- MPO was expressed in early CD34 positive CML cells.
- Ma ⁇ ow was obtained from a patient with CML in CP, a patient with AML, and normal CD34 cells from G-CSF mobilized peripheral blood mononuclear cells from a normal donor for comparison. Cells were first labeled with PE conjugated anti-CD34 antibody (Becton
- FIG. 39 shows that 19% of the CML cells were CD34 positive and 16% of those cells highly expressed Pr3. In addition, CD34-negative cells also expressed MPO. In contrast, none of the normal CD34 positive cells expressed MPO. hi cells from another patient with AML, 57%o of AML cells were CD34- positive and 5%> of those cells highly expressed MPO. This shows that very early progenitor cells overexpress MPO whereas there is no MPO expression normal progenitor cells. To confirm that MPO expression was limited to hematopoietic cells, a panel of human tissues for MPO RNA expression was analyzed using RT-PCR.
- cDNA was amplified with 30 cycles of PCR.
- Primers amplifying a region spanning the 3rd and 4 i coding regions (conjunction position 613, 5' primer 588-610 (CATCTGCTTCGGAGACTCAGGTG (SEQ ID NO:40)), 3' primer 689-672 (TCAGGGAAAAGGCGGGTG (SEQ ID NO:41)) were selected and used to generate PCR products that were then separated on a 2% agarose gel. The gel was imaged on a BioRad analyzer and GelDoc software was used to quantify the products.
- FIG. 40 shows that expression of MPO is limited to bone marrow.
- MHC peptide complexes were extensively purified using FPLC and anion exchange, and biotinylated on a single lysine within the BSP using the BirA enzyme (Avidity, Denver, CO). Tetramers were produced by mixing the biotinylated MHC peptide complexes with phycoerythrin (PE) conjugated Neutravidin (Molecular Probes), or PE(Cy7)-conjugated Neutravidin at a molar ratio of 4: 1. MY2 and MY4 tetramers were validated by staining against a CTL line specific for each peptide.
- PE phycoerythrin
- Neutravidin Molecular Probes
- CMV tetramers were validated by staining with PBMC from a CMV immune individual. Specificity was demonstrated by the lack of staining of irrelevant CTL. By titrating positive CTLs into PBMCs from normal controls, the limit of detection was established to be as low as 0.01% of CD 8+ cells. Each tetramer reagent was titered individually and used at the optimum concentration, generally 20 ⁇ g/ml - 50 ⁇ g/ml.
- peptide/MHC tetramers were examined using peptide/MHC tetramers.
- A2 tetramers were constructed with the following peptides: PRl, MY2, MY4, the CMV pp65 peptide, and the minor antigens HA-1R (a negative control) (den Haan et al, 1998) and HA-1H (the allele against which CTL responses have been shown) (den Haan et al, 1995; den Haan et al, 1998; Marijt et al, 1995).
- FIG. 41 shows that multiple-tetramer staining is associated with a 0.1 %> loss of sensitivity; however, ratios of antigen specific CTL were preserved when compared to single tetramer staining.
- FIG. 42 staining PBMC from HLA-A2.1 -positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and clironic lymphocytic leukemia) showed there was no detectable CTL immunity against myeloid-specific antigens.
- FIG. 42 shows that staining PBMC from HLA-A2.1 -positive healthy donors and from patients with lymphoid-derived tumors (multiple myeloma and clironic lymphocytic leukemia) showed there was no detectable CTL immunity against myeloid-specific antigens.
- FIG. 41 shows that multiple-tetramer staining is associated with a 0.1 %> loss of sensitivity; however, ratios of antigen specific CTL were preserved when
- both PRl-CTL and MY4-CTL are detected in the peripheral blood of these patients, but MY2-CTL is not detected (the limit of sensitivity is 0.01% in cell titration experiments).
- This figure shows a representative patient sample of peripheral blood that was obtained on day 60 post-NST and stained using the multiple tetramer methodology and CD8 and then analyzed using CellQuest software. Next, a total of 9 HLA-A2+ NST recipients were examined on day 60 post-transplant for immunity against each ofthe 6 peptides. By comparing relapse rates, as summarized in FIG.
- PRl /HLA- A2 tetiamer+ CTL from a donor lymphocyte (DLI) product obtained from leukapheresis were stained, sorted and tested for lysis of both donor and recipient (which contained > 90% blasts) cryopreserved BM.
- the recipient was in remission by 6 months after allogeneic BMT, but relapsed with chronic phase CML by 12 months with 100%> Ph+ BM cells.
- the patient was then treated with a total of 7 x 10 7 DLI per kilogram body weight from months 12 to 13 with no other therapy, and was in remission with 0%> Ph+ BM cells by month 18 when PBMC were available for testing.
- the yield of sorted PR1/HLA-A2 tetramer+ cells was 81%>, with 90% purity, and the sorted tetramer- negative population contained no detectable PR1/HLA-A2 tetramer+ CTL.
- the sorted PR1/HLA-A2 tetramer positive CTL showed greater lysis of recipient ma ⁇ ow taken from time of relapse than the non-sorted PBMC.
- the sorted PR1/HLA-A2 tetramer negative CTL showed less lysis of recipient BM than non-sorted PBMC, it was above background lysis against donor BM.
- PR1/HLA-A2 tetramer sorted PBMC showed lysis of HLA-A2.1+ CML cells from 2 unrelated patients, but no lysis of either HLA-A2.1- CML cells or HLA-A2.1+ normal donor marrow cells at E:T ratio of 5:1.
- CTL with specificity for peptides such as MY4 which are identified using a deductive strategy, can successfully be translated to the clinic, a phase I clinical trial using the PRl peptide as a vaccine with incomplete Freund's adjuvant and GM-CSF was initiated. This further demonstrates that highly useful LAA can be identified using these methods.
- Patients eligible for the vaccine included HLA-A2+ CML and AML patients that had failed conventional therapy or AML patients that were in 2nd CR (i.e. at high risk of relapse).
- PRl was administered subcutaneously at 0.25, 0.5 or 1.0 mg every 3 weeks for 3 injections, PRl-specific CTL immunity was elicited in 6 of 9 patients (by tetramer staining) and complete remissions were obtained in 2 patients (1 AML and 1 CML patient).
- the patient with AML was positive for the t(15;17) translocation and subsequently became PCR negative after vaccination.
- the expanded PRl-specific CTL from peripheral blood of that patient were isolated by tetramer staining and relapsed BM cells were killed, but not BM cells taken during remission.
- This technique may be applied to the treatment of other forms of leukemia, to other HLA types and potentially to other tumors as well.
- Pr3 and MPO were investigated as tissue-restricted proteins and it was found that the HLA-A2.1 -restricted self- peptides, PRl and MY4, derived from Pr3 and MPO, respectively, can be used to elicit peptide- specific CTL that preferentially attack myeloid leukemia based on aberrant expression of the parent proteins in the target cells.
- PRl was established as a leukemia-associated antigen.
- MY4-specific CTL will be given in an adoptive immunotherapy study with nonmyeloablative stem cell transplant, and in a clinical phase I trial other peptide antigens that are identified will be added to this approach.
- MY4-specific CTL will be selected and expanded ex vivo with the MY4 antigen for the production of leukemia-reactive CTL to produce a GVL effect and minimize GVHD.
- HLA-A2-restricted peptides Using the same method used to deduce HLA-A2-restricted peptides, several more peptides that are predicted to bind with high affinity to their respective HLA alleles have been identified. These peptides are shown in Table 16 and Table 17. As shown previously, peptides with predicted disassociation half-times of > 10 are the most likely to bind to the relevant HLA alleles (Molldrem et al, 1996). Therefore, all 20 of the A3- and B7-restricted peptides will be synthesized and examined. All peptides will be synthesized to a minimum of 95% purity. The peptides will be dissolved in a minimum of DMSO and solubility characteristics will be noted.
- Binding of each ofthe HLA-A2.1 -restricted peptides will be performed using wild type T2 cells using the method of determining HLA-A2 stabilization by indirect fluorescence and flow cytometry. Relative fluorescence will be obtained using the BB7.2 hybridoma (ATCC) and compared to peptides with known binding characteristics, PRl and pp65.
- Table 16 MPO peptides predicted to bind HLA-A3 HLA-A3 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
- HLA-A3 and HLA-B7 alleles from EBV-transformed B cells derived from HLA-A3+ and HLA-B7+ normal donors were first cloned. These genes were inserted into the BirA- containing cassette that was used to construct the HLA-A2.1 tetramers and were then used to fold HLA-A3 and HLA-B7 tetramers using peptides with known high binding affinity to the respective alleles. Tetramers folded with the newly identified peptides will be used as reagents to test whether patients have evidence of circulating peptide-specific CTL.
- the peptide-specific CTL lines generated in vitro from healthy donors that show peptide-specific lysis will be used as "reagents" to confirm the specificity ofthe tetramers.
- the A3 and B7 alleles have also been cloned into a mammalian vector containing the CMV promoter (Clonetech). Electroporation will be used to transduce T2 cells with these vectors. The transduced T2 cells will then be expanded for up to 1 month and sort-purified using the MoFlo high-speed cell sorter based on increased A3 or B7 surface expression after the addition of stabilizing A3- and B7-binding peptides.
- the resulting T2 cells can then be used to determine whether the predicted peptides from Tables 16 and 17 bind to A3 and B7 by using A3- and B7-specific monoclonal antibodies (hnmunotech and Pharmingen), and measuring surface expression. These binding results will be compared to peptides with known binding affinities to A3 and B7, such as influenza matrix and CMV pp65-derived peptides. The relative binding affinities of these peptides to the HLA allele will be determined by serial dilutions of each peptide and comparing them to PRl after analyzing for surface HLA expression by flow cytometry. In this way, an IC 50 value will be determined for each peptide.
- the resulting peptide-elicited CTL lines will be characterized for their ability to kill peptide-coated T2 cells, fresh leukemia cells and established leukemia cell lines such as U937 and K562.
- HLA restriction will be confirmed using targets without the relevant allele and by blocking experiments with antibodies specific for the relevant alleles.
- the amount of target cell killing will be determined using a standard 4-hr assay (Molldrem et al, 1996; Hensel et al, 1999) and will be correlated with target antigen expression and surface phenotype ofthe leukemia cells and healthy donor BM cells.
- Table 17 MPO peptides predicted to bind HLA-B7HLA-B7 Peptide Start (aa) Subsequence Residue Half-Time Position Disassociation
- MPO intracellular protein expression will be detennined using direct intracellular FACS staining for the MPO protein with a FITC-labeled murine monoclonal antibody.
- This intracellular stain will be combined with surfaced antibodies for myeloid differentiation markers such as CD34, CD33, CD13, CD14, CD16 and HLA-DR to determine which stage of differentiation might be more susceptible to CTL killing.
- the MoFlo cytometer is capable of simultaneous 10-color analysis, which will greatly facilitate the analysis of progenitor stage of development. Both BM and PBMC will be examined similarly for MPO expression and surface phenotype and compared to determine whether there are differences in target susceptibility based on location (marrow vs. peripheral blood).
- CTL with specificity for myeloperoxidase-derived peptides can be detected in vivo in patients at diagnosis, before and after NST and after treatment with chemotherapy. Because CTL lines against both MY2 and MY4 could be elicited from normal donors and kill AML cells, it was next determined whether it was possible to detect these CTL in the peripheral blood of patients with AML. In contrast to CTL with specificity for MY4, MY2-specific CTL caused lysis of both leukemic and healthy bone ma ⁇ ow cells, which suggested it would be unlikely to find high circulating numbers of MY2 -specific CTL since these might mediate autoimmunity in addition to anti-leukemia immunity.
- LAA leukemia associated antigen
- PBMC samples will be obtained prior to transplant and then weekly after transplant, beginning on day 10 and continuing until day 100. Patient samples will then be examined at each follow-up in the BMT clinic, which will be monthly until 1 year post- transplant.
- PBMC samples will also be obtained from the donor pre-transplant.
- BM cells will be obtained from the donor if BM is used as the graft, and from the recipient prior to transplant and again on days 30, 100 and day 365 post-transplant.
- the PBMC and BM samples will be cryopreserved.
- PBMC samples will be used for later evaluation as more peptides are identified as potential LAAs (as discussed herein).
- the lymphocytes for surface expression of several markers will be examined including CD3, CD4, CD8, CD16 + 56, CD45RA, CD45RO, CD57, CD28, CD27 as well as tetramer staining.
- the maximum number of tetramer + cells during the time course of study will be determined.
- Prior experience with viral antigen-specific CTL, with HA-1 -specific CTL and with PRl-specific CTL suggest that the peak number of tetramer+ cells occurs over a 3 to 4 week period and often coincides (or may lag by a week or two) with the time of documented remission. Furthermore, the peak for other peptide- specific CTL is usually in the range of 1% to 10%.
- BM cells will be studied for MPO expression using intracytoplasmic staining combined with surface phenotypic makers that will allow the determination of the point of maturation of the BM cells.
- CDl la CD13, CD14, CD16, CD33, CD34, CD80, CD86, HLA-ABC and HLA-DR will be examined. Because MY4 and the other peptides in this study are self-antigens, it is possible that AML patients tieated with chemotherapy alone may have circulating numbers of MY4/MHC tetramer+ cells based on a previous study of CML patients using the PR1/HLA-A2 tetramer, however, this would seem unlikely. If these peptides are detected in AML patients that are in remission it may indicate that post-chemotherapy recovery of immunity is important for obtaining remission and the length of remission duration.
- All or nearly all of the 90 patients who start NST will be in complete remission or achieve it following NST therapy. From 30 to 40 relapses will have occu ⁇ ed at the time of data analysis, one year after the last patient is treated. Patients will be classified into two groups based on whether or not the patients have detectable tetramer+ cells. The association of response duration to tetramer positivity status will be modeled assuming proportional hazards. The study is powered to detect a tripling in risk of relapse associated with failure to detect tetramer+ lymphocytes. In addition, separate assessments of the association of tetramer positivity with duration of response determined by molecular and cytogenetic methods, will be made.
- MY4-CTL will also be important to determine whether the MY4-CTL are functional.
- Various methods of assessing function have been described, including cytokine secretion, CD69 upregulation, cell proliferation, and cytotoxicity. Tetramer staining and cytokine flow cytometry (CFC) will simultaneously be determined on all patients since the MoFlo will greatly facilitate these experiments.
- PE-labeled antibody to gamma- interferon and PECy7- labeled tetramers will be used to in these studies. Cells will first be labeled for 10 min at 37°C with tetramer and FITC-labeled CD8 and then stimulated with MY4 peptide at 2 ⁇ g/ml.
- Brefeldin A will be added during culture to inhibit secretion of cytokines, and after 6 hr cells will be permeabihzed and stained for interferon. This technique has been successfully used to monitor PRl-CTL responses after vaccination and it was found that CFC positivity co ⁇ elates with cytotoxicity.
- the tetramer+ population will be purified by high-speed sorting using the MoFlo cytometer. Both the tetramer+ and tetramer-cells will be tested for cytotoxicity against cryopreserved leukemia targets prior to NST or chemotherapy.
- the MoFlo is capable of 4-way simultaneous sorting, the killing of peptide-coated target cells of the MY4- CTL will be compared to other peptide-specific CTL (i.e. pp65 in serpositive patients) to directly compare lytic potential.
- peptide-specific CTL i.e. pp65 in serpositive patients
- monocyte- derived DC Although there are many potential sources for precursors to mature DC, including CD34+ cell-derived hematopoietic precursors, monocyte- derived DC have been chosen because they are more readily available in large numbers from donor leukapheresis products. For practical reasons, this methodology is most likely to yield the greatest potential number of DC, which will be needed to grow low precursor frequency self- antigen specific CTL. For similar practical reasons, the use of interferon (IFN) and GM-CSF to grow DC, with or without TNF- added to mature the cells during the last 48 to 72 hr of culture have been studied. The advantage is that both JFN and GMCSF are commercially available and have been used extensively in humans.
- IFN interferon
- GMCSF are commercially available and have been used extensively in humans.
- DCs were grown using combinations of either 1,000 U/ml IL-4 plus 500 U/ml GM-CSF (termed DC/4GM) or 1,000 U/ml interferon- ⁇ 2b plus 500 U/ml GM-CSF (termed DC/IGM).
- DC/4GM 1,000 U/ml IL-4 plus 500 U/ml GM-CSF
- DC/IGM 1,000 U/ml interferon- ⁇ 2b plus 500 U/ml GM-CSF
- Previously cryopreserved PBMC from HLA-A2+ healthy donors were thawed, washed and adhered to plastic flasks prior to the addition of media + 10%) human serum (HS) with the addition ofthe above cytokines.
- T2 cells were maintained in RPMI + 10%. HS prior to co-culture with donor PBMC.
- DC were pulsed with 20 ⁇ g/ml PRl peptide, i ⁇ adiated and combined with fresh PBMC from the same donor at a 1 :2 ratio.
- the culture was restimulated with PRl-pulsed DC (or T2) and on day 8 IL-2 at 20 U/ml was added to the cultures. Restimulation and IL-2 addition was repeated weekly until day 26 through 28 when the PRl-CTL cultures were tested for their ability to lyse PRl-coated target cells or CML cells.
- the PRl-CTL were also evaluated for surface phenotype with the PR1/HLA-A2 tetramer and anti-CD8.
- Typical yields of antigen-specific tetramer+ cell numbers were 3% to 5% PRl-CTL using AAPC or T2 cells, but only 0.3%) to 2%o when DC/IGM are used. These observations are likely to apply to MY4, but all of the comparative experiments will be repeated using this peptide.
- serum-free growth conditions will be compared to 10%> HS and 5% albumin as a serum substitute in both the DC cultures and the CTL cultures. This will determine the optimal conditions that produce the highest numbers of functional MY4-CTL in the shortest period of time.
- MY4-CTL obtained after 4 wk of weekly restimulation will be incubated with MY4 antigen and the bi-specific antibody with anti- CD45 and anti-JFN binding will be co-incubated with the cells.
- a secondary antibody with anti- JFN antibody that is directly linked to microbeads supplied by Miltenyi, Inc., Germany
- the JFN capture method will be compared to a modified peptide/MHC-conjugated bead method developed to select antigen- specific CTL.
- the device may not capture all CTL with the potential to recognize the cognate peptide/MHC ligand. Since it is unclear whether non-secreting antigen- specific CTL might be required to maintain the more functional fraction in vivo, or whether the non-secreting CTL later become able to express effector function, too few CTL may be selected using the commercial product. Monomer coated beads are likely to capture all of the available antigen-specific CTL from the bulk culture, as shown in previous studies. To determine whether peptide antigen-specific CTL can be adoptively transferred to myeloid leukemia patients after T cell-depleted NST to facilitate engraftment, boost GVL and reduce GVHD.
- the overall treatment strategy to enhance GVL and reduce GVHD is to use a nonablative preparative regimen to achieve engraftment of allogeneic blood stem cell or bone marrow transplant and to be the platform to deliver antigen-specific CTL therapy.
- the goal is to detennine the maximal dose of MY4-specific CTL that will provide engraftment in > 80% of patients while preventing development of acute GVHD (the baseline rate of grade 3 and 4 acute GVHD ⁇ 15%) and mediating a GVL effect.
- T-cells have been shown to facilitate engraftment and are required to prevent rejection with the established nonablative preparative regimens.
- this study extends this therapeutic strategy, with manipulation of donor cells to reduce alloreactive cells by enriching for MY4-CTL (and other antigen-specific CTL determined previously). This will be accomplished by selecting and adoptively transferring the MY4-CTL. These cells thus, would not be expected to react against the recipient tissues, but would still be able to mediate anti-leukemia effects.
- Patients with AML who have an HLA compatible related or unrelated donor who failed to respond to initial chemotherapy or after relapse will be used. Lymphocytes will be collected from the donor by apheresis with a goal of collecting 2 x 10 8 CD3+ T-cells/kg.
- Donor type peripheral-blood mononuclear cells are plated in 75-mm flasks at 2 x 10 6 cells/ml and stimulated with 2 x 10 6 i ⁇ adiated donor-derived DC from the patient's donor. If other methods, as discussed above, produce superior results, the procedure will be modified to incorporate those methods. CTL bulk cultures will be restimulated weekly, as described herein. After 28 days of co-culture, the cells will be harvested and live cells will be isolated on FicoU gradient. The cultures are treated with IL-2 20 U/mL final concentration on day 8 and weekly thereafter.
- All the responders and stimulators are suspended into RPMI- 1640 medium with 2 mM L-glutamine, 100 U/mL penicillin, 0.1 mg/mL streptomycin, 25 mM Hepes, 1 mM sodium pyruvate, 0.1 mM non-essential amino acids and 5 x 10 5 M 2-mercaptoethanol.
- Autologous serum at 10% will be supplemented. This will be modified if the results show that albumin or serum-free conditions can be substituted.
- Stem cells will be collected from the donor's blood after G-CSF administration according to standard procedures. If there is a medical contraindication to G-CSF administration, stem cells will be collected by bone ma ⁇ ow harvest.
- Apheresis will occur daily for up to a total of four procedures in order to collect > 5 x 10 6 CD34+ cells/kg recipient weight after positive selection of CD34+ cells.
- the minimal acceptable number is 2 x 10 6 CD34+ cells/kg recipient weight.
- Cells will undergo CD34 selection using the Isolex or Miltenyi device with the final composition including > 2 x 10 6 CD34+ cells and ⁇ 1 x 10 5 T-cells/kg.
- the apheresis product from each day will be cryopreserved according to standard procedures.
- patients will receive fludarabine 25 mg/m 2 intravenously daily at the same time over 30 min on days 6, 5, 4, 3, 2 and melphalan 70 mg/m 2 on day 3 and 2 administered following completion of the fludarabine.
- the allogeneic hematopoietic cell infusion consisting of > 2 x 10 6 CD34+ cells plus MY4-CTL is administered on day 0.
- MY4-CTL will be administered in a phase I study to define the maximal dose that can be administered without producing GVHD. Tetramer staining will be performed at the end of bulk culture.
- Dose levels will be 1: 5 x 10 7 CD8+ cells/kg; 2: 1 x 10 8 CD8+ cells/kg and 3: 5 x 10 8 CD8+ cells/kg.
- Patients will not receive post transplant immunosuppressive therapy or growth factors, but will receive standard supportive care for prevention of infection. It is predicted, based upon previous results, that current expansion techniques will yield sufficient MY4-CTL from the collection of 2 x 10 8 CD3+ T-cells/kg. Patients will be assessed for engraftment and chimerism on days 28, 56, 90, 180, 365 and yearly post transplant.
- Chimerism will be assessed by microsatellite STR (short tandem repeat) markers and analyzed using GeneScan software on peripheral blood, assaying both T-cells and myeloid cells separately. Engraftment is defined as documentation of > 50% donor derived T-cells on day 90. Disease remission will be assessed by bone marrow evaluation on day 28, 90 and 180 and as indicated thereafter. Acute and chronic GVHD will be assessed by standard criteria. Peripheral blood will be collected weekly for tetramer staining and for surface phenotyping, as performed above. Evaluation for Donor Leukocyte Infusion. If no GVHD is observed, and if antigen- specific CTL are no longer detectable, patients will be evaluated at day 45 for infusion of antigen specific T cells.
- STR short tandem repeat
- graft failure occurs in 2 of a given group without GVHD, the dose will be considered too low to ensure engraftment and subsequent patients will be entered at the next higher dose level. If grade 3 acute GVHD does not occur in a given group, subsequent patients will receive the next higher dose level. If grade 3 acute GVHD occurs in one patient, 6 additional patients will be treated at a given level. If grade 3 acute GVHD occurs in 2 patients (out of a maximum of 12) at a given level, the rate of GVHD will be considered excessive and that level will be tenninated. The MTD is the level, which allows engraftment in at least 5 of 6 patients without excessive GVHD. Ten additional patients will be treated at the MTD.
- a phase I trial will be conducted in which a maximum of 60 patients will be assigned among the three levels of cell doses. Outcomes to be monitored are immune response and occurrence of GVHD, both defined over a 100-day period from receipt of transplant. Within each dose group, the goals are to achieve a rate of at least 20% of patients with immune response while maintaining at most a 20% rate of GVHD. Patient outcomes will be monitored and compared to stopping boundaries computed using a Bayesian method. Priors will be based on results of the PRl peptide vaccine trial of active immunotherapy, and doses are assumed independent.
- the vaccine trial has shown a peak tetramer response of 2%> of all CD8+ T-cells, which will provide a good starting estimate for the design of a passive adoptive transfer cell therapy protocol. Stopping boundaries will be computed using available software. This is intented to terminate a dose level if the computed probability of achieving at least a 20%> immune response rate based on accumulated data is less than 10%, or the probability of 20%> GVHD rate is at least 90%>. Among dose levels not terminated early, the dose level having the highest observed immune response rate will be declared optimal, unless there are major differences in GVHD rates.
- MY4/HLA-A2 tetramer could be used to select for a homogeneous population of leukemia- reactive CTL might allow for the first time the adoptive transfer of CTL across MHC barriers to treat leukemia (Toes et al, 1996).
- cyclin E family of proteins were investigated, because it is well known that cyclin E is constitutively expressed in some tumor cells in dependent of the cell cycle, and aberrantly expressing cyclin E contributes to tumorigenesis as a result of chromosomal instability.
- Cyclin E2 is a homologue of cyclin El and both proteins have restricted tissue distribution.
- cyclin El and E2 are over-expressed in hematological malignancy, cyclin El and cyclin E2 mRNA expression were first analyzed in 21 patients with hematological malignancy (11 CML (CP), 5 CML (BC), 2 AML, 2 ALL, 1 NHL) and 12 normal donors by RT-PCR.
- CML CML
- Nonameric peptides derived from cyclin El and cyclin E2 and predicted to bind to the HLA-A2 allele have similar amino acid sequences, differing only at position 7.
- the binding of CCNEl 144.152 (cyclin El derived) and CCNE2 144 _ 152 (cyclin E2 derived) was compared to that of PRl by a peptide-binding assay.
- PBMCs from 7 HLA- A2 positive normal donors were stimulated with peptide-pulsed T2 cells.
- CCNEl 144 152 -stimulated CTL lines killed both CCNEl 144 _ 152 and CCNE 2 144 _ 152 - ⁇ ulsed T2 cells but not non-peptide-pulsed T2 cells and i ⁇ elevant peptide-pulsed T2 cells.
- CCNE2 144 152 -stimulated CTL lines killed both CCNE2 144 _ 152 and CCNEl 144 152 -pulsed
- each peptide-specific CTLs can recognize both peptides with HLA-A2, but the immunogenicity of each peptide is different between individuals.
- CCNEl 144 152 -specific CTL can distinguish leukemic cell lines from normal PBMCs. From the data, it was concluded that cyclin E1/E2 derived peptides are potential tumor- antigens, because 1) cyclin E1/E2 are highly over-expressed in hematological malignancy, 2) cyclin E1/E2 peptides can sufficiently bind to HLA-A2 to stimulate CTL and 3) CCLE1 144 152 specific CTL preferentially kills leukemic cell lines HLA-A2 restrictively.
- compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of prefe ⁇ ed embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps ofthe method described herein without departing from the concept, spirit and scope ofthe invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
- Patent 5,322,783 U.S. Patent 5,384,253 U.S. Patent 5,399,363 U.S. Patent 5,464,765 U.S. Patent 5,466,468 U.S. Patent 5,538,877 U.S. Patent 5,538,880 U.S. Patent 5,543,158 U.S. Patent 5,550,318 U.S. Patent 5,563,055 U.S. Patent 5,580,859 U.S. Patent 5,589,466 U.S. Patent 5,609,870
- Nicolas and Rubinstein In: Vectors: A survey of nolecular cloning vectors and their uses, Rodriguez and Denhardt (Eds.), Stoneham: Butterworth, 494-513, 1988. Nicolau and Sene, Biochim. Biophys. Ada, 721:185-190, 1982. Nicolau et al, Methods Enzymol, 149:157-176, 1987.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Organic Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Hematology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US49823803P | 2003-08-26 | 2003-08-26 | |
| PCT/US2004/027790 WO2005019435A2 (en) | 2003-08-26 | 2004-08-26 | Anti-cancer vaccines |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1660636A2 true EP1660636A2 (en) | 2006-05-31 |
| EP1660636A4 EP1660636A4 (en) | 2009-07-01 |
Family
ID=34216164
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP04782297A Withdrawn EP1660636A4 (en) | 2003-08-26 | 2004-08-26 | ANTICANCER VACCINES |
| EP04809624A Withdrawn EP1670899A2 (en) | 2003-08-26 | 2004-08-26 | Vaccines for cancer, autoimmune disease and infections |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP04809624A Withdrawn EP1670899A2 (en) | 2003-08-26 | 2004-08-26 | Vaccines for cancer, autoimmune disease and infections |
Country Status (5)
| Country | Link |
|---|---|
| EP (2) | EP1660636A4 (en) |
| JP (1) | JP2007504149A (en) |
| AU (1) | AU2004267506A1 (en) |
| CA (1) | CA2536654A1 (en) |
| WO (2) | WO2005019435A2 (en) |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103285392A (en) * | 2005-04-26 | 2013-09-11 | 卫材R&D管理株式会社 | Compositions for cancer immunotherapy and use thereof |
| CA2523032A1 (en) | 2005-10-07 | 2007-04-07 | Immunovaccine Technologies Inc. | Vaccines for cancer therapy |
| CN106310293A (en) | 2007-09-27 | 2017-01-11 | 免疫疫苗技术有限公司 | Use of liposomes in a carrier comprising a continuous hydrophobic phase for delivery of polynucleotides in vivo |
| US20110097312A1 (en) * | 2008-02-15 | 2011-04-28 | Board Of Regents, The University Of Texas System | Anti-cancer vaccines |
| WO2009146523A1 (en) | 2008-06-05 | 2009-12-10 | Immunovaccine Technologies Inc. | Compositions comprising liposomes, an antigen, a polynucleotide and a carrier comprising a continuous phase of a hydrophobic substance |
| GB201009222D0 (en) | 2010-06-02 | 2010-07-21 | Immatics Biotechnologies Gmbh | Improved cancer therapy based on tumour associated antigens derived from cyclin D1 |
| WO2012079075A1 (en) | 2010-12-10 | 2012-06-14 | Concert Pharmaceuticals, Inc. | Deuterated phthalimide derivatives |
| CN113876945A (en) | 2011-10-06 | 2022-01-04 | 免疫疫苗技术有限公司 | Liposome composition comprising adjuvant for activating or increasing TLR2 activity and application thereof |
| WO2013130849A1 (en) | 2012-02-29 | 2013-09-06 | Concert Pharmaceuticals, Inc. | Substituted dioxopiperidinyl phthalimide derivatives |
| US9249093B2 (en) | 2012-04-20 | 2016-02-02 | Concert Pharmaceuticals, Inc. | Deuterated rigosertib |
| EP2922838B1 (en) | 2012-10-22 | 2018-03-14 | Concert Pharmaceuticals Inc. | Solid forms of {s-3-(4-amino-1-oxo-isoindolin-2-yl)(piperidine-3,4,4,5,5-d5)-2,6-dione} . |
| WO2014110322A2 (en) | 2013-01-11 | 2014-07-17 | Concert Pharmaceuticals, Inc. | Substituted dioxopiperidinyl phthalimide derivatives |
| CN103961306A (en) * | 2013-02-05 | 2014-08-06 | 日东电工株式会社 | Vaccine composition for transdermal administration |
| CN103961697A (en) * | 2013-02-05 | 2014-08-06 | 日东电工株式会社 | Vaccine composition for mucosal administration |
| GB201519303D0 (en) | 2015-11-02 | 2015-12-16 | Imp Innovations Ltd | Phagemid vector |
| GB201706451D0 (en) | 2017-04-24 | 2017-06-07 | Imp Innovations Ltd | Cancer treatment |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1286693A4 (en) * | 2000-06-02 | 2005-07-13 | Univ Connecticut Health Ct | COMPLEXES OF ALPHA-2-MACROGLOBULIN AND ANTIGENIC MOLECULES FOR IMMUNOTHERAPY |
-
2004
- 2004-08-26 WO PCT/US2004/027790 patent/WO2005019435A2/en not_active Ceased
- 2004-08-26 CA CA002536654A patent/CA2536654A1/en not_active Abandoned
- 2004-08-26 AU AU2004267506A patent/AU2004267506A1/en not_active Abandoned
- 2004-08-26 WO PCT/US2004/027792 patent/WO2005035714A2/en not_active Ceased
- 2004-08-26 EP EP04782297A patent/EP1660636A4/en not_active Withdrawn
- 2004-08-26 JP JP2006524856A patent/JP2007504149A/en not_active Withdrawn
- 2004-08-26 EP EP04809624A patent/EP1670899A2/en not_active Withdrawn
Non-Patent Citations (4)
| Title |
|---|
| MOLLDREM J ET AL: "TARGETED T-CELL THERAPY FOR HUMAN LEUKEMIA: CYTOTOXIC T LYMPHOCYTESSPECIFIC FOR A PEPTIDE DERIVED FROM PROTEINASE 3 PREFERENTIALLY LYSE HUMAN MYELOID LEUKEMIA CELLS" BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 88, no. 7, 1 October 1996 (1996-10-01), pages 2450-2457, XP000884740 ISSN: 0006-4971 * |
| MOLLDREM J J ET AL: "Evidence that specific T lymphocytes may participate in the elimination of chronic myelogenous leukemia" NATURE MEDICINE, NATURE PUBLISHING GROUP, NEW YORK, NY, US, vol. 6, no. 9, 1 September 2000 (2000-09-01), pages 1018-1023, XP002993663 ISSN: 1078-8956 * |
| MOLLDREM JEFFREY J ET AL: "Peptide Vaccination with PR1 Elicits Active T Cell Immunity That Induces Cytogenetic Remission in Acute Myelogenous Leukemia." BLOOD, vol. 100, no. 11, 16 November 2002 (2002-11-16), page Abstract No. 8, XP008106166 & 44TH ANNUAL MEETING OF THE AMERICAN SOCIETY OF HEMATOLOGY; PHILADELPHIA, PA, USA; DECEMBER 06-10, 2002 ISSN: 0006-4971 * |
| See also references of WO2005019435A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2005019435A8 (en) | 2006-04-27 |
| AU2004267506A1 (en) | 2005-03-03 |
| JP2007504149A (en) | 2007-03-01 |
| EP1660636A4 (en) | 2009-07-01 |
| WO2005035714A2 (en) | 2005-04-21 |
| CA2536654A1 (en) | 2005-03-03 |
| EP1670899A2 (en) | 2006-06-21 |
| WO2005035714A3 (en) | 2009-04-16 |
| WO2005019435A3 (en) | 2006-06-29 |
| WO2005019435A2 (en) | 2005-03-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20060045881A1 (en) | Anti-cancer vaccines | |
| US20110097312A1 (en) | Anti-cancer vaccines | |
| US10993963B2 (en) | Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers | |
| AU2016368981B2 (en) | Novel peptides and combination of peptides for use in immunotherapy against CLL and other cancers | |
| EP3626731B1 (en) | Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers | |
| US8043623B2 (en) | Immunogenic peptides for the treatment of prostate and breast cancer | |
| US20150250864A1 (en) | Anti-cancer vaccines | |
| US11559550B2 (en) | Peptides and combination of peptides for use in immunotherapy against leukemias and other cancers | |
| EP1660636A2 (en) | Anti-cancer vaccines | |
| US8258261B2 (en) | Induction of tumor immunity by variants of folate binding protein | |
| US20060045883A1 (en) | Anti-cancer vaccines | |
| US10206989B2 (en) | CDCA1 epitope peptides for Th1 cells and vaccines containing the same | |
| US10898562B1 (en) | Immunotherapy against several tumors of the blood, such as acute myeloid leukemia (AML) | |
| US20060045884A1 (en) | Vaccines for autoimmune and infectious disease | |
| JP2002512202A (en) | Vaccine adjuvant for immunotherapy of melanoma | |
| US9573975B2 (en) | Melanoma antigen peptide and uses thereof | |
| HK40016904B (en) | Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers | |
| HK40016904A (en) | Novel peptides and combination of peptides for use in immunotherapy against hepatocellular carcinoma (hcc) and other cancers | |
| CN114072171A (en) | Multivalent immunotherapeutic compositions and methods for treating WT 1-positive cancers | |
| Rivoltini et al. | Tumor immunology: Clinical perspectives | |
| Hampton | Identification and characterization of tumor-associated antigens |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20060302 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL HR LT LV MK |
|
| PUAK | Availability of information related to the publication of the international search report |
Free format text: ORIGINAL CODE: 0009015 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07K 1/10 20060101ALI20060707BHEP Ipc: A61K 39/00 20060101ALI20060707BHEP Ipc: A61K 38/00 20060101AFI20060707BHEP |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12N 20060101AFI20070626BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20090603 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07K 14/00 20060101ALI20090527BHEP Ipc: A61P 35/02 20060101ALI20090527BHEP Ipc: A61K 39/00 20060101AFI20090527BHEP |
|
| 18W | Application withdrawn |
Effective date: 20090625 |