EP1649054A1 - Procede de diagnostic des cancers colorectaux - Google Patents

Procede de diagnostic des cancers colorectaux

Info

Publication number
EP1649054A1
EP1649054A1 EP04747831A EP04747831A EP1649054A1 EP 1649054 A1 EP1649054 A1 EP 1649054A1 EP 04747831 A EP04747831 A EP 04747831A EP 04747831 A EP04747831 A EP 04747831A EP 1649054 A1 EP1649054 A1 EP 1649054A1
Authority
EP
European Patent Office
Prior art keywords
fgf
ofthe
crc
expression
compound
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04747831A
Other languages
German (de)
English (en)
Inventor
Yusuke Nakamura
Yoichi Furukawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP1649054A1 publication Critical patent/EP1649054A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/111—Antisense spanning the whole gene, or a large part of it
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • the present invention relates to methods of diagnosing colorectal cancers.
  • colorectal carcinogenesis involves an accumulation of genetic alterations within a cell lineage, which include not only mutations that inactivate tumor suppressor genes and activate proto-oncogenes, but also amplifications of DNA and/or losses of DNA in certain chromosomal regions.
  • epigenetic events such as methylation, loss of imprinting, and/or dysregulated expression resulting from genetic changes or unknown mechanisms underlie the genesis of colorectal tumors.
  • Genes in the Wnt/wingless signaling pathway play critical roles in differentiation and morphogenesis during embryogenesis. Impaired regulation of this pathway often is a feature of tumors arising in the colon, liver, prostate, stomach, brain, endometrium- or elsewhere (3).
  • FGF2 stimulates tissue repair in the adult (14, 15).
  • inappropriate expression of FGFs and/or their receptors occurs in a wide range of human tumors including bladder, cervical and gastric cancers (16, 17).
  • FGF18 is the one that most closely resembles FGF8 and, like FGF2, FGF18 stimulates proliferation of NIH3T3 cells (18), osteoblasts (19), chondrocytes (19), and glial cells (20), and induces neurite outgrowth of PC12 rat pheochromocytoma cells (21).
  • FTIs farnesyltransferase
  • trastuzumab Clinical trials on human using a combination of anti-cancer drugs and an anti-HER2 monoclonal antibody, trastuzumab, have been conducted to antagonize the proto-oncogene receptor HER2/neu, and have been achieving improved clinical response and overall survival of breast-cancer patients (Lin et al., Cancer Res 61 :6345-9 (2001)).
  • a tyrosine kinase inhibitor, STI-571 which selectively inactivates bcr-abl fusion proteins, has been developed to treat chronic myelogenous leukemias, wherein constitutive activation of bcr-abl tyrosine kinase plays a crucial role in the transformation of leukocytes.
  • TAAs discovered so far include : MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)), gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)) ; SART (Shichijo et al., J Exp Med 187: 277-88 (1998)) ; and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)).
  • gene products demonstrated to be specifically overexpressed in tumor cells have been shown to be recognized as targets inducing cellular immune responses.
  • Such gene products include p53 (Umano et al., Brit J Cancer 84: 1052-7 (2001)) ; HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)) ; CEA (Nukaya et al., Int J Cancer 80: 92-7 (1999)), and so on.
  • PBMCs peripheral blood mononuclear cells
  • HLA-A24 and HLA-A0201 are popular HLA alleles in the Japanese population, as well as the Caucasian population (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al., Proceeding ofthe eleventh International Hictocompatibility Workshop and Conference Oxford University Press, Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129 (1997)).
  • antigenic peptides of carcinomas presented by these HLAs may be especially useful for the treatment of carcinomas among Japanese and Caucasian.
  • the present inventors analyzed expression profiles of clinical samples from cancer patients using a genome- wide cDNA microarray.
  • the gene encoding fibroblast growth factor 18 (FGF18) was among those that showed elevated expression.
  • the promoter region of this gene was found to contain putative Tcf4- binding motifs; moreover a reporter-gene assay using the luciferase activity as a marker, as well as an electromobility-shift assay, indicated that FGF18 is a downstream transcription target in the ⁇ -catenin/Tcf4 pathway.
  • the present inventors demonstrated that exogenous FGF18 promoted growth of NIH3T3 cells in an autocrine manner, and that transfection of FGF18 siRNAs suppressed growth of colon-cancer cells in culture. These results indicate that FGF18 is activated in colon cancers as a direct downstream target ofthe Wnt signaling pathway, and, accordingly, represents a marker for early diagnosis and a molecular target for treatment of CRC.
  • the present invention is based on the discovery of a pattern of gene expression of FGF18 correlated with colorectal cancer (CRC).
  • the present invention features a method of diagnosing or determining a predisposition to CRC in a subject, including the step of detej-mining an expression level of FGF18 in a patient-derived biological sample, such as tissue sample.
  • a normal cell is one obtained from colorectal tissue.
  • An increase of the level of expression of the FGF 18 as compared to a normal control level ofthe gene indicates that the subject suffers from or is at risk for developing CRC.
  • normal control level is meant a level of gene expression detected in a normal, healthy individual or in a population of individuals not suffering from CRC.
  • a control level is a single expression pattern derived from a single reference population or from a plurality of expression patterns.
  • control level can be a database of expression patterns from previously tested cells.
  • a normal individual is one with no clinical symptoms of CRC and no family history of CRC.
  • An increase in the level of expression of FGF 18 detected in a test sample as compared to a normal control level indicates the subject (from which the sample was obtained) suffers from or is at risk for developing CRC.
  • Gene expression is preferably increased 10%, 25%, 50% as compared to the control level. Alternately, gene expression may be increased 0.1, 0.2, 1, 2, 5, 10 or more fold as compared to the control level. Expression is determined by detecting hybridization, e.g. , the binding of an FGF 18 gene probe to a gene transcript ofthe patient-derived tissue sample.
  • the patient-derived tissue sample may be any tissue from a test subject, e.g., a patient known to or suspected of having CRC.
  • the tissue may contain a colorectal cancer cell.
  • the tissue is preferably a cell from colon.
  • the present invention further provides methods for identifying agents that inhibit the expression or activity of FGF 18, including the steps of contacting a test cell expressing
  • Therapeutic methods ofthe present invention include a method of treating or preventing CRC in a subject by adm-mistering to the subject an antisense compositionthat reduces the expression of a specific target gene, e.g., an antisense composition containing a nucleotide which is complementary to a nucleic acid sequence of FGF18.
  • Another method includes the steps of administering to a subject a small interfering RNA (siRNA) composition.
  • the siRNA composition reduces the expression of a nucleic acid of FGF 18.
  • Fig. 3 depicts the results of EMS A ofthe ⁇ -catenin/Tcf4 complex using TBM3- oligonucleotide as a probe.
  • a super-shifted band was observed after addition of anti- ⁇ - catenin antibody (lanes 2 and 7) but was not elicited by anti-P53 -antibody (lane 3).
  • Bands corresponding to the DNA-protein complex were reduced by addition of non- labeled wild-type probe (lanes 4, 5), but not by non-labeled mutant probe (lanes 6, 7).
  • Fig. 4. depicts the growth promoting effect of FGF 18 (A and B) or the growth suppressive effect of FGF18-siRNAs (C, D, and E).
  • Fig. 4A depicts the immunoblotting of Flag-tagged FGF 18 protein secreted into culture media. Proteins in the medium and cell lysate were immunoblotted with anti-Flag antibody. NIH3T3 cells were transfected with either pFlagCMN or pFlagCMV-FGFl 8. Black and open triangles indicate the cellular or secreted forms respectively of tagged FGF18 protein.
  • Fig. 4A depicts the growth promoting effect of FGF 18 (A and B) or the growth suppressive effect of FGF18-siRNAs (C, D, and E).
  • Fig. 4A depicts the immunoblotting of Flag-tagged FGF 18 protein secreted into culture media. Proteins in the medium and cell lysate were immunoblotted with anti-Flag antibody. NIH3T3 cells were trans
  • FIG. 4B depicts the microscopic appearance of NIH3T3 cells after incubation in DMEM conta ing 0.5% FBS (left), in the conditioned medium after fransfection with pFlagCMV-FGF18 (center), and in the conditioned medium after transfection with pFlagCMN (right).
  • Fig. 4C depicts the effect of FGF 18 siRNAs on expression of FGF18.
  • the present invention is based in part on the discovery of elevated expression of FGF 18 in colon cells of patients with CRC.
  • the elevated gene expression was identified using a comprehensive cDNA microarray system.
  • a cDNA microarray containing 23,040 genes comprehensive gene- expression profiles of 20 patients were previously constructed.
  • FGF 18 was found to be expressed at high levels in CRC patients.
  • candidate molecular markers were selected with the potential of detecting cancer-related proteins in serum or sputum of patients, and some potential targets for development of signal-suppressing strategies in human colorectal cancer were discovered.
  • FGF18 identified herein are used for diagnostic purposes as a marker of CRC and for therapeutic purposes, as a gene target, the expression of which may be altered to treat or alleviate a symptom of CRC.
  • CRC By measuring expression of FGF 18 in a sample of cells, CRC is diagnosed.
  • agents for treating CRC can be identified.
  • the present invention involves detej-mining (e.g., measuring) the expression of FGF18. Using sequence information provided by the GeneBankTM database entries for the FGF 18 sequence, FGF 18 is detected and measured using techniques well known to one of ordinary skill in the art.
  • sequences witi-in the sequence database entries corresponding to FGF 18 may be used to construct probes for detecting an FGF 18 RNA sequence in, e.g., northern blot hybridization analysis.
  • the sequences can be used to construct primers for specifically amplifying FGF 18 in, e.g, amplification-based detection methods, such as reverse-transcription based polymerase chain reaction.
  • Expression level of FGF 18 in the test cell population e.g., a patient-derived tissue sample, is then compared to expression level of FGF 18 in a reference cell population.
  • the reference cell population includes one or more cells for which the compared parameter is known, i.e., CRC cells or non-CRC cells.
  • a pattern of gene expression in the test cell population as compared to the reference cell population indicates CRC or a predisposition thereto depends upon the composition ofthe reference cell population. For example, if the reference cell population is composed of non-CRC cells, a similar gene expression pattern in the test cell population and reference cell population indicates the test cell population is non-CRC. Conversely, if the reference cell population is made up of CRC cells, a similar gene expression profile between the test cell population and the reference cell population indicates that the test cell population includes CRC cells.
  • a level of expression of a CRC marker gene in a test cell population is considered altered in levels of expression in the reference cell population if its expression level varies by more than 1.0, 1.5, 2.0, 5.0, 10.0 or more fold from the expression level ofthe corresponding marker gene, e.g., FGF18, in the reference cell population.
  • Differential gene expression between a test cell population and a reference cell population is normalized to a control nucleic acid, e.g. a housekeeping gene.
  • a confrol nucleic acid is one which is known not to differ depending on the endometriotic or non- endometriotic state ofthe cell. Expression levels ofthe control nucleic acid in the test and reference nucleic acid can be used to normalize signal levels in the compared populations.
  • Confrol genes include ⁇ -actin, glyceraldehyde 3- phosphate dehydrogenase or ribosomal protein P 1.
  • the test cell population is preferably compared to multiple reference cell populations. Each ofthe multiple reference populations may differ in the known parameter. Thus, a test cell population may be compared to a second reference cell population known to contain, e.g., CRC cells, as well as a second reference population known to contain, e.g. , non-CRC cells (normal cells).
  • the test cell is included in a tissue type or cell sample from a subject known to contain or suspected of containing CRC cells.
  • the test cell is obtained from a bodily tissue or a bodily fluid, e.g., biological fluid (such as blood or urine).
  • FGF 18 a human, non- human primate, mouse, rat, dog, cat, horse, or cow.
  • Expression of FGF 18 disclosed herein is determined at the protein or nucleic acid level using methods known in the art. For example, Northern hybridization analysis using probes which specifically recognize the FGF 18 nucleotide sequence can be used to determine gene expression. Alternatively, expression may be measured using reverse- transcription-based PCR assays, e.g., using primers specific for FGF18. Expression may also be determined at the protein level, i.e., by measuring the levels of polypeptide encoded by the gene product described herein, or biological activity thereof.
  • Such methods include, e.g., irnmunoassays based on antibodies to a protein encoded by FGF 18.
  • the biological activity ofthe protein encoded by the gene is also well known. It is kown that recombinant rat FGF 18 induces neurite outgrowth in PC 12 cells (21) and transgenic mice overexpressing FGF 18 in the liver exhibites an increase in liver weight and hepatocellular proliferation (18). FGF18 stimulats proliferation and inhibites differentiation and matrix synthesis in all cultures of mouse osteoblasts and chondrocytes (19).
  • FGF 18 also induces osteoclast formation through RANKL and cyclooxygenase-2 and stimulates osteoclasts to form resorbed pits on a cultured mouse dentine slice (19). It is noted that these effects are similar to those of FGF2 and proposed that FGF18 and FGF2 may be redundant in their effects on bone and cartilage. It is also kwon that conditional overexpression ⁇ FGF18 in lung epithelial cells during fetal development disrupts branching morphogenesis ofthe lung (29).
  • FGF 18 in a test population of cells i. e. , a patient-derived biological sample
  • the test cell population contains an epithelial cell, e.g., a cell obtained from colon tissue.
  • Gene expression may also be measured in blood or other bodily fluids such as urine.
  • FGF 18 is determined in the test cell or biological sample and then compared to the expression level ofthe normal control.
  • a normal control level is an expression profile of FGF 18 typically found in a population known not to be suffering fro CRC.
  • An increase ofthe level of expression in the patient-derived tissue sample of FGF 18 indicates that the subject is suffering from or is at risk for developing CRC.
  • Alteration of FGF18 in the test population as compared to the normal confrol indicates that the subject suffers from or is at risk for developing CRC.
  • the test cell may be a cell, which has been transfected with FGF18 or which has been transfected with a regulatory sequence (e.g., a promoter sequence) from FGF18 operably linked to a reporter gene.
  • a regulatory sequence e.g., a promoter sequence
  • a candidate compound that interferes with the binding between the ⁇ -catenin/Tcf4 binding motif and the ⁇ - catenin/Tcf4 complex may be identified as an inhibiting agent of FGF18.
  • a difference in expression between FGF18 in the test population and a normal confrol reference cell population indicates the less favorable clinical outcome or prognosis.
  • efficacious is meant that the treatment leads to a reduction in expression of a pathologically up-regulated gene, a increase in expression of a pathologically down- regulated gene or a decrease in size, prevalence, or metastatic potential of colorectal tumors in a subject.
  • freatment When freatment is applied prophylactically, “efficacious” means that the freatment retards or prevents CRC from forming or retards, prevents, or alleviates a symptom of clinical CRC. Assessment of colorectal tumors are made using standard clinical protocols. Efficaciousness is determined in association with any known method for diagnosing or treating CRC. CRC is diagnosed for example, by identifying symptomatic anomalies,.
  • a therapeutic agent for treating CRC that is appropriate for a particular individual Differences in the genetic makeup of individuals can result in differences in their relative abilities to metabolize various drugs.
  • An agent that is metabolized in a subject to act as an anti-CRC agent can manifest itself by inducing a change in gene expression pattern in the subject's cells from that characteristic of an CRC state to a gene expression pattern characteristic of a non-CRC state. Accordingly, the differentially expressed
  • the present invention provides methods for screening candidate agents which are potential targets in the freatment of CRC. As discussed in detail above, by controlling the expression level or activity of a marker gene, one can control the onset and progression of CRC. Thus, candidate agents, which are potential targets in the freatment of CRC, can be identified through screenings that use the expression levels and activities of marker genes as indices.
  • the cell proliferative activity of FGF 18 may be selected as the biological activity.
  • the cell proliferative activity of FGF18 may be detected by proliferation of a cell line such as NIH3T3.
  • the screening method ofthe present invention may comprise the following steps: a) contacting a candidate compound with a cell into which a vector comprising the franscriptional regulatory region of FGF 18 and a reporter gene that is expressed under the control ofthe franscriptional regulatory region has been introduced ; b) measuring the activity or expression of said reporter gene; and c) selecting a compound that reduces the activity or expression level of said reporter gene, as compared to a confrol.
  • Suitable reporter genes and host cells are well known in the art.
  • the reporter construct required for the screening can be prepared by using the franscriptional regulatory region of a marker gene. When the transcriptional regulatory region of a marker gene is known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information.
  • the compound isolated by the screening is a candidate for drugs that inhibit the activity ofthe protein encoded by marker gene and, therefore, can be applied to the treatment or prevention of CRC.
  • compound in which a part ofthe structure ofthe compound inhibiting the activity of protein encoded by marker gene is converted by addition, deletion and/or replacement are also included in the compounds obtainable by the screening method ofthe present invention.
  • the isolated compound When administrating the compound isolated by the method ofthe invention as a pharmaceutical for humans and other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, and chimpanzees, the isolated compound can be directly administered or, alternatively, can be formulated into a dosage form using known pharmaceutical preparation methods.
  • the drugs can be taken orally, as sugar-coated tablets, capsules, elixirs and microcapsules, or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
  • the compounds can be mixed with pharmaceutically acceptable carriers or media, such as sterilized water, physiological saline, plant-oils, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders, and such, in a unit dose form required for generally accepted drug implementation.
  • the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
  • additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; and flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
  • a liquid carrier such as an oil, can also be further included in the above ingredients.
  • Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
  • the dosage and method of administration vary according to the body- weight and age ofthe patient and the administration method selected; however, one skilled in the art can routinely select a suitable dosage and method of administration. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to a patient to perform the therapy. Though the dosage and method of administration vary according to the body- weight, age, and symptoms ofthe patient, one skilled in the art can suitably select them.
  • Assessing the prognosis of a subject with CRC Also provided herein is a method of assessing the prognosis of a subject with CRC by comparing the expression of FGF 18 in a test cell population to the expression of the gene in a reference cell population derived from patients over a spectrum of disease stages.
  • expression may be inhibited by adn-iinistering to the subject a nucleic acid that inhibits, or antagonizes, the expression ofthe over-expressed gene, e.g., an antisense oligonucleotide or small interfering RNA (siRNA) which disrupts expression ofthe over-expressed gene.
  • antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 can be used to reduce the expression level of FGF 18.
  • Antisense nucleic acids corresponding to the nucleotide sequence of FGF 18 that are up-regulated in CRC are useful for the freatment of CRC.
  • the antisense nucleic acids ofthe present invention may act by binding to the nucleotide sequence of FGF 18 or an mRNA corresponding thereto, thereby i-nhibiting the transcription or franslation ofthe gene, promoting the degradation ofthe mRNA, and/or i-nhibiting the expression of protein encoded by a nucleic acid of FGF 18, finally inhibiting the function ofthe proteins .
  • the term "antisense nucleic acids" as used herein encompasses both nucleotides that are entirely complementary to the target sequence and those having one or more nucleotide mismatches, so long as the antisense nucleic acids can specifically hybridize to the target sequences.
  • An antisense-mounting medium can also be used to increase durability and membrane-permeability. Examples are, liposomes, poly-L-lysine, lipids, cholesterol, lipofectin or derivatives of these.
  • the dosage ofthe antisense nucleic acid derivative ofthe present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.
  • the antisense nucleic acids of present invention include modified oligonucleotides. For example, thioated nucleotides may be used to confer nuclease resistance to an oligonucleotide.
  • the present invention also provides siRNA having the general formula 5 ' - [A] - [B] - [A' ] -3 ' , wherein [A] is a ribonucleotide sequence corresponding to the nucleotide sequence of SEQ ID NO: 21, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
  • the region [A] hybridizes to [A'], and then a loop consisting of region [B] is formed.
  • the loop sequence may be preferably 3 to 23 nucleotide in length.
  • the loop sequence for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb. 506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-l replication by RNA interference. Nature 418 : 435-438.) : 1. CCC, CCACC or CCACACC: Jacque, J. M, Triques, K., and Stevenson, M (2002) Modulation of HIN-1 replication by R ⁇ A interference. Nature, Vol. 418: 435-438 ; 2.
  • UUCG Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV- 1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505. Fruscoloni, P., Zamboni, M., and Toccl-dni-Nalentini, G. P. (2003) Exonucleolytic degradation of double-stranded R ⁇ A by an activity in Xenopus laevis germinal vesicles. Proc. ⁇ atl. Acad. Sci. USA 100(4): 1639-1644 ; and 3.
  • UUCAAGAGA Dykxhoorn, D. M., ⁇ ovina, C. D., and Sharp, P. A. (2002) Killing the messenger: Short R ⁇ As that silence gene expression. Nature Reviews Molecular Cell Biology 4: 457-467.
  • An exemplary siRNA o the present invention having hairpin loop structure comprises : gguucuggagaacaacuacu-[b]-aguaguuguucuccagaacc (for target sequence of SEQ ID NO:21).
  • the loop sequence can be selected from group consisting of, CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • a preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA).
  • the regulatory sequences flanking the FGF 18 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner.
  • siRNAs are transcribed infracellularly by cloning the FGF 18 gene template into a vector containing, e.g., a RNA pol III franscription unit from the small nuclear RNA (snR A) U6 or the human HI RNA promoter.
  • transfection-enhancing agent can be used for introducing the vector into the cell. FuGENE (Rochediagnostices), Lipofectamin 2000 (Invitrogen), Oligofectamin (Invitrogen), and Nucleofactor (Wako pure Chemical) are useful as the transfection-enhancing agent.
  • the oligonucleotide is 19-25 nucleotides in length. Most preferably, the oligonucleotide is less than 75, 50 , 25 nucleotides in length.
  • FGF 18 siRNA oligonucleotide which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 21.
  • the nucleotide sequence ofthe siRNAs utilized herein were designed using a siRNA design computer program available from the Ambion website (http://www.ambion.com/techlib/ misc/siRNA_finder.html). The computer program selects nucleotide sequences for siRNA synthesis based on the following protocol. Selection of siRNA Target Sites: 1.
  • the homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/. 3. Select qualifying target sequences for synthesis. At Ambion, preferably several target sequences can be selected along the length ofthe gene for evaluation.
  • the antisense oligonucleotide or siRNA ofthe invention inhibit the expression of the polypeptide ofthe invention and are thereby useful for suppressing the biological activity ofthe polypeptide ofthe invention.
  • expression-inhibitors, comprising the antisense oligonucleotide or siRNA ofthe invention are useful in the point that they can inhibit the biological activity o the polypeptide ofthe invention.
  • a composition comprising the antisense oligonucleotide or siRNA ofthe present invention are useful in treating a CRC.
  • function of gene product ofthe over-expressed gene may be inhibited by administering a compound that binds to or otherwise inhibits the function ofthe gene products.
  • the compound may be an antibody which binds to the over- expressed gene product.
  • the present invention encompasses the use of antibodies, particularly antibodies against a protein encoded by an up-regulated marker gene, as well as fragments of such antibodies.
  • an antibody refers to an immunoglobulin molecule having a specific structure, that interacts (i.e., binds) only with the antigen that was used for synthesizing the antibody (i.e., the up-regulated marker gene product) or with an antigen closely related to it.
  • an antibody may be a fragment of an antibody or a modified antibody, so long as it binds to the protein encoded by the marker gene.
  • the antibody fragment may be Fab, F(ab') 2 , Fv, or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston J. S. et al. Proc. Natl. Acad. Sci.
  • an antibody fragment may be generated by freating an antibody with an enzyme, such as papain or pepsin.
  • an enzyme such as papain or pepsin.
  • a gene encoding the antibody fragment may be constructed, inserted into an expression vector, and expressed in an appropriate host cell (see, for example, Co M. S. et al. J. Immunol. 152:2968-2976 (1994); Better M. and Horwitz A. H. Methods Enzymol. 178:476-496 (1989); Pluckthun A. and Skerra A. Methods Enzymol. 178:497-515 (1989); Lamoyi E. Methods Enzymol. 121:652-663 (1986); Rousseaux J.
  • An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG).
  • PEG polyethylene glycol
  • the present invention provides such modified antibodies.
  • the modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field.
  • an antibody may be obtained as a chimeric antibody, between a variable region derived from a nonhuman antibody and a constant region derived from a human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from a nonhuman antibody, the frame work region (FR) and the constant region derived from a human antibody.
  • CDR complementarity determining region
  • FR frame work region
  • Cancer therapies directed at specific molecular alterations that occur in cancer cells have been validated through clinical development and regulatory approval of anti-cancer drugs such as frastuzumab (Herceptin®) for the treatment of advanced breast cancer, imatinib methylate (Gleevec®) for chronic myeloid leukemia, gefitinib (Iressa®) for non- small cell lung cancer (NSCLC), and rituximab (anti-CD20 mAb) for B-cell lymphoma and mantle cell lymphoma (Ciardiello F, Tortora G.
  • a novel approach in the treatment of cancer targeting the epidermal growth factor receptor. Clin Cancer Res. 2001 Oct;7(10):2958-70.
  • targeted drugs can enhance the efficacy of standard chemotherapy when used in combination with it (Gianni L. (2002). Oncology, 63 Suppl 1, 47-56.; Klejman A, Rushen L, Morrione A, Slupianek A and Skorski T. (2002). Oncogene, 21, 5868-5876.). Therefore, future cancer treatments will probably involve combining conventional drugs with target-specific agents aimed at different characteristics of tumor cells such as angiogenesis and invasiveness. These modulatory methods are performed ex vivo or in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by adn-unistering the agent to a subject).
  • the methods involve administering a protein or combination of proteins or a nucleic acid molecule or combination of nucleic acid molecules as therapy to counteract aberrant expression or activity ofthe differentially expressed genes.
  • Diseases and disorders that are characterized by increased (relative to a subject not suffering from the disease or disorder) levels of biological activity ofthe genes may be treated with therapeutics that antagonize (i.e., reduce or inhibit) activity ofthe over- expressed gene or genes.
  • Therapeutics that antagonize activity are administered therapeutically or prophylactically.
  • Therapeutics that may be utilized include, e.g., (i) a polypeptide, or analogs, derivatives, fragments or homologs thereof of the over-expressed sequence (ii) antibodies to the over-expressed sequence (iii) nucleic acids encoding the over-expressed sequence; (iv) antisense nucleic acids or nucleic acids that are "dysfunctional" (i.e., due to a heterologous insertion within the coding sequence of over-expressed sequence); (v) small interfering RNA (siRNA); or (vi) modulators (i.e., inhibitors, agonists and antagonists that alter the interaction between an over -expressed polypeptide and its binding partner.
  • modulators i.e., inhibitors, agonists and antagonists that alter the interaction between an over -expressed polypeptide and its binding partner.
  • the dysfunctional antisense molecule is utilized to "knockout" endogenous function of a polypeptide by homologous recombination (see, e.g., Capecchi, Science 244: 1288-1292 1989) .
  • Increased levels can be readily detected by quantifying peptide and/or RNA, by obtaining a patient tissue sample (e.g., from biopsy tissue) and assaying it in vitro for RNA or peptide levels, structure and/or activity ofthe expressed peptides (or m-RNAs of a gene whose expression is altered).
  • Methods that are well-known within the art include, but are not limited to, immunoassays (e.g., by Western blot analysis, im unoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, j-mmunocytochemistry, etc.) and/or hybridization assays to detect expression of m-RNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).
  • immunoassays e.g., by Western blot analysis, im unoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, j-mmunocytochemistry, etc.
  • hybridization assays to detect expression of m-RNAs (e.g., Northern assays, dot blots, in situ hybridization, etc.).
  • Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that
  • Therapeutic methods of the present invention include contacting a cell with an agent that modulates one or more of the activities of the gene product of the differentially expressed gene.
  • An agent that modulates protein activity includes a nucleic acid or a protein, a naturally-occurring cognate ligand of these proteins, a peptide, a peptidomimetic, or other small molecule.
  • the present invention also relates to a method of treating or preventing CRC in a subject comprising administering to said subject a vaccine comprising a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide or the fragment thereof.
  • a polypeptide encoded by a nucleic acid of FGF 18, an immunologically active fragment of said polypeptide, or a polynucleotide encoding the polypeptide is administered.
  • the polypeptide or the immunologically active fragments thereof are useful as vaccines against CRC.
  • the proteins or fragments thereof may be administered in a form bound to the T cell recepor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs.
  • vaccine against CRC refers to a substance that has the function to induce anti-tumor --mmunity upon inoculation into animals.
  • polypeptides encoded by a nucleic acid of FGF 18 or fragments thereof were suggested to be HLA-A24 or HLA-A*0201 restricted epitopes peptides that may induce potent and specific immune response against CRC cells expressing FGFl 8.
  • the present invention also encompasses method of inducing anti-tumor immunity using the polypeptides.
  • anti-tumor immunity includes immune responses such as follows: - induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and - induction of anti-tumor cytokine production. Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is decided to have anti-tumor immunity inducing effect.
  • the induction ofthe anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response ofthe immune system in the host against the protein. For example, a method for detecting the induction of cytotoxic T lymphocytes is well known.
  • a foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs).
  • T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting the induction of CTL.
  • APC has the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells.
  • CD4+ T cells and CD8+ T cells are also important in anti-tumor ij-nmunity, the anti-tumor --mmunity inducing action ofthe peptide can be evaluated using the activation effect of these cells as indicators.
  • a method for evaluating the inducing action of CTL using dendritic cells (DCs) as APCs is well known in the art.
  • a DC is a representative APC having the strongest CTL inducing action among APCs.
  • the test polypeptide is initially contacted with a DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DCs shows that the test polypeptide has an activity of inducing the cytotoxic T cells.
  • Activity of CTLs against tumors can be detected, for example, using the lysis of 51 Cr-labeled tumor cells as the indicator.
  • the method of evaluating the degree of tumor cell damage using 3 H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known.
  • LDH lactose dehydrogenase
  • PBMCs peripheral blood mononuclear cells
  • the induction of CTLs is reported that the it can be enhanced by culturing PBMC in the presence of GM-CSF and IL-4.
  • CTLs have been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL- 7.
  • KLH keyhole limpet hemocyanin
  • test polypeptides confirmed to possess CTL-inducing activity by these methods are polypeptides having a DC activation effect and subsequent CTL-inducing activity. Therefore, polypeptides that induce CTLs against tumor cells are useful as vaccines against tumors. Furthermore, APCs that have acquired the ability to induce CTLs against tumors by contacting with the polypeptides are useful as vaccines against tumors. Furthermore, CTLs that have acquired cytotoxicity against tumors due to presentation ofthe polypeptide antigens by APC can be also used as vaccines against tumors. Such therapeutic methods for tumors using anti-tumor immunity due to APCs and CTLs are referred to as cellular immunotherapy.
  • the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal -.mmunized with the polypeptide, and when growth of tumor cells is suppressed by those antibodies, the polypeptide can be determined to have an ability to induce anti-tumor immunity.
  • Anti-tumor j-mmunity is induced by administering the vaccine of this invention; the induction of anti-tumor immunity enables treatment and prevention of CRC.
  • Therapy against cancer or prevention ofthe onset of cancer includes any ofthe steps, such as inhibition ofthe growth of cancerous cells, involution of cancer, and suppression of occurrence of cancer. Decrease in mortality of individuals having cancer, decrease in tumor markers in the blood, alleviation of detectable symptoms accompanying cancer, and such are also included in the therapy or prevention of cancer.
  • Such therapeutic and preventive effects are preferably statistically significant, for example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a confrol without vaccine administration.
  • the above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant.
  • An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity.
  • adjuvants include cholera toxin, salmonella toxin, alum, and such, but are not limited thereto.
  • the vaccine of this invention may be combined with an appropriate pharmaceutically acceptable carrier. Examples of such carriers include sterilized water, physiological saline, phosphate buffer, culture fluid, and such.
  • the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants, and such.
  • the vaccine is administered systemically or locally.
  • Vaccine administration may be performed by single administration, or boosted by multiple aclministrations.
  • tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs ofthe subject receiving treatment or prevention are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APCs or CTLs, the cells may be administered to the subject.
  • APCs can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo.
  • APCs or CTLs induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively. Furthermore, APCs and CTLs isolated in this manner may be used for cellular immunotherapy not only against individuals firom whom the cells are derived, but also against other individuals who has similar types of tumors. Furthermore, a pharmaceutical composition for treating or preventing a cell proliferative disease, such as cancer, comprising a pharmaceutically effective amount of the polypeptide ofthe present invention is provided. The pharmaceutical composition may be used for raising anti-tumor immunity.
  • compositions for inhibiting CRC include those suitable for oral, rectal, nasal, topical
  • compositions suitable for oral administration include capsules, cachets or tablets, each containing a predetermined amount ofthe active ingredient.
  • Formulations also include powders, granules or solutions, suspensions or emulsions.
  • the active ingredient is optionally administered as a bolus electuary or paste.
  • Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants or wetting agents.
  • a tablet may be made by compression or molding, optionally with one or more formulational ingredients.
  • Compressed tablets may be prepared by compressing in a suitable machine the active ingredients in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, lubricating, surface active or dispersing agent.
  • Molded tablets may be made by molding in a suitable machine a mixture ofthe powdered compound moistened with an inert liquid diluent. The tablets may be coated according to methods well known in the art.
  • Oral fluid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use.
  • Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
  • the tablets may optionally be formulated so as to provide slow or controlled release ofthe active ingredient therein.
  • a package of tablets may contain one tablet to be taken on each day ofthe month.
  • Formulations for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood ofthe intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.
  • the formulations may be presented in unit dose or multi-dose containers, for example sealed ampoules and vials, and may be stored in a fireeze-dried (lyophilized) condition requiring only the addition ofthe sterile liquid carrier, for example, saline, water- for-injection, immediately prior to use. Alternatively, the formulations may be presented for continuous infusion.
  • Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets ofthe kind previously described.
  • Formulations for rectal administration include suppositories with standard carriers such as cocoa butter or polyethylene glycol.
  • Formulations for topical admimstration in the mouth include lozenges, which contain the active ingredient in a flavored base such as sucrose and acacia or fragacanth, and pastilles comprising the active ingredient in a base such as gelatin and glycerin or sucrose and acacia.
  • the compounds ofthe invention may be used as a liquid spray or dispersible powder or in the form of drops.
  • Drops may be formulated with an aqueous or non-aqueous base also comprising one or more dispersing agents, solubilizing agents or suspending agents.
  • the compounds are conveniently delivered from an insufflator, nebulizer, pressurized packs or other convenient means of delivering an aerosol spray.
  • Pressurized packs may comprise a suitable propellant such as dichlorodifluoromethane, trichlorofluoromethane, dichiorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be deteraiined by providing a valve to deliver a metered amount.
  • the compounds may take the form of a dry powder composition, for example a powder mix ofthe compound and a suitable powder base such as lactose or starch.
  • the powder composition may be presented in unit dosage form, in for example, capsules, cartridges, gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflators.
  • Other formulations include implantable devices and adhesive patches; which release a therapeutic agent. When desired, the above described formulations, adapted to give sustained release ofthe active ingredient, may be employed.
  • the pharmaceutical compositions may also contain other active ingredients such as antimicrobial agents, immunosuppressants or preservatives.
  • the formulations of this invention may include other agents conventional in the art having regard to the type of formulation in question, for example, those suitable for oral administration may include flavoring agents.
  • Preferred unit dosage formulations are those containing an effective dose, as recited below, or an appropriate fraction thereof, ofthe active ingredient.
  • the compositions e.g., polypeptides and organic compounds, may be aclministered orally or via injection at a dose of from about 0.1 to about 250 mg/kg per day.
  • the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
  • Tablets or other unit dosage forms of presentation provided in discrete units may conveniently contain an amount which is effective at such dosage or as a multiple ofthe same, for instance, units containing about 5 mg to about 500 mg, usually from about 100 mg to about 500 mg.
  • the dose employed will depend upon a number of factors, including the age and sex ofthe subject, the precise disorder being treated, and its severity. Also the route of administration may vary depending upon the condition and its severity. The invention will be further described in the following examples, which do not limit the scope ofthe invention described in the claims.
  • Human colon-cancer cell lines SW480 HCT116 and DLD1, and murine fibroblast line NIH3T3 were obtained from the American Type Culture Collection (ATCC, Rockville, MD).
  • Human colon-cancer cell lines SNUC4 and SNUC5 were obtained from the Korean cell line bank (KCLB, Seoul, Korea). All ofthe cells were cultured as monolayers in appropriate media, as follows: Leibovitz's L-15 (Invitrogen, Carlsbad, CA) for SW480, MaCoy's 5A (Invitrogen) for HCT116, RPMI1640 (Sigma-Aldrich Corporation, St.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase gene
  • Primer sequences were 5'- ACAACAGCCTCAAGATCATCAG-3'(SEQ ID NO: 1) and 5'- GGTCCACCACTGACACGTTG-3'(SEQ ID NO: 2) for GAPDH, and 5*- GGACATGTGCAGGCTGGGCTA-3'(SEQ ID NO: 3) and 5'-
  • FGF 18 Effect of FGF 18 on cell survival in vitro.
  • the entire coding region of human FGFl 8 was amplified by RT-PCR using primers 5'-CCTCAAGCTTAGCGATGTATTCA-3'(SEQ ID NO: 6) and either 5'- CGGTCTAGACTAGGCAGGGTGT-3'(SEQ ID NO: 7) or 5'- CCTCTCTCGAGGGCAGGGTGTGT-3'(SEQ ID NO: 8), and cloned into appropriate cloning sites of expression vectors pcDNA3.1(+) (Invitrogen) or pFlagCMV5 (Sigma- Aldrich).
  • Plasmids expressing FGF 18 (pcDNA-FGF18 or pFlag-FGF18) or empty vector (pcDNA or pFlagCMV5) were transfected into murine fibroblast NIH3T3 cells for a focus- formation assay.
  • pcDNA-FGF18 or pFlag-FGF18 or empty vector (pcDNA or pFlagCMV5) were transfected into murine fibroblast NIH3T3 cells for a focus- formation assay.
  • the medium supporting NIH3T3 cells transfected with either pFlag-FGF18 or empty vector was conditioned with 0.5% FBS; growth of these cells was analyzed by MTT assay.
  • RNA polymerase III Transcription ofthe HI RNA gene by RNA polymerase III produces short transcripts with uridines at the 3' ends.
  • a genomic fragment containing the promoter region of Hi RNA was amplified by PCR, using primers 5'- TGGTAGCCAAGTGCAGGTTATA-3' (SEQ ID NO: 9), and 5'-
  • the product was purified and cloned into pCR2.1 plasmid vector using a TA cloning kit, according to the supplier's protocol (Invitrogen).
  • the BamHL, Xhol fragment containing HI RNA was purified and cloned into pcDNA3.1(+) between nucleotides 56 and 1257, and the fragment was amplified by PCR using primers 5'-
  • a control plasmid, psiHIBX-EGFP was prepared by cloning double-stranded oligonucleotides 5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 17) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC- 3'(SEQ ID NO: 18) into the Bbsl site in the psiHIBX vector.
  • MTT assay Cells (lxl 0 5 ) on 6-well plates were transfected with expression vector or confrol vector using FuGene ⁇ (Roche diagnostics) according to the supplier's protocol. Cell viability was evaluated by MTT assay seven days after fransfection. Cell-counting kit-8 (DOJENDO) was added to each dish at a concenfration of 1/10 volume, and the plates were incubated at 37°C for an additional 4 h; then absorbance was measured at 490 nm, and at 630 nm as reference, with a Microplate Reader 550 (Bio-Rad Laboratories, Hercules, CA).
  • DOJENDO Cell-counting kit-8
  • initiation site (TIS) for transcription of FGF 18 was dete ⁇ nined by comparing the human genomic sequence (GenBank accession no. AC093246) with the cDNA sequence of FGF18 (GenBank accession no. NM_003862). To examine activity ofthe FGF 18 promoter we amplified by PCR four fragments, each corresponding to part ofthe region flanking FGF18 on the 5' side, and cloned each product into an appropriate enzyme site of pGL3 -Basic vector (Promega, Madison, WI).
  • Plasmids expressing an activated form of ⁇ -catenin (mut ⁇ -catenin) and wild-type and dominant-negative forms of Tcf4 (wtTcf4 and dnTcf4) were prepared as described previously (22).
  • One microgram of each reporter plasmid and 1 ⁇ g of each expression construct were co-transfected with 0.2 ⁇ g of pRL-TK plasmid (Promega) into SW480 cells using FuGENE6, to normalize the efficiency of fransfection.
  • Reporter assays were carried out using a dual-luciferase reporter assay system according to the supplier's recommendations (Promega).
  • Electrophoretic mobility-shift assay ( ⁇ MSA .
  • the EMSA was performed as previously described (23) using nuclear extracts from SW480 cells.
  • a double-stranded 16-nucleotide DNA probe was prepared by annealing FGFl 8F (5'-CGCCTTTGATGTGGGC-3*(SEQ ID NO: 19)) to FGFl 8R (5'-
  • FGF 18 Accumulation of FGF 18 in tumor cells.
  • an anti-FGF18 antibody was prepared that would recognize endogenous FGF 18 protein in cells, and investigated expression of this protein in four colorectal-cancer tissues by --mmunohistochemical staining.
  • FGFl 8 was stained in the cytoplasm of cancerous cells (Fig. IB); staining in the cytoplasm of non-cancerous epithelial cells from corresponding mucosae was significantly weaker and localized mainly at the bottom of crypts.
  • the sequences were searched for consensus Tcf4-binding motifs, 5'-CTTTGWW-3' or 5'-WWCAAAG-3', within a two-kb genomic fragment ofthe 5' region flanking FGFl 8, and identified three possible candidate sites; i.e., between -1631 and -1625 (TBM1), -1348 and -1342 (TBM2), and -190 and -184 (TBM3; Fig. 2A).
  • TBM1 -1631 and -1625
  • TBM2 -1348 and -1342
  • TBM3 -190 and -184
  • fragments of various lengths were cloned from its 5' flanking region upstream ofthe luciferase gene, and performed a reporter assay using SW480 cells (Fig. 2B).
  • pGL3-Pl (contan-ing nucleotides between -1644 and +26), pGL3-P2 (-1354 and +26), andpGL3-P3 (-195 and +26) revealed approximately 5-fold increases in luciferase activity as compared with pGL3-P4 (-181 and +26), suggesting that the region between -195 and -182 was responsible for the franscriptional activity.
  • TBM-3 we assayed the luciferase activity after introducing a 2-base mutation (CTTTGAT (SEQ ID NO: 24) to CTTTGGC) at the TBM3 site (pGL3-P3mt). As expected, mutation at the TBM3 site (P3mt) reduced luciferase activity by more than 75%.
  • FGF18 inNIH3T3 cells. Since over-expression of FGF 18 was known to promote growth of fibroblasts and osteoblasts, we hypothesized that FGF 18 could render oncogenic effects in an autocrine manner. In line with that hypothesis, our immunoblotting experiments detected Flag- tagged FGF 18 protein in the culture media of murine fibroblast cells transfected with pFlagCMV-FGFl 8 (Fig. 4A). As expected, the NIH3T3 cells proliferated at a significantly higher rate in conditioned medium with FGFl 8 than cells in conditioned medium without FGF18(Fig. 4B).
  • FGFl 8 siRNA Effect of FGFl 8 siRNA on growth of cancer cells.
  • plasmids expressing siRNA of FGF 18 were prepared and transfected them into five lines of colorectal-carcinoma cells expressing abundant amounts of FGF 18.
  • psiHlBX-FGF18 significantly reduced expression of FGF18 as compared with a confrol plasmid (psiHIBX-EGFP), and markedly decreased the number of viable cells as compared with psiHIBX-EGFP (Fig. 4C,D,E).
  • FGF 18 is frequently up-regulated in colorectal carcinomas, as a direct target ofthe ⁇ -catenin/Tcf4 complex. Since FGFl 8 is a secreted protein, it might serve as a novel marker for early detection of colorectal tumors. Moreover, because FGFl 8 protein promoted growth of NIH3T3 cells in an autocrine manner, and its down-regulation suppressed growth or survival of colon-cancer cells, FGF 18 may also represent a promising molecular target for novel anticancer drugs. FGF 18 was first identified on the basis of its amino-acid similarities to FGF8 and
  • FGFl 7 (60% and 58% identity, respectively) (18). Like other FGFs, it has an important role in limb development, probably through modulation of osteoblasts, chondrocytes, and osteoclasts (12, 25), and in organogenesis ofthe midbrain (26). In mice, expression of FGF 18 has been observed in the developing lung, surrounding developing bones, and cerebral cortex ofthe developing brain during embryonic stage El 5.5 (18). fritra- peritoneal injection of recombinant FGF 18 protein induced significant gains in the weights of liver and intestine in mice (18). Additionally FGF18 stimulated growth of NIH3T3 cells in a heparan sulfate-dependent manner (18).
  • FGF 18 stimulates growth and/or prevents death of epithelial and mesenchymal cells in an autocrine manner.
  • FGFs function by binding with FGF receptors (FGFRs); five FGFR genes and their splicing variants have been identified so far.
  • FGFRs FGF receptors
  • a BIAcore assay demonstrated that FGFR-3c and FGFR-2c, but not FGFRlc, have affinity for FGFl 8 (20).
  • FGF 18 exerts its growth-promoting effect by interacting with some receptors.
  • FGF family to be proven as a direct target of Tcf/LEF.
  • FGF4 was reported to be a direct target of LEF1; recombinant FGF4 fully rescued the Lef /_ phenotype for tooth development in mice (13).
  • Wnt signals also control FGF-dependent limb initiation via FGF8 and FGF10 (12, 25). Since FGF18 is expressed in the right side of Hensen's node, before expression of FGF8 occurs, and expression of FGF 18 also precedes FGF8 in the isthmus in the developing brain, Wnt signals may recruit FGF 18 as an initial mediator of organogenesis of the limb and brain.
  • FGF4 which has fransforming activity (17)
  • FGFl 8 probably can become oncogenic when inappropriately over-expressed.
  • 1-mmunohistochemical staining of FGF 18 in human colon-cancer tissues and corresponding non-cancerous mucosae showed a pattern similar to that of ⁇ -catenin and other ⁇ -catenin Tcf downsfream proteins such as ENC1, CD44, and EPHB2 (28). This evidence supports a view that activated ⁇ -catenin/Tcf4 complexes in colonic tumors have switched on the proliferative signals that are normally restricted to progenitor cells located in the lower third of colonic crypts.
  • FGF 18 expressed in non-tumorous crypts may play some role in maintenance of progenitor cells, which are absent in Tcf4-knockout mice.
  • FGFl 8 -knockout mice did not reveal any abnormalities in intestinal structure, other factors may redundantly affect the development of mucosa (27).
  • FGFl 8 could exert different functions in other tissues, specifically bone and brain. Further studies on the function of genes downstream ofthe ⁇ -catemn/Tcf4 franscription complex should help to clarify which factors are required for maintenance of progenitor cells in colonic epithelium. In conclusion, the data herein underscore the importance of elevated expression of
  • FGFl 8 in colorectal tumorigenesis Since FGFl 8 functions as growth factor by binding its receptor(s) at least, but not solely, in an autocrine manner, the data herein clearly indicates that FGFl 8 should be a good candidate as a tumor marker as well as a molecular target for the development of reagents, such as specific neutralizing antibodies or antagonists against the receptor(s), for treatment of patients with colorectal tumors.
  • the previous gene-expression analysis of genome- wide cDNA microarray identified specific up-regulated gene FGF18.
  • FGF18 serves as target for cancer prevention and therapy.
  • the present invention provides a molecular diagnostic marker for identifying or detecting CRC.
  • the methods described herein are also useful in the identification of additional molecular targets for prevention, diagnosis and freatment of CRC.
  • the data reported herein add to a comprehensive understanding of CRC, facilitate development of novel diagnostic strategies, and provide clues for identification of molecular targets for therapeutic drugs and preventative agents. Such information contributes to a more profound understanding of colorectal tumorigenesis, and provide indicators for developing novel strategies for diagnosis, treatment, and ultimately prevention of CRC.
  • FGF- 18 is a neuron- derived glial cell growth factor expressed in the rat brain during early postnatal development. Brain Res. Mol. Brain Res., 105: 60-66, 2002.

Abstract

L'invention concerne des procédés objectifs de détection et de diagnostic des cancers colorectaux. Dans un mode de réalisation, le procédé de diagnostic implique la détermination d'un niveau d'expression de FGF18 qui permet de faire la distinction entre cellules de cancer colorectal et cellules normales. L'invention concerne également des procédés de criblage d'agents thérapeutiques utiles dans le traitement de cancers colorectaux, des procédés de traitement des cancers colorectaux, et un procédé de vaccination d'un sujet contre les cancers colorectaux.
EP04747831A 2003-07-21 2004-07-15 Procede de diagnostic des cancers colorectaux Withdrawn EP1649054A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US48892403P 2003-07-21 2003-07-21
PCT/JP2004/010442 WO2005007889A1 (fr) 2003-07-21 2004-07-15 Procede de diagnostic des cancers colorectaux

Publications (1)

Publication Number Publication Date
EP1649054A1 true EP1649054A1 (fr) 2006-04-26

Family

ID=34079465

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04747831A Withdrawn EP1649054A1 (fr) 2003-07-21 2004-07-15 Procede de diagnostic des cancers colorectaux

Country Status (3)

Country Link
EP (1) EP1649054A1 (fr)
JP (1) JP2007528717A (fr)
WO (1) WO2005007889A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2679882C (fr) 2007-03-08 2015-12-29 The Board Of Trustees Of The Leland Stanford Junior University Modulateurs de l'aldehyde deshydrogenase-2 mitochondrial, et leurs procedes d'utilisation
ES2477552T3 (es) 2008-09-08 2014-07-17 The Board Of Trustees Of The Leland Stanford Junior University Moduladores de la actividad de la aldehidodeshidrogenasa y métodos de uso de los mismos
EP2349279A4 (fr) 2008-10-28 2013-12-25 Univ Leland Stanford Junior Modulateurs d'aldéhyde déshydrogénase et procédés d'utilisation de ceux-ci
US10457659B2 (en) 2011-04-29 2019-10-29 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for increasing proliferation of adult salivary stem cells
CN105358531B (zh) 2013-03-14 2017-11-14 利兰-斯坦福大学初级学院的董事会 线粒体醛脱氢酶‑2调节剂和其使用方法
JP2020106382A (ja) * 2018-12-27 2020-07-09 学校法人東邦大学 非アルコール性脂肪性肝炎（ｎａｓｈ）の検出方法
WO2024084807A1 (fr) * 2022-10-19 2024-04-25 学校法人東邦大学 Procédé de dosage du facteur de croissance des fibroblastes 18 et réactif de dosage

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL149694A0 (en) * 1999-12-23 2002-11-10 Exiqon As Therapeutic uses of lna-modified oligonucleotides
US20030104573A1 (en) * 2000-09-11 2003-06-05 Shimkets Richard A. Nucleotide sequences and amino acid sequences of secreted proteins involved in angiogenesis
WO2003025139A2 (fr) * 2001-09-17 2003-03-27 Mayo Foundation For Medical Education And Research Administration d'acides nucleiques, d'analogues et de derives de ceux-ci induite par cobalamine

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005007889A1 *

Also Published As

Publication number Publication date
JP2007528717A (ja) 2007-10-18
WO2005007889A1 (fr) 2005-01-27

Similar Documents

Publication Publication Date Title
US20070054849A1 (en) Method for diagnosing hepatocellular carcinomas
JP4620670B2 (ja) 乳癌を診断する方法
US8029981B2 (en) Hypoxia-inducible protein 2 (HIG2), a diagnostic marker for clear cell renal cell carcinoma
JP4851451B2 (ja) 乳癌関連遺伝子ｚｎｆｎ３ａ１
JP2009502112A (ja) 腎細胞癌を診断および処置するための方法
US20070253954A1 (en) Epha4 As Therapeutic Target Of Prc And Pdaca
JP2006500946A (ja) 精巣精上皮腫の診断方法
JP2005537007A (ja) 結腸癌および胃癌の診断方法
US20080063640A1 (en) Pin-Prc Transition Genes
EP1649054A1 (fr) Procede de diagnostic des cancers colorectaux
US20080199468A1 (en) Method For Diagnosing Colorectal Cancers
US8182997B2 (en) Prostate cancer related gene STYK1
JP2009505631A (ja) 癌関連遺伝子ｒａｓｇｅｆ１ａ

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20060221

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20060713

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070124